Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene.

PubMed

Bardin, S D; Voegele, R T; Finan, T M

1998-08-01

Rhizobium meliloti mutants defective in the phoCDET-encoded phosphate transport system form root nodules on alfalfa plants that fail to fix nitrogen (Fix-). We have previously reported that two classes of second-site mutations can suppress the Fix- phenotype of phoCDET mutants to Fix+. Here we show that one of these suppressor loci (sfx1) contains two genes, orfA and pit, which appear to form an operon transcribed in the order orfA-pit. The Pit protein is homologous to various phosphate transporters, and we present evidence that three suppressor mutations arose from a single thymidine deletion in a hepta-thymidine sequence centered 54 nucleotides upstream of the orfA transcription start site. This mutation increased the level of orfA-pit transcription. These data, together with previous biochemical evidence, show that the orfA-pit genes encode a Pi transport system that is expressed in wild-type cells grown with excess Pi but repressed in cells under conditions of Pi limitation. In phoCDET mutant cells, orfA-pit expression is repressed, but this repression is alleviated by the second-site suppressor mutations. Suppression increases orfA-pit expression compensating for the deficiencies in phosphate assimilation and symbiosis of the phoCDET mutants.

Suppressor of gamma response 1 (SOG1) encodes a putative transcription factor governing multiple responses to DNA damage

PubMed Central

Yoshiyama, Kaoru; Conklin, Phillip A.; Huefner, Neil D.; Britt, Anne B.

2009-01-01

The Arabidopsis sog1-1 (suppressor of gamma response) mutant was originally isolated as a second-site suppressor of the radiosensitive phenotype of seeds defective in the repair endonuclease XPF. Here, we report that SOG1 encodes a putative transcription factor. This gene is a member of the NAC domain [petunia NAM (no apical meristem) and Arabidopsis ATAF1, 2 and CUC2] family (a family of proteins unique to land plants). Hundreds of genes are normally up-regulated in Arabidopsis within an hour of treatment with ionizing radiation; the induction of these genes requires the damage response protein kinase ATM, but not the related kinase ATR. Here, we find that SOG1 is also required for this transcriptional up-regulation. In contrast, the SOG1-dependent checkpoint response observed in xpf mutant seeds requires ATR, but does not require ATM. Thus, phenotype of the sog1-1 mutant mimics aspects of the phenotypes of both atr and atm mutants in Arabidopsis, suggesting that SOG1 participates in pathways governed by both of these sensor kinases. We propose that, in plants, signals related to genomic stress are processed through a single, central transcription factor, SOG1. PMID:19549833

The tumor suppressor PTEN has a critical role in antiviral innate immunity.

PubMed

Li, Shun; Zhu, Mingzhu; Pan, Ruangang; Fang, Ting; Cao, Yuan-Yuan; Chen, Shuliang; Zhao, Xiaolu; Lei, Cao-Qi; Guo, Lin; Chen, Yu; Li, Chun-Mei; Jokitalo, Eija; Yin, Yuxin; Shu, Hong-Bing; Guo, Deyin

2016-03-01

The gene encoding PTEN is one of the most frequently mutated tumor suppressor-encoding genes in human cancer. While PTEN's function in tumor suppression is well established, its relationship to anti-microbial immunity remains unknown. Here we found a pivotal role for PTEN in the induction of type I interferon, the hallmark of antiviral innate immunity, that was independent of the pathway of the kinases PI(3)K and Akt. PTEN controlled the import of IRF3, a master transcription factor responsible for IFN-β production, into the nucleus. We further identified a PTEN-controlled negative phosphorylation site at Ser97 of IRF3 and found that release from this negative regulation via the phosphatase activity of PTEN was essential for the activation of IRF3 and its import into the nucleus. Our study identifies crosstalk between PTEN and IRF3 in tumor suppression and innate immunity.

Tumor suppressor genes are larger than apoptosis-effector genes and have more regions of active chromatin: Connection to a stochastic paradigm for sequential gene expression programs.

PubMed

Garcia, Marlene; Mauro, James A; Ramsamooj, Michael; Blanck, George

2015-08-03

Apoptosis- and proliferation-effector genes are substantially regulated by the same transactivators, with E2F-1 and Oct-1 being notable examples. The larger proliferation-effector genes have more binding sites for the transactivators that regulate both sets of genes, and proliferation-effector genes have more regions of active chromatin, i.e, DNase I hypersensitive and histone 3, lysine-4 trimethylation sites. Thus, the size differences between the 2 classes of genes suggest a transcriptional regulation paradigm whereby the accumulation of transcription factors that regulate both sets of genes, merely as an aspect of stochastic behavior, accumulate first on the larger proliferation-effector gene "traps," and then accumulate on the apoptosis effector genes, thereby effecting sequential activation of the 2 different gene sets. As IRF-1 and p53 levels increase, tumor suppressor proteins are first activated, followed by the activation of apoptosis-effector genes, for example during S-phase pausing for DNA repair. Tumor suppressor genes are larger than apoptosis-effector genes and have more IRF-1 and p53 binding sites, thereby likewise suggesting a paradigm for transcription sequencing based on stochastic interactions of transcription factors with different gene classes. In this report, using the ENCODE database, we determined that tumor suppressor genes have a greater number of open chromatin regions and histone 3 lysine-4 trimethylation sites, consistent with the idea that a larger gene size can facilitate earlier transcriptional activation via the inclusion of more transactivator binding sites.

Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. | Office of Cancer Genomics

Cancer.gov

Noncoding mutations in cancer genomes are frequent but challenging to interpret. PVT1 encodes an oncogenic lncRNA, but recurrent translocations and deletions in human cancers suggest alternative mechanisms. Here, we show that the PVT1 promoter has a tumor-suppressor function that is independent of PVT1 lncRNA. CRISPR interference of PVT1 promoter enhances breast cancer cell competition and growth in vivo.

Role of Hyaluronan in Schwannoma Growth

DTIC Science & Technology

2008-06-01

schwannomatosis . Although schwannomas occur due to mutations in the neurofibromatosis 2 gene, which encodes the merlin tumor suppressor protein, recent...pre-disposition syndromes neurofibromatosis 2 (NF2) and schwannomatosis . We and others found that the glycosaminoglycan hyaluronan (HA) is present

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peltomaeki, Paeivi, E-mail: Paivi.Peltomaki@Helsinki.Fi

Cancer is traditionally viewed as a disease of abnormal cell proliferation controlled by a series of mutations. Mutations typically affect oncogenes or tumor suppressor genes thereby conferring growth advantage. Genomic instability facilitates mutation accumulation. Recent findings demonstrate that activation of oncogenes and inactivation of tumor suppressor genes, as well as genomic instability, can be achieved by epigenetic mechanisms as well. Unlike genetic mutations, epimutations do not change the base sequence of DNA and are potentially reversible. Similar to genetic mutations, epimutations are associated with specific patterns of gene expression that are heritable through cell divisions. Knudson's hypothesis postulates that inactivationmore » of tumor suppressor genes requires two hits, with the first hit occurring either in somatic cells (sporadic cancer) or in the germline (hereditary cancer) and the second one always being somatic. Studies on hereditary and sporadic forms of colorectal carcinoma have made it evident that, apart from genetic mutations, epimutations may serve as either hit or both. Furthermore, recent next-generation sequencing studies show that epigenetic genes, such as those encoding histone modifying enzymes and subunits for chromatin remodeling systems, are themselves frequent targets of somatic mutations in cancer and can act like tumor suppressor genes or oncogenes. This review discusses genetic vs. epigenetic origin of cancer, including cancer susceptibility, in light of recent discoveries. Situations in which mutations and epimutations occur to serve analogous purposes are highlighted.« less

An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

PubMed

Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

2017-07-01

We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

Ring structure amino acids affect the suppressor activity of melon aphid-borne yellows virus P0 protein.

PubMed

Han, Yan-Hong; Xiang, Hai-Ying; Wang, Qian; Li, Yuan-Yuan; Wu, Wen-Qi; Han, Cheng-Gui; Li, Da-Wei; Yu, Jia-Lin

2010-10-10

Melon aphid-borne yellows virus (MABYV) is a newly identified polerovirus occurring in China. Here, we demonstrate that the MABYV encoded P0 (P0(MA)) protein is a strong suppressor of post-transcriptional gene silencing (PTGS) with activity comparable to tobacco etch virus (TEV) HC-Pro. In addition we have shown that the LP F-box motif present at the N-terminus of P0(MA) is required for suppressor activity. Detailed mutational analyses on P0(MA) revealed that changing the conserved Trp 212 with non-ring structured amino acids altered silencing suppressor functions. Ala substitutions at positions 12 and 211 for Phe had no effect on P0 suppression-activity, whereas Arg and Glu substitutions had greatly decreased suppressor activity. Furthermore, substitutions targeting Phe at position 30 also resulted in reduced P0 suppression-activity. Altogether, these results suggest that ring structured Trp/Phe residues in P0 have important roles in suppressor activity. Copyright © 2010 Elsevier Inc. All rights reserved.

Frameshift Suppression in SACCHAROMYCES CEREVISIAE. IV. New Suppressors among Spontaneous Co-Revertants of the Group II HIS4-206 and LEU2-3 Frameshift Mutations

PubMed Central

Gaber, Richard F.; Culbertson, Michael R.

1982-01-01

ICR-induced frameshift mutations at the his4 locus in Saccharomyces cerevisiae have been classified into several groups on the basis of their reversion and suppression properties. One group of externally suppressible his4 mutations, designated Group II, have been shown to contain +1 G:C insertions in glycine codons and are suppressed by any one of five suppressor mutations described previously (SUF1, SUF3, SUF4, SUF5, and SUF6). The suppressor genes are believed to encode glycine tRNAs containing four base anticodons.—An analysis of spontaneous co-revertants of the Group II frameshift mutations his4-206 and leu2-3 has revealed the existence of eleven new Group II-specific suppressor genes (SUF15 through SUF25). The locations of the new suppressor loci on the yeast genetic map have been determined.—By comparing the ability or inability of Group II-specific suppressors mapping at 16 different loci to suppress different Group II his4 mutations, two subclasses of suppressors have been defined. One subclass suppresses his4-38 and his4-519, which contain the altered four base mRNA codons 5'-GGGU-3' and 5'-GGGG-3', respectively. The other subclass suppresses his4-38, but fails to suppress his4-519. The mechanism of tRNA-mediated frameshift suppression and the molecular basis for this division of the suppressors into two subclasses is discussed. PMID:6757051

Driver gene classification reveals a substantial overrepresentation of tumor suppressors among very large chromatin-regulating proteins.

PubMed

Waks, Zeev; Weissbrod, Omer; Carmeli, Boaz; Norel, Raquel; Utro, Filippo; Goldschmidt, Yaara

2016-12-23

Compiling a comprehensive list of cancer driver genes is imperative for oncology diagnostics and drug development. While driver genes are typically discovered by analysis of tumor genomes, infrequently mutated driver genes often evade detection due to limited sample sizes. Here, we address sample size limitations by integrating tumor genomics data with a wide spectrum of gene-specific properties to search for rare drivers, functionally classify them, and detect features characteristic of driver genes. We show that our approach, CAnceR geNe similarity-based Annotator and Finder (CARNAF), enables detection of potentially novel drivers that eluded over a dozen pan-cancer/multi-tumor type studies. In particular, feature analysis reveals a highly concentrated pool of known and putative tumor suppressors among the <1% of genes that encode very large, chromatin-regulating proteins. Thus, our study highlights the need for deeper characterization of very large, epigenetic regulators in the context of cancer causality.

Genes, dreams, and cancer.

PubMed Central

Sikora, K.

1994-01-01

There have been tremendous advances in our understanding of cancer from the application of molecular biology over the past decade. The disease is caused by a series of defects in the genes that accelerate growth--oncogenes--and those that slow down cellular turnover--tumour suppressor genes. The proteins they encode provide a promising hunting ground in which to design and test new anticancer drugs. Several treatment strategies are now under clinical trial entailing direct gene transfer. These include the use of gene marking to detect minimal residual disease, the production of novel cancer vaccines by the insertion of genes which uncloak cancer cells so making them visible to the host's immune system, the isolation and coupling of cancer specific molecular switches upstream of drug activating genes, and the correction of aberrant oncogenes or tumour suppressor genes. The issues in these approaches are likely to have a profound impact on the management of cancer patients as we enter the next century. Images p1221-a PMID:8180542

3D view to tumor suppression: Lkb1, polarity and the arrest of oncogenic c-Myc.

PubMed

Partanen, Johanna I; Nieminen, Anni I; Klefstrom, Juha

2009-03-01

Machiavelli wrote, in his famous political treatise Il Principe, about disrupting organization by planting seeds of dissension or by eliminating necessary support elements. Tumor cells do exactly that by disrupting the organized architecture of epithelial cell layers during progression from contained benign tumor to full-blown invasive cancer. However, it is still unclear whether tumor cells primarily break free by activating oncogenes powerful enough to cause chaos or by eliminating tumor suppressor genes guarding the order of the epithelial organization. Studies in Drosophila have exposed genes that encode key regulators of the epithelial apicobasal polarity and which, upon inactivation, cause disorganization of the epithelial layers and promote unscheduled cell proliferation. These polarity regulator/tumor suppressor proteins, which include products of neoplastic tumor suppressor genes (nTSGs), are carefully positioned in polarized epithelial cells to maintain the order of epithelial structures and to impose a restraint on cell proliferation. In this review, we have explored the presence and prevalence of somatic mutations in the human counterparts of Drosophila polarity regulator/tumor suppressor genes across the human cancers. The screen points out LKB1, which is a causal genetic lesion in Peutz-Jeghers cancer syndrome, a gene mutated in certain sporadic cancers and a human homologue of the fly polarity gene par-4. We review the evidence linking Lkb1 protein to polarity regulation in the scope of our recent results suggesting a coupled role for Lkb1 as an architect of organized acinar structures and a suppressor of oncogenic c-Myc. We finally present models to explain how Lkb1-dependent formation of epithelial architecture is coupled to suppression of normal and oncogene-induced proliferation.

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

PubMed

Zhu, Y; Lin, E C

1988-05-01

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

PubMed Central

Zhu, Y; Lin, E C

1988-01-01

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose. PMID:2834341

Identification of Strawberry vein banding virus encoded P6 as an RNA silencing suppressor.

PubMed

Feng, Mingfeng; Zuo, Dengpan; Jiang, Xizi; Li, Shuai; Chen, Jing; Jiang, Lei; Zhou, Xueping; Jiang, Tong

2018-07-01

RNA silencing is a common mechanism that plays a key role in antiviral defense. To overcome host defense responses, plant viruses encode silencing-suppressor proteins to target one or several key steps in the silencing machinery. Here, we report that the P6 protein encoded by Strawberry vein banding virus (SVBV) is an RNA silencing suppressor through Agrobacterium-mediated co-infiltration assays. SVBV P6 protein can suppress green fluorescent protein (GFP) gene silencing induced by single-stranded RNA but not by double-stranded RNA. The P6 protein can also inhibit systemic silencing of GFP through interfering the systemic spread of GFP silencing signal. Subcellular localization study indicated that P6 protein formed irregular bodies and distributed in both cytoplasm and nucleus of Nicotiana benthamiana cells. Furthermore, deletion analysis indicated that a nuclear localization signal (NLS, aa 402-426) in the P6 protein is responsible for the silencing suppression efficiency. In addition, expression of the P6 protein via a Potato virus X (PVX)-based vectors induced more severe mosaic symptoms in N. benthamiana leaves, and transgenic N. benthamiana plants expressing P6 showed obvious vein yellowing as well as severe mosaic symptoms in leaves. Taken together, our results demonstrates that SVBV P6 is a suppressor of RNA silencing, possibly acting at a upstream step for dsRNA generation. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Merlin Isoforms 1 and 2 Both Act as Tumour Suppressors and Are Required for Optimal Sperm Maturation

PubMed Central

Zoch, Ansgar; Mayerl, Steffen; Schulz, Alexander; Greither, Thomas; Frappart, Lucien; Rübsam, Juliane; Heuer, Heike; Giovannini, Marco; Morrison, Helen

2015-01-01

The tumour suppressor Merlin, encoded by the gene NF2, is frequently mutated in the autosomal dominant disorder neurofibromatosis type II, characterised primarily by the development of schwannoma and other glial cell tumours. However, NF2 is expressed in virtually all analysed human and rodent organs, and its deletion in mice causes early embryonic lethality. Additionally, NF2 encodes for two major isoforms of Merlin of unknown functionality. Specifically, the tumour suppressor potential of isoform 2 remains controversial. In this study, we used Nf2 isoform-specific knockout mouse models to analyse the function of each isoform during development and organ homeostasis. We found that both isoforms carry full tumour suppressor functionality and can completely compensate the loss of the other isoform during development and in most adult organs. Surprisingly, we discovered that spermatogenesis is strictly dependent on the presence of both isoforms. While the testis primarily expresses isoform 1, we noticed an enrichment of isoform 2 in spermatogonial stem cells. Deletion of either isoform was found to cause decreased sperm quality as observed by maturation defects and head/midpiece abnormalities. These defects led to impaired sperm functionality as assessed by decreased sperm capacitation. Thus, we describe spermatogenesis as a new Nf2-dependent process. Additionally, we provide for the first time in vivo evidence for equal tumour suppressor potentials of Merlin isoform 1 and isoform 2. PMID:26258444

DNA Fragmentation Factor 45 (DFF45) Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line1

PubMed Central

Yang, Hong Wei; Chen, Ying Zhang; Piao, Hui Ying; Takita, Junko; Soeda, Eiichi; Hayashi, Yasuhide

2001-01-01

Abstract Recently, loss of heterozygosity (LOH) studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p) in neuroblastoma (NB). To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45) gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT)-polymerase chain reaction (PCR) and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region. PMID:11420752

Drosophila as a model for intractable epilepsy: gilgamesh suppresses seizures in para(bss1) heterozygote flies.

PubMed

Howlett, Iris C; Rusan, Zeid M; Parker, Louise; Tanouye, Mark A

2013-08-07

Intractable epilepsies, that is, seizure disorders that do not respond to currently available therapies, are difficult, often tragic, neurological disorders. Na(+) channelopathies have been implicated in some intractable epilepsies, including Dravet syndrome (Dravet 1978), but little progress has been forthcoming in therapeutics. Here we examine a Drosophila model for intractable epilepsy, the Na(+) channel gain-of-function mutant para(bss1) that resembles Dravet syndrome in some aspects (parker et al. 2011a). In particular, we identify second-site mutations that interact with para(bss1), seizure enhancers, and seizure suppressors. We describe one seizure-enhancer mutation named charlatan (chn). The chn gene normally encodes an Neuron-Restrictive Silencer Factor/RE1-Silencing Transcription factor transcriptional repressor of neuronal-specific genes. We identify a second-site seizure-suppressor mutation, gilgamesh (gish), that reduces the severity of several seizure-like phenotypes of para(bss1)/+ heterozygotes. The gish gene normally encodes the Drosophila ortholog of casein kinase CK1g3, a member of the CK1 family of serine-threonine kinases. We suggest that CK1g3 is an unexpected but promising new target for seizure therapeutics.

Integrative Bioinformatics and Functional Analyses of GEO, ENCODE, and TCGA Reveal FADD as a Direct Target of the Tumor Suppressor BRCA1.

PubMed

Nguyen, Dinh-Duc; Lee, Dong Gyu; Kim, Sinae; Kang, Keunsoo; Rhee, Je-Keun; Chang, Suhwan

2018-05-14

BRCA1 is a multifunctional tumor suppressor involved in several essential cellular processes. Although many of these functions are driven by or related to its transcriptional/epigenetic regulator activity, there has been no genome-wide study to reveal the transcriptional/epigenetic targets of BRCA1. Therefore, we conducted a comprehensive analysis of genomics/transcriptomics data to identify novel BRCA1 target genes. We first analyzed ENCODE data with BRCA1 chromatin immunoprecipitation (ChIP)-sequencing results and identified a set of genes with a promoter occupied by BRCA1. We collected 3085 loci with a BRCA1 ChIP signal from four cell lines and calculated the distance between the loci and the nearest gene transcription start site (TSS). Overall, 66.5% of the BRCA1-bound loci fell into a 2-kb region around the TSS, suggesting a role in transcriptional regulation. We selected 45 candidate genes based on gene expression correlation data, obtained from two GEO (Gene Expression Omnibus) datasets and TCGA data of human breast cancer, compared to BRCA1 expression levels. Among them, we further tested three genes ( MEIS2 , CKS1B and FADD ) and verified FADD as a novel direct target of BRCA1 by ChIP, RT-PCR, and a luciferase reporter assay. Collectively, our data demonstrate genome-wide transcriptional regulation by BRCA1 and suggest target genes as biomarker candidates for BRCA1-associated breast cancer.

Avirulence Genes in Cereal Powdery Mildews: The Gene-for-Gene Hypothesis 2.0.

PubMed

Bourras, Salim; McNally, Kaitlin E; Müller, Marion C; Wicker, Thomas; Keller, Beat

2016-01-01

The gene-for-gene hypothesis states that for each gene controlling resistance in the host, there is a corresponding, specific gene controlling avirulence in the pathogen. Allelic series of the cereal mildew resistance genes Pm3 and Mla provide an excellent system for genetic and molecular analysis of resistance specificity. Despite this opportunity for molecular research, avirulence genes in mildews remain underexplored. Earlier work in barley powdery mildew (B.g. hordei) has shown that the reaction to some Mla resistance alleles is controlled by multiple genes. Similarly, several genes are involved in the specific interaction of wheat mildew (B.g. tritici) with the Pm3 allelic series. We found that two mildew genes control avirulence on Pm3f: one gene is involved in recognition by the resistance protein as demonstrated by functional studies in wheat and the heterologous host Nicotiana benthamiana. A second gene is a suppressor, and resistance is only observed in mildew genotypes combining the inactive suppressor and the recognized Avr. We propose that such suppressor/avirulence gene combinations provide the basis of specificity in mildews. Depending on the particular gene combinations in a mildew race, different genes will be genetically identified as the "avirulence" gene. Additionally, the observation of two LINE retrotransposon-encoded avirulence genes in B.g. hordei further suggests that the control of avirulence in mildew is more complex than a canonical gene-for-gene interaction. To fully understand the mildew-cereal interactions, more knowledge on avirulence determinants is needed and we propose ways how this can be achieved based on recent advances in the field.

Avirulence Genes in Cereal Powdery Mildews: The Gene-for-Gene Hypothesis 2.0

PubMed Central

Bourras, Salim; McNally, Kaitlin E.; Müller, Marion C.; Wicker, Thomas; Keller, Beat

2016-01-01

The gene-for-gene hypothesis states that for each gene controlling resistance in the host, there is a corresponding, specific gene controlling avirulence in the pathogen. Allelic series of the cereal mildew resistance genes Pm3 and Mla provide an excellent system for genetic and molecular analysis of resistance specificity. Despite this opportunity for molecular research, avirulence genes in mildews remain underexplored. Earlier work in barley powdery mildew (B.g. hordei) has shown that the reaction to some Mla resistance alleles is controlled by multiple genes. Similarly, several genes are involved in the specific interaction of wheat mildew (B.g. tritici) with the Pm3 allelic series. We found that two mildew genes control avirulence on Pm3f: one gene is involved in recognition by the resistance protein as demonstrated by functional studies in wheat and the heterologous host Nicotiana benthamiana. A second gene is a suppressor, and resistance is only observed in mildew genotypes combining the inactive suppressor and the recognized Avr. We propose that such suppressor/avirulence gene combinations provide the basis of specificity in mildews. Depending on the particular gene combinations in a mildew race, different genes will be genetically identified as the “avirulence” gene. Additionally, the observation of two LINE retrotransposon-encoded avirulence genes in B.g. hordei further suggests that the control of avirulence in mildew is more complex than a canonical gene-for-gene interaction. To fully understand the mildew–cereal interactions, more knowledge on avirulence determinants is needed and we propose ways how this can be achieved based on recent advances in the field. PMID:26973683

Evidence that noncoding RNA dutA is a multicopy suppressor of Dictyostelium discoideum STAT protein Dd-STATa.

PubMed

Shimada, Nao; Kawata, Takefumi

2007-06-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism.

Evidence that Noncoding RNA dutA Is a Multicopy Suppressor of Dictyostelium discoideum STAT Protein Dd-STATa▿

PubMed Central

Shimada, Nao; Kawata, Takefumi

2007-01-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism. PMID:17435008

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

PubMed Central

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

The ALD6 gene product is indispensable for providing NADPH in yeast cells lacking glucose-6-phosphate dehydrogenase activity.

PubMed

Grabowska, Dorota; Chelstowska, Anna

2003-04-18

Reducing equivalents in the form of NADPH are essential for many enzymatic steps involved in the biosynthesis of cellular macromolecules. An adequate level of NADPH is also required to protect cells against oxidative stress. The major enzymatic source of NADPH in the cell is the reaction catalyzed by glucose-6-phosphate dehydrogenase, the first enzyme in the pentose phosphate pathway. Disruption of the ZWF1 gene, encoding glucose-6-phosphate dehydrogenase in the yeast Saccharomyces cerevisiae, results in methionine auxotrophy and increased sensitivity to oxidizing agents. It is assumed that both phenotypes are due to an NADPH deficiency in the zwf1Delta strain. We used a Met(-) phenotype displayed by the zwf1Delta strain to look for multicopy suppressors of this deletion. We found that overexpression of the ALD6 gene coding for cytosolic acetaldehyde dehydrogenase, which utilizes NADP(+) as its cofactor, restores the Met(+) phenotype of the zwf1Delta strain. Another multicopy suppressor identified in our screen, the ZMS1 gene encoding a putative transcription factor, regulates the level of ALD6 expression. A strain bearing a double ZWF1 ALD6 gene disruption is not viable. Thus, our results indicate the reaction catalyzed by Ald6p as an important source of reducing equivalents in the yeast cells.

Mechanisms of regulation of cell-mediated immunity. III. The characterization of azobenzenearsonate-specific suppressor T-cell- derived-suppressor factors

PubMed Central

1979-01-01

Delayed type hypersensitivity to the hapten azobenzenearsonate (ABA) can be induced and suppressed by the administration of hapten-coupled syngeneic spleen cells by the appropriate route. Suppressor T cells stimulated by the intravenous administration of ABA-coupled spleen cells have been shown to produce a discrete subcellular factor(s) which is capable of suppressing delayed type hypersensitivity to azobenzenearsonate in the mouse. Such suppressor factors may be produced by the mechanical disruption of suppressor cells or by placing such suppressor cells in culture for 24 h. The suppressor factor(s) (SF) derived from ABA-specific suppressor cells exhibit biological specificity for the suppression of ABA delayed type hypersensitivity (DTH), but not trinitro-phenyl DTH, as well as the capacity to bind to ABA immunoadsorbents. Passage of suppressor factor(s) over reverse immunoadsorbents utilizing a rabbit anti-mouse F(ab')2 antiserum demonstrated that the antigen-specific T-cell derived SF does not bear conventional immunoglobulin markers. The suppressor factor(s) are not immunoglobulin molecules was further demonstrated by the inability of anti-ABA antibodies to suppress ABA DTH. Gel filtration of ABA suppressor factor(s) showed that the majority of the suppressive activity was present in a fraction with molecular weight ranging between 6.8 x 10(4) and 3.3 x 10(4) daltons. We also analyzed for the presence of determinants encoded by the H-2 major histocompatibility complex (MHC) and found that immunoadsorbents prepared utilizing antisera capable of interacting with gene products of the whole or selected gene regions of H-2 MHC, i.e., B10.D2 anti-B10.A and B10 anti- B10.A immunoadsorbents, retained the suppressive activity of ABA-SF. Elution of such columns with glycine HCl buffers (pH 2.8) permitted recovery of specific suppressive activity. Taken collectively such data supports the notion that suppressor T-cell-derived ABA suppressor factors have antigen-binding specificity as well as determinants controlled by the K end of the H-2 MHC. The distribution of strains capable of making SF has also been analyzed. The relationship of the antigen-binding specificity to VH gene products is discussed in this and the companion paper. PMID:312894

BRG1 and LKB1: tales of two tumor suppressor genes on chromosome 19p and lung cancer.

PubMed

Rodriguez-Nieto, Salvador; Sanchez-Cespedes, Montse

2009-04-01

Losses of heterozygosity (LOH) of the short arm of chromosome 19 are frequent in lung cancer, suggesting that one or more tumor suppressor genes are present in this region. The LKB1 gene, also called STK11, is somatically inactivated through point mutations and large deletions in lung tumors, demonstrating that LKB1 is a target of the LOH of this chromosomal arm. Data from several independent groups have provided information about the profiles of lung tumors with LKB1 inactivation and it is generally agreed that this alteration strongly predominates in non-small cell lung cancer, in particular adenocarcinomas, in smokers. The LKB1 protein has serine-threonine kinase activity and is involved in the regulation of the cell energetic checkpoint through the phosphorylation and activation of adenosine monophosphate-dependent kinase (AMPK). LKB1 is also involved in other processes such as cell polarization, probably through substrates other than AMPK. Interestingly, another gene on chromosome 19p, BRG1, encoding a component of the SWI/SNF chromatin-remodeling complex, has emerged as a tumor suppressor gene that is altered in lung tumors. Similar to LKB1, BRG1 is somatically inactivated by point mutations or large deletions in lung tumors featuring LOH of chromosome 19p. These observations suggest an important role for BRG1 in lung cancer and highlight the need to further our understanding of the function of Brahma/SWI2-related gene 1 (BRG1) in cancer. Finally, simultaneous mutations at LKB1 and BRG1 are common in lung cancer cells, which exemplifies how a single event, LOH of chromosome 19p in this instance, targets two different tumor suppressors.

Structure and expression of 12-oxophytodienoate reductase (subgroup I) genes in pea, and characterization of the oxidoreductase activities of their recombinant products.

PubMed

Matsui, H; Nakamura, G; Ishiga, Y; Toshima, H; Inagaki, Y; Toyoda, K; Shiraishi, T; Ichinose, Y

2004-02-01

Recently, we observed that expression of a pea gene (S64) encoding an oxophytodienoic acid reductase (OPR) was induced by a suppressor of pea defense responses, secreted by the pea pathogen Mycosphaerella pinodes. Because it is known that OPRs are usually encoded by families of homologous genes, we screened for genomic and cDNA clones encoding members of this putative OPR family in pea. We isolated five members of the OPR gene family from a pea genomic DNA library, and amplified six cDNA clones, including S64, by RT-PCR (reverse transcriptase-PCR). Sequencing analysis revealed that S64 corresponds to PsOPR2, and the amino acid sequences of the predicted products of the six OPR-like genes shared more than 80% identity with each other. Based on their sequence similarity, all these OPR-like genes code for OPRs of subgroup I, i.e., enzymes which are not required for jasmonic acid biosynthesis. However, the genes varied in their exon/intron organization and in their promoter sequences. To investigate the expression of each individual OPR-like gene, RT-PCR was performed using gene-specific primers. The results indicated that the OPR-like gene most strongly induced by the inoculation of pea plants with a compatible pathogen and by treatment with the suppressor from M. pinodes was PsOPR2. Furthermore, the ability of the six recombinant OPR-like proteins to reduce a model substrate, 2-cyclohexen-1-one (2-CyHE), was investigated. The results indicated that PsOPR1, 4 and 6 display robust activity, and PsOPR2 has a most remarkable ability to reduce 2-CyHE, whereas PsOPR3 has little and PsOPR5 does not reduce this compound. Thus, the six OPR-like proteins can be classified into four types. Interestingly, the gene structures, expression profiles, and enzymatic activities used to classify each member of the pea OPR-like gene family are clearly correlated, indicating that each member of this OPR-like family has a distinct function.

Tumor suppressor C-RASSF proteins.

PubMed

Iwasa, Hiroaki; Hossain, Shakhawoat; Hata, Yutaka

2018-05-01

Human genome has ten genes that are collectedly called Ras association domain family (RASSF). RASSF is composed of two subclasses, C-RASSF and N-RASSF. Both N-RASSF and C-RASSF encode Ras association domain-containing proteins and are frequently suppressed by DNA hypermethylation in human cancers. However, C-RASSF and N-RASSF are quite different. Six C-RASSF proteins (RASSF1-6) are characterized by a C-terminal coiled-coil motif named Salvador/RASSF/Hippo domain, while four N-RASSF proteins (RASSF7-10) lack it. C-RASSF proteins interact with mammalian Ste20-like kinases-the core kinases of the tumor suppressor Hippo pathway-and cross-talk with this pathway. Some of them share the same interacting molecules such as MDM2 and exert the tumor suppressor role in similar manners. Nevertheless, each C-RASSF protein has distinct characters. In this review, we summarize our current knowledge of how C-RASSF proteins play tumor suppressor roles and discuss the similarities and differences among C-RASSF proteins.

Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

PubMed

Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

1995-02-15

The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

Cytokine Diedel and a viral homologue suppress the IMD pathway in Drosophila.

PubMed

Lamiable, Olivier; Kellenberger, Christine; Kemp, Cordula; Troxler, Laurent; Pelte, Nadège; Boutros, Michael; Marques, Joao Trindade; Daeffler, Laurent; Hoffmann, Jules A; Roussel, Alain; Imler, Jean-Luc

2016-01-19

Viruses are obligatory intracellular parasites that suffer strong evolutionary pressure from the host immune system. Rapidly evolving viral genomes can adapt to this pressure by acquiring genes that counteract host defense mechanisms. For example, many vertebrate DNA viruses have hijacked cellular genes encoding cytokines or cytokine receptors to disrupt host cell communication. Insect viruses express suppressors of RNA interference or apoptosis, highlighting the importance of these cell intrinsic antiviral mechanisms in invertebrates. Here, we report the identification and characterization of a family of proteins encoded by insect DNA viruses that are homologous to a 12-kDa circulating protein encoded by the virus-induced Drosophila gene diedel (die). We show that die mutant flies have shortened lifespan and succumb more rapidly than controls when infected with Sindbis virus. This reduced viability is associated with deregulated activation of the immune deficiency (IMD) pathway of host defense and can be rescued by mutations in the genes encoding the homolog of IKKγ or IMD itself. Our results reveal an endogenous pathway that is exploited by insect viruses to modulate NF-κB signaling and promote fly survival during the antiviral response.

The context of transcription start site regions is crucial for transcription of a plant tRNA(Lys)(UUU) gene group both in vitro and in vivo.

PubMed

Yukawa, Yasushi; Akama, Kazuhito; Noguchi, Kanta; Komiya, Masaaki; Sugiura, Masahiro

2013-01-10

Nuclear tRNA genes are transcribed by RNA polymerase III. The A- and B-boxes located within the transcribed regions are essential promoter elements for nuclear tRNA gene transcription. The Arabidopsis genome contains ten annotated genes encoding identical tRNA(Lys)(UUU) molecules, which are scattered on the five chromosomes. In this study, we prepared ten tDNA constructs including each of the tRNA(Lys)(UUU) coding sequences with their individual 5' and 3' flanking sequences, and assayed tRNA expression using an in vitro RNA polymerase III-dependent transcription system. Transcription levels differed significantly among the ten genes and two of the tRNA genes were transcribed at a very low level, despite possessing A- and B-boxes identical to those of the other tRNA genes. To examine whether the in vitro results were reproducible in vivo, the 5' flanking sequence of an amber suppressor tRNA gene was then replaced with those of the ten tRNA(Lys) genes. An in vivo experiment based on an amber suppressor tRNA that mediates suppression of a premature amber codon in a β-glucuronidase (GUS) reporter gene in plant tissues generated nearly identical results to those obtained in vitro. Analysis of mutated versions of the amber suppressor tRNA gene, which contained base substitutions around the transcription start site (TSS), showed that the context around the transcription start sites is a crucial determinant for transcription of plant tRNA(Lys)(UUU) both in vitro and in vivo. The above transcription regulation by context around TSS differed between tRNA genes and other Pol III-dependent genes. Copyright © 2012 Elsevier B.V. All rights reserved.

Identification of Two Suppressors of CSG2 Calcium Sensitivity, SCS7 and SUR2, as Genes Encoding Hydroxylases of the Sphingolipid Biosynthetic Pathway of Saccharomyces cerevisiae

DTIC Science & Technology

1997-12-10

process can adjusted by experimental alteration of thyroid status. Hyperthyroidism speeds up the time table while hypothyroidism retards it. When 88... canine kidney MDCK cells. The relative amounts ofthe labeled products can be differentially recovered from the basolateral and apical surfaces of these

DLEU2 encodes an antisense RNA for the putative bicistronic RFP2/LEU5 gene in humans and mouse.

PubMed

Corcoran, Martin M; Hammarsund, Marianne; Zhu, Chaoyong; Lerner, Mikael; Kapanadze, Bagrat; Wilson, Bill; Larsson, Catharina; Forsberg, Lars; Ibbotson, Rachel E; Einhorn, Stefan; Oscier, David G; Grandér, Dan; Sangfelt, Olle

2004-08-01

Our group previously identified two novel genes, RFP2/LEU5 and DLEU2, within a 13q14.3 genomic region of loss seen in various malignancies. However, no specific inactivating mutations were found in these or other genes in the vicinity of the deletion, suggesting that a nonclassical tumor-suppressor mechanism may be involved. Here, we present data showing that the DLEU2 gene encodes a putative noncoding antisense RNA, with one exon directly overlapping the first exon of the RFP2/LEU5 gene in the opposite orientation. In addition, the RFP2/LEU5 transcript can be alternatively spliced to produce either several monocistronic transcripts or a putative bicistronic transcript encoding two separate open-reading frames, adding to the complexity of the locus. The finding that these gene structures are conserved in the mouse, including the putative bicistronic RFP2/LEU5 transcript as well as the antisense relationship with DLEU2, further underlines the significance of this unusual organization and suggests a biological function for DLEU2 in the regulation of RFP2/LEU5. Copyright 2004 Wiley-Liss, Inc.

Characterization of the gene encoding pinin/DRS/memA and evidence for its potential tumor suppressor function.

PubMed

Shi, Y; Ouyang, P; Sugrue, S P

2000-01-13

Several cell adhesion-related proteins have been shown to act as tumor-suppressors (TS) in the neoplastic progression of epithelial-derived tumors. Pinin/DRS/memA was first identified in our laboratory and it was shown to be a cell adhesion-related molecule. Our previous study demonstrated that restoration of pinin expression in transformed cells not only positively influenced cellular adhesive properties but also reversed the transformed phenotype to more epithelial-like. Here, we show by FISH analysis that the gene locus for pinin is within 14q13. The alignment of the pinin gene with STS markers localized the gene to the previously identified TS locus D14S75-D14S288. Northern analyses revealed diminished pinin mRNA in renal cell carcinomas (RCC) and certain cancer cell lines. Immunohistochemical examination of tumor samples demonstrated absent or greatly reduced pinin in transitional cell carcinoma (TCC) and RCC tumors. TCC-derived J82 cells as well as EcR-293 cells transfected with full-length pinin cDNA demonstrated inhibition of anchorage-independent growth of cells in soft agar. Furthermore, methylation analyses revealed that aberrant methylation of pinin CpG islands was correlated with decreased/absent pinin expression in a subset of tumor tissues. These data lend significant support to the hypothesis that pinin/DRS/memA may act as a tumor suppressor in certain types of cancers.

Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

PubMed

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

2010-03-15

Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

Oligoamine analogues in combination with 2-difluoromethylornithine synergistically induce re-expression of aberrantly silenced tumour-suppressor genes

PubMed Central

Wu, Yu; Steinbergs, Nora; Murray-Stewart, Tracy; Marton, Laurence J.; Casero, Robert A.

2011-01-01

Epigenetic gene silencing is an important mechanism in the initiation and progression of cancer. Abnormal DNA CpG island hypermethylation and histone modifications are involved in aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) was the first enzyme identified to specifically demethylate H3K4 (Lys4 of histone H3). Methylated H3K4 is an important mark associated with transcriptional activation. The flavin adenine dinucleotide-binding amine oxidase domain of LSD1 is homologous with two polyamine oxidases, SMO (spermine oxidase) and APAO (N1-acetylpolyamine oxidase). We have demonstrated previously that long-chain polyamine analogues, the oligoamines, are inhibitors of LSD1. In the present paper we report the synergistic effects of specific oligoamines in combination with DFMO (2-difluoromethylornithine), an inhibitor of ornithine decarboxylase, in human colorectal cancer cells. DFMO treatment depletes natural polyamines and increases the uptake of exogenous polyamines. The combination of oligoamines and DFMO results in a synergistic re-expression of aberrantly silenced tumour-suppressor genes, including SFRP2 (secreted frizzled-related protein 2), which encodes a Wnt signalling pathway antagonist and plays an anti-tumorigenic role in colorectal cancer. The treatment-induced re-expression of SFRP2 is associated with increased H3K4me2 (di-methyl H3K4) in the gene promoter. The combination of LSD1-inhibiting oligoamines and DFMO represents a novel approach to epigenetic therapy of cancer. PMID:22132744

C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

PubMed

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

2009-10-30

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

Control of cellular morphogenesis by the Ip12/Bem2 GTPase-activating protein: possible role of protein phosphorylation

PubMed Central

1994-01-01

The IPL2 gene is known to be required for normal polarized cell growth in the budding yeast Saccharomyces cerevisiae. We now show that IPL2 is identical to the previously identified BEM2 gene. bem2 mutants are defective in bud site selection at 26 degrees C and localized cell surface growth and organization of the actin cytoskeleton at 37 degrees C. BEM2 encodes a protein with a COOH-terminal domain homologous to sequences found in several GTPase-activating proteins, including human Bcr. The GTPase-activating protein-domain from the Bem2 protein (Bem2p) or human Bcr can functionally substitute for Bem2p. The Rho1 and Rho2 GTPases are the likely in vivo targets of Bem2p because bem2 mutant phenotypes can be partially suppressed by increasing the gene dosage of RHO1 or RHO2. CDC55 encodes the putative regulatory B subunit of protein phosphatase 2A, and mutations in BEM2 have previously been identified as suppressors of the cdc55-1 mutation. We show here that mutations in the previously identified GRR1 gene can suppress bem2 mutations. grr1 and cdc55 mutants are both elongated in shape and cold- sensitive for growth, and cells lacking both GRR1 and CDC55 exhibit a synthetic lethal phenotype. bem2 mutant phenotypes also can be suppressed by the SSD1-vl (also known as SRK1) mutation, which was shown previously to suppress mutations in the protein phosphatase- encoding SIT4 gene. Cells lacking both BEM2 and SIT4 exhibit a synthetic lethal phenotype even in the presence of the SSD1-v1 suppressor. These genetic interactions together suggest that protein phosphorylation and dephosphorylation play an important role in the BEM2-mediated process of polarized cell growth. PMID:7962097

Control of cellular morphogenesis by the Ip12/Bem2 GTPase-activating protein: possible role of protein phosphorylation.

PubMed

Kim, Y J; Francisco, L; Chen, G C; Marcotte, E; Chan, C S

1994-12-01

The IPL2 gene is known to be required for normal polarized cell growth in the budding yeast Saccharomyces cerevisiae. We now show that IPL2 is identical to the previously identified BEM2 gene. bem2 mutants are defective in bud site selection at 26 degrees C and localized cell surface growth and organization of the actin cytoskeleton at 37 degrees C. BEM2 encodes a protein with a COOH-terminal domain homologous to sequences found in several GTPase-activating proteins, including human Bcr. The GTPase-activating protein-domain from the Bem2 protein (Bem2p) or human Bcr can functionally substitute for Bem2p. The Rho1 and Rho2 GTPases are the likely in vivo targets of Bem2p because bem2 mutant phenotypes can be partially suppressed by increasing the gene dosage of RHO1 or RHO2. CDC55 encodes the putative regulatory B subunit of protein phosphatase 2A, and mutations in BEM2 have previously been identified as suppressors of the cdc55-1 mutation. We show here that mutations in the previously identified GRR1 gene can suppress bem2 mutations. grr1 and cdc55 mutants are both elongated in shape and cold-sensitive for growth, and cells lacking both GRR1 and CDC55 exhibit a synthetic lethal phenotype. bem2 mutant phenotypes also can be suppressed by the SSD1-vl (also known as SRK1) mutation, which was shown previously to suppress mutations in the protein phosphatase-encoding SIT4 gene. Cells lacking both BEM2 and SIT4 exhibit a synthetic lethal phenotype even in the presence of the SSD1-v1 suppressor. These genetic interactions together suggest that protein phosphorylation and dephosphorylation play an important role in the BEM2-mediated process of polarized cell growth.

mus304 encodes a novel DNA damage checkpoint protein required during Drosophila development

PubMed Central

Brodsky, Michael H.; Sekelsky, Jeff J.; Tsang, Garson; Hawley, R. Scott; Rubin, Gerald M.

2000-01-01

Checkpoints block cell cycle progression in eukaryotic cells exposed to DNA damaging agents. We show that several Drosophila homologs of checkpoint genes, mei-41, grapes, and 14-3-3ε, regulate a DNA damage checkpoint in the developing eye. We have used this assay to show that the mutagen-sensitive gene mus304 is also required for this checkpoint. mus304 encodes a novel coiled-coil domain protein, which is targeted to the cytoplasm. Similar to mei-41, mus304 is required for chromosome break repair and for genomic stability. mus304 animals also exhibit three developmental defects, abnormal bristle morphology, decreased meiotic recombination, and arrested embryonic development. We suggest that these phenotypes reflect distinct developmental consequences of a single underlying checkpoint defect. Similar mechanisms may account for the puzzling array of symptoms observed in humans with mutations in the ATM tumor suppressor gene. PMID:10733527

Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

PubMed Central

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

2010-01-01

Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

Genomic instability--an evolving hallmark of cancer.

PubMed

Negrini, Simona; Gorgoulis, Vassilis G; Halazonetis, Thanos D

2010-03-01

Genomic instability is a characteristic of most cancers. In hereditary cancers, genomic instability results from mutations in DNA repair genes and drives cancer development, as predicted by the mutator hypothesis. In sporadic (non-hereditary) cancers the molecular basis of genomic instability remains unclear, but recent high-throughput sequencing studies suggest that mutations in DNA repair genes are infrequent before therapy, arguing against the mutator hypothesis for these cancers. Instead, the mutation patterns of the tumour suppressor TP53 (which encodes p53), ataxia telangiectasia mutated (ATM) and cyclin-dependent kinase inhibitor 2A (CDKN2A; which encodes p16INK4A and p14ARF) support the oncogene-induced DNA replication stress model, which attributes genomic instability and TP53 and ATM mutations to oncogene-induced DNA damage.

FgPrp4 Kinase Is Important for Spliceosome B-Complex Activation and Splicing Efficiency in Fusarium graminearum

PubMed Central

Jiang, Cong; Li, Yang; Li, Chaohui; Liu, Huiquan; Kang, Zhensheng; Xu, Jin-Rong

2016-01-01

PRP4 encodes the only kinase among the spliceosome components. Although it is an essential gene in the fission yeast and other eukaryotic organisms, the Fgprp4 mutant was viable in the wheat scab fungus Fusarium graminearum. Deletion of FgPRP4 did not block intron splicing but affected intron splicing efficiency in over 60% of the F. graminearum genes. The Fgprp4 mutant had severe growth defects and produced spontaneous suppressors that were recovered in growth rate. Suppressor mutations were identified in the PRP6, PRP31, BRR2, and PRP8 orthologs in nine suppressor strains by sequencing analysis with candidate tri-snRNP component genes. The Q86K mutation in FgMSL1 was identified by whole genome sequencing in suppressor mutant S3. Whereas two of the suppressor mutations in FgBrr2 and FgPrp8 were similar to those characterized in their orthologs in yeasts, suppressor mutations in Prp6 and Prp31 orthologs or FgMSL1 have not been reported. Interestingly, four and two suppressor mutations identified in FgPrp6 and FgPrp31, respectively, all are near the conserved Prp4-phosphorylation sites, suggesting that these mutations may have similar effects with phosphorylation by Prp4 kinase. In FgPrp31, the non-sense mutation at R464 resulted in the truncation of the C-terminal 130 aa region that contains all the conserved Prp4-phosphorylation sites. Deletion analysis showed that the N-terminal 310-aa rich in SR residues plays a critical role in the localization and functions of FgPrp4. We also conducted phosphoproteomics analysis with FgPrp4 and identified S289 as the phosphorylation site that is essential for its functions. These results indicated that FgPrp4 is critical for splicing efficiency but not essential for intron splicing, and FgPrp4 may regulate pre-mRNA splicing by phosphorylation of other components of the tri-snRNP although itself may be activated by phosphorylation at S289. PMID:27058959

Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke

1997-05-01

Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less

Frameshift Suppression in SACCHAROMYCES CEREVISIAE VI. Complete Genetic Map of Twenty-Five Suppressor Genes

PubMed Central

Gaber, Richard F.; Mathison, Lorilee; Edelman, Irv; Culbertson, Michael R.

1983-01-01

Five previously unmapped frameshift suppressor genes have been located on the yeast genetic map. In addition, we have further characterized the map positions of two suppressors whose approximate locations were determined in an earlier study. These results represent the completion of genetic mapping studies on all 25 of the known frameshift suppressor genes in yeast.—The approximate location of each suppressor gene was initially determined through the use of a set of mapping strains containing 61 signal markers distributed throughout the yeast genome. Standard meiotic linkage was assayed in crosses between strains carrying the suppressors and the mapping strains. Subsequent to these approximate linkage determinations, each suppressor gene was more precisely located in multi-point crosses. The implications of these mapping results for the genomic distribution of frameshift suppressor genes, which include both glycine and proline tRNA genes, are discussed. PMID:17246112

Deletion of a Single-Copy Trna Affects Microtubule Function in Saccharomyces Cerevisiae

PubMed Central

Reijo, R. A.; Cho, D. S.; Huffaker, T. C.

1993-01-01

rts1-1 was identified as an extragenic suppressor of tub2-104, a cold-sensitive allele of the sole gene encoding β-tubulin in the yeast, Saccharomyces cerevisiae. In addition, rts1-1 cells are heat sensitive and resistant to the microtubule-destabilizing drug, benomyl. The rts1-1 mutation is a deletion of approximately 5 kb of genomic DNA on chromosome X that includes one open reading frame and three tRNA genes. Dissection of this region shows that heat sensitivity is due to deletion of the open reading frame (HIT1). Suppression and benomyl resistance are caused by deletion of the gene encoding a tRNA(AGG)(Arg) (HSX1). Northern analysis of rts1-1 cells indicates that HSX1 is the only gene encoding this tRNA. Deletion of HSX1 does not suppress the tub2-104 mutation by misreading at the AGG codons in TUB2. It also does not suppress by interfering with the protein arginylation that targets certain proteins for degradation. These results leave open the prospect that this tRNA(AGG)(Arg) plays a novel role in the cell. PMID:8307335

Clinical prognostic value of DNA methylation in hepatoblastoma: Four novel tumor suppressor candidates.

PubMed

Honda, Shohei; Minato, Masashi; Suzuki, Hiromu; Fujiyoshi, Masato; Miyagi, Hisayuki; Haruta, Masayuki; Kaneko, Yasuhiko; Hatanaka, Kanako C; Hiyama, Eiso; Kamijo, Takehiko; Okada, Tadao; Taketomi, Akinobu

2016-06-01

Hepatoblastoma (HB) is very rare but the most common malignant neoplasm of the liver occurring in children. Despite improvements in therapy, outcomes for patients with advanced HB that is refractory to standard preoperative chemotherapy remain unsatisfactory. To improve the survival rate among this group, identification of novel prognostic markers and therapeutic targets is needed. We have previously reported that altered DNA methylation patterns are of biological and clinical importance in HB. In the present study, using genome-wide methylation analysis and bisulfite pyrosequencing with specimens from HB tumors, we detected nine methylated genes. We then focused on four of those genes, GPR180, MST1R, OCIAD2, and PARP6, because they likely encode tumor suppressors and their increase of methylation was associated with a poor prognosis. The methylation status of the four genes was also associated with age at diagnosis, and significant association with the presence of metastatic tumors was seen in three of the four genes. Multivariate analysis revealed that the presence of metastatic tumors and increase of methylation of GPR180 were independent prognostic factors affecting event-free survival. These findings indicate that the four novel tumor suppressor candidates are potentially useful molecular markers predictive of a poor outcome in HB patients, which may serve as the basis for improved therapeutic strategies when clinical trials are carried out. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Identification of Novel Androgen-Regulated Pathways and mRNA Isoforms through Genome-Wide Exon-Specific Profiling of the LNCaP Transcriptome

PubMed Central

Carling, Phillippa J.; Buist, Thomas; Zhang, Chaolin; Grellscheid, Sushma N.; Armstrong, Kelly; Stockley, Jacqueline; Simillion, Cedric; Gaughan, Luke; Kalna, Gabriela; Zhang, Michael Q.; Robson, Craig N.; Leung, Hing Y.; Elliott, David J.

2011-01-01

Androgens drive the onset and progression of prostate cancer (PCa) by modulating androgen receptor (AR) transcriptional activity. Although several microarray-based studies have identified androgen-regulated genes, here we identify in-parallel global androgen-dependent changes in both gene and alternative mRNA isoform expression by exon-level analyses of the LNCaP transcriptome. While genome-wide gene expression changes correlated well with previously-published studies, we additionally uncovered a subset of 226 novel androgen-regulated genes. Gene expression pathway analysis of this subset revealed gene clusters associated with, and including the tyrosine kinase LYN, as well as components of the mTOR (mammalian target of rapamycin) pathway, which is commonly dysregulated in cancer. We also identified 1279 putative androgen-regulated alternative events, of which 325 (∼25%) mapped to known alternative splicing events or alternative first/last exons. We selected 30 androgen-dependent alternative events for RT-PCR validation, including mRNAs derived from genes encoding tumour suppressors and cell cycle regulators. Of seven positively-validating events (∼23%), five events involved transcripts derived from alternative promoters of known AR gene targets. In particular, we found a novel androgen-dependent mRNA isoform derived from an alternative internal promoter within the TSC2 tumour suppressor gene, which is predicted to encode a protein lacking an interaction domain required for mTOR inhibition. We confirmed that expression of this alternative TSC2 mRNA isoform was directly regulated by androgens, and chromatin immunoprecipitation indicated recruitment of AR to the alternative promoter region at early timepoints following androgen stimulation, which correlated with expression of alternative transcripts. Together, our data suggest that alternative mRNA isoform expression might mediate the cellular response to androgens, and may have roles in clinical PCa. PMID:22194994

In situ hybridization analysis of the expression of futsch, tau, and MESK2 homologues in the brain of the European honeybee (Apis mellifera L.).

PubMed

Kaneko, Kumi; Hori, Sayaka; Morimoto, Mai M; Nakaoka, Takayoshi; Paul, Rajib Kumar; Fujiyuki, Tomoko; Shirai, Kenichi; Wakamoto, Akiko; Tsuboko, Satomi; Takeuchi, Hideaki; Kubo, Takeo

2010-02-16

The importance of visual sense in Hymenopteran social behavior is suggested by the existence of a Hymenopteran insect-specific neural circuit related to visual processing and the fact that worker honeybee brain changes morphologically according to its foraging experience. To analyze molecular and neural bases that underlie the visual abilities of the honeybees, we used a cDNA microarray to search for gene(s) expressed in a neural cell-type preferential manner in a visual center of the honeybee brain, the optic lobes (OLs). Expression analysis of candidate genes using in situ hybridization revealed two genes expressed in a neural cell-type preferential manner in the OLs. One is a homologue of Drosophila futsch, which encodes a microtubule-associated protein and is preferentially expressed in the monopolar cells in the lamina of the OLs. The gene for another microtubule-associated protein, tau, which functionally overlaps with futsch, was also preferentially expressed in the monopolar cells, strongly suggesting the functional importance of these two microtubule-associated proteins in monopolar cells. The other gene encoded a homologue of Misexpression Suppressor of Dominant-negative Kinase Suppressor of Ras 2 (MESK2), which might activate Ras/MAPK-signaling in Drosophila. MESK2 was expressed preferentially in a subclass of neurons located in the ventral region between the lamina and medulla neuropil in the OLs, suggesting that this subclass is a novel OL neuron type characterized by MESK2-expression. These three genes exhibited similar expression patterns in the worker, drone, and queen brains, suggesting that they function similarly irrespective of the honeybee sex or caste. Here we identified genes that are expressed in a monopolar cell (Amfutsch and Amtau) or ventral medulla-preferential manner (AmMESK2) in insect OLs. These genes may aid in visualizing neurites of monopolar cells and ventral medulla cells, as well as in analyzing the function of these neurons.

Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.

PubMed

Hickman, Mark J; Petti, Allegra A; Ho-Shing, Olivia; Silverman, Sanford J; McIsaac, R Scott; Lee, Traci A; Botstein, David

2011-11-01

A yeast strain lacking Met4p, the primary transcriptional regulator of the sulfur assimilation pathway, cannot synthesize methionine. This apparently simple auxotroph did not grow well in rich media containing excess methionine, forming small colonies on yeast extract/peptone/dextrose plates. Faster-growing large colonies were abundant when overnight cultures were plated, suggesting that spontaneous suppressors of the growth defect arise with high frequency. To identify the suppressor mutations, we used genome-wide single-nucleotide polymorphism and standard genetic analyses. The most common suppressors were loss-of-function mutations in OPI1, encoding a transcriptional repressor of phospholipid metabolism. Using a new system that allows rapid and specific degradation of Met4p, we could study the dynamic expression of all genes following loss of Met4p. Experiments using this system with and without Opi1p showed that Met4 activates and Opi1p represses genes that maintain levels of S-adenosylmethionine (SAM), the substrate for most methyltransferase reactions. Cells lacking Met4p grow normally when either SAM is added to the media or one of the SAM synthetase genes is overexpressed. SAM is used as a methyl donor in three Opi1p-regulated reactions to create the abundant membrane phospholipid, phosphatidylcholine. Our results show that rapidly growing cells require significant methylation, likely for the biosynthesis of phospholipids.

Genetic and Biochemical Evidence That Haploinsufficiency of the Nf1 Tumor Suppressor Gene Modulates Melanocyte and Mast Cell Fates in Vivo

PubMed Central

Ingram, David A.; Yang, Feng-Chun; Travers, Jeffrey B.; Wenning, Mary Jo; Hiatt, Kelly; New, Sheryl; Hood, Antoinette; Shannon, Kevin; Williams, David A.; Clapp, D. Wade

2000-01-01

Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's “two hit” model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1−/− murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W41 mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras–mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W41) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types. PMID:10620616

Genetic and biochemical evidence that haploinsufficiency of the Nf1 tumor suppressor gene modulates melanocyte and mast cell fates in vivo.

PubMed

Ingram, D A; Yang, F C; Travers, J B; Wenning, M J; Hiatt, K; New, S; Hood, A; Shannon, K; Williams, D A; Clapp, D W

2000-01-03

Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's "two hit" model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1-/- murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W(41) mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras-mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W(41)) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types.

C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

PubMed Central

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

2009-01-01

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

Direct interaction of menin leads to ubiquitin-proteasomal degradation of β-catenin.

PubMed

Kim, Byungho; Song, Tae-Yang; Jung, Kwan Young; Kim, Seul Gi; Cho, Eun-Jung

2017-10-07

Menin, encoded by the multiple endocrine neoplasia type 1 (MEN1) gene, is a tumor suppressor and transcription regulator. Menin interacts with various proteins as a scaffold protein and is proposed to play important roles in multiple physiological and pathological processes by controlling gene expression, proliferation, and apoptosis. The mechanisms underlying menin's suppression of tumorigenesis are largely elusive. In this study, we showed that menin was essential for the regulation of canonical Wnt/β-catenin signaling in cultured cells. The C-terminal domain of menin was able to directly interact with and promote ubiquitin-mediated degradation of β-catenin. We further revealed that overexpression of menin down-regulated the transcriptional activity of β-catenin and target gene expression. Moreover, menin efficiently inhibited β-catenin protein levels, transcriptional activity, and proliferation of human renal carcinoma cells with an activated β-catenin pathway. Taken together, our results provide novel molecular insights into the tumor suppressor activity of menin, which is partly mediated by proteasomal degradation of β-catenin and inhibition of Wnt/β-catenin signaling. Copyright © 2017 Elsevier Inc. All rights reserved.

Mutations in a signal sequence for the thylakoid membrane identify multiple protein transport pathways and nuclear suppressors

PubMed Central

1994-01-01

The apparatus that permits protein translocation across the internal thylakoid membranes of chloroplasts is completely unknown, even though these membranes have been the subject of extensive biochemical analysis. We have used a genetic approach to characterize the translocation of Chlamydomonas cytochrome f, a chloroplast-encoded protein that spans the thylakoid once. Mutations in the hydrophobic core of the cytochrome f signal sequence inhibit the accumulation of cytochrome f, lead to an accumulation of precursor, and impair the ability of Chlamydomonas cells to grow photosynthetically. One hydrophobic core mutant also reduces the accumulation of other thylakoid membrane proteins, but not those that translocate completely across the membrane. These results suggest that the signal sequence of cytochrome f is required and is involved in one of multiple insertion pathways. Suppressors of two signal peptide mutations describe at least two nuclear genes whose products likely describe the translocation apparatus, and selected second-site chloroplast suppressors further define regions of the cytochrome f signal peptide. PMID:8034740

A Y-Encoded Suppressor of Feminization Arose via Lineage-Specific Duplication of a Cytokinin Response Regulator in Kiwifruit[OPEN

PubMed Central

Ohtani, Haruka; Morimoto, Takuya; Beppu, Kenji; Kataoka, Ikuo

2018-01-01

Dioecy, the presence of male and female flowers on distinct individuals, has evolved independently in multiple plant lineages, and the genes involved in this differential development are just starting to be uncovered in a few species. Here, we used genomic approaches to investigate this pathway in kiwifruits (genus Actinidia). Genome-wide cataloging of male-specific subsequences, combined with transcriptome analysis, led to the identification of a type-C cytokinin response regulator as a potential sex determinant gene in this genus. Functional transgenic analyses in two model systems, Arabidopsis thaliana and Nicotiana tabacum, indicated that this gene acts as a dominant suppressor of carpel development, prompting us to name it Shy Girl (SyGI). Evolutionary analyses in a panel of Actinidia species revealed that SyGI is located in the Y-specific region of the genome and probably arose from a lineage-specific gene duplication. Comparisons with the duplicated autosomal counterpart, and with orthologs from other angiosperms, suggest that the SyGI-specific duplication and subsequent evolution of cis-elements may have played a key role in the acquisition of separate sexes in this species. PMID:29626069

A Restricted Spectrum of Mutations in the SMAD4 Tumor-Suppressor Gene Underlies Myhre Syndrome

PubMed Central

Caputo, Viviana; Cianetti, Luciano; Niceta, Marcello; Carta, Claudio; Ciolfi, Andrea; Bocchinfuso, Gianfranco; Carrani, Eugenio; Dentici, Maria Lisa; Biamino, Elisa; Belligni, Elga; Garavelli, Livia; Boccone, Loredana; Melis, Daniela; Andria, Generoso; Gelb, Bruce D.; Stella, Lorenzo; Silengo, Margherita; Dallapiccola, Bruno; Tartaglia, Marco

2012-01-01

Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor β and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth. PMID:22243968

Characterization of the aes gene of Escherichia coli encoding an enzyme with esterase activity.

PubMed Central

Peist, R; Koch, A; Bolek, P; Sewitz, S; Kolbus, T; Boos, W

1997-01-01

malQ mutants of Escherichia coli lacking amylomaltase cannot grow on maltose. They express the maltose system constitutively and are sensitive to maltose when grown on another carbon source. In an attempt to isolate a multicopy suppressor that would result in growth on maltose, we transformed a malQ mutant with a gene bank of E. coli DNA which had been digested with Sau3a and cloned in pBR322. We screened the transformants on MacConkey maltose plates. A colony was isolated that appeared to be resistant to maltose and was pink on these plates, but it was still unable to grow on minimal medium with maltose as the carbon source. The plasmid was isolated, and the gene causing this phenotype was characterized. The deduced amino acid sequence of the encoded protein shows homology to that of lipases and esterases. We termed the gene aes, for acetyl esterase. Extracts of cells harboring plasmid-encoded aes under its own promoter exhibit a fivefold higher capacity to hydrolyze p-nitrophenyl acetate than do extracts of cells of plasmid-free strains. Similarly, strains harboring plasmid-encoded aes are able to grow on triacetyl glycerol (triacetin) whereas the plasmid-free strains are not. The expression of plasmid-encoded aes resulted in strong repression of the maltose transport genes in malT+ strains (10-fold reduction), but not in a malT(Con) strain which is independent of the inducer. Also, overproduction of MalT counteracted the Aes-dependent repression, indicating a direct interaction between MalT and Aes. PMID:9401025

Identification of Two Candidate Tumor Suppressor Genes on Chromosome 17p13.3: Assessment of Their Roles in Breast and Ovarian Carcinogenesis

DTIC Science & Technology

1997-07-01

minimum region of allelic loss on chromosome 17p 13.3, between polymorphic markers D17S5 and D17S28, in genomic DNA from breast and ovarian tumors (Figure 1...encode proteins of 443 and 227 amino acids, with no known functional motifs. Comparison of genomic and cDNA sequences showed that the genes overlap...is tissue specific (Figure 4). When zoo blots comprised of EcoRI fragments of genomic DNA from various species were probed with the unique exon 1 of

Identification and Characterization of Genes That Interact with Lin-12 in Caenorhabditis Elegans

PubMed Central

Tax, F. E.; Thomas, J. H.; Ferguson, E. L.; Horvitz, H. R.

1997-01-01

We identified and characterized 14 extragenic mutations that suppressed the dominant egg-laying defect of certain lin-12 gain-of-function mutations. These suppressors defined seven genes: sup-17, lag-2, sel-4, sel-5, sel-6, sel-7 and sel-8. Mutations in six of the genes are recessive suppressors, whereas the two mutations that define the seventh gene, lag-2, are semi-dominant suppressors. These suppressor mutations were able to suppress other lin-12 gain-of-function mutations. The suppressor mutations arose at a very low frequency per gene, 10-50 times below the typical loss-of-function mutation frequency. The suppressor mutations in sup-17 and lag-2 were shown to be rare non-null alleles, and we present evidence that null mutations in these two genes cause lethality. Temperature-shift studies for two suppressor genes, sup-17 and lag-2, suggest that both genes act at approximately the same time as lin-12 in specifying a cell fate. Suppressor alleles of six of these genes enhanced a temperature-sensitive loss-of-function allele of glp-1, a gene related to lin-12 in structure and function. Our analysis of these suppressors suggests that the majority of these genes are part of a shared lin-12/glp-1 signal transduction pathway, or act to regulate the expression or stability of lin-12 and glp-1. PMID:9409830

Octapartite negative-sense RNA genome of High Plains wheat mosaic virus encodes two suppressors of RNA silencing.

PubMed

Gupta, Adarsh K; Hein, Gary L; Graybosch, Robert A; Tatineni, Satyanarayana

2018-05-01

High Plains wheat mosaic virus (HPWMoV, genus Emaravirus; family Fimoviridae), transmitted by the wheat curl mite (Aceria tosichella Keifer), harbors a monocistronic octapartite single-stranded negative-sense RNA genome. In this study, putative proteins encoded by HPWMoV genomic RNAs 2-8 were screened for potential RNA silencing suppression activity by using a green fluorescent protein-based reporter agroinfiltration assay. We found that proteins encoded by RNAs 7 (P7) and 8 (P8) suppressed silencing induced by single- or double-stranded RNAs and efficiently suppressed the transitive pathway of RNA silencing. Additionally, a Wheat streak mosaic virus (WSMV, genus Tritimovirus; family Potyviridae) mutant lacking the suppressor of RNA silencing (ΔP1) but having either P7 or P8 from HPWMoV restored cell-to-cell and long-distance movement in wheat, thus indicating that P7 or P8 rescued silencing suppressor-deficient WSMV. Furthermore, HPWMoV P7 and P8 substantially enhanced the pathogenicity of Potato virus X in Nicotiana benthamiana. Collectively, these data demonstrate that the octapartite genome of HPWMoV encodes two suppressors of RNA silencing. Published by Elsevier Inc.

