Identification of Two Candidate Tumor Suppressor Genes on Chromosome 17p13.3: Assessment of Their Roles in Breast and Ovarian Carcinogenesis

DTIC Science & Technology

1999-07-01

but is generally at an advanced stage at the time of detection. Both diseases are controlled by multiple genetic defects, suggesting the involvement of...Functional characterization of OVCA1, a putative tumor suppressor. American Society of Human Genetics , submitted, 1999. Prowse, A.H., Bruening, W...Godwin, A.K. OVCA1, and novel tumor suppressor, is aberrantly expressed in ovarian carcinomas. American Society of Human Genetics , submitted, 1999

BCR expression is decreased in meningiomas showing loss of heterozygosity of 22q within a new minimal deletion region.

PubMed

Wozniak, K; Piaskowski, S; Gresner, S M; Golanska, E; Bieniek, E; Bigoszewska, K; Sikorska, B; Szybka, M; Kulczycka-Wojdala, D; Zakrzewska, M; Zawlik, I; Papierz, W; Stawski, R; Jaskolski, D J; Och, W; Sieruta, M; Liberski, P P; Rieske, P

2008-05-01

Neurofibromin 2 (NF2), located on chromosome arm 22q, has been established as a tumor suppressor gene involved in meningioma pathogenesis. In our study, we investigated 149 meningiomas to determine whether there are additional tumor suppressor genes localized on chromosome 22q, apart from NF2, that might be involved in meningioma pathogenesis. The LOH analysis on chromosome 22q identified two regions of deletion: the first one, which is limited to the NF2 gene locus, and the second one, which is outside this location. The new minimal deletion region (MDR) included the following genes: BCR (breakpoint cluster region), RAB36 (a member of RAS oncogene family), GNAZ [guanine nucleotide binding protein (G protein), alpha-z polypeptide], and RTDR1 (rhabdoid tumor deletion region gene 1). The expression levels of all these genes, including NF2, were subsequently analyzed by quantitative real-time polymerase chain reaction. We observed a significantly lowered expression level of NF2 in meningiomas with 22q loss of heterozygosity (LOH) within NF2 region compared to the one in meningiomas with 22q retention of heterozygosity (ROH, P<0.05). Similarly, BCR showed a significantly lowered expression in meningiomas with 22q LOH within the new MDR compared to cases with 22q ROH (P<0.05). Our data, together with the already published information considering BCR function suggest that BCR can be considered as a candidate tumor suppressor gene localized on chromosome 22q which may be involved in meningioma pathogenesis.

BRG1 and LKB1: tales of two tumor suppressor genes on chromosome 19p and lung cancer.

PubMed

Rodriguez-Nieto, Salvador; Sanchez-Cespedes, Montse

2009-04-01

Losses of heterozygosity (LOH) of the short arm of chromosome 19 are frequent in lung cancer, suggesting that one or more tumor suppressor genes are present in this region. The LKB1 gene, also called STK11, is somatically inactivated through point mutations and large deletions in lung tumors, demonstrating that LKB1 is a target of the LOH of this chromosomal arm. Data from several independent groups have provided information about the profiles of lung tumors with LKB1 inactivation and it is generally agreed that this alteration strongly predominates in non-small cell lung cancer, in particular adenocarcinomas, in smokers. The LKB1 protein has serine-threonine kinase activity and is involved in the regulation of the cell energetic checkpoint through the phosphorylation and activation of adenosine monophosphate-dependent kinase (AMPK). LKB1 is also involved in other processes such as cell polarization, probably through substrates other than AMPK. Interestingly, another gene on chromosome 19p, BRG1, encoding a component of the SWI/SNF chromatin-remodeling complex, has emerged as a tumor suppressor gene that is altered in lung tumors. Similar to LKB1, BRG1 is somatically inactivated by point mutations or large deletions in lung tumors featuring LOH of chromosome 19p. These observations suggest an important role for BRG1 in lung cancer and highlight the need to further our understanding of the function of Brahma/SWI2-related gene 1 (BRG1) in cancer. Finally, simultaneous mutations at LKB1 and BRG1 are common in lung cancer cells, which exemplifies how a single event, LOH of chromosome 19p in this instance, targets two different tumor suppressors.

Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer.

PubMed

Mlakar, Vid; Berginc, Gasper; Volavsek, Metka; Stor, Zdravko; Rems, Miran; Glavac, Damjan

2009-08-13

Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC), it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin.

Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer

PubMed Central

2009-01-01

Background Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC), it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. Methods We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. Results We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Conclusion Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin. PMID:19678923

New Late Gene, dar, Involved in DNA Replication of Bacteriophage T4 I. Isolation, Characterization, and Genetic Location.

PubMed

Wu, J R; Yeh, Y C

1975-05-01

Suppressors of gene 59-defective mutants were isolated by screening spontaneous, temperature-sensitive (ts) revertants of the amber mutant, amC5, in gene 59. Six ts revertants were isolated. No gene 59-defective ts recombinant was obtained by crossing each ts revertant with the wild type, T4D. However, suppressors of gene 59-defective mutants were obtained from two of these ts revertants. These suppressor mutants are referred to as dar (DNA arrested restoration). dar mutants specifically restored the abnormalities, both in DNA synthesis and burst size, caused by gene 59-defective mutants to normal levels. It is unlikely that dar mutants are nonsense suppressors since theý failed to suppress amber mutations in 11 other genes investigated. The genetic expression of dar is controlled by gene 55; therefore, dar is a late gene. The genetic location of dar has been mapped between genes 24 and 25, a region contiguous to late genes. dar appears to be another nonessential gene of T4 since burst sizes of dar were almost identical to those of the wild type. Mutations in dar did not affect genetic recombination and repair of UV-damaged DNA, but caused a sensitivity to hydroxyurea in progeny formation. The effect of the dar mutation on host DNA degradation cannot account for its hydroxyurea sensitivity. dar mutant alleles were recessive to the wild-type allele as judged by restoration of arrested DNA synthesis. The possible mechanisms for the suppression of defects in gene 59 are discussed.

Frameshift Suppression in SACCHAROMYCES CEREVISIAE VI. Complete Genetic Map of Twenty-Five Suppressor Genes

PubMed Central

Gaber, Richard F.; Mathison, Lorilee; Edelman, Irv; Culbertson, Michael R.

1983-01-01

Five previously unmapped frameshift suppressor genes have been located on the yeast genetic map. In addition, we have further characterized the map positions of two suppressors whose approximate locations were determined in an earlier study. These results represent the completion of genetic mapping studies on all 25 of the known frameshift suppressor genes in yeast.—The approximate location of each suppressor gene was initially determined through the use of a set of mapping strains containing 61 signal markers distributed throughout the yeast genome. Standard meiotic linkage was assayed in crosses between strains carrying the suppressors and the mapping strains. Subsequent to these approximate linkage determinations, each suppressor gene was more precisely located in multi-point crosses. The implications of these mapping results for the genomic distribution of frameshift suppressor genes, which include both glycine and proline tRNA genes, are discussed. PMID:17246112

Gastrin-releasing peptide-induced down-regulation of tumor suppressor protein PTEN (phosphatase and tensin homolog deleted on chromosome ten) in neuroblastomas.

PubMed

Qiao, Jingbo; Kang, Junghee; Cree, Jeremy; Evers, B Mark; Chung, Dai H

2005-05-01

To evaluate whether aggressive, undifferentiated neuroblastomas express tumor suppressor protein PTEN (phosphatase and tensin homolog deleted on chromosome ten) and to examine the effects of gastrin-releasing peptide (GRP) on PTEN gene and protein expression. We have previously shown that neuroblastomas secrete GRP, which binds to its cell surface receptor (GRP-R) to stimulate cell growth in an autocrine fashion. However, the effects of GRP on expression of the tumor suppressor gene PTEN have not been elucidated in neuroblastomas. Paraffin-embedded sections from human neuroblastomas were analyzed for PTEN and phospho-Akt protein expression by immunohistochemistry. Human neuroblastoma cell lines (SK-N-SH and SH-SY5Y) were stably transfected with the plasmid pEGFP-GRP-R to establish GRP-R overexpression cell lines, and the effects of GRP on PTEN gene and protein expression were determined. A decrease in the ratio of PTEN to phospho-Akt protein expression was identified in poorly differentiated neuroblastomas. An increase in GRP binding capacity was confirmed in GRP-R overexpressing cells, which demonstrated an accelerated constitutive cell growth rate. PTEN gene and protein expression was significantly decreased in GRP-R overexpressing cells when compared with controls. Our findings demonstrate decreased expression of the tumor suppressor protein PTEN in more aggressive undifferentiated neuroblastomas. An increase in GRP binding capacity, as a result of GRP-R overexpression, down-regulates PTEN expression. These findings suggest that an inhibition of the tumor suppressor gene PTEN may be an important regulatory mechanism involved in GRP-induced cell proliferation in neuroblastomas.

Identification and Characterization of Genes That Interact with Lin-12 in Caenorhabditis Elegans

PubMed Central

Tax, F. E.; Thomas, J. H.; Ferguson, E. L.; Horvitz, H. R.

1997-01-01

We identified and characterized 14 extragenic mutations that suppressed the dominant egg-laying defect of certain lin-12 gain-of-function mutations. These suppressors defined seven genes: sup-17, lag-2, sel-4, sel-5, sel-6, sel-7 and sel-8. Mutations in six of the genes are recessive suppressors, whereas the two mutations that define the seventh gene, lag-2, are semi-dominant suppressors. These suppressor mutations were able to suppress other lin-12 gain-of-function mutations. The suppressor mutations arose at a very low frequency per gene, 10-50 times below the typical loss-of-function mutation frequency. The suppressor mutations in sup-17 and lag-2 were shown to be rare non-null alleles, and we present evidence that null mutations in these two genes cause lethality. Temperature-shift studies for two suppressor genes, sup-17 and lag-2, suggest that both genes act at approximately the same time as lin-12 in specifying a cell fate. Suppressor alleles of six of these genes enhanced a temperature-sensitive loss-of-function allele of glp-1, a gene related to lin-12 in structure and function. Our analysis of these suppressors suggests that the majority of these genes are part of a shared lin-12/glp-1 signal transduction pathway, or act to regulate the expression or stability of lin-12 and glp-1. PMID:9409830

Identification of new adventitious rooting mutants amongst suppressors of the Arabidopsis thaliana superroot2 mutation.

PubMed

Pacurar, Daniel Ioan; Pacurar, Monica Lacramioara; Bussell, John Desmond; Schwambach, Joseli; Pop, Tiberia Ioana; Kowalczyk, Mariusz; Gutierrez, Laurent; Cavel, Emilie; Chaabouni, Salma; Ljung, Karin; Fett-Neto, Arthur Germano; Pamfil, Doru; Bellini, Catherine

2014-04-01

The plant hormone auxin plays a central role in adventitious rooting and is routinely used with many economically important, vegetatively propagated plant species to promote adventitious root initiation and development on cuttings. Nevertheless the molecular mechanisms through which it acts are only starting to emerge. The Arabidopsis superroot2-1 (sur2-1) mutant overproduces auxin and, as a consequence, develops excessive adventitious roots in the hypocotyl. In order to increase the knowledge of adventitious rooting and of auxin signalling pathways and crosstalk, this study performed a screen for suppressors of superroot2-1 phenotype. These suppressors provide a new resource for discovery of genetic players involved in auxin signalling pathways or at the crosstalk of auxin and other hormones or environmental signals. This study reports the identification and characterization of 26 sur2-1 suppressor mutants, several of which were identified as mutations in candidate genes involved in either auxin biosynthesis or signalling. In addition to confirming the role of auxin as a central regulator of adventitious rooting, superroot2 suppressors indicated possible crosstalk with ethylene signalling in this process.

Discovery of Tumor Suppressor Gene Function.

ERIC Educational Resources Information Center

Oppenheimer, Steven B.

1995-01-01

This is an update of a 1991 review on tumor suppressor genes written at a time when understanding of how the genes work was limited. A recent major breakthrough in the understanding of the function of tumor suppressor genes is discussed. (LZ)

Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

PubMed

van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

2005-06-10

To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

Off and back-on again: a tumor suppressor's tale.

PubMed

Acosta, Jonuelle; Wang, Walter; Feldser, David M

2018-06-01

Tumor suppressor genes play critical roles orchestrating anti-cancer programs that are both context dependent and mechanistically diverse. Beyond canonical tumor suppressive programs that control cell division, cell death, and genome stability, unexpected tumor suppressor gene activities that regulate metabolism, immune surveillance, the epigenetic landscape, and others have recently emerged. This diversity underscores the important roles these genes play in maintaining cellular homeostasis to suppress cancer initiation and progression, but also highlights a tremendous challenge in discerning precise context-specific programs of tumor suppression controlled by a given tumor suppressor. Fortunately, the rapid sophistication of genetically engineered mouse models of cancer has begun to shed light on these context-dependent tumor suppressor activities. By using techniques that not only toggle "off" tumor suppressor genes in nascent tumors, but also facilitate the timely restoration of gene function "back-on again" in disease specific contexts, precise mechanisms of tumor suppression can be revealed in an unbiased manner. This review discusses the development and implementation of genetic systems designed to toggle tumor suppressor genes off and back-on again and their potential to uncover the tumor suppressor's tale.

Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell lymphocytic leukemia at 13q14.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouyge-Moreau, I.; Rondeau, G.; Andre, M.T.

A putative tumor suppressor gene involved in B cell chronic lymphocytic leukemia (B-CLL) was mapped to human chromosome 13q14.3 close to the genetic markers D13S25 and D13S319. We constructed a 780-kb-long contig composed of cosmids, bacterial artificial chromosomes, and bacteriophage PI-derived artificial chromosomes that provides essential information and tools for the positional cloning of this gene. The contig contains both flanking markers as well as several additional genetic markers, three ESTs, and one potential CpG island. In addition, using one B-CLL patient, we characterized a small internal deleted region of 550 kb. Comparing this deletion with other recently published deletionsmore » narrows the minimally deleted area to less than 100 kb in our physical map. This deletion core region should contain all or part of the disrupted in B cell malignancies tumor suppressor gene. 27 refs., 3 figs.« less

Helicobacter pylori CagA induces tumor suppressor gene hypermethylation by upregulating DNMT1 via AKT-NFκB pathway in gastric cancer development.

PubMed

Zhang, Bao-gui; Hu, Lei; Zang, Ming-de; Wang, He-xiao; Zhao, Wei; Li, Jian-fang; Su, Li-ping; Shao, Zhifeng; Zhao, Xiaodong; Zhu, Zheng-gang; Yan, Min; Liu, Bingya

2016-03-01

Methylation of CpG islands in tumor suppressor gene prompter is one of the most characteristic abnormalities in Helicobacter pylori (HP)-associated gastric carcinoma (GC). Here, we investigated the pathogenic and molecular mechanisms underlying hypermethylation of tumor suppressor genes in HP induced GC development. We found that tumor suppressor genes hypermethylation, represented by MGMT, positively correlated with CagA in clinical specimens, gastric tissues from HP infected C57 mice and GC cell lines transfected by CagA or treated by HP infection. CagA enhanced PDK1 and AKT interaction and increased AKT phosphorylation. The P-AKT subsequent activated NFκB, which then bound to DNMT1 promoter and increased its expression. Finally, the upregulated DNMT1 promoted tumor suppressor genes hypermethylation with MGMT as a representative. In conclusion, CagA increased tumor suppressor genes hypermethylation via stimulating DNMT1 expression through the AKT-NFκB pathway.