RASSF10 is epigenetically silenced and functions as a tumor suppressor in gastric cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Ziran; Chen, Xia; Chen, Ji

2013-03-22

Highlights: ► Epigenetic silencing of RASSF10 gene expression in GC cells. ► RASSF10 overexpression inhibits cell growth in vitro and in vivo. ► RASSF10 induces apoptosis in GC cells. ► RASSF10 inhibits Wnt/β-catenin signaling pathway. -- Abstract: Ras association domain family (RASSF) proteins are encoded by several tumor suppressor genes that are frequently silenced in human cancers. In this study, we investigated RASSF10 as a target of epigenetic inactivation and examined its functions as a tumor suppressor in gastric cancer. RASSF10 was silenced in six out of eight gastric cancer cell lines. Loss or downregulation of RASSF10 expression was associatedmore » with promoter hypermethylation, and could be restored by a demethylating agent. Overexpression of RASSF10 in gastric cancer cell lines (JRST, BGC823) suppressed cell growth and colony formation, and induced apoptosis, whereas RASSF10 depletion promoted cell growth. In xenograft animal experiments, RASSF10 overexpression effectively repressed tumor growth. Mechanistic investigations revealed that RASSF10 inhibited tumor growth by blocking activation of β-catenin and its downstream targets including c-Myc, cyclinD1, cyclinE1, peroxisome proliferator-activated receptor δ, transcription factor 4, transcription factor 1 and CD44. In conclusion, the results of this study provide insight into the role of RASSF10 as a novel functional tumor suppressor in gastric cancer through inhibition of the Wnt/β-catenin signaling pathway.« less

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Alterations of the PPP2R1B gene located at 11q23 in human colorectal cancers

PubMed Central

Takagi, Y; Futamura, M; Yamaguchi, K; Aoki, S; Takahashi, T; Saji, S

2000-01-01

BACKGROUND/AIMS—In 1998 the PPP2R1B gene encoding the A subunit of the serine/threonine protein phosphatase was identified as a putative tumour suppressor gene in lung and colon cancer in the chromosome region 11q22-24. The aim of the present study was to determine the type of alterations in primary rectal cancers as well as colon cancers and the correlation between these alterations and clinicopathological data.
METHODS—Mutation analyses of the PPP2R1B gene sequence encoding the binding sites of the catalytic C subunit (Huntington elongation A subunit TOR (HEAT) repeats 11-15) and partial binding sites of the regulatory B subunit were carried out on cDNA samples from 30 primary colorectal cancer specimens and corresponding normal tissues using a combination of the polymerase chain reaction and subsequent direct DNA sequencing.
RESULTS—Five missense mutations producing amino acid substitutions were detected in the four colon cancer cases (13.3%; four of 30 colorectal cancers): 15glycine (GGT) to alanine (GCT) and 499leucine (TTA) to isoleucine (ATA) in the same case, and 498valine (GTG) to glutamic acid (GAG), 500valine (GTA) to glycine (GGA), and 365serine (TCT) to proline (CCT). Of these five mutations, three (60%) were located in HEAT repeat 13 and four (80%) showed T to other nucleotide substitutions. In addition, a normal polymorphism, 478leucine, was found. No correlation was found between these mutations and clinicopathological data.
CONCLUSION—Our results suggest that the PPP2R1B gene is one of the true targets at 11q23, and its inactivation is involved in the development of all types of colorectal cancers.


Keywords: PPP2R1B gene; colorectal cancer; tumour suppressor gene; protein phosphatase PMID:10896920

Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

PubMed

Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

2017-08-15

Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N. benthamiana ASYMMETRIC LEAVES 1. To our knowledge, this is the first report establishing an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as both a VSR and a symptom determinant and to provide a mechanistic explanation of how SNF1-related protein kinase 1 acts as a host defense factor. These findings expand the scope of phosphorylation-mediated defense mechanisms and contribute to further understanding of plant defense mechanisms against geminiviruses. Copyright © 2017 American Society for Microbiology.

Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant

PubMed Central

Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin

2017-01-01

ABSTRACT Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana. However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N. benthamiana ASYMMETRIC LEAVES 1. To our knowledge, this is the first report establishing an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as both a VSR and a symptom determinant and to provide a mechanistic explanation of how SNF1-related protein kinase 1 acts as a host defense factor. These findings expand the scope of phosphorylation-mediated defense mechanisms and contribute to further understanding of plant defense mechanisms against geminiviruses. PMID:28539450

The SUD1 gene encodes a putative E3 ubiquitin ligase and is a positive regulator of 3-hydroxy-3-methylglutaryl coenzyme a reductase activity in Arabidopsis.

PubMed

Doblas, Verónica G; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M; Botella, Miguel A

2013-02-01

The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum-associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals.

The SUD1 Gene Encodes a Putative E3 Ubiquitin Ligase and Is a Positive Regulator of 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Activity in Arabidopsis[C][W

PubMed Central

Doblas, Verónica G.; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M.; Botella, Miguel A.

2013-01-01

The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum–associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals. PMID:23404890

Lack of NF1 gene expression in a sporadic schwannoma from a patient without neurofibromatosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norton, K.K.; Dowton, B.; Silow-Santiago, I.

The neurofibromatosis type 1 (NF1) gene encodes a tumor suppressor protein, neurofibromin, which is expressed at high levels in Schwann cells and other adult tissues. Loss of NF1 gene expression has been reported in Schwann cell tumors (neurofibrosarcomas) from patients with NF1 and its loss is associated with increased proliferation of these cells. We examined one spinal schwannoma from a patient without clinical features of neurofibromatosis type 1 or 2. The tumor was a typical schwannoma confirmed by standard neuropathologic criteria and expressed S100 by immunocytochemistry. NF1 gene expression in this tumor was examined by in situ hybridization using anmore » NF1-specific riboprobe, Northern blot analysis and reverse-transcribed (RT) PCR. Little or no expression of NF1 RNA could be detected using these methods whereas abundant expression of S100, cyclophilin and beta-action RNA was found in the tumor. Fibroblast and Schwann cells were then individually cultured from this schwannoma and the RNA extracted for Northern blot and RT-PCR analysis. In these cultured Schwann cells both from early and late passages, abundant expression of NF1 RNA could be detected. It is unlikely that our culture technique preferentially expanded {open_quotes}normal{close_quotes} Schwann cells, since NF1 acts as a tumor suppressor gene and its presence would not confer any growth advantage over the tumor-derived, neurofibromin-negative Schwann cells which presumably have an increased proliferation rate. Similarly, the conditions used to expand these Schwann cells do not result in increased NF1 gene expression as shown in previous studies. These results suggest that, in some tumors, expression of the NF1 gene can be downregulated by factors produced within the tumor and that this type of tumor suppressor gene downregulation may represent another mechanism other than mutation for turning off the expression of these growth-suppressing genes and allowing for cell proliferation in tumors.« less

TRAIL, Wnt, Sonic Hedgehog, TGFβ, and miRNA Signalings Are Potential Targets for Oral Cancer Therapy

PubMed Central

Farooqi, Ammad Ahmad; Shu, Chih-Wen; Huang, Hurng-Wern; Wang, Hui-Ru; Chang, Yung-Ting; Fayyaz, Sundas; Yuan, Shyng-Shiou F.; Tang, Jen-Yang

2017-01-01

Clinical studies and cancer cell models emphasize the importance of targeting therapies for oral cancer. The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is highly expressed in cancer, and is a selective killing ligand for oral cancer. Signaling proteins in the wingless-type mouse mammary tumor virus (MMTV) integration site family (Wnt), Sonic hedgehog (SHH), and transforming growth factor β (TGFβ) pathways may regulate cell proliferation, migration, and apoptosis. Accordingly, the genes encoding these signaling proteins are potential targets for oral cancer therapy. In this review, we focus on recent advances in targeting therapies for oral cancer and discuss the gene targets within TRAIL, Wnt, SHH, and TGFβ signaling for oral cancer therapies. Oncogenic microRNAs (miRNAs) and tumor suppressor miRNAs targeting the genes encoding these signaling proteins are summarized, and the interactions between Wnt, SHH, TGFβ, and miRNAs are interpreted. With suitable combination treatments, synergistic effects are expected to improve targeting therapies for oral cancer. PMID:28708091

TRAIL, Wnt, Sonic Hedgehog, TGFβ, and miRNA Signalings Are Potential Targets for Oral Cancer Therapy.

PubMed

Farooqi, Ammad Ahmad; Shu, Chih-Wen; Huang, Hurng-Wern; Wang, Hui-Ru; Chang, Yung-Ting; Fayyaz, Sundas; Yuan, Shyng-Shiou F; Tang, Jen-Yang; Chang, Hsueh-Wei

2017-07-14

Clinical studies and cancer cell models emphasize the importance of targeting therapies for oral cancer. The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is highly expressed in cancer, and is a selective killing ligand for oral cancer. Signaling proteins in the wingless-type mouse mammary tumor virus (MMTV) integration site family (Wnt), Sonic hedgehog (SHH), and transforming growth factor β (TGFβ) pathways may regulate cell proliferation, migration, and apoptosis. Accordingly, the genes encoding these signaling proteins are potential targets for oral cancer therapy. In this review, we focus on recent advances in targeting therapies for oral cancer and discuss the gene targets within TRAIL, Wnt, SHH, and TGFβ signaling for oral cancer therapies. Oncogenic microRNAs (miRNAs) and tumor suppressor miRNAs targeting the genes encoding these signaling proteins are summarized, and the interactions between Wnt, SHH, TGFβ, and miRNAs are interpreted. With suitable combination treatments, synergistic effects are expected to improve targeting therapies for oral cancer.

Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi

PubMed Central

van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.

2014-01-01

The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815

One gene - many endocrine and metabolic syndromes: PTEN-opathies and precision medicine.

PubMed

Yehia, Lamis; Eng, Charis

2018-05-23

An average of 10% of all cancers (range 1-40%) are caused by heritable mutations and over the years, have become powerful models for precision medicine practice. Furthermore, such cancer predisposition genes for seemingly rare syndromes have turned out to help explain mechanisms of sporadic carcinogenesis and often inform normal development. The tumor suppressor PTEN encodes a ubiquitously expressed phosphatase that counteracts the PI3K/AKT/mTOR cascade - one of the most critical growth-promoting signaling pathways. Clinically, individuals with germline PTEN mutations have diverse phenotypes and fall under the umbrella term PTEN hamartoma tumor syndrome (PHTS). PHTS encompasses four clinically distinct allelic overgrowth syndromes, namely Cowden, Bannayan-Riley-Ruvalcaba, Proteus, and Proteus-like syndromes. Relatedly, mutations in other genes encoding components of the PI3K/AKT/mTOR pathway downstream of PTEN also predispose patients to partially overlapping clinical manifestations, with similar effects as PTEN malfunction. We refer to these syndromes as "PTEN-opathies." As a tumor suppressor and key regulator of normal development, PTEN dysfunction can cause a spectrum of phenotypes including benign overgrowths, malignancies, metabolic, and neurodevelopmental disorders. Relevant to clinical practice, the identification of PTEN mutations in patients not only establishes a PHTS molecular diagnosis, but also informs on more accurate cancer risk assessment and medical management of those patients and affected family members. Importantly, timely diagnosis is key, as early recognition allows for preventative measures such as high-risk screening and surveillance even prior to cancer onset. This review highlights the translational impact that the discovery of PTEN has had on the diagnosis, management, and treatment of PHTS.

Discovery of Tumor Suppressor Gene Function.

ERIC Educational Resources Information Center

Oppenheimer, Steven B.

1995-01-01

This is an update of a 1991 review on tumor suppressor genes written at a time when understanding of how the genes work was limited. A recent major breakthrough in the understanding of the function of tumor suppressor genes is discussed. (LZ)

Off and back-on again: a tumor suppressor's tale.

PubMed

Acosta, Jonuelle; Wang, Walter; Feldser, David M

2018-06-01

Tumor suppressor genes play critical roles orchestrating anti-cancer programs that are both context dependent and mechanistically diverse. Beyond canonical tumor suppressive programs that control cell division, cell death, and genome stability, unexpected tumor suppressor gene activities that regulate metabolism, immune surveillance, the epigenetic landscape, and others have recently emerged. This diversity underscores the important roles these genes play in maintaining cellular homeostasis to suppress cancer initiation and progression, but also highlights a tremendous challenge in discerning precise context-specific programs of tumor suppression controlled by a given tumor suppressor. Fortunately, the rapid sophistication of genetically engineered mouse models of cancer has begun to shed light on these context-dependent tumor suppressor activities. By using techniques that not only toggle "off" tumor suppressor genes in nascent tumors, but also facilitate the timely restoration of gene function "back-on again" in disease specific contexts, precise mechanisms of tumor suppression can be revealed in an unbiased manner. This review discusses the development and implementation of genetic systems designed to toggle tumor suppressor genes off and back-on again and their potential to uncover the tumor suppressor's tale.

Differential Splicing of Oncogenes and Tumor Suppressor Genes in African- and Caucasian-American Populations: Contributing Factor in Prostate Cancer Disparities

DTIC Science & Technology

2015-10-01

signaling protein as defined by in vitro assays and mouse xenograft studies, ii) is associated with worse prognosis in patients, and iii) is resistant to...available. Specific Aim 2. To characterize oncogenic differences of splice variant pairs in vivo using xenograft animal models. Task 1. Validate...idelalisib as defined by in vitro assays and mouse xenograft models. In contrast, the corresponding EA isoform (PI3Kδ-L) encodes a less aggressive isoform

Function of the ING family of PHD proteins in cancer.

PubMed

Gong, Wei; Suzuki, Keiko; Russell, Michael; Riabowol, Karl

2005-05-01

The ING genes encode a family of at least seven proteins with conserved plant homeodomain (PHD)-type zinc fingers in their C-termini. The founding member, ING1, is capable of binding to and affecting the activity of histone acetyltransferase (HAT), histone deacetylase (HDAC), and factor acetyltransferase (FAT) protein complexes. Some ING proteins are involved in transcriptional regulation of genes, such as the p53-inducible genes p21 and Bax. Others have been found to affect post-translational modifications, exemplified by the ING2-induced acetylation of p53 on the same site deacetylated by the Sir2 HDAC. Upon UV irradiation, ING1 causes cell cycle arrest and interacts with proliferating cell nuclear antigen to promote DNA repair or induce apoptosis in cells to prevent tumorigenesis depending upon the severity of DNA damage. It is very likely that, by linking DNA repair, apoptosis and chromatin remodeling to the transcriptional regulation of critical genes, ING1 exerts it tumor suppressor functions by helping maintain genomic stability. Therefore, ING proteins, which are down-regulated in a broad variety of cancer types, are able to restrict cell growth and proliferation, induce apoptosis, and modulate cell cycle progression, which strongly supports the notion that ING family proteins act as class II tumor suppressors.

Suppression of Amber Codons in Caulobacter crescentus by the Orthogonal Escherichia coli Histidyl-tRNA Synthetase/tRNAHis Pair

PubMed Central

Ko, Jae-hyeong; Llopis, Paula Montero; Heinritz, Jennifer; Jacobs-Wagner, Christine; Söll, Dieter

2013-01-01

While translational read-through of stop codons by suppressor tRNAs is common in many bacteria, archaea and eukaryotes, this phenomenon has not yet been observed in the α-proteobacterium Caulobacter crescentus. Based on a previous report that C. crescentus and Escherichia coli tRNAHis have distinctive identity elements, we constructed E. coli tRNAHis CUA, a UAG suppressor tRNA for C. crescentus. By examining the expression of three UAG codon- containing reporter genes (encoding a β-lactamase, the fluorescent mCherry protein, or the C. crescentus xylonate dehydratase), we demonstrated that the E. coli histidyl-tRNA synthetase/tRNAHis CUA pair enables in vivo UAG suppression in C. crescentus. E. coli histidyl-tRNA synthetase (HisRS) or tRNAHis CUA alone did not achieve suppression; this indicates that the E. coli HisRS/tRNAHis CUA pair is orthogonal in C. crescentus. These results illustrate that UAG suppression can be achieved in C. crescentus with an orthogonal aminoacyl-tRNA synthetase/suppressor tRNA pair. PMID:24386240

A tumor suppressor locus within 3p14-p12 mediates rapid cell death of renal cell carcinoma in vivo.

PubMed Central

Sanchez, Y; el-Naggar, A; Pathak, S; Killary, A M

1994-01-01

High frequency loss of alleles and cytogenetic aberrations on the short arm of chromosome 3 have been documented in renal cell carcinoma (RCC). Potentially, three distinct regions on 3p could encode tumor suppressor genes involved in the genesis of this cancer. We report that the introduction of a centric fragment of 3p, encompassing 3p14-q11, into a highly malignant RCC cell line resulted in a dramatic suppression of tumor growth in athymic nude mice. Another defined deletion hybrid contained the region 3p12-q24 of the introduced human chromosome and failed to suppress tumorigenicity. These data functionally define a tumor suppressor locus, nonpapillary renal carcinoma-1 (NRC-1), within 3p14-p12, the most proximal region of high frequency allele loss in sporadic RCC as well as the region containing the translocation breakpoint in familial RCC. Furthermore, we provide functional evidence that NRC-1 controls the growth of RCC cells by inducing rapid cell death in vivo. Images PMID:8159756

Genetic Variability and Evolutionary Implications of RNA Silencing Suppressor Genes in RNA1 of Sweet Potato Chlorotic Stunt Virus Isolates Infecting Sweetpotato and Related Wild Species

PubMed Central

Tugume, Arthur K.; Amayo, Robert; Weinheimer, Isabel; Mukasa, Settumba B.; Rubaihayo, Patrick R.; Valkonen, Jari P. T.

2013-01-01

Background The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae) encodes a Class 1 RNase III (RNase3), a putative hydrophobic protein (p7) and a 22-kDa protein (p22) from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas) virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. Methodology/Principal Findings Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae) in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA) strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae) and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b) encoding an RNase3 homolog (<56% identity to SPCSV RNase3) able to suppresses sense-mediated RNA silencing was detected in I. sinensis. Conclusions/Significance SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in sweetpotato. A second virus encoding an RNase3-like RNA silencing suppressor was detected. Overall, results provided many novel and important insights into evolutionary biology of SPCSV. PMID:24278443

Unfurling of the band 4.1, ezrin, radixin, moesin (FERM) domain of the merlin tumor suppressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yogesha, S.D.; Sharff, Andrew J.; Giovannini, Marco

The merlin-1 tumor suppressor is encoded by the Neurofibromatosis-2 (Nf2) gene and loss-of-function Nf2 mutations lead to nervous system tumors in man and to several tumor types in mice. Merlin is an ERM (ezrin, radixin, moesin) family cytoskeletal protein that interacts with other ERM proteins and with components of cell-cell adherens junctions (AJs). Merlin stabilizes the links of AJs to the actin cytoskeleton. Thus, its loss destabilizes AJs, promoting cell migration and invasion, which in Nf2{sup +/-} mice leads to highly metastatic tumors. Paradoxically, the 'closed' conformation of merlin-1, where its N-terminal four-point-one, ezrin, radixin, moesin (FERM) domain binds tomore » its C-terminal tail domain, directs its tumor suppressor functions. Here we report the crystal structure of the human merlin-1 head domain when crystallized in the presence of its tail domain. Remarkably, unlike other ERM head-tail interactions, this structure suggests that binding of the tail provokes dimerization and dynamic movement and unfurling of the F2 motif of the FERM domain. We conclude the 'closed' tumor suppressor conformer of merlin-1 is in fact an 'open' dimer whose functions are disabled by Nf2 mutations that disrupt this architecture.« less

Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells.

PubMed

Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

2013-03-01

RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. © 2013 Blackwell Publishing Ltd.

Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells

PubMed Central

Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

2013-01-01

RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. PMID:23301723

Suppressor of Fused Chaperones Gli Proteins To Generate Transcriptional Responses to Sonic Hedgehog Signaling

PubMed Central

Zhang, Ziyu; Shen, Longyan; Law, Kelvin; Zhang, Zengdi; Liu, Xiaotong; Hua, Hu; Li, Sanen; Huang, Huijie; Yue, Shen; Hui, Chi-chung

2016-01-01

ABSTRACT Cellular responses to the graded Sonic Hedgehog (Shh) morphogenic signal are orchestrated by three Gli genes that give rise to both transcription activators and repressors. An essential downstream regulator of the pathway, encoded by the tumor suppressor gene Suppressor of fused (Sufu), plays critical roles in the production, trafficking, and function of Gli proteins, but the mechanism remains controversial. Here, we show that Sufu is upregulated in active Shh responding tissues and accompanies Gli activators translocating into and Gli repressors out of the nucleus. Trafficking of Sufu to the primary cilium, potentiated by Gli activators but not repressors, was found to be coupled to its nuclear import. We have identified a nuclear export signal (NES) motif of Sufu in juxtaposition to the protein kinase A (PKA) and glycogen synthase kinase 3 (GSK3) dual phosphorylation sites and show that Sufu binds the chromatin with both Gli1 and Gli3. Close comparison of neural tube development among individual Ptch1−/−, Sufu−/−, and Ptch1−/−; Sufu−/− double mutant embryos indicates that Sufu is critical for the maximal activation of Shh signaling essential to the specification of the most-ventral neurons. These data define Sufu as a novel class of molecular chaperone required for every aspect of Gli regulation and function. PMID:27849569

Molecular role of the PAX5-ETV6 oncoprotein in promoting B-cell acute lymphoblastic leukemia.

PubMed

Smeenk, Leonie; Fischer, Maria; Jurado, Sabine; Jaritz, Markus; Azaryan, Anna; Werner, Barbara; Roth, Mareike; Zuber, Johannes; Stanulla, Martin; den Boer, Monique L; Mullighan, Charles G; Strehl, Sabine; Busslinger, Meinrad

2017-03-15

PAX5 is a tumor suppressor in B-ALL, while the role of PAX5 fusion proteins in B-ALL development is largely unknown. Here, we studied the function of PAX5-ETV6 and PAX5-FOXP1 in mice expressing these proteins from the Pax5 locus. Both proteins arrested B-lymphopoiesis at the pro-B to pre-B-cell transition and, contrary to their proposed dominant-negative role, did not interfere with the expression of most regulated Pax5 target genes. Pax5-Etv6, but not Pax5-Foxp1, cooperated with loss of the Cdkna2a/b tumor suppressors in promoting B-ALL development. Regulated Pax5-Etv6 target genes identified in these B-ALLs encode proteins implicated in pre-B-cell receptor (BCR) signaling and migration/adhesion, which could contribute to the proliferation, survival, and tissue infiltration of leukemic B cells. Together with similar observations made in human PAX5-ETV6 + B-ALLs, these data identified PAX5-ETV6 as a potent oncoprotein that drives B-cell leukemia development. © 2017 The Authors.

Interallelic Complementation at the Suppressor of Forked Locus of Drosophila Reveals Complementation between Suppressor of Forked Proteins Mutated in Different Regions

PubMed Central

Simonelig, M.; Elliott, K.; Mitchelson, A.; O'Hare, K.

1996-01-01

The Su(f) protein of Drosophila melanogaster shares extensive homologies with proteins from yeast (RNA14) and man (77 kD subunit of cleavage stimulation factor) that are required for 3' end processing of mRNA. These homologies suggest that su(f) is involved in mRNA 3' end formation and that some aspects of this process are conserved throughout eukaryotes. We have investigated the genetic and molecular complexity of the su(f) locus. The su(f) gene is transcribed to produce three RNAs and could encode two proteins. Using constructs that contain different parts of the locus, we show that only the larger predicted gene product of 84 kD is required for the wild-type function of su(f). Some lethal alleles of su(f) complement to produce viable combinations. The structures of complementing and noncomplementing su(f) alleles indicate that 84-kD Su(f) proteins mutated in different domains can act in combination for partial su(f) function. Our results suggest protein-protein interaction between or within wild-type Su(f) molecules. PMID:8846900

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

PubMed

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

2011-11-24

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

Helicobacter pylori CagA induces tumor suppressor gene hypermethylation by upregulating DNMT1 via AKT-NFκB pathway in gastric cancer development.

PubMed

Zhang, Bao-gui; Hu, Lei; Zang, Ming-de; Wang, He-xiao; Zhao, Wei; Li, Jian-fang; Su, Li-ping; Shao, Zhifeng; Zhao, Xiaodong; Zhu, Zheng-gang; Yan, Min; Liu, Bingya

2016-03-01

Methylation of CpG islands in tumor suppressor gene prompter is one of the most characteristic abnormalities in Helicobacter pylori (HP)-associated gastric carcinoma (GC). Here, we investigated the pathogenic and molecular mechanisms underlying hypermethylation of tumor suppressor genes in HP induced GC development. We found that tumor suppressor genes hypermethylation, represented by MGMT, positively correlated with CagA in clinical specimens, gastric tissues from HP infected C57 mice and GC cell lines transfected by CagA or treated by HP infection. CagA enhanced PDK1 and AKT interaction and increased AKT phosphorylation. The P-AKT subsequent activated NFκB, which then bound to DNMT1 promoter and increased its expression. Finally, the upregulated DNMT1 promoted tumor suppressor genes hypermethylation with MGMT as a representative. In conclusion, CagA increased tumor suppressor genes hypermethylation via stimulating DNMT1 expression through the AKT-NFκB pathway.

Helicobacter pylori CagA induces tumor suppressor gene hypermethylation by upregulating DNMT1 via AKT-NFκB pathway in gastric cancer development

PubMed Central

Wang, He-xiao; Zhao, Wei; Li, Jian-fang; Su, Li-ping; Shao, Zhifeng; Zhao, Xiaodong; Zhu, Zheng-gang; Yan, Min; Liu, Bingya

2016-01-01

Methylation of CpG islands in tumor suppressor gene prompter is one of the most characteristic abnormalities in Helicobacter pylori (HP)-associated gastric carcinoma (GC). Here, we investigated the pathogenic and molecular mechanisms underlying hypermethylation of tumor suppressor genes in HP induced GC development. We found that tumor suppressor genes hypermethylation, represented by MGMT, positively correlated with CagA in clinical specimens, gastric tissues from HP infected C57 mice and GC cell lines transfected by CagA or treated by HP infection. CagA enhanced PDK1 and AKT interaction and increased AKT phosphorylation. The P-AKT subsequent activated NFκB, which then bound to DNMT1 promoter and increased its expression. Finally, the upregulated DNMT1 promoted tumor suppressor genes hypermethylation with MGMT as a representative. In conclusion, CagA increased tumor suppressor genes hypermethylation via stimulating DNMT1 expression through the AKT-NFκB pathway. PMID:26848521

Elimination of sucrose transport and hydrolysis in Saccharomyces cerevisiae: a platform strain for engineering sucrose metabolism

PubMed Central

Marques, Wesley Leoricy; Mans, Robert; Marella, Eko Roy; Cordeiro, Rosa Lorizolla; van den Broek, Marcel; Daran, Jean-Marc G.; Pronk, Jack T.; Gombert, Andreas K.; van Maris, Antonius J.A.

2017-01-01

Abstract Many relevant options to improve efficacy and kinetics of sucrose metabolism in Saccharomyces cerevisiae and, thereby, the economics of sucrose-based processes remain to be investigated. An essential first step is to identify all native sucrose-hydrolysing enzymes and sucrose transporters in this yeast, including those that can be activated by suppressor mutations in sucrose-negative strains. A strain in which all known sucrose-transporter genes (MAL11, MAL21, MAL31, MPH2, MPH3) were deleted did not grow on sucrose after 2 months of incubation. In contrast, a strain with deletions in genes encoding sucrose-hydrolysing enzymes (SUC2, MAL12, MAL22, MAL32) still grew on sucrose. Its specific growth rate increased from 0.08 to 0.25 h−1 after sequential batch cultivation. This increase was accompanied by a 3-fold increase of in vitro sucrose-hydrolysis and isomaltase activities, as well as by a 3- to 5-fold upregulation of the isomaltase-encoding genes IMA1 and IMA5. One-step Cas9-mediated deletion of all isomaltase-encoding genes (IMA1-5) completely abolished sucrose hydrolysis. Even after 2 months of incubation, the resulting strain did not grow on sucrose. This sucrose-negative strain can be used as a platform to test metabolic engineering strategies and for fundamental studies into sucrose hydrolysis or transport. PMID:28087672

A Screen for Modifiers of Hedgehog Signaling in Drosophila melanogaster Identifies swm and mts

PubMed Central

Casso, David J.; Liu, Songmei; Iwaki, D. David; Ogden, Stacey K.; Kornberg, Thomas B.

2008-01-01

Signaling by Hedgehog (Hh) proteins shapes most tissues and organs in both vertebrates and invertebrates, and its misregulation has been implicated in many human diseases. Although components of the signaling pathway have been identified, key aspects of the signaling mechanism and downstream targets remain to be elucidated. We performed an enhancer/suppressor screen in Drosophila to identify novel components of the pathway and identified 26 autosomal regions that modify a phenotypic readout of Hh signaling. Three of the regions include genes that contribute constituents to the pathway—patched, engrailed, and hh. One of the other regions includes the gene microtubule star (mts) that encodes a subunit of protein phosphatase 2A. We show that mts is necessary for full activation of Hh signaling. A second region includes the gene second mitotic wave missing (swm). swm is recessive lethal and is predicted to encode an evolutionarily conserved protein with RNA binding and Zn+ finger domains. Characterization of newly isolated alleles indicates that swm is a negative regulator of Hh signaling and is essential for cell polarity. PMID:18245841

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

PubMed

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Akt phosphorylation regulates the tumour-suppressor merlin through ubiquitination and degradation.

PubMed

Tang, Xiaoling; Jang, Sung-Wuk; Wang, Xuerong; Liu, Zhixue; Bahr, Scott M; Sun, Shi-Yong; Brat, Daniel; Gutmann, David H; Ye, Keqiang

2007-10-01

The neurofibromatosis-2 (NF2) tumour-suppressor gene encodes an intracellular membrane-associated protein, called merlin, whose growth-suppressive function is dependent on its ability to form interactions through its intramolecular amino-terminal domain (NTD) and carboxy-terminal domain (CTD). Merlin phosphorylation plays a critical part in dictating merlin NTD/CTD interactions as well as in controlling binding to its effector proteins. Merlin is partially regulated by phosphorylation of Ser 518, such that hyperphosphorylated merlin is inactive and fails to form productive intramolecular and intermolecular interactions. Here, we show that the protein kinase Akt directly binds to and phosphorylates merlin on residues Thr 230 and Ser 315, which abolishes merlin NTD/CTD interactions and binding to merlin's effector protein PIKE-L and other binding partners. Furthermore, Akt-mediated phosphorylation leads to merlin degradation by ubiquitination. These studies demonstrate that Akt-mediated merlin phosphorylation regulates the function of merlin in the absence of an inactivating mutation.

Diabetes and apoptosis: neural crest cells and neural tube.

PubMed

Chappell, James H; Wang, Xiao Dan; Loeken, Mary R

2009-12-01

Birth defects resulting from diabetic pregnancy are associated with apoptosis of a critical mass of progenitor cells early during the formation of the affected organ(s). Insufficient expression of genes that regulate viability of the progenitor cells is responsible for the apoptosis. In particular, maternal diabetes inhibits expression of a gene, Pax3, that encodes a transcription factor which is expressed in neural crest and neuroepithelial cells. As a result of insufficient Pax3, cardiac neural crest and neuroepithelial cells undergo apoptosis by a process dependent on the p53 tumor suppressor protein. This, then provides a cellular explanation for the cardiac outflow tract and neural tube and defects induced by diabetic pregnancy.

Diabetes and apoptosis: neural crest cells and neural tube

PubMed Central

Chappell, James H.; Dan Wang, Xiao

2016-01-01

Birth defects resulting from diabetic pregnancy are associated with apoptosis of a critical mass of progenitor cells early during the formation of the affected organ(s). Insufficient expression of genes that regulate viability of the progenitor cells is responsible for the apoptosis. In particular, maternal diabetes inhibits expression of a gene, Pax3, that encodes a transcription factor which is expressed in neural crest and neuroepithelial cells. As a result of insufficient Pax3, cardiac neural crest and neuroepithelial cells undergo apoptosis by a process dependent on the p53 tumor suppressor protein. This, then provides a cellular explanation for the cardiac outflow tract and neural tube and defects induced by diabetic pregnancy. PMID:19333760

Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain.

PubMed

Li, Yingzhong; Tessaro, Mark J; Li, Xin; Zhang, Yuelin

2010-07-01

Plant Resistance (R) genes encode immune receptors that recognize pathogens and activate defense responses. Because of fitness costs associated with maintaining R protein-mediated resistance, expression levels of R genes have to be tightly regulated. However, mechanisms on how R-gene expression is regulated are poorly understood. Here we show that MODIFIER OF snc1, 1 (MOS1) regulates the expression of SUPPRESSOR OF npr1-1, CONSTITUTIVE1 (SNC1), which encodes a Toll/interleukin receptor-nucleotide binding site-leucine-rich repeat type of R protein in Arabidopsis (Arabidopsis thaliana). In the mos1 loss-of-function mutant plants, snc1 expression is repressed and constitutive resistance responses mediated by snc1 are lost. The repression of snc1 expression in mos1 is released by knocking out DECREASE IN DNA METHYLATION1. In mos1 mutants, DNA methylation in a region upstream of SNC1 is altered. Furthermore, expression of snc1 transgenes using the native promoter does not require MOS1, indicating that regulation of SNC1 expression by MOS1 is at the chromatin level. Map-based cloning of MOS1 revealed that it encodes a novel protein with a HLA-B ASSOCIATED TRANSCRIPT2 (BAT2) domain that is conserved in plants and animals. Our study on MOS1 suggests that BAT2 domain-containing proteins may function in regulation of gene expression at chromatin level.

CDH4 suppresses the progression of salivary adenoid cystic carcinoma via E-cadherin co-expression.

PubMed

Xie, Jian; Feng, Yan; Lin, Ting; Huang, Xiao-Yu; Gan, Rui-Huan; Zhao, Yong; Su, Bo-Hua; Ding, Lin-Can; She, Lin; Chen, Jiang; Lin, Li-Song; Lin, Xu; Zheng, Da-Li; Lu, You-Guang

2016-12-13

The cadherin-4 gene (CDH4) of the cadherin family encodes non-epithelial R-cadherin (R-cad); however, the function of this gene in different types of cancer remains controversial. In this study, we found higher expression of CDH4 mRNA in a salivary adenoid cystic carcinoma (SACC) cell line with low metastatic potential (SACC-83) than in a cell line with high metastatic potential (SACC-LM). By analyzing 67 samples of SACC tissues and 40 samples of paraneoplastic normal tissues, we found R-cad highly expressed in 100% of normal paraneoplastic tissue but only expressed in 64% of SACC tumor tissues (P<0.001). Knockdown of CDH4 expression in vitro promoted the growth, mobility and invasion of SACC cells, and in vivo experiments showed that decreased CDH4 expression enhanced SACC tumorigenicity. Furthermore, CDH4 suppression resulted in down-regulation of E-cadherin (E-cad), which is encoded by CDH1 gene and is a well-known tumor suppressor gene by inhibition of cell proliferation and migration. These results indicate that CDH4 may play a negative role in the growth and metastasis of SACC via co-expression with E-cadherin.

Differential splicing of oncogenes and tumor suppressor genes in African and Caucasian American populations: contributing factor in prostate cancer disparities

DTIC Science & Technology

2017-12-01

exhibited enhanced activation of the PI3K/AKT pathway compared to the same lines over-expressing the CA- enriched long (-L) variant PIK3CD-L (retains...demonstrate that FGFR3-S: i) encodes a more aggressive oncogenic signaling protein compared to CA-enriched FGFR3-L (retains exon 14) as defined by in vitro...into PCa cell lines for in vitro and in vivo investigations completed in Year 1 (see description below). 3 FIGURE 1. Full-length cDNA

Cyclin D1 Determines Mitochondrial Function In Vivo†

PubMed Central

Sakamaki, Toshiyuki; Casimiro, Mathew C.; Ju, Xiaoming; Quong, Andrew A.; Katiyar, Sanjay; Liu, Manran; Jiao, Xuanmao; Li, Anping; Zhang, Xueping; Lu, Yinan; Wang, Chenguang; Byers, Stephen; Nicholson, Robert; Link, Todd; Shemluck, Melvin; Yang, Jianguo; Fricke, Stanley T.; Novikoff, Phyllis M.; Papanikolaou, Alexandros; Arnold, Andrew; Albanese, Christopher; Pestell, Richard

2006-01-01

The cyclin D1 gene encodes a regulatory subunit of the holoenzyme that phosphorylates and inactivates the pRb tumor suppressor to promote nuclear DNA synthesis. cyclin D1 is overexpressed in human breast cancers and is sufficient for the development of murine mammary tumors. Herein, cyclin D1 is shown to perform a novel function, inhibiting mitochondrial function and size. Mitochondrial activity was enhanced by genetic deletion or antisense or small interfering RNA to cyclin D1. Global gene expression profiling and functional analysis of mammary epithelial cell-targeted cyclin D1 antisense transgenics demonstrated that cyclin D1 inhibits mitochondrial activity and aerobic glycolysis in vivo. Reciprocal regulation of these genes was observed in cyclin D1-induced mammary tumors. Cyclin D1 thus integrates nuclear DNA synthesis and mitochondrial function. PMID:16809779

The Receptor Tyrosine Kinase EphA2 Is a Direct Target Gene of Hypermethylated in Cancer 1 (HIC1)*

PubMed Central

Foveau, Bénédicte; Boulay, Gaylor; Pinte, Sébastien; Van Rechem, Capucine; Rood, Brian R.; Leprince, Dominique

2012-01-01

The tumor suppressor gene hypermethylated in cancer 1 (HIC1), which encodes a transcriptional repressor, is epigenetically silenced in many human tumors. Here, we show that ectopic expression of HIC1 in the highly malignant MDA-MB-231 breast cancer cell line severely impairs cell proliferation, migration, and invasion in vitro. In parallel, infection of breast cancer cell lines with a retrovirus expressing HIC1 also induces decreased mRNA and protein expression of the tyrosine kinase receptor EphA2. Moreover, chromatin immunoprecipitation (ChIP) and sequential ChIP experiments demonstrate that endogenous HIC1 proteins are bound, together with the MTA1 corepressor, to the EphA2 promoter in WI38 cells. Taken together, our results identify EphA2 as a new direct target gene of HIC1. Finally, we observe that inactivation of endogenous HIC1 through RNA interference in normal breast epithelial cells results in the up-regulation of EphA2 and is correlated with increased cellular migration. To conclude, our results involve the tumor suppressor HIC1 in the transcriptional regulation of the tyrosine kinase receptor EphA2, whose ligand ephrin-A1 is also a HIC1 target gene. Thus, loss of the regulation of this Eph pathway through HIC1 epigenetic silencing could be an important mechanism in the pathogenesis of epithelial cancers. PMID:22184117

The pVHL172 isoform is not a tumor suppressor and up-regulates a subset of pro-tumorigenic genes including TGFB1 and MMP13

PubMed Central

Hascoet, Pauline; Chesnel, Franck; Jouan, Florence; Goff, Cathy Le; Couturier, Anne; Darrigrand, Eric; Mahe, Fabrice; Rioux-Leclercq, Nathalie; Goff, Xavier Le; Arlot-Bonnemains, Yannick

2017-01-01

The von Hippel-Lindau (VHL) tumor suppressor gene is often deleted or mutated in ccRCC (clear cell renal cell carcinoma) producing a non-functional protein. The gene encodes two mRNA, and three protein isoforms (pVHL213, pVHL160 and pVHL172). The pVHL protein is part of an E3 ligase complex involved in the ubiquitination and proteasomal degradation of different proteins, particularly hypoxia inducible factors (HIF) that drive the transcription of genes involved in the regulation of cell proliferation, angiogenesis or extracellular matrix remodelling. Other non-canonical (HIF-independent) pVHL functions have been described. A recent work reported the expression of the uncharacterized protein isoform pVHL172 which is translated from the variant 2 by alternative splicing of the exon 2. This splice variant is sometimes enriched in the ccRCCs and the protein has been identified in the respective samples of ccRCCs and different renal cell lines. Functional studies on pVHL have only concerned the pVHL213 and pVHL160 isoforms, but no function was assigned to pVHL172. Here we show that pVHL172 stable expression in renal cancer cells does not regulate the level of HIF, exacerbates tumorigenicity when 786-O-pVHL172 cells were xenografted in mice. The pVHL172-induced tumors developed a sarcomatoid phenotype. Moreover, pVHL172 expression was shown to up regulate a subset of pro-tumorigenic genes including TGFB1, MMP1 and MMP13. In summary we identified that pVHL172 is not a tumor suppressor. Furthermore our findings suggest an antagonistic function of this pVHL isoform in the HIF-independent aggressiveness of renal tumors compared to pVHL213. PMID:29100286

DNA methylation of miRNA-encoding genes in non-small cell lung cancer patients.

PubMed

Heller, Gerwin; Altenberger, Corinna; Steiner, Irene; Topakian, Thais; Ziegler, Barbara; Tomasich, Erwin; Lang, György; End-Pfützenreuter, Adelheid; Zehetmayer, Sonja; Döme, Balazs; Arns, Britt-Madeleine; Klepetko, Walter; Zielinski, Christoph C; Zöchbauer-Müller, Sabine

2018-03-23

De-regulated DNA methylation leading to transcriptional inactivation of certain genes occurs frequently in non-small cell lung cancers (NSCLC). Besides protein-encoding genes also microRNA (miRNA)-encoding genes may be targets for methylation in NSCLCs, however, the number of known methylated miRNA genes is still small. Thus, we investigated methylation of miRNA genes in primary tumours (TU) and corresponding non-malignant lung tissue samples (NL) of 50 NSCLC patients using methylated DNA immunoprecipitation followed by custom designed tiling microarray analyses (MeDIP-chip) and 252 differentially methylated probes between TU and NL samples were identified. These probes were annotated which resulted in the identification of 34 miRNA-encoding genes with increased methylation in TU specimens. While some of these miRNA-encoding genes were already known to be methylated in NSCLCs (e.g. miR-9-3, miR-124), methylation of the vast majority of them was unknown so far. We selected six miRNA genes (miR-10b, miR-1179, miR-137, miR-572, miR-3150b and miR-129-2) for gene-specific methylation analyses in TU and corresponding NL samples of 104 NSCLC patients and observed a statistically significant increase of methylation of these miRNA genes in TU samples (p<0.0001, respectively). In silico target prediction of the six miRNAs identified several oncogenic/cell proliferation promoting factors (e.g. CCNE1 as miR-1179 target). To investigate if miR-1179 indeed targets CCNE1, we transfected miR-1179 mimics into CCNE1 expressing NSCLC cells and observed down-regulated CCNE1 mRNA expression in these cells compared to control cells. Similar effects on Cyclin E1 expression were seen in Western blot analyses. In addition, we found a statistically significant growth reduction of NSCLC cells transfected with miR-1179 mimics compared to control cells. In conclusion, we identified many methylated miRNA genes in NSCLC patients and found that miR-1179 is a potential tumour cell growth suppressor in NSCLCs. Overall, our findings emphasize the impact of miRNA gene methylation on the pathogenesis of NSCLCs. This article is protected by copyright. All rights reserved.

Internal deletion of BCOR reveals a tumor suppressor function for BCOR in T lymphocyte malignancies

PubMed Central

Tanaka, Tomoyuki; Nakajima-Takagi, Yaeko; Tara, Shiro; Saraya, Atsunori; Koide, Shuhei; Si, Sha; Manabe, Ichiro; Sanada, Masashi; Nakayama, Manabu; Masuko, Masayoshi; Sone, Hirohito

2017-01-01

Recurrent inactivating mutations have been identified in various hematological malignancies in the X-linked BCOR gene encoding BCL6 corepressor (BCOR); however, its tumor suppressor function remains largely uncharacterized. We generated mice missing Bcor exon 4, expressing a variant BCOR lacking the BCL6-binding domain. Although the deletion of exon 4 in male mice (BcorΔE4/y) compromised the repopulating capacity of hematopoietic stem cells, BcorΔE4/y thymocytes had augmented proliferative capacity in culture and showed a strong propensity to induce acute T-cell lymphoblastic leukemia (T-ALL), mostly in a Notch-dependent manner. Myc, one of the critical NOTCH1 targets in T-ALL, was highly up-regulated in BcorΔE4/y T-ALL cells. Chromatin immunoprecipitation/DNA sequencing analysis revealed that BCOR was recruited to the Myc promoter and restrained its activation in thymocytes. BCOR also targeted other NOTCH1 targets and potentially antagonized their transcriptional activation. Bcl6-deficient thymocytes behaved in a manner similar to BcorΔE4/y thymocytes. Our results provide the first evidence of a tumor suppressor role for BCOR in the pathogenesis of T lymphocyte malignancies. PMID:28827447

The RING finger/B-box factor TAM-1 and a retinoblastoma-like protein LIN-35 modulate context-dependent gene silencing in Caenorhabditis elegans.

PubMed

Hsieh, J; Liu, J; Kostas, S A; Chang, C; Sternberg, P W; Fire, A

1999-11-15

Context-dependent gene silencing is used by many organisms to stably modulate gene activity for large chromosomal regions. We have used tandem array transgenes as a model substrate in a screen for Caenorhabditis elegans mutants that affect context-dependent gene silencing in somatic tissues. This screen yielded multiple alleles of a previously uncharacterized gene, designated tam-1 (for tandem-array-modifier). Loss-of-function mutations in tam-1 led to a dramatic reduction in the activity of numerous highly repeated transgenes. These effects were apparently context dependent, as nonrepetitive transgenes retained activity in a tam-1 mutant background. In addition to the dramatic alterations in transgene activity, tam-1 mutants showed modest alterations in expression of a subset of endogenous cellular genes. These effects include genetic interactions that place tam-1 into a group called the class B synMuv genes (for a Synthetic Multivulva phenotype); this family plays a negative role in the regulation of RAS pathway activity in C. elegans. Loss-of-function mutants in other members of the class-B synMuv family, including lin-35, which encodes a protein similar to the tumor suppressor Rb, exhibit a hypersilencing in somatic transgenes similar to that of tam-1 mutants. Molecular analysis reveals that tam-1 encodes a broadly expressed nuclear protein with RING finger and B-box motifs.

Cancer vulnerabilities unveiled by genomic loss

PubMed Central

Nijhawan, Deepak; Zack, Travis I.; Ren, Yin; Strickland, Matthew R.; Lamothe, Rebecca; Schumacher, Steven E.; Tsherniak, Aviad; Besche, Henrike C.; Rosenbluh, Joseph; Shehata, Shyemaa; Cowley, Glenn S.; Weir, Barbara A.; Goldberg, Alfred L.; Mesirov, Jill P.; Root, David E.; Bhatia, Sangeeta N.; Beroukhim, Rameen; Hahn, William C.

2012-01-01

Summary Due to genome instability, most cancers exhibit loss of regions containing tumor suppressor genes and collateral loss of other genes. To identify cancer-specific vulnerabilities that are the result of copy-number losses, we performed integrated analyses of genome-wide copy-number and RNAi profiles and identified 56 genes for which gene suppression specifically inhibited the proliferation of cells harboring partial copy-number loss of that gene. These CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes are enriched for spliceosome, proteasome and ribosome components. One CYCLOPS gene, PSMC2, encodes an essential member of the 19S proteasome. Normal cells express excess PSMC2, which resides in a complex with PSMC1, PSMD2, and PSMD5 and acts as a reservoir protecting cells from PSMC2 suppression. Cells harboring partial PSMC2 copy-number loss lack this complex and die after PSMC2 suppression. These observations define a distinct class of cancer-specific liabilities resulting from genome instability. PMID:22901813

The future: genetics advances in MEN1 therapeutic approaches and management strategies.

PubMed

Agarwal, Sunita K

2017-10-01

The identification of the multiple endocrine neoplasia type 1 ( MEN1 ) gene in 1997 has shown that germline heterozygous mutations in the MEN1 gene located on chromosome 11q13 predisposes to the development of tumors in the MEN1 syndrome. Tumor development occurs upon loss of the remaining normal copy of the MEN1 gene in MEN1-target tissues. Therefore, MEN1 is a classic tumor suppressor gene in the context of MEN1. This tumor suppressor role of the protein encoded by the MEN1 gene, menin, holds true in mouse models with germline heterozygous Men1 loss, wherein MEN1-associated tumors develop in adult mice after spontaneous loss of the remaining non-targeted copy of the Men1 gene. The availability of genetic testing for mutations in the MEN1 gene has become an essential part of the diagnosis and management of MEN1. Genetic testing is also helping to exclude mutation-negative cases in MEN1 families from the burden of lifelong clinical screening. In the past 20 years, efforts of various groups world-wide have been directed at mutation analysis, molecular genetic studies, mouse models, gene expression studies, epigenetic regulation analysis, biochemical studies and anti-tumor effects of candidate therapies in mouse models. This review will focus on the findings and advances from these studies to identify MEN1 germline and somatic mutations, the genetics of MEN1-related states, several protein partners of menin, the three-dimensional structure of menin and menin-dependent target genes. The ongoing impact of all these studies on disease prediction, management and outcomes will continue in the years to come. © 2017 Society for Endocrinology.

Generation of Myostatin Gene-Edited Channel Catfish (Ictalurus punctatus) via Zygote Injection of CRISPR/Cas9 System.

PubMed

Khalil, Karim; Elayat, Medhat; Khalifa, Elsayed; Daghash, Samer; Elaswad, Ahmed; Miller, Michael; Abdelrahman, Hisham; Ye, Zhi; Odin, Ramjie; Drescher, David; Vo, Khoi; Gosh, Kamal; Bugg, William; Robinson, Dalton; Dunham, Rex

2017-08-04

The myostatin (MSTN) gene is important because of its role in regulation of skeletal muscle growth in all vertebrates. In this study, CRISPR/Cas9 was utilized to successfully target the channel catfish, Ictalurus punctatus, muscle suppressor gene MSTN. CRISPR/Cas9 induced high rates (88-100%) of mutagenesis in the target protein-encoding sites of MSTN. MSTN-edited fry had more muscle cells (p < 0.001) than controls, and the mean body weight of gene-edited fry increased by 29.7%. The nucleic acid alignment of the mutated sequences against the wild-type sequence revealed multiple insertions and deletions. These results demonstrate that CRISPR/Cas9 is a highly efficient tool for editing the channel catfish genome, and opens ways for facilitating channel catfish genetic enhancement and functional genomics. This approach may produce growth-enhanced channel catfish and increase productivity.

piRNA-mediated transposon regulation and the germ-line mutation rate in Drosophila melanogaster males.

PubMed

Simmons, Michael J; Peterson, Mark P; Thorp, Michael W; Buschette, Jared T; DiPrima, Stephanie N; Harter, Christine L; Skolnick, Matthew J

2015-03-01

Transposons, especially retrotransposons, are abundant in the genome of Drosophila melanogaster. These mobile elements are regulated by small RNAs that interact with the Piwi family of proteins-the piwi-interacting or piRNAs. The Piwi proteins are encoded by the genes argonaute3 (ago3), aubergine (aub), and piwi. Heterochromatin Protein 1 (HP1), a chromatin-organizing protein encoded by the Suppressor of variegation 205 [Su(var)205] gene, also plays a role in this regulation. To assess the mutational impact of weakening the system for transposon regulation, we measured the frequency of recessive X-linked lethal mutations occurring in the germ lines of males from stocks that were heterozygous for mutant alleles of the ago3, aub, piwi, or Su(var)205 genes. These mutant alleles are expected to deplete the wild-type proteins encoded by these genes by as much as 50%. The mutant alleles of piwi and Su(var)205 significantly increased the X-linked lethal mutation frequency, whereas the mutant alleles of ago3 did not. An increased mutation frequency was also observed in males from one of two mutant aub stocks, but this increase may not have been due to the aub mutant. The increased mutation frequency caused by depleting Piwi or HP1suggests that chromatin-organizing proteins play important roles in minimizing the germ-line mutation rate, possibly by stabilizing the structure of the heterochromatin in which many transposons are situated. Copyright © 2015 Elsevier B.V. All rights reserved.

Reduced expression of fumarate hydratase in clear cell renal cancer mediates HIF-2α accumulation and promotes migration and invasion.

PubMed

Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen

2011-01-01

Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.

Prostaglandin E2 regulates B cell proliferation through a candidate tumor suppressor, Ptger4.

PubMed

Murn, Jernej; Alibert, Olivier; Wu, Ning; Tendil, Simon; Gidrol, Xavier

2008-12-22

B cell receptor (BCR) signaling contributes to the pathogenesis of B cell malignancies, and most B cell lymphomas depend on BCR signals for survival. Identification of genes that restrain BCR-mediated proliferation is therefore an important goal toward improving the therapy of B cell lymphoma. Here, we identify Ptger4 as a negative feedback regulator of proliferation in response to BCR signals and show that its encoded EP4 receptor is a principal molecule conveying the growth-suppressive effect of prostaglandin E2 (PGE2). Stable knockdown of Ptger4 in B cell lymphoma markedly accelerated tumor spread in mice, whereas Ptger4 overexpression yielded significant protection. Mechanistically, we show that the intrinsic activity of Ptger4 and PGE2-EP4 signaling target a similar set of activating genes, and find Ptger4 to be significantly down-regulated in human B cell lymphoma. We postulate that Ptger4 functions in B cells as a candidate tumor suppressor whose activity is regulated by PGE2 in the microenvironment. These findings suggest that targeting EP4 receptor for prostaglandin may present a novel strategy for treatment of B cell malignancies.

Prostaglandin E2 regulates B cell proliferation through a candidate tumor suppressor, Ptger4

PubMed Central

Murn, Jernej; Alibert, Olivier; Wu, Ning; Tendil, Simon; Gidrol, Xavier

2008-01-01

B cell receptor (BCR) signaling contributes to the pathogenesis of B cell malignancies, and most B cell lymphomas depend on BCR signals for survival. Identification of genes that restrain BCR-mediated proliferation is therefore an important goal toward improving the therapy of B cell lymphoma. Here, we identify Ptger4 as a negative feedback regulator of proliferation in response to BCR signals and show that its encoded EP4 receptor is a principal molecule conveying the growth-suppressive effect of prostaglandin E2 (PGE2). Stable knockdown of Ptger4 in B cell lymphoma markedly accelerated tumor spread in mice, whereas Ptger4 overexpression yielded significant protection. Mechanistically, we show that the intrinsic activity of Ptger4 and PGE2–EP4 signaling target a similar set of activating genes, and find Ptger4 to be significantly down-regulated in human B cell lymphoma. We postulate that Ptger4 functions in B cells as a candidate tumor suppressor whose activity is regulated by PGE2 in the microenvironment. These findings suggest that targeting EP4 receptor for prostaglandin may present a novel strategy for treatment of B cell malignancies. PMID:19075289

The Potential for Tumor Suppressor Gene Therapy in Head and Neck Cancer

PubMed Central

Birkeland, Andrew C.; Ludwig, Megan L.; Spector, Matthew E.; Brenner, J. Chad

2016-01-01

Head and neck squamous cell carcinoma remains a highly morbid and fatal disease. Importantly, genomic sequencing of head and neck cancers has identified frequent mutations in tumor suppressor genes. While targeted therapeutics increasingly are being investigated in head and neck cancer, the majority of these agents are against overactive/overexpressed oncogenes. Therapy to restore lost tumor suppressor gene function remains a key and under-addressed niche in trials for head and neck cancer. Recent advances in gene editing have captured the interest of both the scientific community and the public. As our technology for gene editing and gene expression modulation improves, addressing lost tumor suppressor gene function in head and neck cancers is becoming a reality. This review will summarize new techniques, challenges to implementation, future directions, and ethical ramifications of gene therapy in head and neck cancer. PMID:26896601

Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

PubMed

Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

2011-12-01

Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor-suppressor genes.

PubMed

Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

2015-10-01

Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs and our experimental data from clinical samples, we discovered broad peaks for trimethylation of histone H3 at lysine 4 (H3K4me3; wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity, which together lead to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Genes with broad H3K4me3 peaks conserved across normal cells may represent pan-cancer tumor suppressors, such as TP53 and PTEN, whereas genes with cell type-specific broad H3K4me3 peaks may represent cell identity genes and cell type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 peaks in cancers is associated with repression of tumor suppressors. Thus, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of new tumor suppressors.

Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

PubMed

Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

1996-05-16

A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

Molecular Genetic Study of Human Esophageal Carcinoma

DTIC Science & Technology

1991-07-16

chromosome 13q (Friend, et al. 1986; Lee, et al. 1987). The biochemical functions of the tumor suppressor gene products are not clearly elucidated...et al. 1990). In contrast to the dominant oncogenes, two genetic lesions are required for the manifestation of tumor suppressor gene , one each to...multiple genetic mutations. Oncogenes and tumor suppressor genes are frequently involved in the pathogenesis of human cancers. The transformation

A Network of Genes Antagonistic to the LIN-35 Retinoblastoma Protein of Caenorhabditis elegans

PubMed Central

Polley, Stanley R. G.; Fay, David S.

2012-01-01

The Caenorhabditis elegans pRb ortholog, LIN-35, functions in a wide range of cellular and developmental processes. This includes a role of LIN-35 in nutrient utilization by the intestine, which it carries out redundantly with SLR-2, a zinc-finger protein. This and other redundant functions of LIN-35 were identified in genetic screens for mutations that display synthetic phenotypes in conjunction with loss of lin-35. To explore the intestinal role of LIN-35, we conducted a genome-wide RNA-interference-feeding screen for suppressors of lin-35; slr-2 early larval arrest. Of the 26 suppressors identified, 17 fall into three functional classes: (1) ribosome biogenesis genes, (2) mitochondrial prohibitins, and (3) chromatin regulators. Further characterization indicates that different categories of suppressors act through distinct molecular mechanisms. We also tested lin-35; slr-2 suppressors, as well as suppressors of the synthetic multivulval phenotype, to determine the spectrum of lin-35-synthetic phenotypes that could be suppressed following inhibition of these genes. We identified 19 genes, most of which are evolutionarily conserved, that can suppress multiple unrelated lin-35-synthetic phenotypes. Our study reveals a network of genes broadly antagonistic to LIN-35 as well as genes specific to the role of LIN-35 in intestinal and vulval development. Suppressors of multiple lin-35 phenotypes may be candidate targets for anticancer therapies. Moreover, screening for suppressors of phenotypically distinct synthetic interactions, which share a common altered gene, may prove to be a novel and effective approach for identifying genes whose activities are most directly relevant to the core functions of the shared gene. PMID:22542970

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

PubMed Central

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

2011-01-01

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

Overexpression of Nrp/b (nuclear restrict protein in brain) suppresses the malignant phenotype in the C6/ST1 glioma cell line.

PubMed

Degaki, Theri Leica; Demasi, Marcos Angelo Almeida; Sogayar, Mari Cleide

2009-11-01

Upon searching for glucocorticoid-regulated cDNA sequences associated with the transformed to normal phenotypic reversion of C6/ST1 rat glioma cells, we identified Nrp/b (nuclear restrict protein in brain) as a novel rat gene. Here we report on the identification and functional characterization of the complete sequence encoding the rat NRP/B protein. The cloned cDNA presented a 1767 nucleotides open-reading frame encoding a 589 amino acids residues sequence containing a BTB/POZ (broad complex Tramtrack bric-a-brac/Pox virus and zinc finger) domain in its N-terminal region and kelch motifs in its C-terminal region. Sequence analysis indicates that the rat Nrp/b displays a high level of identity with the equivalent gene orthologs from other organisms. Among rat tissues, Nrp/b expression is more pronounced in brain tissue. We show that overexpression of the Nrp/b cDNA in C6/ST1 cells suppresses anchorage independence in vitro and tumorigenicity in vivo, altering their malignant nature towards a more benign phenotype. Therefore, Nrp/b may be postulated as a novel tumor suppressor gene, with possible relevance for glioblastoma therapy.

Parturition failure in mice lacking Mamld1

PubMed Central

Miyado, Mami; Miyado, Kenji; Katsumi, Momori; Saito, Kazuki; Nakamura, Akihiro; Shihara, Daizou; Ogata, Tsutomu; Fukami, Maki

2015-01-01

In mice, the onset of parturition is triggered by a rapid decline in circulating progesterone. Progesterone withdrawal occurs as a result of functional luteolysis, which is characterized by an increase in the enzymatic activity of 20α-hydroxysteroid dehydrogenase (20α-HSD) in the corpus luteum and is mediated by the prostaglandin F2α (PGF2α) signaling. Here, we report that the genetic knockout (KO) of Mamld1, which encodes a putative non-DNA-binding regulator of testicular steroidogenesis, caused defective functional luteolysis and subsequent parturition failure and neonatal deaths. Progesterone receptor inhibition induced the onset of parturition in pregnant KO mice, and MAMLD1 regulated the expression of Akr1c18, the gene encoding 20α-HSD, in cultured cells. Ovaries of KO mice at late gestation were morphologically unremarkable; however, Akr1c18 expression was reduced and expression of its suppressor Stat5b was markedly increased. Several other genes including Prlr, Cyp19a1, Oxtr, and Lgals3 were also dysregulated in the KO ovaries, whereas PGF2α signaling genes remained unaffected. These results highlight the role of MAMLD1 in labour initiation. MAMLD1 likely participates in functional luteolysis by regulating Stat5b and other genes, independent of the PGF2α signaling pathway. PMID:26435405

The VPH1 gene encodes a 95-kDa integral membrane polypeptide required for in vivo assembly and activity of the yeast vacuolar H(+)-ATPase.

PubMed

Manolson, M F; Proteau, D; Preston, R A; Stenbit, A; Roberts, B T; Hoyt, M A; Preuss, D; Mulholland, J; Botstein, D; Jones, E W

1992-07-15

Yeast vacuolar acidification-defective (vph) mutants were identified using the pH-sensitive fluorescence of 6-carboxyfluorescein diacetate (Preston, R. A., Murphy, R. F., and Jones, E. W. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 7027-7031). Vacuoles purified from yeast bearing the vph1-1 mutation had no detectable bafilomycin-sensitive ATPase activity or ATP-dependent proton pumping. The peripherally bound nucleotide-binding subunits of the vacuolar H(+)-ATPase (60 and 69 kDa) were no longer associated with vacuolar membranes yet were present in wild type levels in yeast whole cell extracts. The VPH1 gene was cloned by complementation of the vph1-1 mutation and independently cloned by screening a lambda gt11 expression library with antibodies directed against a 95-kDa vacuolar integral membrane protein. Deletion disruption of the VPH1 gene revealed that the VPH1 gene is not essential for viability but is required for vacuolar H(+)-ATPase assembly and vacuolar acidification. VPH1 encodes a predicted polypeptide of 840 amino acid residues (molecular mass 95.6 kDa) and contains six putative membrane-spanning regions. Cell fractionation and immunodetection demonstrate that Vph1p is a vacuolar integral membrane protein that co-purifies with vacuolar H(+)-ATPase activity. Multiple sequence alignments show extensive homology over the entire lengths of the following four polypeptides: Vph1p, the 116-kDa polypeptide of the rat clathrin-coated vesicles/synaptic vesicle proton pump, the predicted polypeptide encoded by the yeast gene STV1 (Similar To VPH1, identified as an open reading frame next to the BUB2 gene), and the TJ6 mouse immune suppressor factor.

Genetic analysis of the role of amyloplasts in shoot gravisensing

NASA Astrophysics Data System (ADS)

Tasaka, M.; Morita, M.

Plant can change the growth direction after sensing the gravity orientation This response calls gravitropism and the initial step is the gravisensing We have isolated many Arabidopsis mutants shoot gravitropism sgr with reduced or no gravitropic response in inflorescence stems The analysis of sgr1 and sgr7 revealed that endoderm cells in the inflorescence stems were gravisensing sites zig zigzag sgr4 and sgr3 showed no or reduced gravitropism in shoot respectively and their amyloplasts thought to be statoliths did not sedimented to the orientation of gravity in the endoderm cells ZIG encoded a SNARE AtVTI11 and SGR3 encoded other SNARE AtVAM3 These two SNAREs made a complex in the shoot endoderm cells suggesting that the vesicle transport from trans-Golgi network TGN to prevacuolar compartment PVC and or vacuole was involved in the amyloplasts localization and movement The analysis to visualize amyloplasts and vacuolar membrane in living endoderm cells supported that the vacuole function was important for the amyloplasts movement Recently we have isolated many suppressor mutants of zig One of them named zig suppressor zip 1 had a point mutation in the gene encoded other SNARE of AtVTI12 This protein is a homologous to ZIG AtVTI11 and these two proteins have partially redundant functions Although wild type At VTI 12 could not rescued zig mutated AtVTI12 protein ZIP1 could almost completely play the part of ZIG In zigzip1 amyloplasts in endoderm cells sedimented normally and the shoots showed normal gravitropic response The other

Identification of a maize chlorotic dwarf virus silencing suppressor protein

USDA-ARS?s Scientific Manuscript database

Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

AZU-1: A Candidate Breast Tumor Suppressor and Biomarker for Tumor Progression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Huei-Mei; Schmeichel, Karen L; Mian, I. Saira

2000-02-04

To identify genes misregulated in the final stages of breast carcinogenesis, we performed differential display to compare the gene expression patterns of the human tumorigenic mammary epithelial cells, HMT-3522-T4-2, with those of their immediate premalignant progenitors, HMT-3522-S2. We identified a novel gene, called anti-zuai-1 (AZU-1), that was abundantly expressed in non- and premalignant cells and tissues but was appreciably reduced in breast tumor cell types and in primary tumors. The AZU-1 gene encodes an acidic 571-amino-acid protein containing at least two structurally distinct domains with potential protein-binding functions: an N-terminal serine and proline-rich domain with a predicted immunoglobulin-like fold andmore » a C-terminal coiled-coil domain. In HMT-3522 cells, the bulk of AZU-1 protein resided in a detergent-extractable cytoplasmic pool and was present at much lower levels in tumorigenic T4-2 cells than in their nonmalignant counterparts. Reversion of the tumorigenic phenotype of T4-2 cells, by means described previously, was accompanied by the up-regulation of AZU-1. In addition, reexpression of AZU-1 in T4-2 cells, using viral vectors, was sufficient to reduce their malignant phenotype substantially, both in culture and in vivo. These results indicate that AZU-1 is a candidate breast tumor suppressor that may exert its effects by promoting correct tissue morphogenesis.« less

Role of chromosome 3p12-p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis.

PubMed

Martinez, A; Fullwood, P; Kondo, K; Kishida, T; Yao, M; Maher, E R; Latif, F

2000-06-01

Chromosome 3p deletions and loss of heterozygosity (LOH) for 3p markers are features of clear cell renal cell carcinoma but are rare in non-clear cell renal cell carcinoma. The VHL tumour suppressor gene, which maps to 3p25, is a major gatekeeper gene for clear cell renal cell carcinoma and is inactivated in most sporadic cases of this disease. However, it has been suggested that inactivation of other 3p tumour suppressor genes might be crucial for clear cell renal cell carcinoma tumorigenesis, with inactivation (VHL negative) and without inactivation (VHL positive) of the VHL tumour suppressor gene. This study set out to investigate the role of non-VHL tumour suppressor genes in VHL negative and VHL positive clear cell renal cell carcinoma. Eighty two clear cell renal cell carcinomas of known VHL inactivation status were analysed for LOH at polymorphic loci within the candidate crucial regions for chromosome 3p tumour suppressor genes (3p25, LCTSGR1 at 3p21.3, LCTSGR2 at 3p12 and at 3p14.2). Chromosome 3p12-p21 LOH was frequent both in VHL negative and VHL positive clear cell renal cell carcinoma. However, although the frequency of 3p25 LOH in VHL negative clear cell renal cell carcinoma was similar to that at 3p12-p21, VHL positive tumours demonstrated significantly less LOH at 3p25 than at 3p12-p21. Although there was evidence of LOH for clear cell renal cell carcinoma tumour suppressor genes at 3p21, 3p14.2, and 3p12, both in VHL negative and VHL positive tumours, the major clear cell renal cell carcinoma LOH region mapped to 3p21.3, close to the lung cancer tumour suppressor gene region 1 (LCTSGR1). There was no association between tumour VHL status and tumour grade and stage. These findings further indicate that VHL inactivation is not sufficient to initiate clear cell renal cell carcinoma and that loss of a gatekeeper 3p21 tumour suppressor gene is a crucial event for renal cell carcinoma development in both VHL negative and VHL positive clear cell renal cell carcinoma.

Constitutional 3p26.3 terminal microdeletion in an adolescent with neuroblastoma.

PubMed

Pezzolo, Annalisa; Sementa, Angela Rita; Lerone, Margherita; Morini, Martina; Ognibene, Marzia; Defferrari, Raffaella; Mazzocco, Katia; Conte, Massimo; Gigliotti, Anna Rita; Garaventa, Alberto; Pistoia, Vito; Varesio, Luigi

2017-05-04

Neuroblastoma (NB) is a common and often lethal cancer of early childhood that accounts for 10% of pediatric cancer mortality. Incidence peaks in infancy and then rapidly declines, with less than 5% of cases diagnosed in children and adolescents ≥ 10 y. There is increasing evidence that NB has unique biology and an chronic disease course in older children and adolescents, but ultimately dismal survival. We describe a rare constitutional 3p26.3 terminal microdeletion which occurred in an adolescent with NB, with apparently normal phenotype without neurocognitive defects. We evaluated the association of expression of genes involved in the microdeletion with NB patient outcomes using R2 platform. We screened NB patient's tumor cells for CHL1 protein expression using immunofluorescence. Constitutional and tumor DNA were tested by array-comparative genomic hybridization and single nucleotide-polymorphism-array analyses. Peripheral blood mononuclear cells from the patient showed a 2.54 Mb sub-microscopic constitutional terminal 3p deletion that extended to band p26.3. The microdeletion 3p disrupted the CNTN4 gene and the neighboring CNTN6 and CHL1 genes were hemizygously deleted, each of these genes encode neuronal cell adhesion molecules. Low expression of CNTN6 and CNTN4 genes did not stratify NB patients, whereas low CHL1 expression characterized 417 NB patients having worse overall survival. CHL1 protein expression on tumor cells from the patient was weaker than positive control. This is the first report of a constitutional 3p26.3 deletion in a NB patient. Since larger deletions of 3p, indicative of the presence of one or more tumor suppressor genes in this region, occur frequently in neuroblastoma, our results pave the way to the identification of one putative NB suppressor genes mapping in 3p26.3.

The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.

PubMed

Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C

2007-09-18

Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.

Tumor suppressors: enhancers or suppressors of regeneration?

PubMed Central

Pomerantz, Jason H.; Blau, Helen M.

2013-01-01

Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544

Prognostic significance of downregulated expression of the candidate tumour suppressor gene SASH1 in colon cancer.

PubMed

Rimkus, C; Martini, M; Friederichs, J; Rosenberg, R; Doll, D; Siewert, J R; Holzmann, B; Janssen, K P

2006-11-20

The gene SASH1 (SAM- and SH3-domain containing 1) has originally been identified as a candidate tumour suppressor gene in breast cancer. SASH1 is a member of the SH3-domain containing expressed in lymphocytes (SLY1) gene family that encodes signal adapter proteins composed of several protein-protein interaction domains. The other members of this family are expressed mainly in haematopoietic cells, whereas SASH1 shows ubiquitous expression. We have used quantitative real-time PCR to investigate the expression of SASH1 in tissue samples from 113 patients with colon carcinoma, and compared the expression with 15 normal colon tissue samples. Moreover, nine benign adenomas and 10 liver metastases were analysed. Expression levels of SASH1 were strongly and significantly reduced in colon cancer of UICC stage II, III, and IV, as well as in liver metastases. Moreover, SASH1 was also found to be downregulated on protein levels by immunoblot analysis. However, SASH1 expression was not significantly deregulated in precancerous adenomas and in earlier stage lesions (UICC I). Overall, 48 out of 113 primary colon tumours showed SASH1 expression that was at least 10-fold lower than the levels found in normal colon tissue. Downregulation of SASH1 expression was correlated with the formation of metachronous distant metastasis, and multivariate analysis identified SASH1 downregulation as an independent negative prognostic parameter for patient survival. This study demonstrates for the first time that expression of a member of the SLY1-gene family has prognostic significance in human cancer.

Prognostic significance of downregulated expression of the candidate tumour suppressor gene SASH1 in colon cancer

PubMed Central

Rimkus, C; Martini, M; Friederichs, J; Rosenberg, R; Doll, D; Siewert, J R; Holzmann, B; Janssen, K P

2006-01-01

The gene SASH1 (SAM- and SH3-domain containing 1) has originally been identified as a candidate tumour suppressor gene in breast cancer. SASH1 is a member of the SH3-domain containing expressed in lymphocytes (SLY1) gene family that encodes signal adapter proteins composed of several protein–protein interaction domains. The other members of this family are expressed mainly in haematopoietic cells, whereas SASH1 shows ubiquitous expression. We have used quantitative real-time PCR to investigate the expression of SASH1 in tissue samples from 113 patients with colon carcinoma, and compared the expression with 15 normal colon tissue samples. Moreover, nine benign adenomas and 10 liver metastases were analysed. Expression levels of SASH1 were strongly and significantly reduced in colon cancer of UICC stage II, III, and IV, as well as in liver metastases. Moreover, SASH1 was also found to be downregulated on protein levels by immunoblot analysis. However, SASH1 expression was not significantly deregulated in precancerous adenomas and in earlier stage lesions (UICC I). Overall, 48 out of 113 primary colon tumours showed SASH1 expression that was at least 10-fold lower than the levels found in normal colon tissue. Downregulation of SASH1 expression was correlated with the formation of metachronous distant metastasis, and multivariate analysis identified SASH1 downregulation as an independent negative prognostic parameter for patient survival. This study demonstrates for the first time that expression of a member of the SLY1-gene family has prognostic significance in human cancer. PMID:17088907

Chromatin Immunoprecipitation and DNA Sequencing Identified a LIMS1/ILK Pathway Regulated by LMO1 in Neuroblastoma.

PubMed

Saeki, Norihisa; Saito, Akira; Sugaya, Yuki; Amemiya, Mitsuhiro; Ono, Hiroe; Komatsuzaki, Rie; Yanagihara, Kazuyoshi; Sasaki, Hiroki

2018-01-01

Overall survival for the high-risk group of neuroblastoma (NB) remains at 40-50%. An integrative genomics study revealed that LIM domain only 1 (LMO1) encoding a transcriptional regulator to be an NB-susceptibility gene with a tumor-promoting activity, that needs to be revealed. We conducted chromatin immunoprecipitation and DNA sequencing analyses and cell proliferation assays on two NB cell lines. We identified three genes regulated by LMO1 in the cells, LIM and senescent cell antigen-like domains 1 (LIMS1), Ras suppressor protein 1 (RSU1) and relaxin 2 (RLN2). LIMS1 and RSU1 encode proteins functioning with integrin-linked kinase (ILK), and inhibition of LIMS1, ILK or RLN2 by shRNA reduced cell proliferation of the NB cells, which was also suppressed with an ILK inhibiting compound Cpd 22. The downstream of LMO1-regulatory cascade includes a tumor-promoting LIMS1/ILK pathway, which has a potential to be a novel therapeutic target. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

PubMed

Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

2017-06-01

Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

NASA Astrophysics Data System (ADS)

Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

2004-11-01

Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

A spontaneous tRNA suppressor of a mutation in the Chlamydomonas reinhardtii nuclear MCD1 gene required for stability of the chloroplast petD mRNA

PubMed Central

Murakami, Shinya; Kuehnle, Katrin; Stern, David B.

2005-01-01

Numerous nuclear gene products are required for the correct expression of organellar genes. One such gene in the green alga Chlamydomonas reinhardtii is MCD1, whose product is required for stability of the chloroplast-encoded petD mRNA. In mcd1 mutants, which are non-photosynthetic, petD mRNA is degraded by a 5′–3′ exonuclease activity, resulting in a failure to synthesize its product, subunit IV of the cytochrome b 6/f complex. Here, we report the sequence of the wild-type MCD1 gene, which encodes a large and novel putative protein. Analysis of three mutant alleles showed that two harbored large deletions, but that one allele, mcd1-2, had a single base change resulting in a nonsense codon near the N-terminus. This same mutant allele can be suppressed by a second-site mutation in the nuclear MCD2 gene, whereas mcd2-1 cannot suppress the deletion in mcd1-1 (Esposito,D. Higgs,D.C. Drager,R.G. Stern, D.B. and Girard-Bascou,J. (2001) Curr. Genet., 39, 40–48). We report the cloning of mcd2-1, and show that the mutation lies in a tRNASer(CGA), which has been modified to translate the nonsense codon in mcd1-2. We discuss how the existence of a large tRNASer gene family may permit this suppression without pleiotropic consequences. PMID:15947135

Altered expression of miRNAs and methylation of their promoters are correlated in neuroblastoma.

PubMed

Maugeri, Marco; Barbagallo, Davide; Barbagallo, Cristina; Banelli, Barbara; Di Mauro, Stefania; Purrello, Francesco; Magro, Gaetano; Ragusa, Marco; Di Pietro, Cinzia; Romani, Massimo; Purrello, Michele

2016-12-13

Neuroblastoma is the most common human extracranial solid tumor during infancy. Involvement of several miRNAs in its pathogenesis has been ascertained. Interestingly, most of their encoding genes reside in hypermethylated genomic regions: thus, their tumor suppressor function is normally disallowed in these tumors. To date, the therapeutic role of the demethylating agent 5'-Aza-2 deoxycytidine (5'-AZA) and its effects on miRNAome modulation in neuroblastoma have not been satisfactorily explored. Starting from a high-throughput expression profiling of 754 miRNAs and based on a proper selection, we focused on miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p as candidate miRNAs for our analysis. They resulted downregulated in four neuroblastoma cell lines with respect to normal adrenal gland. MiRNAs 29a-3p and 34b-3p also resulted downregulated in vivo in a murine neuroblastoma progression model. Unlike the amount of methylation of their encoding gene promoters, all these miRNAs were significantly overexpressed following treatment with 5'-AZA. Transfection with candidate miRNAs mimics significantly decreased neuroblastoma cells proliferation rate. A lower expression of miR-181c was significantly associated to a worse overall survival in a public dataset of 498 neuroblastoma samples (http://r2.amc.nl). Our data strongly suggest that CDK6, DNMT3A, DNMT3B are targets of miR-29a-3p, while CCNE2 and E2F3 are targets of miR-34b-3p. Based on all these data, we propose that miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p are disallowed tumor suppressor genes in neuroblastoma and suggest them as new therapeutic targets in neuroblastoma.

Altered expression of miRNAs and methylation of their promoters are correlated in neuroblastoma

PubMed Central

Di Mauro, Stefania; Purrello, Francesco; Magro, Gaetano; Ragusa, Marco; Di Pietro, Cinzia; Romani, Massimo; Purrello, Michele

2016-01-01

Neuroblastoma is the most common human extracranial solid tumor during infancy. Involvement of several miRNAs in its pathogenesis has been ascertained. Interestingly, most of their encoding genes reside in hypermethylated genomic regions: thus, their tumor suppressor function is normally disallowed in these tumors. To date, the therapeutic role of the demethylating agent 5′-Aza-2 deoxycytidine (5'-AZA) and its effects on miRNAome modulation in neuroblastoma have not been satisfactorily explored. Starting from a high-throughput expression profiling of 754 miRNAs and based on a proper selection, we focused on miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p as candidate miRNAs for our analysis. They resulted downregulated in four neuroblastoma cell lines with respect to normal adrenal gland. MiRNAs 29a-3p and 34b-3p also resulted downregulated in vivo in a murine neuroblastoma progression model. Unlike the amount of methylation of their encoding gene promoters, all these miRNAs were significantly overexpressed following treatment with 5′-AZA. Transfection with candidate miRNAs mimics significantly decreased neuroblastoma cells proliferation rate. A lower expression of miR-181c was significantly associated to a worse overall survival in a public dataset of 498 neuroblastoma samples (http://r2.amc.nl). Our data strongly suggest that CDK6, DNMT3A, DNMT3B are targets of miR-29a-3p, while CCNE2 and E2F3 are targets of miR-34b-3p. Based on all these data, we propose that miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p are disallowed tumor suppressor genes in neuroblastoma and suggest them as new therapeutic targets in neuroblastoma. PMID:27829219

Mutations in eukaryotic release factors 1 and 3 act as general nonsense suppressors in Drosophila.

PubMed Central

Chao, Anna T; Dierick, Herman A; Addy, Tracie M; Bejsovec, Amy

2003-01-01

In a screen for suppressors of the Drosophila wingless(PE4) nonsense allele, we isolated mutations in the two components that form eukaryotic release factor. eRF1 and eRF3 comprise the translation termination complex that recognizes stop codons and catalyzes the release of nascent polypeptide chains from ribosomes. Mutations disrupting the Drosophila eRF1 and eRF3 show a strong maternal-effect nonsense suppression due to readthrough of stop codons and are zygotically lethal during larval stages. We tested nonsense mutations in wg and in other embryonically acting genes and found that different stop codons can be suppressed but only a subset of nonsense alleles are subject to suppression. We suspect that the context of the stop codon is significant: nonsense alleles sensitive to suppression by eRF1 and eRF3 encode stop codons that are immediately followed by a cytidine. Such suppressible alleles appear to be intrinsically weak, with a low level of readthrough that is enhanced when translation termination is disrupted. Thus the eRF1 and eRF3 mutations provide a tool for identifying nonsense alleles that are leaky. Our findings have important implications for assigning null mutant phenotypes and for selecting appropriate alleles to use in suppressor screens. PMID:14573473

BAX Inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives.

PubMed

Hückelhoven, R

2004-05-01

BAX Inhibitor-1 (BI-1) was originally described as testis enhanced gene transcript in mammals. Functional screening in yeast for human proteins that can inhibit the cell death provoking function of BAX, a proapoptotic Bcl-2 family member, led to functional characterisation and renaming of BI-1. The identification of functional homologues of BI-1 in plants and yeast widened the understanding of BI-1 function as an ancient suppressor of programmed cell death. BI-1 is one of the few cell death suppressors conserved in animals and plants. Computer predictions and experimental data together suggest that BI-1 is a membrane spanning protein with 6 to 7 transmembrane domains and a cytoplasmic C-terminus sticking in the endoplasmatic reticulum and nuclear envelope. Proteins similar to BI-1 are present in other eukaryotes, bacteria, and even viruses encode BI-1 like proteins. BI-1 is involved in development, response to biotic and abiotic stress and probably represents an indispensable cell protectant. BI-1 appears to suppress cell death induced by mitochondrial dysfunction, reactive oxygen species or elevated cytosolic Ca(2+) levels. This review focuses on the present understanding about BI-1 and suggests potential directions for further analyses of this increasingly noticed protein.

Genome-Wide Profile of Pleural Mesothelioma versus Parietal and Visceral Pleura: The Emerging Gene Portrait of the Mesothelioma Phenotype

PubMed Central

Røe, Oluf Dimitri; Anderssen, Endre; Helge, Eli; Pettersen, Caroline Hild; Olsen, Karina Standahl; Sandeck, Helmut; Haaverstad, Rune; Lundgren, Steinar; Larsson, Erik

2009-01-01

Background Malignant pleural mesothelioma is considered an almost incurable tumour with increasing incidence worldwide. It usually develops in the parietal pleura, from mesothelial lining or submesothelial cells, subsequently invading the visceral pleura. Chromosomal and genomic aberrations of mesothelioma are diverse and heterogenous. Genome-wide profiling of mesothelioma versus parietal and visceral normal pleural tissue could thus reveal novel genes and pathways explaining its aggressive phenotype. Methodology and Principal Findings Well-characterised tissue from five mesothelioma patients and normal parietal and visceral pleural samples from six non-cancer patients were profiled by Affymetrix oligoarray of 38 500 genes. The lists of differentially expressed genes tested for overrepresentation in KEGG PATHWAYS (Kyoto Encyclopedia of Genes and Genomes) and GO (gene ontology) terms revealed large differences of expression between visceral and parietal pleura, and both tissues differed from mesothelioma. Cell growth and intrinsic resistance in tumour versus parietal pleura was reflected in highly overexpressed cell cycle, mitosis, replication, DNA repair and anti-apoptosis genes. Several genes of the “salvage pathway” that recycle nucleobases were overexpressed, among them TYMS, encoding thymidylate synthase, the main target of the antifolate drug pemetrexed that is active in mesothelioma. Circadian rhythm genes were expressed in favour of tumour growth. The local invasive, non-metastatic phenotype of mesothelioma, could partly be due to overexpression of the known metastasis suppressors NME1 and NME2. Down-regulation of several tumour suppressor genes could contribute to mesothelioma progression. Genes involved in cell communication were down-regulated, indicating that mesothelioma may shield itself from the immune system. Similarly, in non-cancer parietal versus visceral pleura signal transduction, soluble transporter and adhesion genes were down-regulated. This could represent a genetical platform of the parietal pleura propensity to develop mesothelioma. Conclusions Genome-wide microarray approach using complex human tissue samples revealed novel expression patterns, reflecting some important features of mesothelioma biology that should be further explored. PMID:19662092

Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

PubMed Central

Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

1999-01-01

Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

Resetting the epigenetic balance of Polycomb and COMPASS function at enhancers for cancer therapy.

PubMed

Wang, Lu; Zhao, Zibo; Ozark, Patrick A; Fantini, Damiano; Marshall, Stacy A; Rendleman, Emily J; Cozzolino, Kira A; Louis, Nundia; He, Xingyao; Morgan, Marc A; Takahashi, Yoh-Hei; Collings, Clayton K; Smith, Edwin R; Ntziachristos, Panagiotis; Savas, Jeffrey N; Zou, Lihua; Hashizume, Rintaro; Meeks, Joshua J; Shilatifard, Ali

2018-06-01

The lysine methyltransferase KMT2C (also known as MLL3), a subunit of the COMPASS complex, implements monomethylation of Lys4 on histone H3 (H3K4) at gene enhancers. KMT2C (hereafter referred to as MLL3) frequently incurs point mutations across a range of human tumor types, but precisely how these lesions alter MLL3 function and contribute to oncogenesis is unclear. Here we report a cancer mutational hotspot in MLL3 within the region encoding its plant homeodomain (PHD) repeats and demonstrate that this domain mediates association of MLL3 with the histone H2A deubiquitinase and tumor suppressor BAP1. Cancer-associated mutations in the sequence encoding the MLL3 PHD repeats disrupt the interaction between MLL3 and BAP1 and correlate with poor patient survival. Cancer cells that had PHD-associated MLL3 mutations or lacked BAP1 showed reduced recruitment of MLL3 and the H3K27 demethylase KDM6A (also known as UTX) to gene enhancers. As a result, inhibition of the H3K27 methyltransferase activity of the Polycomb repressive complex 2 (PRC2) in tumor cells harboring BAP1 or MLL3 mutations restored normal gene expression patterns and impaired cell proliferation in vivo. This study provides mechanistic insight into the oncogenic effects of PHD-associated mutations in MLL3 and suggests that restoration of a balanced state of Polycomb-COMPASS activity may have therapeutic efficacy in tumors that bear mutations in the genes encoding these epigenetic factors.

Analysis of Autoregulation at the Level of Pre-mRNA Splicing of the Suppressor-of-White-Apricot Gene in Drosophila

PubMed Central

Zachar, Z.; Chou, T. B.; Kramer, J.; Mims, I. P.; Bingham, P. M.

1994-01-01

The Drosophila suppressor-of-white-apricot [su(w(a))] protein regulates/modulates at least two somatic RNA processing events. It is a potent regulator of its own expression. We report here new studies of this autoregulatory circuit. Among other things, our studies show the following. First, new evidence that su(w(a)) expression is autoregulated at the level of pre-mRNA splicing is reported. su(w(a)) protein represses accumulation of the fully spliced su(w(a)) mRNA encoding it and promotes accumulation of high levels of incompletely spliced su(w(a)) pre-mRNA. Second, the fully spliced su(w(a)) mRNA is sufficient for all known su(w(a)) genetic functions indicating that it encodes the sole su(w(a)) protein. Third, the incompletely spliced su(w(a)) pre-mRNAs resulting from autoregulation are not translated (probably as a result of nuclear retention) and apparently represent nonfunctional by-products. Fourth, the special circumstances of su(w(a)) expression during oogenesis allows maternal deposition exclusively of fully spliced su(w(a)) mRNA. Fifth, su(w(a)) protein immunolocalizes to nuclei consistent with its being a direct regulator of pre-mRNA processing. We discuss the implications of our results for mechanisms of splicing regulation and for developmental control of su(w(a)) expression. PMID:8056305

Genetic and Biochemical Analysis of High Iron Toxicity in Yeast

PubMed Central

Lin, Huilan; Li, Liangtao; Jia, Xuan; Ward, Diane McVey; Kaplan, Jerry

2011-01-01

Iron storage in yeast requires the activity of the vacuolar iron transporter Ccc1. Yeast with an intact CCC1 are resistant to iron toxicity, but deletion of CCC1 renders yeast susceptible to iron toxicity. We used genetic and biochemical analysis to identify suppressors of high iron toxicity in Δccc1 cells to probe the mechanism of high iron toxicity. All genes identified as suppressors of high iron toxicity in aerobically grown Δccc1 cells encode organelle iron transporters including mitochondrial iron transporters MRS3, MRS4, and RIM2. Overexpression of MRS3 suppressed high iron toxicity by decreasing cytosolic iron through mitochondrial iron accumulation. Under anaerobic conditions, Δccc1 cells were still sensitive to high iron toxicity, but overexpression of MRS3 did not suppress iron toxicity and did not result in mitochondrial iron accumulation. We conclude that Mrs3/Mrs4 can sequester iron within mitochondria under aerobic conditions but not anaerobic conditions. We show that iron toxicity in Δccc1 cells occurred under both aerobic and anaerobic conditions. Microarray analysis showed no evidence of oxidative damage under anaerobic conditions, suggesting that iron toxicity may not be solely due to oxidative damage. Deletion of TSA1, which encodes a peroxiredoxin, exacerbated iron toxicity in Δccc1 cells under both aerobic and anaerobic conditions, suggesting a unique role for Tsa1 in iron toxicity. PMID:21115478

PLAU inferred from a correlation network is critical for suppressor function of regulatory T cells

PubMed Central

He, Feng; Chen, Hairong; Probst-Kepper, Michael; Geffers, Robert; Eifes, Serge; del Sol, Antonio; Schughart, Klaus; Zeng, An-Ping; Balling, Rudi

2012-01-01

Human FOXP3+CD25+CD4+ regulatory T cells (Tregs) are essential to the maintenance of immune homeostasis. Several genes are known to be important for murine Tregs, but for human Tregs the genes and underlying molecular networks controlling the suppressor function still largely remain unclear. Here, we describe a strategy to identify the key genes directly from an undirected correlation network which we reconstruct from a very high time-resolution (HTR) transcriptome during the activation of human Tregs/CD4+ T-effector cells. We show that a predicted top-ranked new key gene PLAU (the plasminogen activator urokinase) is important for the suppressor function of both human and murine Tregs. Further analysis unveils that PLAU is particularly important for memory Tregs and that PLAU mediates Treg suppressor function via STAT5 and ERK signaling pathways. Our study demonstrates the potential for identifying novel key genes for complex dynamic biological processes using a network strategy based on HTR data, and reveals a critical role for PLAU in Treg suppressor function. PMID:23169000

SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

PubMed

Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

2015-04-23

With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

The Nucleocapsid Protein of Coronaviruses Acts as a Viral Suppressor of RNA Silencing in Mammalian Cells.

PubMed

Cui, Lei; Wang, Haiying; Ji, Yanxi; Yang, Jie; Xu, Shan; Huang, Xingyu; Wang, Zidao; Qin, Lei; Tien, Po; Zhou, Xi; Guo, Deyin; Chen, Yu

2015-09-01

RNA interference (RNAi) is a process of eukaryotic posttranscriptional gene silencing that functions in antiviral immunity in plants, nematodes, and insects. However, recent studies provided strong supports that RNAi also plays a role in antiviral mechanism in mammalian cells. To combat RNAi-mediated antiviral responses, many viruses encode viral suppressors of RNA silencing (VSR) to facilitate their replication. VSRs have been widely studied for plant and insect viruses, but only a few have been defined for mammalian viruses currently. We identified a novel VSR from coronaviruses, a group of medically important mammalian viruses including Severe acute respiratory syndrome coronavirus (SARS-CoV), and showed that the nucleocapsid protein (N protein) of coronaviruses suppresses RNAi triggered by either short hairpin RNAs or small interfering RNAs in mammalian cells. Mouse hepatitis virus (MHV) is closely related to SARS-CoV in the family Coronaviridae and was used as a coronavirus replication model. The replication of MHV increased when the N proteins were expressed in trans, while knockdown of Dicer1 or Ago2 transcripts facilitated the MHV replication in mammalian cells. These results support the hypothesis that RNAi is a part of the antiviral immunity responses in mammalian cells. IMPORTANCE RNAi has been well known to play important antiviral roles from plants to invertebrates. However, recent studies provided strong supports that RNAi is also involved in antiviral response in mammalian cells. An important indication for RNAi-mediated antiviral activity in mammals is the fact that a number of mammalian viruses encode potent suppressors of RNA silencing. Our results demonstrate that coronavirus N protein could function as a VSR through its double-stranded RNA binding activity. Mutational analysis of N protein allowed us to find out the critical residues for the VSR activity. Using the MHV-A59 as the coronavirus replication model, we showed that ectopic expression of SARS-CoV N protein could promote MHV replication in RNAi-active cells but not in RNAi-depleted cells. These results indicate that coronaviruses encode a VSR that functions in the replication cycle and provide further evidence to support that RNAi-mediated antiviral response exists in mammalian cells.

Claudin-1 has tumor suppressive activity and is a direct target of RUNX3 in gastric epithelial cells.

PubMed

Chang, Ti Ling; Ito, Kosei; Ko, Tun Kiat; Liu, Qiang; Salto-Tellez, Manuel; Yeoh, Khay Guan; Fukamachi, Hiroshi; Ito, Yoshiaki

2010-01-01

The transcription factor RUNX3 is a gastric tumor suppressor. Tumorigenic Runx3(-/-) gastric epithelial cells attach weakly to each other, compared with nontumorigenic Runx3(+/+) cells. We aimed to identify RUNX3 target genes that promote cell-cell contact to improve our understanding of RUNX3's role in suppressing gastric carcinogenesis. We compared gene expression profiles of Runx3(+/+) and Runx3(-/-) cells and observed down-regulation of genes associated with cell-cell adhesion in Runx3(-/-) cells. Reporter, mobility shift, and chromatin immunoprecipitation assays were used to examine the regulation of these genes by RUNX3. Tumorigenesis assays and immunohistological analyses of human gastric tumors were performed to confirm the role of the candidate genes in gastric tumor development. Mobility shift and chromatin immunoprecipitation assays revealed that the promoter activity of the gene that encodes the tight junction protein claudin-1 was up-regulated via the binding of RUNX3 to the RUNX consensus sites. The tumorigenicity of gastric epithelial cells from Runx3(-/-) mice was significantly reduced by restoration of claudin-1 expression, whereas knockdown of claudin-1 increased the tumorigenicity of human gastric cancer cells. Concomitant expression of RUNX3 and claudin-1 was observed in human normal gastric epithelium and cancers. The tight junction protein claudin-1 has gastric tumor suppressive activity and is a direct transcriptional target of RUNX3. Claudin-1 is down-regulated during the epithelial-mesenchymal transition; RUNX3 might therefore act as a tumor suppressor to antagonize the epithelial-mesenchymal transition. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

Role of chromosome 3p12–p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis

PubMed Central

Martinez, A; Fullwood, P; Kondo, K; Kishida, T; Yao, M; Maher, E R; Latif, F

2000-01-01

Aims—Chromosome 3p deletions and loss of heterozygosity (LOH) for 3p markers are features of clear cell renal cell carcinoma but are rare in non-clear cell renal cell carcinoma. The VHL tumour suppressor gene, which maps to 3p25, is a major gatekeeper gene for clear cell renal cell carcinoma and is inactivated in most sporadic cases of this disease. However, it has been suggested that inactivation of other 3p tumour suppressor genes might be crucial for clear cell renal cell carcinoma tumorigenesis, with inactivation (VHL negative) and without inactivation (VHL positive) of the VHL tumour suppressor gene. This study set out to investigate the role of non-VHL tumour suppressor genes in VHL negative and VHL positive clear cell renal cell carcinoma. Methods—Eighty two clear cell renal cell carcinomas of known VHL inactivation status were analysed for LOH at polymorphic loci within the candidate crucial regions for chromosome 3p tumour suppressor genes (3p25, LCTSGR1 at 3p21.3, LCTSGR2 at 3p12 and at 3p14.2). Results—Chromosome 3p12–p21 LOH was frequent both in VHL negative and VHL positive clear cell renal cell carcinoma. However, although the frequency of 3p25 LOH in VHL negative clear cell renal cell carcinoma was similar to that at 3p12–p21, VHL positive tumours demonstrated significantly less LOH at 3p25 than at 3p12–p21. Although there was evidence of LOH for clear cell renal cell carcinoma tumour suppressor genes at 3p21, 3p14.2, and 3p12, both in VHL negative and VHL positive tumours, the major clear cell renal cell carcinoma LOH region mapped to 3p21.3, close to the lung cancer tumour suppressor gene region 1 (LCTSGR1). There was no association between tumour VHL status and tumour grade and stage. Conclusions—These findings further indicate that VHL inactivation is not sufficient to initiate clear cell renal cell carcinoma and that loss of a gatekeeper 3p21 tumour suppressor gene is a crucial event for renal cell carcinoma development in both VHL negative and VHL positive clear cell renal cell carcinoma. PMID:10897333

Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

PubMed Central

Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

2015-01-01

In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

p120Ras-GAP binds the DLC1 Rho-GAP tumor suppressor protein and inhibits its RhoA GTPase and growth-suppressing activities.

PubMed

Yang, X-Y; Guan, M; Vigil, D; Der, C J; Lowy, D R; Popescu, N C

2009-03-19

DLC1 (deleted in liver cancer 1), which encodes a Rho GTPase-activating protein (Rho-GAP), is a potent tumor suppressor gene that is frequently inactivated in several human cancers. DLC1 is a multidomain protein that has been shown previously to bind members of the tensin gene family. Here we show that p120Ras-GAP (Ras-GAP; also known as RASA1) interacts and extensively colocalizes with DLC1 in focal adhesions. The binding was mapped to the SH3 domain located in the N terminus of Ras-GAP and to the Rho-GAP catalytic domain located in the C terminus of the DLC1. In vitro analyses with purified proteins determined that the isolated Ras-GAP SH3 domain inhibits DLC1 Rho-GAP activity, suggesting that Ras-GAP is a negative regulator of DLC1 Rho-GAP activity. Consistent with this possibility, we found that ectopic overexpression of Ras-GAP in a Ras-GAP-insensitive tumor line impaired the growth-suppressing activity of DLC1 and increased RhoA activity in vivo. Our observations expand the complexity of proteins that regulate DLC1 function and define a novel mechanism of the cross talk between Ras and Rho GTPases.1R01CA129610

MDS1, a dosage suppressor of an mck1 mutant, encodes a putative yeast homolog of glycogen synthase kinase 3.

PubMed Central

Puziss, J W; Hardy, T A; Johnson, R B; Roach, P J; Hieter, P

1994-01-01

The yeast gene MCK1 encodes a serine/threonine protein kinase that is thought to function in regulating kinetochore activity and entry into meiosis. Disruption of MCK1 confers a cold-sensitive phenotype, a temperature-sensitive phenotype, and sensitivity to the microtubule-destabilizing drug benomyl and leads to loss of chromosomes during growth on benomyl. A dosage suppression selection was used to identify genes that, when present at high copy number, could suppress the cold-sensitive phenotype of mck1::HIS3 mutant cells. Several unique classes of clones were identified, and one of these, designated MDS1, has been characterized in some detail. Nucleotide sequence data reveal that MDS1 encodes a serine/threonine protein kinase that is highly homologous to the shaggy/zw3 kinase in Drosophila melanogaster and its functional homolog, glycogen synthase kinase 3, in rats. The presence of MDS1 in high copy number rescues both the cold-sensitive and the temperature-sensitive phenotypes, but not the benomyl-sensitive phenotype, associated with the disruption of MCK1. Analysis of strains harboring an mds1 null mutation demonstrates that MDS1 is not essential during normal vegetative growth but appears to be required for meiosis. Finally, in vitro experiments indicate that the proteins encoded by both MCK1 and MDS1 possess protein kinase activity with substrate specificity similar to that of mammalian glycogen synthase kinase 3. Images PMID:8264650

RNA splicing factors as oncoproteins and tumor suppressors

PubMed Central

Dvinge, Heidi; Kim, Eunhee; Abdel-Wahab, Omar; Bradley, Robert K.

2016-01-01

Preface The recent genomic characterization of cancers has revealed recurrent somatic point mutations and copy number changes affecting genes encoding RNA splicing factors. Initial studies of these ‘spliceosomal mutations’ suggest that the proteins bearing these mutations exhibit altered splice site and/or exon recognition preferences relative to their wild-type counterparts, resulting in cancer-specific mis-splicing. Such changes in the splicing machinery may create novel vulnerabilities in cancer cells that can be therapeutically exploited using compounds that can influence the splicing process. Further studies to dissect the biochemical, genomic, and biological effects of spliceosomal mutations are critical for the development of cancer therapies targeted to these mutations. PMID:27282250

Growth inhibition of Saccharomyces cerevisiae by the immunosuppressant leflunomide is due to the inhibition of uracil uptake via Fur4p.

PubMed

Fujimura, H

1998-10-01

The immunosuppressant leflunomide inhibits cytokine-stimulated proliferation of lymphoid cells in vitro and also inhibits the growth of the eukaryotic microorganism Saccharomyces cerevisiae. To elucidate the molecular mechanism of action of the drug, two yeast genes which suppress the anti-proliferative effect when present in multiple copies were cloned and designated MLF1 and MLF2 for multicopy suppressor of leflunomide sensitivity. DNA sequencing analysis revealed that the MLF1 gene is identical to the FUR4 gene, which encodes a uracil permease and functions to import uracil efficiently. The MLF2 was found to be identical to the URA3 gene. Excess exogenous uracil also overcomes the anti-proliferative effect of leflunomide on yeast cells. Uracil prototrophy also conferred resistance to leflunomide. Uracil uptake was inhibited by leflunomide. Thus, the growth inhibition by leflunomide seen in a S. cerevisiae ura3 auxotroph is due to the inhibition of the entry of exogenous uracil via the Fur4 uracil permease.

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

PubMed Central

Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

2016-01-01

Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs, and our experimental data from clinical samples, we discovered broad H3K4me3 (wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity together leading to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Broad H3K4me3 conserved across normal cells may represent pan-cancer tumor suppressors, such as P53 and PTEN, whereas cell-type-specific broad H3K4me3 may indicate cell-identity genes and cell-type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 in cancers is associated with repression of tumor suppressors. Together, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of novel tumor suppressors. PMID:26301496

Fine mapping of the NRC-1 tumor suppressor locus within chromosome 3p12.

PubMed

Zhang, Kun; Lott, Steven T; Jin, Li; Killary, Ann McNeill

2007-08-31

Identification of tumor suppressor genes based on physical mapping exercises has proven to be a challenging endeavor, due to the difficulty of narrowing regions of loss of heterozygosity (LOH), infrequency of homozygous deletions, and the labor-intensive characterization process for screening candidates in a given genomic interval. We previously defined a chromosome 3p12 tumor suppressor locus NRC-1 (Nonpapillary Renal Carcinoma-1) by functional complementation experiments in which renal cell carcinoma microcell hybrids containing introduced normal chromosome 3p fragments were either suppressed or unsuppressed for tumorigenicity following injection into athymic nude mice. We now present the fine-scale physical mapping of NRC-1 using a QPCR-based approach for measuring copy number at sequence tagged sites (STS) which allowed a sub-exon mapping resolution. Using STS-QPCR and a novel statistical algorithm, the NRC-1 locus was narrowed to 4.615-Mb with the distal boundary mapping within a 38-Kb interval between exon 3 and exon 4 of the DUTT1/Robo1 gene, currently the only candidate tumor suppressor gene in the interval. Further mutational screening and gene expression analyses indicate that DUTT1/ROBO1 is not involved in the tumor suppressor activity of NRC-1, suggesting that there are at least two important tumor suppressor genes within the chromosome 3p12 interval.

RET is a potential tumor suppressor gene in colorectal cancer

PubMed Central

Luo, Yanxin; Tsuchiya, Karen D.; Park, Dong Il; Fausel, Rebecca; Kanngurn, Samornmas; Welcsh, Piri; Dzieciatkowski, Slavomir; Wang, Jianping; Grady, William M.

2012-01-01

Cancer arises as the consequence of mutations and epigenetic alterations that activate oncogenes and inactivate tumor suppressor genes. Through a genome-wide screen for methylated genes in colon neoplasms, we identified aberrantly methylated RET in colorectal cancer. RET, a transmembrane receptor tyrosine kinase and a receptor for the GDNF-family ligands, was one of the first oncogenes to be identified and has been shown to be an oncogene in thyroid cancer and pheochromocytoma. However, unexpectedly, we found RET is methylated in 27% of colon adenomas and in 63% of colorectal cancers, and now provide evidence that RET has tumor suppressor activity in colon cancer. The aberrant methylation of RET correlates with decreased RET expression, whereas the restoration of RET in colorectal cancer cell lines results in apoptosis. Furthermore, in support of a tumor suppressor function of RET, mutant RET has also been found in primary colorectal cancer. We now show that these mutations inactivate RET, which is consistent with RET being a tumor suppressor gene in the colon. These findings suggest that the aberrant methylation of RET and the mutational inactivation of RET promote colorectal cancer formation and that RET can serve as a tumor suppressor gene in the colon. Moreover, the increased frequency of methylated RET in colon cancers compared to adenomas suggests RET inactivation is involved in the progression of colon adenomas to cancer. PMID:22751117

Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.

PubMed

Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H

2009-09-01

Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.

Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

PubMed

Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

2015-08-18

p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

Characterization and subcellular localization of an RNA silencing suppressor encoded by Rice stripe tenuivirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong Ruyi; Wu Jianxiang; Zhou Yijun

2009-04-25

Rice stripe virus (RSV) is a single-stranded (ss) RNA virus belonging to the genus Tenuivirus. RSV is present in many East Asian countries and causes severe diseases in rice fields, especially in China. In this study, we analyzed six proteins encoded by the virus for their abilities to suppress RNA silencing in plant using a green fluorescent protein (GFP)-based transient expression assay. Our results indicate that NS3 encoded by RSV RNA3, but not other five RSV encoded proteins, can strongly suppress local GFP silencing in agroinfiltrated Nicotiana benthamiana leaves. NS3 can reverse the GFP silencing, it can also prevent longmore » distance spread of silencing signals which have been reported to be necessary for inducing systemic silencing in host plants. The NS3 protein can significantly reduce the levels of small interfering RNAs (siRNAs) in silencing cells, and was found to bind 21-nucleotide ss-siRNA, siRNA duplex and long ssRNA but not long double-stranded (ds)-RNA. Both N and C terminal of the NS3 protein are critical for silencing suppression, and mutation of the putative nuclear localization signal decreases its local silencing suppression efficiency and blocks its systemic silencing suppression. The NS3-GFP fusion protein and NS3 were shown to accumulate predominantly in nuclei of onion, tobacco and rice cells through transient expression assay or immunocytochemistry and electron microscopy. In addition, transgenic rice and tobacco plants expressing the NS3 did not show any apparent alteration in plant growth and morphology, although NS3 was proven to be a pathogenicity determinant in the PVX heterogenous system. Taken together, our results demonstrate that RSV NS3 is a suppressor of RNA silencing in planta, possibly through sequestering siRNA molecules generated in cells that are undergoing gene silencing.« less

ROOT HAIR DEFECTIVE SIX-LIKE4 (RSL4) promotes root hair elongation by transcriptionally regulating the expression of genes required for cell growth.

PubMed

Vijayakumar, Priya; Datta, Sourav; Dolan, Liam

2016-12-01

ROOT HAIR DEFECTIVE SIX-LIKE4 (RSL4) is necessary and sufficient for root hair elongation in Arabidopsis thaliana. Root hair length is determined by the duration for which RSL4 protein is present in the developing root hair. The aim of this research was to identify genes regulated by RSL4 that affect root hair growth. To identify genes regulated by RSL4, we identified genes whose expression was elevated by induction of RSL4 activity in the presence of an inhibitor of translation. Thirty-four genes were identified as putative targets of RSL transcriptional regulation, and the results suggest that the activities of SUPPRESSOR OF ACTIN (SAC1), EXOCSYT SUBUNIT 70A1 (EXO70A1), PEROXIDASE7 (PRX7) and CALCIUM-DEPENDENT PROTEIN KINASE11 (CPK11) are required for root hair elongation. These data indicate that RSL4 controls cell growth by controlling the expression of genes encoding proteins involved in cell signalling, cell wall modification and secretion. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Loss of function of Saccharomyces cerevisiae kinesin-related CIN8 and KIP1 is suppressed by KAR3 motor domain mutations.

PubMed

Hoyt, M A; He, L; Totis, L; Saunders, W S

1993-09-01

The kinesin-related products of the CIN8 and KIP1 genes of Saccharomyces cerevisiae redundantly perform an essential function in mitosis. The action of either gene-product is required for an outwardly directed force that acts upon the spindle poles. We have selected mutations that suppress the temperature-sensitivity of a cin8-temperature-sensitive kip1-delta strain. The extragenic suppressors analyzed were all found to be alleles of the KAR3 gene. KAR3 encodes a distinct kinesin-related protein whose action antagonizes Cin8p/Kip1p function. All seven alleles analyzed were altered within the region of KAR3 that encodes the putative force-generating (or "motor") domain. These mutations also suppressed the inviability associated with the cin8-delta kip1-delta genotype, a property not shared by a deletion of KAR3. Other properties of the suppressing alleles revealed that they were not null for function. Six of the seven were unaffected for the essential karyogamy and meiosis properties of KAR3 and the seventh was dominant for the suppressing trait. Our findings suggest that despite an antagonistic relationship between Cin8p/Kip1p and Kar3p, aspects of their mitotic roles may be similar.

The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening[OPEN

PubMed Central

Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui

2017-01-01

The plant hormone ethylene is critical for ripening in climacteric fruits, including apple (Malus domestica). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1, an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2, encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3, encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1. This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1. Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. PMID:28550149

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening.

PubMed

Li, Tong; Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui; Wang, Aide

2017-06-01

The plant hormone ethylene is critical for ripening in climacteric fruits, including apple ( Malus domestica ). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1 , an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2 , encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3 , encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1 This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1 Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. © 2017 American Society of Plant Biologists. All rights reserved.

Molecular diversity of Rice grassy stunt virus in Vietnam.

PubMed

Ta, Hoang-Anh; Nguyen, Doan-Phuong; Causse, Sandrine; Nguyen, Thanh-Duc; Ngo, Vinh-Vien; Hébrard, Eugénie

2013-04-01

Rice grassy stunt virus (RGSV, Tenuivirus) recently emerged on rice in Vietnam, causing high yield losses during 2006-2009. The genetic diversity of RGSV is poorly documented. In this study, the two genes encoded by each ambisense segment RNA3 and RNA5 of RGSV isolates from six provinces of South Vietnam were sequenced. P3 and Pc3 (RNA3) have unknown function, P5 (RNA5) encodes the putative silencing suppressor, and Pc5 (RNA5) encodes the nucleocapsid protein (N). The sequences of 17 Vietnamese isolates were compared with reference isolates from North and South Philippines. The average nucleotide diversity among the isolates was low. We confirmed a higher variability of RNA3 than RNA5 and Pc3 than P3. No relationships between the genetic diversity and the geographic distribution of RGSV isolates could be ascertained, likely because of the long-distance migration of the insect vector. This data will contribute to a better understanding on the RGSV epidemiology in South Vietnam, a prerequisite for further management of the disease and rice breeding for resistance.

Loss of neurofibromatosis type 1 (NF1) gene expression in pheochromocytomas from patients without NF1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geist, R.T.; Gutmann, D.H.; Moley, J.F.

The neurofibromatosis type 1 (NF1) gene encodes a tumor suppressor protein, termed neurofibromin. Loss of NF1 gene expression has been reported in Schwann cell tumors (neurofibrosarcomas) from patients with NF1 as well as malignant and neuroblastomas from patients without NF1. Previously, we demonstrated the lack of neurofibromin expression in six pheochromocytomas from patients with NF1, suggesting that neurofibromin loss is associated with the progression to neoplasia in pheochromocytomas in these patients. The lack of NF1 gene expression in NF1 patient pheochromocytomas supports the notion that neurofibromin might be an essential regulator of cell growth in these cells. To determine whethermore » NF1 gene expression is similarly altered in pheochromocytomas from patients without NF1, twenty pheochromocytomas were examined for the presence of NF1 RNA by reverse-transcribed PCR (RT-PCR). Lack of NF1 gene expression was documented in four of these twenty tumors (20%) which corresponds to previously reported numbers for malignant melanomas and neuroblastomas in non-NF1 patients. Of these twenty pheochromocytomas, one of four sporadic tumors, one of ten tumors from patients with MEN2A, one of four tumors from patients with MEN2B, and one of two tumors from patients with von Hippel-Lindau syndrome demonstrated loss of NF1 gene expression. In all cases, the quality and quantity of tumor RNA was determined by RT-PCR amplification using primers which amplify cyclophilin RNA. We previously demonstrated that these tumors do not harbor activating mutations of the N-ras, K-ras or H-ras proto-oncogenes. These results suggest that loss of NF1 gene expression is frequently associated with the progression to neoplasia in tumors derived from adrenal medullary tissue in patients without clinical manifestations of neurofibromatosis and supports the notion that neurofibromin is a tumor suppressor gene product involved in the pathogenesis of a wide variety of tumor types.« less

Tumor Suppressor Genes: A Key to the Cancer Puzzle?

ERIC Educational Resources Information Center

Oppenheimer, Steven B.

1991-01-01

Author describes developments in understanding of tumor suppressor genes or antioncogenes that he feels is most important breakthrough in solving cancer problem. Describes 1969 starting work of Harris with mouse fibroblast genes and later work of Knudson with retinoblastoma cells. Provides evidence that deletion of chromosome that results in the…

A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

PubMed

Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

2008-11-01

Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

Unique pathway of expression of an opal suppressor phosphoserine tRNA.

PubMed Central

Lee, B J; de la Peña, P; Tobian, J A; Zasloff, M; Hatfield, D

1987-01-01

An opal suppressor phosphoserine tRNA gene is present in single copy in the genomes of higher vertebrates. We have shown that the product of this gene functions as a suppressor in an in vitro assay, and we have proposed that it may donate a modified amino acid directly to protein in response to specific UGA codons. In this report, we show through in vitro and in vivo studies that the human and Xenopus opal suppressor phosphoserine tRNAs are synthesized by a pathway that is, to the best of our knowledge, unlike that of any known eukaryotic tRNA. The primary transcript of this gene does not contain a 5'-leader sequence; and, therefore, transcription of this suppressor is initiated at the first nucleotide within the coding sequence. The 5'-terminal triphosphate, present on the primary transcript, remains intact through 3'-terminal maturation and through subsequent transport of the tRNA to the cytoplasm. The unique biosynthetic pathway of this opal suppressor may underlie its distinctive role in eukaryotic cells. Images PMID:3114749

Transcription factor FOXA2-centered transcriptional regulation network in non-small cell lung cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jang, Sang-Min; An, Joo-Hee; Kim, Chul-Hong

2015-08-07

Lung cancer is the leading cause of cancer-mediated death. Although various therapeutic approaches are used for lung cancer treatment, these mainly target the tumor suppressor p53 transcription factor, which is involved in apoptosis and cell cycle arrest. However, p53-targeted therapies have limited application in lung cancer, since p53 is found to be mutated in more than half of lung cancers. In this study, we propose tumor suppressor FOXA2 as an alternative target protein for therapies against lung cancer and reveal a possible FOXA2-centered transcriptional regulation network by identifying new target genes and binding partners of FOXA2 by using various screeningmore » techniques. The genes encoding Glu/Asp-rich carboxy-terminal domain 2 (CITED2), nuclear receptor subfamily 0, group B, member 2 (NR0B2), cell adhesion molecule 1 (CADM1) and BCL2-associated X protein (BAX) were identified as putative target genes of FOXA2. Additionally, the proteins including highly similar to heat shock protein HSP 90-beta (HSP90A), heat shock 70 kDa protein 1A variant (HSPA1A), histone deacetylase 1 (HDAC1) and HDAC3 were identified as novel interacting partners of FOXA2. Moreover, we showed that FOXA2-dependent promoter activation of BAX and p21 genes is significantly reduced via physical interactions between the identified binding partners and FOXA2. These results provide opportunities to understand the FOXA2-centered transcriptional regulation network and novel therapeutic targets to modulate this network in p53-deficient lung cancer. - Highlights: • Identification of new target genes of FOXA2. • Identifications of novel interaction proteins of FOXA2. • Construction of FOXA2-centered transcriptional regulatory network in non-small cell lung cancer.« less

Assessment of the Requirements for Magnesium Transporters in Bacillus subtilis

PubMed Central

Wakeman, Catherine A.; Goodson, Jonathan R.; Zacharia, Vineetha M.

2014-01-01

Magnesium is the most abundant divalent metal in cells and is required for many structural and enzymatic functions. For bacteria, at least three families of proteins function as magnesium transporters. In recent years, it has been shown that a subset of these transport proteins is regulated by magnesium-responsive genetic control elements. In this study, we investigated the cellular requirements for magnesium homeostasis in the model microorganism Bacillus subtilis. Putative magnesium transporter genes were mutationally disrupted, singly and in combination, in order to assess their general importance. Mutation of only one of these genes resulted in strong dependency on supplemental extracellular magnesium. Notably, this transporter gene, mgtE, is known to be under magnesium-responsive genetic regulatory control. This suggests that the identification of magnesium-responsive genetic mechanisms may generally denote primary transport proteins for bacteria. To investigate whether B. subtilis encodes yet additional classes of transport mechanisms, suppressor strains that permitted the growth of a transporter-defective mutant were identified. Several of these strains were sequenced to determine the genetic basis of the suppressor phenotypes. None of these mutations occurred in transport protein homologues; instead, they affected housekeeping functions, such as signal recognition particle components and ATP synthase machinery. From these aggregate data, we speculate that the mgtE protein provides the primary route of magnesium import in B. subtilis and that the other putative transport proteins are likely to be utilized for more-specialized growth conditions. PMID:24415722

Gelsolin functions as a metastasis suppressor in B16-BL6 mouse melanoma cells and requirement of the carboxyl-terminus for its effect.

PubMed

Fujita, H; Okada, F; Hamada , J; Hosokawa, M; Moriuchi, T; Koya, R C; Kuzumaki, N

2001-09-01

Gelsolin, an actin-binding protein, is implicated as a critical regulator in cell motility. In addition, we have reported that cellular levels of gelsolin are decreased in various tumor cells, and overexpression of gelsolin by gene transfer suppresses tumorigenicity. We sought to assess the effects of gelsolin overexpression on metastasis and to determine the importance of a carboxyl-terminus that confers Ca(2+) dependency on gelsolin for effects of its overexpression. Expression vectors with cDNA encoding either full-length wild-type or His321 mutant form, isolated from a flat revertant of Ras-transformed cells and a carboxyl-terminal truncate, C-del of gelsolin, were transfected into a highly metastatic murine melanoma cell line, B16-BL6. Expression of introduced cDNA in transfectants was confirmed using Western blotting, 2-dimensional gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR). We characterized phenotypes of transfectants, such as growth rate, colony formation in soft agar, cell motility and metastasis formation in vivo. Transfectants expressing the wild-type, His321 mutant and C-del gelsolin exhibited reduced growth ability in soft agar. Although expression of integrin beta1 or alpha4 on the cell surface of transfectants was not changed, wild-type and His321 mutant gelsolin, except for C-del gelsolin, exhibited retardation of cell spreading, reduced chemotatic migration to fibronectin and suppressed lung colonization in spontaneous metastasis assay. Gelsolin may function as a metastasis suppressor as well as a tumor suppressor gene. The carboxyl-terminus of gelsolin is important for retardation of cell spreading, reduced chemotasis and metastasis suppression. Copyright 2001 Wiley-Liss, Inc.

Chromatin reorganisation in Epstein-Barr virus-infected cells and its role in cancer development.

PubMed

West, Michelle J

2017-10-01

The oncogenic Epstein-Barr virus (EBV) growth transforms B cells and drives lymphoma and carcinoma development. The virus encodes four key transcription factors (EBNA2, EBNA3A, EBNA3B and EBNA3C) that hijack host cell factors to bind gene control elements and reprogramme infected B cells. These viral factors predominantly target long-range enhancers to alter the expression of host cell genes that control B cell growth and survival and facilitate virus persistence. Enhancer and super-enhancer binding by these EBNAs results in large-scale reorganisation of three-dimensional enhancer-promoter architecture to drive the overexpression of oncogenes, the silencing of tumour suppressors and the modulation of transcription, cell-cycle progression, migration and adhesion. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

[Immunomorphologic features of epithelial-stromal relationships at hyperplasia and endometrial carcinoma].

PubMed

Bantysh, B B; Paukov, v S; Kogan, E A

2012-01-01

The results of a immunomorphologic comprehensive study of epithelial-stromal relationships in the uterus hyperplasia and endometrial cancer suggest that the suppressor gene of cancer (PTEN) plays a key role in the process of neoplastic transformation of endometrial hyperplasia and adenocarcinoma development. For the first time the existence of two highly differentiated endometrial adenocarcinoma immunophenotype were detected The first one is a PTEN-negative endometrial aedenocarcinoma, characterized by an almost complete inhibition of tumor suppressor gene PTEN in the epithelium of the glands and stromal cell of the tumor The second type is a PTEN-positive endometrial adenocarcinoma, in which epithelial and stromal tumor suppressor gene PTEN activity has retained Based on these results we have formulated a hypothesis about the different types of endometrial hyperplasia morphogenesis and its possible transfer to cervical cancer associated with features of tumor suppressor gene PTEN.

soc-2 encodes a leucine-rich repeat protein implicated in fibroblast growth factor receptor signaling

PubMed Central

Selfors, Laura M.; Schutzman, Jennifer L.; Borland, Christina Z.; Stern, Michael J.

1998-01-01

Activation of fibroblast growth factor (FGF) receptors elicits diverse cellular responses including growth, mitogenesis, migration, and differentiation. The intracellular signaling pathways that mediate these important processes are not well understood. In Caenorhabditis elegans, suppressors of clr-1 identify genes, termed soc genes, that potentially mediate or activate signaling through the EGL-15 FGF receptor. We demonstrate that three soc genes, soc-1, soc-2, and sem-5, suppress the activity of an activated form of the EGL-15 FGF receptor, consistent with the soc genes functioning downstream of EGL-15. We show that soc-2 encodes a protein composed almost entirely of leucine-rich repeats, a domain implicated in protein–protein interactions. We identified a putative human homolog, SHOC-2, which is 54% identical to SOC-2. We find that shoc-2 maps to 10q25, shoc-2 mRNA is expressed in all tissues assayed, and SHOC-2 protein is cytoplasmically localized. Within the leucine-rich repeats of both SOC-2 and SHOC-2 are two YXNX motifs that are potential tyrosine-phosphorylated docking sites for the SEM-5/GRB2 Src homology 2 domain. However, phosphorylation of these residues is not required for SOC-2 function in vivo, and SHOC-2 is not observed to be tyrosine phosphorylated in response to FGF stimulation. We conclude that this genetic system has allowed for the identification of a conserved gene implicated in mediating FGF receptor signaling in C. elegans. PMID:9618511

A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors.

PubMed

Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena

2015-03-21

Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

Inference of cancer-specific gene regulatory networks using soft computing rules.

PubMed

Wang, Xiaosheng; Gotoh, Osamu

2010-03-24

Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

Specificity of a Rust Resistance Suppressor on 7DL in the Spring Wheat Cultivar Canthatch.

PubMed

Talajoor, Mina; Jin, Yue; Wan, Anmin; Chen, Xianming; Bhavani, Sridhar; Tabe, Linda; Lagudah, Evans; Huang, Li

2015-04-01

The spring wheat 'Canthatch' has been shown to suppress stem rust resistance genes in the background due to the presence of a suppressor gene located on the long arm of chromosome 7D. However, it is unclear whether the suppressor also suppresses resistance genes against leaf rust and stripe rust. In this study, we investigated the specificity of the resistance suppression. To determine whether the suppression is genome origin specific, chromosome location specific, or rust species or race specific, we introduced 11 known rust resistance genes into the Canthatch background, including resistance to leaf, stripe, or stem rusts, originating from A, B, or D genomes and located on different chromosome homologous groups. F1 plants of each cross were tested with the corresponding rust race, and the infection types were scored and compared with the parents. Our results show that the Canthatch 7DL suppressor only suppressed stem rust resistance genes derived from either the A or B genome, and the pattern of the suppression is gene specific and independent of chromosomal location.

Genetic Characterization of the SufJ Frameshift Suppressor in SALMONELLA TYPHIMURIUM

PubMed Central

Bossi, Lionello; Kohno, Tadahiko; Roth, John R.

1983-01-01

A new suppressor of +1 frameshift mutations has been isolated in Salmonella typhimurium. This suppressor, sufJ, maps at minute 89 on the Salmonella genetic map between the argH and rpo(rif) loci, closely linked to the gene for the ochre suppressor tyrU(supM). The suppressor mutation is dominant to its wild-type allele, consistent with the suppressor phenotype being caused by an altered tRNA species. The sufJ map position coincides with that of a threonine tRNA(ACC/U) gene; the suppressor has been shown to read the related fourbase codons ACCU, ACCC, ACCA.—The ability of sufJ to correct one particular mutation depends on the presence of a hisT mutation which causes a defect in tRNA modification. This requirement is allele specific, since other frameshift mutations can be corrected by sufJ regardless of the state of the hisT locus.—Strains carrying both a sufJ and a hisT mutation are acutely sensitive to growth inhibition by uracil; the inhibition is reversed by arginine. This behavior is characteristic of strains with mutations affecting the arginine-uracil biosynthetic enzyme carbamyl phosphate synthetase. The combination of two mutations affecting tRNA structure may reduce expression of the structural gene for this enzyme (pyrA). PMID:6188650

Transcriptional Regulation by KLF6, A Novel Tumor Suppressor Gene in Prostate Cancer, Through Interaction with HATS and HDACS

DTIC Science & Technology

2006-03-01

Frequent inactivation of the tumor suppressor Kruppel like factor 6 (KLF6) in hepatocellular carcinoma . Hepatology, 40:1047-1052, 2004. Studies...p21 by the KLF6 tumor suppressor gene in mouse liver and human hepatocellular carcinoma . Invited resubmission to Oncogene, currently under re-review...prostate, including glioblastoma, and primary hepatocellular carcinoma . REFERENCES 1. Narla G, Heath KE, Reeves HL, Li D, Giono LE

VGLL3 expression is associated with a tumor suppressor phenotype in epithelial ovarian cancer.

PubMed

Gambaro, Karen; Quinn, Michael C J; Wojnarowicz, Paulina M; Arcand, Suzanna L; de Ladurantaye, Manon; Barrès, Véronique; Ripeau, Jean-Sébastien; Killary, Ann M; Davis, Elaine C; Lavoie, Josée; Provencher, Diane M; Mes-Masson, Anne-Marie; Chevrette, Mario; Tonin, Patricia N

2013-06-01

Previous studies have implicated vestigial like 3 (VGLL3), a chromosome 3p12.3 gene that encodes a putative transcription co-factor, as a candidate tumor suppressor gene (TSG) in high-grade serous ovarian carcinomas (HGSC), the most common type of epithelial ovarian cancer. A complementation analysis based on microcell-mediated chromosome transfer (MMCT) using a centric fragment of chromosome 3 (der3p12-q12.1) into the OV-90 ovarian cancer cell line haploinsufficient for 3p and lacking VGLL3 expression was performed to assess the effect on tumorigenic potential and growth characteristics. Genetic characterization of the derived MMCT hybrids revealed that only the hybrid that contained an intact VGLL3 locus exhibited alterations of tumorigenic potential in a nude mouse xenograft model and various in vitro growth characteristics. Only stable OV-90 transfectant clones expressing low levels of VGLL3 were derived. These clones exhibited an altered cytoplasmic morphology characterized by numerous single membrane bound multivesicular-bodies (MVB) that were not attributed to autophagy. Overexpression of VGLL3 in OV-90 was achieved using a lentivirus-based tetracycline inducible gene expression system, which also resulted in MVB formation in the infected cell population. Though there was no significant differences in various in vitro and in vivo growth characteristics in a comparison of VGLL3-expressing clones with empty vector transfectant controls, loss of VGLL3 expression was observed in tumors derived from mouse xenograft models. VGLL3 gene and protein expression was significantly reduced in HGSC samples (>98%, p < 0.05) relative to either normal ovarian surface epithelial cells or epithelial cells of the fallopian tube, possible tissues of origin of HGSC. Also, there appeared to be to be more cases with higher staining levels in stromal tissue component from HGSC cases that had a prolonged disease-free survival. The results taken together suggest that VGLL3 is involved in tumor suppressor pathways, a feature that is characterized by the absence of VGLL3 expression in HGSC samples. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Problems in mechanistic theoretical models for cell transformation by ionizing radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatterjee, A.; Holley, W.R.

1991-10-01

A mechanistic model based on yields of double strand breaks has been developed to determine the dose response curves for cell transformation frequencies. At its present stage the model is applicable to immortal cell lines and to various qualities (X-rays, Neon and Iron) of ionizing radiation. Presently, we have considered four types of processes which can lead to activation phenomena: (1) point mutation events on a regulatory segment of selected oncogenes, (2) inactivation of suppressor genes, through point mutation, (3) deletion of a suppressor gene by a single track, and (4) deletion of a suppressor gene by two tracks.

Aberrant DNA Methylation as a Biomarker and a Therapeutic Target of Cholangiocarcinoma.

PubMed

Nakaoka, Toshiaki; Saito, Yoshimasa; Saito, Hidetsugu

2017-05-23

Cholangiocarcinoma is an epithelial malignancy arising in the region between the intrahepatic bile ducts and the ampulla of Vater at the distal end of the common bile duct. The effect of current chemotherapy regimens against cholangiocarcinoma is limited, and the prognosis of patients with cholangiocarcinoma is poor. Aberrant DNA methylation and histone modification induce silencing of tumor suppressor genes and chromosomal instability during carcinogenesis. Studies have shown that the tumor suppressor genes and microRNAs (miRNAs) including MLH1 , p14 , p16 , death-associated protein kinase ( DAPK ), miR-370 and miR-376c are frequently methylated in cholangiocarcinoma. Silencing of these tumor suppressor genes and miRNAs plays critical roles in the initiation and progression of cholangiocarcinoma. In addition, recent studies have demonstrated that DNA methylation inhibitors induce expression of endogenous retroviruses and exert the anti-tumor effect of via an anti-viral immune response. Aberrant DNA methylation of tumor suppressor genes and miRNAs could be a powerful biomarker for the diagnosis and treatment of cholangiocarcinoma. Epigenetic therapy with DNA methylation inhibitors holds considerable promise for the treatment of cholangiocarcinoma through the reactivation of tumor suppressor genes and miRNAs as well as the induction of an anti-viral immune response.

Aberrant DNA Methylation as a Biomarker and a Therapeutic Target of Cholangiocarcinoma

PubMed Central

Nakaoka, Toshiaki; Saito, Yoshimasa; Saito, Hidetsugu

2017-01-01

Cholangiocarcinoma is an epithelial malignancy arising in the region between the intrahepatic bile ducts and the ampulla of Vater at the distal end of the common bile duct. The effect of current chemotherapy regimens against cholangiocarcinoma is limited, and the prognosis of patients with cholangiocarcinoma is poor. Aberrant DNA methylation and histone modification induce silencing of tumor suppressor genes and chromosomal instability during carcinogenesis. Studies have shown that the tumor suppressor genes and microRNAs (miRNAs) including MLH1, p14, p16, death-associated protein kinase (DAPK), miR-370 and miR-376c are frequently methylated in cholangiocarcinoma. Silencing of these tumor suppressor genes and miRNAs plays critical roles in the initiation and progression of cholangiocarcinoma. In addition, recent studies have demonstrated that DNA methylation inhibitors induce expression of endogenous retroviruses and exert the anti-tumor effect of via an anti-viral immune response. Aberrant DNA methylation of tumor suppressor genes and miRNAs could be a powerful biomarker for the diagnosis and treatment of cholangiocarcinoma. Epigenetic therapy with DNA methylation inhibitors holds considerable promise for the treatment of cholangiocarcinoma through the reactivation of tumor suppressor genes and miRNAs as well as the induction of an anti-viral immune response. PMID:28545228

Haploinsufficiency of Anx7 tumor suppressor gene and consequent genomic instability promotes tumorigenesis in the Anx7(+/-) mouse

PubMed Central

Srivastava, Meera; Montagna, Cristina; Leighton, Ximena; Glasman, Mirta; Naga, Shanmugam; Eidelman, Ofer; Ried, Thomas; Pollard, Harvey B.

2003-01-01

Annexin 7 (ANX7) acts as a tumor suppressor gene in prostate cancer, where loss of heterozygosity and reduction of ANX7 protein expression is associated with aggressive metastatic tumors. To investigate the mechanism by which this gene controls tumor development, we have developed an Anx7(+/-) knockout mouse. As hypothesized, the Anx7(+/-) mouse has a cancer-prone phenotype. The emerging tumors express low levels of Anx7 protein. Nonetheless, the wild-type Anx7 allele is detectable in laser-capture microdissection-derived tumor tissue cells. Genome array analysis of hepatocellular carcinoma tissue indicates that the Anx7(+/-) genotype is accompanied by profound reductions of expression of several other tumor suppressor genes, DNA repair genes, and apoptosis-related genes. In situ analysis by tissue imprinting from chromosomes in the primary tumor and spectral karyotyping analysis of derived cell lines identify chromosomal instability and clonal chromosomal aberrations. Furthermore, whereas 23% of the mutant mice develop spontaneous neoplasms, all mice exhibit growth anomalies, including gender-specific gigantism and organomegaly. We conclude that haploinsufficiency of Anx7 expression appears to drive disease progression to cancer because of genomic instability through a discrete signaling pathway involving other tumor suppressor genes, DNA-repair genes, and apoptosis-related genes. PMID:14608035

Two Routes to Genetic Suppression of RNA Trimethylguanosine Cap Deficiency via C-Terminal Truncation of U1 snRNP Subunit Snp1 or Overexpression of RNA Polymerase Subunit Rpo26.

PubMed

Qiu, Zhicheng R; Schwer, Beate; Shuman, Stewart

2015-04-24

The trimethylguanosine (TMG) caps of small nuclear (sn) RNAs are synthesized by the enzyme Tgs1 via sequential methyl additions to the N2 atom of the m(7)G cap. Whereas TMG caps are inessential for Saccharomyces cerevisiae vegetative growth at 25° to 37°, tgs1∆ cells that lack TMG caps fail to thrive at 18°. The cold-sensitive defect correlates with ectopic stoichiometric association of nuclear cap-binding complex (CBC) with the residual m(7)G cap of the U1 snRNA and is suppressed fully by Cbc2 mutations that weaken cap binding. Here, we show that normal growth of tgs1∆ cells at 18° is also restored by a C-terminal deletion of 77 amino acids from the Snp1 subunit of yeast U1 snRNP. These results underscore the U1 snRNP as a focal point for TMG cap function in vivo. Casting a broader net, we conducted a dosage suppressor screen for genes that allowed survival of tgs1∆ cells at 18°. We thereby recovered RPO26 (encoding a shared subunit of all three nuclear RNA polymerases) and RPO31 (encoding the largest subunit of RNA polymerase III) as moderate and weak suppressors of tgs1∆ cold sensitivity, respectively. A structure-guided mutagenesis of Rpo26, using rpo26∆ complementation and tgs1∆ suppression as activity readouts, defined Rpo26-(78-155) as a minimized functional domain. Alanine scanning identified Glu89, Glu124, Arg135, and Arg136 as essential for rpo26∆ complementation. The E124A and R135A alleles retained tgs1∆ suppressor activity, thereby establishing a separation-of-function. These results illuminate the structure activity profile of an essential RNA polymerase component. Copyright © 2015 Qiu et al.

'Overgrowth' mutants in barley and wheat: new alleles and phenotypes of the 'Green Revolution' DELLA gene.

PubMed

Chandler, Peter Michael; Harding, Carol Anne

2013-04-01

A suppressor screen using dwarf mutants of barley (Hordeum vulgare L.) led to the isolation of 'overgrowth' derivatives, which retained the original dwarfing gene but grew at a faster rate because of a new mutation. The new mutations were in the Slender1 (Sln1) gene (11/13 cases), which encodes the DELLA protein central to gibberellin (GA) signalling, showed 100% genetic linkage to Sln1 (1/13), or were in the Spindly1 (Spy1) gene (1/13), which encodes another protein involved in GA signalling. The overgrowth mutants were characterized by increased GA signalling, although the extent still depended on the background GA biosynthesis capacity, GA receptor function, and DELLA activity. A comparison between two GA responses, α-amylase production and leaf growth rate, revealed degrees of specificity for both the overgrowth allele and the GA response under consideration. Many overgrowth mutants were also isolated in a dwarf line of bread wheat (Triticum aestivum L.) and 19 new alleles were identified in the Rht-B1 gene, one of the 'Green Revolution' semi-dwarfing genes and the orthologue of Sln1. The sites of amino acid substitutions in the DELLA proteins of both species provide insight into DELLA function, and included examples where identical but independent substitutions were observed. In both species, the starting lines were too dwarfed to be directly useful in breeding programmes, but new overgrowth derivatives with semidwarf heights have now been characterized. The variation they exhibit in GA-influenced traits identifies novel alleles with perfect markers that are of potential use in breeding.

Complementation of non-tumorigenicity of HPV18-positive cervical carcinoma cells involves differential mRNA expression of cellular genes including potential tumor suppressor genes on chromosome 11q13.

PubMed

Kehrmann, Angela; Truong, Ha; Repenning, Antje; Boger, Regina; Klein-Hitpass, Ludger; Pascheberg, Ulrich; Beckmann, Alf; Opalka, Bertram; Kleine-Lowinski, Kerstin

2013-01-01

The fusion between human tumorigenic cells and normal human diploid fibroblasts results in non-tumorigenic hybrid cells, suggesting a dominant role for tumor suppressor genes in the generated hybrid cells. After long-term cultivation in vitro, tumorigenic segregants may arise. The loss of tumor suppressor genes on chromosome 11q13 has been postulated to be involved in the induction of the tumorigenic phenotype of human papillomavirus (HPV)18-positive cervical carcinoma cells and their derived tumorigenic hybrid cells after subcutaneous injection in immunocompromised mice. The aim of this study was the identification of novel cellular genes that may contribute to the suppression of the tumorigenic phenotype of non-tumorigenic hybrid cells in vivo. We used cDNA microarray technology to identify differentially expressed cellular genes in tumorigenic HPV18-positive hybrid and parental HeLa cells compared to non-tumorigenic HPV18-positive hybrid cells. We detected several as yet unknown cellular genes that play a role in cell differentiation, cell cycle progression, cell-cell communication, metastasis formation, angiogenesis, antigen presentation, and immune response. Apart from the known differentially expressed genes on 11q13 (e.g., phosphofurin acidic cluster sorting protein 1 (PACS1) and FOS ligand 1 (FOSL1 or Fra-1)), we detected novel differentially expressed cellular genes located within the tumor suppressor gene region (e.g., EGF-containing fibulin-like extracellular matrix protein 2 (EFEMP2) and leucine rich repeat containing 32 (LRRC32) (also known as glycoprotein-A repetitions predominant (GARP)) that may have potential tumor suppressor functions in this model system of non-tumorigenic and tumorigenic HeLa x fibroblast hybrid cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

PubMed

Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

2001-01-01

The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or insertions (nine of 22, 41%), a microrearrangement (one of 22, 5%), and single nucleotide substitutions (12 of 22, 56%). In addition, we analyzed the functional characteristics of seven unique mutant p16 proteins identified in this study by assessing their ability to inhibit cyclin-dependent kinase 4 activity. Six of the seven mutant proteins tested exhibited reduced function compared with wild-type p16, ranging from minor decreases of function (twofold to eightfold) in four samples to total loss of function (29- to 38-fold decrease) in two other samples. Overall, somatic mutation of the INK4a/ARF tumor suppressor locus, resulting in functionally deficient p16 and possibly p14(ARF) proteins, seems to be a prevalent event in the development of SCCHN. Mol. Carcinog. 30:26-36, 2001. Copyright 2001 Wiley-Liss, Inc.