Helicobacter pylori CagA induces tumor suppressor gene hypermethylation by upregulating DNMT1 via AKT-NFκB pathway in gastric cancer development

PubMed Central

Wang, He-xiao; Zhao, Wei; Li, Jian-fang; Su, Li-ping; Shao, Zhifeng; Zhao, Xiaodong; Zhu, Zheng-gang; Yan, Min; Liu, Bingya

2016-01-01

Methylation of CpG islands in tumor suppressor gene prompter is one of the most characteristic abnormalities in Helicobacter pylori (HP)-associated gastric carcinoma (GC). Here, we investigated the pathogenic and molecular mechanisms underlying hypermethylation of tumor suppressor genes in HP induced GC development. We found that tumor suppressor genes hypermethylation, represented by MGMT, positively correlated with CagA in clinical specimens, gastric tissues from HP infected C57 mice and GC cell lines transfected by CagA or treated by HP infection. CagA enhanced PDK1 and AKT interaction and increased AKT phosphorylation. The P-AKT subsequent activated NFκB, which then bound to DNMT1 promoter and increased its expression. Finally, the upregulated DNMT1 promoted tumor suppressor genes hypermethylation with MGMT as a representative. In conclusion, CagA increased tumor suppressor genes hypermethylation via stimulating DNMT1 expression through the AKT-NFκB pathway. PMID:26848521

Epigenetics provides a new generation of oncogenes and tumour-suppressor genes

PubMed Central

Esteller, M

2006-01-01

Cancer is nowadays recognised as a genetic and epigenetic disease. Much effort has been devoted in the last 30 years to the elucidation of the ‘classical' oncogenes and tumour-suppressor genes involved in malignant cell transformation. However, since the acceptance that major disruption of DNA methylation, histone modification and chromatin compartments are a common hallmark of human cancer, epigenetics has come to the fore in cancer research. One piece is still missing from the story: are the epigenetic genes themselves driving forces on the road to tumorigenesis? We are in the early stages of finding the answer, and the data are beginning to appear: knockout mice defective in DNA methyltransferases, methyl-CpG-binding proteins and histone methyltransferases strongly affect the risk of cancer onset; somatic mutations, homozygous deletions and methylation-associated silencing of histone acetyltransferases, histone methyltransferases and chromatin remodelling factors are being found in human tumours; and the first cancer-prone families arising from germline mutations in epigenetic genes, such as hSNF5/INI1, have been described. Even more importantly, all these ‘new' oncogenes and tumour-suppressor genes provide novel molecular targets for designed therapies, and the first DNA-demethylating agents and inhibitors of histone deacetylases are reaching the bedside of patients with haematological malignancies. PMID:16404435

Reversal of hypermethylation and reactivation of glutathione S-transferase pi 1 gene by curcumin in breast cancer cell line.

PubMed

Kumar, Umesh; Sharma, Ujjawal; Rathi, Garima

2017-02-01

One of the mechanisms for epigenetic silencing of tumor suppressor genes is hypermethylation of cytosine residue at CpG islands at their promoter region that contributes to malignant progression of tumor. Therefore, activation of tumor suppressor genes that have been silenced by promoter methylation is considered to be very attractive molecular target for cancer therapy. Epigenetic silencing of glutathione S-transferase pi 1, a tumor suppressor gene, is involved in various types of cancers including breast cancer. Epigenetic silencing of tumor suppressor genes can be reversed by several molecules including natural compounds such as polyphenols that can act as a hypomethylating agent. Curcumin has been found to specifically target various tumor suppressor genes and alter their expression. To check the effect of curcumin on the methylation pattern of glutathione S-transferase pi 1 gene in MCF-7 breast cancer cell line in dose-dependent manner. To check the reversal of methylation pattern of hypermethylated glutathione S-transferase pi 1, MCF-7 breast cancer cell line was treated with different concentrations of curcumin for different time periods. DNA and proteins of treated and untreated cell lines were isolated, and methylation status of the promoter region of glutathione S-transferase pi 1 was analyzed using methylation-specific polymerase chain reaction assay, and expression of this gene was analyzed by immunoblotting using specific antibodies against glutathione S-transferase pi 1. A very low and a nontoxic concentration (10 µM) of curcumin treatment was able to reverse the hypermethylation and led to reactivation of glutathione S-transferase pi 1 protein expression in MCF-7 cells after 72 h of treatment, although the IC 50 value of curcumin was found to be at 20 µM. However, curcumin less than 3 µM of curcumin could not alter the promoter methylation pattern of glutathione S-transferase pi 1. Treatment of breast cancer MCF-7 cells with curcumin causes complete reversal of glutathione S-transferase pi 1 promoter hypermethylation and leads to re-expression of glutathione S-transferase pi 1, suggesting it to be an excellent nontoxic hypomethylating agent.

Promoter methylation profile in gallbladder cancer.

PubMed

Roa, Juan Carlos; Anabalón, Leonardo; Roa, Iván; Melo, Angélica; Araya, Juan Carlos; Tapia, Oscar; de Aretxabala, Xavier; Muñoz, Sergio; Schneider, Barbara

2006-03-01

Methylation in the promoter region of genes is an important mechanism of inactivation of tumor suppressor genes. Our objective was to analyze the methylation pattern of some of the genes involved in carcinogenesis of the gallbladder, examining the immunohistochemical expression of proteins, clinical features, and patient survival time. Twenty cases of gallbladder cancer were selected from the frozen tumor bank. The DNA extracted was analyzed by means of a methylation-specific polymerase chain reaction test for the CDKN2A (p16), MLH1, APC, FHIT, and CDH1 (E-cadherin) genes. Morphological and clinical data and follow-up information were obtained. All cases were in an advanced stage: histologically moderate or poorly differentiated tumors (95%). Methylation of the promoter area of genes was observed in 5%, 20%, 30%, 40%, and 65% of cases, and an altered immunohistochemical pattern (AIP) in 5%, 35%, 21%, 25%, and 66% for the MLH1, CDKN2A, FHIT, APC, and CDH1 genes, respectively. The Kappa concordance index between methylation of the promoter area and AIP for the MLH1 and CDH1 genes was very high (K > 0.75) and substantial for APC (K > 0.45). No correlation was found between survival time and the methylation of the genes studied. The high frequency of gene methylation (with the exception of MLH1) and the high agreement between AIP and methylation of the gene promoter area for the MLH1, APC, and CDH1 genes suggest that the inactivation of tumor suppressor genes and of the genes related to the control of cellular proliferation through this mechanism is involved in gallbladder carcinogenesis.

The Potential for Tumor Suppressor Gene Therapy in Head and Neck Cancer

PubMed Central

Birkeland, Andrew C.; Ludwig, Megan L.; Spector, Matthew E.; Brenner, J. Chad

2016-01-01

Head and neck squamous cell carcinoma remains a highly morbid and fatal disease. Importantly, genomic sequencing of head and neck cancers has identified frequent mutations in tumor suppressor genes. While targeted therapeutics increasingly are being investigated in head and neck cancer, the majority of these agents are against overactive/overexpressed oncogenes. Therapy to restore lost tumor suppressor gene function remains a key and under-addressed niche in trials for head and neck cancer. Recent advances in gene editing have captured the interest of both the scientific community and the public. As our technology for gene editing and gene expression modulation improves, addressing lost tumor suppressor gene function in head and neck cancers is becoming a reality. This review will summarize new techniques, challenges to implementation, future directions, and ethical ramifications of gene therapy in head and neck cancer. PMID:26896601

Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

PubMed

Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

2011-12-01

Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor-suppressor genes.

PubMed

Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

2015-10-01

Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs and our experimental data from clinical samples, we discovered broad peaks for trimethylation of histone H3 at lysine 4 (H3K4me3; wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity, which together lead to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Genes with broad H3K4me3 peaks conserved across normal cells may represent pan-cancer tumor suppressors, such as TP53 and PTEN, whereas genes with cell type-specific broad H3K4me3 peaks may represent cell identity genes and cell type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 peaks in cancers is associated with repression of tumor suppressors. Thus, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of new tumor suppressors.

Tumor suppressor function of Betaig-H3 gene in radiation carcinogenesis

NASA Astrophysics Data System (ADS)

Zhao, Y. L.; Piao, C. Q.; Hei, T. K.

Interaction between cell and extracellular matrix (ECM) plays a crucial role in tumor invasiveness and metastasis. Using an immortalized human bronchial epithelial (BEP2D) cell model, we showed previously that expression of a list of genes including Betaig-h3 (induced by transforming growth factor-β) DCC (deleted in colorectal cancer), p21 cip1, c-fos , Heat shock protein (HSP27) and cytokeratin 14 were differentially expressed in several independently generated, radiation-induced tumor cell lines (TL1-TL5) relative to parental BEP2D cells. Our previous data further demonstrated that loss of tumor suppressor gene(s) as a likely mechanism of radiation carcinogenesis. In the present study, we chose Betaig-h3 and DCC that were downregulated in tumorigenic cells for further study. Restored expression of Betaig-h3 gene, not DCC gene, by transfecting cDNA into tumor cells resulted in a significant reduction in tumor growth. While integrin receptor α5β1 was overexpressed in tumor cells, its expression was corrected to the level found in control BEP2D cells after Betaig-h3 transfection. These data suggest that Betaig-h3 gene is involved in tumor progression by regulating integrin α5β1 receptor. Furthermore, exogenous TGF-β1 induced expression of Betaig-h3 gene and inhibited the growth of both control and tumorigenic BEP2D cells. Therefore, downregulation of Betaig-h3 gene may results from the decreased expression of upstream mediators such as TGF-β. The findings provide strong evidence that the Betaig-h3 gene has tumor suppressor function in radiation-induced tumorigenic human bronchial epithelial cells and suggest a potential target for interventional therapy.

microRNA-449a functions as a tumor suppressor in neuroblastoma through inducing cell differentiation and cell cycle arrest

PubMed Central

Zhao, Zhenze; Ma, Xiuye; Sung, Derek; Li, Monica; Kosti, Adam; Lin, Gregory; Chen, Yidong; Pertsemlidis, Alexander; Hsiao, Tzu-Hung; Du, Liqin

2015-01-01

microRNA-449a (miR-449a) has been identified to function as a tumor suppressor in several types of cancers. However, the role of miR-449a in neuroblastoma has not been intensively investigated. We recently found that the overexpression of miR-449a significantly induces neuroblastoma cell differentiation, suggesting its potential tumor suppressor function in neuroblastoma. In this study, we further investigated the mechanisms underlying the tumor suppressive function of miR-449a in neuroblastoma. We observed that miR-449a inhibits neuroblastoma cell survival and growth through 2 mechanisms—inducing cell differentiation and cell cycle arrest. Our comprehensive investigations on the dissection of the target genes of miR-449a revealed that 3 novel targets- MFAP4, PKP4 and TSEN15 -play important roles in mediating its differentiation-inducing function. In addition, we further found that its function in inducing cell cycle arrest involves down-regulating its direct targets CDK6 and LEF1. To determine the clinical significance of the miR-449a-mediated tumor suppressive mechanism, we examined the correlation between the expression of these 5 target genes in neuroblastoma tumor specimens and the survival of neuroblastoma patients. Remarkably, we noted that high tumor expression levels of all the 3 miR-449a target genes involved in regulating cell differentiation, but not the target genes involved in regulating cell cycle, are significantly correlated with poor survival of neuroblastoma patients. These results suggest the critical role of the differentiation-inducing function of miR-449a in determining neuroblastoma progression. Overall, our study provides the first comprehensive characterization of the tumor-suppressive function of miR-449a in neuroblastoma, and reveals the potential clinical significance of the miR-449a-mediated tumor suppressive pathway in neuroblastoma prognosis. PMID:25760387

A Network of Genes Antagonistic to the LIN-35 Retinoblastoma Protein of Caenorhabditis elegans

PubMed Central

Polley, Stanley R. G.; Fay, David S.

2012-01-01

The Caenorhabditis elegans pRb ortholog, LIN-35, functions in a wide range of cellular and developmental processes. This includes a role of LIN-35 in nutrient utilization by the intestine, which it carries out redundantly with SLR-2, a zinc-finger protein. This and other redundant functions of LIN-35 were identified in genetic screens for mutations that display synthetic phenotypes in conjunction with loss of lin-35. To explore the intestinal role of LIN-35, we conducted a genome-wide RNA-interference-feeding screen for suppressors of lin-35; slr-2 early larval arrest. Of the 26 suppressors identified, 17 fall into three functional classes: (1) ribosome biogenesis genes, (2) mitochondrial prohibitins, and (3) chromatin regulators. Further characterization indicates that different categories of suppressors act through distinct molecular mechanisms. We also tested lin-35; slr-2 suppressors, as well as suppressors of the synthetic multivulval phenotype, to determine the spectrum of lin-35-synthetic phenotypes that could be suppressed following inhibition of these genes. We identified 19 genes, most of which are evolutionarily conserved, that can suppress multiple unrelated lin-35-synthetic phenotypes. Our study reveals a network of genes broadly antagonistic to LIN-35 as well as genes specific to the role of LIN-35 in intestinal and vulval development. Suppressors of multiple lin-35 phenotypes may be candidate targets for anticancer therapies. Moreover, screening for suppressors of phenotypically distinct synthetic interactions, which share a common altered gene, may prove to be a novel and effective approach for identifying genes whose activities are most directly relevant to the core functions of the shared gene. PMID:22542970

Dominant suppressor mutation bypasses the sphingolipid requirement for growth of Saccharomyces cells at low pH: role of the CWP2 gene.

PubMed

Skrzypek, M; Lester, R L; Spielmann, P; Zingg, N; Shelling, J; Dickson, R C

2000-11-01

Strains of Saccharomyces cerevisiae termed sphingolipid compensatory (SLC) do not grow at low pH when the cells lack sphingolipids. To begin to understand why sphingolipids are required for growth at low pH, we isolated derivatives of SLC strains, termed low pH resistant (LprR), carrying the LPR suppressor gene that allows growth at pH 4.1 when cells lack sphingolipids. Suppression is due to mutation of a single nuclear gene. The LPR suppressor gene functions, at least in part, by enhancing the ability of cells lacking sphingolipids to generate a net efflux of protons in suspension fluid with a pH range of 4.0-6.0. The LPR suppressor gene also enables cells lacking sphingolipids to maintain their intracellular pH near neutrality when the pH of the suspension fluid is low, unlike cells lacking the suppressor gene, which cannot maintain their intracellular pH in the face of a low external pH. These results demonstrate that some functions(s) of sphingolipids necessary for growth at low pH can be bypassed by a suppressor mutation. Attempts to clone the LPR suppressor gene were not successful, but they led to the isolation of the CWP2 gene, which encodes a major mannoprotein component of the outer cell wall. It was isolated because an increased copy number has the unusual property of increasing the frequency at which LprR strains arise. As we show here, part of the reason for this effect is that the CWP2 gene is essential for generating a net efflux of protons and for controlling intracellular pH in LprR strains that lack sphingolipids. These results suggest new cellular functions for the Cwp2 protein.

Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

PubMed

Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

2015-01-01

A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

A Novel Plasmid-Based Microarray Screen Identifies Suppressors of rrp6Δ in Saccharomyces cerevisiae▿†

PubMed Central

Abruzzi, Katharine; Denome, Sylvia; Olsen, Jens Raabjerg; Assenholt, Jannie; Haaning, Line Lindegaard; Jensen, Torben Heick; Rosbash, Michael

2007-01-01

Genetic screens in Saccharomyces cerevisiae provide novel information about interacting genes and pathways. We screened for high-copy-number suppressors of a strain with the gene encoding the nuclear exosome component Rrp6p deleted, with either a traditional plate screen for suppressors of rrp6Δ temperature sensitivity or a novel microarray enhancer/suppressor screening (MES) strategy. MES combines DNA microarray technology with high-copy-number plasmid expression in liquid media. The plate screen and MES identified overlapping, but also different, suppressor genes. Only MES identified the novel mRNP protein Nab6p and the tRNA transporter Los1p, which could not have been identified in a traditional plate screen; both genes are toxic when overexpressed in rrp6Δ strains at 37°C. Nab6p binds poly(A)+ RNA, and the functions of Nab6p and Los1p suggest that mRNA metabolism and/or protein synthesis are growth rate limiting in rrp6Δ strains. Microarray analyses of gene expression in rrp6Δ strains and a number of suppressor strains support this hypothesis. PMID:17101774

Genetic analysis of Ikaros target genes and tumor suppressor function in BCR-ABL1+ pre–B ALL

PubMed Central

Aghajanirefah, Ali; McLaughlin, Jami; Cheng, Donghui; Geng, Huimin; Eggesbø, Linn M.; Smale, Stephen T.; Müschen, Markus

2017-01-01

Inactivation of the tumor suppressor gene encoding the transcriptional regulator Ikaros (IKZF1) is a hallmark of BCR-ABL1+ precursor B cell acute lymphoblastic leukemia (pre–B ALL). However, the mechanisms by which Ikaros functions as a tumor suppressor in pre–B ALL remain poorly understood. Here, we analyzed a mouse model of BCR-ABL1+ pre–B ALL together with a new model of inducible expression of wild-type Ikaros in IKZF1 mutant human BCR-ABL1+ pre–B ALL. We performed integrated genome-wide chromatin and expression analyses and identified Ikaros target genes in mouse and human BCR-ABL1+ pre–B ALL, revealing novel conserved gene pathways associated with Ikaros tumor suppressor function. Notably, genetic depletion of different Ikaros targets, including CTNND1 and the early hematopoietic cell surface marker CD34, resulted in reduced leukemic growth. Our results suggest that Ikaros mediates tumor suppressor function by enforcing proper developmental stage–specific expression of multiple genes through chromatin compaction at its target genes. PMID:28190001

Enhancement of Recombinant Protein Production in Transgenic Nicotiana benthamiana Plant Cell Suspension Cultures with Co-Cultivation of Agrobacterium Containing Silencing Suppressors.

PubMed

Huang, Ting-Kuo; Falk, Bryce W; Dandekar, Abhaya M; McDonald, Karen A

2018-05-24

We have previously demonstrated that the inducible plant viral vector (CMViva) in transgenic plant cell cultures can significantly improve the productivity of extracellular functional recombinant human alpha-1-antiryspin (rAAT) compared with either a common plant constitutive promoter ( Cauliflower mosaic virus (CaMV) 35S) or a chemically inducible promoter (estrogen receptor-based XVE) system. For a transgenic plant host system, however, viral or transgene-induced post-transcriptional gene silencing (PTGS) has been identified as a host response mechanism that may dramatically reduce the expression of a foreign gene. Previous studies have suggested that viral gene silencing suppressors encoded by a virus can block or interfere with the pathways of transgene-induced PTGS in plant cells. In this study, the capability of nine different viral gene silencing suppressors were evaluated for improving the production of rAAT protein in transgenic plant cell cultures (CMViva, XVE or 35S system) using an Agrobacterium -mediated transient expression co-cultivation process in which transgenic plant cells and recombinant Agrobacterium carrying the viral gene silencing suppressor were grown together in suspension cultures. Through the co-cultivation process, the impacts of gene silencing suppressors on the rAAT production were elucidated, and promising gene silencing suppressors were identified. Furthermore, the combinations of gene silencing suppressors were optimized using design of experiments methodology. The results have shown that in transgenic CMViva cell cultures, the functional rAAT as a percentage of total soluble protein is increased 5.7 fold with the expression of P19, and 17.2 fold with the co-expression of CP, P19 and P24.

Role of chromosome 3p12-p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis.

PubMed

Martinez, A; Fullwood, P; Kondo, K; Kishida, T; Yao, M; Maher, E R; Latif, F

2000-06-01

Chromosome 3p deletions and loss of heterozygosity (LOH) for 3p markers are features of clear cell renal cell carcinoma but are rare in non-clear cell renal cell carcinoma. The VHL tumour suppressor gene, which maps to 3p25, is a major gatekeeper gene for clear cell renal cell carcinoma and is inactivated in most sporadic cases of this disease. However, it has been suggested that inactivation of other 3p tumour suppressor genes might be crucial for clear cell renal cell carcinoma tumorigenesis, with inactivation (VHL negative) and without inactivation (VHL positive) of the VHL tumour suppressor gene. This study set out to investigate the role of non-VHL tumour suppressor genes in VHL negative and VHL positive clear cell renal cell carcinoma. Eighty two clear cell renal cell carcinomas of known VHL inactivation status were analysed for LOH at polymorphic loci within the candidate crucial regions for chromosome 3p tumour suppressor genes (3p25, LCTSGR1 at 3p21.3, LCTSGR2 at 3p12 and at 3p14.2). Chromosome 3p12-p21 LOH was frequent both in VHL negative and VHL positive clear cell renal cell carcinoma. However, although the frequency of 3p25 LOH in VHL negative clear cell renal cell carcinoma was similar to that at 3p12-p21, VHL positive tumours demonstrated significantly less LOH at 3p25 than at 3p12-p21. Although there was evidence of LOH for clear cell renal cell carcinoma tumour suppressor genes at 3p21, 3p14.2, and 3p12, both in VHL negative and VHL positive tumours, the major clear cell renal cell carcinoma LOH region mapped to 3p21.3, close to the lung cancer tumour suppressor gene region 1 (LCTSGR1). There was no association between tumour VHL status and tumour grade and stage. These findings further indicate that VHL inactivation is not sufficient to initiate clear cell renal cell carcinoma and that loss of a gatekeeper 3p21 tumour suppressor gene is a crucial event for renal cell carcinoma development in both VHL negative and VHL positive clear cell renal cell carcinoma.

Oligoamine analogues in combination with 2-difluoromethylornithine synergistically induce re-expression of aberrantly silenced tumour-suppressor genes

PubMed Central

Wu, Yu; Steinbergs, Nora; Murray-Stewart, Tracy; Marton, Laurence J.; Casero, Robert A.

2011-01-01

Epigenetic gene silencing is an important mechanism in the initiation and progression of cancer. Abnormal DNA CpG island hypermethylation and histone modifications are involved in aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) was the first enzyme identified to specifically demethylate H3K4 (Lys4 of histone H3). Methylated H3K4 is an important mark associated with transcriptional activation. The flavin adenine dinucleotide-binding amine oxidase domain of LSD1 is homologous with two polyamine oxidases, SMO (spermine oxidase) and APAO (N1-acetylpolyamine oxidase). We have demonstrated previously that long-chain polyamine analogues, the oligoamines, are inhibitors of LSD1. In the present paper we report the synergistic effects of specific oligoamines in combination with DFMO (2-difluoromethylornithine), an inhibitor of ornithine decarboxylase, in human colorectal cancer cells. DFMO treatment depletes natural polyamines and increases the uptake of exogenous polyamines. The combination of oligoamines and DFMO results in a synergistic re-expression of aberrantly silenced tumour-suppressor genes, including SFRP2 (secreted frizzled-related protein 2), which encodes a Wnt signalling pathway antagonist and plays an anti-tumorigenic role in colorectal cancer. The treatment-induced re-expression of SFRP2 is associated with increased H3K4me2 (di-methyl H3K4) in the gene promoter. The combination of LSD1-inhibiting oligoamines and DFMO represents a novel approach to epigenetic therapy of cancer. PMID:22132744

Pretreatment dietary intake is associated with tumor suppressor DNA methylation in head and neck squamous cell carcinomas

PubMed Central

Colacino, Justin A.; Arthur, Anna E.; Dolinoy, Dana C.; Sartor, Maureen A.; Duffy, Sonia A.; Chepeha, Douglas B.; Bradford, Carol R.; Walline, Heather M.; McHugh, Jonathan B.; D'Silva, Nisha; Carey, Thomas E.; Wolf, Gregory T.; Taylor, Jeremy M.G.; Peterson, Karen E.; Rozek, Laura S.

2012-01-01

Diet is associated with cancer prognosis, including head and neck cancer (HNC), and has been hypothesized to influence epigenetic state by determining the availability of functional groups involved in the modification of DNA and histone proteins. The goal of this study was to describe the association between pretreatment diet and HNC tumor DNA methylation. Information on usual pretreatment food and nutrient intake was estimated via food frequency questionnaire (FFQ) on 49 HNC cases. Tumor DNA methylation patterns were assessed using the Illumina Goldengate Methylation Cancer Panel. First, a methylation score, the sum of individual hypermethylated tumor suppressor associated CpG sites, was calculated and associated with dietary intake of micronutrients involved in one-carbon metabolism and antioxidant activity, and food groups abundant in these nutrients. Second, gene specific analyses using linear modeling with empirical Bayesian variance estimation were conducted to identify if methylation at individual CpG sites was associated with diet. All models were controlled for age, sex, smoking, alcohol and HPV status. Individuals reporting in the highest quartile of folate, vitamin B12 and vitamin A intake, compared with those in the lowest quartile, showed significantly less tumor suppressor gene methylation, as did patients reporting the highest cruciferous vegetable intake. Gene specific analyses identified differential associations between DNA methylation and vitamin B12 and vitamin A intake when stratifying by HPV status. These preliminary results suggest that intake of folate, vitamin A and vitamin B12 may be associated with the tumor DNA methylation profile in HNC and enhance tumor suppression. PMID:22722388

Tumor suppressors: enhancers or suppressors of regeneration?

PubMed Central

Pomerantz, Jason H.; Blau, Helen M.

2013-01-01

Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544

Gene expression during ovarian differentiation in parasitic and non-parasitic lampreys: implications for fecundity and life history types.

PubMed

Spice, Erin K; Whyard, Steven; Docker, Margaret F

2014-11-01

Lampreys diverged from the jawed vertebrate lineage approximately 500million years ago. Lampreys undergo sex differentiation much later than most other vertebrates, and ovarian differentiation occurs several years before testicular differentiation. The genetic basis of lamprey sex differentiation is of particular interest both because of the phylogenetic importance of lampreys and because of their unusual pattern of sex differentiation. As well, differences between parasitic and non-parasitic lampreys may first become evident at ovarian differentiation. However, nothing is known about the genetic basis of ovarian differentiation in lampreys. This study examined potential differences in gene expression before, during, and after ovarian differentiation in parasitic chestnut lamprey Ichthyomyzon castaneus and non-parasitic northern brook lamprey Ichthyomyzonfossor. Eight target genes (17β-hydroxysteroid dehydrogenase, germ cell-less, estrogen receptor β, insulin-like growth factor 1 receptor, daz-associated protein 1, cytochrome c oxidase subunit III, Wilms' tumour suppressor protein 1, and dehydrocholesterol reductase 7) were examined. Northern brook lamprey displayed higher expression of cytochrome c oxidase subunit III, whereas chestnut lamprey displayed higher expression of insulin-like growth factor 1 receptor; these genes may be involved in apoptosis and oocyte growth, respectively. Presumptive male larvae had higher expression of Wilms' tumour suppressor protein 1, which may be involved in the undifferentiated gonad and/or later testicular development. Differentiated females had higher expression of 17β hydroxysteroid dehydrogenase and daz-associated protein 1, which may be involved in female development. This study is the first to identify genes that may be involved in ovarian differentiation and fecundity in lampreys. Copyright © 2014 Elsevier Inc. All rights reserved.

The pVHL172 isoform is not a tumor suppressor and up-regulates a subset of pro-tumorigenic genes including TGFB1 and MMP13

PubMed Central

Hascoet, Pauline; Chesnel, Franck; Jouan, Florence; Goff, Cathy Le; Couturier, Anne; Darrigrand, Eric; Mahe, Fabrice; Rioux-Leclercq, Nathalie; Goff, Xavier Le; Arlot-Bonnemains, Yannick

2017-01-01

The von Hippel-Lindau (VHL) tumor suppressor gene is often deleted or mutated in ccRCC (clear cell renal cell carcinoma) producing a non-functional protein. The gene encodes two mRNA, and three protein isoforms (pVHL213, pVHL160 and pVHL172). The pVHL protein is part of an E3 ligase complex involved in the ubiquitination and proteasomal degradation of different proteins, particularly hypoxia inducible factors (HIF) that drive the transcription of genes involved in the regulation of cell proliferation, angiogenesis or extracellular matrix remodelling. Other non-canonical (HIF-independent) pVHL functions have been described. A recent work reported the expression of the uncharacterized protein isoform pVHL172 which is translated from the variant 2 by alternative splicing of the exon 2. This splice variant is sometimes enriched in the ccRCCs and the protein has been identified in the respective samples of ccRCCs and different renal cell lines. Functional studies on pVHL have only concerned the pVHL213 and pVHL160 isoforms, but no function was assigned to pVHL172. Here we show that pVHL172 stable expression in renal cancer cells does not regulate the level of HIF, exacerbates tumorigenicity when 786-O-pVHL172 cells were xenografted in mice. The pVHL172-induced tumors developed a sarcomatoid phenotype. Moreover, pVHL172 expression was shown to up regulate a subset of pro-tumorigenic genes including TGFB1, MMP1 and MMP13. In summary we identified that pVHL172 is not a tumor suppressor. Furthermore our findings suggest an antagonistic function of this pVHL isoform in the HIF-independent aggressiveness of renal tumors compared to pVHL213. PMID:29100286

PLAU inferred from a correlation network is critical for suppressor function of regulatory T cells

PubMed Central

He, Feng; Chen, Hairong; Probst-Kepper, Michael; Geffers, Robert; Eifes, Serge; del Sol, Antonio; Schughart, Klaus; Zeng, An-Ping; Balling, Rudi

2012-01-01

Human FOXP3+CD25+CD4+ regulatory T cells (Tregs) are essential to the maintenance of immune homeostasis. Several genes are known to be important for murine Tregs, but for human Tregs the genes and underlying molecular networks controlling the suppressor function still largely remain unclear. Here, we describe a strategy to identify the key genes directly from an undirected correlation network which we reconstruct from a very high time-resolution (HTR) transcriptome during the activation of human Tregs/CD4+ T-effector cells. We show that a predicted top-ranked new key gene PLAU (the plasminogen activator urokinase) is important for the suppressor function of both human and murine Tregs. Further analysis unveils that PLAU is particularly important for memory Tregs and that PLAU mediates Treg suppressor function via STAT5 and ERK signaling pathways. Our study demonstrates the potential for identifying novel key genes for complex dynamic biological processes using a network strategy based on HTR data, and reveals a critical role for PLAU in Treg suppressor function. PMID:23169000

SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

PubMed

Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

2015-04-23

With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

Epigenetic deregulation of TCF21 inhibits metastasis suppressor KISS1 in metastatic melanoma.