P16INK4a MEDIATED SUPPRESSION OF TELOMERASE IN NORMAL AND MALIGNANT HUMAN BREAST CELLS

PubMed Central

Bazarov, Alexey V.; van Sluis, Marjolein; Hines, Curtis; Bassett, Ekaterina; Beliveau, Alain; Campeau, Eric; Mukhopadhyay, Rituparna; Lee, Won Jae; Melodyev, Sonya; Zaslavsky, Yuri; Lee, Leonard; Rodier, Francis; Chicas, Agustin; Lowe, Scott W.; Benhattar, Jean; Ren, Bing; Campisi, Judith; Yaswen, Paul

2010-01-01

Summary The cyclin-dependent kinase inhibitor p16INK4a (CDKN2A) is an important tumor-suppressor gene frequently inactivated in human tumors. p16 suppresses the development of cancer by triggering an irreversible arrest of cell proliferation termed cellular senescence. Here, we describe another anti-oncogenic function of p16 in addition to its ability to halt cell cycle progression. We show that transient expression of p16 stably represses the hTERT gene, encoding the catalytic subunit of telomerase, in both normal and malignant breast epithelial cells. Short-term p16 expression increases the amount of histone H3 trimethylated on lysine 27 (H3K27) bound to the hTERT promoter, resulting in transcriptional silencing, likely mediated by polycomb complexes. Our results indicate that transient p16 exposure may prevent malignant progression in dividing cells by irreversible repression of genes, such as hTERT, whose activity is necessary for extensive self-renewal. PMID:20569236

Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

PubMed

Cusick, John K; Hager, Elizabeth; Gill, Ronald E

2015-01-01

The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The Downregulation of the Expression of CD147 by Tumor Suppressor REIC/Dkk-3, and Its Implication in Human Prostate Cancer Cell Growth Inhibition.

PubMed

Mori, Akihiro; Watanabe, Masami; Sadahira, Takuya; Kobayashi, Yasuyuki; Ariyoshi, Yuichi; Ueki, Hideo; Wada, Koichiro; Ochiai, Kazuhiko; Li, Shun-Ai; Nasu, Yasutomo

2017-04-01

The cluster of differentiation 147 (CD147), also known as EMMPRIN, is a key molecule that promotes cancer progression. We previously developed an adenoviral vector encoding a tumor suppressor REIC/Dkk-3 gene (Ad-REIC) for cancer gene therapy. The therapeutic effects are based on suppressing the growth of cancer cells, but, the underlying molecular mechanism has not been fully clarified. To elucidate this mechanism, we investigated the effects of Ad-REIC on the expression of CD147 in LNCaP prostate cancer cells. Western blotting revealed that the expression of CD147 was significantly suppressed by Ad-REIC. Ad-REIC also suppressed the cell growth of LNCaP cells. Since other researchers have demonstrated that phosphorylated mitogen-activated protein kinases (MAPKs) and c-Myc protein positively regulate the expression of CD147, we investigated the correlation between the CD147 level and the activation of MAPK and c-Myc expression. Unexpectedly, no positive correlation was observed between CD147 and its possible regulators, suggesting that another signaling pathway was involved in the downregulation of CD147. This is the first study to show the downregulation of CD147 by Ad-REIC in prostate cancer cells. At least some of the therapeutic effects of Ad-REIC may be due to the downregulation of the cancer-progression factor, CD147.

Co-expression of hepatitis C virus polytope-HBsAg and p19-silencing suppressor protein in tobacco leaves.

PubMed

Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo

2016-01-01

Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Identification of yeast genes that confer resistance to chitosan oligosaccharide (COS) using chemogenomics

PubMed Central

2012-01-01

Background Chitosan oligosaccharide (COS), a deacetylated derivative of chitin, is an abundant, and renewable natural polymer. COS has higher antimicrobial properties than chitosan and is presumed to act by disrupting/permeabilizing the cell membranes of bacteria, yeast and fungi. COS is relatively non-toxic to mammals. By identifying the molecular and genetic targets of COS, we hope to gain a better understanding of the antifungal mode of action of COS. Results Three different chemogenomic fitness assays, haploinsufficiency (HIP), homozygous deletion (HOP), and multicopy suppression (MSP) profiling were combined with a transcriptomic analysis to gain insight in to the mode of action and mechanisms of resistance to chitosan oligosaccharides. The fitness assays identified 39 yeast deletion strains sensitive to COS and 21 suppressors of COS sensitivity. The genes identified are involved in processes such as RNA biology (transcription, translation and regulatory mechanisms), membrane functions (e.g. signalling, transport and targeting), membrane structural components, cell division, and proteasome processes. The transcriptomes of control wild type and 5 suppressor strains overexpressing ARL1, BCK2, ERG24, MSG5, or RBA50, were analyzed in the presence and absence of COS. Some of the up-regulated transcripts in the suppressor overexpressing strains exposed to COS included genes involved in transcription, cell cycle, stress response and the Ras signal transduction pathway. Down-regulated transcripts included those encoding protein folding components and respiratory chain proteins. The COS-induced transcriptional response is distinct from previously described environmental stress responses (i.e. thermal, salt, osmotic and oxidative stress) and pre-treatment with these well characterized environmental stressors provided little or any resistance to COS. Conclusions Overexpression of the ARL1 gene, a member of the Ras superfamily that regulates membrane trafficking, provides protection against COS-induced cell membrane permeability and damage. We found that the ARL1 COS-resistant over-expression strain was as sensitive to Amphotericin B, Fluconazole and Terbinafine as the wild type cells and that when COS and Fluconazole are used in combination they act in a synergistic fashion. The gene targets of COS identified in this study indicate that COS’s mechanism of action is different from other commonly studied fungicides that target membranes, suggesting that COS may be an effective fungicide for drug-resistant fungal pathogens. PMID:22727066

Menin regulates Inhbb expression through an Akt/Ezh2-mediated H3K27 histone modification.

PubMed

Gherardi, Samuele; Ripoche, Doriane; Mikaelian, Ivan; Chanal, Marie; Teinturier, Romain; Goehrig, Delphine; Cordier-Bussat, Martine; Zhang, Chang X; Hennino, Ana; Bertolino, Philippe

2017-04-01

Although Men1 is a well-known tumour suppressor gene, little is known about the functions of Menin, the protein it encodes for. Since few years, numerous publications support a major role of Menin in the control of epigenetics gene regulation. While Menin interaction with MLL complex favours transcriptional activation of target genes through H3K4me3 marks, Menin also represses gene expression via mechanisms involving the Polycomb repressing complex (PRC). Interestingly, Ezh2, the PRC-methyltransferase that catalyses H3K27me3 repressive marks and Menin have been shown to co-occupy a large number of promoters. However, lack of binding between Menin and Ezh2 suggests that another member of the PRC complex is mediating this indirect interaction. Having found that ActivinB - a TGFβ superfamily member encoded by the Inhbb gene - is upregulated in insulinoma tumours caused by Men1 invalidation, we hypothesize that Menin could directly participate in the epigenetic-repression of Inhbb gene expression. Using Animal model and cell lines, we report that loss of Menin is directly associated with ActivinB-induced expression both in vivo and in vitro. Our work further reveals that ActivinB expression is mediated through a direct modulation of H3K27me3 marks on the Inhbb locus in Menin-KO cell lines. More importantly, we show that Menin binds on the promoter of Inhbb gene where it favours the recruitment of Ezh2 via an indirect mechanism involving Akt-phosphorylation. Our data suggests therefore that Menin could take an important part to the Ezh2-epigenetic repressive landscape in many cells and tissues through its capacity to modulate Akt phosphorylation. Copyright © 2017 Elsevier B.V. All rights reserved.

Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

PubMed

Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

2016-11-29

Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

PubMed

Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

2017-11-24

To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

Indirect intergenic suppression of a radiosensitive mutant of Sordaria macrospora defective in sister-chromatid cohesiveness.

PubMed

Huynh, A D; Leblon, G; Zickler, D

1986-01-01

Six ultra violet (UV) mutageneses were performed on the spo76 UV-sensitive mutant of Sordaria macrospora. Spo76 shows an early centromere cleavage associated with an arrest at the first meiotic division and therefore does not form ascospores. Moreover, it exhibits altered pairing structure (synaptonemal complex), revealing a defect in the sister-chromatid cohesiveness. From 37 revertants which partially restored sporulation, 34 extragenic suppressors of spo76 were isolated. All suppressors are altered in chromosomal pairing but, unlike spo76, show a wild type centromere cleavage. The 34 suppressors were assigned to six different genes and mapped. Only one of the suppressor genes is involved in repair functions.

Epstein–Barr virus nuclear antigen 3C interact with p73: Interplay between a viral oncoprotein and cellular tumor suppressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sahu, Sushil Kumar; Mohanty, Suchitra; Kumar, Amit

The p73 protein has structural and functional homology with the tumor suppressor p53, which plays an important role in cell cycle regulation, apoptosis, and DNA repair. The p73 locus encodes both a tumor suppressor (TAp73) and a putative oncogene (ΔNp73). p73 May play a significant role in p53-deficient lymphomas infected with Epstein–Barr virus (EBV). EBV produces an asymptomatic infection in the majority of the global population, but it is associated with several human B-cell malignancies. The EBV-encoded Epstein–Barr virus nuclear antigen 3C (EBNA3C) is thought to disrupt the cell cycle checkpoint by interacting directly with p53 family proteins. Doxorubicin, amore » commonly used chemotherapeutic agent, induces apoptosis through p53 and p73 signaling such that the lowΔNp73 level promotes the p73-mediated intrinsic pathway of apoptosis. In this report, we investigated the mechanism by which EBV infection counters p73α-induced apoptosis through EBNA3C. - Highlights: • EBV-encoded EBNA3C suppresses doxorubicin-induced apoptosis in B-cell lymphomas. • EBNA3C binds to p73 to suppress its apoptotic effect. • EBNA3C maintains latency by regulating downstream mitochondrial pathways.« less

Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

PubMed Central

Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

2010-01-01

RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

Improvement of fermentation ability under baking-associated stress conditions by altering the POG1 gene expression in baker's yeast.

PubMed

Sasano, Yu; Haitani, Yutaka; Hashida, Keisuke; Oshiro, Satoshi; Shima, Jun; Takagi, Hiroshi

2013-08-01

During the bread-making process, yeast cells are exposed to many types of baking-associated stress. There is thus a demand within the baking industry for yeast strains with high fermentation abilities under these stress conditions. The POG1 gene, encoding a putative transcription factor involved in cell cycle regulation, is a multicopy suppressor of the yeast Saccharomyces cerevisiae E3 ubiquitin ligase Rsp5 mutant. The pog1 mutant is sensitive to various stresses. Our results suggested that the POG1 gene is involved in stress tolerance in yeast cells. In this study, we showed that overexpression of the POG1 gene in baker's yeast conferred increased fermentation ability in high-sucrose-containing dough, which is used for sweet dough baking. Furthermore, deletion of the POG1 gene drastically increased the fermentation ability in bread dough after freeze-thaw stress, which would be a useful characteristic for frozen dough baking. Thus, the engineering of yeast strains to control the POG1 gene expression level would be a novel method for molecular breeding of baker's yeast. Copyright © 2013 Elsevier B.V. All rights reserved.

Activation of the Yeast UBI4 Polyubiquitin Gene by Zap1 Transcription Factor via an Intragenic Promoter Is Critical for Zinc-deficient Growth*

PubMed Central

MacDiarmid, Colin W.; Taggart, Janet; Jeong, Jeeyon; Kerdsomboon, Kittikhun; Eide, David J.

2016-01-01

Stability of many proteins requires zinc. Zinc deficiency disrupts their folding, and the ubiquitin-proteasome system may help manage this stress. In Saccharomyces cerevisiae, UBI4 encodes five tandem ubiquitin monomers and is essential for growth in zinc-deficient conditions. Although UBI4 is only one of four ubiquitin-encoding genes in the genome, a dramatic decrease in ubiquitin was observed in zinc-deficient ubi4Δ cells. The three other ubiquitin genes were strongly repressed under these conditions, contributing to the decline in ubiquitin. In a screen for ubi4Δ suppressors, a hypomorphic allele of the RPT2 proteasome regulatory subunit gene (rpt2E301K) suppressed the ubi4Δ growth defect. The rpt2E301K mutation also increased ubiquitin accumulation in zinc-deficient cells, and by using a ubiquitin-independent proteasome substrate we found that proteasome activity was reduced. These results suggested that increased ubiquitin supply in suppressed ubi4Δ cells was a consequence of more efficient ubiquitin release and recycling during proteasome degradation. Degradation of a ubiquitin-dependent substrate was restored by the rpt2E301K mutation, indicating that ubiquitination is rate-limiting in this process. The UBI4 gene was induced ∼5-fold in low zinc and is regulated by the zinc-responsive Zap1 transcription factor. Surprisingly, Zap1 controls UBI4 by inducing transcription from an intragenic promoter, and the resulting truncated mRNA encodes only two of the five ubiquitin repeats. Expression of a short transcript alone complemented the ubi4Δ mutation, indicating that it is efficiently translated. Loss of Zap1-dependent UBI4 expression caused a growth defect in zinc-deficient conditions. Thus, the intragenic UBI4 promoter is critical to preventing ubiquitin deficiency in zinc-deficient cells. PMID:27432887

Expression of the 12-oxophytodienoic acid 10,11-reductase gene in the compatible interaction between pea and fungal pathogen.

PubMed

Ishiga, Yasuhiro; Funato, Akiko; Tachiki, Tomoyuki; Toyoda, Kazuhiro; Shiraishi, Tomonori; Yamada, Tetsuji; Ichinose, Yuki

2002-10-01

Suppressors produced by Mycosphaerella pinodes are glycopeptides to block pea defense responses induced by elicitors. A clone, S64, was isolated as cDNA for suppressor-inducible gene from pea epicotyls. The treatment of pea epicotyls with suppressor alone induced an increase of S64 mRNA within 1 h, and it reached a maximum level at 3 h after treatment. The induction was not affected by application of the elicitor, indicating that the suppressor has a dominant action to regulate S64 gene expression. S64 was also induced by inoculation with a virulent pathogen, M. pinodes, but not by inoculation with a non-pathogen, Ascochyta rabiei, nor by treatment with fungal elicitor. The deduced structure of S64 showed high homology to 12-oxophytodienoic acid reductase (OPR) in Arabidopsis thaliana. A recombinant protein derived from S64 had OPR activity, suggesting compatibility-specific activation of the octadecanoid pathway in plants. Treatment with jasmonic acid (JA) or methyl jasmonic acid, end products of the octadecanoid pathway, inhibited the elicitor-induced accumulation of PAL mRNA in pea. These results indicate that the suppressor-induced S64 gene expression leads to the production of JA or related compounds, which might contribute to the establishment of compatibility by inhibiting the phenylpropanoid biosynthetic pathway.

A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

PubMed Central

Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

2010-01-01

A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

New Late Gene, dar, Involved in DNA Replication of Bacteriophage T4 I. Isolation, Characterization, and Genetic Location.

PubMed

Wu, J R; Yeh, Y C

1975-05-01

Suppressors of gene 59-defective mutants were isolated by screening spontaneous, temperature-sensitive (ts) revertants of the amber mutant, amC5, in gene 59. Six ts revertants were isolated. No gene 59-defective ts recombinant was obtained by crossing each ts revertant with the wild type, T4D. However, suppressors of gene 59-defective mutants were obtained from two of these ts revertants. These suppressor mutants are referred to as dar (DNA arrested restoration). dar mutants specifically restored the abnormalities, both in DNA synthesis and burst size, caused by gene 59-defective mutants to normal levels. It is unlikely that dar mutants are nonsense suppressors since theý failed to suppress amber mutations in 11 other genes investigated. The genetic expression of dar is controlled by gene 55; therefore, dar is a late gene. The genetic location of dar has been mapped between genes 24 and 25, a region contiguous to late genes. dar appears to be another nonessential gene of T4 since burst sizes of dar were almost identical to those of the wild type. Mutations in dar did not affect genetic recombination and repair of UV-damaged DNA, but caused a sensitivity to hydroxyurea in progeny formation. The effect of the dar mutation on host DNA degradation cannot account for its hydroxyurea sensitivity. dar mutant alleles were recessive to the wild-type allele as judged by restoration of arrested DNA synthesis. The possible mechanisms for the suppression of defects in gene 59 are discussed.

IBR5 Modulates Temperature-Dependent, R Protein CHS3-Mediated Defense Responses in Arabidopsis.

PubMed

Liu, Jingyan; Yang, Haibian; Bao, Fei; Ao, Kevin; Zhang, Xiaoyan; Zhang, Yuelin; Yang, Shuhua

2015-10-01

Plant responses to low temperature are tightly associated with defense responses. We previously characterized the chilling-sensitive mutant chs3-1 resulting from the activation of the Toll and interleukin 1 receptor-nucleotide binding-leucine-rich repeat (TIR-NB-LRR)-type resistance (R) protein harboring a C-terminal LIM (Lin-11, Isl-1 and Mec-3 domains) domain. Here we report the identification of a suppressor of chs3, ibr5-7 (indole-3-butyric acid response 5), which largely suppresses chilling-activated defense responses. IBR5 encodes a putative dual-specificity protein phosphatase. The accumulation of CHS3 protein at chilling temperatures is inhibited by the IBR5 mutation. Moreover, chs3-conferred defense phenotypes were synergistically suppressed by mutations in HSP90 and IBR5. Further analysis showed that IBR5, with holdase activity, physically associates with CHS3, HSP90 and SGT1b (Suppressor of the G2 allele of skp1) to form a complex that protects CHS3. In addition to the positive role of IBR5 in regulating CHS3, IBR5 is also involved in defense responses mediated by R genes, including SNC1 (Suppressor of npr1-1, Constitutive 1), RPS4 (Resistance to P. syringae 4) and RPM1 (Resistance to Pseudomonas syringae pv. maculicola 1). Thus, the results of the present study reveal a role for IBR5 in the regulation of multiple R protein-mediated defense responses.

Tissue-specific autoregulation of Drosophila suppressor of forked by alternative poly(A) site utilization leads to accumulation of the suppressor of forked protein in mitotically active cells.

PubMed Central

Juge, F; Audibert, A; Benoit, B; Simonelig, M

2000-01-01

The Suppressor of forked protein is the Drosophila homolog of the 77K subunit of human cleavage stimulation factor, a complex required for the first step of the mRNA 3'-end-processing reaction. We have shown previously that wild-type su(f) function is required for the accumulation of a truncated su(f) transcript polyadenylated in intron 4 of the gene. This led us to propose a model in which the Su(f) protein would negatively regulate its own accumulation by stimulating 3'-end formation of this truncated su(f) RNA. In this article, we demonstrate this model and show that su(f) autoregulation is tissue specific. The Su(f) protein accumulates at a high level in dividing tissues, but not in nondividing tissues. We show that this distribution of the Su(f) protein results from stimulation by Su(f) of the tissue-specific utilization of the su(f) intronic poly(A) site, leading to the accumulation of the truncated su(f) transcript in nondividing tissues. Utilization of this intronic poly(A) site is affected in a su(f) mutant and restored in the mutant with a transgene encoding wild-type Su(f) protein. These data provide an in vivo example of cell-type-specific regulation of a protein level by poly(A) site choice, and confirm the role of Su(f) in regulation of poly(A) site utilization. PMID:11105753

MLL4 Is Required to Maintain Broad H3K4me3 Peaks and Super-Enhancers at Tumor Suppressor Genes.

PubMed

Dhar, Shilpa S; Zhao, Dongyu; Lin, Tao; Gu, Bingnan; Pal, Khusboo; Wu, Sarah J; Alam, Hunain; Lv, Jie; Yun, Kyuson; Gopalakrishnan, Vidya; Flores, Elsa R; Northcott, Paul A; Rajaram, Veena; Li, Wei; Shilatifard, Ali; Sillitoe, Roy V; Chen, Kaifu; Lee, Min Gyu

2018-06-07

Super-enhancers are large clusters of enhancers that activate gene expression. Broad trimethyl histone H3 lysine 4 (H3K4me3) often defines active tumor suppressor genes. However, how these epigenomic signatures are regulated for tumor suppression is little understood. Here we show that brain-specific knockout of the H3K4 methyltransferase MLL4 (a COMPASS-like enzyme, also known as KMT2D) in mice spontaneously induces medulloblastoma. Mll4 loss upregulates oncogenic Ras and Notch pathways while downregulating neuronal gene expression programs. MLL4 enhances DNMT3A-catalyzed DNA methylation and SIRT1/BCL6-mediated H4K16 deacetylation, which antagonize expression of Ras activators and Notch pathway components, respectively. Notably, Mll4 loss downregulates tumor suppressor genes (e.g., Dnmt3a and Bcl6) by diminishing broad H3K4me3 and super-enhancers and also causes widespread impairment of these epigenomic signatures during medulloblastoma genesis. These findings suggest an anti-tumor role for super-enhancers and provide a unique tumor-suppressive mechanism in which MLL4 is necessary to maintain broad H3K4me3 and super-enhancers at tumor suppressor genes. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular Mechanisms of Metastasis Suppression in Human Breast Cancer

DTIC Science & Technology

2000-07-01

September 29 Identifying and characterizing human metastasis-suppressor genes. Novartis Pharma , May WELCH, Danny R, Ph.D...Growth and Differentiation Chemica -Biological Interactions CRC Press - Reviews European Journal of Cancer and Clinical Oncology Journal of...September 29 Identifying and characterizing human metastasis-suppressor genes. Novartis Pharma , May 27 Regulation of Metastasis in Human Cancers

The Arf-inducing Transcription Factor Dmp1 Encodes a Transcriptional Activator of Amphiregulin, Thrombospondin-1, JunB and Egr1

PubMed Central

Mallakin, Ali; Sugiyama, Takayuki; Kai, Fumitake; Taneja, Pankaj; Kendig, Robert D.; Frazier, Donna P.; Maglic, Dejan; Matise, Lauren A.; Willingham, Mark C.; Inoue, Kazushi

2009-01-01

Dmp1 (Dmtf1) encodes a Myb-like transcription factor implicated in tumor suppression through direct activation of the Arf-p53 pathway. The human DMP1 gene is frequently deleted in non-small cell lung cancers, especially those that retain wild-type INK4a/ARF and/or p53. To identify novel genes that are regulated by Dmp1, transcriptional profiles of lung tissue from Dmp1-null and wild-type mice were generated using the GeneChip Microarray. Comparative analysis of gene expression changes between the two groups resulted in identification of numerous genes that may be regulated by Dmp1. Notably, amphiregulin (Areg), thrombospondin-1 (Tsp-1), JunB, Egr1, adrenomedullin (Adm), Bcl-3 and methyl-CpG binding domain protein 1 (Mbd1) were downregulated in the lungs from Dmp1-null mice while Gas1 and Ect2 genes were upregulated. These target genes were chosen for further analyses since they are involved in cell proliferation, transcription, angiogenesis/metastasis, apoptosis, or DNA methylation, and thus could account for the tumor suppressor phenotype of Dmp1. Dmp1 directly bound to the genomic loci of Areg, Tsp-1, JunB and Egr1. Significant upregulation or downregulation of the novel Dmp1 target genes was observed upon transient expression of Dmp1 in alveolar epithelial cells, an effect which was nullified by the inhibition of de novo mRNA synthesis. Interestingly, these genes and their protein products were significantly downregulated or upregulated in the lungs from Dmp1-heterozygous mice as well. Identification of novel Dmp1 target genes not only provides insights into the effects of Dmp1 on global gene expression, but also sheds light on the mechanism of haploid insufficiency of Dmp1 in tumor suppression. PMID:19816943

[Exon-intron structure of the fet5+ gene of Schizosaccharomyces pombe and physical mapping of genome encompassing regions].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1998-01-01

Plasmid pYUK3 bearing the fet5+ gene of Schizosaccharomyces pombe was isolated from a genomic library of the fission yeast, and a detailed physical map of the whole genomic insert (ca. 9.6 Kbp) was constructed. The primary structure of the fet5+ gene and its flanking regions is established. The gene contains a single 45-bp intron in its distal part. A typical TATA-box (TATAAG) was found in the 5'-noncoding region ca. 50 bp upstream of the putative start of transcription, and the 3'-noncoding region contains AT-rich palindromes, which are probably involved in termination of the fet5+ transcription. A previously unidentified gene of Sz. pombe encoding a protein with some similarity to one of the transcriptional activators from the TBP (TATA-binding protein) group of SPT factors of transcription was found in the vicinity of the fet5+ gene. Taking into account that cDNA of the fet5(+)-gene was isolated as a suppressor of the genetic-defect of nuclear RNA polymerases I-III (Bioorg. Khim., 1997, vol. 23, No 3, pp. 234-237), this vicinity may be the first evidence of possible clustering, in the genome of the fission yeast, of genes participating in transcription regulation.

Construction and Characterization of Human Mammary Epithelial Cell Lines Containing Mutations in the p53 or BRCA1 Genes

DTIC Science & Technology

1999-01-01

development of breast cancers. To study the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway, we have...the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway. The consequences of transduction of these...proposed three approaches for constructing p53-deficient cells; i.e., by mutating the p53 gene directly, by abrogating the protein’s normal cellular

Tip60 degradation by adenovirus relieves transcriptional repression of viral transcriptional activator EIA.

PubMed

Gupta, A; Jha, S; Engel, D A; Ornelles, D A; Dutta, A

2013-10-17

Adenoviruses are linear double-stranded DNA viruses that infect human and rodent cell lines, occasionally transform them and cause tumors in animal models. The host cell challenges the virus in multifaceted ways to restrain viral gene expression and DNA replication, and sometimes even eliminates the infected cells by programmed cell death. To combat these challenges, adenoviruses abrogate the cellular DNA damage response pathway. Tip60 is a lysine acetyltransferase that acetylates histones and other proteins to regulate gene expression, DNA damage response, apoptosis and cell cycle regulation. Tip60 is a bona fide tumor suppressor as mice that are haploid for Tip60 are predisposed to tumors. We have discovered that Tip60 is degraded by adenovirus oncoproteins EIB55K and E4orf6 by a proteasome-mediated pathway. Tip60 binds to the immediate early adenovirus promoter and suppresses adenovirus EIA gene expression, which is a master regulator of adenovirus transcription, at least partly through retention of the virally encoded repressor pVII on this promoter. Thus, degradation of Tip60 by the adenoviral early proteins is important for efficient viral early gene transcription and for changes in expression of cellular genes.

Chromosome VIII disomy influences the nonsense suppression efficiency and transition metal tolerance of the yeast Saccharomyces cerevisiae.

PubMed

Zadorsky, S P; Sopova, Y V; Andreichuk, D Y; Startsev, V A; Medvedeva, V P; Inge-Vechtomov, S G

2015-06-01

The SUP35 gene of the yeast Saccharomyces cerevisiae encodes the translation termination factor eRF3. Mutations in this gene lead to the suppression of nonsense mutations and a number of other pleiotropic phenotypes, one of which is impaired chromosome segregation during cell division. Similar effects result from replacing the S. cerevisiae SUP35 gene with its orthologues. A number of genetic and epigenetic changes that occur in the sup35 background result in partial compensation for this suppressor effect. In this study we showed that in S. cerevisiae strains in which the SUP35 orthologue from the yeast Pichia methanolica replaces the S. cerevisiae SUP35 gene, chromosome VIII disomy results in decreased efficiency of nonsense suppression. This antisuppressor effect is not associated with decreased stop codon read-through. We identified SBP1, a gene that localizes to chromosome VIII, as a dosage-dependent antisuppressor that strongly contributes to the overall antisuppressor effect of chromosome VIII disomy. Disomy of chromosome VIII also leads to a change in the yeast strains' tolerance of a number of transition metal salts. Copyright © 2015 John Wiley & Sons, Ltd.

Comprehensive genomic profiles of small cell lung cancer

PubMed Central

George, Julie; Lim, Jing Shan; Jang, Se Jin; Cun, Yupeng; Ozretić, Luka; Kong, Gu; Leenders, Frauke; Lu, Xin; Fernández-Cuesta, Lynnette; Bosco, Graziella; Müller, Christian; Dahmen, Ilona; Jahchan, Nadine S.; Park, Kwon-Sik; Yang, Dian; Karnezis, Anthony N.; Vaka, Dedeepya; Torres, Angela; Wang, Maia Segura; Korbel, Jan O.; Menon, Roopika; Chun, Sung-Min; Kim, Deokhoon; Wilkerson, Matt; Hayes, Neil; Engelmann, David; Pützer, Brigitte; Bos, Marc; Michels, Sebastian; Vlasic, Ignacija; Seidel, Danila; Pinther, Berit; Schaub, Philipp; Becker, Christian; Altmüller, Janine; Yokota, Jun; Kohno, Takashi; Iwakawa, Reika; Tsuta, Koji; Noguchi, Masayuki; Muley, Thomas; Hoffmann, Hans; Schnabel, Philipp A.; Petersen, Iver; Chen, Yuan; Soltermann, Alex; Tischler, Verena; Choi, Chang-min; Kim, Yong-Hee; Massion, Pierre P.; Zou, Yong; Jovanovic, Dragana; Kontic, Milica; Wright, Gavin M.; Russell, Prudence A.; Solomon, Benjamin; Koch, Ina; Lindner, Michael; Muscarella, Lucia A.; la Torre, Annamaria; Field, John K.; Jakopovic, Marko; Knezevic, Jelena; Castaños-Vélez, Esmeralda; Roz, Luca; Pastorino, Ugo; Brustugun, Odd-Terje; Lund-Iversen, Marius; Thunnissen, Erik; Köhler, Jens; Schuler, Martin; Botling, Johan; Sandelin, Martin; Sanchez-Cespedes, Montserrat; Salvesen, Helga B.; Achter, Viktor; Lang, Ulrich; Bogus, Magdalena; Schneider, Peter M.; Zander, Thomas; Ansén, Sascha; Hallek, Michael; Wolf, Jürgen; Vingron, Martin; Yatabe, Yasushi; Travis, William D.; Nürnberg, Peter; Reinhardt, Christian; Perner, Sven; Heukamp, Lukas; Büttner, Reinhard; Haas, Stefan A.; Brambilla, Elisabeth; Peifer, Martin; Sage, Julien; Thomas, Roman K.

2016-01-01

We have sequenced the genomes of 110 small cell lung cancers (SCLC), one of the deadliest human cancers. In nearly all the tumours analysed we found bi-allelic inactivation of TP53 and RB1, sometimes by complex genomic rearrangements. Two tumours with wild-type RB1 had evidence of chromothripsis leading to overexpression of cyclin D1 (encoded by the CCND1 gene), revealing an alternative mechanism of Rb1 deregulation. Thus, loss of the tumour suppressors TP53 and RB1 is obligatory in SCLC. We discovered somatic genomic rearrangements of TP73 that create an oncogenic version of this gene, TP73Δex2/3. In rare cases, SCLC tumours exhibited kinase gene mutations, providing a possible therapeutic opportunity for individual patients. Finally, we observed inactivating mutations in NOTCH family genes in 25% of human SCLC. Accordingly, activation of Notch signalling in a pre-clinical SCLC mouse model strikingly reduced the number of tumours and extended the survival of the mutant mice. Furthermore, neuroendocrine gene expression was abrogated by Notch activity in SCLC cells. This first comprehensive study of somatic genome alterations in SCLC uncovers several key biological processes and identifies candidate therapeutic targets in this highly lethal form of cancer. PMID:26168399

RNAi-Based Suppressor Screens Reveal Genetic Interactions Between the CRL2LRR-1 E3-Ligase and the DNA Replication Machinery in Caenorhabditis elegans

PubMed Central

Ossareh-Nazari, Batool; Katsiarimpa, Anthi; Merlet, Jorge; Pintard, Lionel

2016-01-01

Cullin-RING E3-Ligases (CRLs), the largest family of E3 ubiquitin-Ligases, regulate diverse cellular processes by promoting ubiquitination of target proteins. The evolutionarily conserved Leucine Rich Repeat protein 1 (LRR-1) is a substrate-recognition subunit of a CRL2LRR-1 E3-ligase. Here we provide genetic evidence supporting a role of this E3-enzyme in the maintenance of DNA replication integrity in Caenorhabditis elegans. Through RNAi-based suppressor screens of lrr-1(0) and cul-2(or209ts) mutants, we identified two genes encoding components of the GINS complex, which is part of the Cdc45-MCM-GINS (CMG) replicative helicase, as well as CDC-7 and MUS-101, which drives the assembly of the CMG helicase during DNA replication. In addition, we identified the core components of the ATR/ATL-1 DNA replication checkpoint pathway (MUS-101, ATL-1, CLSP-1, CHK-1). These results suggest that the CRL2LRR-1 E3-ligase acts to modify or degrade factor(s) that would otherwise misregulate the replisome, eventually leading to the activation of the DNA replication checkpoint. PMID:27543292

Expression of geminiviral AC2 RNA silencing suppressor changes sugar and jasmonate responsive gene expression in transgenic tobacco plants

PubMed Central

2012-01-01

Background RNA-silencing is a conserved gene regulation and surveillance machinery, which in plants, is also used as major defence mechanism against viruses. Various virus-specific dsRNA structures are recognized by the silencing machinery leading to degradation of the viral RNAs or, as in case of begomoviruses, to methylation of their DNA genomes. Viruses produce specific RNA silencing suppressor (RSS) proteins to prevent these host defence mechanisms, and as these interfere with the silencing machinery they also disturb the endogenous silencing reactions. In this paper, we describe how expression of AC2 RSS, derived from African cassava mosaic geminivirus changes transcription profile in tobacco (Nicotiana tabacum) leaves and in flowers. Results Expression of AC2 RSS in transgenic tobacco plants induced clear phenotypic changes both in leaves and in flowers. Transcriptomes of these plants were strongly altered, with total of 1118 and 251 differentially expressed genes in leaves and flowers, respectively. The three most up-regulated transcript groups were related to stress, cell wall modifications and signalling, whereas the three most down-regulated groups were related to translation, photosynthesis and transcription. It appears that many of the gene expression alterations appeared to be related to enhanced biosynthesis of jasmonate and ethylene, and consequent enhancement of the genes and pathways that are regulated by these hormones, or to the retrograde signalling caused by the reduced photosynthetic activity and sugar metabolism. Comparison of these results to a previous transcriptional profiling of HC-Pro RSS-expressing plants revealed that some of same genes were induced by both RSSs, but their expression levels were typically higher in AC2 than in HC-Pro RSS expressing plants. All in all, a large number of transcript alterations were found to be specific to each of the RSS expressing transgenic plants. Conclusions AC2 RSS in transgenic tobacco plants interferes with the silencing machinery. It causes stress and defence reactions for instance via induction of the jasmonate and ethylene biosynthesis, and by consequent gene expression alteration regulated by these hormones. The changed sugar metabolism may cause significant down-regulation of genes encoding ribosomal proteins, thus reducing the general translation level. PMID:23130567

An evidence-based knowledgebase of metastasis suppressors to identify key pathways relevant to cancer metastasis

PubMed Central

Zhao, Min; Li, Zhe; Qu, Hong

2015-01-01

Metastasis suppressor genes (MS genes) are genes that play important roles in inhibiting the process of cancer metastasis without preventing growth of the primary tumor. Identification of these genes and understanding their functions are critical for investigation of cancer metastasis. Recent studies on cancer metastasis have identified many new susceptibility MS genes. However, the comprehensive illustration of diverse cellular processes regulated by metastasis suppressors during the metastasis cascade is lacking. Thus, the relationship between MS genes and cancer risk is still unclear. To unveil the cellular complexity of MS genes, we have constructed MSGene (http://MSGene.bioinfo-minzhao.org/), the first literature-based gene resource for exploring human MS genes. In total, we manually curated 194 experimentally verified MS genes and mapped to 1448 homologous genes from 17 model species. Follow-up functional analyses associated 194 human MS genes with epithelium/tissue morphogenesis and epithelia cell proliferation. In addition, pathway analysis highlights the prominent role of MS genes in activation of platelets and coagulation system in tumor metastatic cascade. Moreover, global mutation pattern of MS genes across multiple cancers may reveal common cancer metastasis mechanisms. All these results illustrate the importance of MSGene to our understanding on cell development and cancer metastasis. PMID:26486520

Expression profiling and pathway analysis of Krüppel-like factor 4 in mouse embryonic fibroblasts

PubMed Central

Hagos, Engda G; Ghaleb, Amr M; Kumar, Amrita; Neish, Andrew S; Yang, Vincent W

2011-01-01

Background: Krüppel-like factor 4 (KLF4) is a zinc-finger transcription factor with diverse regulatory functions in proliferation, differentiation, and development. KLF4 also plays a role in inflammation, tumorigenesis, and reprogramming of somatic cells to induced pluripotent stem (iPS) cells. To gain insight into the mechanisms by which KLF4 regulates these processes, we conducted DNA microarray analyses to identify differentially expressed genes in mouse embryonic fibroblasts (MEFs) wild type and null for Klf4. Methods: Expression profiles of fibroblasts isolated from mouse embryos wild type or null for the Klf4 alleles were examined by DNA microarrays. Differentially expressed genes were subjected to the Database for Annotation, Visualization and Integrated Discovery (DAVID). The microarray data were also interrogated with the Ingenuity Pathway Analysis (IPA) and Gene Set Enrichment Analysis (GSEA) for pathway identification. Results obtained from the microarray analysis were confirmed by Western blotting for select genes with biological relevance to determine the correlation between mRNA and protein levels. Results: One hundred and sixty three up-regulated and 88 down-regulated genes were identified that demonstrated a fold-change of at least 1.5 and a P-value < 0.05 in Klf4-null MEFs compared to wild type MEFs. Many of the up-regulated genes in Klf4-null MEFs encode proto-oncogenes, growth factors, extracellular matrix, and cell cycle activators. In contrast, genes encoding tumor suppressors and those involved in JAK-STAT signaling pathways are down-regulated in Klf4-null MEFs. IPA and GSEA also identified various pathways that are regulated by KLF4. Lastly, Western blotting of select target genes confirmed the changes revealed by microarray data. Conclusions: These data are not only consistent with previous functional studies of KLF4's role in tumor suppression and somatic cell reprogramming, but also revealed novel target genes that mediate KLF4's functions. PMID:21892412

Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

DTIC Science & Technology

2000-04-01

Genes, LOH Mapping, Chromosome 17, Physical Mapping, Genetic Mapping, CDNA Screening, Humans, Anatomical 81 Samples, Mutation Detection, Breast Cancer...According to the established model for LOH involving tumor suppressor genes, the allele remaining in the tumor sample would harbor the deleterious mutation ...sequencing on an AB1373A sequencer (Applied Biosystems, Foster City, CA). As none of the samples we have sequenced have revealed any mutations , we have

Gastrin-releasing peptide-induced down-regulation of tumor suppressor protein PTEN (phosphatase and tensin homolog deleted on chromosome ten) in neuroblastomas.

PubMed

Qiao, Jingbo; Kang, Junghee; Cree, Jeremy; Evers, B Mark; Chung, Dai H

2005-05-01

To evaluate whether aggressive, undifferentiated neuroblastomas express tumor suppressor protein PTEN (phosphatase and tensin homolog deleted on chromosome ten) and to examine the effects of gastrin-releasing peptide (GRP) on PTEN gene and protein expression. We have previously shown that neuroblastomas secrete GRP, which binds to its cell surface receptor (GRP-R) to stimulate cell growth in an autocrine fashion. However, the effects of GRP on expression of the tumor suppressor gene PTEN have not been elucidated in neuroblastomas. Paraffin-embedded sections from human neuroblastomas were analyzed for PTEN and phospho-Akt protein expression by immunohistochemistry. Human neuroblastoma cell lines (SK-N-SH and SH-SY5Y) were stably transfected with the plasmid pEGFP-GRP-R to establish GRP-R overexpression cell lines, and the effects of GRP on PTEN gene and protein expression were determined. A decrease in the ratio of PTEN to phospho-Akt protein expression was identified in poorly differentiated neuroblastomas. An increase in GRP binding capacity was confirmed in GRP-R overexpressing cells, which demonstrated an accelerated constitutive cell growth rate. PTEN gene and protein expression was significantly decreased in GRP-R overexpressing cells when compared with controls. Our findings demonstrate decreased expression of the tumor suppressor protein PTEN in more aggressive undifferentiated neuroblastomas. An increase in GRP binding capacity, as a result of GRP-R overexpression, down-regulates PTEN expression. These findings suggest that an inhibition of the tumor suppressor gene PTEN may be an important regulatory mechanism involved in GRP-induced cell proliferation in neuroblastomas.

The P1N-PISPO trans-Frame Gene of Sweet Potato Feathery Mottle Potyvirus Is Produced during Virus Infection and Functions as an RNA Silencing Suppressor

PubMed Central

Mingot, Ares; Valli, Adrián; Rodamilans, Bernardo; San León, David; Baulcombe, David C.; García, Juan Antonio

2016-01-01

ABSTRACT The positive-sense RNA genome of Sweet potato feathery mottle virus (SPFMV) (genus Potyvirus, family Potyviridae) contains a large open reading frame (ORF) of 3,494 codons translatable as a polyprotein and two embedded shorter ORFs in the −1 frame: PISPO, of 230 codons, and PIPO, of 66 codons, located in the P1 and P3 regions, respectively. PISPO is specific to some sweet potato-infecting potyviruses, while PIPO is present in all potyvirids. In SPFMV these two extra ORFs are preceded by conserved G2A6 motifs. We have shown recently that a polymerase slippage mechanism at these sites could produce transcripts bringing these ORFs in frame with the upstream polyprotein, thus leading to P1N-PISPO and P3N-PIPO products (B. Rodamilans, A. Valli, A. Mingot, D. San Leon, D. B. Baulcombe, J. J. Lopez-Moya, and J.A. Garcia, J Virol 89:6965–6967, 2015, doi:10.1128/JVI.00337-15). Here, we demonstrate by liquid chromatography coupled to mass spectrometry that both P1 and P1N-PISPO are produced during viral infection and coexist in SPFMV-infected Ipomoea batatas plants. Interestingly, transient expression of SPFMV gene products coagroinfiltrated with a reporter gene in Nicotiana benthamiana revealed that P1N-PISPO acts as an RNA silencing suppressor, a role normally associated with HCPro in other potyviruses. Moreover, mutation of WG/GW motifs present in P1N-PISPO abolished its silencing suppression activity, suggesting that the function might require interaction with Argonaute components of the silencing machinery, as was shown for other viral suppressors. Altogether, our results reveal a further layer of complexity of the RNA silencing suppression activity within the Potyviridae family. IMPORTANCE Gene products of potyviruses include P1, HCPro, P3, 6K1, CI, 6K2, VPg/NIaPro, NIb, and CP, all derived from the proteolytic processing of a large polyprotein, and an additional P3N-PIPO product, with the PIPO segment encoded in a different frame within the P3 cistron. In sweet potato feathery mottle virus (SPFMV), another out-of-frame element (PISPO) was predicted within the P1 region. We have shown recently that a polymerase slippage mechanism can generate the transcript variants with extra nucleotides that could be translated into P1N-PISPO and P3N-PIPO. Now, we demonstrate by mass spectrometry analysis that P1N-PISPO is indeed produced in SPFMV-infected plants, in addition to P1. Interestingly, while in other potyviruses the suppressor of RNA silencing is HCPro, we show here that P1N-PISPO exhibited this activity in SPFMV, revealing how the complexity of the gene content could contribute to supply this essential function in members of the Potyviridae family. PMID:26792740

Metastasis Suppressor Genes: At the Interface Between the Environment and Tumor Cell Growth

PubMed Central

Hurst, Douglas R.; Welch, Danny R.

2013-01-01

The molecular mechanisms and genetic programs required for cancer metastasis are sometimes overlapping, but components are clearly distinct from those promoting growth of a primary tumor. Every sequential, rate-limiting step in the sequence of events leading to metastasis requires coordinated expression of multiple genes, necessary signaling events, and favorable environmental conditions or the ability to escape negative selection pressures. Metastasis suppressors are molecules that inhibit the process of metastasis without preventing growth of the primary tumor. The cellular processes regulated by metastasis suppressors are diverse and function at every step in the metastatic cascade. As we gain knowledge into the molecular mechanisms of metastasis suppressors and cofactors with which they interact, we learn more about the process, including appreciation that some are potential targets for therapy of metastasis, the most lethal aspect of cancer. Until now, metastasis suppressors have been described largely by their function. With greater appreciation of their biochemical mechanisms of action, the importance of context is increasingly recognized especially since tumor cells exist in myriad microenvironments. In this review, we assemble the evidence that selected molecules are indeed suppressors of metastasis, collate the data defining the biochemical mechanisms of action, and glean insights regarding how metastasis suppressors regulate tumor cell communication to–from microenvironments. PMID:21199781

Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

PubMed

Donehower, Lawrence A

2014-06-01

Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

Construction and properties of a temperature-sensitive mutation in the gene for the bacteriophage SPO1 DNA-binding protein TF1.

PubMed

Sayre, M H; Geiduschek, E P

1990-08-01

The Bacillus subtilis bacteriophage SPO1 encodes the DNA-binding protein TF1, a homolog of the ubiquitous type II DNA-binding proteins that are components of bacterial chromatin. The known three-dimensional structure of a related protein was used in devising a scheme of site-directed mutagenesis that led to the creation of a temperature-sensitive mutation in the TF1 gene. At the nonpermissive temperature, this mutation disrupted the temporal regulation of viral protein synthesis and processing, altered the kinetics of accumulation of at least one viral transcript, and prohibited the production of infective progeny phage. We suggest that TF1 function is required to shut off the expression of several early-middle and middle viral genes and that TF1 plays a role in phage head morphogenesis. Spontaneous second-site mutations of the temperature-sensitive mutant TF1 allele that suppressed its associated phenotypes were analyzed. These suppressor mutations conferred greater amino acid sequence homology with the type II DNA-binding protein from the thermophile Bacillus stearothermophilus.

p16(INK4a) -mediated suppression of telomerase in normal and malignant human breast cells.

PubMed

Bazarov, Alexey V; Van Sluis, Marjolein; Hines, William C; Bassett, Ekaterina; Beliveau, Alain; Campeau, Eric; Mukhopadhyay, Rituparna; Lee, Won Jae; Melodyev, Sonya; Zaslavsky, Yuri; Lee, Leonard; Rodier, Francis; Chicas, Agustin; Lowe, Scott W; Benhattar, Jean; Ren, Bing; Campisi, Judith; Yaswen, Paul

2010-10-01

The cyclin-dependent kinase inhibitor p16(INK4a) (CDKN2A) is an important tumor suppressor gene frequently inactivated in human tumors. p16 suppresses the development of cancer by triggering an irreversible arrest of cell proliferation termed cellular senescence. Here, we describe another anti-oncogenic function of p16 in addition to its ability to halt cell cycle progression. We show that transient expression of p16 stably represses the hTERT gene, encoding the catalytic subunit of telomerase, in both normal and malignant breast epithelial cells. Short-term p16 expression increases the amount of histone H3 trimethylated on lysine 27 (H3K27) bound to the hTERT promoter, resulting in transcriptional silencing, likely mediated by polycomb complexes. Our results indicate that transient p16 exposure may prevent malignant progression in dividing cells by irreversible repression of genes, such as hTERT, whose activity is necessary for extensive self-renewal. © 2010 The Authors Aging Cell © 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

Elucidation of Chromatin Remodeling Machinery Involved in Regulation of Estrogen Receptor Alpha Expression in Human Breast Cancer Cells

DTIC Science & Technology

2006-08-01

depsipeptide with 5-aza-dC has been shown to synergistically reactivate silenced tumor suppressor genes in human cancer cells, including MLH1 , TIMP3...depsipeptide with 5- aza-dC has been shown to synergistically reactivate silenced tumor suppressor genes in human cancer cells, including MLH1 , TIMP3

PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

ERIC Educational Resources Information Center

Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

2009-01-01

Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

Metastasis Suppressor Gene Inactivates Actin-Based Mechanism of Tumor Cell Motility | Center for Cancer Research

Cancer.gov

Metastasis is responsible for up to 90 percent of all cancer-related deaths. Though proteins derived from nearly a dozen metastasis suppressor genes have been discovered over the past 15 years, strategies for exploiting the proteins in metastasis-prevention therapies has been hampered by the lack of knowledge regarding the mechanisms underlying the proteins’ interactions with

Neurofibromatosis type 1 (NF1) gene: Beyond café au lait spots and dermal neurofibromas.

PubMed

Peltonen, Sirkku; Kallionpää, Roope A; Peltonen, Juha

2017-07-01

Neurofibromatosis 1 (NF1) occurs in 1:2000 births. The main diagnostic signs are visible on the skin, and this opens several interesting aspects for dermatological point of view. The NF1 syndrome is caused by mutations in the NF1 gene which encodes the tumor suppressor protein neurofibromin. Neurofibromin functions as a Ras-GTPase-activating protein (RasGAP), and NF1 mutations lead to overactivation of the Ras signalling pathway. The NF1 gene and neurofibromin have intriguing functions in keratinocytes and melanocytes. Neurofibromin regulates melanin synthesis and keratinocyte differentiation in a currently unknown manner. The NF1 gene has also an important but poorly understood role in tumorigenesis and cancer. Compared to the general population, NF1 patients have a fivefold risk for cancer and a more than 2000-fold risk for neurogenic malignancies. Mutations of the NF1 gene are common in numerous cancer types in patients without NF1, and this suggests a more general role for the NF1 gene in oncogenesis. In melanoma, NF1 mutations seem to drive tumorigenesis and contribute to drug resistance. In this article, we review the literature on neurofibromin with special attention to keratinocytes, melanocytes, NF1-related tumors and melanoma. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Functional characterization of EZH2β reveals the increased complexity of EZH2 isoforms involved in the regulation of mammalian gene expression

PubMed Central

2013-01-01

Background Histone methyltransferase enhancer of zeste homologue 2 (EZH2) forms an obligate repressive complex with suppressor of zeste 12 and embryonic ectoderm development, which is thought, along with EZH1, to be primarily responsible for mediating Polycomb-dependent gene silencing. Polycomb-mediated repression influences gene expression across the entire gamut of biological processes, including development, differentiation and cellular proliferation. Deregulation of EZH2 expression is implicated in numerous complex human diseases. To date, most EZH2-mediated function has been primarily ascribed to a single protein product of the EZH2 locus. Results We report that the EZH2 locus undergoes alternative splicing to yield at least two structurally and functionally distinct EZH2 methyltransferases. The longest protein encoded by this locus is the conventional enzyme, which we refer to as EZH2α, whereas EZH2β, characterized here, represents a novel isoform. We find that EZH2β localizes to the cell nucleus, complexes with embryonic ectoderm development and suppressor of zeste 12, trimethylates histone 3 at lysine 27, and mediates silencing of target promoters. At the cell biological level, we find that increased EZH2β induces cell proliferation, demonstrating that this protein is functional in the regulation of processes previously attributed to EZH2α. Biochemically, through the use of genome-wide expression profiling, we demonstrate that EZH2β governs a pattern of gene repression that is often ontologically redundant from that of EZH2α, but also divergent for a wide variety of specific target genes. Conclusions Combined, these results demonstrate that an expanded repertoire of EZH2 writers can modulate histone code instruction during histone 3 lysine 27-mediated gene silencing. These data support the notion that the regulation of EZH2-mediated gene silencing is more complex than previously anticipated and should guide the design and interpretation of future studies aimed at understanding the biochemical and biological roles of this important family of epigenomic regulators. PMID:23448518

Suppressors of dGTP Starvation in Escherichia coli

PubMed Central

Itsko, Mark

2017-01-01

ABSTRACT dGTP starvation, a newly discovered phenomenon in which Escherichia coli cells are starved specifically for the DNA precursor dGTP, leads to impaired growth and, ultimately, cell death. Phenomenologically, it represents an example of nutritionally induced unbalanced growth: cell mass amplifies normally as dictated by the nutritional status of the medium, but DNA content growth is specifically impaired. The other known example of such a condition, thymineless death (TLD), involves starvation for the DNA precursor dTTP, which has been found to have important chemotherapeutic applications. Experimentally, dGTP starvation is induced by depriving an E. coli gpt optA1 strain of its required purine source, hypoxanthine. In our studies of this phenomenon, we noted the emergence of a relatively high frequency of suppressor mutants that proved resistant to the treatment. To study such suppressors, we used next-generation sequencing on a collection of independently obtained mutants. A significant fraction was found to carry a defect in the PurR transcriptional repressor, controlling de novo purine biosynthesis, or in its downstream purEK operon. Thus, upregulation of de novo purine biosynthesis appears to be a major mode of overcoming the lethal effects of dGTP starvation. In addition, another large fraction of the suppressors contained a large tandem duplication of a 250- to 300-kb genomic region that included the purEK operon as well as the acrAB-encoded multidrug efflux system. Thus, the suppressive effects of the duplications could potentially involve beneficial effects of a number of genes/operons within the amplified regions. IMPORTANCE Concentrations of the four precursors for DNA synthesis (2′-deoxynucleoside-5′-triphosphates [dNTPs]) are critical for both the speed of DNA replication and its accuracy. Previously, we investigated consequences of dGTP starvation, where the DNA precursor dGTP was specifically reduced to a low level. Under this condition, E. coli cells continued cell growth but eventually developed a DNA replication defect, leading to cell death due to formation of unresolvable DNA structures. Nevertheless, dGTP-starved cultures eventually resumed growth due to the appearance of resistant mutants. Here, we used whole-genome DNA sequencing to identify the responsible suppressor mutations. We show that the majority of suppressors can circumvent death by upregulating purine de novo biosynthesis, leading to restoration of dGTP to acceptable levels. PMID:28373271

Decreased Genetic Dosage of Hepatic Yin Yang 1 Causes Diabetic-Like Symptoms

PubMed Central

Verdeguer, Francisco; Blättler, Sharon M.; Cunningham, John T.; Hall, Jessica A.; Chim, Helen

2014-01-01

Insulin sensitivity in liver is characterized by the ability of insulin to efficiently inhibit glucose production and fatty acid oxidation as well as promote de novo lipid biosynthesis. Specific dysregulation of glucose and lipid metabolism in liver is sufficient to cause insulin resistance and type 2 diabetes; this is seen by a selective inability of insulin to suppress glucose production while remaining insulin-sensitive to de novo lipid biosynthesis. We have previously shown that the transcription factor Yin Yang 1 (YY1) controls diabetic-linked glucose and lipid metabolism gene sets in skeletal muscle, but whether liver YY1-targeted metabolic genes impact a diabetic phenotype is unknown. Here we show that decreased genetic dosage of YY1 in liver causes insulin resistance, hepatic lipid accumulation, and dyslipidemia. Indeed, YY1 liver-specific heterozygous mice exhibit blunted activation of hepatic insulin signaling in response to insulin. Mechanistically, YY1, through direct recruitment to promoters, functions as a suppressor of genes encoding for metabolic enzymes of the gluconeogenic and lipogenic pathways and as an activator of genes linked to fatty acid oxidation. These counterregulatory transcriptional activities make targeting hepatic YY1 an attractive approach for treating insulin-resistant diabetes. PMID:24467246

Drosophila homolog of the human S6 ribosomal protein is required for tumor suppression in the hematopoietic system.

PubMed Central

Watson, K L; Konrad, K D; Woods, D F; Bryant, P J

1992-01-01

The tumor suppressor gene lethal(1)aberrant immune response 8 (air8) of Drosophila melanogaster encodes a homolog of the human S6 ribosomal protein. P element insertions that prevent expression of this gene cause overgrowth of the lymph glands (the hematopoietic organs), abnormal blood cell differentiation, and melanotic tumor formation. They also cause delayed development, inhibit growth of most of the larval organs, and lead to larval lethality. Mitotic recombination experiments indicate that the normal S6 gene is required for clone survival in the germ line and imaginal discs. The S6 gene produces a 1.1-kilobase transcript that is abundant throughout development in wild-type animals and in revertants derived from the insertional mutants but is barely detectable in the mutant larvae. cDNAs corresponding to this transcript show a 248-amino acid open reading frame with 75.4% identity and 94.8% similarity to both human and rat S6 ribosomal protein sequences. The results reveal a regulatory function of this ribosomal protein in the hematopoietic system of Drosophila that may be related to its developmentally regulated phosphorylation. Images PMID:1454811

LARG at chromosome 11q23 has functional characteristics of a tumor suppressor in human breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ong, Danny C.T.; Rudduck, Christina; Chin, Koei

2008-05-06

Deletion of 11q23-q24 is frequent in a diverse variety of malignancies, including breast and colorectal carcinoma, implicating the presence of a tumor suppressor gene at that chromosomal region. We show here that LARG, from 11q23, has functional characteristics of a tumor suppressor. We examined a 6-Mb region on 11q23 by high-resolution deletion mapping, utilizing both loss of heterozygosity (LOH) analysis and microarray comparative genomic hybridization (CGH). LARG (also called ARHGEF12), identified from the analyzed region, was underexpressed in 34% of primary breast carcinomas and 80% of breast cancer cell lines including the MCF-7 line. Multiplex ligation-dependent probe amplification on 30more » primary breast cancers and six breast cancer cell lines showed that LARG had the highest frequency of deletion compared to the BCSC-1 and TSLC1 genes, two known candidate tumor suppressor genes from 11q. In vitro analysis of breast cancer cell lines that underexpress LARG showed that LARG could be reactivated by trichostatin A, a histone deacetylase inhibitor, but not by 5-Aza-2{prime}-deoxycytidine, a demethylating agent. Bisulfite sequencing and quantitative high-throughput analysis of DNA methylation confirmed the lack of CpG island methylation in LARG in breast cancer. Restoration of LARG expression in MCF-7 cells by stable transfection resulted in reduced proliferation and colony formation, suggesting that LARG has functional characteristics of a tumor suppressor gene.« less

Targeted deletion of MKK4 in cancer cells: a detrimental phenotype manifests as decreased experimental metastasis and suggests a counterweight to the evolution of tumor-suppressor loss.

PubMed

Cunningham, Steven C; Gallmeier, Eike; Hucl, Tomas; Dezentje, David A; Calhoun, Eric S; Falco, Geppino; Abdelmohsen, Kotb; Gorospe, Myriam; Kern, Scott E

2006-06-01

Tumor-suppressors have commanded attention due to the selection for their inactivating mutations in human tumors. However, relatively little is understood about the inverse, namely, that tumors do not select for a large proportion of seemingly favorable mutations in tumor-suppressor genes. This could be explained by a detrimental phenotype accruing in a cell type-specific manner to most cells experiencing a biallelic loss. For example, MKK4, a tumor suppressor gene distinguished by a remarkably consistent mutational rate across diverse tumor types and an unusually high rate of loss of heterozygosity, has the surprisingly low rate of genetic inactivation of only approximately 5%. To explore this incongruity, we engineered a somatic gene knockout of MKK4 in human cancer cells. Although the null cells resembled the wild-type cells regarding in vitro viability and proliferation in plastic dishes, there was a marked difference in a more relevant in vivo model of experimental metastasis and tumorigenesis. MKK4(-/-) clones injected i.v. produced fewer lung metastases than syngeneic MKK4-competent cells (P = 0.0034). These findings show how cell type-specific detrimental phenotypes can offer a paradoxical and yet key counterweight to the selective advantage attained by cells as they experiment with genetic null states during tumorigenesis, the resultant balance then determining the observed biallelic mutation rate for a given tumor-suppressor gene.

CDKN2B loss promotes progression from benign melanocytic nevus to melanoma

PubMed Central

McNeal, Andrew S.; Liu, Kevin; Nakhate, Vihang; Natale, Christopher A.; Duperret, Elizabeth K.; Capell, Brian C.; Dentchev, Tzvete; Berger, Shelley L.; Herlyn, Meenhard; Seykora, John T.; Ridky, Todd W.

2015-01-01

Deletion of the entire CDKN2B-CDKN2A gene cluster is among the most common genetic events in cancer. The tumor-promoting effects are generally attributed to loss of CDKN2A-encoded p16 and p14ARF tumor suppressors. The degree to which the associated CDKN2B-encoded p15 loss contributes to human tumorigenesis is unclear. Here we show that CDKN2B is highly upregulated in benign melanocytic nevi, contributes to maintaining nevus melanocytes in a growth-arrested premalignant state, and is commonly lost in melanoma. Using primary melanocytes isolated directly from freshly excised human nevi naturally expressing the common BRAF(V600E) activating mutation, nevi progressing to melanoma, and normal melanocytes engineered to inducibly express BRAF(V600E), we show that BRAF activation results in reversible, TGFβ-dependent, p15 induction that halts proliferation. Further, we engineer human skin grafts containing nevus-derived melanocytes to establish a new, architecturally faithful, in vivo melanoma model, and demonstrate that p15 loss promotes the transition from benign nevus to melanoma. PMID:26183406

Rat1p and Xrn1p are functionally interchangeable exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively.

PubMed Central

Johnson, A W

1997-01-01

XRN1 encodes an abundant cytoplasmic exoribonuclease, Xrn1p, responsible for mRNA turnover in yeast. A screen for bypass suppressors of the inviability of xrn1 ski2 double mutants identified dominant alleles of RAT1, encoding an exoribonuclease homologous with Xrn1p. These RAT1 alleles restored XRN1-like functions, including cytoplasmic RNA turnover, wild-type sensitivity to the microtubule-destabilizing drug benomyl, and sporulation. The mutations were localized to a region of the RAT1 gene encoding a putative bipartite nuclear localization sequence (NLS). Fusions to green fluorescent protein were used to demonstrate that wild-type Rat1p is localized to the nucleus and that the mutant alleles result in mislocalization of Rat1p to the cytoplasm. Conversely, targeting Xrn1p to the nucleus by the addition of the simian virus 40 large-T-antigen NLS resulted in complementation of the temperature sensitivity of a rat1-1 strain. These results indicate that Xrn1p and Rat1p are functionally interchangeable exoribonucleases that function in and are restricted to the cytoplasm and nucleus, respectively. It is likely that the higher eukaryotic homologs of these proteins will function similarly in the cytoplasm and nucleus. PMID:9315672

Two Forkhead transcription factors regulate the division of cardiac progenitor cells by a Polo-dependent pathway

PubMed Central

Ahmad, Shaad M.; Tansey, Terese R.; Busser, Brian W.; Nolte, Michael T.; Jeffries, Neal; Gisselbrecht, Stephen S.; Rusan, Nasser M.; Michelson, Alan M.

2012-01-01

SUMMARY The development of a complex organ requires the specification of appropriate numbers of each of its constituent cell types, as well as their proper differentiation and correct positioning relative to each other. During Drosophila cardiogenesis, all three of these processes are controlled by jumeau (jumu) and Checkpoint suppressor homologue (CHES-1-like), two genes encoding forkhead transcription factors that we discovered utilizing an integrated genetic, genomic and computational strategy for identifying genes expressed in the developing Drosophila heart. Both jumu and CHES-1-like are required during asymmetric cell division for the derivation of two distinct cardiac cell types from their mutual precursor, and in symmetric cell divisions that produce yet a third type of heart cell. jumu and CHES-1-like control the division of cardiac progenitors by regulating the activity of Polo, a kinase involved in multiple steps of mitosis. This pathway demonstrates how transcription factors integrate diverse developmental processes during organogenesis. PMID:22814603

Frasier syndrome with childhood-onset renal failure.

PubMed

Buzi, F; Mella, P; Pilotta, A; Felappi, B; Camerino, G; Notarangelo, L D

2001-01-01

The Wilms' tumour 1 (WT1) gene encodes a protein which is believed to exert transcriptional and tumour-suppressor activities. Mutations of this gene have occasionally been associated with Wilms' tumour (<15% of cases) and, more consistently, with three syndromes characterized by urogenital abnormalities (WAGR, Denys-Drash and Frasier syndrome). SUBJECT/METHOD: A 25-year-old phenotypic female with a 46,XY karyotype presented with amenorrhoea. An ultrasound scan showed streak gonads and a rudimentary uterus. The patient had a history of post-streptococcal glomerulonephrosis, when aged 4 years, which had rapidly progressed to kidney failure, requiring transplantation at age 8. Frasier syndrome was suspected and confirmed by genetic analysis. In fact, direct sequencing of the PCR product of the intron 9 donor splice site revealed a substitution of guanine for adenine in position +5. Besides being one of the few Frasier syndrome cases to be genetically characterized, this case is interesting because of the unusually early-onset renal failure. Copyright 2001 S. Karger AG, Basel

Study on expression of CDH4 in lung cancer.

PubMed

Li, Zhupeng; Su, Dan; Ying, Lisha; Yu, Guangmao; Mao, Weimin

2017-01-17

The human CDH4 gene, which encodes the R-cadherin protein, has an important role in cell migration and cell adhesion, sorting, tissue morphogenesis, and tumor genesis. This study analyzed the relationship of CDH4 mRNA expression with lung cancer. Real time PCR was applied to detect CDH4 mRNA transcription in 142 paired cases of lung cancer and noncancerous regions. No correlation was identified between CDH4 mRNA expression and gender, age, lymphnode metastasis, TNM stage, family history, smoking state, drinking state (P > 0.05), but grade and histotype (P < 0.05). The relative CDH4 mRNA value was remarkably decreased in lung cancer tissues compared with noncancerous tissues (P = 0.001). We found that CDH4 mRNA expression was associated with grade and histotype. What is more, the relative CDH4 mRNA value was decreased in the lung cancer tissues. Our results suggested that CDH4 might be a putative tumor suppressor gene (TSG) in lung cancer.

Decoding the genetic basis of Cushing's disease: USP8 in the spotlight.

PubMed

Theodoropoulou, Marily; Reincke, Martin; Fassnacht, Martin; Komada, Masayuki

2015-10-01

Cushing's disease (CD) arises from pituitary-dependent glucocorticoid excess due to an ACTH-secreting corticotroph tumor. Genetic hits in oncogenes and tumor suppressor genes that afflict other pituitary tumor subtypes are not found in corticotrophinomas. Recently, a somatic mutational hotspot was found in up to half of corticotrophinomas in the USP8 gene that encodes a protein that impairs the downregulation of the epidermal growth factor receptor (EGFR) and enables its constitutive signaling. EGF is an important regulator of corticotroph function and its receptor is highly expressed in Cushing's pituitary tumors, where it leads to increased ACTH synthesis in vitro and in vivo. The mutational hotspot found in corticotrophinomas hyper-activates USP8, enabling it to rescue EGFR from lysosomal degradation and ensure its stimulatory signaling. This review presents new developments in the study of the genetics of CD and focuses on the USP8-EGFR system as trigger and target of corticotroph tumorigenesis. © 2015 European Society of Endocrinology.

The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development

PubMed Central

Ortega-Molina, Ana; Boss, Isaac W.; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W.; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A.; Gascoyne, Randy D.; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M.; Wendel, Hans-Guido

2015-01-01

The lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL). However, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center (GC) involution, impedes B cell differentiation and class switch recombination (CSR). Integrative genomic analyses indicate that KMT2D affects H3K4 methylation and expression of a specific set of genes including those in the CD40, JAK-STAT, Toll-like receptor, and B cell receptor pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3, and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell activating pathways. PMID:26366710

Metastasis Suppressor Gene Inactivates Actin-Based Mechanism of Tumor Cell Motility | Center for Cancer Research

Cancer.gov

Metastasis is responsible for up to 90 percent of all cancer-related deaths. Though proteins derived from nearly a dozen metastasis suppressor genes have been discovered over the past 15 years, strategies for exploiting the proteins in metastasis-prevention therapies has been hampered by the lack of knowledge regarding the mechanisms underlying the proteins’ interactions with other proteins.

Cyclic di-adenosine monophosphate (c-di-AMP) is required for osmotic regulation in Staphylococcus aureus but dispensable for viability in anaerobic conditions.

PubMed

Zeden, Merve S; Schuster, Christopher F; Bowman, Lisa; Zhong, Qiyun; Williams, Huw D; Gründling, Angelika

2018-03-02

Cyclic di-adenosine monophosphate (c-di-AMP) is a recently discovered signaling molecule important for the survival of Firmicutes, a large bacterial group that includes notable pathogens such as Staphylococcus aureus However, the exact role of this molecule has not been identified. dacA , the S. aureus gene encoding the diadenylate cyclase enzyme required for c-di-AMP production, cannot be deleted when bacterial cells are grown in rich medium, indicating that c-di-AMP is required for growth in this condition. Here, we report that an S. aureus dacA mutant can be generated in chemically defined medium. Consistent with previous findings, this mutant had a severe growth defect when cultured in rich medium. Using this growth defect in rich medium, we selected for suppressor strains with improved growth to identify c-di-AMP-requiring pathways. Mutations bypassing the essentiality of dacA were identified in alsT and opuD, encoding a predicted amino acid and osmolyte transporter, the latter of which we show here to be the main glycine betaine-uptake system in S. aureus. Inactivation of these transporters likely prevents the excessive osmolyte and amino acid accumulation in the cell, providing further evidence for a key role of c-di-AMP in osmotic regulation. Suppressor mutations were also obtained in hepS, hemB, ctaA, and qoxB, coding proteins required for respiration. Furthermore, we show that dacA is dispensable for growth in anaerobic conditions. Together, these findings reveal an essential role for the c-di-AMP signaling network in aerobic, but not anaerobic, respiration in S. aureus . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Gene array analysis reveals a common Runx transcriptional program controlling cell adhesion and survival

PubMed Central

Wotton, Sandy; Terry, Anne; Kilbey, Anna; Jenkins, Alma; Herzyk, Pawel; Cameron, Ewan; Neil, James C.

2008-01-01

The Runx genes play divergent roles in development and cancer, where they can act either as oncogenes or tumour suppressors. We compared the effects of ectopic Runx expression in established fibroblasts, where all three genes produce an indistinguishable phenotype entailing epithelioid morphology and increased cell survival under stress conditions. Gene array analysis revealed a strongly overlapping transcriptional signature, with no examples of opposing regulation of the same target gene. A common set of 50 highly regulated genes was identified after further filtering on regulation by inducible RUNX1-ER. This set revealed a strong bias towards genes with annotated roles in cancer and development, and a preponderance of targets encoding extracellular or surface proteins, reflecting the marked effects of Runx on cell adhesion. Furthermore, in silico prediction of resistance to glucocorticoid growth inhibition was confirmed in fibroblasts and lymphoid cells expressing ectopic Runx. The effects of fibroblast expression of common RUNX1 fusion oncoproteins (RUNX1-ETO, TEL-RUNX1, CBFB-MYH11) were also tested. While two direct Runx activation target genes were repressed (Ncam1, Rgc32), the fusion proteins appeared to disrupt regulation of down-regulated targets (Cebpd, Id2, Rgs2) rather than impose constitutive repression. These results elucidate the oncogenic potential of the Runx family and reveal novel targets for therapeutic inhibition. PMID:18560354

MiR-339 and especially miR-766 reactivate the expression of tumor suppressor genes in colorectal cancer cell lines through DNA methyltransferase 3B gene inhibition.

PubMed

Afgar, Ali; Fard-Esfahani, Pezhman; Mehrtash, Amirhosein; Azadmanesh, Kayhan; Khodarahmi, Farnaz; Ghadir, Mahdis; Teimoori-Toolabi, Ladan

2016-11-01

It is observed that upregulation of DNMT3B enzyme in some cancers, including colon cancer, could lead to silencing of tumor suppressor genes. MiR-339 and miR-766 have been predicted to target 3'UTR of DNMT3B gene. Luciferase reporter assay validated that individual and co-transfection of miR-766 and miR-339 into the HEK293T cell reduced luciferase activity to 26% ± 0.41%, 43% ± 0.42 and 64% ± 0.52%, respectively, compared to the control (P < 0.05). Furthermore, transduction of miR-339 and miR-766 expressing viruses into colon cancer cell lines (SW480 and HCT116) decreased DNMT3B expression (1.5, 3-fold) and (3, 4-fold), respectively. In addition, DNA methylation of some tumor suppressor genes decreased. Expression of these genes such as SFRP1 (2 and 1.6-fold), SFRP2 (0.07 and 4-fold), WIF1 (0.05 and 4-fold), and DKK2 (2 and 4-fold) increased in SW-339 and SW-766 cell lines; besides, expression increments for these genes in HCT-339 and HCT-766 cell lines were (2.8, 4-fold), (0.005, 1.5-fold), (1.7 and 3-fold) and (0.04, 1.7-fold), respectively. Also, while in SW-766, cell proliferation reduced to 2.8% and 21.7% after 24 and 48 hours, respectively, SW-339 showed no reduced proliferation. Meanwhile, HCT-766 and HCT-339 showed (3.5%, 12.8%) and (18.8%, 33.9%) reduced proliferation after 24 and 48 hours, respectively. Finally, targeting DNMT3B by these miRs, decreased methylation of tumor suppressor genes such as SFRP1, SFRP2, WIF1 and DKK2 in the mentioned cell lines, and returned the expression of these tumor suppressor genes which can contribute to lethal effect on colon cancer cells and reducing tumorigenicity of these cells.

Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

PubMed

van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

2005-06-10

To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

Identifying Breast Tumor Suppressors Using in Vitro and in Vivo RNAi Screens

DTIC Science & Technology

2011-10-01

vivo RNA interference screen, breast cancer , tumor suppressor, leukemia inhibitory factor receptor (LIFR) 16. SECURITY CLASSIFICATION OF: 17...The identification of these genes will improve the understanding of the causes of breast cancer , which may lead to therapeutic advancements for... breast cancer prevention and treatment. BODY Objective 1: Identification of breast tumor suppressors using in vitro and in vivo RNAi screens

Myxovirus resistance, osteopontin and suppressor of cytokine signaling 3 polymorphisms predict hepatitis C virus therapy response in an admixed patient population: comparison with IL28B.

PubMed

Angelo, Ana Luiza Dias; Cavalcante, Lourianne Nascimento; Abe-Sandes, Kiyoko; Machado, Taísa Bonfim; Lemaire, Denise Carneiro; Malta, Fernanda; Pinho, João Renato; Lyra, Luiz Guilherme Costa; Lyra, Andre Castro

2013-10-01

Suppressor of cytokine signaling 3, myxovirus resistance protein and osteopontin gene polymorphisms may influence the therapeutic response in patients with chronic hepatitis C, and an association with IL28 might increase the power to predict sustained virologic response. Our aims were to evaluate the association between myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 gene polymorphisms in combination with IL28B and to assess the therapy response in hepatitis C patients treated with pegylated-interferon plus ribavirin. Myxovirus resistance protein, osteopontin, suppressor of cytokine signaling 3 and IL28B polymorphisms were analyzed by PCR-restriction fragment length polymorphism, direct sequencing and real-time PCR. Ancestry was determined using genetic markers. We analyzed 181 individuals, including 52 who were sustained virologic responders. The protective genotype frequencies among the sustained virologic response group were as follows: the G/G suppressor of cytokine signaling 3 (rs4969170) (62.2%); T/T osteopontin (rs2853744) (60%); T/T osteopontin (rs11730582) (64.3%); and the G/T myxovirus resistance protein (rs2071430) genotype (54%). The patients who had ≥3 of the protective genotypes from the myxovirus resistance protein, the suppressor of cytokine signaling 3 and osteopontin had a greater than 90% probability of achieving a sustained response (p<0.0001). The C/C IL28B genotype was present in 58.8% of the subjects in this group. The sustained virological response rates increased to 85.7% and 91.7% by analyzing C/C IL28B with the T/T osteopontin genotype at rs11730582 and the G/G suppressor of cytokine signaling 3 genotype, respectively. Genetic ancestry analysis revealed an admixed population. Hepatitis C genotype 1 patients who were responders to interferon-based therapy had a high frequency of multiple protective polymorphisms in the myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 genes. The combined analysis of the suppressor of cytokine signaling 3 and IL28B genotypes more effectively predicted sustained virologic response than IL28B analysis alone.

A mutation in the neurofibromatosis type 2 tumor-suppressor gene, giving rise to widely different clinical phenotypes in two unrelated individuals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bourn, D.; Carter, S.A.; Goodship, J.

The authors have sought mutations in the recently identified neurofibromatosis type 2 (NF2) tumor-suppressor gene in a large panel of NF2 patients, using PCR-based SSCP and heteroduplex analysis, followed by cloning and sequencing of appropriate PCR products. Two unrelated NF2 patients were found to have identical nonsense mutations caused by a C-to-T transition in a CpG dinucleotide that is a potential mutational hot spot in the NF2 tumor-suppressor gene. Unexpectedly, the two individuals had widely different clinical phenotypes, representing the severe Wishart and mild Gardner clinical subtypes. Analysis of DNA samples from different tissues of the mildly affected patient suggestsmore » that he is a somatic mosaic for the mutation. 26 refs., 3 figs.« less

High-resolution array comparative genomic hybridization (aCGH) identifies copy number alterations in diffuse large B-cell lymphoma that predict response to immuno-chemotherapy

PubMed Central

Kreisel, F.; Kulkarni, S.; Kerns, R. T.; Hassan, A.; Deshmukh, H.; Nagarajan, R.; Frater, J. L.; Cashen, A.

2013-01-01

Despite recent attempts at sub-categorization, including gene expression profiling into prognostically different groups of “germinal center B-cell type” and “activated B-cell type”, diffuse large B-cell lymphoma (DLBCL) remains a biologically heterogenous tumor with no clear prognostic biomarkers to guide therapy. Whole genome, high resolution array comparative genomic hybridization (aCGH) was performed on 4 cases of chemoresistant DLBCL and 4 cases of chemo-responsive DLBCL to identify genetic differences which may correlate with response to R-CHOP therapy. Array CGH analysis identified 7 DNA copy number alteration (CNA) regions exclusive to the chemoresistant group, consisting of amplifications at 1p36.13, 1q42.3, 3p21.31, 7q11.23, and 16p13.3, and loss at 9p21.3, and 14p21.31. Copy number loss of the tumor suppressor genes CDKN2A (p16, p14) and CDKN2B (p15) at 9p21.3 was validated by fluorescence in situ hybridization and immunohistochemistry as independent techniques. In the chemo-sensitive group, 12 CNAs were detected consisting of segment gains on 1p36.11, 1p36.22, 2q11.2, 8q24.3, 12p13.33, and 22q13.2 and segment loss on 6p21.32. RUNX3, a tumor suppressor gene located on 1p36.11 and MTHFR, which encodes for the enzyme methylenetetrahydrofolate reductase, located on 1p36.22 are the only known genes in this group associated with lymphoma. Whole genome aCGH analysis has detected copy number alterations exclusive to either chemoresistant or chemo-responsive DLBCL that may represent consistent clonal changes predictive for prognosis and outcome of chemotherapy. PMID:21504712

Structure-Based Analysis Reveals Cancer Missense Mutations Target Protein Interaction Interfaces.

PubMed

Engin, H Billur; Kreisberg, Jason F; Carter, Hannah

2016-01-01

Recently it has been shown that cancer mutations selectively target protein-protein interactions. We hypothesized that mutations affecting distinct protein interactions involving established cancer genes could contribute to tumor heterogeneity, and that novel mechanistic insights might be gained into tumorigenesis by investigating protein interactions under positive selection in cancer. To identify protein interactions under positive selection in cancer, we mapped over 1.2 million nonsynonymous somatic cancer mutations onto 4,896 experimentally determined protein structures and analyzed their spatial distribution. In total, 20% of mutations on the surface of known cancer genes perturbed protein-protein interactions (PPIs), and this enrichment for PPI interfaces was observed for both tumor suppressors (Odds Ratio 1.28, P-value < 10(-4)) and oncogenes (Odds Ratio 1.17, P-value < 10(-3)). To study this further, we constructed a bipartite network representing structurally resolved PPIs from all available human complexes in the Protein Data Bank (2,864 proteins, 3,072 PPIs). Analysis of frequently mutated cancer genes within this network revealed that tumor-suppressors, but not oncogenes, are significantly enriched with functional mutations in homo-oligomerization regions (Odds Ratio 3.68, P-Value < 10(-8)). We present two important examples, TP53 and beta-2-microglobulin, for which the patterns of somatic mutations at interfaces provide insights into specifically perturbed biological circuits. In patients with TP53 mutations, patient survival correlated with the specific interactions that were perturbed. Moreover, we investigated mutations at the interface of protein-nucleotide interactions and observed an unexpected number of missense mutations but not silent mutations occurring within DNA and RNA binding sites. Finally, we provide a resource of 3,072 PPI interfaces ranked according to their mutation rates. Analysis of this list highlights 282 novel candidate cancer genes that encode proteins participating in interactions that are perturbed recurrently across tumors. In summary, mutation of specific protein interactions is an important contributor to tumor heterogeneity and may have important implications for clinical outcomes.

Transcriptional activation of the suppressor of cytokine signaling-3 (SOCS-3) gene via STAT3 is increased in F9 REX1 (ZFP-42) knockout teratocarcinoma stem cells relative to wild-type cells.

PubMed

Xu, Juliana; Sylvester, Renia; Tighe, Ann P; Chen, Siming; Gudas, Lorraine J

2008-03-14

Rex1 (Zfp42), first identified as a gene that is transcriptionally repressed by retinoic acid (RA), encodes a zinc finger transcription factor expressed at high levels in F9 teratocarcinoma stem cells, embryonic stem cells, and other stem cells. Loss of both alleles of Rex1 by homologous recombination alters the RA-induced differentiation of F9 cells, a model of pluripotent embryonic stem cells. We identified Suppressor of Cytokine Signaling-3 (SOCS-3) as a gene that exhibits greatly increased transcriptional activation in RA, cAMP, and theophylline (RACT)-treated F9 Rex1(-/-) cells (approximately 25-fold) as compared to wild-type (WT) cells ( approximately 2.5-fold). By promoter deletion, mutation, and transient transfection analyses, we have shown that this transcriptional increase is mediated by the STAT3 DNA-binding elements located between -99 to -60 in the SOCS-3 promoter. Overexpression of STAT3 dominant-negative mutants greatly diminishes this SOCS-3 transcriptional increase in F9 Rex1(-/-) cells. This increase in SOCS-3 transcription is associated with a four- to fivefold higher level of tyrosine-phosphorylated STAT3 in the RACT-treated F9 Rex1(-/-) cells as compared to WT. Dominant-negative Src tyrosine kinase, Jak2, and protein kinase A partially reduce the transcriptional activation of the SOCS 3 gene in RACT-treated F9 Rex1 null cells. In contrast, parathyroid hormone peptide enhances the effect of RA in F9 Rex1(-/-) cells, but not in F9 WT. Thus, Rex1, which is highly expressed in stem cells, inhibits signaling via the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway, thereby modulating the differentiation of F9 cells.

Neuroblastoma cells undergo transcriptomic alterations upon dissemination into the bone marrow and subsequent tumor progression.

PubMed

Rifatbegovic, Fikret; Frech, Christian; Abbasi, M Reza; Taschner-Mandl, Sabine; Weiss, Tamara; Schmidt, Wolfgang M; Schmidt, Iris; Ladenstein, Ruth; Ambros, Inge M; Ambros, Peter F

2018-01-15

Neuroblastoma is the most common extracranial solid tumor in childhood. The vast majority of metastatic (M) stage patients present with disseminated tumor cells (DTCs) in the bone marrow (BM) at diagnosis and relapse. Although these cells represent a major obstacle in the treatment of neuroblastoma patients, insights into their expression profile remained elusive. The present RNA-Seq study of stage 4/M primary tumors, enriched BM-derived diagnostic and relapse DTCs, as well as the corresponding BM-derived mononuclear cells (MNCs) from 53 patients revealed 322 differentially expressed genes in DTCs as compared to the tumors (q < 0.001, |log 2 FC|>2). Particularly, the levels of transcripts encoded by mitochondrial DNA were elevated in DTCs, whereas, for example, genes involved in angiogenesis were downregulated. Furthermore, 224 genes were highly expressed in DTCs and only slightly, if at all, in MNCs (q < 8 × 10 -75 log 2 FC > 6). Interestingly, we found the transcriptome of relapse DTCs largely resembling those of diagnostic DTCs with only 113 differentially expressed genes under relaxed cut-offs (q < 0.01, |log 2 FC|>0.5). Notably, relapse DTCs showed a positional enrichment of 31 downregulated genes on chromosome 19, including five tumor suppressor genes: SIRT6, BBC3/PUMA, STK11, CADM4 and GLTSCR2. This first RNA-Seq analysis of neuroblastoma DTCs revealed their unique expression profile in comparison to the tumors and MNCs, and less pronounced differences between diagnostic and relapse DTCs. The latter preferentially affected downregulation of genes encoded by chromosome 19. As these alterations might be associated with treatment failure and disease relapse, further functional studies on DTCs should be considered. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Liu, E-mail: lyang@u.washington.edu; Medical Research Service, VA Puget Sound Health Care System, Seattle, WA 98108; Hu, Hsien-Ming

2010-11-05

Research highlights: {yields} Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. {yields} The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. {yields} While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. {yields} This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusionmore » protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.« less

Roles of plant hormones and anti-apoptosis genes during drought stress in rice (Oryza sativa L.).

PubMed

Ubaidillah, Mohammad; Safitri, Fika Ayu; Jo, Jun-Hyeon; Lee, Sang-Kyu; Hussain, Adil; Mun, Bong-Gyu; Chung, Il Kyung; Yun, Byung-Wook; Kim, Kyung-Min

2016-12-01

We previously identified the rice (Oryza sativa) senescence-associated gene OsSAP which encodes a highly conserved protein involved in anti-apoptotic activity. This novel Bax suppressor-related gene regulates tolerance to multiple stresses in yeast. Here, we show the effects of drought stress on leaf and root tissues of plants over-expressing OsSAP in relation to the levels of phytohormones, abscisic acid (ABA), jasmonic acid (JA), indole-3-carboxylic acid (ICA), gibberellic acid (GA 3 ), and zeatin. Results showed that rice plants over-expressing SAP were tolerant to drought stress compared to wild type and the plants over-expressing AtBI-1, which is a homolog of the human Bax inhibitor-1 in Arabidopsis. ABA and JA levels in OsSAP and AtBI-1 transgenic plants consistently increased up to at least 3 days after drought treatment, whereas lower GA 3 levels were recorded during early drought period. Comparison between control and transgenic plants overexpressing anti-apoptosis genes OsSAP and AtBI-1 resulted in different patterns of hormone levels, indicating that these genes are involved in the plant responses to drought stress and present an opportunity for further study on drought stress tolerance in rice and other plant species.

Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

PubMed Central

Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

2015-01-01

ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

Non-transmissible Sendai virus vector encoding c-myc suppressor FBP-interacting repressor for cancer therapy

PubMed Central

Matsushita, Kazuyuki; Shimada, Hideaki; Ueda, Yasuji; Inoue, Makoto; Hasegawa, Mamoru; Tomonaga, Takeshi; Matsubara, Hisahiro; Nomura, Fumio

2014-01-01

AIM: To investigate a novel therapeutic strategy to target and suppress c-myc in human cancers using far up stream element (FUSE)-binding protein-interacting repressor (FIR). METHODS: Endogenous c-Myc suppression and apoptosis induction by a transient FIR-expressing vector was examined in vivo via a HA-tagged FIR (HA-FIR) expression vector. A fusion gene-deficient, non-transmissible, Sendai virus (SeV) vector encoding FIR cDNA, SeV/dF/FIR, was prepared. SeV/dF/FIR was examined for its gene transduction efficiency, viral dose dependency of antitumor effect and apoptosis induction in HeLa (cervical squamous cell carcinoma) cells and SW480 (colon adenocarcinoma) cells. Antitumor efficacy in a mouse xenograft model was also examined. The molecular mechanism of the anti-tumor effect and c-Myc suppression by SeV/dF/FIR was examined using Spliceostatin A (SSA), a SAP155 inhibitor, or SAP155 siRNA which induce c-Myc by increasing FIR∆exon2 in HeLa cells. RESULTS: FIR was found to repress c-myc transcription and in turn the overexpression of FIR drove apoptosis through c-myc suppression. Thus, FIR expressing vectors are potentially applicable for cancer therapy. FIR is alternatively spliced by SAP155 in cancer cells lacking the transcriptional repression domain within exon 2 (FIR∆exon2), counteracting FIR for c-Myc protein expression. Furthermore, FIR forms a complex with SAP155 and inhibits mutual well-established functions. Thus, both the valuable effects and side effects of exogenous FIR stimuli should be tested for future clinical application. SeV/dF/FIR, a cytoplasmic RNA virus, was successfully prepared and showed highly efficient gene transduction in in vivo experiments. Furthermore, in nude mouse tumor xenograft models, SeV/dF/FIR displayed high antitumor efficiency against human cancer cells. SeV/dF/FIR suppressed SSA-activated c-Myc. SAP155 siRNA, potentially produces FIR∆exon2, and led to c-Myc overexpression with phosphorylation at Ser62. HA-FIR suppressed endogenous c-Myc expression and induced apoptosis in HeLa and SW480 cells. A c-myc transcriptional suppressor FIR expressing SeV/dF/FIR showed high gene transduction efficiency with significant antitumor effects and apoptosis induction in HeLa and SW480 cells. CONCLUSION: SeV/dF/FIR showed strong tumor growth suppression with no significant side effects in an animal xenograft model, thus SeV/dF/FIR is potentially applicable for future clinical cancer treatment. PMID:24764668

A structured viroid RNA serves as a substrate for dicer-like cleavage to produce biologically active small RNAs but is resistant to RNA-induced silencing complex-mediated degradation.

PubMed

Itaya, Asuka; Zhong, Xuehua; Bundschuh, Ralf; Qi, Yijun; Wang, Ying; Takeda, Ryuta; Harris, Ann R; Molina, Carlos; Nelson, Richard S; Ding, Biao

2007-03-01

RNA silencing is a potent means of antiviral defense in plants and animals. A hallmark of this defense response is the production of 21- to 24-nucleotide viral small RNAs via mechanisms that remain to be fully understood. Many viruses encode suppressors of RNA silencing, and some viral RNAs function directly as silencing suppressors as counterdefense. The occurrence of viroid-specific small RNAs in infected plants suggests that viroids can trigger RNA silencing in a host, raising the question of how these noncoding and unencapsidated RNAs survive cellular RNA-silencing systems. We address this question by characterizing the production of small RNAs of Potato spindle tuber viroid (srPSTVds) and investigating how PSTVd responds to RNA silencing. Our molecular and biochemical studies provide evidence that srPSTVds were derived mostly from the secondary structure of viroid RNAs. Replication of PSTVd was resistant to RNA silencing, although the srPSTVds were biologically active in guiding RNA-induced silencing complex (RISC)-mediated cleavage, as shown with a sensor system. Further analyses showed that without possessing or triggering silencing suppressor activities, the PSTVd secondary structure played a critical role in resistance to RISC-mediated cleavage. These findings support the hypothesis that some infectious RNAs may have evolved specific secondary structures as an effective means to evade RNA silencing in addition to encoding silencing suppressor activities. Our results should have important implications in further studies on RNA-based mechanisms of host-pathogen interactions and the biological constraints that shape the evolution of infectious RNA structures.

A loss of profilin-1 in late-stage oral squamous cell carcinoma.

PubMed

Adami, Guy R; O'Callaghan, Thomas N; Kolokythas, Antonia; Cabay, Robert J; Zhou, Yalu; Schwartz, Joel L

2017-08-01

The genes for PFN1 and TMSB4 are both highly expressed in oral tissue and both encode actin monomer binding proteins thought to play a role in cell motility and possibly other crucial parts of tumor progression. Oral brush cytology of epithelium from oral squamous cell carcinoma (OSCC) was used to measure PFN1 and TMSB4 mRNA in OSCC, while immunohistochemical analysis of tissue was used to check protein levels. High but variable expression of mRNAs encoding these two proteins was observed suggesting they may contribute to tumor characteristics in a subset of OSCCs. Both proteins were highly expressed in normal appearing basal epithelium, in the cytoplasm, and perinuclear area, while expression was minimal in upper epithelial layers. In OSCCs, expression of these proteins varied. In tumors classified as later stage, based on size and/or lymph node involvement, PFN1 levels were lower in tumor epithelium. A control gene, KRT13, showed expression in normal differentiated basal and suprabasal oral mucosa epithelial cells and as reported was lost in OSCC cells. Loss of PFN1 in tumor cells has been associated with lymph node invasion and metastasis in other tumor types, strengthening the argument that the protein has the potential to be a tumor suppressor in late-stage OSCC. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Arid1a Inactivation in an Apc and Pten-defective Mouse Ovarian Cancer Model Enhances Epithelial Differentiation and Prolongs Survival

PubMed Central

Zhai, Yali; Kuick, Rork; Tipton, Courtney; Wu, Rong; Sessine, Michael; Wang, Zhong; Baker, Suzanne J.; Fearon, Eric R.; Cho, Kathleen R.

2015-01-01

Inactivation of the ARID1A tumor suppressor gene is frequent in ovarian endometrioid (OEC) and clear cell carcinomas (OCCC), often in conjunction with mutations activating the PI3K/AKT and/or canonical Wnt signaling pathways. Prior work has shown that conditional bi-allelic inactivation of the Apc and Pten tumor suppressor genes in the mouse ovarian surface epithelium (OSE) promotes outgrowth of tumors that reflect the biological behavior and gene expression profiles of human OECs harboring comparable Wnt and PI3K/AKT pathway defects, though the mouse tumors are more poorly differentiated than their human tumor counterparts. We found that conditional inactivation of one or both Arid1a alleles in OSE concurrently with Apc and Pten inactivation unexpectedly prolonged survival of tumor-bearing mice and promoted striking epithelial differentiation of the cancer cells, resulting in morphological features akin to those in human OECs. Enhanced epithelial differentiation was linked to reduced expression of mesenchymal markers N-cadherin and vimentin, and increased expression of epithelial markers Crb3 and E-cadherin. Global gene expression profiling showed enrichment for genes associated with mesenchymal-to-epithelial transition in the Arid1a-deficient tumors. We also found that an activating (E545K) Pik3ca mutation, unlike Pten inactivation or Pik3ca H1047R mutation, cannot cooperate with Arid1a loss to promote ovarian cancer development in the mouse. Our results indicate the Arid1a tumor suppressor gene has a key role in regulating OEC differentiation, and paradoxically the mouse cancers with more initiating tumor suppressor gene defects had a less aggressive phenotype than cancers arising from fewer gene alterations. PMID:26279473

Screening for germline mutations in the neurofibromatosis type 2 (NF2) gene in NF2 patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andermann, A.A.; Ruttledge, M.H.; Rangaratnam, A.

Neurofibromatosis type 2 (NF2) is an autosomal dominant disease with over 95% penetrance which predisposes gene carriers to develop multiple tumors of the central nervous system. The NF2 gene is a putative tumor suppressor gene which was previously mapped to the long arm of chromosome 22, and has recently been identified, using positional cloning techniques. The gene encodes a protein, schwannomin (SCH), which is highly homologous to the band 4.1 protein family. In an attempt to identify and characterize mutations which lead to the manifestation of the disease, we have used single strand conformation analysis (SSCA) to screen for germlinemore » mutations in all 17 exons of the NF2 gene in 59 unrelated NF2 patients, representing both familial and new mutations. A total of 27 migration abnormalities was found in 26 patients. Using direct sequencing analysis, the majority of these variants were found to result in nonsense, splice-site or frameshift mutations. Mutations identified in familial NF2 patients segregate in the family, and may prove to be useful tools for a simple and direct SSCA-based technique of presymptomatic or prenatal diagnosis in relatives of patients with NF2. This may be of particular importance in children of patients who have new mutations in the NF2 gene, where linkage analysis may not be feasible.« less

Suppressor Analysis of the Fusogenic Lambda Spanins.

PubMed

Cahill, Jesse; Rajaure, Manoj; Holt, Ashley; Moreland, Russell; O'Leary, Chandler; Kulkarni, Aneesha; Sloan, Jordan; Young, Ry

2017-07-15

The final step of lysis in phage λ infections of Escherichia coli is mediated by the spanins Rz and Rz1. These proteins form a complex that bridges the cell envelope and that has been proposed to cause fusion of the inner and outer membranes. Accordingly, mutations that block spanin function are found within coiled-coil domains and the proline-rich region, motifs essential in other fusion systems. To gain insight into spanin function, pseudorevertant alleles that restored plaque formation for lysis-defective mutants of Rz and Rz1 were selected. Most second-site suppressors clustered within a coiled-coil domain of Rz near the outer leaflet of the cytoplasmic membrane and were not allele specific. Suppressors largely encoded polar insertions within the hydrophobic core of the coiled-coil interface. Such suppressor changes resulted in decreased proteolytic stability of the Rz double mutants in vivo Unlike the wild type, in which lysis occurs while the cells retain a rod shape, revertant alleles with second-site suppressor mutations supported lysis events that were preceded by spherical cell formation. This suggests that destabilization of the membrane-proximal coiled coil restores function for defective spanin alleles by increasing the conformational freedom of the complex at the cost of its normal, all-or-nothing functionality. IMPORTANCE Caudovirales encode cell envelope-spanning proteins called spanins, which are thought to fuse the inner and outer membranes during phage lysis. Recent genetic analysis identified the functional domains of the lambda spanins, which are similar to class I viral fusion proteins. While the pre- and postfusion structures of model fusion systems have been well characterized, the intermediate structure(s) formed during the fusion reaction remains elusive. Genetic analysis would be expected to identify functional connections between intermediates. Since most membrane fusion systems are not genetically tractable, only few such investigations have been reported. Here, we report a suppressor analysis of lambda spanin function. To our knowledge this is the first suppression analysis of a class I-like complex and also the first such analysis of a prokaryote membrane fusion system. Copyright © 2017 American Society for Microbiology.

The Conserved ATPase Get3/Arr4 Modulates the Activity of Membrane-Associated Proteins in Saccharomyces cerevisiae

PubMed Central

Auld, Kathryn L.; Hitchcock, Amy L.; Doherty, Hugh K.; Frietze, Seth; Huang, Linda S.; Silver, Pamela A.

2006-01-01

The regulation of cellular membrane dynamics is crucial for maintaining proper cell growth and division. The Cdc48-Npl4-Ufd1 complex is required for several regulated membrane-associated processes as part of the ubiquitin–proteasome system, including ER-associated degradation and the control of lipid composition in yeast. In this study we report the results of a genetic screen in Saccharomyces cerevisiae for extragenic suppressors of a temperature-sensitive npl4 allele and the subsequent analysis of one suppressor, GET3/ARR4. The GET3 gene encodes an ATPase with homology to the regulatory component of the bacterial arsenic pump. Mutants of GET3 rescue several phenotypes of the npl4 mutant and transcription of GET3 is coregulated with the proteasome, illustrating a functional relationship between GET3 and NPL4 in the ubiquitin–proteasome system. We have further found that Get3 biochemically interacts with the trans-membrane domain proteins Get1/Mdm39 and Get2/Rmd7 and that Δget3 is able to suppress phenotypes of get1 and get2 mutants, including sporulation defects. In combination, our characterization of GET3 genetic and biochemical interactions with NPL4, GET1, and GET2 implicates Get3 in multiple membrane-dependent pathways. PMID:16816426

Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

PubMed

Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

2011-03-01

Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

RNAi-Based Suppressor Screens Reveal Genetic Interactions Between the CRL2LRR-1 E3-Ligase and the DNA Replication Machinery in Caenorhabditis elegans.

PubMed

Ossareh-Nazari, Batool; Katsiarimpa, Anthi; Merlet, Jorge; Pintard, Lionel

2016-10-13

Cullin-RING E3-Ligases (CRLs), the largest family of E3 ubiquitin-Ligases, regulate diverse cellular processes by promoting ubiquitination of target proteins. The evolutionarily conserved Leucine Rich Repeat protein 1 (LRR-1) is a substrate-recognition subunit of a CRL2 LRR-1 E3-ligase. Here we provide genetic evidence supporting a role of this E3-enzyme in the maintenance of DNA replication integrity in Caenorhabditis elegans Through RNAi-based suppressor screens of lrr-1(0) and cul-2(or209ts) mutants, we identified two genes encoding components of the GINS complex, which is part of the Cdc45-MCM-GINS (CMG) replicative helicase, as well as CDC-7 and MUS-101, which drives the assembly of the CMG helicase during DNA replication. In addition, we identified the core components of the ATR/ATL-1 DNA replication checkpoint pathway (MUS-101, ATL-1, CLSP-1, CHK-1). These results suggest that the CRL2 LRR-1 E3-ligase acts to modify or degrade factor(s) that would otherwise misregulate the replisome, eventually leading to the activation of the DNA replication checkpoint. Copyright © 2016 Ossareh-Nazari et al.

Division of Labor Among the Yeast Sol Proteins Implicated in tRNA Nuclear Export and Carbohydrate Metabolism

PubMed Central

Stanford, D. R.; Whitney, M. L.; Hurto, R. L.; Eisaman, D. M.; Shen, W.-C.; Hopper, A. K.

2004-01-01

SOL1, the founding member of the S. cerevisiae SOL family, was previously identified as a multi-copy suppressor of the los1 defect in tRNA-mediated nonsense suppression. Here we report that the four-member SOL family is not essential and that individual family members appear to have distinct functions. SOL1–SOL4 are homologous to genes encoding 6-phosphogluconolactonase (6Pgl) involved in the pentose phosphate pathway. Both Sol3p and Sol4p affect this activity. However, Sol4p does not act as a los1 multi-copy suppressor. In contrast, neither Sol1p nor Sol2p, both of which correct the los1 defect in nonsense suppression, possess detectable 6Pgl activity. Rather, Sol1p and Sol2p appear to function in tRNA nuclear export as sol1 and sol2 mutants possess elevated levels of nuclear tRNA. Members of the Sol protein family appear to have different subcellular distributions. Thus, Sol3p and Sol4p likely function in carbohydrate metabolism, while Sol1p and Sol2p appear to have roles in tRNA function and nuclear export, thereby defining an unusual protein family whose individual members are biochemically distinct and spatially dispersed. PMID:15454531

Division of labor among the yeast Sol proteins implicated in tRNA nuclear export and carbohydrate metabolism.

PubMed

Stanford, D R; Whitney, M L; Hurto, R L; Eisaman, D M; Shen, W-C; Hopper, A K

2004-09-01

SOL1, the founding member of the S. cerevisiae SOL family, was previously identified as a multi-copy suppressor of the los1 defect in tRNA-mediated nonsense suppression. Here we report that the four-member SOL family is not essential and that individual family members appear to have distinct functions. SOL1-SOL4 are homologous to genes encoding 6-phosphogluconolactonase (6Pgl) involved in the pentose phosphate pathway. Both Sol3p and Sol4p affect this activity. However, Sol4p does not act as a los1 multi-copy suppressor. In contrast, neither Sol1p nor Sol2p, both of which correct the los1 defect in nonsense suppression, possess detectable 6Pgl activity. Rather, Sol1p and Sol2p appear to function in tRNA nuclear export as sol1 and sol2 mutants possess elevated levels of nuclear tRNA. Members of the Sol protein family appear to have different subcellular distributions. Thus, Sol3p and Sol4p likely function in carbohydrate metabolism, while Sol1p and Sol2p appear to have roles in tRNA function and nuclear export, thereby defining an unusual protein family whose individual members are biochemically distinct and spatially dispersed.

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

PubMed

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

Reversal of hypermethylation and reactivation of glutathione S-transferase pi 1 gene by curcumin in breast cancer cell line.

PubMed

Kumar, Umesh; Sharma, Ujjawal; Rathi, Garima

2017-02-01

One of the mechanisms for epigenetic silencing of tumor suppressor genes is hypermethylation of cytosine residue at CpG islands at their promoter region that contributes to malignant progression of tumor. Therefore, activation of tumor suppressor genes that have been silenced by promoter methylation is considered to be very attractive molecular target for cancer therapy. Epigenetic silencing of glutathione S-transferase pi 1, a tumor suppressor gene, is involved in various types of cancers including breast cancer. Epigenetic silencing of tumor suppressor genes can be reversed by several molecules including natural compounds such as polyphenols that can act as a hypomethylating agent. Curcumin has been found to specifically target various tumor suppressor genes and alter their expression. To check the effect of curcumin on the methylation pattern of glutathione S-transferase pi 1 gene in MCF-7 breast cancer cell line in dose-dependent manner. To check the reversal of methylation pattern of hypermethylated glutathione S-transferase pi 1, MCF-7 breast cancer cell line was treated with different concentrations of curcumin for different time periods. DNA and proteins of treated and untreated cell lines were isolated, and methylation status of the promoter region of glutathione S-transferase pi 1 was analyzed using methylation-specific polymerase chain reaction assay, and expression of this gene was analyzed by immunoblotting using specific antibodies against glutathione S-transferase pi 1. A very low and a nontoxic concentration (10 µM) of curcumin treatment was able to reverse the hypermethylation and led to reactivation of glutathione S-transferase pi 1 protein expression in MCF-7 cells after 72 h of treatment, although the IC 50 value of curcumin was found to be at 20 µM. However, curcumin less than 3 µM of curcumin could not alter the promoter methylation pattern of glutathione S-transferase pi 1. Treatment of breast cancer MCF-7 cells with curcumin causes complete reversal of glutathione S-transferase pi 1 promoter hypermethylation and leads to re-expression of glutathione S-transferase pi 1, suggesting it to be an excellent nontoxic hypomethylating agent.

The 32-Kilodalton Subunit of Replication Protein A Interacts with Menin, the Product of the MEN1 Tumor Suppressor Gene

PubMed Central

Sukhodolets, Karen E.; Hickman, Alison B.; Agarwal, Sunita K.; Sukhodolets, Maxim V.; Obungu, Victor H.; Novotny, Elizabeth A.; Crabtree, Judy S.; Chandrasekharappa, Settara C.; Collins, Francis S.; Spiegel, Allen M.; Burns, A. Lee; Marx, Stephen J.

2003-01-01

Menin is a 70-kDa protein encoded by MEN1, the tumor suppressor gene disrupted in multiple endocrine neoplasia type 1. In a yeast two-hybrid system based on reconstitution of Ras signaling, menin was found to interact with the 32-kDa subunit (RPA2) of replication protein A (RPA), a heterotrimeric protein required for DNA replication, recombination, and repair. The menin-RPA2 interaction was confirmed in a conventional yeast two-hybrid system and by direct interaction between purified proteins. Menin-RPA2 binding was inhibited by a number of menin missense mutations found in individuals with multiple endocrine neoplasia type 1, and the interacting regions were mapped to the N-terminal portion of menin and amino acids 43 to 171 of RPA2. This region of RPA2 contains a weak single-stranded DNA-binding domain, but menin had no detectable effect on RPA-DNA binding in vitro. Menin bound preferentially in vitro to free RPA2 rather than the RPA heterotrimer or a subcomplex consisting of RPA2 bound to the 14-kDa subunit (RPA3). However, the 70-kDa subunit (RPA1) was coprecipitated from HeLa cell extracts along with RPA2 by menin-specific antibodies, suggesting that menin binds to the RPA heterotrimer or a novel RPA1-RPA2-containing complex in vivo. This finding was consistent with the extensive overlap in the nuclear localization patterns of endogenous menin, RPA2, and RPA1 observed by immunofluorescence. PMID:12509449

Direct role for the RNA polymerase domain of T7 primase in primer delivery

PubMed Central

Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

2010-01-01

Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755

Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold.

PubMed

Gao, Jinpeng; Wallis, James G; Browse, John

2015-09-01

The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C-6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. © 2015 American Society of Plant Biologists. All Rights Reserved.

C. elegans HIM-8 functions outside of meiosis to antagonize EGL-13 Sox protein function.

PubMed

Nelms, Brian L; Hanna-Rose, Wendy

2006-05-15

egl-13 encodes a Sox domain protein that is required for proper uterine seam cell development in Caenorhabditis elegans. We demonstrate that mutations of the C2H2 zinc fingers encoded by the him-8 (high incidence of males) gene partially suppress the egg-laying and connection-of-gonad morphology defects caused by incompletely penetrant alleles of egl-13. him-8 alleles have previously characterized recessive effects on recombination and segregation of the X chromosome during meiosis due to failure of X chromosome homolog pairing and subsequent synapsis. However, we show that him-8 alleles are semi-dominant suppressors of egl-13, and the semi-dominant effect is due to haplo-insufficiency of the him-8 locus. Thus, we conclude that the wild-type him-8 gene product acts antagonistically to EGL-13. Null alleles of egl-13 cannot be suppressed, suggesting that this antagonistic interaction most likely occurs either upstream of or in parallel with EGL-13. Moreover, we conclude that suppression of egl-13 is due to a meiosis-independent function of him-8 because suppression is observed in mutants that have severely reduced meiotic germ cell populations and suppression does not depend on the function of him-8 in the maternal germ line. We also show that the chromosomal context of egl-13 seems important in the him-8 suppression mechanism. Interactions between these genes can give insight into function of Sox family members, which are important in many aspects of metazoan development, and into functions of him-8 outside of meiosis.

The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.

PubMed

Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi

2005-07-01

Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.

The molecular pathogenesis of schwannomatosis, a paradigm for the co-involvement of multiple tumour suppressor genes in tumorigenesis.

PubMed

Kehrer-Sawatzki, Hildegard; Farschtschi, Said; Mautner, Victor-Felix; Cooper, David N

2017-02-01

Schwannomatosis is characterized by the predisposition to develop multiple schwannomas and, less commonly, meningiomas. Despite the clinical overlap with neurofibromatosis type 2 (NF2), schwannomatosis is not caused by germline NF2 gene mutations. Instead, germline mutations of either the SMARCB1 or LZTR1 tumour suppressor genes have been identified in 86% of familial and 40% of sporadic schwannomatosis patients. In contrast to patients with rhabdoid tumours, which are due to complete loss-of-function SMARCB1 mutations, individuals with schwannomatosis harbour predominantly hypomorphic SMARCB1 mutations which give rise to the synthesis of mutant proteins with residual function that do not cause rhabdoid tumours. Although biallelic mutations of SMARCB1 or LZTR1 have been detected in the tumours of patients with schwannomatosis, the classical two-hit model of tumorigenesis is insufficient to account for schwannoma growth, since NF2 is also frequently inactivated in these tumours. Consequently, tumorigenesis in schwannomatosis must involve the mutation of at least two different tumour suppressor genes, an occurrence frequently mediated by loss of heterozygosity of large parts of chromosome 22q harbouring not only SMARCB1 and LZTR1 but also NF2. Thus, schwannomatosis is paradigmatic for a tumour predisposition syndrome caused by the concomitant mutational inactivation of two or more tumour suppressor genes. This review provides an overview of current models of tumorigenesis and mutational patterns underlying schwannomatosis that will ultimately help to explain the complex clinical presentation of this rare disease.

CMTM5 exhibits tumor suppressor activity through promoter methylation in oral squamous cell carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Heyu; Nan, Xu; Li, Xuefen

Highlights: • Down-regulation of CMTM5 expression in OSCC tissues was found. • The promoter methylation status of CMTM5 was measured. • CMTM5-v1 inhibited cell proliferation and migration and induced apoptosis. • CMTM5 might act as a putative tumor suppressor gene in OSCC. - Abstract: Oral squamous cell carcinoma (OSCC) is one of the most common types of malignancies in the head and neck region. CKLF-like MARVEL transmembrane domain-containing member 5 (CMTM5) has been recently implicated as a tumor suppressor gene in several cancer types. Herein, we examined the expression and function of CMTM5 in oral squamous cell carcinoma. CMTM5 wasmore » down-regulated in oral squamous cell lines and tumor samples from patients with promoter methylation. Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored CMTM5 expression. In the OSCC cell lines CAL27 and GNM, the ectopic expression of CMTM5-v1 strongly inhibited cell proliferation and migration and induced apoptosis. In addition, CMTM5-v1 inhibited tumor formation in vivo. Therefore, CMTM5 might act as a putative tumor suppressor gene through promoter methylation in oral squamous cell carcinoma.« less

Distinguishing between cancer driver and passenger gene alteration candidates via cross-species comparison: a pilot study.

PubMed

Ji, Xinglai; Tang, Jie; Halberg, Richard; Busam, Dana; Ferriera, Steve; Peña, Maria Marjorette O; Venkataramu, Chinnambally; Yeatman, Timothy J; Zhao, Shaying

2010-08-13

We are developing a cross-species comparison strategy to distinguish between cancer driver- and passenger gene alteration candidates, by utilizing the difference in genomic location of orthologous genes between the human and other mammals. As an initial test of this strategy, we conducted a pilot study with human colorectal cancer (CRC) and its mouse model C57BL/6J ApcMin/+, focusing on human 5q22.2 and 18q21.1-q21.2. We first performed bioinformatics analysis on the evolution of 5q22.2 and 18q21.1-q21.2 regions. Then, we performed exon-targeted sequencing, real time quantitative polymerase chain reaction (qPCR), and real time quantitative reverse transcriptase PCR (qRT-PCR) analyses on a number of genes of both regions with both human and mouse colon tumors. These two regions (5q22.2 and 18q21.1-q21.2) are frequently deleted in human CRCs and encode genuine colorectal tumor suppressors APC and SMAD4. They also encode genes such as MCC (mutated in colorectal cancer) with their role in CRC etiology unknown. We have discovered that both regions are evolutionarily unstable, resulting in genes that are clustered in each human region being found scattered at several distinct loci in the genome of many other species. For instance, APC and MCC are within 200 kb apart in human 5q22.2 but are 10 Mb apart in the mouse genome. Importantly, our analyses revealed that, while known CRC driver genes APC and SMAD4 were disrupted in both human colorectal tumors and tumors from ApcMin/+ mice, the questionable MCC gene was disrupted in human tumors but appeared to be intact in mouse tumors. These results indicate that MCC may not actually play any causative role in early colorectal tumorigenesis. We also hypothesize that its disruption in human CRCs is likely a mere result of its close proximity to APC in the human genome. Expanding this pilot study to the entire genome may identify more questionable genes like MCC, facilitating the discovery of new CRC driver gene candidates.

What Has Cancer Taught Us about the Cell?

ERIC Educational Resources Information Center

Hatton, Mary E.; Hatton, Mark P.

1997-01-01

Discusses what is cancer; proto-oncogenes that encode four classes of proteins including growth factors, growth factor receptors, intracellular signaling messengers, and transcription factors; tumor suppressors; and cancer therapy including metabolic inhibitors, alkylating agents and antibiotics, mitotic inhibitors, and hormone-related therapy.…

Sec34p, a Protein Required for Vesicle Tethering to the Yeast Golgi Apparatus, Is in a Complex with Sec35p

PubMed Central

VanRheenen, Susan M.; Cao, Xiaochun; Sapperstein, Stephanie K.; Chiang, Elbert C.; Lupashin, Vladimir V.; Barlowe, Charles; Waters, M. Gerard

1999-01-01

A screen for mutants of Saccharomyces cerevisiae secretory pathway components previously yielded sec34, a mutant that accumulates numerous vesicles and fails to transport proteins from the ER to the Golgi complex at the restrictive temperature (Wuestehube, L.J., R. Duden, A. Eun, S. Hamamoto, P. Korn, R. Ram, and R. Schekman. 1996. Genetics. 142:393–406). We find that SEC34 encodes a novel protein of 93-kD, peripherally associated with membranes. The temperature-sensitive phenotype of sec34-2 is suppressed by the rab GTPase Ypt1p that functions early in the secretory pathway, or by the dominant form of the ER to Golgi complex target-SNARE (soluble N-ethylmaleimide sensitive fusion protein attachment protein receptor)–associated protein Sly1p, Sly1-20p. Weaker suppression is evident upon overexpression of genes encoding the vesicle tethering factor Uso1p or the vesicle-SNAREs Sec22p, Bet1p, or Ykt6p. This genetic suppression profile is similar to that of sec35-1, a mutant allele of a gene encoding an ER to Golgi vesicle tethering factor and, like Sec35p, Sec34p is required in vitro for vesicle tethering. sec34-2 and sec35-1 display a synthetic lethal interaction, a genetic result explained by the finding that Sec34p and Sec35p can interact by two-hybrid analysis. Fractionation of yeast cytosol indicates that Sec34p and Sec35p exist in an ∼750-kD protein complex. Finally, we describe RUD3, a novel gene identified through a genetic screen for multicopy suppressors of a mutation in USO1, which suppresses the sec34-2 mutation as well. PMID:10562277

Li-Fraumeni syndrome: cancer risk assessment and clinical management.

PubMed

McBride, Kate A; Ballinger, Mandy L; Killick, Emma; Kirk, Judy; Tattersall, Martin H N; Eeles, Rosalind A; Thomas, David M; Mitchell, Gillian

2014-05-01

Carriers of germline mutations in the TP53 gene, encoding the cell-cycle regulator and tumour suppressor p53, have a markedly increased risk of cancer-related morbidity and mortality during both childhood and adulthood, and thus require appropriate and effective cancer risk management. However, the predisposition of such patients to multiorgan tumorigenesis presents a specific challenge for cancer risk management programmes. Herein, we review the clinical implications of germline mutations in TP53 and the evidence for cancer screening and prevention strategies in individuals carrying such mutations, as well as examining the potential psychosocial implications of lifelong management for a ubiquitous cancer risk. In addition, we propose an evidence-based framework for the clinical management of TP53 mutation carriers and provide a platform for addressing the management of other cancer predisposition syndromes that can affect multiple organs.

Positive selection of deleterious alleles through interaction with a sex-ratio suppressor gene in African Buffalo: a plausible new mechanism for a high frequency anomaly.

PubMed

van Hooft, Pim; Greyling, Ben J; Getz, Wayne M; van Helden, Paul D; Zwaan, Bas J; Bastos, Armanda D S

2014-01-01

Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer) population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations), we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has important implications for our understanding not only of the evolutionary and ecological dynamics of sex-ratio distorters and suppressors, but also of the functioning of deleterious and sexually-antagonistic alleles, and their impact on population viability.

Epigenetic Targeting of Granulin in Hepatoma Cells by Synthetic CRISPR dCas9 Epi-suppressors.

PubMed

Wang, Hong; Guo, Rui; Du, Zhonghua; Bai, Ling; Li, Lingyu; Cui, Jiuwei; Li, Wei; Hoffman, Andrew R; Hu, Ji-Fan

2018-06-01

The CRISPR-associated Cas9 system can modulate disease-causing alleles both in vivo and ex vivo, raising the possibility of therapeutic genome editing. In addition to gene targeting, epigenetic modulation by the catalytically inactive dCas9 may also be a potential form of cancer therapy. Granulin (GRN), a potent pluripotent mitogen and growth factor that promotes cancer progression by maintaining self-renewal of hepatic stem cancer cells, is upregulated in hepatoma tissues and is associated with decreased tumor survival in patients with hepatoma. We synthesized a group of dCas9 epi-suppressors to target GRN by tethering the C terminus of dCas9 with three epigenetic suppressor genes: DNMT3a (DNA methyltransferase), EZH2 (histone 3 lysine 27 methyltransferase), and KRAB (the Krüppel-associated box transcriptional repression domain). In conjunction with guide RNAs (gRNAs), the dCas9 epi-suppressors caused significant decreases in GRN mRNA abundance in Hep3B hepatoma cells. These dCas9 epi-suppressors initiated de novo CpG DNA methylation in the GRN promoter, and they produced histone codes that favor gene suppression, including decreased H3K4 methylation, increased H3K9 methylation, and enhanced HP1a binding. Epigenetic knockdown of GRN led to the inhibition of cell proliferation, decreased tumor sphere formation, and reduced cell invasion. These changes were achieved at least partially through the MMP/TIMP pathway. This study thus demonstrates the potential utility of using dCas9 epi-suppressors in the development of epigenetic targeting against tumors. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Suppression of RNA Silencing by a Plant DNA Virus Satellite Requires a Host Calmodulin-Like Protein to Repress RDR6 Expression

PubMed Central

Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping

2014-01-01

In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential role for RDR6 in RNA silencing defense response against geminivirus infection. PMID:24516387

Genomic and Epigenomic Landscapes of Adult De Novo Acute Myeloid Leukemia

PubMed Central

2013-01-01

BACKGROUND Many mutations that contribute to the pathogenesis of acute myeloid leukemia (AML) are undefined. The relationships between patterns of mutations and epigenetic phenotypes are not yet clear. METHODS We analyzed the genomes of 200 clinically annotated adult cases of de novo AML, using either whole-genome sequencing (50 cases) or whole-exome sequencing (150 cases), along with RNA and microRNA sequencing and DNA-methylation analysis. RESULTS AML genomes have fewer mutations than most other adult cancers, with an average of only 13 mutations found in genes. Of these, an average of 5 are in genes that are recurrently mutated in AML. A total of 23 genes were significantly mutated, and another 237 were mutated in two or more samples. Nearly all samples had at least 1 nonsynonymous mutation in one of nine categories of genes that are almost certainly relevant for pathogenesis, including transcription-factor fusions (18% of cases), the gene encoding nucleophosmin (NPM1) (27%), tumor-suppressor genes (16%), DNA-methylation–related genes (44%), signaling genes (59%), chromatin-modifying genes (30%), myeloid transcription-factor genes (22%), cohesin-complex genes (13%), and spliceosome-complex genes (14%). Patterns of cooperation and mutual exclusivity suggested strong biologic relationships among several of the genes and categories. CONCLUSIONS We identified at least one potential driver mutation in nearly all AML samples and found that a complex interplay of genetic events contributes to AML pathogenesis in individual patients. The databases from this study are widely available to serve as a foundation for further investigations of AML pathogenesis, classification, and risk stratification. (Funded by the National Institutes of Health.) PMID:23634996

What we know about ST13, a co-factor of heat shock protein, or a tumor suppressor?*

PubMed Central

Shi, Zheng-zheng; Zhang, Jia-wei; Zheng, Shu

2007-01-01

This article is to summarize the molecular and functional analysis of the gene “suppression of tumorigenicity 13” (ST13). ST13 is in fact the gene encoding Hsp70 interacting protein (Hip), a co-factor (co-chaperone) of the 70-kDa heat shock proteins (Hsc/Hsp70). By collaborating with other positive co-factors such as Hsp40 and the Hsp70-Hsp90 organizing protein (Hop), or competing with negative co-factors such as Bcl2-associated athanogen 1 (Bag1), Hip may facilitate the chaperone function of Hsc/Hsp70 in protein folding and repair, and in controlling the activity of regulatory proteins such as steroid receptors and regulators of proliferation or apoptosis. Although the nomenclature of ST13 implies a role in the suppression of tumorigenicity (ST), to date available experimental data are not sufficient to support its role in cancer development, except for the possible down-regulation of ST13 in gastric and colorectal cancers. Further investigation of this gene at the physiological level would benefit our understanding of diseases such as endocrinological disorders, cancer, and neurodegeneration commonly associated with protein misfolding. PMID:17323428

Epigenetic regulation in myelodysplastic syndromes: implications for therapy.

PubMed

Vigna, Ernesto; Recchia, Anna Grazia; Madeo, Antonio; Gentile, Massimo; Bossio, Sabrina; Mazzone, Carla; Lucia, Eugenio; Morabito, Lucio; Gigliotti, Vincenzo; Stefano, Laura De; Caruso, Nadia; Servillo, Pasquale; Franzese, Stefania; Fimognari, Filippo; Bisconte, Maria Grazia; Gentile, Carlo; Morabito, Fortunato

2011-04-01

Myelodysplastic syndromes (MDS), characterized by ineffective hematopoiesis and dysplasia in one or more lineages, produce life-threatening cytopenias and progress to acute myeloid leukemia (AML). Growing evidence suggests that targeting epigenetic mechanisms improves MDS/AML pathophysiology. This review provides an understanding of studies investigating novel agents published up to January 2011 aimed at normalizing and monitoring the epigenetic profile of the MDS cancer cell. The authors discuss how non-intensive epigenetic therapy can 're-programme' gene expression patterns of abnormal hematopoiesis in MDS. Recently FDA-approved DNA-methyltransferase inhibitors, 5-azacytidine and 5-aza-2'-deoxycytidine or decitabine, represent frontline nonablative treatments, while combinations with histone deacetylase inhibitors show promising synergism in preclinical and Phase I/II trials in tumor suppressor gene re-expression and overall survival. Additional epigenetic mechanisms including non-encoding transcripts with inhibitory posttranscriptional regulatory functions, such as microRNAs, though not fully understood, present novel molecular and clinical implications in these disorders. Alongside current single-agent epigenetic regimens, combination therapies represent potentially effective options for intermediate-2 and high-risk MDS. Methylation profiles and gene mutation predictors provide promising areas of development for monitoring MDS disease progression and outcome, while targeting microRNA dysregulation represents an important therapeutic goal.

MicroRNA-31 inhibits RhoA-mediated tumor invasion and chemotherapy resistance in MKN-45 gastric adenocarcinoma cells.

PubMed

Korourian, Alireza; Roudi, Raheleh; Shariftabrizi, Ahmad; Madjd, Zahra

2017-12-01

microRNAs are small single-stranded non-coding RNA molecules which modify gene expression by silencing potential target genes. The aberrant expression of RhoA, a small GTPase protein of Rho family, is involved in gastric cancer tumorigenesis. Since miR-31 is a pleomorphic molecule, we evaluated the miR-31/RhoA axis in inducing the malignant phenotype of gastric cancer cells MKN-45. Also, the clinicopathological significance of RhoA was investigated in a well-defined collection of gastric carcinomas which were embedded in tissue microarray blocks. Induction of miR-31 in MKN-45 followed by suppression of RhoA expression resulted in increased sensitivity to 5-fluorouracil, inhibition of cell proliferation, and invasion compared to the control groups. Immunohistochemical analysis in gastric adenocarcinoma patients' samples showed significantly higher expression of RhoA in diffuse versus intestinal subtype tumors ( P = 0.009), poorly differentiated versus well and moderately differentiated tumors ( P = 0.03) and the presence of vascular invasion versus the absence of vascular invasion ( P = 0.04). Our findings suggest a critical role for miR-31, as a tumor suppressor gene, in gastric cancer tumorigenesis by targeting the RhoA. Impact statement Gastric cancer ranks as the third leading cause of cancer-associated deaths worldwide. The RhoA gene encodes a small GTPase protein of Rho family (RhoA) that its dysregulation is associated with cell motility and invasion. A strong line of evidence supports the regulation of RhoA by a number of miRs, including miR-31 in tumors. Our findings revealed that miR-31 is involved in gastric cancer tumorigenesis as a tumor suppressor gene. Through down-regulation of RhoA, miR-31 decreased cell proliferation, migration, and invasion in gastric cancer cells. In addition, induction of miR-31 increased sensitivity to 5-FU; thus, increasing its tissue concentrations could be a potential target for treatment of gastric cancer in the future.

MicroRNA-31 inhibits RhoA-mediated tumor invasion and chemotherapy resistance in MKN-45 gastric adenocarcinoma cells

PubMed Central

Korourian, Alireza; Roudi, Raheleh; Shariftabrizi, Ahmad

2017-01-01

microRNAs are small single-stranded non-coding RNA molecules which modify gene expression by silencing potential target genes. The aberrant expression of RhoA, a small GTPase protein of Rho family, is involved in gastric cancer tumorigenesis. Since miR-31 is a pleomorphic molecule, we evaluated the miR-31/RhoA axis in inducing the malignant phenotype of gastric cancer cells MKN-45. Also, the clinicopathological significance of RhoA was investigated in a well-defined collection of gastric carcinomas which were embedded in tissue microarray blocks. Induction of miR-31 in MKN-45 followed by suppression of RhoA expression resulted in increased sensitivity to 5-fluorouracil, inhibition of cell proliferation, and invasion compared to the control groups. Immunohistochemical analysis in gastric adenocarcinoma patients’ samples showed significantly higher expression of RhoA in diffuse versus intestinal subtype tumors (P = 0.009), poorly differentiated versus well and moderately differentiated tumors (P = 0.03) and the presence of vascular invasion versus the absence of vascular invasion (P = 0.04). Our findings suggest a critical role for miR-31, as a tumor suppressor gene, in gastric cancer tumorigenesis by targeting the RhoA. Impact statement Gastric cancer ranks as the third leading cause of cancer-associated deaths worldwide. The RhoA gene encodes a small GTPase protein of Rho family (RhoA) that its dysregulation is associated with cell motility and invasion. A strong line of evidence supports the regulation of RhoA by a number of miRs, including miR-31 in tumors. Our findings revealed that miR-31 is involved in gastric cancer tumorigenesis as a tumor suppressor gene. Through down-regulation of RhoA, miR-31 decreased cell proliferation, migration, and invasion in gastric cancer cells. In addition, induction of miR-31 increased sensitivity to 5-FU; thus, increasing its tissue concentrations could be a potential target for treatment of gastric cancer in the future. PMID:28836853

Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer.

PubMed

Mlakar, Vid; Berginc, Gasper; Volavsek, Metka; Stor, Zdravko; Rems, Miran; Glavac, Damjan

2009-08-13

Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC), it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin.

Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer

PubMed Central

2009-01-01

Background Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC), it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. Methods We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. Results We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Conclusion Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin. PMID:19678923

Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

PubMed

Xayarath, Bobbi; Yother, Janet

2007-05-01

Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

A Structured Viroid RNA Serves as a Substrate for Dicer-Like Cleavage To Produce Biologically Active Small RNAs but Is Resistant to RNA-Induced Silencing Complex-Mediated Degradation▿

PubMed Central

Itaya, Asuka; Zhong, Xuehua; Bundschuh, Ralf; Qi, Yijun; Wang, Ying; Takeda, Ryuta; Harris, Ann R.; Molina, Carlos; Nelson, Richard S.; Ding, Biao

2007-01-01

RNA silencing is a potent means of antiviral defense in plants and animals. A hallmark of this defense response is the production of 21- to 24-nucleotide viral small RNAs via mechanisms that remain to be fully understood. Many viruses encode suppressors of RNA silencing, and some viral RNAs function directly as silencing suppressors as counterdefense. The occurrence of viroid-specific small RNAs in infected plants suggests that viroids can trigger RNA silencing in a host, raising the question of how these noncoding and unencapsidated RNAs survive cellular RNA-silencing systems. We address this question by characterizing the production of small RNAs of Potato spindle tuber viroid (srPSTVds) and investigating how PSTVd responds to RNA silencing. Our molecular and biochemical studies provide evidence that srPSTVds were derived mostly from the secondary structure of viroid RNAs. Replication of PSTVd was resistant to RNA silencing, although the srPSTVds were biologically active in guiding RNA-induced silencing complex (RISC)-mediated cleavage, as shown with a sensor system. Further analyses showed that without possessing or triggering silencing suppressor activities, the PSTVd secondary structure played a critical role in resistance to RISC-mediated cleavage. These findings support the hypothesis that some infectious RNAs may have evolved specific secondary structures as an effective means to evade RNA silencing in addition to encoding silencing suppressor activities. Our results should have important implications in further studies on RNA-based mechanisms of host-pathogen interactions and the biological constraints that shape the evolution of infectious RNA structures. PMID:17202210

Cerebellar Ataxia, Seizures, Premature Death, and Cardiac Abnormalities in Mice with Targeted Disruption of the Cacna2d2 Gene

PubMed Central

Ivanov, Sergey V.; Ward, Jerrold M.; Tessarollo, Lino; McAreavey, Dorothea; Sachdev, Vandana; Fananapazir, Lameh; Banks, Melissa K.; Morris, Nicole; Djurickovic, Draginja; Devor-Henneman, Deborah E.; Wei, Ming-Hui; Alvord, Gregory W.; Gao, Boning; Richardson, James A.; Minna, John D.; Rogawski, Michael A.; Lerman, Michael I.

2004-01-01

CACNA2D2 is a putative tumor suppressor gene located in the human chromosome 3p21.3 region that shows frequent allelic imbalances in lung, breast, and other cancers. The α2δ-2 protein encoded by the gene is a regulatory subunit of voltage-dependent calcium channels and is expressed in brain, heart, and other tissues. Here we report that mice homozygous for targeted disruption of the Cacna2d2 gene exhibit growth retardation, reduced life span, ataxic gait with apoptosis of cerebellar granule cells followed by Purkinje cell depletion, enhanced susceptibility to seizures, and cardiac abnormalities. The Cacna2d2tm1NCIF null phenotype has much in common with that of Cacna1a mutants, such as cerebellar neuro-degeneration associated with ataxia, seizures, and premature death. A tendency to bradycardia and limited response of null mutants to isoflurane implicate α2δ-2 in sympathetic regulation of cardiac function. In summary, our findings provide genetic evidence that the α2δ-2 subunit serves in vivo as a component of P/Q-type calcium channels, is indispensable for the central nervous system function, and may be involved in hereditary cerebellar ataxias and epileptic disorders in humans. PMID:15331424

A Drought-Inducible Transcription Factor Delays Reproductive Timing in Rice.

PubMed

Zhang, Chunyu; Liu, Jun; Zhao, Tao; Gomez, Adam; Li, Cong; Yu, Chunsheng; Li, Hongyu; Lin, Jianzhong; Yang, Yuanzhu; Liu, Bin; Lin, Chentao

2016-05-01

The molecular mechanisms underlying photoperiod or temperature control of flowering time have been recently elucidated, but how plants regulate flowering time in response to other external factors, such as water availability, remains poorly understood. Using a large-scale Hybrid Transcription Factor approach, we identified a bZIP transcriptional factor, O. sativa ABA responsive element binding factor 1 (OsABF1), which acts as a suppressor of floral transition in a photoperiod-independent manner. Simultaneous knockdown of both OsABF1 and its closest homologous gene, OsbZIP40, in rice (Oryza sativa) by RNA interference results in a significantly earlier flowering phenotype. Molecular and genetic analyses demonstrate that a drought regime enhances expression of the OsABF1 gene, which indirectly suppresses expression of the Early heading date 1 (Ehd1) gene that encodes a key activator of rice flowering. Furthermore, we identified a drought-inducible gene named OsWRKY104 that is under the direct regulation of OsABF1 Overexpression of OsWRKY104 can suppress Ehd1 expression and confers a later flowering phenotype in rice. Together, these findings reveal a novel pathway by which rice modulates heading date in response to the change of ambient water availability. © 2016 American Society of Plant Biologists. All Rights Reserved.

The Landscape of Somatic Chromosomal Copy Number Aberrations in GEM Models of Prostate Carcinoma

PubMed Central

Bianchi-Frias, Daniella; Hernandez, Susana A.; Coleman, Roger; Wu, Hong; Nelson, Peter S.

2015-01-01

Human prostate cancer (PCa) is known to harbor recurrent genomic aberrations consisting of chromosomal losses, gains, rearrangements and mutations that involve oncogenes and tumor suppressors. Genetically engineered mouse (GEM) models have been constructed to assess the causal role of these putative oncogenic events and provide molecular insight into disease pathogenesis. While GEM models generally initiate neoplasia by manipulating a single gene, expression profiles of GEM tumors typically comprise hundreds of transcript alterations. It is unclear whether these transcriptional changes represent the pleiotropic effects of single oncogenes, and/or cooperating genomic or epigenomic events. Therefore, it was determined if structural chromosomal alterations occur in GEM models of PCa and whether the changes are concordant with human carcinomas. Whole genome array-based comparative genomic hybridization (CGH) was used to identify somatic chromosomal copy number aberrations (SCNAs) in the widely used TRAMP, Hi-Myc, Pten-null and LADY GEM models. Interestingly, very few SCNAs were identified and the genomic architecture of Hi-Myc, Pten-null and LADY tumors were essentially identical to the germline. TRAMP neuroendocrine carcinomas contained SCNAs, which comprised three recurrent aberrations including a single copy loss of chromosome 19 (encoding Pten). In contrast, cell lines derived from the TRAMP, Hi-Myc, and Pten-null tumors were notable for numerous SCNAs that included copy gains of chromosome 15 (encoding Myc) and losses of chromosome 11 (encoding p53). PMID:25298407

Tumor suppressor NDRG2 inhibits glycolysis and glutaminolysis in colorectal cancer cells by repressing c-Myc expression

PubMed Central

Chu, Dake; Wei, Li; Li, Xia; Yang, Guodong; Liu, Xinping; Yao, Libo; Zhang, Jian; Shen, Lan

2015-01-01

Cancer cells use glucose and glutamine as the major sources of energy and precursor intermediates, and enhanced glycolysis and glutamimolysis are the major hallmarks of metabolic reprogramming in cancer. Oncogene activation and tumor suppressor gene inactivation alter multiple intracellular signaling pathways that affect glycolysis and glutaminolysis. N-Myc downstream regulated gene 2 (NDRG2) is a tumor suppressor gene inhibiting cancer growth, metastasis and invasion. However, the role and molecular mechanism of NDRG2 in cancer metabolism remains unclear. In this study, we discovered the role of the tumor suppressor gene NDRG2 in aerobic glycolysis and glutaminolysis of cancer cells. NDRG2 inhibited glucose consumption and lactate production, glutamine consumption and glutamate production in colorectal cancer cells. Analysis of glucose transporters and the catalytic enzymes involved in glycolysis revealed that glucose transporter 1 (GLUT1), hexokinase 2 (HK2), pyruvate kinase M2 isoform (PKM2) and lactate dehydrogenase A (LDHA) was significantly suppressed by NDRG2. Analysis of glutamine transporter and the catalytic enzymes involved in glutaminolysis revealed that glutamine transporter ASC amino-acid transporter 2 (ASCT2) and glutaminase 1 (GLS1) was also significantly suppressed by NDRG2. Transcription factor c-Myc mediated inhibition of glycolysis and glutaminolysis by NDRG2. More importantly, NDRG2 inhibited the expression of c-Myc by suppressing the expression of β-catenin, which can transcriptionally activate C-MYC gene in nucleus. In addition, the growth and proliferation of colorectal cancer cells were suppressed significantly by NDRG2 through inhibition of glycolysis and glutaminolysis. Taken together, these findings indicate that NDRG2 functions as an essential regulator in glycolysis and glutaminolysis via repression of c-Myc, and acts as a suppressor of carcinogenesis through coordinately targeting glucose and glutamine transporter, multiple catalytic enzymes involved in glycolysis and glutaminolysis, which fuels the bioenergy and biomaterials needed for cancer proliferation and progress. PMID:26317652

SUPPRESSOR OF MORE AXILLARY GROWTH2 1 Controls Seed Germination and Seedling Development in Arabidopsis1[W][OPEN

PubMed Central

Stanga, John P.; Smith, Steven M.; Briggs, Winslow R.; Nelson, David C.