PubMed

Arab, Khelifa; Smith, Laura T; Gast, Andreas; Weichenhan, Dieter; Huang, Joseph Po-Hsien; Claus, Rainer; Hielscher, Thomas; Espinosa, Allan V; Ringel, Matthew D; Morrison, Carl D; Schadendorf, Dirk; Kumar, Rajiv; Plass, Christoph

2011-10-01

Metastatic melanoma is a fatal disease due to the lack of successful therapies and biomarkers for early detection and its incidence has been increasing. Genetic studies have defined recurrent chromosomal aberrations, suggesting the location of either tumor suppressor genes or oncogenes. Transcription factor 21 (TCF21) belongs to the class A of the basic helix-loop-helix family with reported functions in early lung and kidney development as well as tumor suppressor function in the malignancies of the lung and head and neck. In this study, we combined quantitative DNA methylation analysis in patient biopsies and in their derived cell lines to demonstrate that TCF21 expression is downregulated in metastatic melanoma by promoter hypermethylation and TCF21 promoter DNA methylation is correlated with decreased survival in metastatic skin melanoma patients. In addition, the chromosomal location of TCF21 on 6q23-q24 coincides with the location of a postulated metastasis suppressor in melanoma. Functionally, TCF21 binds the promoter of the melanoma metastasis-suppressing gene, KiSS1, and enhances its gene expression through interaction with E12, a TCF3 isoform and with TCF12. Loss of TCF21 expression results in loss of KISS1 expression through loss of direct interaction of TCF21 at the KISS1 promoter. Finally, overexpression of TCF21 inhibits motility of C8161 melanoma cells. These data suggest that epigenetic downregulation of TCF21 is functionally involved in melanoma progression and that it may serve as a biomarker for aggressive tumor behavior.

Cyclin D1 down-regulation is essential for DBC2's tumor suppressor function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshihara, Takashi; Collado, Denise; Hamaguchi, Masaaki

2007-07-13

The expression of tumor suppressor gene DBC2 causes certain breast cancer cells to stop growing [M. Hamaguchi, J.L. Meth, C. Von Klitzing, W. Wei, D. Esposito, L. Rodgers, T. Walsh, P. Welcsh, M.C. King, M.H. Wigler, DBC2, a candidate for a tumor suppressor gene involved in breast cancer, Proc. Natl. Acad. Sci. USA 99 (2002) 13647-13652]. Recently, DBC2 was found to participate in diverse cellular functions such as protein transport, cytoskeleton regulation, apoptosis, and cell cycle control [V. Siripurapu, J.L. Meth, N. Kobayashi, M. Hamaguchi, DBC2 significantly influences cell cycle, apoptosis, cytoskeleton, and membrane trafficking pathways. J. Mol. Biol. 346more » (2005) 83-89]. Its tumor suppression mechanism, however, remains unclear. In this paper, we demonstrate that DBC2 suppresses breast cancer proliferation through down-regulation of Cyclin D1 (CCND1). Additionally, the constitutional overexpression of CCND1 prevented the negative impact of DBC2 expression on their growth. Under a CCND1 promoter, the expression of CCNE1 exhibited the same protective effect. Our results indicate that the down-regulation of CCND1 is an essential step for DBC2's growth suppression of cancer cells. We believe that this discovery contributes to a better understanding of DBC2's tumor suppressor function.« less

Role of chromosome 3p12–p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis

PubMed Central

Martinez, A; Fullwood, P; Kondo, K; Kishida, T; Yao, M; Maher, E R; Latif, F

2000-01-01

Aims—Chromosome 3p deletions and loss of heterozygosity (LOH) for 3p markers are features of clear cell renal cell carcinoma but are rare in non-clear cell renal cell carcinoma. The VHL tumour suppressor gene, which maps to 3p25, is a major gatekeeper gene for clear cell renal cell carcinoma and is inactivated in most sporadic cases of this disease. However, it has been suggested that inactivation of other 3p tumour suppressor genes might be crucial for clear cell renal cell carcinoma tumorigenesis, with inactivation (VHL negative) and without inactivation (VHL positive) of the VHL tumour suppressor gene. This study set out to investigate the role of non-VHL tumour suppressor genes in VHL negative and VHL positive clear cell renal cell carcinoma. Methods—Eighty two clear cell renal cell carcinomas of known VHL inactivation status were analysed for LOH at polymorphic loci within the candidate crucial regions for chromosome 3p tumour suppressor genes (3p25, LCTSGR1 at 3p21.3, LCTSGR2 at 3p12 and at 3p14.2). Results—Chromosome 3p12–p21 LOH was frequent both in VHL negative and VHL positive clear cell renal cell carcinoma. However, although the frequency of 3p25 LOH in VHL negative clear cell renal cell carcinoma was similar to that at 3p12–p21, VHL positive tumours demonstrated significantly less LOH at 3p25 than at 3p12–p21. Although there was evidence of LOH for clear cell renal cell carcinoma tumour suppressor genes at 3p21, 3p14.2, and 3p12, both in VHL negative and VHL positive tumours, the major clear cell renal cell carcinoma LOH region mapped to 3p21.3, close to the lung cancer tumour suppressor gene region 1 (LCTSGR1). There was no association between tumour VHL status and tumour grade and stage. Conclusions—These findings further indicate that VHL inactivation is not sufficient to initiate clear cell renal cell carcinoma and that loss of a gatekeeper 3p21 tumour suppressor gene is a crucial event for renal cell carcinoma development in both VHL negative and VHL positive clear cell renal cell carcinoma. PMID:10897333

Frameshift Suppression in SACCHAROMYCES CEREVISIAE. V. Isolation and Genetic Properties of Nongroup-Specific Suppressors

PubMed Central

Culbertson, Michael R.; Gaber, Richard F.; Cummins, Claudia M.

1982-01-01

Two classes of frameshift suppressors distributed at 22 different loci were identified in previous studies in the yeast Saccharomyces cerevisiae. These suppressors exhibited allele-specific suppression of +1 G:C insertion mutations in either glycine or proline codons, designated as group II and group III frameshift mutations, respectively. Genes corresponding to representative suppressors of each group have been shown to encode altered glycine or proline tRNAs containing four base anticodons.—This communication reports the existence of a third class of frameshift suppressor that exhibits a wider range in specificity of suppression. The suppressors map at three loci, suf12, suf13, and suf14, which are located on chromosomes IV, XV, and XIV, respectively. The phenotypes of these suppressors suggest that suppression may be mediated by genes other than those encoding the primary structure of glycine or proline tRNAs. PMID:6757053

Np95/Uhrf1 regulates tumor suppressor gene expression of neural stem/precursor cells, contributing to neurogenesis in the adult mouse brain.

PubMed

Murao, Naoya; Matsubara, Shuzo; Matsuda, Taito; Noguchi, Hirofumi; Mutoh, Tetsuji; Mutoh, Masahiro; Koseki, Haruhiko; Namihira, Masakazu; Nakashima, Kinichi

2018-05-31

Adult neurogenesis is a process of generating new neurons from neural stem/precursor cells (NS/PCs) in restricted adult brain regions throughout life. It is now generally known that adult neurogenesis in the hippocampal dentate gyrus (DG) and subventricular zone participates in various higher brain functions, such as learning and memory formation, olfactory discrimination and repair after brain injury. However, the mechanisms underlying adult neurogenesis remain to be fully understood. Here, we show that Nuclear protein 95 KDa (Np95, also known as UHRF1 or ICBP90), which is an essential protein for maintaining DNA methylation during cell division, is involved in multiple processes of adult neurogenesis. Specific ablation of Np95 in adult NS/PCs (aNS/PCs) led to a decrease in their proliferation and an impairment of neuronal differentiation and to suppression of neuronal maturation associated with the impairment of dendritic formation in the hippocampal DG. We also found that deficiency of Np95 in NS/PCs increased the expression of tumor suppressor genes p16 and p53, and confirmed that expression of these genes in NS/PCs recapitulates the phenotype of Np95-deficient NS/PCs. Taken together, our findings suggest that Np95 plays an essential role in proliferation and differentiation of aNS/PCs through the regulation of tumor suppressor gene expression in adult neurogenesis. Copyright © 2018 Elsevier B.V. and Japan Neuroscience Society. All rights reserved.

ARLTS1 and Prostate Cancer Risk - Analysis of Expression and Regulation

PubMed Central

Siltanen, Sanna; Fischer, Daniel; Rantapero, Tommi; Laitinen, Virpi; Mpindi, John Patrick; Kallioniemi, Olli; Wahlfors, Tiina; Schleutker, Johanna

2013-01-01

Prostate cancer (PCa) is a heterogeneous trait for which several susceptibility loci have been implicated by genome-wide linkage and association studies. The genomic region 13q14 is frequently deleted in tumour tissues of both sporadic and familial PCa patients and is consequently recognised as a possible locus of tumour suppressor gene(s). Deletions of this region have been found in many other cancers. Recently, we showed that homozygous carriers for the T442C variant of the ARLTS1 gene (ADP-ribosylation factor-like tumour suppressor protein 1 or ARL11, located at 13q14) are associated with an increased risk for both unselected and familial PCa. Furthermore, the variant T442C was observed in greater frequency among malignant tissue samples, PCa cell lines and xenografts, supporting its role in PCa tumourigenesis. In this study, 84 PCa cases and 15 controls were analysed for ARLTS1 expression status in blood-derived RNA. A statistically significant (p = 0.0037) decrease of ARLTS1 expression in PCa cases was detected. Regulation of ARLTS1 expression was analysed with eQTL (expression quantitative trait loci) methods. Altogether fourteen significant cis-eQTLs affecting the ARLTS1 expression level were found. In addition, epistatic interactions of ARLTS1 genomic variants with genes involved in immune system processes were predicted with the MDR program. In conclusion, this study further supports the role of ARLTS1 as a tumour suppressor gene and reveals that the expression is regulated through variants localised in regulatory regions. PMID:23940804

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

PubMed Central

Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

2016-01-01

Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs, and our experimental data from clinical samples, we discovered broad H3K4me3 (wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity together leading to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Broad H3K4me3 conserved across normal cells may represent pan-cancer tumor suppressors, such as P53 and PTEN, whereas cell-type-specific broad H3K4me3 may indicate cell-identity genes and cell-type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 in cancers is associated with repression of tumor suppressors. Together, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of novel tumor suppressors. PMID:26301496

The epigenome as a therapeutic target in prostate cancer.

PubMed

Perry, Antoinette S; Watson, R William G; Lawler, Mark; Hollywood, Donal

2010-12-01

During cancer development and progression, tumor cells undergo abnormal epigenetic modifications, including DNA methylation, histone deacetylation and nucleosome remodeling. Collectively, these aberrations promote genomic instability and lead to silencing of tumor-suppressor genes and reactivation of oncogenic retroviruses. Epigenetic modifications, therefore, provide exciting new avenues for prostate cancer research. Promoter hypermethylation is widespread during neoplastic transformation of prostate cells, which suggests that restoration of a 'normal' epigenome through treatment with inhibitors of the enzymes involved could be clinically beneficial. Global patterns of histone modifications are also being defined and have been associated with clinical and pathologic predictors of prostate cancer outcome. Although treatment for localized prostate cancer can be curative, the development of successful therapies for the management of castration-resistant metastatic disease is urgently needed. Reactivation of tumor-suppressor genes by demethylating agents and histone deacetylase inhibitors could be a potential treatment option for patients with advanced disease.

Involvement of PSMD10, CDK4, and Tumor Suppressors in Development of Intrahepatic Cholangiocarcinoma of Syrian Golden Hamsters Induced by Clonorchis sinensis and N-Nitrosodimethylamine

PubMed Central

Uddin, Md. Hafiz; Choi, Min-Ho; Kim, Woo Ho; Jang, Ja-June; Hong, Sung-Tae

2015-01-01

Background Clonorchis sinensis is a group-I bio-carcinogen for cholangiocarcinoma (CCA). Although the epidemiological evidence links clonorchiasis and CCA, the underlying molecular mechanism involved in this process is poorly understood. In the present study, we investigated expression of oncogenes and tumor suppressors, including PSMD10, CDK4, p53 and RB in C. sinensis induced hamster CCA model. Methods Different histochemical/immunohistochemical techniques were performed to detect CCA in 4 groups of hamsters: uninfected control (Ctrl.), infected with C. sinensis (Cs), ingested N-nitrosodimethylamine (NDMA), and both Cs infected and NDMA introduced (Cs+NDMA). The liver tissues from all groups were analyzed for gene/protein expressions by quantitative PCR (qPCR) and western blotting. Principal Findings CCA was observed in all hamsters of Cs+NDMA group with well, moderate, and poorly differentiated types measured in 21.8% ± 1.5%, 13.3% ± 1.3%, and 10.8% ± 1.3% of total tissue section areas respectively. All CCA differentiations progressed in a time dependent manner, starting from the 8th week of infection. CCA stroma was characterized with increased collagen type I, mucin, and proliferative cell nuclear antigen (PCNA). The qPCR analysis showed PSMD10, CDK4 and p16INK4 were over-expressed, whereas p53 was under-expressed in the Cs+NDMA group. We observed no change in RB1 at mRNA level but found significant down-regulation of RB protein. The apoptosis related genes, BAX and caspase 9 were found downregulated in the CCA tissue. Gene/protein expressions were matched well with the pathological changes of different groups except the NDMA group. Though the hamsters in the NDMA group showed no marked pathological lesions, we observed over-expression of Akt/PKB and p53 genes proposing molecular interplay in this group which might be related to the CCA initiation in this animal model. Conclusions/Significance The present findings suggest that oncogenes, PSMD10 and CDK4, and tumor suppressors, p53 and RB, are involved in the carcinogenesis process of C. sinensis induced CCA in hamsters. PMID:26313366

Tumor Suppressor Genes: A Key to the Cancer Puzzle?

ERIC Educational Resources Information Center

Oppenheimer, Steven B.

1991-01-01

Author describes developments in understanding of tumor suppressor genes or antioncogenes that he feels is most important breakthrough in solving cancer problem. Describes 1969 starting work of Harris with mouse fibroblast genes and later work of Knudson with retinoblastoma cells. Provides evidence that deletion of chromosome that results in the…

Unique pathway of expression of an opal suppressor phosphoserine tRNA.