2013-01-01

Abiotic chemical signals discovered in smoke that are known as karrikins (KARs) and the endogenous hormone strigolactone (SL) control plant growth through a shared MORE AXILLARY GROWTH2 (MAX2)-dependent pathway. A SL biosynthetic pathway and candidate KAR/SL receptors have been characterized, but signaling downstream of MAX2 is poorly defined. A screen for genetic suppressors of the enhanced seed dormancy phenotype of max2 in Arabidopsis (Arabidopsis thaliana) led to identification of a suppressor of max2 1 (smax1) mutant. smax1 restores the seed germination and seedling photomorphogenesis phenotypes of max2 but does not affect the lateral root formation, axillary shoot growth, or senescence phenotypes of max2. Expression of three transcriptional markers of KAR/SL signaling, D14-LIKE2, KAR-UP F-BOX1, and INDOLE-3-ACETIC ACID INDUCIBLE1, is rescued in smax1 max2 seedlings. SMAX1 is a member of an eight-gene family in Arabidopsis that has weak similarity to HEAT SHOCK PROTEIN 101, which encodes a caseinolytic peptidase B chaperonin required for thermotolerance. SMAX1 and the SMAX1-like (SMXL) homologs are differentially expressed in Arabidopsis tissues. SMAX1 transcripts are most abundant in dry seed, consistent with its function in seed germination control. Several SMXL genes are up-regulated in seedlings treated with the synthetic SL GR24. SMAX1 and SMXL2 transcripts are reduced in max2 seedlings, which could indicate negative feedback regulation by KAR/SL signaling. smax1 seed and seedling growth mimics the wild type treated with KAR/SL, but smax1 seedlings are still responsive to 2H-furo[2,3-c]pyran-2-one (KAR2) or GR24. We conclude that SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth but is not necessary for all MAX2-dependent responses. We hypothesize that one or more SMXL proteins may also act downstream of MAX2 to control the diverse developmental responses to KARs and SLs. PMID:23893171

Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

PubMed

Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

2015-10-02

Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

Hunting for Novel X-Linked Breast Cancer Suppressor Genes in Mouse and Human

DTIC Science & Technology

2007-03-01

display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 01/03/07 2 . REPORT TYPE...and correlated significantly with HER- 2 over-expression, regardless of the status of HER- 2 amplification. In toto, the data demonstrate that FOXP3...is an X-linked breast cancer suppressor gene and an important regulator of the HER- 2 /ErbB2 oncogene. 15. SUBJECT TERMS No subject terms provided 16

Differential Splicing of Oncogenes and Tumor Suppressor Genes in African- and Caucasian-American Populations: Contributing Factor in Prostate Cancer Disparities

DTIC Science & Technology

2015-10-01

Populations: Contributing Factor in Prostate Cancer Disparities? PRINCIPAL INVESTIGATOR: Norman H Lee, Ph.D. CONTRACTING ORGANIZATION: George Washington...Prostate Cancer Disparities? 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Norman H Lee, PhD; Bi-Dar Wang, PhD; Jacqueline Olender (PhD graduate...suppressor genes in prostate cancer disparities between African American (AA) and Caucasian American (CA) prostate cancer (PCa). In year 1 of this award

Identification of Two Candidate Tumor Suppressor Genes on Chromosome 17p13.3: Assessment of Their Roles in Breast and Ovarian Carcinogenesis.

DTIC Science & Technology

1998-08-01

has also been reported in primitive neuroectodermal tumors (19), carcinoma of the cervix uteri (20), medulloblastoma, osteosarcoma (21), astrocytoma...Knudson, A. G., Jr. Oncogenes and tumor-suppressor genes. In: W. J. Hoskins, C. A. Perez, and R. C. Young (eds.), Principles and Practice of... Young , B. D., Nakayama, K., and Steiner, D. F. Processing of wild-type and mutant proinsulin-like growth factor-IA by subtilisin-related proprotein

Small RNA-induced INTS6 gene up-regulation suppresses castration-resistant prostate cancer cells by regulating β-catenin signaling.

PubMed

Chen, Hong; Shen, Hai-Xiang; Lin, Yi-Wei; Mao, Ye-Qing; Liu, Ben; Xie, Li-Ping

2018-06-12

Small RNAs play an important role in gene regulatory networks. The gene suppressive effect of small RNAs was previously the dominant focus of studies, but during the recent decade, small RNA-induced gene activation has been reported and has become a notable gene manipulation technique. In this study, a putative tumor suppressor, INTS6, was activated by introducing a promoter-targeted small RNA (dsRNA-915) into castration-resistant prostate cancer (CRPC) cells. Unique dynamics associated with the gene upregulation phenomenon was observed. Following gene activation, cell proliferation and motility were suppressed in vitro. Downregulation of Wnt/β-catenin signaling was observed during the activation period, and the impairment of β-catenin degradation reversed the tumor suppressor effects of INTS6. These results suggest the potential application of small activating RNAs in targeted gene therapy for CRPC.

The Epigenetics of Kidney Cancer and Bladder Cancer

PubMed Central

Hoffman, Amanda M.; Cairns, Paul

2012-01-01

Summary This review focuses on the epigenetic alterations of aberrant promoter hypermethylation of genes, histone modifications or RNA interference in cancer cells. The current knowledge of hypermethylation of allele(s) in classical tumor suppressor genes in inherited and sporadic cancer, candidate tumor suppressor and other cancer genes is summarized gene by gene. Global and array-based studies of tumor cell hypermethylation are discussed. The importance of standardization of scoring of the methylation status of a gene is highlighted. The histone marks associated with hypermethylated genes, and the microRNAs with dysregulated expression, in kidney or bladder tumor cells are also discussed. Kidney cancer has the highest mortality rate of the genitourinary cancers. There are management issues with the high recurrence rate of superficial bladder cancer while muscle invasive bladder cancer has a poor prognosis. These clinical problems are the basis for translational application of gene hypermethylation to the diagnosis and prognosis of kidney and bladder cancer. PMID:22126150

Genome-wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma.

PubMed

Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J; Almutairi, Bader; Etchevers, Heather C; McConville, Carmel; Malik, Karim T A; Brown, Keith W

2017-04-01

Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome-wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome-wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down-regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest-expressing tumors had reduced relapse-free survival. Our functional studies showed that knock-down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc.

Genome‐wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma

PubMed Central

Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.

2016-01-01

Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318

Do EBV Encoded Small RNAs Interfere with Tumor Suppressor APC in EBV Associated Breast Cancers

DTIC Science & Technology

2006-08-01

acute infectious mononucleosis but ultimately establishes persistent lifetime latent infection. In all latently infected cells EBVexpresses two small non...human initially causes acute infectious mononucleosis and later establishes persistent lifetime latent infection. In all latently EBV-infected cells, only

Genetic characterization of frameshift suppressors with new decoding properties.

PubMed Central

Hughes, D; Thompson, S; O'Connor, M; Tuohy, T; Nichols, B P; Atkins, J F

1989-01-01

Suppressor mutants that cause ribosomes to shift reading frame at specific and new sequences are described. Suppressors for trpE91, the only known suppressible -1 frameshift mutant, have been isolated in Escherichia coli and in Salmonella typhimurium. E. coli hopR acts on trpE91 within the 9-base-pair sequence GGA GUG UGA, is dominant, and is located at min 52 on the chromosome. Its Salmonella homolog maps at an equivalent position and arises as a rarer class in that organism as compared with E. coli. The Salmonella suppressor, hopE, believed to be in a duplicate copy of the same gene, maps at min 17. The +1 suppressor, sufT, acts at the nonmonotonous sequence CCGU, is dominant, and maps at min 59 on the Salmonella chromosome. PMID:2644219

Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

PubMed Central

Cheng, J; Haas, M

1990-01-01

Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

Drosophila histone locus bodies form by hierarchical recruitment of components

PubMed Central

White, Anne E.; Burch, Brandon D.; Yang, Xiao-cui; Gasdaska, Pamela Y.; Dominski, Zbigniew; Marzluff, William F.

2011-01-01

Nuclear bodies are protein- and RNA-containing structures that participate in a wide range of processes critical to genome function. Molecular self-organization is thought to drive nuclear body formation, but whether this occurs stochastically or via an ordered, hierarchical process is not fully understood. We addressed this question using RNAi and proteomic approaches in Drosophila melanogaster to identify and characterize novel components of the histone locus body (HLB), a nuclear body involved in the expression of replication-dependent histone genes. We identified the transcription elongation factor suppressor of Ty 6 (Spt6) and a homologue of mammalian nuclear protein of the ataxia telangiectasia–mutated locus that is encoded by the homeotic gene multisex combs (mxc) as novel HLB components. By combining genetic manipulation in both cell culture and embryos with cytological observations of Mxc, Spt6, and the known HLB components, FLICE-associated huge protein, Mute, U7 small nuclear ribonucleoprotein, and MPM-2 phosphoepitope, we demonstrated sequential recruitment and hierarchical dependency for localization of factors to HLBs during development, suggesting that ordered assembly can play a role in nuclear body formation. PMID:21576393

Investigating Genetic Alterations in Bladder Cancer | Center for Cancer Research

Cancer.gov

Bladder cancer (BC) is the fifth most common cancer worldwide and the sixth most common cancer in the U.S. Mutations in a number of oncogenes and tumor suppressor genes were previously associated with invasive or noninvasive forms of the disease. More recently, next generation sequencing (NGS) of bladder tumors from over 100 Chinese patients revealed alterations in additional genes, including those encoding chromatin remodeling enzymes, like lysine specific histone demethylase 6A (KDM6A) and ARID1A, and spindle checkpoint proteins. Because the NGS studies analyzed tumors from patients of a single ethnicity, the results may not be representative of alterations in other patients. To expand on these findings, Michael Nickerson, Ph.D., and Michael Dean, Ph.D., of CCR’s Cancer and Inflammation Program and their colleagues, including Dan Theodorescu, M.D., Ph.D., Director of the University of Colorado NCI-Designated Comprehensive Cancer Center, performed exome sequencing of 14 tumors and targeted sequencing of another 40 tumors all from non-Asian patients diagnosed with BC in the U.S.

IC97 Is a Novel Intermediate Chain of I1 Dynein That Interacts with Tubulin and Regulates Interdoublet Sliding

PubMed Central

Wirschell, Maureen; Yang, Chun; Yang, Pinfen; Fox, Laura; Yanagisawa, Haru-aki; Kamiya, Ritsu; Witman, George B.; Porter, Mary E.

2009-01-01

Our goal is to understand the assembly and regulation of flagellar dyneins, particularly the Chlamydomonas inner arm dynein called I1 dynein. Here, we focus on the uncharacterized I1-dynein IC IC97. The IC97 gene encodes a novel IC without notable structural domains. IC97 shares homology with the murine lung adenoma susceptibility 1 (Las1) protein—a candidate tumor suppressor gene implicated in lung tumorigenesis. Multiple, independent biochemical assays determined that IC97 interacts with both α- and β-tubulin subunits within the axoneme. I1-dynein assembly mutants suggest that IC97 interacts with both the IC138 and IC140 subunits within the I1-dynein motor complex and that IC97 is part of a regulatory complex that contains IC138. Microtubule sliding assays, using axonemes containing I1 dynein but devoid of IC97, show reduced microtubule sliding velocities that are not rescued by kinase inhibitors, revealing a critical role for IC97 in I1-dynein function and control of dynein-driven motility. PMID:19420136

A Recurrent Mutation in PARK2 Is Associated with Familial Lung Cancer

PubMed Central

Xiong, Donghai; Wang, Yian; Kupert, Elena; Simpson, Claire; Pinney, Susan M.; Gaba, Colette R.; Mandal, Diptasri; Schwartz, Ann G.; Yang, Ping; de Andrade, Mariza; Pikielny, Claudio; Byun, Jinyoung; Li, Yafang; Stambolian, Dwight; Spitz, Margaret R.; Liu, Yanhong; Amos, Christopher I.; Bailey-Wilson, Joan E.; Anderson, Marshall; You, Ming

2015-01-01

PARK2, a gene associated with Parkinson disease, is a tumor suppressor in human malignancies. Here, we show that c.823C>T (p.Arg275Trp), a germline mutation in PARK2, is present in a family with eight cases of lung cancer. The resulting amino acid change, p.Arg275Trp, is located in the highly conserved RING finger 1 domain of PARK2, which encodes an E3 ubiquitin ligase. Upon further analysis, the c.823C>T mutation was detected in three additional families affected by lung cancer. The effect size for PARK2 c.823C>T (odds ratio = 5.24) in white individuals was larger than those reported for variants from lung cancer genome-wide association studies. These data implicate this PARK2 germline mutation as a genetic susceptibility factor for lung cancer. Our results provide a rationale for further investigations of this specific mutation and gene for evaluation of the possibility of developing targeted therapies against lung cancer in individuals with PARK2 variants by compensating for the loss-of-function effect caused by the associated variation. PMID:25640678

Identification of Two Candidate Tumor Suppressor Genes on Chromosome 17p13.3: Assessment of Their Roles in Breast and Ovarian Carcinogenesis

DTIC Science & Technology

1999-07-01

but is generally at an advanced stage at the time of detection. Both diseases are controlled by multiple genetic defects, suggesting the involvement of...Functional characterization of OVCA1, a putative tumor suppressor. American Society of Human Genetics , submitted, 1999. Prowse, A.H., Bruening, W...Godwin, A.K. OVCA1, and novel tumor suppressor, is aberrantly expressed in ovarian carcinomas. American Society of Human Genetics , submitted, 1999

The LKB1-AMPK pathway: metabolism and growth control in tumour suppression.

PubMed

Shackelford, David B; Shaw, Reuben J

2009-08-01

In the past decade, studies of the human tumour suppressor LKB1 have uncovered a novel signalling pathway that links cell metabolism to growth control and cell polarity. LKB1 encodes a serine-threonine kinase that directly phosphorylates and activates AMPK, a central metabolic sensor. AMPK regulates lipid, cholesterol and glucose metabolism in specialized metabolic tissues, such as liver, muscle and adipose tissue. This function has made AMPK a key therapeutic target in patients with diabetes. The connection of AMPK with several tumour suppressors suggests that therapeutic manipulation of this pathway using established diabetes drugs warrants further investigation in patients with cancer.

GBF-dependent family genes morphologically suppress the partially active Dictyostelium STATa strain.

PubMed

Shimada, Nao; Kanno-Tanabe, Naoko; Minemura, Kakeru; Kawata, Takefumi

2008-02-01

Transcription factor Dd-STATa, a functional Dictyostelium homologue of metazoan signal transducers and activators of transcription proteins, is necessary for culmination during development. We have isolated more than 18 putative multicopy suppressors of Dd-STATa using genetic screening. One was hssA gene, whose expression is known to be G-box-binding-factor-dependent and which was specific to prestalk A (pstA) cells, where Dd-STATa is activated. Also, hssA mRNA was expressed in pstA cells in the Dd-STATa-null mutant. At least 40 hssA-related genes are present in the genome and constitute a multigene family. The tagged HssA protein was translated; hssA encodes an unusually high-glycine-serine-rich small protein (8.37 kDa), which has strong homology to previously reported cyclic-adenosine-monophosphate-inducible 2C and 7E proteins. Overexpression of hssA mRNA as well as frame-shifted versions of hssA RNA suppressed the phenotype of the partially active Dd-STATa strain, suggesting that translation is not necessary for suppression. Although overexpression of prespore-specific genes among the family did not suppress the parental phenotype, prestalk-specific family members did. Although overexpression of the hssA did not revert the expression of Dd-STATa target genes, and although its suppression mechanism remains unknown, morphological reversion implies functional relationships between Dd-STATa and hssA.

Sleep quality and methylation status of selected tumor suppressor genes among nurses and midwives.

PubMed

Bukowska-Damska, Agnieszka; Reszka, Edyta; Kaluzny, Pawel; Wieczorek, Edyta; Przybek, Monika; Zienolddiny, Shanbeh; Peplonska, Beata

2018-01-01

Chronic sleep restriction may affect metabolism, hormone secretion patterns and inflammatory responses. Limited reports suggest also epigenetic effects, such as changes in DNA methylation profiles. The study aims to assess the potential association between poor sleep quality or sleep duration and the levels of 5-methylcytosine in the promoter regions of selected tumor suppressor genes. A cross-sectional study was conducted on 710 nurses and midwives aged 40-60 years. Data from interviews regarding sleep habits and potential confounders were used. The methylation status of tumor suppressor genes was determined via qMSP reactions using DNA samples derived from leucocytes. No significant findings were observed in the total study population or in the two subgroups of women stratified by the current system of work. A borderline significance association was observed between a shorter duration of sleep and an increased methylation level in CDKN2A among day working nurses and midwives. Further studies are warranted to explore this under-investigated topic.

Functional conservation of the human EXT1 tumor suppressor gene and its Drosophila homolog tout velu.

PubMed

Dasgupta, Ujjaini; Dixit, Bharat L; Rusch, Melissa; Selleck, Scott; The, Inge

2007-08-01

Heparan sulfate proteoglycans play a vital role in signaling of various growth factors in both Drosophila and vertebrates. In Drosophila, mutations in the tout velu (ttv) gene, a homolog of the mammalian EXT1 tumor suppressor gene, leads to abrogation of glycosaminoglycan (GAG) biosynthesis. This impairs distribution and signaling activities of various morphogens such as Hedgehog (Hh), Wingless (Wg), and Decapentaplegic (Dpp). Mutations in members of the exostosin (EXT) gene family lead to hereditary multiple exostosis in humans leading to bone outgrowths and tumors. In this study, we provide genetic and biochemical evidence that the human EXT1 (hEXT1) gene is conserved through species and can functionally complement the ttv mutation in Drosophila. The hEXT1 gene was able to rescue a ttv null mutant to adulthood and restore GAG biosynthesis.

Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L).

PubMed

Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

2016-01-01

MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango ( Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5' UTR and a 189 bp long 3' UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems' leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue -specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis . In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango.

Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L)

PubMed Central

Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

2016-01-01

MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5′ UTR and a 189 bp long 3′ UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems’ leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue –specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango. PMID:27965680

MicroRNA-200a suppresses the Wnt/β-catenin signaling pathway by interacting with β-catenin.

PubMed

Su, Juan; Zhang, Anling; Shi, Zhendong; Ma, Feifei; Pu, Peiyu; Wang, Tao; Zhang, Jie; Kang, Chunsheng; Zhang, Qingyu

2012-04-01

The Wnt/β-catenin signaling pathway is crucial for human organ development and is involved in tumor progression of many cancers. Accumulating evidence suggests that the expression of β-catenin is, in part, regulated by specific microRNAs (miRNAs). The purpose of this study was to determine the expression of a recently identified epithelial to mesenchymal transition (EMT)-associated tumor suppressor microRNA (miR)-200a, in cancer cells. We also aimed to identify specific miR-200a target genes and to investigate the antitumor effects of miR-200a on the Wnt/β-catenin signaling pathway. We employed TOP/FOP flash luciferase assays to identify the effect of miR-200a on the Wnt/β-catenin pathway and we confirmed our observations using fluorescence microscopy. To determine target genes of miR-200a, a 3' untranslated region (3' UTR) luciferase assay was performed. Cell viability, invasion and wound healing assays were carried out for functional analysis after miRNA transfection. We further investigated the role of miR-200a in EMT by Western blot analysis. We found fluctuation in the expression of miR-200a that was accompanied by changes in the expression of members of the Wnt/β-catenin signaling pathway. We also determined that miR-200a can directly interact with the 3' UTR of CTNNB1 (the gene that encodes β-catenin) to suppress Wnt/β-catenin signaling. MiR-200a could also influence the biological activities of SGC790 and U251 cells. Our results demonstrate that miR-200a is a new tumor suppressor that can regulate the activity of the Wnt/β-catenin signaling pathway via two mechanisms. MiR-200a is a candidate target for tumor treatment via its regulation of the Wnt/β-catenin signaling pathway.

A Study of Gibberellin Homeostasis and Cryptochrome-Mediated Blue Light Inhibition of Hypocotyl Elongation1[W][OA

PubMed Central

Zhao, Xiaoying; Yu, Xuhong; Foo, Eloise; Symons, Gregory M.; Lopez, Javier; Bendehakkalu, Krishnaprasad T.; Xiang, Jing; Weller, James L.; Liu, Xuanming; Reid, James B.; Lin, Chentao

2007-01-01

Cryptochromes mediate blue light-dependent photomorphogenic responses, such as inhibition of hypocotyl elongation. To investigate the underlying mechanism, we analyzed a genetic suppressor, scc7-D (suppressors of cry1cry2), which suppressed the long-hypocotyl phenotype of the cry1cry2 (cryptochrome1/cryptochrome2) mutant in a light-dependent but wavelength-independent manner. scc7-D is a gain-of-expression allele of the GA2ox8 gene encoding a gibberellin (GA)-inactivating enzyme, GA 2-oxidase. Although scc7-D is hypersensitive to light, transgenic seedlings expressing GA2ox at a level higher than scc7-D showed a constitutive photomorphogenic phenotype, confirming a general role of GA2ox and GA in the suppression of hypocotyl elongation. Prompted by this result, we investigated blue light regulation of mRNA expression of the GA metabolic and catabolic genes. We demonstrated that cryptochromes are required for the blue light regulation of GA2ox1, GA20ox1, and GA3ox1 expression in transient induction, continuous illumination, and photoperiodic conditions. The kinetics of cryptochrome induction of GA2ox1 expression and cryptochrome suppression of GA20ox1 or GA3ox1 expression correlate with the cryptochrome-dependent transient reduction of GA4 in etiolated wild-type seedlings exposed to blue light. Therefore we propose that in deetiolating seedlings, cryptochromes mediate blue light regulation of GA catabolic/metabolic genes, which affect GA levels and hypocotyl elongation. Surprisingly, no significant change in the GA4 content was detected in the whole shoot samples of the wild-type or cry1cry2 seedlings grown in the dark or continuous blue light, suggesting that cryptochromes may also regulate GA responsiveness and/or trigger cell- or tissue-specific changes of the level of bioactive GAs. PMID:17644628

Tumor suppressor BRCA1 is expressed in prostate cancer and controls IGF-I receptor (IGF-IR) gene transcription in an androgen receptor-dependent manner

PubMed Central

Schayek, Hagit; Haugk, Kathy; Sun, Shihua; True, Lawrence D.; Plymate, Stephen R.; Werner, Haim

2010-01-01

Purpose The insulin-like growth factor (IGF) system plays an important role in prostate cancer. The BRCA1 gene encodes a transcription factor with tumor suppressor activity. The involvement of BRCA1 in prostate cancer, however, has not yet been elucidated. The purpose of the present study was to examine the functional correlations between BRCA1 and the IGF system in prostate cancer. Experimental Design An immunohistochemical analysis of BRCA1 was performed on Tissue Microarrays comprising 203 primary prostate cancer specimens. In addition, BRCA1 levels were measured in prostate cancer xenografts and in cell lines representing early stages of the disease (P69 cells) and advanced stages (M12 cells). The ability of BRCA1 to regulate IGF-IR expression was studied by coexpression experiments using a BRCA1 expression vector along with an IGF-IR promoter-luciferase reporter. Results We found significantly elevated BRCA1 levels in prostate cancer in comparison to histologically normal prostate tissue (p < 0.001). In addition, an inverse correlation between BRCA1 and IGF-IR levels was observed in the AR-negative P69 and M12 prostate cancer-derived cell lines. Coexpression experiments in M12 cells revealed that BRCA1 was able to suppress IGF-IR promoter activity and endogenous IGF-IR levels. On the other hand, BRCA1 enhanced IGF-IR levels in LnCaP C4-2 cells expressing an endogenous AR. Conclusions We provide evidence that BRCA1 differentially regulates IGF-IR expression in AR positive and negative prostate cancer cells. The mechanism of action of BRCA1 involves modulation of IGF-IR gene transcription. In addition, immunohistochemical data is consistent with a potential survival role of BRCA1 in prostate cancer. PMID:19223505

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

Monitoring the Assembly of a Secreted Bacterial Virulence Factor Using Site-specific Crosslinking

PubMed Central

Pavlova, Olga; Ieva, Raffaele; Bernstein, Harris D

2013-01-01

This article describes a method to detect and analyze dynamic interactions between a protein of interest and other factors in vivo. Our method is based on the amber suppression technology that was originally developed by Peter Schultz and colleagues1. An amber mutation is first introduced at a specific codon of the gene encoding the protein of interest. The amber mutant is then expressed in E. coli together with genes encoding an amber suppressor tRNA and an amino acyl-tRNA synthetase derived from Methanococcus jannaschii. Using this system, the photo activatable amino acid analog p-benzoylphenylalanine (Bpa) is incorporated at the amber codon. Cells are then irradiated with ultraviolet light to covalently link the Bpa residue to proteins that are located within 3-8 Å. Photocrosslinking is performed in combination with pulse-chase labeling and immunoprecipitation of the protein of interest in order to monitor changes in protein-protein interactions that occur over a time scale of seconds to minutes. We optimized the procedure to study the assembly of a bacterial virulence factor that consists of two independent domains, a domain that is integrated into the outer membrane and a domain that is translocated into the extracellular space, but the method can be used to study many different assembly processes and biological pathways in both prokaryotic and eukaryotic cells. In principle interacting factors and even specific residues of interacting factors that bind to a protein of interest can be identified by mass spectrometry. PMID:24378574

The tumour suppressor CDKN2A/p16INK4a regulates adipogenesis and bone marrow-dependent development of perivascular adipose tissue

PubMed Central

Wouters, Kristiaan; Deleye, Yann; Hannou, Sarah A; Vanhoutte, Jonathan; Maréchal, Xavier; Coisne, Augustin; Tagzirt, Madjid; Derudas, Bruno; Bouchaert, Emmanuel; Duhem, Christian; Vallez, Emmanuelle; Schalkwijk, Casper G; Pattou, François; Montaigne, David; Staels, Bart; Paumelle, Réjane

2017-01-01

The genomic CDKN2A/B locus, encoding p16INK4a among others, is linked to an increased risk for cardiovascular disease and type 2 diabetes. Obesity is a risk factor for both cardiovascular disease and type 2 diabetes. p16INK4a is a cell cycle regulator and tumour suppressor. Whether it plays a role in adipose tissue formation is unknown. p16INK4a knock-down in 3T3/L1 preadipocytes or p16INK4a deficiency in mouse embryonic fibroblasts enhanced adipogenesis, suggesting a role for p16INK4a in adipose tissue formation. p16INK4a-deficient mice developed more epicardial adipose tissue in response to the adipogenic peroxisome proliferator activated receptor gamma agonist rosiglitazone. Additionally, adipose tissue around the aorta from p16INK4a-deficient mice displayed enhanced rosiglitazone-induced gene expression of adipogenic markers and stem cell antigen, a marker of bone marrow-derived precursor cells. Mice transplanted with p16INK4a-deficient bone marrow had more epicardial adipose tissue compared to controls when fed a high-fat diet. In humans, p16INK4a gene expression was enriched in epicardial adipose tissue compared to other adipose tissue depots. Moreover, epicardial adipose tissue from obese humans displayed increased expression of stem cell antigen compared to lean controls, supporting a bone marrow origin of epicardial adipose tissue. These results show that p16INK4a modulates epicardial adipose tissue development, providing a potential mechanistic link between the genetic association of the CDKN2A/B locus and cardiovascular disease risk. PMID:28868898

Multiple endocrine neoplasia type 1 knockout mice develop parathyroid, pancreatic, pituitary and adrenal tumours with hypercalcaemia, hypophosphataemia and hypercorticosteronaemia.

PubMed

Harding, Brian; Lemos, Manuel C; Reed, Anita A C; Walls, Gerard V; Jeyabalan, Jeshmi; Bowl, Michael R; Tateossian, Hilda; Sullivan, Nicky; Hough, Tertius; Fraser, William D; Ansorge, Olaf; Cheeseman, Michael T; Thakker, Rajesh V

2009-12-01

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant disorder characterized in man by parathyroid, pancreatic, pituitary and adrenal tumours. The MEN1 gene encodes a 610-amino acid protein (menin) which is a tumour suppressor. To investigate the in vivo role of menin, we developed a mouse model, by deleting Men1 exons 1 and 2 and investigated this for MEN1-associated tumours and serum abnormalities. Men1(+/-) mice were viable and fertile, and 220 Men1(+/-) and 94 Men1(+/+) mice were studied between the ages of 3 and 21 months. Survival in Men1(+/-) mice was significantly lower than in Men1(+/+) mice (<68% vs >85%, P<0.01). Men1(+/-) mice developed, by 9 months of age, parathyroid hyperplasia, pancreatic tumours which were mostly insulinomas, by 12 months of age, pituitary tumours which were mostly prolactinomas, and by 15 months parathyroid adenomas and adrenal cortical tumours. Loss of heterozygosity and menin expression was demonstrated in the tumours, consistent with a tumour suppressor role for the Men1 gene. Men1(+/-) mice with parathyroid neoplasms were hypercalcaemic and hypophosphataemic, with inappropriately normal serum parathyroid hormone concentrations. Pancreatic and pituitary tumours expressed chromogranin A (CgA), somatostatin receptor type 2 and vascular endothelial growth factor-A. Serum CgA concentrations in Men1(+/-) mice were not elevated. Adrenocortical tumours, which immunostained for 3-beta-hydroxysteroid dehydrogenase, developed in seven Men1(+/-) mice, but resulted in hypercorticosteronaemia in one out of the four mice that were investigated. Thus, these Men1(+/-) mice are representative of MEN1 in man, and will help in investigating molecular mechanisms and treatments for endocrine tumours.

Lipid phosphatase SHIP2 functions as oncogene in colorectal cancer by regulating PKB activation.

PubMed

Hoekstra, Elmer; Das, Asha M; Willemsen, Marcella; Swets, Marloes; Kuppen, Peter J K; van der Woude, Christien J; Bruno, Marco J; Shah, Jigisha P; Ten Hagen, Timo L M; Chisholm, John D; Kerr, William G; Peppelenbosch, Maikel P; Fuhler, Gwenny M

2016-11-08

Colorectal cancer (CRC) is the second most common cause of cancer-related death, encouraging the search for novel therapeutic targets affecting tumor cell proliferation and migration. These cellular processes are under tight control of two opposing groups of enzymes; kinases and phosphatases. Aberrant activity of kinases is observed in many forms of cancer and as phosphatases counteract such "oncogenic" kinases, it is generally assumed that phosphatases function as tumor suppressors. However, emerging evidence suggests that the lipid phosphatase SH2-domain-containing 5 inositol phosphatase (SHIP2), encoded by the INPPL1 gene, may act as an oncogene. Just like the well-known tumor suppressor gene Phosphatase and Tensin Homolog (PTEN) it hydrolyses phosphatidylinositol (3,4,5) triphosphate (PI(3,4,5)P3). However, unlike PTEN, the reaction product is PI(3,4)P2, which is required for full activation of the downstream protein kinase B (PKB/Akt), suggesting that SHIP2, in contrast to PTEN, could have a tumor initiating role through PKB activation. In this work, we investigated the role of SHIP2 in colorectal cancer. We found that SHIP2 and INPPL1 expression is increased in colorectal cancer tissue in comparison to adjacent normal tissue, and this is correlated with decreased patient survival. Moreover, SHIP2 is more active in colorectal cancer tissue, suggesting that SHIP2 can induce oncogenesis in colonic epithelial cells. Furthermore, in vitro experiments performed on colorectal cancer cell lines shows an oncogenic role for SHIP2, by enhancing chemoresistance, cell migration, and cell invasion. Together, these data indicate that SHIP2 expression contributes to the malignant potential of colorectal cancer, providing a possible target in the fight against this devastating disease.

Dendritic cells with increased expression of suppressor of cytokine signaling 1(SOCS1) gene ameliorate lipopolysaccharide/d-galactosamine-induced acute liver failure.

PubMed

Li, Shan-Shan; Yang, Min; Chen, Yong-Ping; Tang, Xin-Yue; Zhang, Sheng-Guo; Ni, Shun-Lan; Yang, Nai-Bin; Lu, Ming-Qin

2018-05-28

Acute liver failure is a devastating clinical syndrome with extremely terrible inflammation reaction, which is still lack of effective treatment in clinic. Suppressor of Cytokine Signaling 1 protein is inducible intracellular negative regulator of Janus kinases (JAK)/signal transducers and activators of transcription (STAT) pathway that plays essential role in inhibiting excessive intracellular signaling cascade and preventing autoimmune reaction. In this paper, we want to explore whether dendritic cells (DCs) with overexpression of SOCS1 have a therapeutic effect on experimental acute liver failure. Bone marrow derived dendritic cells were transfected with lentivirus encoding SOCS1 and negative control lentivirus, thereafter collected for costimulatory molecules analysis, allogeneic Mixed Lymphocyte Reaction and Western blot test of JAK/STAT pathway. C57BL/6 mice were randomly separated into normal control and treatment groups which respectively received tail vein injection of modified DCs, negative control DCs and normal saline 12 h earlier than acute liver failure induction. Our results indicated that DCs with overexpression of SOCS1 exhibited like regulatory DCs (DCregs) with low level of costimulatory molecules and poor allostimulatory ability in vitro, which was supposed to correlate with block of JAK2/STAT1 signaling. In vivo tests, we found that infusion of modified DCs increased survival rate of acute liver failure mice and alleviate liver injury via inhibition of TLR4/HMGB1 pathway. We concluded that DCs transduced with SOCS1 gene exhibit as DCregs through negative regulation of JAK2/STAT1 pathway and ameliorated lipopolysaccharide/d-galactosamine induced acute liver failure via inhibition of TLR4 pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Life without tRNAIle-lysidine synthetase: translation of the isoleucine codon AUA in Bacillus subtilis lacking the canonical tRNA2Ile

PubMed Central

Köhrer, Caroline; Mandal, Debabrata; Gaston, Kirk W.; Grosjean, Henri; Limbach, Patrick A.; RajBhandary, Uttam L.

2014-01-01

Translation of the isoleucine codon AUA in most prokaryotes requires a modified C (lysidine or agmatidine) at the wobble position of tRNA2Ile to base pair specifically with the A of the AUA codon but not with the G of AUG. Recently, a Bacillus subtilis strain was isolated in which the essential gene encoding tRNAIle-lysidine synthetase was deleted for the first time. In such a strain, C34 at the wobble position of tRNA2Ile is expected to remain unmodified and cells depend on a mutant suppressor tRNA derived from tRNA1Ile, in which G34 has been changed to U34. An important question, therefore, is how U34 base pairs with A without also base pairing with G. Here, we show (i) that unlike U34 at the wobble position of all B. subtilis tRNAs of known sequence, U34 in the mutant tRNA is not modified, and (ii) that the mutant tRNA binds strongly to the AUA codon on B. subtilis ribosomes but only weakly to AUG. These in vitro data explain why the suppressor strain displays only a low level of misreading AUG codons in vivo and, as shown here, grows at a rate comparable to that of the wild-type strain. PMID:24194599

A Herpesvirus Ribosome-Associated, RNA-Binding Protein Confers a Growth Advantage upon Mutants Deficient in a GADD34-Related Function†

PubMed Central

Mulvey, Matthew; Poppers, Jeremy; Ladd, Alison; Mohr, Ian

1999-01-01

The herpes simplex virus type 1 γ34.5 gene product and the cellular GADD34 protein both contain similar domains that can regulate the activity of eukaryotic initiation factor 2 (eIF2), a critical translation initiation factor. Viral mutants that lack the GADD34-related function grow poorly on a variety of malignant human cells, as activation of the cellular PKR kinase leads to the accumulation of inactive, phosphorylated eIF2 at late times postinfection. Termination of translation prior to the completion of the viral reproductive cycle leads to impaired growth. Extragenic suppressors that regain the ability to synthesize proteins efficiently in the absence of the viral GADD34-related function have been isolated. These suppressor alleles are dominant in trans and affect the steady-state accumulation of several viral mRNA species. We demonstrate that deregulated expression of Us11, a virus-encoded RNA-binding, ribosome-associated protein is necessary and sufficient to confer a growth advantage upon viral mutants that lack a GADD34-related function. Ectopic expression of Us11 reduces the accumulation of the activated cellular PKR kinase and allows for sustained protein synthesis. Thus, an RNA-binding, ribosome-associated protein (Us11) and a GADD34-related protein (γ34.5) both function in a signal pathway that regulates translation by modulating eIF2 phosphorylation. PMID:10074192

Klotho, stem cells, and aging.

PubMed

Bian, Ao; Neyra, Javier A; Zhan, Ming; Hu, Ming Chang

2015-01-01

Aging is an inevitable and progressive biological process involving dysfunction and eventually destruction of every tissue and organ. This process is driven by a tightly regulated and complex interplay between genetic and acquired factors. Klotho is an antiaging gene encoding a single-pass transmembrane protein, klotho, which serves as an aging suppressor through a wide variety of mechanisms, such as antioxidation, antisenescence, antiautophagy, and modulation of many signaling pathways, including insulin-like growth factor and Wnt. Klotho deficiency activates Wnt expression and activity contributing to senescence and depletion of stem cells, which consequently triggers tissue atrophy and fibrosis. In contrast, the klotho protein was shown to suppress Wnt-signaling transduction, and inhibit cell senescence and preserve stem cells. A better understanding of the potential effects of klotho on stem cells could offer novel insights into the cellular and molecular mechanisms of klotho deficiency-related aging and disease. The klotho protein may be a promising therapeutic agent for aging and aging-related disorders.

Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

PubMed

Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

2017-02-21

Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

Genetic variations in ARE1 mediate grain yield by modulating nitrogen utilization in rice.

PubMed

Wang, Qing; Nian, Jinqiang; Xie, Xianzhi; Yu, Hong; Zhang, Jian; Bai, Jiaoteng; Dong, Guojun; Hu, Jiang; Bai, Bo; Chen, Lichao; Xie, Qingjun; Feng, Jian; Yang, Xiaolu; Peng, Juli; Chen, Fan; Qian, Qian; Li, Jiayang; Zuo, Jianru

2018-02-21

In crops, nitrogen directly determines productivity and biomass. However, the improvement of nitrogen utilization efficiency (NUE) is still a major challenge in modern agriculture. Here, we report the characterization of are1, a genetic suppressor of a rice fd-gogat mutant defective in nitrogen assimilation. ARE1 is a highly conserved gene, encoding a chloroplast-localized protein. Loss-of-function mutations in ARE1 cause delayed senescence and result in 10-20% grain yield increases, hence enhance NUE under nitrogen-limiting conditions. Analysis of a panel of 2155 rice varieties reveals that 18% indica and 48% aus accessions carry small insertions in the ARE1 promoter, which result in a reduction in ARE1 expression and an increase in grain yield under nitrogen-limiting conditions. We propose that ARE1 is a key mediator of NUE and represents a promising target for breeding high-yield cultivars under nitrogen-limiting condition.

Genetic loss of SH2B3 in acute lymphoblastic leukemia.

PubMed

Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Hadler, Michael; Rigo, Isaura; LeDuc, Charles A; Kelly, Kara; Jalas, Chaim; Paietta, Elisabeth; Racevskis, Janis; Rowe, Jacob M; Tallman, Martin S; Paganin, Maddalena; Basso, Giuseppe; Tong, Wei; Chung, Wendy K; Ferrando, Adolfo A

2013-10-03

The SH2B adaptor protein 3 (SH2B3) gene encodes a negative regulator of cytokine signaling with a critical role in the homeostasis of hematopoietic stem cells and lymphoid progenitors. Here, we report the identification of germline homozygous SH2B3 mutations in 2 siblings affected with developmental delay and autoimmunity, one in whom B-precursor acute lymphoblastic leukemia (ALL) developed. Mechanistically, loss of SH2B3 increases Janus kinase-signal transducer and activator of transcription signaling, promotes lymphoid cell proliferation, and accelerates leukemia development in a mouse model of NOTCH1-induced ALL. Moreover, extended mutation analysis showed homozygous somatic mutations in SH2B3 in 2 of 167 ALLs analyzed. Overall, these results demonstrate a Knudson tumor suppressor role for SH2B3 in the pathogenesis of ALL and highlight a possible link between genetic predisposition factors in the pathogenesis of autoimmunity and leukemogenesis.

A pseudogene long noncoding RNA network regulates PTEN transcription and translation in human cells

PubMed Central

Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V.

2013-01-01

PTEN is a tumor suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1 encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, alpha and beta. The alpha isoform functions in trans, localizes to the PTEN promoter, and epigenetically modulates PTEN transcription by the recruitment of DNMT3a and EZH2. In contrast, the beta isoform interacts with PTENpg1 through an RNA:RNA pairing interaction, which affects PTEN protein output via changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell cycle arrest and sensitizes cells to doxorubicin, suggesting a biological function for the respective PTENpg1 expressed asRNAs. PMID:23435381

A pseudogene long-noncoding-RNA network regulates PTEN transcription and translation in human cells.

PubMed

Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V

2013-04-01

PTEN is a tumor-suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1-encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, α and β. The α isoform functions in trans, localizes to the PTEN promoter and epigenetically modulates PTEN transcription by the recruitment of DNA methyltransferase 3a and Enhancer of Zeste. In contrast, the β isoform interacts with PTENpg1 through an RNA-RNA pairing interaction, which affects PTEN protein output through changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell-cycle arrest and sensitizes cells to doxorubicin, which suggests a biological function for the respective PTENpg1 expressed asRNAs.

Comprehensive assessment of cancer missense mutation clustering in protein structures.

PubMed

Kamburov, Atanas; Lawrence, Michael S; Polak, Paz; Leshchiner, Ignaty; Lage, Kasper; Golub, Todd R; Lander, Eric S; Getz, Gad

2015-10-06

Large-scale tumor sequencing projects enabled the identification of many new cancer gene candidates through computational approaches. Here, we describe a general method to detect cancer genes based on significant 3D clustering of mutations relative to the structure of the encoded protein products. The approach can also be used to search for proteins with an enrichment of mutations at binding interfaces with a protein, nucleic acid, or small molecule partner. We applied this approach to systematically analyze the PanCancer compendium of somatic mutations from 4,742 tumors relative to all known 3D structures of human proteins in the Protein Data Bank. We detected significant 3D clustering of missense mutations in several previously known oncoproteins including HRAS, EGFR, and PIK3CA. Although clustering of missense mutations is often regarded as a hallmark of oncoproteins, we observed that a number of tumor suppressors, including FBXW7, VHL, and STK11, also showed such clustering. Beside these known cases, we also identified significant 3D clustering of missense mutations in NUF2, which encodes a component of the kinetochore, that could affect chromosome segregation and lead to aneuploidy. Analysis of interaction interfaces revealed enrichment of mutations in the interfaces between FBXW7-CCNE1, HRAS-RASA1, CUL4B-CAND1, OGT-HCFC1, PPP2R1A-PPP2R5C/PPP2R2A, DICER1-Mg2+, MAX-DNA, SRSF2-RNA, and others. Together, our results indicate that systematic consideration of 3D structure can assist in the identification of cancer genes and in the understanding of the functional role of their mutations.

Comprehensive assessment of cancer missense mutation clustering in protein structures

PubMed Central

Kamburov, Atanas; Lawrence, Michael S.; Polak, Paz; Leshchiner, Ignaty; Lage, Kasper; Golub, Todd R.; Lander, Eric S.; Getz, Gad

2015-01-01

Large-scale tumor sequencing projects enabled the identification of many new cancer gene candidates through computational approaches. Here, we describe a general method to detect cancer genes based on significant 3D clustering of mutations relative to the structure of the encoded protein products. The approach can also be used to search for proteins with an enrichment of mutations at binding interfaces with a protein, nucleic acid, or small molecule partner. We applied this approach to systematically analyze the PanCancer compendium of somatic mutations from 4,742 tumors relative to all known 3D structures of human proteins in the Protein Data Bank. We detected significant 3D clustering of missense mutations in several previously known oncoproteins including HRAS, EGFR, and PIK3CA. Although clustering of missense mutations is often regarded as a hallmark of oncoproteins, we observed that a number of tumor suppressors, including FBXW7, VHL, and STK11, also showed such clustering. Beside these known cases, we also identified significant 3D clustering of missense mutations in NUF2, which encodes a component of the kinetochore, that could affect chromosome segregation and lead to aneuploidy. Analysis of interaction interfaces revealed enrichment of mutations in the interfaces between FBXW7-CCNE1, HRAS-RASA1, CUL4B-CAND1, OGT-HCFC1, PPP2R1A-PPP2R5C/PPP2R2A, DICER1-Mg2+, MAX-DNA, SRSF2-RNA, and others. Together, our results indicate that systematic consideration of 3D structure can assist in the identification of cancer genes and in the understanding of the functional role of their mutations. PMID:26392535

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Fuming; Saha, Abhik; Murakami, Masanao

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

Spi1 GTPase interacts with RCC1 to maintain interdependency of cell cycle events.

PubMed

Matsumoto, T; Beach, D

1991-01-01

A mutant which can enter mitosis at any cell cycle stage has been isolated and characterized in fission yeast. The pim1 (premature initiation of mitosis) mutant prearrested at G1/S can develop a mitotic spindle and has tightly condensed chromosomes upon shift to the restrictive temperature. pim1-induced mitosis requires maturation promoting factor (MPF) activity, but not the essential mitotic inducer, cdc25. The pim1+ gene encodes a homolog of regulator of chromosome condensation 1 (RCC1), a regulator of onset of mitosis in mammalian cells. A multicopy suppressor of pim1, spi1, was isolated, and found to encode a 25 kDa GTPase. The primary sequence of the spi1 GTPase shows extensive identity (80%) to human TC4, whose function is unknown. The spi1/TC4 GTPase defines a novel class in the "ras-like" GTPase family, which is distinct from ras, rho, or ypt. Disruption of the spi1+ gene causes genomic instability in a heterozygous diploid. These genetic data suggest that pim1+ and spi1+ interact to coordinate correct entry into mitosis. Immunological experiments demonstrate that the pim1+ and spi1+ products are physically associated. Mutation in the pim1 gene results in lowered affinity of the protein for the spi1 protein in vitro, which may explain why high dosages of the spi1 protein can rescue the pim1 mutant in vivo. The pim1/spi1 complex dissociates in the presence of Mg2+ and GTP. The current data suggests that pim1+ acts as a GTP exchanger for the spi1 GTPase.

Altered sterol metabolism in budding yeast affects mitochondrial iron-sulfur (Fe-S) cluster synthesis.

PubMed

Ward, Diane M; Chen, Opal S; Li, Liangtao; Kaplan, Jerry; Bhuiyan, Shah Alam; Natarajan, Selvamuthu K; Bard, Martin; Cox, James E

2018-05-17

Ergosterol synthesis is essential for cellular growth and viability of the budding yeast Saccharomyces cerevisiae, and intracellular sterol distribution and homeostasis are therefore highly regulated in this species. Erg25 is an iron-containing C4-methyl sterol oxidase that contributes to the conversion of 4,4-dimethylzymosterol to zymosterol, a precursor of ergosterol. The ERG29 gene encodes an endoplasmic reticulum (ER)-associated protein, and here we identified a role for Erg29 in the methyl sterol oxidase step of ergosterol synthesis. ERG29 deletion resulted in lethality in respiring cells, but respiration-incompetent (Rho- or Rho0) cells survived, suggesting that Erg29 loss leads to accumulation of oxidized sterol metabolites that affect cell viability. Down-regulation of ERG29 expression in Δerg29 cells indeed led to accumulation of methyl sterol metabolites, resulting in increased mitochondrial oxidants and a decreased ability of mitochondria to synthesize iron-sulfur (Fe-S) clusters due to reduced levels of Yfh1, the mammalian frataxin homolog, which is involved in mitochondrial Fe metabolism. Using a high-copy genomic library, we identified suppressor genes that permitted growth of Δerg29 cells on respiratory substrates, and these included genes encoding the mitochondrial proteins Yfh1, Mmt1, Mmt2, and Pet20, which reversed all phenotypes associated with loss of ERG29. Of note, loss of Erg25 also resulted in accumulation of methyl sterol metabolites and also increased mitochondrial oxidants and degradation of Yfh1. We propose that accumulation of toxic intermediates of the methyl sterol oxidase reaction increase mitochondrial oxidants, which affect Yfh1 protein stability. These results indicate an interaction between sterols generated by ER proteins and mitochondrial iron metabolism. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Monothiol glutaredoxin Grx5 interacts with Fe-S scaffold proteins Isa1 and Isa2 and supports Fe-S assembly and DNA integrity in mitochondria of fission yeast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Kyoung-Dong; Chung, Woo-Hyun; Kim, Hyo-Jin

2010-02-12

Mitochondrial monothiol glutaredoxins that bind Fe-S cluster are known to participate in Fe-S cluster assembly. However, their precise role has not been well understood. Among three monothiol glutaredoxins (Grx3, 4, and 5) in Schizosaccharomyces pombe only Grx5 resides in mitochondria. The {Delta}grx5 mutant requires cysteine on minimal media, and does not grow on non-fermentable carbon source such as glycerol. We found that the mutant is low in the activity of Fe-S enzymes in mitochondria as well as in the cytoplasm. Screening of multi-copy suppressor of growth defects of the mutant identified isa1{sup +} gene encoding a putative A-type Fe-S scaffold,more » in addition to mas5{sup +} and hsc1{sup +} genes encoding putative chaperones for Fe-S assembly process. Examination of other scaffold and chaperone genes revealed that isa2{sup +}, but not isu1{sup +} and ssc1{sup +}, complemented the growth phenotype of {Delta}grx5 mutant as isa1{sup +} did, partly through restoration of Fe-S enzyme activities. The mutant also showed a significant decrease in the amount of mitochondrial DNA. We demonstrated that Grx5 interacts in vivo with Isa1 and Isa2 proteins in mitochondria by observing bimolecular fluorescence complementation. These results indicate that Grx5 plays a central role in Fe-S assembly process through interaction with A-type Fe-S scaffold proteins Isa1 and Isa2, each of which is an essential protein in S. pombe, and supports mitochondrial genome integrity as well as Fe-S assembly.« less

Expression of Hormonal Carcinogenesis Genes and Related Regulatory microRNAs in Uterus and Ovaries of DDT-Treated Female Rats.

PubMed

Kalinina, T S; Kononchuk, V V; Gulyaeva, L F

2017-10-01

The insecticide dichlorodiphenyltrichloroethane (DDT) is a nonmutagenic xenobiotic compound able to exert estrogen-like effects resulting in activation of estrogen receptor-α (ERα) followed by changed expression of its downstream target genes. In addition, studies performed over recent years suggest that DDT may also influence expression of microRNAs. However, an impact of DDT on expression of ER, microRNAs, and related target genes has not been fully elucidated. Here, using real-time PCR, we assessed changes in expression of key genes involved in hormonal carcinogenesis as well as potentially related regulatory oncogenic/tumor suppressor microRNAs and their target genes in the uterus and ovaries of female Wistar rats during single and chronic multiple-dose DDT exposure. We found that applying DDT results in altered expression of microRNAs-221, -222, -205, -126a, and -429, their target genes (Pten, Dicer1), as well as genes involved in hormonal carcinogenesis (Esr1, Pgr, Ccnd1, Cyp19a1). Notably, Cyp19a1 expression seems to be also regulated by microRNAs-221, -222, and -205. The data suggest that epigenetic effects induced by DDT as a potential carcinogen may be based on at least two mechanisms: (i) activation of ERα followed by altered expression of the target genes encoding receptor Pgr and Ccnd1 as well as impaired expression of Cyp19a1, affecting, thereby, cell hormone balance; and (ii) changed expression of microRNAs resulting in impaired expression of related target genes including reduced level of Cyp19a1 mRNA.

The Genetics of a Small Autosomal Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. III. Hypomorphic and Hypermorphic Mutations Affecting the Expression of Hairless

PubMed Central

Ashburner, Michael

1982-01-01

A lethal locus (l(2)br7;35B6-10), near Adh on chromosome arm 2L of D. melanogaster, is identified with Plunkett's dominant suppressor of Hairless (H). Of eight new alleles, seven act as dominant suppressors of H, the eighth is a dominant enhancer of H. One of the suppressor alleles is both a leaky lethal and a weak suppressor of H. Confirming Nash (1970), deletions of l(2)br7 are dominant suppressors, and duplications are dominant enhancers of H. A simple model is proposed to account for the interaction of l(2)br7 and H, assuming that amorphic (or hypomorphic) alleles of l(2)br7 suppress H and that hypermorphic alleles enhance H. PMID:6816670

Metabolic engineering of an ATP-neutral Embden-Meyerhof-Parnas pathway in Corynebacterium glutamicum: growth restoration by an adaptive point mutation in NADH dehydrogenase.

PubMed

Komati Reddy, Gajendar; Lindner, Steffen N; Wendisch, Volker F

2015-03-01

Corynebacterium glutamicum uses the Embden-Meyerhof-Parnas pathway of glycolysis and gains 2 mol of ATP per mol of glucose by substrate-level phosphorylation (SLP). To engineer glycolysis without net ATP formation by SLP, endogenous phosphorylating NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was replaced by nonphosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (GapN) from Clostridium acetobutylicum, which irreversibly converts glyceraldehyde-3-phosphate (GAP) to 3-phosphoglycerate (3-PG) without generating ATP. As shown recently (S. Takeno, R. Murata, R. Kobayashi, S. Mitsuhashi, and M. Ikeda, Appl Environ Microbiol 76:7154-7160, 2010, http://dx.doi.org/10.1128/AEM.01464-10), this ATP-neutral, NADPH-generating glycolytic pathway did not allow for the growth of Corynebacterium glutamicum with glucose as the sole carbon source unless hitherto unknown suppressor mutations occurred; however, these mutations were not disclosed. In the present study, a suppressor mutation was identified, and it was shown that heterologous expression of udhA encoding soluble transhydrogenase from Escherichia coli partly restored growth, suggesting that growth was inhibited by NADPH accumulation. Moreover, genome sequence analysis of second-site suppressor mutants that were able to grow faster with glucose revealed a single point mutation in the gene of non-proton-pumping NADH:ubiquinone oxidoreductase (NDH-II) leading to the amino acid change D213G, which was shared by these suppressor mutants. Since related NDH-II enzymes accepting NADPH as the substrate possess asparagine or glutamine residues at this position, D213G, D213N, and D213Q variants of C. glutamicum NDH-II were constructed and were shown to oxidize NADPH in addition to NADH. Taking these findings together, ATP-neutral glycolysis by the replacement of endogenous NAD-dependent GAPDH with NADP-dependent GapN became possible via oxidation of NADPH formed in this pathway by mutant NADPH-accepting NDH-II(D213G) and thus by coupling to electron transport phosphorylation (ETP). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Proto-oncogene FBI-1 (Pokemon/ZBTB7A) represses transcription of the tumor suppressor Rb gene via binding competition with Sp1 and recruitment of co-repressors.

PubMed

Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

2008-11-28

FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp -308 to -188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp -65 to -56) and GC-box 2 (bp -18 to -9), the latter of which is also bound by FBI-1. We found that FRE3 (bp -244 to -236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression.

Breast carcinoma metastasis suppressor gene 1 (BRMS1): update on its role as the suppressor of cancer metastases.

PubMed

Kodura, Magdalena Anna; Souchelnytskyi, Serhiy

2015-12-01

BRMS1 was discovered over a decade ago as a potential tumor suppressor gene. In this review, we summarize the recent findings about the structure of BRMS1, mechanisms of its action and a role of BRMS1 in the cancer progression. As a suppressor of metastasis, BRMS1 has demonstrated a variety of ways to act on the cell functions, such as cell migration, invasiveness, angiogenesis, cell survival, cytoskeleton rearrangements, cell adhesion, and immune recognition. This variety of effects is a likely reason behind the robustness of anti-metastatic influence of BRMS1. Intracellular signaling mechanisms employed by BRMS1 include regulation of transcription, EGF/HER2 signaling, and expression of NF-kB, fascin, osteopontin, and IL-6. Recently reported clinical studies confirm that BRMS1 can indeed be used as a prognostic marker. Approaches to employ BRMS1 in a development of anti-cancer treatment have also been made. The studies reviewed here with respect to BRMS1 structure, cellular effects, intracellular signaling, and clinical value consolidate the importance of BRMS1 in the development of metastasis.

Epigenetics provides a new generation of oncogenes and tumour-suppressor genes

PubMed Central

Esteller, M

2006-01-01

Cancer is nowadays recognised as a genetic and epigenetic disease. Much effort has been devoted in the last 30 years to the elucidation of the ‘classical' oncogenes and tumour-suppressor genes involved in malignant cell transformation. However, since the acceptance that major disruption of DNA methylation, histone modification and chromatin compartments are a common hallmark of human cancer, epigenetics has come to the fore in cancer research. One piece is still missing from the story: are the epigenetic genes themselves driving forces on the road to tumorigenesis? We are in the early stages of finding the answer, and the data are beginning to appear: knockout mice defective in DNA methyltransferases, methyl-CpG-binding proteins and histone methyltransferases strongly affect the risk of cancer onset; somatic mutations, homozygous deletions and methylation-associated silencing of histone acetyltransferases, histone methyltransferases and chromatin remodelling factors are being found in human tumours; and the first cancer-prone families arising from germline mutations in epigenetic genes, such as hSNF5/INI1, have been described. Even more importantly, all these ‘new' oncogenes and tumour-suppressor genes provide novel molecular targets for designed therapies, and the first DNA-demethylating agents and inhibitors of histone deacetylases are reaching the bedside of patients with haematological malignancies. PMID:16404435

Application of advanced cytometric and molecular technologies to minimal residual disease monitoring

NASA Astrophysics Data System (ADS)

Leary, James F.; He, Feng; Reece, Lisa M.

2000-04-01

Minimal residual disease monitoring presents a number of theoretical and practical challenges. Recently it has been possible to meet some of these challenges by combining a number of new advanced biotechnologies. To monitor the number of residual tumor cells requires complex cocktails of molecular probes that collectively provide sensitivities of detection on the order of one residual tumor cell per million total cells. Ultra-high-speed, multi parameter flow cytometry is capable of analyzing cells at rates in excess of 100,000 cells/sec. Residual tumor selection marker cocktails can be optimized by use of receiver operating characteristic analysis. New data minimizing techniques when combined with multi variate statistical or neural network classifications of tumor cells can more accurately predict residual tumor cell frequencies. The combination of these techniques can, under at least some circumstances, detect frequencies of tumor cells as low as one cell in a million with an accuracy of over 98 percent correct classification. Detection of mutations in tumor suppressor genes requires insolation of these rare tumor cells and single-cell DNA sequencing. Rare residual tumor cells can be isolated at single cell level by high-resolution single-cell cell sorting. Molecular characterization of tumor suppressor gene mutations can be accomplished using a combination of single- cell polymerase chain reaction amplification of specific gene sequences followed by TA cloning techniques and DNA sequencing. Mutations as small as a single base pair in a tumor suppressor gene of a single sorted tumor cell have been detected using these methods. Using new amplification procedures and DNA micro arrays it should be possible to extend the capabilities shown in this paper to screening of multiple DNA mutations in tumor suppressor and other genes on small numbers of sorted metastatic tumor cells.

Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

PubMed

Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

2008-01-01

The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

Tumor suppressor miR-1 inhibits tumor growth and metastasis by simultaneously targeting multiple genes

PubMed Central

Liu, Cuilian; Zhang, Song; Wang, Qizhi; Zhang, Xiaobo

2017-01-01

Cancer progression depends on tumor growth and metastasis, which are activated or suppressed by multiple genes. An individual microRNA may target multiple genes, suggesting that a miRNA may suppress tumor growth and metastasis via simultaneously targeting different genes. However, thus far, this issue has not been explored. In the present study, the findings showed that miR-1 could simultaneously inhibit tumor growth and metastasis of gastric and breast cancers by targeting multiple genes. The results indicated that miR-1 was significantly downregulated in cancer tissues compared with normal tissues. The miR-1 overexpression led to cell cycle arrest in the G1 phase in gastric and breast cancer cells but not in normal cells. Furthermore, the miR-1 overexpression significantly inhibited the metastasis of gastric and breast cancer cells. An analysis of the underlying mechanism revealed that the simultaneous inhibition of tumor growth and metastasis mediated by miR-1 was due to the synchronous targeting of 6 miR-1 target genes encoding cyclin dependent kinase 4, twinfilin actin binding protein 1, calponin 3, coronin 1C, WAS protein family member 2 and thymosin beta 4, X-linked. In vivo assays demonstrated that miR-1 efficiently inhibited tumor growth and metastasis of gastric and breast cancers in nude mice. Therefore, our study contributed novel insights into the miR-1′s roles in tumorigenesis of gastric and breast cancers. PMID:28159933

Tumor suppressor miR-1 inhibits tumor growth and metastasis by simultaneously targeting multiple genes.

PubMed

Liu, Cuilian; Zhang, Song; Wang, Qizhi; Zhang, Xiaobo

2017-06-27

Cancer progression depends on tumor growth and metastasis, which are activated or suppressed by multiple genes. An individual microRNA may target multiple genes, suggesting that a miRNA may suppress tumor growth and metastasis via simultaneously targeting different genes. However, thus far, this issue has not been explored. In the present study, the findings showed that miR-1 could simultaneously inhibit tumor growth and metastasis of gastric and breast cancers by targeting multiple genes. The results indicated that miR-1 was significantly downregulated in cancer tissues compared with normal tissues. The miR-1 overexpression led to cell cycle arrest in the G1 phase in gastric and breast cancer cells but not in normal cells. Furthermore, the miR-1 overexpression significantly inhibited the metastasis of gastric and breast cancer cells. An analysis of the underlying mechanism revealed that the simultaneous inhibition of tumor growth and metastasis mediated by miR-1 was due to the synchronous targeting of 6 miR-1 target genes encoding cyclin dependent kinase 4, twinfilin actin binding protein 1, calponin 3, coronin 1C, WAS protein family member 2 and thymosin beta 4, X-linked. In vivo assays demonstrated that miR-1 efficiently inhibited tumor growth and metastasis of gastric and breast cancers in nude mice. Therefore, our study contributed novel insights into the miR-1's roles in tumorigenesis of gastric and breast cancers.

CedA is a novel Escherichia coli protein that activates the cell division inhibited by chromosomal DNA over-replication.

PubMed

Katayama, T; Takata, M; Sekimizu, K

1997-11-01

We isolated and characterized a new gene related to the control of cell division regulation in Escherichia coli. At 30 degrees C, the dnaAcos mutant causes over-replication of the chromosome, and colony formation is inhibited. We found that, at this temperature, the dnaAcos cells form filaments; therefore, septum formation is inhibited. This inhibition was independent of SfiA, an inhibitor of the septum-forming protein, FtsZ. To identify factors involved in this pathway of inhibition, we isolated seven multicopy suppressors for the cold-sensitive phenotype of the dnaAcos mutant. One of these proved to be a previously unknown gene, which we named cedA. This gene encoded a 12 kDa protein and resided at 38.9min on the E. coli genome map. A multicopy supply of the cedA gene to the dnaAcos cells did not repress over-replication of the chromosome but did stimulate cell division of the host, the result being growth of cells with an abnormally elevated chromosomal copy number. Therefore, the expression level of the cedA gene seems to be important for inhibiting cell division of the dnaAcos mutant at 30 degrees C. We propose that over-replication of the chromosome activates a pathway for inhibiting cell division and that the cedA gene modulates this division control. In the dnaA+ background, cedA also seems to affect cell division.

The human ARF tumor suppressor senses blastema activity and suppresses epimorphic tissue regeneration

PubMed Central

Hesse, Robert G; Kouklis, Gayle K; Ahituv, Nadav; Pomerantz, Jason H

2015-01-01

The control of proliferation and differentiation by tumor suppressor genes suggests that evolution of divergent tumor suppressor repertoires could influence species’ regenerative capacity. To directly test that premise, we humanized the zebrafish p53 pathway by introducing regulatory and coding sequences of the human tumor suppressor ARF into the zebrafish genome. ARF was dormant during development, in uninjured adult fins, and during wound healing, but was highly expressed in the blastema during epimorphic fin regeneration after amputation. Regenerative, but not developmental signals resulted in binding of zebrafish E2f to the human ARF promoter and activated conserved ARF-dependent Tp53 functions. The context-dependent activation of ARF did not affect growth and development but inhibited regeneration, an unexpected distinct tumor suppressor response to regenerative versus developmental environments. The antagonistic pleiotropic characteristics of ARF as both tumor and regeneration suppressor imply that inducing epimorphic regeneration clinically would require modulation of ARF –p53 axis activation. DOI: http://dx.doi.org/10.7554/eLife.07702.001 PMID:26575287

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in hepatocellular carcinoma.

PubMed

Liu, Rui; Zhang, Haiyang; Zhang, Yan; Li, Shuang; Wang, Xinyi; Wang, Xia; Wang, Cheng; Liu, Bin; Zen, Ke; Zhang, Chen-Yu; Zhang, Chunni; Ba, Yi

2017-04-01

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha plays a crucial role in regulating the biosynthesis of mitochondria, which is closely linked to the energy metabolism in various tumors. This study investigated the regulatory role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha in the pathogenesis of hepatocellular carcinoma. In this study, the changes of peroxisome proliferator-activated receptor gamma coactivator-1 alpha messenger RNA levels between normal human liver and hepatocellular carcinoma tissue were examined by quantitative reverse transcription polymerase chain reaction. Knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by RNA interference in the human liver cell line L02, while overexpression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha complementary DNA in the human hepatocarcinoma cell line HepG2. Cellular morphological changes were observed via optical and electron microscopy. Cellular apoptosis was determined by Hoechst 33258 staining. In addition, the expression levels of 21,400 genes in tissues and cells were detected by microarray. It was shown that peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression was significantly downregulated in hepatocellular carcinoma compared with normal liver tissues. After knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression in L02 cells, cells reverted to immature and dedifferentiated morphology exhibiting cancerous tendency. Apoptosis occurred in the HepG2 cells after transfection by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Microarray analysis showed consistent results. The results suggest that peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in the formation and development of hepatocellular carcinoma and that peroxisome proliferator-activated receptor gamma coactivator-1 alpha may be a potential therapeutic target for hepatocellular carcinoma.

Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes

PubMed Central

Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo

2010-01-01

We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513

Tomato Spotted Wilt Virus NSs Protein Supports Infection and Systemic Movement of a Potyvirus and Is a Symptom Determinant

PubMed Central

Gabriel Peralta, Sergio M.; Harte-Maxwell, Patricia A.

2018-01-01

Plant viruses are inducers and targets of antiviral RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressor proteins that interfere with antiviral RNA silencing. The NSs protein is an RNA silencing suppressor in orthotospoviruses, such as the tomato spotted wilt virus (TSWV). The mechanism of RNA silencing suppression by NSs and its role in virus infection and movement are poorly understood. Here, we cloned and tagged TSWV NSs and expressed it from a GFP-tagged turnip mosaic virus (TuMV-GFP) carrying either a wild-type or suppressor-deficient (AS9) helper component proteinase (HC-Pro). When expressed in cis, NSs restored pathogenicity and promoted systemic infection of suppressor-deficient TuMV-AS9-GFP in Nicotiana benthamiana and Arabidopsis thaliana. Inactivating mutations were introduced in NSs RNA-binding domain one. A genetic analysis with active and suppressor-deficient NSs, in combination with wild-type and mutant plants lacking essential components of the RNA silencing machinery, showed that the NSs insert is stable when expressed from a potyvirus. NSs can functionally replace potyviral HC-Pro, condition virus susceptibility, and promote systemic infection and symptom development by suppressing antiviral RNA silencing through a mechanism that partially overlaps that of potyviral HC-Pro. The results presented provide new insight into the mechanism of silencing suppression by NSs and its effect on virus infection. PMID:29538326

Tomato Spotted Wilt Virus NSs Protein Supports Infection and Systemic Movement of a Potyvirus and Is a Symptom Determinant.

PubMed

Garcia-Ruiz, Hernan; Gabriel Peralta, Sergio M; Harte-Maxwell, Patricia A

2018-03-14

Plant viruses are inducers and targets of antiviral RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressor proteins that interfere with antiviral RNA silencing. The NSs protein is an RNA silencing suppressor in orthotospoviruses, such as the tomato spotted wilt virus (TSWV). The mechanism of RNA silencing suppression by NSs and its role in virus infection and movement are poorly understood. Here, we cloned and tagged TSWV NSs and expressed it from a GFP-tagged turnip mosaic virus (TuMV-GFP) carrying either a wild-type or suppressor-deficient (AS9) helper component proteinase (HC-Pro). When expressed in cis, NSs restored pathogenicity and promoted systemic infection of suppressor-deficient TuMV-AS9-GFP in Nicotiana benthamiana and Arabidopsis thaliana . Inactivating mutations were introduced in NSs RNA-binding domain one. A genetic analysis with active and suppressor-deficient NSs, in combination with wild-type and mutant plants lacking essential components of the RNA silencing machinery, showed that the NSs insert is stable when expressed from a potyvirus. NSs can functionally replace potyviral HC-Pro, condition virus susceptibility, and promote systemic infection and symptom development by suppressing antiviral RNA silencing through a mechanism that partially overlaps that of potyviral HC-Pro. The results presented provide new insight into the mechanism of silencing suppression by NSs and its effect on virus infection.

Immunohistochemical detection of tumor suppressor gene p53 protein in feline injection site-associated sarcomas.