PubMed Central

Lee, B J; de la Peña, P; Tobian, J A; Zasloff, M; Hatfield, D

1987-01-01

An opal suppressor phosphoserine tRNA gene is present in single copy in the genomes of higher vertebrates. We have shown that the product of this gene functions as a suppressor in an in vitro assay, and we have proposed that it may donate a modified amino acid directly to protein in response to specific UGA codons. In this report, we show through in vitro and in vivo studies that the human and Xenopus opal suppressor phosphoserine tRNAs are synthesized by a pathway that is, to the best of our knowledge, unlike that of any known eukaryotic tRNA. The primary transcript of this gene does not contain a 5'-leader sequence; and, therefore, transcription of this suppressor is initiated at the first nucleotide within the coding sequence. The 5'-terminal triphosphate, present on the primary transcript, remains intact through 3'-terminal maturation and through subsequent transport of the tRNA to the cytoplasm. The unique biosynthetic pathway of this opal suppressor may underlie its distinctive role in eukaryotic cells. Images PMID:3114749

Role of Tomato Lipoxygenase D in Wound-Induced Jasmonate Biosynthesis and Plant Immunity to Insect Herbivores

PubMed Central

Li, Shuyu; Wang, Bao; Huang, Tingting; Du, Minmin; Sun, Jiaqiang; Kang, Le; Li, Chang-Bao; Li, Chuanyou

2013-01-01

In response to insect attack and mechanical wounding, plants activate the expression of genes involved in various defense-related processes. A fascinating feature of these inducible defenses is their occurrence both locally at the wounding site and systemically in undamaged leaves throughout the plant. Wound-inducible proteinase inhibitors (PIs) in tomato (Solanum lycopersicum) provide an attractive model to understand the signal transduction events leading from localized injury to the systemic expression of defense-related genes. Among the identified intercellular molecules in regulating systemic wound response of tomato are the peptide signal systemin and the oxylipin signal jasmonic acid (JA). The systemin/JA signaling pathway provides a unique opportunity to investigate, in a single experimental system, the mechanism by which peptide and oxylipin signals interact to coordinate plant systemic immunity. Here we describe the characterization of the tomato suppressor of prosystemin-mediated responses8 (spr8) mutant, which was isolated as a suppressor of (pro)systemin-mediated signaling. spr8 plants exhibit a series of JA-dependent immune deficiencies, including the inability to express wound-responsive genes, abnormal development of glandular trichomes, and severely compromised resistance to cotton bollworm (Helicoverpa armigera) and Botrytis cinerea. Map-based cloning studies demonstrate that the spr8 mutant phenotype results from a point mutation in the catalytic domain of TomLoxD, a chloroplast-localized lipoxygenase involved in JA biosynthesis. We present evidence that overexpression of TomLoxD leads to elevated wound-induced JA biosynthesis, increased expression of wound-responsive genes and, therefore, enhanced resistance to insect herbivory attack and necrotrophic pathogen infection. These results indicate that TomLoxD is involved in wound-induced JA biosynthesis and highlight the application potential of this gene for crop protection against insects and pathogens. PMID:24348260

Role of tomato lipoxygenase D in wound-induced jasmonate biosynthesis and plant immunity to insect herbivores.

PubMed

Yan, Liuhua; Zhai, Qingzhe; Wei, Jianing; Li, Shuyu; Wang, Bao; Huang, Tingting; Du, Minmin; Sun, Jiaqiang; Kang, Le; Li, Chang-Bao; Li, Chuanyou

2013-01-01

In response to insect attack and mechanical wounding, plants activate the expression of genes involved in various defense-related processes. A fascinating feature of these inducible defenses is their occurrence both locally at the wounding site and systemically in undamaged leaves throughout the plant. Wound-inducible proteinase inhibitors (PIs) in tomato (Solanum lycopersicum) provide an attractive model to understand the signal transduction events leading from localized injury to the systemic expression of defense-related genes. Among the identified intercellular molecules in regulating systemic wound response of tomato are the peptide signal systemin and the oxylipin signal jasmonic acid (JA). The systemin/JA signaling pathway provides a unique opportunity to investigate, in a single experimental system, the mechanism by which peptide and oxylipin signals interact to coordinate plant systemic immunity. Here we describe the characterization of the tomato suppressor of prosystemin-mediated responses8 (spr8) mutant, which was isolated as a suppressor of (pro)systemin-mediated signaling. spr8 plants exhibit a series of JA-dependent immune deficiencies, including the inability to express wound-responsive genes, abnormal development of glandular trichomes, and severely compromised resistance to cotton bollworm (Helicoverpa armigera) and Botrytis cinerea. Map-based cloning studies demonstrate that the spr8 mutant phenotype results from a point mutation in the catalytic domain of TomLoxD, a chloroplast-localized lipoxygenase involved in JA biosynthesis. We present evidence that overexpression of TomLoxD leads to elevated wound-induced JA biosynthesis, increased expression of wound-responsive genes and, therefore, enhanced resistance to insect herbivory attack and necrotrophic pathogen infection. These results indicate that TomLoxD is involved in wound-induced JA biosynthesis and highlight the application potential of this gene for crop protection against insects and pathogens.

[Immunomorphologic features of epithelial-stromal relationships at hyperplasia and endometrial carcinoma].

PubMed

Bantysh, B B; Paukov, v S; Kogan, E A

2012-01-01

The results of a immunomorphologic comprehensive study of epithelial-stromal relationships in the uterus hyperplasia and endometrial cancer suggest that the suppressor gene of cancer (PTEN) plays a key role in the process of neoplastic transformation of endometrial hyperplasia and adenocarcinoma development. For the first time the existence of two highly differentiated endometrial adenocarcinoma immunophenotype were detected The first one is a PTEN-negative endometrial aedenocarcinoma, characterized by an almost complete inhibition of tumor suppressor gene PTEN in the epithelium of the glands and stromal cell of the tumor The second type is a PTEN-positive endometrial adenocarcinoma, in which epithelial and stromal tumor suppressor gene PTEN activity has retained Based on these results we have formulated a hypothesis about the different types of endometrial hyperplasia morphogenesis and its possible transfer to cervical cancer associated with features of tumor suppressor gene PTEN.

Inference of cancer-specific gene regulatory networks using soft computing rules.

PubMed

Wang, Xiaosheng; Gotoh, Osamu

2010-03-24

Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

Specificity of a Rust Resistance Suppressor on 7DL in the Spring Wheat Cultivar Canthatch.

PubMed

Talajoor, Mina; Jin, Yue; Wan, Anmin; Chen, Xianming; Bhavani, Sridhar; Tabe, Linda; Lagudah, Evans; Huang, Li

2015-04-01

The spring wheat 'Canthatch' has been shown to suppress stem rust resistance genes in the background due to the presence of a suppressor gene located on the long arm of chromosome 7D. However, it is unclear whether the suppressor also suppresses resistance genes against leaf rust and stripe rust. In this study, we investigated the specificity of the resistance suppression. To determine whether the suppression is genome origin specific, chromosome location specific, or rust species or race specific, we introduced 11 known rust resistance genes into the Canthatch background, including resistance to leaf, stripe, or stem rusts, originating from A, B, or D genomes and located on different chromosome homologous groups. F1 plants of each cross were tested with the corresponding rust race, and the infection types were scored and compared with the parents. Our results show that the Canthatch 7DL suppressor only suppressed stem rust resistance genes derived from either the A or B genome, and the pattern of the suppression is gene specific and independent of chromosomal location.

Genetic Characterization of the SufJ Frameshift Suppressor in SALMONELLA TYPHIMURIUM

PubMed Central

Bossi, Lionello; Kohno, Tadahiko; Roth, John R.

1983-01-01

A new suppressor of +1 frameshift mutations has been isolated in Salmonella typhimurium. This suppressor, sufJ, maps at minute 89 on the Salmonella genetic map between the argH and rpo(rif) loci, closely linked to the gene for the ochre suppressor tyrU(supM). The suppressor mutation is dominant to its wild-type allele, consistent with the suppressor phenotype being caused by an altered tRNA species. The sufJ map position coincides with that of a threonine tRNA(ACC/U) gene; the suppressor has been shown to read the related fourbase codons ACCU, ACCC, ACCA.—The ability of sufJ to correct one particular mutation depends on the presence of a hisT mutation which causes a defect in tRNA modification. This requirement is allele specific, since other frameshift mutations can be corrected by sufJ regardless of the state of the hisT locus.—Strains carrying both a sufJ and a hisT mutation are acutely sensitive to growth inhibition by uracil; the inhibition is reversed by arginine. This behavior is characteristic of strains with mutations affecting the arginine-uracil biosynthetic enzyme carbamyl phosphate synthetase. The combination of two mutations affecting tRNA structure may reduce expression of the structural gene for this enzyme (pyrA). PMID:6188650

Novel p53 tumour suppressor mutations in cases of spindle cell sarcoma, pleomorphic sarcoma and fibrosarcoma in cats.

PubMed

Mayr, B; Reifinger, M; Alton, K; Schaffner, G

1998-06-01

Twenty feline neoplasms were sequenced in the region from exons 5 to 8 for the presence of tumour suppressor gene p53 mutations. In a spindle cell sarcoma of the bladder, a missense mutation (codon 164 AAG-->GAG, lysine-->glutamic acid) in exon 5 was detected. In a pleomorphic sarcoma, a 23 bp deletion involving the splicing junction between intron 5 and exon 6 was observed. In a fibrosarcoma, a 6 bp deletion of p53 covering 2 bp of exon 7 and 4 bp of intron 7, including the splicing junction, was found. The study demonstrates three new p53 mutations in different types of sarcomas in cats.

Transcriptional Regulation by KLF6, A Novel Tumor Suppressor Gene in Prostate Cancer, Through Interaction with HATS and HDACS

DTIC Science & Technology

2006-03-01

Frequent inactivation of the tumor suppressor Kruppel like factor 6 (KLF6) in hepatocellular carcinoma . Hepatology, 40:1047-1052, 2004. Studies...p21 by the KLF6 tumor suppressor gene in mouse liver and human hepatocellular carcinoma . Invited resubmission to Oncogene, currently under re-review...prostate, including glioblastoma, and primary hepatocellular carcinoma . REFERENCES 1. Narla G, Heath KE, Reeves HL, Li D, Giono LE

RUNX1 and FOXP3 interplay regulates expression of breast cancer related genes

PubMed Central

Recouvreux, María Sol; Grasso, Esteban Nicolás; Echeverria, Pablo Christian; Rocha-Viegas, Luciana; Castilla, Lucio Hernán; Schere-Levy, Carolina; Tocci, Johanna Melisa; Kordon, Edith Claudia; Rubinstein, Natalia

2016-01-01

Runx1 participation in epithelial mammary cells is still under review. Emerging data indicates that Runx1 could be relevant for breast tumor promotion. However, to date no studies have specifically evaluated the functional contribution of Runx1 to control gene expression in mammary epithelial tumor cells. It has been described that Runx1 activity is defined by protein context interaction. Interestingly, Foxp3 is a breast tumor suppressor gene. Here we show that endogenous Runx1 and Foxp3 physically interact in normal mammary cells and this interaction blocks Runx1 transcriptional activity. Furthermore we demonstrate that Runx1 is able to bind to R-spondin 3 (RSPO3) and Gap Junction protein Alpha 1 (GJA1) promoters. This binding upregulates Rspo3 oncogene expression and downregulates GJA1 tumor suppressor gene expression in a Foxp3-dependent manner. Moreover, reduced Runx1 transcriptional activity decreases tumor cell migration properties. Collectively, these data provide evidence of a new mechanism for breast tumor gene expression regulation, in which Runx1 and Foxp3 physically interact to control mammary epithelial cell gene expression fate. Our work suggests for the first time that Runx1 could be involved in breast tumor progression depending on Foxp3 availability. PMID:26735887

RUNX1 and FOXP3 interplay regulates expression of breast cancer related genes.

PubMed

Recouvreux, María Sol; Grasso, Esteban Nicolás; Echeverria, Pablo Christian; Rocha-Viegas, Luciana; Castilla, Lucio Hernán; Schere-Levy, Carolina; Tocci, Johanna Melisa; Kordon, Edith Claudia; Rubinstein, Natalia

2016-02-09

Runx1 participation in epithelial mammary cells is still under review. Emerging data indicates that Runx1 could be relevant for breast tumor promotion. However, to date no studies have specifically evaluated the functional contribution of Runx1 to control gene expression in mammary epithelial tumor cells. It has been described that Runx1 activity is defined by protein context interaction. Interestingly, Foxp3 is a breast tumor suppressor gene. Here we show that endogenous Runx1 and Foxp3 physically interact in normal mammary cells and this interaction blocks Runx1 transcriptional activity. Furthermore we demonstrate that Runx1 is able to bind to R-spondin 3 (RSPO3) and Gap Junction protein Alpha 1 (GJA1) promoters. This binding upregulates Rspo3 oncogene expression and downregulates GJA1 tumor suppressor gene expression in a Foxp3-dependent manner. Moreover, reduced Runx1 transcriptional activity decreases tumor cell migration properties. Collectively, these data provide evidence of a new mechanism for breast tumor gene expression regulation, in which Runx1 and Foxp3 physically interact to control mammary epithelial cell gene expression fate. Our work suggests for the first time that Runx1 could be involved in breast tumor progression depending on Foxp3 availability.

Problems in mechanistic theoretical models for cell transformation by ionizing radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatterjee, A.; Holley, W.R.

1991-10-01

A mechanistic model based on yields of double strand breaks has been developed to determine the dose response curves for cell transformation frequencies. At its present stage the model is applicable to immortal cell lines and to various qualities (X-rays, Neon and Iron) of ionizing radiation. Presently, we have considered four types of processes which can lead to activation phenomena: (1) point mutation events on a regulatory segment of selected oncogenes, (2) inactivation of suppressor genes, through point mutation, (3) deletion of a suppressor gene by a single track, and (4) deletion of a suppressor gene by two tracks.

Aberrant DNA Methylation as a Biomarker and a Therapeutic Target of Cholangiocarcinoma.

PubMed

Nakaoka, Toshiaki; Saito, Yoshimasa; Saito, Hidetsugu

2017-05-23

Cholangiocarcinoma is an epithelial malignancy arising in the region between the intrahepatic bile ducts and the ampulla of Vater at the distal end of the common bile duct. The effect of current chemotherapy regimens against cholangiocarcinoma is limited, and the prognosis of patients with cholangiocarcinoma is poor. Aberrant DNA methylation and histone modification induce silencing of tumor suppressor genes and chromosomal instability during carcinogenesis. Studies have shown that the tumor suppressor genes and microRNAs (miRNAs) including MLH1 , p14 , p16 , death-associated protein kinase ( DAPK ), miR-370 and miR-376c are frequently methylated in cholangiocarcinoma. Silencing of these tumor suppressor genes and miRNAs plays critical roles in the initiation and progression of cholangiocarcinoma. In addition, recent studies have demonstrated that DNA methylation inhibitors induce expression of endogenous retroviruses and exert the anti-tumor effect of via an anti-viral immune response. Aberrant DNA methylation of tumor suppressor genes and miRNAs could be a powerful biomarker for the diagnosis and treatment of cholangiocarcinoma. Epigenetic therapy with DNA methylation inhibitors holds considerable promise for the treatment of cholangiocarcinoma through the reactivation of tumor suppressor genes and miRNAs as well as the induction of an anti-viral immune response.

Aberrant DNA Methylation as a Biomarker and a Therapeutic Target of Cholangiocarcinoma

PubMed Central

Nakaoka, Toshiaki; Saito, Yoshimasa; Saito, Hidetsugu

2017-01-01

Cholangiocarcinoma is an epithelial malignancy arising in the region between the intrahepatic bile ducts and the ampulla of Vater at the distal end of the common bile duct. The effect of current chemotherapy regimens against cholangiocarcinoma is limited, and the prognosis of patients with cholangiocarcinoma is poor. Aberrant DNA methylation and histone modification induce silencing of tumor suppressor genes and chromosomal instability during carcinogenesis. Studies have shown that the tumor suppressor genes and microRNAs (miRNAs) including MLH1, p14, p16, death-associated protein kinase (DAPK), miR-370 and miR-376c are frequently methylated in cholangiocarcinoma. Silencing of these tumor suppressor genes and miRNAs plays critical roles in the initiation and progression of cholangiocarcinoma. In addition, recent studies have demonstrated that DNA methylation inhibitors induce expression of endogenous retroviruses and exert the anti-tumor effect of via an anti-viral immune response. Aberrant DNA methylation of tumor suppressor genes and miRNAs could be a powerful biomarker for the diagnosis and treatment of cholangiocarcinoma. Epigenetic therapy with DNA methylation inhibitors holds considerable promise for the treatment of cholangiocarcinoma through the reactivation of tumor suppressor genes and miRNAs as well as the induction of an anti-viral immune response. PMID:28545228

The insulator protein Suppressor of Hairy-wing is an essential transcriptional repressor in the Drosophila ovary.

PubMed

Soshnev, Alexey A; Baxley, Ryan M; Manak, J Robert; Tan, Kai; Geyer, Pamela K

2013-09-01

Suppressor of Hairy-wing [Su(Hw)] is a DNA-binding factor required for gypsy insulator function and female germline development in Drosophila. The insulator function of the gypsy retrotransposon depends on Su(Hw) binding to clustered Su(Hw) binding sites (SBSs) and recruitment of the insulator proteins Centrosomal Protein 190 kD (CP190) and Modifier of mdg4 67.2 kD (Mod67.2). By contrast, the Su(Hw) germline function involves binding to non-clustered SBSs and does not require CP190 or Mod67.2. Here, we identify Su(Hw) target genes, using genome-wide analyses in the ovary to uncover genes with an ovary-bound SBS that are misregulated upon Su(Hw) loss. Most Su(Hw) target genes demonstrate enriched expression in the wild-type CNS. Loss of Su(Hw) leads to increased expression of these CNS-enriched target genes in the ovary and other tissues, suggesting that Su(Hw) is a repressor of neural genes in non-neural tissues. Among the Su(Hw) target genes is RNA-binding protein 9 (Rbp9), a member of the ELAV/Hu gene family. Su(Hw) regulation of Rbp9 appears to be insulator independent, as Rbp9 expression is unchanged in a genetic background that compromises the functions of the CP190 and Mod67.2 insulator proteins, even though both localize to Rbp9 SBSs. Rbp9 misregulation is central to su(Hw)(-/-) sterility, as Rbp9(+/-), su(Hw)(-/-) females are fertile. Eggs produced by Rbp9(+/-), su(Hw)(-/-) females show patterning defects, revealing a somatic requirement for Su(Hw) in the ovary. Our studies demonstrate that Su(Hw) is a versatile transcriptional regulatory protein with an essential developmental function involving transcriptional repression.

The candidate tumor suppressor gene, RASSF1A, from human chromosome 3p21.3 is involved in kidney tumorigenesis

PubMed Central

Dreijerink, Koen; Braga, Eleonora; Kuzmin, Igor; Geil, Laura; Duh, Fuh-Mei; Angeloni, Debora; Zbar, Berton; Lerman, Michael I.; Stanbridge, Eric J.; Minna, John D.; Protopopov, Alexei; Li, Jingfeng; Kashuba, Vladimir; Klein, George; Zabarovsky, Eugene R.

2001-01-01

Clear cell-type renal cell carcinomas (clear RCC) are characterized almost universally by loss of heterozygosity on chromosome 3p, which usually involves any combination of three regions: 3p25-p26 (harboring the VHL gene), 3p12-p14.2 (containing the FHIT gene), and 3p21-p22, implying inactivation of the resident tumor-suppressor genes (TSGs). For the 3p21-p22 region, the affected TSGs remain, at present, unknown. Recently, the RAS association family 1 gene (isoform RASSF1A), located at 3p21.3, has been identified as a candidate lung and breast TSG. In this report, we demonstrate aberrant silencing by hypermethylation of RASSF1A in both VHL-caused clear RCC tumors and clear RCC without VHL inactivation. We found hypermethylation of RASSF1A's GC-rich putative promoter region in most of analyzed samples, including 39 of 43 primary tumors (91%). The promoter was methylated partially or completely in all 18 RCC cell lines analyzed. Methylation of the GC-rich putative RASSF1A promoter region and loss of transcription of the corresponding mRNA were related causally. RASSF1A expression was reactivated after treatment with 5-aza-2′-deoxycytidine. Forced expression of RASSF1A transcripts in KRC/Y, a renal carcinoma cell line containing a normal and expressed VHL gene, suppressed growth on plastic dishes and anchorage-independent colony formation in soft agar. Mutant RASSF1A had reduced growth suppression activity significantly. These data suggest that RASSF1A is the candidate renal TSG gene for the 3p21.3 region. PMID:11390984

Oligonucleotide DNA microarray profiling of lung adenocarcinoma revealed significant downregulation and deletions of vasoactive intestinal peptide receptor 1.

PubMed

Mlakar, Vid; Strazisar, Mojca; Sok, Mihael; Glavac, Damjan

2010-06-01

The purpose of this study was to find novel gene(s) involved in the development of lung adenocarcinoma (AD). Using DNA microarrays, we identified 31 up-regulated and 8 downregulated genes in 12 AD. Real time PCR was used to measure expression of VIPR1 and SPP1 mRNA and possible losses or gains of genes in 32 AD. We describe significant upregulation of the SPP1 gene, downregulation of VIPR1, and losses of the VIPR1 gene. Our findings complement a proposed VIPR1 tumor suppressor role, in which deletions in the 3p22 chromosome region are an important mechanism leading to loss of the VIPR1 gene.

A Y-Encoded Suppressor of Feminization Arose via Lineage-Specific Duplication of a Cytokinin Response Regulator in Kiwifruit[OPEN

PubMed Central

Ohtani, Haruka; Morimoto, Takuya; Beppu, Kenji; Kataoka, Ikuo

2018-01-01

Dioecy, the presence of male and female flowers on distinct individuals, has evolved independently in multiple plant lineages, and the genes involved in this differential development are just starting to be uncovered in a few species. Here, we used genomic approaches to investigate this pathway in kiwifruits (genus Actinidia). Genome-wide cataloging of male-specific subsequences, combined with transcriptome analysis, led to the identification of a type-C cytokinin response regulator as a potential sex determinant gene in this genus. Functional transgenic analyses in two model systems, Arabidopsis thaliana and Nicotiana tabacum, indicated that this gene acts as a dominant suppressor of carpel development, prompting us to name it Shy Girl (SyGI). Evolutionary analyses in a panel of Actinidia species revealed that SyGI is located in the Y-specific region of the genome and probably arose from a lineage-specific gene duplication. Comparisons with the duplicated autosomal counterpart, and with orthologs from other angiosperms, suggest that the SyGI-specific duplication and subsequent evolution of cis-elements may have played a key role in the acquisition of separate sexes in this species. PMID:29626069

THE ROLE OF THE RETINOBLASTOMA/E2F1 TUMOR SUPPRESSOR PATHWAY IN THE LESION RECOGNITION STEP OF NUCLEOTIDE EXCISION REPAIR

PubMed Central

Lin, Patrick S.; McPherson, Lisa A.; Chen, Aubrey Y.; Sage, Julien; Ford, James M.

2009-01-01

The retinoblastoma Rb/E2F tumor suppressor pathway plays a major role in the regulation of mammalian cell cycle progression. The pRb protein, along with closely related proteins p107 and p130, exerts its anti-proliferative effects by binding to the E2F family of transcription factors known to regulate essential genes throughout the cell cycle. We sought to investigate the role of the Rb/E2F1 pathway in the lesion recognition step of nucleotide excision repair (NER) in mouse embryonic fibroblasts (MEFs). Rb−/−;p107−/−;p130−/− MEFs repaired both cyclobutane pyrimidine dimers (CPD) and 6-4 photoproducts (6-4PPs) at higher efficiency than did wildtype cells following UV-C irradiation. The expression of damaged DNA binding gene DDB2 involved in the DNA lesion recognition step was elevated in the Rb family-deficient MEFs. To determine if the enhanced DNA repair in the absence of the Rb gene family is due to the derepression of E2F1, we assayed the ability of E2F1-deficient cells to repair damaged DNA and demonstrated that E2F1−/− MEFs are impaired for the removal of both CPDs and 6-4PPs. Furthermore, wildtype cells induced a higher expression of DDB2 and xeroderma pigmentosum gene XPC transcript levels than did E2F1−/− cells following UV-C irradiation. Using an E2F SiteScan algorithm, we uncovered a putative E2F-responsive element in the XPC promoter upstream of the transcription start site. We showed with chromatin immunoprecipitation assays the binding of E2F1 to the XPC promoter in a UV-dependent manner, suggesting that E2F1 is a transcriptional regulator of XPC. Our study identifies a novel E2F1 gene target and further supports the growing body of evidence that the Rb/E2F1 tumor suppressor pathway is involved in the regulation of the DNA lesion recognition step of nucleotide excision repair. PMID:19376752

Tumor suppressor genes are larger than apoptosis-effector genes and have more regions of active chromatin: Connection to a stochastic paradigm for sequential gene expression programs.

PubMed

Garcia, Marlene; Mauro, James A; Ramsamooj, Michael; Blanck, George

2015-08-03

Apoptosis- and proliferation-effector genes are substantially regulated by the same transactivators, with E2F-1 and Oct-1 being notable examples. The larger proliferation-effector genes have more binding sites for the transactivators that regulate both sets of genes, and proliferation-effector genes have more regions of active chromatin, i.e, DNase I hypersensitive and histone 3, lysine-4 trimethylation sites. Thus, the size differences between the 2 classes of genes suggest a transcriptional regulation paradigm whereby the accumulation of transcription factors that regulate both sets of genes, merely as an aspect of stochastic behavior, accumulate first on the larger proliferation-effector gene "traps," and then accumulate on the apoptosis effector genes, thereby effecting sequential activation of the 2 different gene sets. As IRF-1 and p53 levels increase, tumor suppressor proteins are first activated, followed by the activation of apoptosis-effector genes, for example during S-phase pausing for DNA repair. Tumor suppressor genes are larger than apoptosis-effector genes and have more IRF-1 and p53 binding sites, thereby likewise suggesting a paradigm for transcription sequencing based on stochastic interactions of transcription factors with different gene classes. In this report, using the ENCODE database, we determined that tumor suppressor genes have a greater number of open chromatin regions and histone 3 lysine-4 trimethylation sites, consistent with the idea that a larger gene size can facilitate earlier transcriptional activation via the inclusion of more transactivator binding sites.

Amino acid sequence motifs essential for P0-mediated suppression of RNA silencing in an isolate of potato leafroll virus from Inner Mongolia.

PubMed

Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2014-06-01

Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.

Analysis of alterations of oncogenes and tumor suppressor genes in chronic lymphocytic leukemia.

PubMed Central

Gaidano, G.; Newcomb, E. W.; Gong, J. Z.; Tassi, V.; Neri, A.; Cortelezzi, A.; Calori, R.; Baldini, L.; Dalla-Favera, R.

1994-01-01

B cell chronic lymphocytic leukemia (B-CLL) represents the most frequent adult leukemia in the Western world. The molecular pathogenesis of B-CLL is largely unknown. Although initial reports on small panels of cases had suggested a role for Bcl-1 and Bcl-2 oncogene activation in B-CLL, later investigations failed to confirm these data. Among tumor suppressor genes, p53 mutations have been reported in a fraction of cases. In this study, we have attempted a conclusive definition of the involvement of dominantly acting oncogenes (Bcl-1 and Bcl-2) and tumor suppressor loci (p53, 6q-) in 100 cases of B-CLL selected for their CD5 positivity and Rai's stage (0 to IV). Rearrangements of Bcl-1 and Bcl-2 and deletions of 6q and 17p were analyzed by Southern blot using multiple probes. Mutational analysis (single strand conformation polymorphism and polymerase chain reaction direct sequencing) was used to assay p53 inactivation. No alterations of Bcl-1 or Bcl-2 were detected in the 100 cases tested. Mutations of p53 were found in 10/100 cases without any significant association with clinical stage. Deletions of 6q were present in 4/100 cases. Overall, our data indicate that: 1) contrary to previous reports, Bcl-1 and Bcl-2 rearrangements are not involved in CD5+ B-CLL pathogenesis and 2) p53 mutations are present in 10% of cases at all stages of the disease. Images Figure 1 Figure 2 Figure 3 PMID:8203469

Sex determination in papaya.

PubMed

Ming, Ray; Yu, Qingyi; Moore, Paul H

2007-06-01

Sex determination is an intriguing system in trioecious papaya. Over the past seven decades various hypotheses, based on the knowledge and information available at the time, have been proposed to explain the genetics of the papaya's sex determination. These include a single gene with three alleles, a group of closely linked genes, a genic balance of sex chromosome over autosomes, classical XY chromosomes, and regulatory elements of the flower development pathway. Recent advancements in genomic technology make it possible to characterize the genomic region involved in sex determination at the molecular level. High density linkage mapping validated the hypothesis that predicted recombination suppression at the sex determination locus. Physical mapping and sample sequencing of the non-recombination region led to the conclusion that sex determination is controlled by a pair of primitive sex chromosomes with a small male-specific region (MSY) of the Y chromosome. We now postulate that two sex determination genes control the sex determination pathway. One, a feminizing or stamen suppressor gene, causes stamen abortion before or at flower inception while the other, a masculinizing or carpel suppressor gene, causes carpel abortion at a later flower developmental stage. Detailed physical mapping is beginning to reveal structural details about the sex determination region and sequencing is expected to uncover candidate sex determining genes. Cloning of the sex determination genes and understanding the sex determination process could have profound application in papaya production.

A cosmid and cDNA fine physical map of a human chromosome 13q14 region frequently lost in B-cell chronic lymphocytic leukemia and identification of a new putative tumor suppressor gene, Leu5.