PubMed

Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M

2001-03-01

Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.

Nuclear factor one B (NFIB) encodes a subtype-specific tumour suppressor in glioblastoma

PubMed Central

Stringer, Brett W.; Bunt, Jens; Day, Bryan W.; Barry, Guy; Jamieson, Paul R.; Ensbey, Kathleen S.; Bruce, Zara C.; Goasdoué, Kate; Vidal, Hélène; Charmsaz, Sara; Smith, Fiona M.; Cooper, Leanne T.; Piper, Michael

2016-01-01

Glioblastoma (GBM) is an essentially incurable and rapidly fatal cancer, with few markers predicting a favourable prognosis. Here we report that the transcription factor NFIB is associated with significantly improved survival in GBM. NFIB expression correlates inversely with astrocytoma grade and is lowest in mesenchymal GBM. Ectopic expression of NFIB in low-passage, patient-derived classical and mesenchymal subtype GBM cells inhibits tumourigenesis. Ectopic NFIB expression activated phospho-STAT3 signalling only in classical and mesenchymal GBM cells, suggesting a mechanism through which NFIB may exert its context-dependent tumour suppressor activity. Finally, NFIB expression can be induced in GBM cells by drug treatment with beneficial effects. PMID:27083054

Cystatin E/M Suppresses Tumor Cell Growth through Cytoplasmic Retention of NF-κB

PubMed Central

Soh, Hendrick; Venkatesan, Natarajan; Veena, Mysore S.; Ravichandran, Sandhiya; Zinabadi, Alborz; Basak, Saroj K.; Parvatiyar, Kislay; Srivastava, Meera; Liang, Li-Jung; Gjertson, David W.; Torres, Jorge Z.; Moatamed, Neda A.

2016-01-01

We and others have shown that the cystatin E/M gene is inactivated in primary human tumors, pointing to its role as a tumor suppressor gene. However, the molecular mechanism of tumor suppression is not yet understood. Using plasmid-directed cystatin E/M gene overexpression, a lentivirus-mediated tetracycline-inducible vector system, and human papillomavirus 16 (HPV 16) E6 and E7 gene-immortalized normal human epidermal keratinocytes, we demonstrated intracellular and non-cell-autonomous apoptotic growth inhibition of tumor cell lines and that growth inhibition is associated with cytoplasmic retention of NF-κB. We further demonstrated decreased phosphorylation of IκB kinase (IKKβ) and IκBα in the presence of tumor necrosis factor alpha (TNF-α), confirming the role of cystatin E/M in the regulation of the NF-κB signaling pathway. Growth suppression of nude mouse xenograft tumors carrying a tetracycline-inducible vector system was observed with the addition of doxycycline in drinking water, confirming that the cystatin E/M gene is a tumor suppressor gene. Finally, immunohistochemical analyses of cervical carcinoma in situ and primary tumors have shown a statistically significant inverse relationship between the expression of cystatin E/M and cathepsin L and a direct relationship between the loss of cystatin E/M expression and nuclear expression of NF-κB. We therefore propose that the cystatin E/M suppressor gene plays an important role in the regulation of NF-κB. PMID:27090639

A chemotactic signaling surface on CheY defined by suppressors of flagellar switch mutations.

PubMed Central

Roman, S J; Meyers, M; Volz, K; Matsumura, P

1992-01-01

CheY is the response regulator protein that interacts with the flagellar switch apparatus to modulate flagellar rotation during chemotactic signaling. CheY can be phosphorylated and dephosphorylated in vitro, and evidence indicates that CheY-P is the activated form that induces clockwise flagellar rotation, resulting in a tumble in the cell's swimming pattern. The flagellar switch apparatus is a complex macromolecular structure composed of at least three gene products, FliG, FliM, and FliN. Genetic analysis of Escherichia coli has identified fliG and fliM as genes in which mutations occur that allele specifically suppress cheY mutations, indicating interactions among these gene products. We have generated a class of cheY mutations selected for dominant suppression of fliG mutations. Interestingly, these cheY mutations dominantly suppressed both fliG and fliM mutations; this is consistent with the idea that the CheY protein interacts with both switch gene products during signaling. Biochemical characterization of wild-type and suppressor CheY proteins did not reveal altered phosphorylation properties or evidence for phosphorylation-dependent CheY multimerization. These data indicate that suppressor CheY proteins are specifically altered in the ability to transduce chemotactic signals to the switch at some point subsequent to phosphorylation. Physical mapping of suppressor amino acid substitutions on the crystal structure of CheY revealed a high degree of spatial clustering, suggesting that this region of CheY is a signaling surface that transduces chemotactic signals to the switch. Images PMID:1400175

The Isoforms of the p53 Protein

PubMed Central

Khoury, Marie P.; Bourdon, Jean-Christophe

2010-01-01

p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

Gene within gene configuration and expression of the Drosophila melanogaster genes lethal(2) neighbour of tid [l(2)not] and lethal(2) relative of tid[l(2)rot].

PubMed

Kurzik-Dumke, U; Kaymer, M; Gundacker, D; Debes, A; Labitzke, K

1997-10-24

In this paper, we describe the structure and temporal expression pattern of the Drosophila melanogaster genes l(2)not and l(2)rot located at locus 59F5 vis à vis the tumor suppressor gene l(2)tid described previously and exhibiting a gene within gene configuration. The l(2)not protein coding region, 1530 nt, is divided into two exons by an intron, 2645 nt, harboring the genes l(2)rot, co-transcribed from the same DNA strand, and l(2)tid, co-transcribed from the opposite DNA strand, located vis à vis. To determine proteins encoded by the genes described in this study polyclonal rabbit antibodies (Ab), anti-Not and anti-Rot, were generated. Immunostaining of developmental Western blots with the anti-Not Ab resulted in the identification of a 45-kDa protein, Not45, which is smaller than the Not56 protein predicted from the sequence. Its localization in endoplasmic reticulum (ER) was established by immunoelectron microscopy of Drosophila melanogaster Schneider 2 cells. Not45 shows significant homology to yeast ALG3 protein acting as a dolichol mannosyltransferase in the asparagine-linked glycosylation. It is synthesized ubiquitously throughout embryonic life. The protein predicted from the l(2)rot sequence, Rot57, shows a homology to the NS2B protein of the yellow fever virus1 (yefv1). The results of l(2)rot RNA analysis by developmental Northern blot and by in situ RNA localization, as well as the results of the protein analysis via Western blot and immunohistochemistry suggest that l(2)rot is transcribed but not translated. Since RNAs encoded by the genes l(2)tid and l(2)rot are complementary and l(2)rot is presumably not translated we performed preliminary experiments on the function of the l(2)rot RNA as a natural antisense RNA (asRNA) regulator of l(2)tid expression, expressed in the same temporal and spatial manner as the l(2)tid- and l(2)not RNA. l(2)tid knock-out by antisense RNA yielded late embryonic lethality resulting from multiple morphogenetic defects.

Functional analysis of a weak viral RNA silencing suppressor using two GFP variants as silencing inducers.

PubMed

Mann, Krin S; Dietzgen, Ralf G

2017-01-01

RNA silencing in plants can be triggered by the introduction of an exogenous gene. Green fluorescent protein (GFP) has been widely used as a visual reporter to study RNA silencing and viral-mediated suppression of RNA silencing in the model plant Nicotiana benthamiana. In transgenic N. benthamiana plants expressing an endoplasmic reticulum targeted GFP variant (16c) known as mGFP5, RNA silencing can be induced by ectopic over-expression of mGFP5. However, other GFP variants can also be used to induce GFP silencing in these plants. We compared the efficiency to induce local and systemic silencing of two commonly used GFP variants: enhanced GFP (eGFP) and mGFP5. Using lettuce necrotic yellows virus (LNYV) P protein to suppress GFP silencing, we demonstrate that eGFP gene, which is 76% identical at the nucleotide level to the endogenously expressed mGFP5 in 16c plants, triggers silencing more slowly and concurrently prolongs detectable silencing suppressor activity of the weak LNYV P suppressor, compared to the homologous mGFP5 gene. The use of eGFP as RNA silencing inducer in wild type or 16c plants appears to be a useful tool in identifying and analysing weak viral RNA silencing suppressor proteins whose activity might otherwise have been masked when challenged by a stronger RNA silencing response. We also show that reducing the dosage of strong dsRNA silencing inducers in conjunction with their homologous GFP targets facilitates the discovery and analysis of "weaker" RNA silencing suppressor activities. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of a novel intergenic miRNA located between the human DDC and COBL genes with a potential function in cell cycle arrest.

PubMed

Hoballa, Mohamad Hussein; Soltani, Bahram M; Mowla, Seyed Javad; Sheikhpour, Mojgan; Kay, Maryam

2018-07-01

Frequent abnormalities in 7p12 locus in different tumors like lung cancer candidate this region for novel regulatory elements. MiRNAs as novel regulatory elements encoded within the human genome are potentially oncomiRs or miR suppressors. Here, we have used bioinformatics tools to search for the novel miRNAs embedded within human chromosome 7p12. A bona fide stem loop (named mirZa precursor) had the features of producing a real miRNA (named miRZa) which was detected through RT-qPCR following the overexpression of its precursor. Then, endogenous miRZa was detected in human cell lines and tissues and sequenced. Consistent to the bioinformatics prediction, RT-qPCR as well as dual luciferase assay indicated that SMAD3 and IGF1R genes were targeted by miRZa. MiRZa-3p and miRZa-5p were downregulated in lung tumor tissue samples detected by RT-qPCR, and mirZa precursor overexpression in SW480 cells resulted in increased sub-G1 cell population. Overall, here we introduced a novel miRNA which is capable of targeting SMAD3 and IGF1R regulatory genes and increases the cell population in sub-G1 stage.

Characterization of SIS1, a Saccharomyces cerevisiae homologue of bacterial dnaJ proteins

PubMed Central

1991-01-01

The Saccharomyces cerevisiae SIS1 gene was identified as a high copy number suppressor of the slow growth phenotype of strains containing mutations in the SIT4 gene, which encodes a predicted serine/threonine protein phosphatase. The SIS1 protein is similar to bacterial dnaJ proteins in the amino-terminal third and carboxyl-terminal third of the proteins. In contrast, the middle third of SIS1 is not similar to dnaJ proteins. This region of SIS1 contains a glycine/methionine-rich region which, along with more amino-terminal sequences, is required for SIS1 to associate with a protein of apparent molecular mass of 40 kD. The SIS1 gene is essential. Strains limited for the SIS1 protein accumulate cells that appear blocked for migration of the nucleus from the mother cell into the daughter cell. In addition, many of the cells become very large and contain a large vacuole. The SIS1 protein is localized throughout the cell but is more concentrated at the nucleus. About one- fourth of the SIS1 protein is released from a nuclear fraction upon treatment with RNase. We also show that overexpression of YDJ1, another yeast protein with similarity to bacterial dnaJ proteins, can not substitute for SIS1. PMID:1714460

Targeting the Hippo Pathway Is a New Potential Therapeutic Modality for Malignant Mesothelioma.

PubMed

Sekido, Yoshitaka

2018-03-22

Malignant mesothelioma (MM) constitutes a very aggressive tumor that arises from the pleural or peritoneal cavities and is highly refractory to conventional therapies. Several key genetic alterations are associated with the development and progression of MM including mutations of the CDKN2A/ARF , NF2 , and BAP1 tumor-suppressor genes. Notably, activating oncogene mutations are very rare; thus, it is difficult to develop effective inhibitors to treat MM. The NF2 gene encodes merlin, a protein that regulates multiple cell-signaling cascades including the Hippo pathway. MMs also exhibit inactivation of Hippo pathway components including LATS1/2, strongly suggesting that merlin-Hippo pathway dysregulation plays a key role in the development and progression of MM. Furthermore, Hippo pathway inactivation has been shown to result in constitutive activation of the YAP1/TAZ transcriptional coactivators, thereby conferring malignant phenotypes to mesothelial cells. Critical YAP1/TAZ target genes, including prooncogenic CCDN1 and CTGF , have also been shown to enhance the malignant phenotypes of MM cells. Together, these data indicate the Hippo pathway as a therapeutic target for the treatment of MM, and support the development of new strategies to effectively target the activation status of YAP1/TAZ as a promising therapeutic modality for this formidable disease.

The nonstructural proteins of Pneumoviruses are remarkably distinct in substrate diversity and specificity.

PubMed

Ribaudo, Michael; Barik, Sailen

2017-11-06

Interferon (IFN) inhibits viruses by inducing several hundred cellular genes, aptly named 'interferon (IFN)-stimulated genes' (ISGs). The only two RNA viruses of the Pneumovirus genus of the Paramyxoviridae family, namely Respiratory Syncytial Virus (RSV) and Pneumonia Virus of Mice (PVM), each encode two nonstructural (NS) proteins that share no sequence similarity but yet suppress IFN. Since suppression of IFN underlies the ability of these viruses to replicate in the host cells, the mechanism of such suppression has become an important area of research. This Short Report is an important extension of our previous efforts in defining this mechanism. We show that, like their PVM counterparts, the RSV NS proteins also target multiple members of the ISG family. While significantly extending the substrate repertoire of the RSV NS proteins, these results, unexpectedly, also reveal that the target preferences of the NS proteins of the two viruses are entirely different. This is surprising since the two Pneumoviruses are phylogenetically close with similar genome organization and gene function, and the NS proteins of both also serve as suppressors of host IFN response. The finding that the NS proteins of the two highly similar viruses suppress entirely different members of the ISG family raises intriguing questions of pneumoviral NS evolution and mechanism of action.

Epigenetic Alterations in Human Papillomavirus-Associated Cancers

PubMed Central

Song, Christine; McLaughlin-Drubin, Margaret E.

2017-01-01

Approximately 15–20% of human cancers are caused by viruses, including human papillomaviruses (HPVs). Viruses are obligatory intracellular parasites and encode proteins that reprogram the regulatory networks governing host cellular signaling pathways that control recognition by the immune system, proliferation, differentiation, genomic integrity, and cell death. Given that key proteins in these regulatory networks are also subject to mutation in non-virally associated diseases and cancers, the study of oncogenic viruses has also been instrumental to the discovery and analysis of many fundamental cellular processes, including messenger RNA (mRNA) splicing, transcriptional enhancers, oncogenes and tumor suppressors, signal transduction, immune regulation, and cell cycle control. More recently, tumor viruses, in particular HPV, have proven themselves invaluable in the study of the cancer epigenome. Epigenetic silencing or de-silencing of genes can have cellular consequences that are akin to genetic mutations, i.e., the loss and gain of expression of genes that are not usually expressed in a certain cell type and/or genes that have tumor suppressive or oncogenic activities, respectively. Unlike genetic mutations, the reversible nature of epigenetic modifications affords an opportunity of epigenetic therapy for cancer. This review summarizes the current knowledge on epigenetic regulation in HPV-infected cells with a focus on those elements with relevance to carcinogenesis. PMID:28862667

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Characterisation of worldwide Helicobacter pylori strains reveals genetic conservation and essentiality of serine protease HtrA

PubMed Central

Tegtmeyer, Nicole; Moodley, Yoshan; Yamaoka, Yoshio; Pernitzsch, Sandy Ramona; Schmidt, Vanessa; Traverso, Francisco Rivas; Schmidt, Thomas P.; Rad, Roland; Yeoh, Khay Guan; Bow, Ho; Torres, Javier; Gerhard, Markus; Schneider, Gisbert; Wessler, Silja

2015-01-01

Summary HtrA proteases and chaperones exhibit important roles in periplasmic protein quality control and stress responses. The genetic inactivation of htrA has been described for many bacterial pathogens. However, in some cases such as the gastric pathogen H elicobacter pylori, HtrA is secreted where it cleaves the tumour‐suppressor E‐cadherin interfering with gastric disease development, but the generation of htrA mutants is still lacking. Here, we show that the htrA gene locus is highly conserved in worldwide strains. HtrA presence was confirmed in 992 H . pylori isolates in gastric biopsy material from infected patients. Differential RNA‐sequencing (dRNA‐seq) indicated that htrA is encoded in an operon with two subsequent genes, HP1020 and HP1021. Genetic mutagenesis and complementation studies revealed that HP1020 and HP1021, but not htrA, can be mutated. In addition, we demonstrate that suppression of HtrA proteolytic activity with a newly developed inhibitor is sufficient to effectively kill H . pylori, but not other bacteria. We show that H elicobacter  htrA is an essential bifunctional gene with crucial intracellular and extracellular functions. Thus, we describe here the first microbe in which htrA is an indispensable gene, a situation unique in the bacterial kingdom. HtrA can therefore be considered a promising new target for anti‐bacterial therapy. PMID:26568477

Liver tumor formation by a mutant retinoblastoma protein in the transgenic mice is caused by an upregulation of c-Myc target genes.

PubMed

Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat; Sharkar, Mohammad Tofael Kabir; Noritake, Hidenao; Kimura, Wataru; Wu, Yi-Xin; Kobayashi, Yoshimasa; Uezato, Tadayoshi; Miura, Naoyuki

2012-01-06

The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, we generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with ∼50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age. Copyright © 2011 Elsevier Inc. All rights reserved.

LACTB is a tumour suppressor that modulates lipid metabolism and cell state.

PubMed

Keckesova, Zuzana; Donaher, Joana Liu; De Cock, Jasmine; Freinkman, Elizaveta; Lingrell, Susanne; Bachovchin, Daniel A; Bierie, Brian; Tischler, Verena; Noske, Aurelia; Okondo, Marian C; Reinhardt, Ferenc; Thiru, Prathapan; Golub, Todd R; Vance, Jean E; Weinberg, Robert A

2017-03-30

Post-mitotic, differentiated cells exhibit a variety of characteristics that contrast with those of actively growing neoplastic cells, such as the expression of cell-cycle inhibitors and differentiation factors. We hypothesized that the gene expression profiles of these differentiated cells could reveal the identities of genes that may function as tumour suppressors. Here we show, using in vitro and in vivo studies in mice and humans, that the mitochondrial protein LACTB potently inhibits the proliferation of breast cancer cells. Its mechanism of action involves alteration of mitochondrial lipid metabolism and differentiation of breast cancer cells. This is achieved, at least in part, through reduction of the levels of mitochondrial phosphatidylserine decarboxylase, which is involved in the synthesis of mitochondrial phosphatidylethanolamine. These observations uncover a novel mitochondrial tumour suppressor and demonstrate a connection between mitochondrial lipid metabolism and the differentiation program of breast cancer cells, thereby revealing a previously undescribed mechanism of tumour suppression.

Oncogene activation and tumor suppressor gene inactivation find their sites of expression in the changes in time and space of the age-adjusted cancer incidence rate.

PubMed

Kodama, M; Kodama, T; Murakami, M

2000-01-01

The purpose of the present investigation is to elucidate the relation between the distribution pattern of the age-adjusted incidence rate (AAIR) changes in time and space of 15 tumors of bothe sexes and the locations of centers of centripetal-(oncogene type) and centrifugal-(tumoe suppressor gene type) forces. The fitness of the observed log AAIR data sets to the oncogene type- and the tumor suppressor gene type-equilibrium models and the locations of 2 force centers were calculated by applying the least square method of Gauss to log AAIR pair data series with and without topological data manipulations, which are so designed as to let log AAIR pair data series fit to 2 variant (x, y) frameworks, the Rect-coordinates and the Para-coordinates. The 2 variant (x, y) coordinates are defined each as an (x, y) framework with its X axis crossed at a right angle to the regression line of the original log AAIR data (the Rect-coordinates) and as another framework with its X axis run in parallel with the regression line of the original log AAIR pair data series (the Para-coordinates). The fitness test of log AAIR data series to either the oncogene activation type equilibrium model (r = -1.000) or the tumor suppressor gene inactivation type (r = 1.000) was conducted for each of the male-female type pair data and the female-male type data, for each of log AAIR changes in space and log AAIR changes in time, and for each of the 3 (x, y) frameworks in a given neoplasia of both sexes. The results obtained are given as follows: 1) The positivity rates of the fitness test to the oncogene type equilibrium model and the tumor suppressor gene type model were each 63.3% and 56.7% with the log AAIR changes in space, and 73.3% and 73.3% with log AAIR changes in time, as tested in 15 human neoplasias of both sexes. 2) Evidence was presented to indicate that the clearance of oncogene activation and tumor suppressor gene inactivation is the sine qua non premise of carciniogenesis. 3) The r profile in which the correlation coefficient r, a measure of fitness to the 2 equilibrium models, is converted to either +(r > 0) or -(0 > r) for each of the original-, the Rect-, and the Para-coordinates was found to be informative in identifying a group of tumors with sex discrimination of cancer risk (log AAIR changes in space) or another group of environmental hormone-linked tumors (log AAIR changes in time and space)--a finding to indicate that the r-profile of a given tumor, when compared with other neoplasias, may provide a clue to investigating the biological behavior of the tumor. 4) The recent risk increase of skin cancer of both sexes, being classified as an example of environmental hormone-linked neoplasias, was found to commit its ascension of cancer risk along the direction of the centrifugal forces of the time- and space-linked tumor suppressor gene inactivation plotted in the 2-dimension diagram. In conclusion, the centripetal force of oncogene activation and centrifugal force of tumor suppressor gene inactivation found their sites of expression in the distribution pattern of a cancer risk parameter, log AAIR, of a given neoplasias of both sexes on the 2-dimension diagram. The application of the least square method of Gauss to the log AAIR changes in time and space, and also with and without topological modulations of the original sets, when presented in terms of the r-profile, was found to be informative in understanding behavioral characteristics of human neoplaisias.

Tumor suppressor function of Betaig-H3 gene in radiation carcinogenesis

NASA Astrophysics Data System (ADS)

Zhao, Y. L.; Piao, C. Q.; Hei, T. K.

Interaction between cell and extracellular matrix (ECM) plays a crucial role in tumor invasiveness and metastasis. Using an immortalized human bronchial epithelial (BEP2D) cell model, we showed previously that expression of a list of genes including Betaig-h3 (induced by transforming growth factor-β) DCC (deleted in colorectal cancer), p21 cip1, c-fos , Heat shock protein (HSP27) and cytokeratin 14 were differentially expressed in several independently generated, radiation-induced tumor cell lines (TL1-TL5) relative to parental BEP2D cells. Our previous data further demonstrated that loss of tumor suppressor gene(s) as a likely mechanism of radiation carcinogenesis. In the present study, we chose Betaig-h3 and DCC that were downregulated in tumorigenic cells for further study. Restored expression of Betaig-h3 gene, not DCC gene, by transfecting cDNA into tumor cells resulted in a significant reduction in tumor growth. While integrin receptor α5β1 was overexpressed in tumor cells, its expression was corrected to the level found in control BEP2D cells after Betaig-h3 transfection. These data suggest that Betaig-h3 gene is involved in tumor progression by regulating integrin α5β1 receptor. Furthermore, exogenous TGF-β1 induced expression of Betaig-h3 gene and inhibited the growth of both control and tumorigenic BEP2D cells. Therefore, downregulation of Betaig-h3 gene may results from the decreased expression of upstream mediators such as TGF-β. The findings provide strong evidence that the Betaig-h3 gene has tumor suppressor function in radiation-induced tumorigenic human bronchial epithelial cells and suggest a potential target for interventional therapy.

Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors*S⃞

PubMed Central

Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

2008-01-01

FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

CRISPR-mediated direct mutation of cancer genes in the mouse liver

PubMed Central

Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S.; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G.; Zhang, Feng; Anderson, Daniel G.; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem (ES) cells1. Here we describe a new method of cancer model generation using the CRISPR/Cas system in vivo in wild-type mice. We have used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs)2–4 to the liver and directly target the tumor suppressor genes Pten5 and p536, alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology7, 8. Simultaneous targeting of Pten and p53 induced liver tumors that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumor tissue revealed insertion or deletion (indel) mutations of the tumor suppressor genes, including bi-allelic mutations of both Pten and p53 in tumors. Furthermore, co-injection of Cas9 plasmids harboring sgRNAs targeting the β-Catenin gene (Ctnnb1) and a single-stranded DNA (ssDNA) oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-Catenin. This study demonstrates the feasibility of direct mutation of tumor suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics. PMID:25119044

CRISPR-mediated direct mutation of cancer genes in the mouse liver.

PubMed

Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G; Zhang, Feng; Anderson, Daniel G; Sharp, Phillip A; Jacks, Tyler

2014-10-16

The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem cells. Here we describe a new method of cancer model generation using the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system in vivo in wild-type mice. We used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs) to the liver that directly target the tumour suppressor genes Pten (ref. 5) and p53 (also known as TP53 and Trp53) (ref. 6), alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology. Simultaneous targeting of Pten and p53 induced liver tumours that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumour tissue revealed insertion or deletion mutations of the tumour suppressor genes, including bi-allelic mutations of both Pten and p53 in tumours. Furthermore, co-injection of Cas9 plasmids harbouring sgRNAs targeting the β-catenin gene and a single-stranded DNA oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-catenin. This study demonstrates the feasibility of direct mutation of tumour suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics.

Deletion of Brca2 exon 27 causes hypersensitivity to DNA crosslinks, chromosomal instability, and reduced life span in mice

NASA Technical Reports Server (NTRS)

Donoho, Greg; Brenneman, Mark A.; Cui, Tracy X.; Donoviel, Dorit; Vogel, Hannes; Goodwin, Edwin H.; Chen, David J.; Hasty, Paul

2003-01-01

The Brca2 tumor-suppressor gene contributes to genomic stability, at least in part by a role in homologous recombinational repair. BRCA2 protein is presumed to function in homologous recombination through interactions with RAD51. Both exons 11 and 27 of Brca2 code for domains that interact with RAD51; exon 11 encodes eight BRC motifs, whereas exon 27 encodes a single, distinct interaction domain. Deletion of all RAD51-interacting domains causes embryonic lethality in mice. A less severe phenotype is seen with BRAC2 truncations that preserve some, but not all, of the BRC motifs. These mice can survive beyond weaning, but are runted and infertile, and die very young from cancer. Cells from such mice show hypersensitivity to some genotoxic agents and chromosomal instability. Here, we have analyzed mice and cells with a deletion of only the RAD51-interacting region encoded by exon 27. Mice homozygous for this mutation (called brca2(lex1)) have a shorter life span than that of control littermates, possibly because of early onsets of cancer and sepsis. No other phenotype was observed in these animals; therefore, the brca2(lex1) mutation is less severe than truncations that delete some BRC motifs. However, at the cellular level, the brca2(lex1) mutation causes reduced viability, hypersensitivity to the DNA interstrand crosslinking agent mitomycin C, and gross chromosomal instability, much like more severe truncations. Thus, the extreme carboxy-terminal region encoded by exon 27 is important for BRCA2 function, probably because it is required for a fully functional interaction between BRCA2 and RAD51. Copyright 2003 Wiley-Liss, Inc.

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

PubMed

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

UBE2QL1 is Disrupted by a Constitutional Translocation Associated with Renal Tumor Predisposition and is a Novel Candidate Renal Tumor Suppressor Gene

PubMed Central

Wake, Naomi C; Ricketts, Christopher J; Morris, Mark R; Prigmore, Elena; Gribble, Susan M; Skytte, Anne-Bine; Brown, Michael; Clarke, Noel; Banks, Rosamonde E; Hodgson, Shirley; Turnell, Andrew S; Maher, Eamonn R; Woodward, Emma R

2013-01-01

Investigation of rare familial forms of renal cell carcinoma (RCC) has led to the identification of genes such as VHL and MET that are also implicated in the pathogenesis of sporadic RCC. In order to identify a novel candidate renal tumor suppressor gene, we characterized the breakpoints of a constitutional balanced translocation, t(5;19)(p15.3;q12), associated with familial RCC and found that a previously uncharacterized gene UBE2QL1 was disrupted by the chromosome 5 breakpoint. UBE2QL1 mRNA expression was downregulated in 78.6% of sporadic RCC and, although no intragenic mutations were detected, gene deletions and promoter region hypermethylation were detected in 17.3% and 20.3%, respectively, of sporadic RCC. Reexpression of UBE2QL1 in a deficient RCC cell line suppressed anchorage-independent growth. UBE2QL1 shows homology to the E2 class of ubiquitin conjugating enzymes and we found that (1) UBE2QL1 possesses an active-site cysteine (C88) that is monoubiquitinated in vivo, and (2) UBE2QL1 interacts with FBXW7 (an F box protein providing substrate recognition to the SCF E3 ubiquitin ligase) and facilitates the degradation of the known FBXW7 targets, CCNE1 and mTOR. These findings suggest UBE2QL1 as a novel candidate renal tumor suppressor gene. PMID:24000165

HPV16 integration probably contributes to cervical oncogenesis through interrupting tumor suppressor genes and inducing chromosome instability.

PubMed

Zhao, Jun-Wei; Fang, Fang; Guo, Yi; Zhu, Tai-Lin; Yu, Yun-Yun; Kong, Fan-Fei; Han, Ling-Fei; Chen, Dong-Sheng; Li, Fang

2016-11-25

The integration of human papilloma virus (HPV) into host genome is one of the critical steps that lead to the progression of precancerous lesion into cancer. However, the mechanisms and consequences of such integration events are poorly understood. This study aims to explore those questions by studying high risk HPV16 integration in women with cervical intraepithelial neoplasia (CIN) and cervical squamous cell carcinoma (SCC). Specifically, HPV integration status of 13 HPV16-infected patients were investigated by ligation-mediated PCR (DIPS-PCR) followed by DNA sequencing. In total, 8 HPV16 integration sites were identified inside or around genes associated with cancer development. In particular, the well-studied tumor suppressor genes SCAI was found to be integrated by HPV16, which would likely disrupt its expression and therefore facilitate the migration of tumor. On top of that, we observed several cases of chromosome translocation events coincide with HPV integration, which suggests the existence of chromosome instability. Additionally, short overlapping sequences were observed between viral derived and host derived fragments in viral-cellular junctions, indicating that integration was mediated by micro homology-mediated DNA repair pathway. Overall, our study suggests a model in which HPV16 might contribute to oncogenesis not only by disrupting tumor suppressor genes, but also by inducing chromosome instability.

BCR expression is decreased in meningiomas showing loss of heterozygosity of 22q within a new minimal deletion region.

PubMed

Wozniak, K; Piaskowski, S; Gresner, S M; Golanska, E; Bieniek, E; Bigoszewska, K; Sikorska, B; Szybka, M; Kulczycka-Wojdala, D; Zakrzewska, M; Zawlik, I; Papierz, W; Stawski, R; Jaskolski, D J; Och, W; Sieruta, M; Liberski, P P; Rieske, P

2008-05-01

Neurofibromin 2 (NF2), located on chromosome arm 22q, has been established as a tumor suppressor gene involved in meningioma pathogenesis. In our study, we investigated 149 meningiomas to determine whether there are additional tumor suppressor genes localized on chromosome 22q, apart from NF2, that might be involved in meningioma pathogenesis. The LOH analysis on chromosome 22q identified two regions of deletion: the first one, which is limited to the NF2 gene locus, and the second one, which is outside this location. The new minimal deletion region (MDR) included the following genes: BCR (breakpoint cluster region), RAB36 (a member of RAS oncogene family), GNAZ [guanine nucleotide binding protein (G protein), alpha-z polypeptide], and RTDR1 (rhabdoid tumor deletion region gene 1). The expression levels of all these genes, including NF2, were subsequently analyzed by quantitative real-time polymerase chain reaction. We observed a significantly lowered expression level of NF2 in meningiomas with 22q loss of heterozygosity (LOH) within NF2 region compared to the one in meningiomas with 22q retention of heterozygosity (ROH, P<0.05). Similarly, BCR showed a significantly lowered expression in meningiomas with 22q LOH within the new MDR compared to cases with 22q ROH (P<0.05). Our data, together with the already published information considering BCR function suggest that BCR can be considered as a candidate tumor suppressor gene localized on chromosome 22q which may be involved in meningioma pathogenesis.

Loss of heterozygosity at 7q22 and mutation analysis of the CDP gene in human epithelial ovarian tumors.

PubMed

Neville, P J; Thomas, N; Campbell, I G

2001-02-01

Many tumor types including that of the ovary show loss of heterozygosity (LOH) on chromosome arm 7q, which suggests the existence of at least one tumor suppressor gene (TSG) on this chromosome arm. We have studied the region surrounding the putative tumor suppressor gene CUTL1 at 7q22 in 127 epithelial ovarian tumors. LOH was found across 7q22 in 31% of malignant and 14% of benign ovarian tumors. In 16% of the tumors the LOH appeared to be centered on the CUTL1 gene. This gene has been implicated previously as a TSG in both uterine leiomyomas and breast carcinoma. However, mutation analysis of the CUTL1 gene in 47 tumors with 7q22 LOH failed to identify any somatic alterations in the coding regions. This finding suggests that CUTL1 may not be the target of the 7q22 LOH in ovarian cancers.

Prognostic value of the expression of tumor suppressor genes p53, p21, p16 and prb, and Ki-67 labelling in high grade astrocytomas treated with radiotherapy.

PubMed

Kirla, R; Salminen, E; Huhtala, S; Nuutinen, J; Talve, L; Haapasalo, H; Kalimo, H

2000-01-01

Cumulative inactivation of tumor suppressor genes and/or amplification of oncogenes lead to progressively more malignant astrocytic tumors. We have analyzed the significance of tumor suppressor genes p53, p21, p16 and retinoblastoma protein (pRb) and proliferative activity for survival in 77 high grade astrocytic tumors. After operation, the patients--25 anaplastic astrocytomas (AA) and 52 glioblastomas (GBs)--were treated with similar radiotherapy. The expression of the suppressor genes and the proliferative activity were analyzed immunohistochemically. p53 immunopositivity was found in 44% of AAs and 46% of GBs. Tumors with aberrant p53 expression had lower proliferation indices than p53 immunonegative tumors. Neither p53 expression nor p21 immunonegativity (52% of AAs and 48% of GBs) correlated with survival. p16 immunostaining was negative in 16% of AAs and in 44% of GBs, and it correlated inversely with survival in both uni- and multivariate analyses. pRb immunostaining was negative only in 8% of both AAs and GBs and the absence of p16 and pRb were mutually exclusive. Ki-67 labelling index (LI) was significantly higher in GBs (26.8%) than in AAs (20.3%), and in multivariate analysis it was an independent prognostic factor for survival. In 48% of AAs Ki-67 LI exceeded 20% and this subset of AAs had similar prognosis as GB. In high grade astrocytic tumors p16 immunonegativity was an independent indicator of poor prognosis in addition to the previously established patient's age, histopathology and Ki-67 LI. Furthermore, there was a subset of AAs with a high proliferation rate (> 20%) in which the histopathological hallmarks of GB were lacking, but which had similarly dismal prognosis as GB.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed Central

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Physical and functional mapping of a tumor suppressor locus for renal cell carcinoma within chromosome 3p12.

PubMed

Lott, S T; Lovell, M; Naylor, S L; Killary, A M

1998-08-15

Using a functional genetic approach, we previously identified a novel genetic locus, NRC-1 (Nonpapillary Renal Cell Carcinoma 1), that mediated tumor suppression and rapid cell death of renal cell carcinoma (RCC) cells in vivo. For these experiments, a defined subchromosomal fragment of human chromosome 3p was transferred into a sporadic RCC cell line via microcell fusion, and microcell hybrid clones were tested for tumorigenicity in vivo. The results indicated functional evidence for a novel tumor suppressor locus within the 3p14-p12 interval known to contain the most common fragile site of the human genome (FRA3B), the FHIT gene, and the breakpoint region associated with the familial form of RCC. We now report the physical mapping of the NRC-1 critical region by detailed microsatellite analyses of novel microcell hybrid clones containing transferred fragments of chromosome 3p in the RCC cell background that were phenotypically suppressed or unsuppressed for tumorigenicity in vivo. The results limit the region containing the tumor suppressor locus within chromosome 3p12. The FHIT gene, FRA3B, and the familial RCC breakpoint region were excluded from the NRC-1 critical region. Furthermore, the NRC-1 locus falls within a well-characterized homozygous deletion region of 5-7 Mb associated with a small cell lung carcinoma cell line, U2020, suggesting that a more general tumor suppressor gene may reside in this region.

Modeling colorectal cancer using CRISPR-Cas9-mediated engineering of human intestinal organoids.

PubMed

Matano, Mami; Date, Shoichi; Shimokawa, Mariko; Takano, Ai; Fujii, Masayuki; Ohta, Yuki; Watanabe, Toshiaki; Kanai, Takanori; Sato, Toshiro

2015-03-01

Human colorectal tumors bear recurrent mutations in genes encoding proteins operative in the WNT, MAPK, TGF-β, TP53 and PI3K pathways. Although these pathways influence intestinal stem cell niche signaling, the extent to which mutations in these pathways contribute to human colorectal carcinogenesis remains unclear. Here we use the CRISPR-Cas9 genome-editing system to introduce multiple such mutations into organoids derived from normal human intestinal epithelium. By modulating the culture conditions to mimic that of the intestinal niche, we selected isogenic organoids harboring mutations in the tumor suppressor genes APC, SMAD4 and TP53, and in the oncogenes KRAS and/or PIK3CA. Organoids engineered to express all five mutations grew independently of niche factors in vitro, and they formed tumors after implantation under the kidney subcapsule in mice. Although they formed micrometastases containing dormant tumor-initiating cells after injection into the spleen of mice, they failed to colonize in the liver. In contrast, engineered organoids derived from chromosome-instable human adenomas formed macrometastatic colonies. These results suggest that 'driver' pathway mutations enable stem cell maintenance in the hostile tumor microenvironment, but that additional molecular lesions are required for invasive behavior.

E-Cadherin and Gastric Cancer: Cause, Consequence, and Applications

PubMed Central

Liu, Xin

2014-01-01

E-cadherin (epithelial-cadherin), encoded by the CDH1 gene, is a transmembrane glycoprotein playing a crucial role in maintaining cell-cell adhesion. E-cadherin has been reported to be a tumor suppressor and to be down regulated in gastric cancer. Besides genetic mutations in CDH1 gene to induce hereditary diffuse gastric cancer (HDGC), epigenetic factors such as DNA hypermethylation also contribute to the reduction of E-cadherin in gastric carcinogenesis. In addition, expression of E-cadherin could be mediated by infectious agents such as H. pylori (Helicobacter pylori). As E-cadherin is vitally involved in signaling pathways modulating cell proliferation, survival, invasion, and migration, dysregulation of E-cadherin leads to dysfunction of gastric epithelial cells and contributes to gastric cancer development. Moreover, changes in its expression could reflect pathological conditions of gastric mucosa, making its role in gastric cancer complicated. In this review, we summarize the functions of E-cadherin and the signaling pathways it regulates. We aim to provide comprehensive perspectives in the molecular mechanism of E-cadherin and its involvement in gastric cancer initiation and progression. We also focus on its applications for early diagnosis, prognosis, and therapy in gastric cancer in order to open new avenues in this field. PMID:25184143

Hepatitis B virus X protein suppresses virus-triggered IRF3 activation and IFN-beta induction by disrupting the VISA-associated complex.

PubMed

Wang, Xianmiao; Li, Ying; Mao, Aiping; Li, Chao; Li, Yongkui; Tien, Po

2010-09-01

Viral RNAs produced during viral infection are recognized by the cytoplasmic RNA helicases retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5). A central adapter protein downstream of RIG-I and MDA5 is the mitochondrial membrane protein virus-induced signaling adaptor (VISA), which mediates the induction of type I interferons (IFNs) through the activation of transcription factors such as nuclear factor-kappaB (NF-kappaB) and IFN-regulatory factor-3 (IRF3). Here we found that hepatitis B virus (HBV)-encoded X protein (HBx) acts as an inhibitor of virus-triggered IRF3 activation and IFN-beta induction. Reporter and plaque assays indicate that HBx inhibits signaling by components upstream but not downstream of VISA. Immunoprecipitation experiments indicate that HBx interacts with VISA and disrupts the association of VISA with its upstream and downstream components. These findings suggest that HBx acts as a suppressor of virus-triggered induction of type I IFNs, which explains the observation that HBV causes transient and chronic infection in hepatocytes but fails to activate the pattern recognition receptor-mediated IFN induction pathways.

Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control1[W][OPEN

PubMed Central

Fang, Su-Chiung; Chung, Chin-Lin; Chen, Chun-Han; Lopez-Paz, Cristina; Umen, James G.

2014-01-01

We previously identified a mutation, suppressor of mating type locus3 15-1 (smt15-1), that partially suppresses the cell cycle defects caused by loss of the retinoblastoma tumor suppressor-related protein encoded by the MAT3 gene in Chlamydomonas reinhardtii. smt15-1 single mutants were also found to have a cell cycle defect leading to a small-cell phenotype. SMT15 belongs to a previously uncharacterized subfamily of putative membrane-localized sulfate/anion transporters that contain a sulfate transporter domain and are found in a widely distributed subset of eukaryotes and bacteria. Although we observed that smt15-1 has a defect in acclimation to sulfur-limited growth conditions, sulfur acclimation (sac) mutants, which are more severely defective for acclimation to sulfur limitation, do not have cell cycle defects and cannot suppress mat3. Moreover, we found that smt15-1, but not sac mutants, overaccumulates glutathione. In wild-type cells, glutathione fluctuated during the cell cycle, with highest levels in mid G1 phase and lower levels during S and M phases, while in smt15-1, glutathione levels remained elevated during S and M. In addition to increased total glutathione levels, smt15-1 cells had an increased reduced-to-oxidized glutathione redox ratio throughout the cell cycle. These data suggest a role for SMT15 in maintaining glutathione homeostasis that impacts the cell cycle and sulfur acclimation responses. PMID:25361960

MicroRNAs and cancer.

PubMed

Cowland, Jack B; Hother, Christoffer; Grønbaek, Kirsten

2007-10-01

MicroRNAs (miRNAs) are a recently discovered group of small RNA molecules involved in the regulation of gene expression. Analogously to mRNAs, the non-protein-encoding pri-miRNAs are synthesized by RNA polymerase II and post-transcriptionally modified by addition of a 5'-cap and a 3'-poly (A) tail. Subsequently, the pri-miRNA undergoes a number of processing steps in the nucleus and cytoplasm, and ends up as a mature approximately 22 nt miRNA, which can exert its function by binding to the 3'-untranslated region of a subset of mRNAs. Binding of the miRNA to the mRNA results in a reduced translation rate and/or increased degradation of the mRNA. In this way a large number of cellular pathways, such as cellular proliferation, differentiation, and apoptosis, are regulated by mi-RNAs. As corruption of these pathways is the hallmark of many cancers, dysregulation of miRNA biogenesis or expression levels may lead to tumorigenesis. The mechanisms that alter the expression of miRNAs are similar to those that change the expression levels of mRNAs of tumor suppressor- and oncogenes, i.e. gross genomic aberrations, epigenetic changes, and minor mutations affecting the expression level, processing, or target-interaction potential of the miRNA. Furthermore, expression profiling of miRNAs has been found to be useful for classification of different tumor types. Taken together, miRNAs can be classified as onco-miRs or tumor suppressor-miRs, and may turn out to be potential targets for cancer therapy.

The New Rga Locus Encodes a Negative Regulator of Gibberellin Response in Arabidopsis Thaliana

PubMed Central

Silverstone, A. L.; Mak, PYA.; Martinez, E. C.; Sun, T.

1997-01-01

We have identified a new locus involved in gibberellin (GA) signal transduction by screening for suppressors of the Arabidopsis thaliana GA biosynthetic mutant ga1-3. The locus is named RGA for repressor of ga1-3. Based on the recessive phenotype of the digenic rga/ga1-3 mutant, the wild-type gene product of RGA is probably a negative regulator of GA responses. Our screen for suppressors of ga1-3 identified 17 mutant alleles of RGA as well as 10 new mutant alleles at the previously identified SPY locus. The digenic (double homozygous) rga/ga1-3 mutants are able to partially repress several defects of ga1-3 including stem growth, leaf abaxial trichome initiation, flowering time, and apical dominance. The phenotype of the trigenic mutant (triple homozygous) rga/spy/ga1-3 shows that rga and spy have additive effects regulating flowering time, abaxial leaf trichome initiation and apical dominance. This trigenic mutant is similar to wild type with respect to each of these developmental events. Because rga/spy/ga1-3 is almost insensitive to GA for hypocotyl growth and its bolting stem is taller than the wild-type plant, the combined effects of the rga and spy mutations appear to allow GA-independent stem growth. Our studies indicate that RGA lies on a separate branch of the GA signal transduction pathway from SPY, which leads us to propose a modified model of the GA response pathway. PMID:9215910

Crystal Structure of Menin Reveals Binding Site for Mixed Lineage Leukemia (MLL) Protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murai, Marcelo J.; Chruszcz, Maksymilian; Reddy, Gireesh

2014-10-02

Menin is a tumor suppressor protein that is encoded by the MEN1 (multiple endocrine neoplasia 1) gene and controls cell growth in endocrine tissues. Importantly, menin also serves as a critical oncogenic cofactor of MLL (mixed lineage leukemia) fusion proteins in acute leukemias. Direct association of menin with MLL fusion proteins is required for MLL fusion protein-mediated leukemogenesis in vivo, and this interaction has been validated as a new potential therapeutic target for development of novel anti-leukemia agents. Here, we report the first crystal structure of menin homolog from Nematostella vectensis. Due to a very high sequence similarity, the Nematostellamore » menin is a close homolog of human menin, and these two proteins likely have very similar structures. Menin is predominantly an {alpha}-helical protein with the protein core comprising three tetratricopeptide motifs that are flanked by two {alpha}-helical bundles and covered by a {beta}-sheet motif. A very interesting feature of menin structure is the presence of a large central cavity that is highly conserved between Nematostella and human menin. By employing site-directed mutagenesis, we have demonstrated that this cavity constitutes the binding site for MLL. Our data provide a structural basis for understanding the role of menin as a tumor suppressor protein and as an oncogenic co-factor of MLL fusion proteins. It also provides essential structural information for development of inhibitors targeting the menin-MLL interaction as a novel therapeutic strategy in MLL-related leukemias.« less

ACCA phosphopeptide recognition by the BRCT repeats of BRCA1.

PubMed

Ray, Hind; Moreau, Karen; Dizin, Eva; Callebaut, Isabelle; Venezia, Nicole Dalla

2006-06-16

The tumour suppressor gene BRCA1 encodes a 220 kDa protein that participates in multiple cellular processes. The BRCA1 protein contains a tandem of two BRCT repeats at its carboxy-terminal region. The majority of disease-associated BRCA1 mutations affect this region and provide to the BRCT repeats a central role in the BRCA1 tumour suppressor function. The BRCT repeats have been shown to mediate phospho-dependant protein-protein interactions. They recognize phosphorylated peptides using a recognition groove that spans both BRCT repeats. We previously identified an interaction between the tandem of BRCA1 BRCT repeats and ACCA, which was disrupted by germ line BRCA1 mutations that affect the BRCT repeats. We recently showed that BRCA1 modulates ACCA activity through its phospho-dependent binding to ACCA. To delineate the region of ACCA that is crucial for the regulation of its activity by BRCA1, we searched for potential phosphorylation sites in the ACCA sequence that might be recognized by the BRCA1 BRCT repeats. Using sequence analysis and structure modelling, we proposed the Ser1263 residue as the most favourable candidate among six residues, for recognition by the BRCA1 BRCT repeats. Using experimental approaches, such as GST pull-down assay with Bosc cells, we clearly showed that phosphorylation of only Ser1263 was essential for the interaction of ACCA with the BRCT repeats. We finally demonstrated by immunoprecipitation of ACCA in cells, that the whole BRCA1 protein interacts with ACCA when phosphorylated on Ser1263.

Genetic analysis of the relationship between activation loop phosphorylation and cyclin binding in the activation of the Saccharomyces cerevisiae Cdc28p cyclin-dependent kinase.

PubMed Central

Cross, F R; Levine, K

2000-01-01

We showed recently that a screen for mutant CDC28 with improved binding to a defective Cln2p G1 cyclin yielded a spectrum of mutations similar to those yielded by a screen for intragenic suppressors of the requirement for activation loop phosphorylation (T169E suppressors). Recombination among these mutations yielded CDC28 mutants that bypassed the G1 cyclin requirement. Here we analyze further the interrelationship between T169E suppression, interaction with defective cyclin, and G1 cyclin bypass. DNA shuffling of mutations from the various screens and recombination onto a T169E-encoding 3' end yielded CDC28 mutants with strong T169E suppression. Some of the strongest T169E suppressors could suppress the defective Cln2p G1 cyclin even while retaining T169E. The strong T169E suppressors did not exhibit bypass of the G1 cyclin requirement but did so when T169E was reverted to T. These results suggested that for these mutants, activation loop phosphorylation and cyclin binding might be alternative means of activation rather than independent requirements for activation (as with wild type). These results suggest mechanistic overlap between the conformational shift induced by cyclin binding and that induced by activation loop phosphorylation. This conclusion was supported by analysis of suppressors of a mutation in the Cdk phosphothreonine-binding pocket created by cyclin binding. PMID:10747052

KAPOSI’S SARCOMA–ASSOCIATED HERPESVIRUS IMMUNOEVASION AND TUMORIGENESIS: TWO SIDES OF THE SAME COIN?

PubMed Central

Moore, Patrick S.; Chang, Yuan

2013-01-01

Kaposi’s sarcoma–associated herpesvirus (KSHV) [or human herpesvirus 8 (HHV-8)] is the most frequent cause of malignancy among AIDS patients. KSHV and related herpesviruses have extensively pirated cellular cDNAs from the host genome, providing a unique opportunity to examine the range of viral mechanisms for controlling cell proliferation. Many of the viral regulatory homologs encode proteins that directly inhibit host adaptive and innate immunity. Other viral proteins target retinoblastoma protein and p53 control of tumor suppressor pathways, which also play key effector roles in intracellular immune responses. The immune evasion strategies employed by KSHV, by targeting tumor suppressor pathways activated during immune system signaling, may lead to inadvertent cell proliferation and tumorigenesis in susceptible hosts. PMID:14527293

Frameshift Suppression in SACCHAROMYCES CEREVISIAE. III. Isolation and Genetic Properties of Group III Suppressors

PubMed Central

Cummins, Claudia M.; Gaber, Richard F.; Culbertson, Michael R.; Mann, Richard; Fink, Gerald R.

1980-01-01

Suppressors of ICR-induced mutations that exhibit behavior similar to bacterial frameshift suppressors have been identified in the yeast Saccharomyces cerevisiae. The yeast suppressors have been divided into two groups. Previous evidence indicated that suppressors of one group (Group II: SUF1, SUF3, SUF4, SUF5 and SUF6) represent mutations in the structural genes for glycyl-tRNA's. Suppressors of the other group (Group III: SUF2 and SUF7) were less well characterized. Although they suppressed some ICR-revertible mutations, they failed to suppress Group II frameshift mutations. This communication provides a more thorough characterization of the Group III suppressors and describes the isolation and properties of four new suppressors in that group (SUF8, SUF9, SUF10 and suf11).——In our original study, Group III suppressors were isolated as revertants of the Group III mutations his4–712 and his4–713. All suppressors obtained as ICR-induced revertants of these mutations mapped at the SUF2 locus near the centromere of chromosome III. Suppressors mapping at other loci were obtained in this study by analyzing spontaneous and UV-induced revertants of the Group III mutations. SUF2 and SUF10 suppress both Group III his4 mutations, whereas SUF7, SUF8, SUF9 and suf11 suppress his4–713, but not his4–712. All of the suppressors except suf11 are dominant in diploids homozygous for his4-713. The suppressors fail to suppress representative UAA, UAG and UGA nonsense mutations.——SUF9 is linked to the centromere of chromosome VI, and SUF10 is linked to the centromere of chromosome XIV. A triploid mapping procedure was used to determine the chromosome locations of SUF7 and SUF8. Subsequent standard crosses revealed linkage of SUF7 to cdc5 on chromosome XIII and linkage of SUF8 to cdc12 and pet3 on chromosome VIII. PMID:7009319

Suppressor Analysis Reveals a Role for SecY in the SecA2-Dependent Protein Export Pathway of Mycobacteria

PubMed Central

Ligon, Lauren S.; Rigel, Nathan W.; Romanchuk, Artur; Jones, Corbin D.

2013-01-01

All bacteria use the conserved Sec pathway to transport proteins across the cytoplasmic membrane, with the SecA ATPase playing a central role in the process. Mycobacteria are part of a small group of bacteria that have two SecA proteins: the canonical SecA (SecA1) and a second, specialized SecA (SecA2). The SecA2-dependent pathway exports a small subset of proteins and is required for Mycobacterium tuberculosis virulence. The mechanism by which SecA2 drives export of proteins across the cytoplasmic membrane remains poorly understood. Here we performed suppressor analysis on a dominant negative secA2 mutant (secA2 K129R) of the model mycobacterium Mycobacterium smegmatis to better understand the pathway used by SecA2 to export proteins. Two extragenic suppressor mutations were identified as mapping to the promoter region of secY, which encodes the central component of the canonical Sec export channel. These suppressor mutations increased secY expression, and this effect was sufficient to alleviate the secA2 K129R phenotype. We also discovered that the level of SecY protein was greatly diminished in the secA2 K129R mutant, but at least partially restored in the suppressors. Furthermore, the level of SecY in a suppressor strongly correlated with the degree of suppression. Our findings reveal a detrimental effect of SecA2 K129R on SecY, arguing for an integrated system in which SecA2 works with SecY and the canonical Sec translocase to export proteins. PMID:23913320

Structural Basis of Merlin Tumor Suppressor Functions in Neurofibromatosis-2

DTIC Science & Technology

2013-10-01

Neurofibromatosis -2 PRINCIPAL INVESTIGATOR: Tina Izard CONTRACTING ORGANIZATION: The Scripps Research Institute La Jolla, CA 92037-1000...30September2012-29September2013 4. TITLE AND SUBTITLE Structural Basis of Merlin Tumor Suppressor Functions in Neurofibromatosis -2 5a. CONTRACT...14. ABSTRACT Loss-of-function mutations in the neurofibromatosis -2 (NF2) gene lead to familial and sporadic neurological malignancies in man

Stromal loss of TGFβ drives cancer growth in the epithelium via inflammation | Center for Cancer Research

Cancer.gov

Interactions between epithelial and stromal cells play an important role in cancer development and progression. Epithelial cancers develop when changes occur to tumor suppressor genes in stromal fibroblast cells. For example, loss of tumor suppressor, p53, in stromal fibroblasts leads to p53 inactivation in the epithelium in a prostate cancer model, and disruption of the

Recurrent selection on the Winters sex-ratio genes in Drosophila simulans.

PubMed

Kingan, Sarah B; Garrigan, Daniel; Hartl, Daniel L

2010-01-01

Selfish genes, such as meiotic drive elements, propagate themselves through a population without increasing the fitness of host organisms. X-linked (or Y-linked) meiotic drive elements reduce the transmission of the Y (X) chromosome and skew progeny and population sex ratios, leading to intense conflict among genomic compartments. Drosophila simulans is unusual in having a least three distinct systems of X chromosome meiotic drive. Here, we characterize naturally occurring genetic variation at the Winters sex-ratio driver (Distorter on the X or Dox), its progenitor gene (Mother of Dox or MDox), and its suppressor gene (Not Much Yang or Nmy), which have been previously mapped and characterized. We survey three North American populations as well as 13 globally distributed strains and present molecular polymorphism data at the three loci. We find that all three genes show signatures of selection in North America, judging from levels of polymorphism and skews in the site-frequency spectrum. These signatures likely result from the biased transmission of the driver and selection on the suppressor for the maintenance of equal sex ratios. Coalescent modeling indicates that the timing of selection is more recent than the age of the alleles, suggesting that the driver and suppressor are coevolving under an evolutionary "arms race." None of the Winters sex-ratio genes are fixed in D. simulans, and at all loci we find ancestral alleles, which lack the gene insertions and exhibit high levels of nucleotide polymorphism compared to the derived alleles. In addition, we find several "null" alleles that have mutations on the derived Dox background, which result in loss of drive function. We discuss the possible causes of the maintenance of presence-absence polymorphism in the Winters sex-ratio genes.

Modulation of Genetic and Epigenetic Biomarkers of Colorectal Cancer in Humans by Black Raspberries: A Phase I Pilot Study

PubMed Central

Wang, Li-Shu; Arnold, Mark; Huang, Yi-Wen; Sardo, Christine; Seguin, Claire; Martin, Edward; Huang, Tim H.-M.; Riedl, Ken; Schwartz, Steven; Frankel, Wendy; Pearl, Dennis; Xu, Yiqing; Winston, John; Yang, Guang-Yu; Stoner, Gary

2010-01-01

Purpose This study evaluated the effects of black raspberries (BRBs) on biomarkers of tumor development in the human colon and rectum including methylation of relevant tumor suppressor genes, cell proliferation, apoptosis, angiogenesis and expression of Wnt pathway genes. Experimental Design Biopsies of adjacent normal tissues and colorectal adenocarcinomas were taken from 20 patients before and after oral consumption of BRB powder (60g/day) for 1-to-9 wks. Methylation status of promoter regions of five tumor suppressor genes was quantified. Protein expression of DNA methyltransferase 1 (DNMT1) and genes associated with cell proliferation, apoptosis, angiogenesis, and Wnt signaling were measured. Results The methylation of three Wnt inhibitors, SFRP2, SFRP5, and WIF1, upstream genes in Wnt pathway, and PAX6a, a developmental regulator, was modulated in a protective direction by BRBs in normal tissues and in colorectal tumors only in patients who received an average of 4 wks of BRB treatment, but not in all 20 patients with 1-to-9 wks of BRB treatment. This was associated with decreased expression of DNMT1. BRBs modulated expression of genes associated with Wnt pathway, proliferation, apoptosis and angiogenesis in a protective direction. Conclusions These data provide evidence of the ability of BRBs to demethylate tumor suppressor genes and to modulate other biomarkers of tumor development in the human colon and rectum. While demethylation of genes did not occur in colorectal tissues from all treated patients, the positive results with the secondary endpoints suggest that additional studies of BRBs for the prevention of colorectal cancer in humans now appear warranted. PMID:21123457

Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

PubMed

Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

2016-11-04

Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

Comprehensive analysis of transcriptome variation uncovers known and novel driver events in T-cell acute lymphoblastic leukemia.

PubMed

Atak, Zeynep Kalender; Gianfelici, Valentina; Hulselmans, Gert; De Keersmaecker, Kim; Devasia, Arun George; Geerdens, Ellen; Mentens, Nicole; Chiaretti, Sabina; Durinck, Kaat; Uyttebroeck, Anne; Vandenberghe, Peter; Wlodarska, Iwona; Cloos, Jacqueline; Foà, Robin; Speleman, Frank; Cools, Jan; Aerts, Stein

2013-01-01

RNA-seq is a promising technology to re-sequence protein coding genes for the identification of single nucleotide variants (SNV), while simultaneously obtaining information on structural variations and gene expression perturbations. We asked whether RNA-seq is suitable for the detection of driver mutations in T-cell acute lymphoblastic leukemia (T-ALL). These leukemias are caused by a combination of gene fusions, over-expression of transcription factors and cooperative point mutations in oncogenes and tumor suppressor genes. We analyzed 31 T-ALL patient samples and 18 T-ALL cell lines by high-coverage paired-end RNA-seq. First, we optimized the detection of SNVs in RNA-seq data by comparing the results with exome re-sequencing data. We identified known driver genes with recurrent protein altering variations, as well as several new candidates including H3F3A, PTK2B, and STAT5B. Next, we determined accurate gene expression levels from the RNA-seq data through normalizations and batch effect removal, and used these to classify patients into T-ALL subtypes. Finally, we detected gene fusions, of which several can explain the over-expression of key driver genes such as TLX1, PLAG1, LMO1, or NKX2-1; and others result in novel fusion transcripts encoding activated kinases (SSBP2-FER and TPM3-JAK2) or involving MLLT10. In conclusion, we present novel analysis pipelines for variant calling, variant filtering, and expression normalization on RNA-seq data, and successfully applied these for the detection of translocations, point mutations, INDELs, exon-skipping events, and expression perturbations in T-ALL.

Acquisition and amplification of a testis-expressed autosomal gene, SSL, by the Drosophila Y chromosome

PubMed Central

Kalmykova, Alla I.; Shevelyov, Yury Y.; Dobritsa, Anna A.; Gvozdev, Vladimir A.

1997-01-01

The acquisition of autosomal fertility genes has been proposed to be an important process in human Y chromosome evolution. For example, the Y-linked fertility factor DAZ (Deleted in Azoospermia) appears to have arisen after the transposition and tandem amplification of the autosomal DAZH gene. The Drosophila melanogaster Y chromosome contains tandemly repeated Su(Ste) units that are thought to affect male fertility as suppressors of the homologous X-linked Stellate repeats. Here we report the detection of a testis-expressed autosomal gene, SSL [Su(Ste)-like], that appears to be an ancestor of the Y-linked Su(Ste) units. SSL encodes a casein kinase 2 (CK2) β-subunit-like protein. Its putative ORF shares extensive (45%) homology with the genuine β-subunit of CK2 and retains the conserved C-terminal and Glu/Asp-rich domains that are essential for CK2 holoenzyme regulation. SSL maps within region 60D1–2 of D. melanogaster and D. simulans polytene chromosomes. We present evidence that SSL was derived from the genuine βCK2 gene by reverse transcription. This event resulted in the loss of the first three introns in the coding region of the SSL ancestor gene. Evolutionary analysis indicates that SSL has evolved under selective pressure at the translational level. Its sequence, especially in the 3′ region, is much closer to the Y-linked Su(Ste) tandem repeats than to the βCK2 gene. These results suggest that the acquisition of testis-specific autosomal genes may be important for the evolution of Drosophila as well as human Y chromosomes. PMID:9177211

Molecular changes preceding endometrial and ovarian cancer: a study of consecutive endometrial specimens from Lynch syndrome surveillance.

PubMed

Niskakoski, Anni; Pasanen, Annukka; Lassus, Heini; Renkonen-Sinisalo, Laura; Kaur, Sippy; Mecklin, Jukka-Pekka; Bützow, Ralf; Peltomäki, Päivi

2018-03-27

Molecular alterations preceding endometrial and ovarian cancer and the sequence of events are unknown. Consecutive specimens from lifelong surveillance for Lynch syndrome provides a natural setting to address such questions. To molecularly define the multistep gynecological tumorigenesis, DNA mismatch repair gene mutation carriers with endometrial or ovarian carcinoma or endometrial hyperplasia were identified from a nation-wide registry and endometrial biopsy specimens taken from these individuals during 20 years of screening were collected. A total of 213 endometrial and ovarian specimens from Lynch syndrome individuals and 197 histology-matched (non-serous) samples from sporadic cases were available for this investigation. The specimens were profiled for markers linked to endometrial and ovarian tumorigenesis, including ARID1A protein expression, mismatch repair status, and tumor suppressor gene promoter methylation. In Lynch syndrome-associated endometrial and ovarian carcinomas, ARID1A protein was lost in 61-100% and mismatch repair was deficient in 97-100%, compared to 0-17% and 14-44% in sporadic cases (P = 0.000). ARID1A loss appeared in complex hyperplasia and deficient mismatch repair and tumor suppressor gene promoter methylation in histologically normal endometrium. Despite quantitative differences between Lynch syndrome and sporadic cases, ARID1A expression, mismatch repair, and tumor suppressor gene promoter methylation divided endometrial samples from both patient groups into three categories of increasing abnormality, comprising normal endometrium and simple hyperplasia (I), complex hyperplasia with or without atypia (II), and endometrial cancer (III). Complex hyperplasias without vs. with atypia were molecularly indistinguishable. In conclusion, surveillance specimens from Lynch syndrome identify mismatch repair deficiency, tumor suppressor gene promoter methylation, and ARID1A loss as early changes in tumor development. Our findings are clinically relevant for the classification of endometrial hyperplasias and have potential implications in cancer prevention in Lynch syndrome and beyond.

P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.

PubMed

He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M

2000-09-26

P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.

MiR-21 plays an Important Role in Radiation Induced Carcinogenesis in BALB/c Mice by Directly Targeting the Tumor Suppressor Gene Big-h3

PubMed Central

Liu, Cong; Li, Bailong; Cheng, Ying; Lin, Jing; Hao, Jun; Zhang, Shuyu; Mitchel, R.E.J.; Sun, Ding; Ni, Jin; Zhao, Luqian; Gao, Fu; Cai, Jianming

2011-01-01

Dysregulation of certain microRNAs (miRNAs) in cancer can promote tumorigenesis, metastasis and invasion. However, the functions and targets of only a few mammalian miRNAs are known. In particular, the miRNAs that participates in radiation induced carcinogenesis and the miRNAs that target the tumor suppressor gene Big-h3 remain undefined. Here in this study, using a radiation induced thymic lymphoma model in BALB/c mice, we found that the tumor suppressor gene Big-h3 is down-regulated and miR-21 is up-regulated in radiation induced thymic lymphoma tissue samples. We also found inverse correlations between Big-h3 protein and miR-21 expression level among different tissue samples. Furthermore, our data indicated that miR-21 could directly target Big-h3 in a 3′UTR dependent manner. Finally, we found that miR-21 could be induced by TGFβ, and miR-21 has both positive and negative effects in regulating TGFβ signaling. We conclude that miR-21 participates in radiation induced carcinogenesis and it regulates TGFβ signaling. PMID:21494432

E6 and E7 gene silencing results in decreased methylation of tumor suppressor genes and induces phenotype transformation of human cervical carcinoma cell lines

PubMed Central

Long, Jia; Shen, Danbei; Zhou, Wuqing; Zhou, Qiyan; Yang, Jia; Jiang, Mingjun

2015-01-01

In SiHa and CaSki cells, E6 and E7-targeting shRNA specifically and effectively knocked down human papillomavirus (HPV) 16 E6 and E7 at the transcriptional level, reduced the E6 and E7 mRNA levels by more than 80% compared with control cells that expressed a scrambled-sequence shRNA. E6 and E7 repression resulted in down-regulation of DNA methyltransferase mRNA and protein expression, decreased DNA methylation and increased mRNA expression levels of tumor suppressor genes, induced a certain apoptosis and inhibited proliferation in E6 and E7 shRNA-infected SiHa and CaSki cells compared with the uninfected cells. Repression of E6 and E7 oncogenes resulted in restoration of DNA methyltransferase suppressor pathways and induced apoptosis in HPV16-positive cervical carcinoma cell lines. Our findings suggest that the potential carcinogenic mechanism of HPV16 through influencing DNA methylation pathway to activate the development of cervical cancer exist, and maybe as a candidate therapeutic strategy for cervical and other HPV-associated cancers. PMID:26329329

Genetics Home Reference: primary macronodular adrenal hyperplasia

MedlinePlus

... too rapidly or in an uncontrolled way. ARMC5 gene mutations are believed to impair the protein's tumor-suppressor ... endocrine glands, including the adrenal glands. The GNAS gene mutations that cause PMAH are believed to result in ...

N-terminal RASSF family

PubMed Central

Underhill-Day, Nicholas; Hill, Victoria

2011-01-01

Epigenetic inactivation of tumor suppressor genes is a hallmark of cancer development. RASSF1A (Ras Association Domain Family 1 isoform A) tumor suppressor gene is one of the most frequently epigenetically inactivated genes in a wide range of adult and children's cancers and could be a useful molecular marker for cancer diagnosis and prognosis. RASSF1A has been shown to play a role in several biological pathways, including cell cycle control, apoptosis and microtubule dynamics. RASSF2, RASSF4, RASSF5 and RASSF6 are also epigenetically inactivated in cancer but have not been analyzed in as wide a range of malignancies as RASSF1A. Recently four new members of the RASSF family were identified these are termed N-Terminal RASSF genes (RASSF7–RASSF10). Molecular and biological analysis of these newer members has just begun. This review highlights what we currently know in respects to structural, functional and molecular properties of the N-Terminal RASSFs. PMID:21116130

Role of Molecular Biology in Cancer Treatment: A Review Article.

PubMed

Imran, Aman; Qamar, Hafiza Yasara; Ali, Qurban; Naeem, Hafsa; Riaz, Mariam; Amin, Saima; Kanwal, Naila; Ali, Fawad; Sabar, Muhammad Farooq; Nasir, Idrees Ahmad

2017-11-01

Cancer is a genetic disease and mainly arises due to a number of reasons include activation of onco-genes, malfunction of tumor suppressor genes or mutagenesis due to external factors. This article was written from the data collected from PubMed, Nature, Science Direct, Springer and Elsevier groups of journals. Oncogenes are deregulated form of normal proto-oncogenes required for cell division, differentiation and regulation. The conversion of proto-oncogene to oncogene is caused due to translocation, rearrangement of chromosomes or mutation in gene due to addition, deletion, duplication or viral infection. These oncogenes are targeted by drugs or RNAi system to prevent proliferation of cancerous cells. There have been developed different techniques of molecular biology used to diagnose and treat cancer, including retroviral therapy, silencing of oncogenes and mutations in tumor suppressor genes. Among all the techniques used, RNAi, zinc finger nucleases and CRISPR hold a brighter future towards creating a Cancer Free World.

Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

PubMed

Zhao, Yongzhong; Epstein, Richard J

2013-01-01

Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

Early function of the Abutilon mosaic virus AC2 gene as a replication brake.