PubMed

Kapanadze, B; Kashuba, V; Baranova, A; Rasool, O; van Everdink, W; Liu, Y; Syomov, A; Corcoran, M; Poltaraus, A; Brodyansky, V; Syomova, N; Kazakov, A; Ibbotson, R; van den Berg, A; Gizatullin, R; Fedorova, L; Sulimova, G; Zelenin, A; Deaven, L; Lehrach, H; Grander, D; Buys, C; Oscier, D; Zabarovsky, E R; Einhorn, S; Yankovsky, N

1998-04-17

B-cell chronic lymphocytic leukemia (B-CLL) is a human hematological neoplastic disease often associated with the loss of a chromosome 13 region between RB1 gene and locus D13S25. A new tumor suppressor gene (TSG) may be located in the region. A cosmid contig has been constructed between the loci D13S1168 (WI9598) and D13S25 (H2-42), which corresponds to the minimal region shared by B-CLL associated deletions. The contig includes more than 200 LANL and ICRF cosmid clones covering 620 kb. Three cDNAs likely corresponding to three different genes have been found in the minimally deleted region, sequenced and mapped against the contigged cosmids. cDNA clone 10k4 as well as a chimeric clone 13g3, codes for a zinc-finger domain of the RING type and shares homology to some known genes involved in tumorigenesis (RET finger protein, BRCA1) and embryogenesis (MID1). We have termed the gene corresponding to 10k4/13g3 clones LEU5. This is the first gene with homology to known TSGs which has been found in the region of B-CLL rearrangements.

The Wnt5A/Protein Kinase C Pathway Mediates Motility in Melanoma Cells via the Inhibition of Metastasis Suppressors and Initiation of an Epithelial to Mesenchymal Transition*S

PubMed Central

Dissanayake, Samudra K.; Wade, Michael; Johnson, Carrie E.; O’Connell, Michael P.; Leotlela, Poloko D.; French, Amanda D.; Shah, Kavita V.; Hewitt, Kyle J.; Rosenthal, Devin T.; Indig, Fred E.; Jiang, Yuan; Nickoloff, Brian J.; Taub, Dennis D.; Trent, Jeffrey M.; Moon, Randall T.; Bittner, Michael; Weeraratna, Ashani T.

2008-01-01

We have shown that Wnt5A increases the motility of melanoma cells. To explore cellular pathways involving Wnt5A, we compared gain-of-function (WNT5A stable transfectants) versus loss-of-function (siRNA knockdown) of WNT5A by microarray analysis. Increasing WNT5A suppressed the expression of several genes, which were re-expressed after small interference RNA-mediated knockdown of WNT5A. Genes affected by WNT5A include KISS-1, a metastasis suppressor, and CD44, involved in tumor cell homing during metastasis. This could be validated at the protein level using both small interference RNA and recombinant Wnt5A (rWnt5A). Among the genes up-regulated by WNT5A was the gene vimentin, associated with an epithelial to mesenchymal transition (EMT), which involves decreases in E-cadherin, due to up-regulation of the transcriptional repressor, Snail. rWnt5A treatment increases Snail and vimentin expression, and decreases E-cadherin, even in the presence of dominant-negativeTCF4, suggesting that this activation is independent of Wnt/β-catenin signaling. Because Wnt5A can signal via protein kinase C (PKC), the role of PKC in Wnt5A-mediated motility and EMT was also assessed using PKC inhibition and activation studies. Treating cells expressing low levels of Wnt5A with phorbol ester increased Snail expression inhibiting PKC in cells expressing high levels of Wnt5A decreased Snail. Furthermore, inhibition of PKC before Wnt5A treatment blocked Snail expression, implying that Wnt5A can potentiate melanoma metastasis via the induction of EMT in a PKC-dependent manner. PMID:17426020

Molecular chaperone Hsp27 regulates the Hippo tumor suppressor pathway in cancer

PubMed Central

Vahid, Sepideh; Thaper, Daksh; Gibson, Kate F.; Bishop, Jennifer L.; Zoubeidi, Amina

2016-01-01

Heat shock protein 27 (Hsp27) is a molecular chaperone highly expressed in aggressive cancers, where it is involved in numerous pro-tumorigenic signaling pathways. Using functional genomics we identified for the first time that Hsp27 regulates the gene signature of transcriptional co-activators YAP and TAZ, which are negatively regulated by the Hippo Tumor Suppressor pathway. The Hippo pathway inactivates YAP by phosphorylating and increasing its cytoplasmic retention with the 14.3.3 proteins. Gain and loss of function experiments in prostate, breast and lung cancer cells showed that Hsp27 knockdown induced YAP phosphorylation and cytoplasmic localization while overexpression of Hsp27 displayed opposite results. Mechanistically, Hsp27 regulates the Hippo pathway by accelerating the proteasomal degradation of ubiquitinated MST1, the core Hippo kinase, resulting in reduced phosphorylation/activity of LATS1 and MOB1, its downstream effectors. Importantly, our in vitro results were supported by data from human tumors; clinically, high expression of Hsp27 in prostate tumors is correlated with increased expression of YAP gene signature and reduced phosphorylation of YAP in lung and invasive breast cancer clinical samples. This study reveals for the first time a link between Hsp27 and the Hippo cascade, providing a novel mechanism of deregulation of this tumor suppressor pathway across multiple cancers. PMID:27555231

Molecular chaperone Hsp27 regulates the Hippo tumor suppressor pathway in cancer.

PubMed

Vahid, Sepideh; Thaper, Daksh; Gibson, Kate F; Bishop, Jennifer L; Zoubeidi, Amina

2016-08-24

Heat shock protein 27 (Hsp27) is a molecular chaperone highly expressed in aggressive cancers, where it is involved in numerous pro-tumorigenic signaling pathways. Using functional genomics we identified for the first time that Hsp27 regulates the gene signature of transcriptional co-activators YAP and TAZ, which are negatively regulated by the Hippo Tumor Suppressor pathway. The Hippo pathway inactivates YAP by phosphorylating and increasing its cytoplasmic retention with the 14.3.3 proteins. Gain and loss of function experiments in prostate, breast and lung cancer cells showed that Hsp27 knockdown induced YAP phosphorylation and cytoplasmic localization while overexpression of Hsp27 displayed opposite results. Mechanistically, Hsp27 regulates the Hippo pathway by accelerating the proteasomal degradation of ubiquitinated MST1, the core Hippo kinase, resulting in reduced phosphorylation/activity of LATS1 and MOB1, its downstream effectors. Importantly, our in vitro results were supported by data from human tumors; clinically, high expression of Hsp27 in prostate tumors is correlated with increased expression of YAP gene signature and reduced phosphorylation of YAP in lung and invasive breast cancer clinical samples. This study reveals for the first time a link between Hsp27 and the Hippo cascade, providing a novel mechanism of deregulation of this tumor suppressor pathway across multiple cancers.

Allelotype analysis of chemically induced squamous cell carcinomas in F(1) hybrids of two inbred mouse strains with different susceptibility to tumor progression.

PubMed

Stern, M C; Benavides, F; Klingelberger, E A; Conti, C J

2000-07-01

Loss of heterozygosity (LOH) at specific chromosomal loci is generally considered indirect evidence for the presence of putative suppressor genes. Allelotyping of tumors using polymorphic markers distributed throughout the entire genome allows the analysis of specific allelic losses. In the field of chemical carcinogenesis, the outbred SENCAR mouse has been commonly used to analyze the multistage nature of skin tumor development. In the study reported here we generated F(1) hybrids between two inbred strains (SENCARB/Pt and SSIN/Sprd) derived from the SENCAR stock that differ in their susceptibility to tumor progression. We typed 24 7, 12-dimethylbenz[a]anthracene and 12-O-tetradecanoylphorbol-13-acetate-induced squamous cell carcinomas for LOH using 56 microsatellite markers distributed among all autosomal chromosomes. The highest percentage of LOH, 78%, was found on chromosome 7, but there was no preferential loss of one particular allele, indicating that the putative suppressor genes found in this area are not involved in genetic susceptibility. High levels of LOH were also found on chromosomes 16 (39%), 6 (29%), 4 (25%), 9 (25%), 14 (22%), 10 (20%) and 19 (20%), but with no preferential loss of the alleles of one strain. The chromosomal regions with LOH on mouse chromosomes 4, 6, 7, 9, 10, 14, 16 and 19 correspond to regions in the human genome where LOH has been reported and have been suggested to harbor tumor suppressor genes.

Enhanced Transgene Expression in Sugarcane by Co-Expression of Virus-Encoded RNA Silencing Suppressors

PubMed Central

Park, Jong-Won; Beyene, Getu; Buenrostro-Nava, Marco T.; Molina, Joe; Wang, Xiaofeng; Ciomperlik, Jessica J.; Manabayeva, Shuga A.; Alvarado, Veria Y.; Rathore, Keerti S.; Scholthof, Herman B.; Mirkov, T. Erik

2013-01-01

Post-transcriptional gene silencing is commonly observed in polyploid species and often poses a major limitation to plant improvement via biotechnology. Five plant viral suppressors of RNA silencing were evaluated for their ability to counteract gene silencing and enhance the expression of the Enhanced Yellow Fluorescent Protein (EYFP) or the β-glucuronidase (GUS) reporter gene in sugarcane, a major sugar and biomass producing polyploid. Functionality of these suppressors was first verified in Nicotiana benthamiana and onion epidermal cells, and later tested by transient expression in sugarcane young leaf segments and protoplasts. In young leaf segments co-expressing a suppressor, EYFP reached its maximum expression at 48–96 h post-DNA introduction and maintained its peak expression for a longer time compared with that in the absence of a suppressor. Among the five suppressors, Tomato bushy stunt virus-encoded P19 and Barley stripe mosaic virus-encoded γb were the most efficient. Co-expression with P19 and γb enhanced EYFP expression 4.6-fold and 3.6-fold in young leaf segments, and GUS activity 2.3-fold and 2.4-fold in protoplasts compared with those in the absence of a suppressor, respectively. In transgenic sugarcane, co-expression of GUS and P19 suppressor showed the highest accumulation of GUS levels with an average of 2.7-fold more than when GUS was expressed alone, with no detrimental phenotypic effects. The two established transient expression assays, based on young leaf segments and protoplasts, and confirmed by stable transgene expression, offer a rapid versatile system to verify the efficiency of RNA silencing suppressors that proved to be valuable in enhancing and stabilizing transgene expression in sugarcane. PMID:23799071

Tumor Suppression and Promotion by Autophagy

PubMed Central

Ávalos, Yenniffer; Canales, Jimena; Criollo, Alfredo; Quest, Andrew F. G.

2014-01-01

Autophagy is a highly regulated catabolic process that involves lysosomal degradation of proteins and organelles, mostly mitochondria, for the maintenance of cellular homeostasis and reduction of metabolic stress. Problems in the execution of this process are linked to different pathological conditions, such as neurodegeneration, aging, and cancer. Many of the proteins that regulate autophagy are either oncogenes or tumor suppressor proteins. Specifically, tumor suppressor genes that negatively regulate mTOR, such as PTEN, AMPK, LKB1, and TSC1/2 stimulate autophagy while, conversely, oncogenes that activate mTOR, such as class I PI3K, Ras, Rheb, and AKT, inhibit autophagy, suggesting that autophagy is a tumor suppressor mechanism. Consistent with this hypothesis, the inhibition of autophagy promotes oxidative stress, genomic instability, and tumorigenesis. Nevertheless, autophagy also functions as a cytoprotective mechanism under stress conditions, including hypoxia and nutrient starvation, that promotes tumor growth and resistance to chemotherapy in established tumors. Here, in this brief review, we will focus the discussion on this ambiguous role of autophagy in the development and progression of cancer. PMID:25328887

Tumor suppression and promotion by autophagy.

PubMed

Ávalos, Yenniffer; Canales, Jimena; Bravo-Sagua, Roberto; Criollo, Alfredo; Lavandero, Sergio; Quest, Andrew F G

2014-01-01

Autophagy is a highly regulated catabolic process that involves lysosomal degradation of proteins and organelles, mostly mitochondria, for the maintenance of cellular homeostasis and reduction of metabolic stress. Problems in the execution of this process are linked to different pathological conditions, such as neurodegeneration, aging, and cancer. Many of the proteins that regulate autophagy are either oncogenes or tumor suppressor proteins. Specifically, tumor suppressor genes that negatively regulate mTOR, such as PTEN, AMPK, LKB1, and TSC1/2 stimulate autophagy while, conversely, oncogenes that activate mTOR, such as class I PI3K, Ras, Rheb, and AKT, inhibit autophagy, suggesting that autophagy is a tumor suppressor mechanism. Consistent with this hypothesis, the inhibition of autophagy promotes oxidative stress, genomic instability, and tumorigenesis. Nevertheless, autophagy also functions as a cytoprotective mechanism under stress conditions, including hypoxia and nutrient starvation, that promotes tumor growth and resistance to chemotherapy in established tumors. Here, in this brief review, we will focus the discussion on this ambiguous role of autophagy in the development and progression of cancer.

Mutations in a signal sequence for the thylakoid membrane identify multiple protein transport pathways and nuclear suppressors

PubMed Central

1994-01-01

The apparatus that permits protein translocation across the internal thylakoid membranes of chloroplasts is completely unknown, even though these membranes have been the subject of extensive biochemical analysis. We have used a genetic approach to characterize the translocation of Chlamydomonas cytochrome f, a chloroplast-encoded protein that spans the thylakoid once. Mutations in the hydrophobic core of the cytochrome f signal sequence inhibit the accumulation of cytochrome f, lead to an accumulation of precursor, and impair the ability of Chlamydomonas cells to grow photosynthetically. One hydrophobic core mutant also reduces the accumulation of other thylakoid membrane proteins, but not those that translocate completely across the membrane. These results suggest that the signal sequence of cytochrome f is required and is involved in one of multiple insertion pathways. Suppressors of two signal peptide mutations describe at least two nuclear genes whose products likely describe the translocation apparatus, and selected second-site chloroplast suppressors further define regions of the cytochrome f signal peptide. PMID:8034740

Role of novel histone modifications in cancer

PubMed Central

Shanmugam, Muthu K.; Arfuso, Frank; Arumugam, Surendar; Chinnathambi, Arunachalam; Jinsong, Bian; Warrier, Sudha; Wang, Ling Zhi; Kumar, Alan Prem; Ahn, Kwang Seok; Sethi, Gautam; Lakshmanan, Manikandan

2018-01-01

Oncogenesis is a multistep process mediated by a variety of factors including epigenetic modifications. Global epigenetic post-translational modifications have been detected in almost all cancers types. Epigenetic changes appear briefly and do not involve permanent changes to the primary DNA sequence. These epigenetic modifications occur in key oncogenes, tumor suppressor genes, and transcription factors, leading to cancer initiation and progression. The most commonly observed epigenetic changes include DNA methylation, histone lysine methylation and demethylation, histone lysine acetylation and deacetylation. However, there are several other novel post-translational modifications that have been observed in recent times such as neddylation, sumoylation, glycosylation, phosphorylation, poly-ADP ribosylation, ubiquitination as well as transcriptional regulation and these have been briefly discussed in this article. We have also highlighted the diverse epigenetic changes that occur during the process of tumorigenesis and described the role of histone modifications that can occur on tumor suppressor genes as well as oncogenes, which regulate tumorigenesis and can thus form the basis of novel strategies for cancer therapy. PMID:29541423

Driver Fusions and Their Implications in the Development and Treatment of Human Cancers.