PubMed

Krenz, Björn; Deuschle, Kathrin; Deigner, Tobias; Unseld, Sigrid; Kepp, Gabi; Wege, Christina; Kleinow, Tatjana; Jeske, Holger

2015-04-01

The C2/AC2 genes of monopartite/bipartite geminiviruses of the genera Begomovirus and Curtovirus encode important pathogenicity factors with multiple functions described so far. A novel function of Abutilon mosaic virus (AbMV) AC2 as a replication brake is described, utilizing transgenic plants with dimeric inserts of DNA B or with a reporter construct to express green fluorescent protein (GFP). Their replicational release upon AbMV superinfection or the individual and combined expression of epitope-tagged AbMV AC1, AC2, and AC3 was studied. In addition, the effects were compared in the presence and in the absence of an unrelated tombusvirus suppressor of silencing (P19). The results show that AC2 suppresses replication reproducibly in all assays and that AC3 counteracts this effect. Examination of the topoisomer distribution of supercoiled DNA, which indicates changes in the viral minichromosome structure, did not support any influence of AC2 on transcriptional gene silencing and DNA methylation. The geminiviral AC2 protein has been detected here for the first time in plants. The experiments revealed an extremely low level of AC2, which was slightly increased if constructs with an intron and a hemagglutinin (HA) tag in addition to P19 expression were used. AbMV AC2 properties are discussed with reference to those of other geminiviruses with respect to charge, modification, and size in order to delimit possible reasons for the different behaviors. The (A)C2 genes encode a key pathogenicity factor of begomoviruses and curtoviruses in the plant virus family Geminiviridae. This factor has been implicated in the resistance breaking observed in agricultural cotton production. AC2 is a multifunctional protein involved in transcriptional control, gene silencing, and regulation of basal biosynthesis. Here, a new function of Abutilon mosaic virus AC2 in replication control is added as a feature of this protein in viral multiplication, providing a novel finding on geminiviral molecular biology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

PubMed Central

Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

2013-01-01

Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

PubMed

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome triplication analysis in B. oleracea, B. rapa and A. thaliana genomes, our study provides insight into the evolutionary history of NBS-encoding genes after divergence of A. thaliana and the Brassica lineage. These results together with expression pattern analysis of NBS-encoding orthologous genes provide useful resource for functional characterization of these genes and genetic improvement of relevant crops.

Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

PubMed

Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

2018-06-19

Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

PubMed

Daniel, Dianne C; Johnson, Edward M

2018-02-15

The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding element is amplified as expanded polynucleotide repeats in several brain diseases including fragile X syndrome and a familial form of amyotrophic lateral sclerosis/fronto-temporal dementia. Throughout evolution the Pura protein plays a critical role in survival, based on conservation of its nucleic acid binding properties. These Pura properties have been adapted in higher organisms to the as yet unfathomable development of the human brain. Copyright © 2017 Elsevier B.V. All rights reserved.

Drosophila SLC22A transporter is a memory suppressor gene that influences cholinergic neurotransmission to the mushroom bodies

PubMed Central

Gai, Yunchao; Liu, Ze; Cervantes-Sandoval, Isaac; Davis, Ronald L.

2016-01-01

SUMMARY The mechanisms that constrain memory formation are of special interest because they provide insights into the brain’s memory management systems and potential avenues for correcting cognitive disorders. RNAi knockdown in the Drosophila mushroom body neurons (MBn) of a newly discovered memory suppressor gene, Solute Carrier DmSLC22A, a member of the organic cation transporter family, enhances olfactory memory expression, while overexpression inhibits it. The protein localizes to the dendrites of the MBn, surrounding the presynaptic terminals of cholinergic afferent fibers from projection neurons (Pn). Cell-based expression assays show that this plasma membrane protein transports cholinergic compounds with the highest affinity among several in vitro substrates. Feeding flies choline or inhibiting acetylcholinesterase in Pn enhances memory; an effect blocked by overexpression of the transporter in the MBn. The data argue that DmSLC22A is a memory suppressor protein that limits memory formation by helping to terminate cholinergic neurotransmission at the Pn:MBn synapse. PMID:27146270

Detection of doublecortin domain-containing 2 (DCDC2), a new candidate tumor suppressor gene of hepatocellular carcinoma, by triple combination array analysis

PubMed Central

2013-01-01

Background To detect genes correlated with hepatocellular carcinoma (HCC), we developed a triple combination array consisting of methylation array, gene expression array and single nucleotide polymorphism (SNP) array analysis. Methods A surgical specimen obtained from a 68-year-old female HCC patient was analyzed by triple combination array, which identified doublecortin domain-containing 2 (DCDC2) as a candidate tumor suppressor gene of HCC. Subsequently, samples from 48 HCC patients were evaluated for their DCDC2 methylation and expression status using methylation specific PCR (MSP) and semi-quantitative reverse transcriptase (RT) PCR, respectively. Then, we investigated the relationship between clinicopathological factors and methylation status of DCDC2. Results DCDC2 was revealed to be hypermethylated (methylation value 0.846, range 0–1.0) in cancer tissue, compared with adjacent normal tissue (0.212) by methylation array in the 68-year-old female patient. Expression array showed decreased expression of DCDC2 in cancerous tissue. SNP array showed that the copy number of chromosome 6p22.1, in which DCDC2 resides, was normal. MSP revealed hypermethylation of the promoter region of DCDC2 in 41 of the tumor samples. DCDC2 expression was significantly decreased in the cases with methylation (P = 0.048). Furthermore, the methylated cases revealed worse prognosis for overall survival than unmethylated cases (P = 0.048). Conclusions The present study indicates that triple combination array is an effective method to detect novel genes related to HCC. We propose that DCDC2 is a tumor suppressor gene of HCC. PMID:24034596

A Genome-Wide RNAi Screen Identifies FOXO4 as a Metastasis-Suppressor through Counteracting PI3K/AKT Signal Pathway in Prostate Cancer

PubMed Central

Su, Bing; Gao, Lingqiu; Baranowski, Catherine; Gillard, Bryan; Wang, Jianmin; Ransom, Ryan; Ko, Hyun-Kyung; Gelman, Irwin H.

2014-01-01

Activation of the PI3K/AKT signal pathway is a known driving force for the progression to castration-recurrent prostate cancer (CR-CaP), which constitutes the major lethal phenotype of CaP. Here, we identify using a genomic shRNA screen the PI3K/AKT-inactivating downstream target, FOXO4, as a potential CaP metastasis suppressor. FOXO4 protein levels inversely correlate with the invasive potential of a panel of human CaP cell lines, with decreased mRNA levels correlating with increased incidence of clinical metastasis. Knockdown (KD) of FOXO4 in human LNCaP cells causes increased invasion in vitro and lymph node (LN) metastasis in vivo without affecting indices of proliferation or apoptosis. Increased Matrigel invasiveness was found by KD of FOXO1 but not FOXO3. Comparison of differentially expressed genes affected by FOXO4-KD in LNCaP cells in culture, in primary tumors and in LN metastases identified a panel of upregulated genes, including PIP, CAMK2N1, PLA2G16 and PGC, which, if knocked down by siRNA, could decrease the increased invasiveness associated with FOXO4 deficiency. Although only some of these genes encode FOXO promoter binding sites, they are all RUNX2-inducible, and RUNX2 binding to the PIP promoter is increased in FOXO4-KD cells. Indeed, the forced expression of FOXO4 reversed the increased invasiveness of LNCaP/shFOXO4 cells; the forced expression of FOXO4 did not alter RUNX2 protein levels, yet it decreased RUNX2 binding to the PIP promoter, resulting in PIP downregulation. Finally, there was a correlation between FOXO4, but not FOXO1 or FOXO3, downregulation and decreased metastasis-free survival in human CaP patients. Our data strongly suggest that increased PI3K/AKT-mediated metastatic invasiveness in CaP is associated with FOXO4 loss, and that mechanisms to induce FOXO4 re-expression might suppress CaP metastatic aggressiveness. PMID:24983969

Toxin Kid uncouples DNA replication and cell division to enforce retention of plasmid R1 in Escherichia coli cells.

PubMed

Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A; Agu, Chukwuma A; Wang, Xindan; Bernal, Juan A; Sherratt, David J; de la Cueva-Méndez, Guillermo

2014-02-18

Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid-bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs.

Toxin Kid uncouples DNA replication and cell division to enforce retention of plasmid R1 in Escherichia coli cells

PubMed Central

Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A.; Agu, Chukwuma A.; Wang, Xindan; Bernal, Juan A.; Sherratt, David J.; de la Cueva-Méndez, Guillermo

2014-01-01

Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid–bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs. PMID:24449860

Tombusvirus-based vector systems to permit over-expression of genes or that serve as sensors of antiviral RNA silencing in plants.

PubMed

Shamekova, Malika; Mendoza, Maria R; Hsieh, Yi-Cheng; Lindbo, John; Omarov, Rustem T; Scholthof, Herman B

2014-03-01

A next generation Tomato bushy stunt virus (TBSV) coat protein gene replacement vector system is described that can be applied by either RNA inoculation or through agroinfiltration. A vector expressing GFP rapidly yields high levels of transient gene expression in inoculated leaves of various plant species, as illustrated for Nicotiana benthamiana, cowpea, tomato, pepper, and lettuce. A start-codon mutation to down-regulate the dose of the P19 silencing suppressor reduces GFP accumulation, whereas mutations that result in undetectable levels of P19 trigger rapid silencing of GFP. Compared to existing virus vectors the TBSV system has a unique combination of a very broad host range, rapid and high levels of replication and gene expression, and the ability to regulate its suppressor. These features are attractive for quick transient assays in numerous plant species for over-expression of genes of interest, or as a sensor to monitor the efficacy of antiviral RNA silencing. Copyright © 2014. Published by Elsevier Inc.

SIRT3 is a Mitochondrial Tumor Suppressor and Genetic Loss Results in a Murine Model for ER/PR-Positive Mammary Tumors Connecting Metabolism and Carcinogenesis Mitochondrial Tumor Suppressor. Revision

DTIC Science & Technology

2013-11-01

dependent gene expression, as shown by co-transfection assays using an HRE luciferase reporter (Fig. 4b, bar 1 vs. 2). In addition, exposure to NAC...transfected with p3x- HRE -luciferase with or without NAC or stigmatellin and 40 hours afterwards luciferase levels were determined. (c) MTCLT3

Topological and organizational properties of the products of house-keeping and tissue-specific genes in protein-protein interaction networks.

PubMed

Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing

2009-03-11

Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene-encoded proteins are attached to the core at more peripheral positions of the networks.

Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

PubMed

Yassin, Atteyet F; Langenberg, Stefan; Huntemann, Marcel; Clum, Alicia; Pillay, Manoj; Palaniappan, Krishnaveni; Varghese, Neha; Mikhailova, Natalia; Mukherjee, Supratim; Reddy, T B K; Daum, Chris; Shapiro, Nicole; Ivanova, Natalia; Woyke, Tanja; Kyrpides, Nikos C

2017-01-01

The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA) pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS) were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM) systems, type II toxin-antitoxin (TA), CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA) and topisomerase IV (ParC) enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH-flavin oxidoreductase.

The Promiscuous sumA Missense Suppressor from Salmonella enterica Has an Intriguing Mechanism of Action

PubMed Central

Cole, Ashley E.; Hani, Fatmah M.; Altman, Ronni; Meservy, Megan; Roth, John R.; Altman, Elliot

2017-01-01

While most missense suppressors have very narrow specificities and only suppress the allele against which they were isolated, the sumA missense suppressor from Salmonella enterica serovar Typhimurium is a promiscuous or broad-acting missense suppressor that suppresses numerous missense mutants. The sumA missense suppressor was identified as a glyV tRNA Gly3(GAU/C) missense suppressor that can recognize GAU or GAC aspartic acid codons and insert a glycine amino acid instead of aspartic acid. In addition to rescuing missense mutants caused by glycine to aspartic acid changes as expected, sumA could also rescue a number of other missense mutants as well by changing a neighboring (contacting) aspartic acid to glycine, which compensated for the other amino acid change. Thus the ability of sumA to rescue numerous missense mutants was due in part to the large number of glycine codons in genes that can be mutated to an aspartic acid codon and in part to the general tolerability and/or preference for glycine amino acids in proteins. Because the glyV tRNA Gly3(GAU/C) missense suppressor has also been extensively characterized in Escherichia coli as the mutA mutator, we demonstrated that all gain-of-function mutants isolated in a glyV tRNA Gly3(GAU/C) missense suppressor are transferable to a wild-type background and thus the increased mutation rates, which occur in glyV tRNA Gly3(GAU/C) missense suppressors, are not due to the suppression of these mutants. PMID:27974497

Myeloid malignancies: mutations, models and management

PubMed Central

2012-01-01

Myeloid malignant diseases comprise chronic (including myelodysplastic syndromes, myeloproliferative neoplasms and chronic myelomonocytic leukemia) and acute (acute myeloid leukemia) stages. They are clonal diseases arising in hematopoietic stem or progenitor cells. Mutations responsible for these diseases occur in several genes whose encoded proteins belong principally to five classes: signaling pathways proteins (e.g. CBL, FLT3, JAK2, RAS), transcription factors (e.g. CEBPA, ETV6, RUNX1), epigenetic regulators (e.g. ASXL1, DNMT3A, EZH2, IDH1, IDH2, SUZ12, TET2, UTX), tumor suppressors (e.g. TP53), and components of the spliceosome (e.g. SF3B1, SRSF2). Large-scale sequencing efforts will soon lead to the establishment of a comprehensive repertoire of these mutations, allowing for a better definition and classification of myeloid malignancies, the identification of new prognostic markers and therapeutic targets, and the development of novel therapies. Given the importance of epigenetic deregulation in myeloid diseases, the use of drugs targeting epigenetic regulators appears as a most promising therapeutic approach. PMID:22823977

Development of a novel mouse glioma model using lentiviral vectors

PubMed Central

Marumoto, Tomotoshi; Tashiro, Ayumu; Friedmann-Morvinski, Dinorah; Scadeng, Miriam; Soda, Yasushi; Gage, Fred H; Verma, Inder M

2009-01-01

We report the development of a new method to induce glioblastoma multiforme in adult immunocompetent mice by injecting Cre-loxP–controlled lentiviral vectors expressing oncogenes. Cell type- or region-specific expression of activated forms of the oncoproteins Harvey-Ras and AKT in fewer than 60 glial fibrillary acidic protein–positive cells in the hippocampus, subventricular zone or cortex of mice heterozygous for the gene encoding the tumor suppressor Tp53 were tested. Mice developed glioblastoma multiforme when transduced either in the subventricular zone or the hippocampus. However, tumors were rarely detected when the mice were transduced in the cortex. Transplantation of brain tumor cells into naive recipient mouse brain resulted in the formation of glioblastoma multiforme–like tumors, which contained CD133+ cells, formed tumorspheres and could differentiate into neurons and astrocytes. We suggest that the use of Cre-loxP–controlled lentiviral vectors is a novel way to generate a mouse glioblastoma multiforme model in a region- and cell type-specific manner in adult mice. PMID:19122659

DNA methylation of ESR-1 and N-33 in colorectal mucosa of patients with ulcerative colitis (UC).

PubMed

Arasaradnam, Ramesh P; Khoo, Kevin; Bradburn, Mike; Mathers, John C; Kelly, Seamus B

2010-07-01

Epigenetic marking such as DNA methylation influence gene transcription and chromosomal stability and may also be affected by environmental exposures. Few studies exist on alteration in DNA methylation profiles (genomic and gene specific methylation) in patients with Ulcerative Colitis (UC) and no studies exist that assess its relationship with lifestyle exposures. The methylation level of both ESR-1 and N-33 genes were significantly higher in UC subjects compared with controls (7.9% vs. 5.9%; p = 0.015 and 66% vs. 9.3%; p < 0.001 respectively). There was no detectable difference in global DNA methylation between patients with UC and age and sex matched controls. No associations between indices of DNA methylation and anthropometric measures or smoking patterns were detected. To assess genomic methylation and promoter methylation of the ESR-1 (oestrogen receptor-1) and N-33 (tumor suppressor candidate-3) genes in the macroscopically normal mucosa of UC patients as well as to investigate effects of anthropometric and lifestyle exposures on DNA methylation. Sixty eight subjects were recruited (24 UC and 44 age and sex matched controls). Colorectal mucosal biopsies were obtained and DNA was extracted. Genomic DNA methylation was quantified using the tritium-labelled cytosine extension assay (3[H] dCTP) while gene specific methylation was quantified using the COBRA method. For the first time, we have shown increased methylation in the promoter regions of the putative tumor suppressor gene N-33 in macroscopically normal mucosa of patients with UC. In addition, we have confirmed that methylation of ESR-1 promoter is higher in UC patients compared with age and sex matched controls. These findings suggest that inactivation through methylation of the putative tumor suppressor genes N-33 and ESR-1 may not be associated with colorectal carcinogenesis in UC.

Direct inhibition of RNAse T2 expression by the HTLV-1 viral protein Tax.

PubMed

Polakowski, Nicholas; Han, Hongjin; Lemasson, Isabelle

2011-08-01

Adult T-cell leukemia (ATL) is one of the primary diseases caused by Human T-cell Leukemia Virus type 1 (HTLV-1) infection. The virally-encoded Tax protein is believed to initiate early events in the development of this disease, as it is able to promote immortalization of T-cells and transformation of other cell types. These processes may be aided by the ability of the viral protein to directly deregulate expression of specific cellular genes through interactions with numerous transcriptional regulators. To identify gene promoters where Tax is localized, we isolated Tax-DNA complexes from an HTLV-1-infected T-cell line through a chromatin immunoprecipitation (ChIP) assay and used the DNA to probe a CpG island microarray. A site within the RNASET2 gene was found to be occupied by Tax. Real-time PCR analysis confirmed this result, and transient expression of Tax in uninfected cells led to the recruitment of the viral protein to the promoter. This event correlated with a decrease in the level of RNase T2 mRNA and protein, suggesting that Tax represses expression of this gene. Loss of RNase T2 expression occurs in certain hematological malignancies and other forms of cancer, and RNase T2 was recently reported to function as a tumor suppressor. Consequently, a reduction in the level of RNase T2 by Tax may play a role in ATL development.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

PubMed

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Direct Inhibition of RNAse T2 Expression by the HTLV-1 Viral Protein Tax

PubMed Central

Polakowski, Nicholas; Han, Hongjin; Lemasson, Isabelle

2011-01-01

Adult T-cell leukemia (ATL) is one of the primary diseases caused by Human T-cell Leukemia Virus type 1 (HTLV-1) infection. The virally-encoded Tax protein is believed to initiate early events in the development of this disease, as it is able to promote immortalization of T-cells and transformation of other cell types. These processes may be aided by the ability of the viral protein to directly deregulate expression of specific cellular genes through interactions with numerous transcriptional regulators. To identify gene promoters where Tax is localized, we isolated Tax-DNA complexes from an HTLV-1-infected T-cell line through a chromatin immunoprecipitation (ChIP) assay and used the DNA to probe a CpG island microarray. A site within the RNASET2 gene was found to be occupied by Tax. Real-time PCR analysis confirmed this result, and transient expression of Tax in uninfected cells led to the recruitment of the viral protein to the promoter. This event correlated with a decrease in the level of RNase T2 mRNA and protein, suggesting that Tax represses expression of this gene. Loss of RNase T2 expression occurs in certain hematological malignancies and other forms of cancer, and RNase T2 was recently reported to function as a tumor suppressor. Consequently, a reduction in the level of RNase T2 by Tax may play a role in ATL development. PMID:21994792

Epigenetic deregulation of TCF21 inhibits metastasis suppressor KISS1 in metastatic melanoma.

PubMed

Arab, Khelifa; Smith, Laura T; Gast, Andreas; Weichenhan, Dieter; Huang, Joseph Po-Hsien; Claus, Rainer; Hielscher, Thomas; Espinosa, Allan V; Ringel, Matthew D; Morrison, Carl D; Schadendorf, Dirk; Kumar, Rajiv; Plass, Christoph

2011-10-01

Metastatic melanoma is a fatal disease due to the lack of successful therapies and biomarkers for early detection and its incidence has been increasing. Genetic studies have defined recurrent chromosomal aberrations, suggesting the location of either tumor suppressor genes or oncogenes. Transcription factor 21 (TCF21) belongs to the class A of the basic helix-loop-helix family with reported functions in early lung and kidney development as well as tumor suppressor function in the malignancies of the lung and head and neck. In this study, we combined quantitative DNA methylation analysis in patient biopsies and in their derived cell lines to demonstrate that TCF21 expression is downregulated in metastatic melanoma by promoter hypermethylation and TCF21 promoter DNA methylation is correlated with decreased survival in metastatic skin melanoma patients. In addition, the chromosomal location of TCF21 on 6q23-q24 coincides with the location of a postulated metastasis suppressor in melanoma. Functionally, TCF21 binds the promoter of the melanoma metastasis-suppressing gene, KiSS1, and enhances its gene expression through interaction with E12, a TCF3 isoform and with TCF12. Loss of TCF21 expression results in loss of KISS1 expression through loss of direct interaction of TCF21 at the KISS1 promoter. Finally, overexpression of TCF21 inhibits motility of C8161 melanoma cells. These data suggest that epigenetic downregulation of TCF21 is functionally involved in melanoma progression and that it may serve as a biomarker for aggressive tumor behavior.

Identification and characterization of suppressors of plant cell death (SPD) effectors from Magnaporthe oryzae.

PubMed

Sharpee, William; Oh, Yeonyee; Yi, Mihwa; Franck, William; Eyre, Alex; Okagaki, Laura H; Valent, Barbara; Dean, Ralph A

2017-08-01

Phytopathogenic microorganisms, including the fungal pathogen Magnaporthe oryzae, secrete a myriad of effector proteins to facilitate infection. Utilizing the transient expression of candidate effectors in the leaves of the model plant Nicotiana benthamiana, we identified 11 suppressors of plant cell death (SPD) effectors from M. oryzae that were able to block the host cell death reaction induced by Nep1. Ten of these 11 were also able to suppress BAX-mediated plant cell death. Five of the 11 SPD genes have been identified previously as either essential for the pathogenicity of M. oryzae, secreted into the plant during disease development, or as suppressors or homologues of other characterized suppressors. In addition, of the remaining six, we showed that SPD8 (previously identified as BAS162) was localized to the rice cytoplasm in invaded and surrounding uninvaded cells during biotrophic invasion. Sequence analysis of the 11 SPD genes across 43 re-sequenced M. oryzae genomes revealed that SPD2, SPD4 and SPD7 have nucleotide polymorphisms amongst the isolates. SPD4 exhibited the highest level of nucleotide diversity of any currently known effector from M. oryzae in addition to the presence/absence polymorphisms, suggesting that this gene is potentially undergoing selection to avoid recognition by the host. Taken together, we have identified a series of effectors, some of which were previously unknown or whose function was unknown, that probably act at different stages of the infection process and contribute to the virulence of M. oryzae. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Landscape of somatic mutations and clonal evolution in mantle cell lymphoma.

PubMed

Beà, Sílvia; Valdés-Mas, Rafael; Navarro, Alba; Salaverria, Itziar; Martín-Garcia, David; Jares, Pedro; Giné, Eva; Pinyol, Magda; Royo, Cristina; Nadeu, Ferran; Conde, Laura; Juan, Manel; Clot, Guillem; Vizán, Pedro; Di Croce, Luciano; Puente, Diana A; López-Guerra, Mónica; Moros, Alexandra; Roue, Gael; Aymerich, Marta; Villamor, Neus; Colomo, Lluís; Martínez, Antonio; Valera, Alexandra; Martín-Subero, José I; Amador, Virginia; Hernández, Luis; Rozman, Maria; Enjuanes, Anna; Forcada, Pilar; Muntañola, Ana; Hartmann, Elena M; Calasanz, María J; Rosenwald, Andreas; Ott, German; Hernández-Rivas, Jesús M; Klapper, Wolfram; Siebert, Reiner; Wiestner, Adrian; Wilson, Wyndham H; Colomer, Dolors; López-Guillermo, Armando; López-Otín, Carlos; Puente, Xose S; Campo, Elías

2013-11-05

Mantle cell lymphoma (MCL) is an aggressive tumor, but a subset of patients may follow an indolent clinical course. To understand the mechanisms underlying this biological heterogeneity, we performed whole-genome and/or whole-exome sequencing on 29 MCL cases and their respective matched normal DNA, as well as 6 MCL cell lines. Recurrently mutated genes were investigated by targeted sequencing in an independent cohort of 172 MCL patients. We identified 25 significantly mutated genes, including known drivers such as ataxia-telangectasia mutated (ATM), cyclin D1 (CCND1), and the tumor suppressor TP53; mutated genes encoding the anti-apoptotic protein BIRC3 and Toll-like receptor 2 (TLR2); and the chromatin modifiers WHSC1, MLL2, and MEF2B. We also found NOTCH2 mutations as an alternative phenomenon to NOTCH1 mutations in aggressive tumors with a dismal prognosis. Analysis of two simultaneous or subsequent MCL samples by whole-genome/whole-exome (n = 8) or targeted (n = 19) sequencing revealed subclonal heterogeneity at diagnosis in samples from different topographic sites and modulation of the initial mutational profile at the progression of the disease. Some mutations were predominantly clonal or subclonal, indicating an early or late event in tumor evolution, respectively. Our study identifies molecular mechanisms contributing to MCL pathogenesis and offers potential targets for therapeutic intervention.

A microRNA family exerts maternal control on sex determination in C. elegans

PubMed Central

McJunkin, Katherine; Ambros, Victor

2017-01-01

Gene expression in early animal embryogenesis is in large part controlled post-transcriptionally. Maternally contributed microRNAs may therefore play important roles in early development. We elucidated a major biological role of the nematode mir-35 family of maternally contributed essential microRNAs. We show that this microRNA family regulates the sex determination pathway at multiple levels, acting both upstream of and downstream from her-1 to prevent aberrantly activated male developmental programs in hermaphrodite embryos. Both of the predicted target genes that act downstream from the mir-35 family in this process, suppressor-26 (sup-26) and NHL (NCL-1, HT2A, and LIN-41 repeat) domain-containing-2 (nhl-2), encode RNA-binding proteins, thus delineating a previously unknown post-transcriptional regulatory subnetwork within the well-studied sex determination pathway of Caenorhabditis elegans. Repression of nhl-2 by the mir-35 family is required for not only proper sex determination but also viability, showing that a single microRNA target site can be essential. Since sex determination in C. elegans requires zygotic gene expression to read the sex chromosome karyotype, early embryos must remain gender-naïve; our findings show that the mir-35 family microRNAs act in the early embryo to function as a developmental timer that preserves naïveté and prevents premature deleterious developmental decisions. PMID:28279983

Physical and Functional Interactions of Human Endogenous Retrovirus Proteins Np9 and Rec with the Promyelocytic Leukemia Zinc Finger Protein▿

PubMed Central

Denne, Miriam; Sauter, Marlies; Armbruester, Vivienne; Licht, Jonathan D.; Roemer, Klaus; Mueller-Lantzsch, Nikolaus

2007-01-01

Only few of the human endogenous retrovirus (HERV) sequences in the human genome can produce proteins. We have previously reported that (i) patients with germ cell tumors often make antibodies against proteins encoded by HERV-K elements, (ii) expression of the HERV-K rec gene in transgenic mice can interfere with germ cell development and induce carcinoma in situ, and (iii) HERV-K np9 transcript is overproduced in many tumors including breast cancers. Here we document that both Np9 and Rec physically and functionally interact with the promyelocytic leukemia zinc finger (PLZF) tumor suppressor, a transcriptional repressor and chromatin remodeler implicated in cancer and the self-renewal of spermatogonial stem cells. Interaction is mediated via two different central and C-terminal domains of Np9 and Rec and the C-terminal zinc fingers of PLZF. One major target of PLZF is the c-myc proto-oncogene. Coexpression of Np9 and Rec with PLZF abrogates the transcriptional repression of the c-myc gene promoter by PLZF and results in c-Myc overproduction, altered expression of c-Myc-regulated genes, and corresponding effects on cell proliferation and survival. Thus, the human endogenous retrovirus proteins Np9 and Rec may act oncogenically by derepressing c-myc through the inhibition of PLZF. PMID:17360752

Planarian PTEN homologs regulate stem cells and regeneration through TOR signaling.

PubMed

Oviedo, Néstor J; Pearson, Bret J; Levin, Michael; Sánchez Alvarado, Alejandro

2008-01-01

We have identified two genes, Smed-PTEN-1 and Smed-PTEN-2, capable of regulating stem cell function in the planarian Schmidtea mediterranea. Both genes encode proteins homologous to the mammalian tumor suppressor, phosphatase and tensin homolog deleted on chromosome 10 (PTEN). Inactivation of Smed-PTEN-1 and -2 by RNA interference (RNAi) in planarians disrupts regeneration, and leads to abnormal outgrowths in both cut and uncut animals followed soon after by death (lysis). The resulting phenotype is characterized by hyperproliferation of neoblasts (planarian stem cells), tissue disorganization and a significant accumulation of postmitotic cells with impaired differentiation capacity. Further analyses revealed that rapamycin selectively prevented such accumulation without affecting the normal neoblast proliferation associated with physiological turnover and regeneration. In animals in which PTEN function is abrogated, we also detected a significant increase in the number of cells expressing the planarian Akt gene homolog (Smed-Akt). However, functional abrogation of Smed-Akt in Smed-PTEN RNAi-treated animals does not prevent cell overproliferation and lethality, indicating that functional abrogation of Smed-PTEN is sufficient to induce abnormal outgrowths. Altogether, our data reveal roles for PTEN in the regulation of planarian stem cells that are strikingly conserved to mammalian models. In addition, our results implicate this protein in the control of stem cell maintenance during the regeneration of complex structures in planarians.

A Novel Method for Gene-Specific Enhancement of Protein Translation by Targeting 5’UTRs of Selected Tumor Suppressors

PubMed Central

Master, Adam; Wójcicka, Anna; Giżewska, Kamilla; Popławski, Piotr; Williams, Graham R.; Nauman, Alicja

2016-01-01

Background Translational control is a mechanism of protein synthesis regulation emerging as an important target for new therapeutics. Naturally occurring microRNAs and synthetic small inhibitory RNAs (siRNAs) are the most recognized regulatory molecules acting via RNA interference. Surprisingly, recent studies have shown that interfering RNAs may also activate gene transcription via the newly discovered phenomenon of small RNA-induced gene activation (RNAa). Thus far, the small activating RNAs (saRNAs) have only been demonstrated as promoter-specific transcriptional activators. Findings We demonstrate that oligonucleotide-based trans-acting factors can also specifically enhance gene expression at the level of protein translation by acting at sequence-specific targets within the messenger RNA 5’-untranslated region (5’UTR). We designed a set of short synthetic oligonucleotides (dGoligos), specifically targeting alternatively spliced 5’UTRs in transcripts expressed from the THRB and CDKN2A suppressor genes. The in vitro translation efficiency of reporter constructs containing alternative TRβ1 5’UTRs was increased by up to more than 55-fold following exposure to specific dGoligos. Moreover, we found that the most folded 5’UTR has higher translational regulatory potential when compared to the weakly folded TRβ1 variant. This suggests such a strategy may be especially applied to enhance translation from relatively inactive transcripts containing long 5’UTRs of complex structure. Significance This report represents the first method for gene-specific translation enhancement using selective trans-acting factors designed to target specific 5’UTR cis-acting elements. This simple strategy may be developed further to complement other available methods for gene expression regulation including gene silencing. The dGoligo-mediated translation-enhancing approach has the potential to be transferred to increase the translation efficiency of any suitable target gene and may have future application in gene therapy strategies to enhance expression of proteins including tumor suppressors. PMID:27171412

TUSC2 Immunogene Therapy Synergizes with Anti-PD-1 through Enhanced Proliferation and Infiltration of Natural Killer Cells in Syngeneic Kras-Mutant Mouse Lung Cancer Models.

PubMed

Meraz, Ismail M; Majidi, Mourad; Cao, Xiaobo; Lin, Heather; Li, Lerong; Wang, Jing; Baladandayuthapani, Veera; Rice, David; Sepesi, Boris; Ji, Lin; Roth, Jack A

2018-02-01

Expression of the multikinase inhibitor encoded by the tumor suppressor gene TUSC2 (also known as FUS1 ) is lost or decreased in non-small cell lung carcinoma (NSCLC). TUSC2 delivered systemically by nanovesicles has mediated tumor regression in clinical trials. Because of the role of TUSC2 in regulating immune cells, we assessed TUSC2 efficacy on antitumor immune responses alone and in combination with anti-PD-1 in two Kras -mutant syngeneic mouse lung cancer models. TUSC2 alone significantly reduced tumor growth and prolonged survival compared with anti-PD-1. When combined, this effect was significantly enhanced, and correlated with a pronounced increases in circulating and splenic natural killer (NK) cells and CD8 + T cells, and a decrease in regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and T-cell checkpoint receptors PD-1, CTLA-4, and TIM-3. TUSC2 combined with anti-PD-1 induced tumor infiltrating more than NK and CD8 + T cells and fewer MDSCs and Tregs than each agent alone, both in subcutaneous tumor and in lung metastases. NK-cell depletion abrogated the antitumor effect and Th1-mediated immune response of this combination, indicating that NK cells mediate TUSC2/anti-PD-1 synergy. Release of IL15 and IL18 cytokines and expression of the IL15Rα chain and IL18R1 were associated with NK-cell activation by TUSC2. Immune response-related gene expression in the tumor microenvironment was altered by combination treatment. These data provide a rationale for immunogene therapy combined with immune checkpoint blockade in the treatment of NSCLC. Cancer Immunol Res; 6(2); 163-77. ©2018 AACR . ©2018 American Association for Cancer Research.

Destabilization of MYC/MYCN by the mitochondrial inhibitors, metaiodobenzylguanidine, metformin and phenformin

PubMed Central

WANG, STEPHANIE S.; HSIAO, RUTH; LIMPAR, MARIKO M.; LOMAHAN, SARAH; TRAN, TUAN-ANH; MALONEY, NOLAN J.; IKEGAKI, NAOHIKO; TANG, XAO X.

2014-01-01

In the present study, we investigated the anticancer effects of the mitochondrial inhibitors, metaiodobenzylguanidine (MIBG), metformin and phenformin. 131I-MIBG has been used for scintigraphic detection and the targeted radiotherapy of neuroblastoma (NB), a pediatric malignancy. Non-radiolabeled MIBG has been reported to be cytotoxic to NB cells in vitro and in vivo. However, the mechanisms behind its growth suppressive effects have not yet been fully elucidated. Metformin and phenformin are diabetes medications that are being considered in anticancer therapeutics. We investigated the anticancer mechanisms of action of MIBG and metformin in NB. Our data revealed that both drugs suppressed NB cell growth and that the combination drug treatment was more potent. MIBG reduced MYCN and MYC expression in MYCN-amplified and non-MYCN-amplified NB cells in a dose- and time-dependent manner. Metformin was less effective than MIBG in destabilizing MYC/MYCN. The treatment of NB cells with metformin or MIBG resulted in an increased expression of genes encoding biomarkers for favorable outcome in NB [(ephrin (EFN)B2, EFNB3, EPH receptor B6 (EPHB6), neurotrophic tyrosine kinase, receptor, type 1 (NTRK1), CD44 and Myc-interacting zinc finger protein (MIZ-1)] and tumor suppressor genes [(early growth response 1 (EGR1), EPH receptor A2 (EPHA2), growth arrest and DNA-damage-inducible, beta (GADD45B), neuregulin 1 (NRG1), TP53 apoptosis effector (PERP) and sel-1 suppressor of lin-12-like (C. elegans) (SEL1L)]. Accordingly, metformin and MIBG augmented histone H3 acetylation in these cells. Phenformin also exhibited histone modification and was more effective than metformin in destabilizing MYC/MYCN in NB cells. Our data suggest that the destabilization of MYC/MYCN by MIBG, metformin and phenformin and their effects on histone modification are important mechanisms underlying their anticancer effects. PMID:24190252

Destabilization of MYC/MYCN by the mitochondrial inhibitors, metaiodobenzylguanidine, metformin and phenformin.

PubMed

Wang, Stephanie S; Hsiao, Ruth; Limpar, Mariko M; Lomahan, Sarah; Tran, Tuan-Anh; Maloney, Nolan J; Ikegaki, Naohiko; Tang, Xao X

2014-01-01

In the present study, we investigated the anticancer effects of the mitochondrial inhibitors, metaiodobenzylguanidine (MIBG), metformin and phenformin. 131I-MIBG has been used for scintigraphic detection and the targeted radiotherapy of neuroblastoma (NB), a pediatric malignancy. Non-radiolabeled MIBG has been reported to be cytotoxic to NB cells in vitro and in vivo. However, the mechanisms behind its growth suppressive effects have not yet been fully elucidated. Metformin and phenformin are diabetes medications that are being considered in anticancer therapeutics. We investigated the anticancer mechanisms of action of MIBG and metformin in NB. Our data revealed that both drugs suppressed NB cell growth and that the combination drug treatment was more potent. MIBG reduced MYCN and MYC expression in MYCN-amplified and non-MYCN-amplified NB cells in a dose- and time-dependent manner. Metformin was less effective than MIBG in destabilizing MYC/MYCN. The treatment of NB cells with metformin or MIBG resulted in an increased expression of genes encoding biomarkers for favorable outcome in NB [(ephrin (EFN)B2, EFNB3, EPH receptor B6 (EPHB6), neurotrophic tyrosine kinase, receptor, type 1 (NTRK1), CD44 and Myc-interacting zinc finger protein (MIZ-1)] and tumor suppressor genes [(early growth response 1 (EGR1), EPH receptor A2 (EPHA2), growth arrest and DNA-damage-inducible, beta (GADD45B), neuregulin 1 (NRG1), TP53 apoptosis effector (PERP) and sel-1 suppressor of lin-12-like (C. elegans) (SEL1L)]. Accordingly, metformin and MIBG augmented histone H3 acetylation in these cells. Phenformin also exhibited histone modification and was more effective than metformin in destabilizing MYC/MYCN in NB cells. Our data suggest that the destabilization of MYC/MYCN by MIBG, metformin and phenformin and their effects on histone modification are important mechanisms underlying their anticancer effects.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

PubMed

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Deletion of Ptprd and Cdkn2a cooperate to accelerate tumorigenesis

PubMed Central

Ortiz, Berenice; White, Julie R.; Wu, Wei H.; Chan, Timothy A.

2014-01-01

PTPRD encodes the protein tyrosine phosphatase receptor type D and is frequently inactivated across many human cancers. Despite its frequent inactivation, it is unknown whether loss of PTPRD promotes tumorigenesis in vivo. PTPRD is located on chromosome 9p, as is CDKN2A, and the two loci are frequently deleted together. Here, we show that co-deletion of Ptprd and Cdkn2a cooperate to accelerate tumorigenesis. Interestingly, heterozygous loss of Ptprd was sufficient to promote tumorigenesis in our model, suggesting that Ptprd may be a haploinsufficient tumor suppressor. The loss of Ptprd resulted in changes to the tumor spectrum in mice and increased the frequency of lymphomas. In total, we reveal that Ptprd is a tumor suppressor that can promote tumorigenesis in concert with Cdkn2a loss. PMID:25138050

Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

PubMed

Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

2017-03-01

The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha-LSL transcript accumulation was also detected in leaves and floral primordia at early stages of development. These results were corroborated by qRT-PCR analyses that evidenced high levels of Ha-LSL transcripts in very young leaves and disc flowers, suggesting a role of Ha-LSL for the early outgrowth of lateral primordia.

Global profiling of alternative RNA splicing events provides insights into molecular differences between various types of hepatocellular carcinoma.

PubMed

Tremblay, Marie-Pier; Armero, Victoria E S; Allaire, Andréa; Boudreault, Simon; Martenon-Brodeur, Camille; Durand, Mathieu; Lapointe, Elvy; Thibault, Philippe; Tremblay-Létourneau, Maude; Perreault, Jean-Pierre; Scott, Michelle S; Bisaillon, Martin

2016-08-26

Dysregulations in alternative splicing (AS) patterns have been associated with many human diseases including cancer. In the present study, alterations to the global RNA splicing landscape of cellular genes were investigated in a large-scale screen from 377 liver tissue samples using high-throughput RNA sequencing data. Our study identifies modifications in the AS patterns of transcripts encoded by more than 2500 genes such as tumor suppressor genes, transcription factors, and kinases. These findings provide insights into the molecular differences between various types of hepatocellular carcinoma (HCC). Our analysis allowed the identification of 761 unique transcripts for which AS is misregulated in HBV-associated HCC, while 68 are unique to HCV-associated HCC, 54 to HBV&HCV-associated HCC, and 299 to virus-free HCC. Moreover, we demonstrate that the expression pattern of the RNA splicing factor hnRNPC in HCC tissues significantly correlates with patient survival. We also show that the expression of the HBx protein from HBV leads to modifications in the AS profiles of cellular genes. Finally, using RNA interference and a reverse transcription-PCR screening platform, we examined the implications of cellular proteins involved in the splicing of transcripts involved in apoptosis and demonstrate the potential contribution of these proteins in AS control. This study provides the first comprehensive portrait of global changes in the RNA splicing signatures that occur in hepatocellular carcinoma. Moreover, these data allowed us to identify unique signatures of genes for which AS is misregulated in the different types of HCC.

Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

PubMed Central

2014-01-01

Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

New genetic variants of LATS1 detected in urinary bladder and colon cancer.

PubMed

Saadeldin, Mona K; Shawer, Heba; Mostafa, Ahmed; Kassem, Neemat M; Amleh, Asma; Siam, Rania

2014-01-01

LATS1, the large tumor suppressor 1 gene, encodes for a serine/threonine kinase protein and is implicated in cell cycle progression. LATS1 is down-regulated in various human cancers, such as breast cancer, and astrocytoma. Point mutations in LATS1 were reported in human sarcomas. Additionally, loss of heterozygosity of LATS1 chromosomal region predisposes to breast, ovarian, and cervical tumors. In the current study, we investigated LATS1 genetic variations including single nucleotide polymorphisms (SNPs), in 28 Egyptian patients with either urinary bladder or colon cancers. The LATS1 gene was amplified and sequenced and the expression of LATS1 at the RNA level was assessed in 12 urinary bladder cancer samples. We report, the identification of a total of 29 variants including previously identified SNPs within LATS1 coding and non-coding sequences. A total of 18 variants were novel. Majority of the novel variants, 13, were mapped to intronic sequences and un-translated regions of the gene. Four of the five novel variants located in the coding region of the gene, represented missense mutations within the serine/threonine kinase catalytic domain. Interestingly, LATS1 RNA steady state levels was lost in urinary bladder cancerous tissue harboring four specific SNPs (16045 + 41736 + 34614 + 56177) positioned in the 5'UTR, intron 6, and two silent mutations within exon 4 and exon 8, respectively. This study identifies novel single-base-sequence alterations in the LATS1 gene. These newly identified variants could potentially be used as novel diagnostic or prognostic tools in cancer.

The RasGAP Gene, RASAL2, is a Tumor and Metastasis Suppressor

PubMed Central

McLaughlin, Sara Koenig; Olsen, Sarah Naomi; Dake, Benjamin; De Raedt, Thomas; Lim, Elgene; Bronson, Roderick Terry; Beroukhim, Rameen; Polyak, Kornelia; Brown, Myles; Kuperwasser, Charlotte; Cichowski, Karen

2013-01-01

SUMMARY RAS genes are commonly mutated in cancer; however, RAS mutations are rare in breast cancer, despite the fact that Ras and ERK are frequently hyperactivated. Here we report that the RasGAP gene, RASAL2, functions as a tumor and metastasis suppressor. RASAL2 is mutated or suppressed in human breast cancer and RASAL2 ablation promotes tumor growth, progression, and metastasis in mouse models. In human breast cancer RASAL2-loss is associated with metastatic disease, low RASAL2 levels correlate with recurrence of luminal B tumors, and RASAL2 ablation promotes metastasis of luminal mouse tumors. Additional data reveal a broader role for RASAL2 inactivation in other tumor-types. These studies highlight the expanding role of RasGAPs and reveal an alternative mechanism of activating Ras in cancer. PMID:24029233

The Chromatin Remodeler SPLAYED Negatively Regulates SNC1-Mediated Immunity.

PubMed

Johnson, Kaeli C M; Xia, Shitou; Feng, Xiaoqi; Li, Xin

2015-08-01

SNC1 (SUPPRESSOR OF NPR1, CONSTITUTIVE 1) is one of a suite of intracellular Arabidopsis NOD-like receptor (NLR) proteins which, upon activation, result in the induction of defense responses. However, the molecular mechanisms underlying NLR activation and the subsequent provocation of immune responses are only partially characterized. To identify negative regulators of NLR-mediated immunity, a forward genetic screen was undertaken to search for enhancers of the dwarf, autoimmune gain-of-function snc1 mutant. To avoid lethality resulting from severe dwarfism, the screen was conducted using mos4 (modifier of snc1, 4) snc1 plants, which display wild-type-like morphology and resistance. M2 progeny were screened for mutant, snc1-enhancing (muse) mutants displaying a reversion to snc1-like phenotypes. The muse9 mos4 snc1 triple mutant was found to exhibit dwarf morphology, elevated expression of the pPR2-GUS defense marker reporter gene and enhanced resistance to the oomycete pathogen Hyaloperonospora arabidopsidis Noco2. Via map-based cloning and Illumina sequencing, it was determined that the muse9 mutation is in the gene encoding the SWI/SNF chromatin remodeler SYD (SPLAYED), and was thus renamed syd-10. The syd-10 single mutant has no observable alteration from wild-type-like resistance, although the syd-4 T-DNA insertion allele displays enhanced resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326. Transcription of SNC1 is increased in both syd-4 and syd-10. These data suggest that SYD plays a subtle, specific role in the regulation of SNC1 expression and SNC1-mediated immunity. SYD may work with other proteins at the chromatin level to repress SNC1 transcription; such regulation is important for fine-tuning the expression of NLR-encoding genes to prevent unpropitious autoimmunity. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Cwf16p Associating with the Nineteen Complex Ensures Ordered Exon Joining in Constitutive Pre-mRNA Splicing in Fission Yeast

PubMed Central

Sasaki-Haraguchi, Noriko; Ikuyama, Takeshi; Yoshii, Shogo; Takeuchi-Andoh, Tomoko; Frendewey, David; Tani, Tokio

2015-01-01

Exons are ligated in an ordered manner without the skipping of exons in the constitutive splicing of pre-mRNAs with multiple introns. To identify factors ensuring ordered exon joining in constitutive pre-mRNA splicing, we previously screened for exon skipping mutants in Schizosaccharomyces pombe using a reporter plasmid, and characterized three exon skipping mutants named ods1 (ordered splicing 1), ods2, and ods3, the responsible genes of which encode Prp2/U2AF59, U2AF23, and SF1, respectively. They form an SF1-U2AF59-U2AF23 complex involved in recognition of the branch and 3′ splice sites in pre-mRNA. In the present study, we identified a fourth ods mutant, ods4, which was isolated in an exon-skipping screen. The ods4 + gene encodes Cwf16p, which interacts with the NineTeen Complex (NTC), a complex thought to be involved in the first catalytic step of the splicing reaction. We isolated two multi-copy suppressors for the ods4-1 mutation, Srp2p, an SR protein essential for pre-mRNA splicing, and Tif213p, a translation initiation factor, in S. pombe. The overexpression of Srp2p suppressed the exon-skipping phenotype of all ods mutants, whereas Tif213p suppressed only ods4-1, which has a mutation in the translational start codon of the cwf16 gene. We also showed that the decrease in the transcriptional elongation rate induced by drug treatment suppressed exon skipping in ods4-1. We propose that Cwf16p/NTC participates in the early recognition of the branch and 3′ splice sites and cooperates with the SF1-U2AF59-U2AF23 complex to maintain ordered exon joining. PMID:26302002

PsRBR1 encodes a pea retinoblastoma-related protein that is phosphorylated in axillary buds during dormancy-to-growth transition

PubMed Central

Shimizu-Sato, Sae; Ike, Yoko

2007-01-01

In intact plants, cells in axillary buds are arrested at the G1 phase of the cell cycle during dormancy. In mammalian cells, the cell cycle is suppressed at the G1 phase by the activities of retinoblastoma tumor suppressor gene (RB) family proteins, depending on their phosphorylation state. Here, we report the isolation of a pea cDNA clone encoding an RB-related protein (PsRBR1, Accession No. AB012024) with a high degree of amino acid conservation in comparison with RB family proteins. PsRBR1 protein was detected as two polypeptides using an anti-PsRBR1 antibody in dormant axillary buds, whereas it was detected as three polypeptides, which were the same two polypeptides and another larger polypeptide 2 h after terminal decapitation. Both in vitro-synthesized PsPRB1 protein and lambda protein phosphatase-treated PsRBR1 protein corresponded to the smallest polypeptide detected by anti-PsRBR1 antibody, suggesting that the three polypeptides correspond to non-phosphorylated form of PsRBR1 protein, and lower- and higher-molecular mass forms of phosphorylated PsRBR1 protein. Furthermore, in vivo labeling with [32P]-inorganic phosphate indicated that PsRBR1 protein was more phosphorylated before mRNA accumulation of cell cycle regulatory genes such as PCNA. Together these findings suggest that dormancy-to-growth transition in pea axillary buds is regulated by molecular mechanisms of cell cycle control similar to those in mammals, and that the PsRBR1 protein has an important role in suppressing the cell cycle during dormancy in axillary buds. PMID:18034314

Characterization of a highly conserved human homolog to the chicken neural cell surface protein Bravo/Nr-CAM that maps to chromosome band 7q31

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lane, R.P.; Vielmetter, J.; Dreyer, W.J.

1996-08-01

The neuronal cell adhesion molecule Bravo/Nr-CAM is a cell surface protein of the immunoglobulin (Ig) superfamily and is closely related to the L1/NgCAM and neurofascin molecules, all of which contain six immunoglobulin domains, five fibronectin repeats, a transmembrane region, and an intracellular domain. Chicken Bravo/Nr-CAM has been shown to interact with other cell surface molecules of the Ig superfamily and has been implicated in specific pathfinding roles of axonal growth cones in the developing nervous system. We now report the characterization of cDNA clones encoding the human Bravo/Nr-CAM protein, which, like its chicken homolog, is composed of six V-like Igmore » domains and five fibronectin type III repeats. The human Bravo/Nr-CAM homolog also contains a transmembrane and intracellular domain, both of which are 100% conserved at the amino acid level compared to its chicken homolog. Overall, the human Bravo/Nr-CAM homolog is 82% identical to the chicken Bravo/Nr-CAM amino acid sequence. Independent cDNAs encoding four different isoforms were also identified, all of which contain alternatively spliced variants around the fifth fibronectin type III repeat, including one isoform that had been previously identified for chicken Bravo/Nr-CAM. Northern blot analysis reveals one mRNA species of approximately 7.0 kb in adult human brain tissue. Fluorescence in situ hybridization maps the gene for human Bravo/Nr-CAM to human chromosome 7q31.1-q31.2. This chromosomal locus has been previously identified as containing a tumore suppressor candidate gene commonly deleted in certain human cancer tissues. 38 refs., 5 figs.« less

A complex interaction of imprinted and maternal-effect genes modifies sex determination in Odd Sex (Ods) mice.

PubMed

Poirier, Christophe; Qin, Yangjun; Adams, Carolyn P; Anaya, Yanett; Singer, Jonathan B; Hill, Annie E; Lander, Eric S; Nadeau, Joseph H; Bishop, Colin E

2004-11-01

The transgenic insertional mouse mutation Odd Sex (Ods) represents a model for the long-range regulation of Sox9. The mutation causes complete female-to-male sex reversal by inducing a male-specific expression pattern of Sox9 in XX Ods/+ embryonic gonads. We previously described an A/J strain-specific suppressor of Ods termed Odsm1(A). Here we show that phenotypic sex depends on a complex interaction between the suppressor and the transgene. Suppression can be achieved only if the transgene is transmitted paternally. In addition, the suppressor itself exhibits a maternal effect, suggesting that it may act on chromatin in the early embryo.

A Complex Interaction of Imprinted and Maternal-Effect Genes Modifies Sex Determination in Odd Sex (Ods) Mice

PubMed Central

Poirier, Christophe; Qin, Yangjun; Adams, Carolyn P.; Anaya, Yanett; Singer, Jonathan B.; Hill, Annie E.; Lander, Eric S.; Nadeau, Joseph H.; Bishop, Colin E.

2004-01-01

The transgenic insertional mouse mutation Odd Sex (Ods) represents a model for the long-range regulation of Sox9. The mutation causes complete female-to-male sex reversal by inducing a male-specific expression pattern of Sox9 in XX Ods/+ embryonic gonads. We previously described an A/J strain-specific suppressor of Ods termed Odsm1A. Here we show that phenotypic sex depends on a complex interaction between the suppressor and the transgene. Suppression can be achieved only if the transgene is transmitted paternally. In addition, the suppressor itself exhibits a maternal effect, suggesting that it may act on chromatin in the early embryo. PMID:15579706

Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

PubMed

de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

2016-01-01

Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Identification of new adventitious rooting mutants amongst suppressors of the Arabidopsis thaliana superroot2 mutation.

PubMed

Pacurar, Daniel Ioan; Pacurar, Monica Lacramioara; Bussell, John Desmond; Schwambach, Joseli; Pop, Tiberia Ioana; Kowalczyk, Mariusz; Gutierrez, Laurent; Cavel, Emilie; Chaabouni, Salma; Ljung, Karin; Fett-Neto, Arthur Germano; Pamfil, Doru; Bellini, Catherine

2014-04-01

The plant hormone auxin plays a central role in adventitious rooting and is routinely used with many economically important, vegetatively propagated plant species to promote adventitious root initiation and development on cuttings. Nevertheless the molecular mechanisms through which it acts are only starting to emerge. The Arabidopsis superroot2-1 (sur2-1) mutant overproduces auxin and, as a consequence, develops excessive adventitious roots in the hypocotyl. In order to increase the knowledge of adventitious rooting and of auxin signalling pathways and crosstalk, this study performed a screen for suppressors of superroot2-1 phenotype. These suppressors provide a new resource for discovery of genetic players involved in auxin signalling pathways or at the crosstalk of auxin and other hormones or environmental signals. This study reports the identification and characterization of 26 sur2-1 suppressor mutants, several of which were identified as mutations in candidate genes involved in either auxin biosynthesis or signalling. In addition to confirming the role of auxin as a central regulator of adventitious rooting, superroot2 suppressors indicated possible crosstalk with ethylene signalling in this process.

Modulation and Expression of Tumor Suppressor Genes by Environmental Agents.

DTIC Science & Technology

1996-12-01

were developed to evaluate alterations in the retinoblastoma gene in retinoblastoma and hepatocarcinomas following induction with known environmental...Tumors (3) Hepatocarcinomas (4) MRb-1 + + + + MRb-2 + + MRb-3 + + + + MRb-4 + + MRb-5 + + MRb-6 + + + + ** Studies in progress Figure 25. Screening of

Therapeutic advances for the tumors associated with neurofibromatosis type 1, type 2, and schwannomatosis

PubMed Central

Blakeley, Jaishri O.; Plotkin, Scott R.

2016-01-01

Neurofibromatosis type 1 (NF1), neurofibromatosis type 2 (NF2), and schwannomatosis (SWN) are tumor-suppressor syndromes. Each syndrome is an orphan disease; however, the tumors that arise within them represent the most common tumors of the nervous system worldwide. Systematic investigation of the pathways impacted by the loss of function of neurofibromin (encoded by NF1) and merlin (encoded by NF2) have led to therapeutic advances for patients with NF1 and NF2. In the syndrome of SWN, the genetic landscape is more complex, with 2 known causative genes (SMARCB1 and LZTR1) accounting for up to 50% of familial SWN patients. The understanding of the molecular underpinnings of these syndromes is developing rapidly and offers more therapeutic options for the patients. In addition, common sporadic cancers harbor somatic alterations in NF1 (ie, glioblastoma, breast cancer, melanoma), NF2 (ie, meningioma, mesothelioma) and SMARCB1 (ie, atypical teratoid/rhabdoid tumors) such that advances in management of syndromic tumors may benefit patients both with and without germline mutations. In this review, we discuss the clinical and genetic features of NF1, NF2 and SWN, the therapeutic advances for the tumors that arise within these syndromes and the interaction between these rare tumor syndromes and the common tumors that share these mutations. PMID:26851632

BCL11B is frequently downregulated in HTLV-1-infected T-cells through Tax-mediated proteasomal degradation.

PubMed

Permatasari, Happy Kurnia; Nakahata, Shingo; Ichikawa, Tomonaga; Morishita, Kazuhiro

2017-08-26

Human T-cell leukemia virus type 1 (HTLV-1) is a causative agent of adult T-cell leukemia-lymphoma (ATLL). The HTLV-1-encoded protein Tax plays important roles in the proliferation of HTLV-1-infected T-cells by affecting cellular proteins. In this study, we showed that Tax transcriptionally and post-transcriptionally downregulates the expression of the tumor suppressor gene B-cell leukemia/lymphoma 11B (BCL11B), which encodes a lymphoid-related transcription factor. BCL11B expression was downregulated in HTLV-1-infected T-cell lines at the mRNA and protein levels, and forced expression of BCL11B suppressed the proliferation of these cells. The proteasomal inhibitor MG132 increased BCL11B expression in HTLV-1-infected cell lines, and colocalization of Tax with BCL11B was detected in the cytoplasm of HTLV-1-infected T-cells following MG132 treatment. shRNA knock-down of Tax expression also increased the expression of BCL11B in HTLV-1-infected cells. Moreover, we found that Tax physically binds to BCL11B protein and induces the polyubiquitination of BCL11B and proteasome-dependent degradation of BCL11B. Thus, inactivation of BCL11B by Tax protein may play an important role in the Tax-mediated leukemogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

A Genetic Analysis of the Suppressor 2 of Zeste Complex of Drosophila Melanogaster

PubMed Central

Wu, C. T.; Howe, M.

1995-01-01

The zeste(1) (z(1)) mutation of Drosophila melanogaster produces a mutant yellow eye color instead of the wild-type red. Genetic and molecular data suggest that z(1) achieves this change by altering expression of the wild-type white gene in a manner that exhibits transvection effects. There exist suppressor and enhancer mutations that modify the z(1) eye color, and this paper summarizes our studies of those belonging to the Suppressor 2 of zeste complex [Su(z)2-C]. The Su(z)2-C consists of at least three subregions called Psc (Posterior sex combs), Su(z)2 and Su(z)2D (Distal). The products of these subregions are proposed to act at the level of chromatin. Complementation analyses predict that the products are functionally similar and interacting. The alleles of Psc define two overlapping phenotypic classes, the hopeful and hapless. The distinctions between these two classes and the intragenic complementation seen among some of the Psc alleles are consistent with a multidomain structure for the product of Psc. Psc is a member of the homeotic Polycomb group of genes. A general discussion of the Polycomb and trithorax group of genes, position-effect variegation, transvection, chromosome pairing and chromatin structure is presented. PMID:7635282

Genetic Polymorphisms of Metastasis Suppressor Gene NME1 and Breast Cancer Survival

PubMed Central

Qu, Shimian; Long, Jirong; Cai, Qiuyin; Shu, Xiao-Ou; Cai, Hui; Gao, Yu-Tang; Zheng, Wei

2009-01-01

Purpose Ample evidence supports an important role of tumor metastasis suppressor genes in cancer metastatic processes. We evaluated the association of genetic polymorphisms of tumor metastasis suppressor gene NME1 with breast cancer prognosis in a follow-up study of patients with primary breast cancer and further investigated the functions of these polymorphisms. Experimental Design NME1 genotypes were analyzed in a cohort of 1134 breast cancer patients recruited as part of the Shanghai Breast Cancer Study who were followed for a median of 7.1 years. In vitro biochemical analyses were carried out to examine the function of NME1 gene polymorphisms. Results Single nucleotide polymorphisms (SNPs) in the promoter region of the NME1 gene were found to be associated with breast cancer prognosis. Patients carrying the C allele in rs16949649 were associated with higher breast cancer-specific mortality (HR =1.4, 95% CI =1.1–1.9) as compared to those carrying the wild-type allele, and the association was more evident in patients with an early stage cancer (HR=1.7, 95% CI =1.2–2.5). SNP rs2302254 was also associated with breast cancer prognosis, and the association was statistically significant for the risk of breast cancer relapse, metastasis, and death (HR=1.3, 95% CI, 1.0–1.6). In vitro biochemical analyses showed that minor alleles in rs2302254 and rs3760468, which is in strong linkage disequilibrium with rs16949646, altered nuclear proteins binding capacity and reduced NME1 promoter activity, supporting the results from an association study of these SNPs with breast cancer survival. Conclusion Promoter polymorphisms in the NME1 gene may alter its expression and influence breast cancer survival. PMID:18676749

ARLTS1 and Prostate Cancer Risk - Analysis of Expression and Regulation

PubMed Central

Siltanen, Sanna; Fischer, Daniel; Rantapero, Tommi; Laitinen, Virpi; Mpindi, John Patrick; Kallioniemi, Olli; Wahlfors, Tiina; Schleutker, Johanna

2013-01-01

Prostate cancer (PCa) is a heterogeneous trait for which several susceptibility loci have been implicated by genome-wide linkage and association studies. The genomic region 13q14 is frequently deleted in tumour tissues of both sporadic and familial PCa patients and is consequently recognised as a possible locus of tumour suppressor gene(s). Deletions of this region have been found in many other cancers. Recently, we showed that homozygous carriers for the T442C variant of the ARLTS1 gene (ADP-ribosylation factor-like tumour suppressor protein 1 or ARL11, located at 13q14) are associated with an increased risk for both unselected and familial PCa. Furthermore, the variant T442C was observed in greater frequency among malignant tissue samples, PCa cell lines and xenografts, supporting its role in PCa tumourigenesis. In this study, 84 PCa cases and 15 controls were analysed for ARLTS1 expression status in blood-derived RNA. A statistically significant (p = 0.0037) decrease of ARLTS1 expression in PCa cases was detected. Regulation of ARLTS1 expression was analysed with eQTL (expression quantitative trait loci) methods. Altogether fourteen significant cis-eQTLs affecting the ARLTS1 expression level were found. In addition, epistatic interactions of ARLTS1 genomic variants with genes involved in immune system processes were predicted with the MDR program. In conclusion, this study further supports the role of ARLTS1 as a tumour suppressor gene and reveals that the expression is regulated through variants localised in regulatory regions. PMID:23940804

Differential expression of alternatively spliced transcripts related to energy metabolism in colorectal cancer.

PubMed

Snezhkina, Anastasiya Vladimirovna; Krasnov, George Sergeevich; Zaretsky, Andrew Rostislavovich; Zhavoronkov, Alex; Nyushko, Kirill Mikhailovich; Moskalev, Alexey Alexandrovich; Karpova, Irina Yurievna; Afremova, Anastasiya Isaevna; Lipatova, Anastasiya Valerievna; Kochetkov, Dmitriy Vladimitovich; Fedorova, Maria Sergeena; Volchenko, Nadezhda Nikolaevna; Sadritdinova, Asiya Fayazovna; Melnikova, Nataliya Vladimirovna; Sidorov, Dmitry Vladimirovich; Popov, Anatoly Yurievich; Kalinin, Dmitry Valerievich; Kaprin, Andrey Dmitrievich; Alekseev, Boris Yakovlevich; Dmitriev, Alexey Alexandrovich; Kudryavtseva, Anna Viktorovna

2016-12-28

Colorectal cancer (CRC) is one of the most common malignant tumors worldwide. CRC molecular pathogenesis is heterogeneous and may be followed by mutations in oncogenes and tumor suppressor genes, chromosomal and microsatellite instability, alternative splicing alterations, hypermethylation of CpG islands, oxidative stress, impairment of different signaling pathways and energy metabolism. In the present work, we have studied the alterations of alternative splicing patterns of genes related to energy metabolism in CRC. Using CrossHub software, we analyzed The Cancer Genome Atlas (TCGA) RNA-Seq datasets derived from colon tumor and matched normal tissues. The expression of 1014 alternative mRNA isoforms involved in cell energy metabolism was examined. We found 7 genes with differentially expressed alternative transcripts whereas overall expression of these genes was not significantly altered in CRC. A set of 8 differentially expressed transcripts of interest has been validated by qPCR. These eight isoforms encoded by OGDH, COL6A3, ICAM1, PHPT1, PPP2R5D, SLC29A1, and TRIB3 genes were up-regulated in colorectal tumors, and this is in concordance with the bioinformatics data. The alternative transcript NM_057167 of COL6A3 was also strongly up-regulated in breast, lung, prostate, and kidney tumors. Alternative transcript of SLC29A1 (NM_001078177) was up-regulated only in CRC samples, but not in the other tested tumor types. We identified tumor-specific expression of alternative spliced transcripts of seven genes involved in energy metabolism in CRC. Our results bring new knowledge on alternative splicing in colorectal cancer and suggest a set of mRNA isoforms that could be used for cancer diagnosis and development of treatment methods.

Liver tumor formation by a mutant retinoblastoma protein in the transgenic mice is caused by an upregulation of c-Myc target genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat

2012-01-06

Highlights: Black-Right-Pointing-Pointer Fifty percent of the mutant Rb transgenic mice produced liver tumors. Black-Right-Pointing-Pointer In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. Black-Right-Pointing-Pointer No increase in expression of the Myc-target genes was observed in the non-tumorous liver. Black-Right-Pointing-Pointer Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, wemore » generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with {approx}50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.« less

Small Molecule Suppressors of Drosophila Kinesin Deficiency Rescue Motor Axon Development in a Zebrafish Model of Spinal Muscular Atrophy

PubMed Central

Gassman, Andrew; Hao, Le T.; Bhoite, Leena; Bradford, Chad L.; Chien, Chi-Bin; Beattie, Christine E.; Manfredi, John P.

2013-01-01

Proximal spinal muscular atrophy (SMA) is the most common inherited motor neuropathy and the leading hereditary cause of infant mortality. Currently there is no effective treatment for the disease, reflecting a need for pharmacologic interventions that restore performance of dysfunctional motor neurons or suppress the consequences of their dysfunction. In a series of assays relevant to motor neuron biology, we explored the activities of a collection of tetrahydroindoles that were reported to alter the metabolism of amyloid precursor protein (APP). In Drosophila larvae the compounds suppressed aberrant larval locomotion due to mutations in the Khc and Klc genes, which respectively encode the heavy and light chains of kinesin-1. A representative compound of this class also suppressed the appearance of axonal swellings (alternatively termed axonal spheroids or neuritic beads) in the segmental nerves of the kinesin-deficient Drosophila larvae. Given the importance of kinesin-dependent transport for extension and maintenance of axons and their growth cones, three members of the class were tested for neurotrophic effects on isolated rat spinal motor neurons. Each compound stimulated neurite outgrowth. In addition, consistent with SMA being an axonopathy of motor neurons, the three axonotrophic compounds rescued motor axon development in a zebrafish model of SMA. The results introduce a collection of small molecules as pharmacologic suppressors of SMA-associated phenotypes and nominate specific members of the collection for development as candidate SMA therapeutics. More generally, the results reinforce the perception of SMA as an axonopathy and suggest novel approaches to treating the disease. PMID:24023935

Adenovirus Small E1A Employs the Lysine Acetylases p300/CBP and Tumor Suppressor Rb to Repress Select Host Genes and Promote Productive Virus Infection

PubMed Central

Ferrari, Roberto; Gou, Dawei; Jawdekar, Gauri; Johnson, Sarah A.; Nava, Miguel; Su, Trent; Yousef, Ahmed F.; Zemke, Nathan R.; Pellegrini, Matteo; Kurdistani, Siavash K.; Berk, Arnold J.

2015-01-01

SUMMARY Oncogenic transformation by adenovirus small e1a depends on simultaneous interactions with the host lysine acetylases p300/CBP and the tumor suppressor RB. How these interactions influence cellular gene expression remains unclear. We find that e1a displaces RBs from E2F transcription factors and promotes p300 acetylation of RB1 K873/K874 to lock it into a repressing conformation that interacts with repressive chromatin-modifying enzymes. These repressing p300-e1a-RB1 complexes specifically interact with host genes that have unusually high p300 association within the gene body. The TGFβ-, TNF-, and interleukin-signaling pathway components are enriched among such p300-targeted genes. The p300-e1a-RB1 complex condenses chromatin in a manner dependent on HDAC activity, p300 lysine acetylase activity, the p300 bromodomain, and RB K873/K874 and e1a K239 acetylation to repress host genes that would otherwise inhibit productive virus infection. Thus, adenovirus employs e1a to repress host genes that interfere with viral replication. PMID:25525796

Identical mutations of the p53 tumor suppressor gene in the gliomatous and the sarcomatous components of gliosarcomas suggest a common origin from glial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biernat, W.; Aguzzi, A.; Sure, U.

Gliosarcomas are morphologically heterogeneous tumors of the central nervous system composed of gliomatous and sarcomatous components. The histogenesis of the latter is still a matter of debate. As mutations of the p53 tumor suppressor gene represent an early event in the development of gliomas, we attempted to determine whether both components of gliosarcomas share identical alterations of the p53 gene. Using single-strand conformation analysis (SSCA) and direct DNA sequencing of the p53 gene, we analyzed dissected gliomatous and sarcomatous parts of 12 formalin-fixed, paraffin-embedded gliosarcomas. The two tumors that contained a p53 alteration were found to carry the identical mutationmore » (exon 5; codon 151, CCC {r_arrow} TCC; codon 173, GTG {r_arrow} GTA) in the gliomatous and the sarcomatous components. These findings suggest a common origin of the two cellular components from neoplastic glial cells. 37 refs., 3 figs., 1 tab.« less