PubMed

Gao, Qingsong; Liang, Wen-Wei; Foltz, Steven M; Mutharasu, Gnanavel; Jayasinghe, Reyka G; Cao, Song; Liao, Wen-Wei; Reynolds, Sheila M; Wyczalkowski, Matthew A; Yao, Lijun; Yu, Lihua; Sun, Sam Q; Chen, Ken; Lazar, Alexander J; Fields, Ryan C; Wendl, Michael C; Van Tine, Brian A; Vij, Ravi; Chen, Feng; Nykter, Matti; Shmulevich, Ilya; Ding, Li

2018-04-03

Gene fusions represent an important class of somatic alterations in cancer. We systematically investigated fusions in 9,624 tumors across 33 cancer types using multiple fusion calling tools. We identified a total of 25,664 fusions, with a 63% validation rate. Integration of gene expression, copy number, and fusion annotation data revealed that fusions involving oncogenes tend to exhibit increased expression, whereas fusions involving tumor suppressors have the opposite effect. For fusions involving kinases, we found 1,275 with an intact kinase domain, the proportion of which varied significantly across cancer types. Our study suggests that fusions drive the development of 16.5% of cancer cases and function as the sole driver in more than 1% of them. Finally, we identified druggable fusions involving genes such as TMPRSS2, RET, FGFR3, ALK, and ESR1 in 6.0% of cases, and we predicted immunogenic peptides, suggesting that fusions may provide leads for targeted drug and immune therapy. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Generation Of A Mouse Model For Schwannomatosis

DTIC Science & Technology

2010-09-01

TITLE: Generation of a Mouse Model for Schwannomatosis PRINCIPAL INVESTIGATOR: Long-Sheng Chang, Ph.D. CONTRACTING ORGANIZATION: The...Annual 3. DATES COVERED (From - To) 1 Sep 2009 - 31 Aug 2010 4. TITLE AND SUBTITLE Generation of a Mouse Model for Schwannomatosis 5a. CONTRACT...hypothesis involving inactivation of both the INI1/SNF5 and NF2 tumor suppressor genes in the formation of schwannomatosis -associated tumors. To

Somatic mutations affect key pathways in lung adenocarcinoma

PubMed Central

Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

2009-01-01

Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

Expression of the 12-oxophytodienoic acid 10,11-reductase gene in the compatible interaction between pea and fungal pathogen.

PubMed

Ishiga, Yasuhiro; Funato, Akiko; Tachiki, Tomoyuki; Toyoda, Kazuhiro; Shiraishi, Tomonori; Yamada, Tetsuji; Ichinose, Yuki

2002-10-01

Suppressors produced by Mycosphaerella pinodes are glycopeptides to block pea defense responses induced by elicitors. A clone, S64, was isolated as cDNA for suppressor-inducible gene from pea epicotyls. The treatment of pea epicotyls with suppressor alone induced an increase of S64 mRNA within 1 h, and it reached a maximum level at 3 h after treatment. The induction was not affected by application of the elicitor, indicating that the suppressor has a dominant action to regulate S64 gene expression. S64 was also induced by inoculation with a virulent pathogen, M. pinodes, but not by inoculation with a non-pathogen, Ascochyta rabiei, nor by treatment with fungal elicitor. The deduced structure of S64 showed high homology to 12-oxophytodienoic acid reductase (OPR) in Arabidopsis thaliana. A recombinant protein derived from S64 had OPR activity, suggesting compatibility-specific activation of the octadecanoid pathway in plants. Treatment with jasmonic acid (JA) or methyl jasmonic acid, end products of the octadecanoid pathway, inhibited the elicitor-induced accumulation of PAL mRNA in pea. These results indicate that the suppressor-induced S64 gene expression leads to the production of JA or related compounds, which might contribute to the establishment of compatibility by inhibiting the phenylpropanoid biosynthetic pathway.

MITOSTATIN, a putative tumor suppressor on chromosome 12q24.1, is downregulated in human bladder and breast cancer.

PubMed

Vecchione, A; Fassan, M; Anesti, V; Morrione, A; Goldoni, S; Baldassarre, G; Byrne, D; D'Arca, D; Palazzo, J P; Lloyd, J; Scorrano, L; Gomella, L G; Iozzo, R V; Baffa, R

2009-01-15

Allelic deletions on human chromosome 12q24 are frequently reported in a variety of malignant neoplasms, indicating the presence of a tumor suppressor gene(s) in this chromosomal region. However, no reasonable candidate has been identified so far. In this study, we report the cloning and functional characterization of a novel mitochondrial protein with tumor suppressor activity, henceforth designated MITOSTATIN. Human MITOSTATIN was found within a 3.2-kb transcript, which encoded a approximately 62 kDa, ubiquitously expressed protein with little homology to any known protein. We found homozygous deletions and mutations of MITOSTATIN gene in approximately 5 and approximately 11% of various cancer-derived cells and solid tumors, respectively. When transiently overexpressed, MITOSTATIN inhibited colony formation, tumor cell growth and was proapoptotic, all features shared by established tumor suppressor genes. We discovered a specific link between MITOSTATIN overexpression and downregulation of Hsp27. Conversely, MITOSTATIN knockdown cells showed an increase in cell growth and cell survival rates. Finally, MITOSTATIN expression was significantly reduced in primary bladder and breast tumors, and its reduction was associated with advanced tumor stages. Our findings support the hypothesis that MITOSTATIN has many hallmarks of a classical tumor suppressor in solid tumors and may play an important role in cancer development and progression.

A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

PubMed Central

Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

2010-01-01

A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

Integrative Bioinformatics and Functional Analyses of GEO, ENCODE, and TCGA Reveal FADD as a Direct Target of the Tumor Suppressor BRCA1.

PubMed

Nguyen, Dinh-Duc; Lee, Dong Gyu; Kim, Sinae; Kang, Keunsoo; Rhee, Je-Keun; Chang, Suhwan

2018-05-14

BRCA1 is a multifunctional tumor suppressor involved in several essential cellular processes. Although many of these functions are driven by or related to its transcriptional/epigenetic regulator activity, there has been no genome-wide study to reveal the transcriptional/epigenetic targets of BRCA1. Therefore, we conducted a comprehensive analysis of genomics/transcriptomics data to identify novel BRCA1 target genes. We first analyzed ENCODE data with BRCA1 chromatin immunoprecipitation (ChIP)-sequencing results and identified a set of genes with a promoter occupied by BRCA1. We collected 3085 loci with a BRCA1 ChIP signal from four cell lines and calculated the distance between the loci and the nearest gene transcription start site (TSS). Overall, 66.5% of the BRCA1-bound loci fell into a 2-kb region around the TSS, suggesting a role in transcriptional regulation. We selected 45 candidate genes based on gene expression correlation data, obtained from two GEO (Gene Expression Omnibus) datasets and TCGA data of human breast cancer, compared to BRCA1 expression levels. Among them, we further tested three genes ( MEIS2 , CKS1B and FADD ) and verified FADD as a novel direct target of BRCA1 by ChIP, RT-PCR, and a luciferase reporter assay. Collectively, our data demonstrate genome-wide transcriptional regulation by BRCA1 and suggest target genes as biomarker candidates for BRCA1-associated breast cancer.

Comparative study of angiostatic and anti-invasive gene expressions as prognostic factors in gastric cancer.

PubMed

Lee, J H; Koh, J T; Shin, B A; Ahn, K Y; Roh, J H; Kim, Y J; Kim, K K

2001-02-01

Genes involving angiogenesis and metastasis play an important role in the progression and infiltration of cancer. We examined the expressions of various angiostatic and potential invasion/metastasis suppressor genes through RT-PCR analyses in 32 gastric cancer specimens with or without distant metastasis. The expressions of the invasion/metastasis suppressor, nm23 and E-cadherin increased much more in the cancer tissue (CT) and metastatic lymph node (MLN) than in the extraneoplastic mucosa (EM) and non-metastatic lymph node (NLN), respectively. The expressions of the angiostatic factor, angiopoietin 2 and thrombospondin 2 increased in the CT and MLN as compared with the EM and NLN, respectively. The newly cloned angiostatic factor, brain-specific angiogenesis inhibitor 1 (BAI1) decreased much more in the CT and MLN than the EM and NLN, respectively. However, BAI1 increased in the CT compared with the EM among the patients with poor prognosis and distant metastasis, such as liver or peritoneum. The expressions of the invasive factor, matrix metalloproteinase-2 and its suppressor, tissue inhibitor metalloproteinase-2 (TIMP-2) increased in the CM as compared with the EM, but the increased expression pattern of these genes in the CT became blunted among the patients with good prognosis. Our results indicate that BAI1 and TIMP-2 expressions in the extraneoplastic mucosa and non-metastatic lymph nodes were not suppressed in the patients with good prognosis, but increased expressions of angiopoietin 2, thrombospondin 2, TIMP-2, nm23 and E-cadherin in the tumor tissue did not lead to a long survival after operation. It is suggested that the extent of BAI1 and TIMP-2 expression in the gastric mucosa may be an important prognostic factor for predicting survival in gastric cancer.

MLL4 Is Required to Maintain Broad H3K4me3 Peaks and Super-Enhancers at Tumor Suppressor Genes.

PubMed

Dhar, Shilpa S; Zhao, Dongyu; Lin, Tao; Gu, Bingnan; Pal, Khusboo; Wu, Sarah J; Alam, Hunain; Lv, Jie; Yun, Kyuson; Gopalakrishnan, Vidya; Flores, Elsa R; Northcott, Paul A; Rajaram, Veena; Li, Wei; Shilatifard, Ali; Sillitoe, Roy V; Chen, Kaifu; Lee, Min Gyu

2018-06-07

Super-enhancers are large clusters of enhancers that activate gene expression. Broad trimethyl histone H3 lysine 4 (H3K4me3) often defines active tumor suppressor genes. However, how these epigenomic signatures are regulated for tumor suppression is little understood. Here we show that brain-specific knockout of the H3K4 methyltransferase MLL4 (a COMPASS-like enzyme, also known as KMT2D) in mice spontaneously induces medulloblastoma. Mll4 loss upregulates oncogenic Ras and Notch pathways while downregulating neuronal gene expression programs. MLL4 enhances DNMT3A-catalyzed DNA methylation and SIRT1/BCL6-mediated H4K16 deacetylation, which antagonize expression of Ras activators and Notch pathway components, respectively. Notably, Mll4 loss downregulates tumor suppressor genes (e.g., Dnmt3a and Bcl6) by diminishing broad H3K4me3 and super-enhancers and also causes widespread impairment of these epigenomic signatures during medulloblastoma genesis. These findings suggest an anti-tumor role for super-enhancers and provide a unique tumor-suppressive mechanism in which MLL4 is necessary to maintain broad H3K4me3 and super-enhancers at tumor suppressor genes. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular Mechanisms of Metastasis Suppression in Human Breast Cancer

DTIC Science & Technology

2000-07-01

September 29 Identifying and characterizing human metastasis-suppressor genes. Novartis Pharma , May WELCH, Danny R, Ph.D...Growth and Differentiation Chemica -Biological Interactions CRC Press - Reviews European Journal of Cancer and Clinical Oncology Journal of...September 29 Identifying and characterizing human metastasis-suppressor genes. Novartis Pharma , May 27 Regulation of Metastasis in Human Cancers

Mechanisms of regulation of cell-mediated immunity. III. The characterization of azobenzenearsonate-specific suppressor T-cell- derived-suppressor factors

PubMed Central

1979-01-01

Delayed type hypersensitivity to the hapten azobenzenearsonate (ABA) can be induced and suppressed by the administration of hapten-coupled syngeneic spleen cells by the appropriate route. Suppressor T cells stimulated by the intravenous administration of ABA-coupled spleen cells have been shown to produce a discrete subcellular factor(s) which is capable of suppressing delayed type hypersensitivity to azobenzenearsonate in the mouse. Such suppressor factors may be produced by the mechanical disruption of suppressor cells or by placing such suppressor cells in culture for 24 h. The suppressor factor(s) (SF) derived from ABA-specific suppressor cells exhibit biological specificity for the suppression of ABA delayed type hypersensitivity (DTH), but not trinitro-phenyl DTH, as well as the capacity to bind to ABA immunoadsorbents. Passage of suppressor factor(s) over reverse immunoadsorbents utilizing a rabbit anti-mouse F(ab')2 antiserum demonstrated that the antigen-specific T-cell derived SF does not bear conventional immunoglobulin markers. The suppressor factor(s) are not immunoglobulin molecules was further demonstrated by the inability of anti-ABA antibodies to suppress ABA DTH. Gel filtration of ABA suppressor factor(s) showed that the majority of the suppressive activity was present in a fraction with molecular weight ranging between 6.8 x 10(4) and 3.3 x 10(4) daltons. We also analyzed for the presence of determinants encoded by the H-2 major histocompatibility complex (MHC) and found that immunoadsorbents prepared utilizing antisera capable of interacting with gene products of the whole or selected gene regions of H-2 MHC, i.e., B10.D2 anti-B10.A and B10 anti- B10.A immunoadsorbents, retained the suppressive activity of ABA-SF. Elution of such columns with glycine HCl buffers (pH 2.8) permitted recovery of specific suppressive activity. Taken collectively such data supports the notion that suppressor T-cell-derived ABA suppressor factors have antigen-binding specificity as well as determinants controlled by the K end of the H-2 MHC. The distribution of strains capable of making SF has also been analyzed. The relationship of the antigen-binding specificity to VH gene products is discussed in this and the companion paper. PMID:312894

Construction and Characterization of Human Mammary Epithelial Cell Lines Containing Mutations in the p53 or BRCA1 Genes

DTIC Science & Technology

1999-01-01

development of breast cancers. To study the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway, we have...the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway. The consequences of transduction of these...proposed three approaches for constructing p53-deficient cells; i.e., by mutating the p53 gene directly, by abrogating the protein’s normal cellular

Identification of a region of frequent loss of heterozygosity at 11q24 in colorectal cancer.

PubMed

Connolly, K C; Gabra, H; Millwater, C J; Taylor, K J; Rabiasz, G J; Watson, J E; Smyth, J F; Wyllie, A H; Jodrell, D I

1999-06-15

Loss of heterozygosity (LOH) at 11q23-qter occurs frequently in ovarian and other cancers, but for colorectal cancer, the evidence is conflicting. Seven polymorphic loci were analyzed between D11S897 and D11S969 in 50 colorectal tumors. Two distinct LOH regions were detected, suggesting possible sites for tumor-suppressor genes involved in colorectal neoplasia: a large centromeric region between D11S897 and D11S925, and a telomeric 4.9-Mb region between D11S912 and D11S969. There was no correlation with clinicopathological features. This analysis describes a region of LOH in the region 11q23.3-24.3 for the first time in colorectal cancer and provides complementary evidence for the ongoing effort to identify the gene(s) involved.

Trinucleotide Insertions, Deletions, and Point Mutations in Glucose Transporters Confer K+ Uptake in Saccharomyces cerevisiae

PubMed Central

Liang, Hong; Ko, Christopher H.; Herman, Todd; Gaber, Richard F.

1998-01-01

Deletion of TRK1 and TRK2 abolishes high-affinity K+ uptake in Saccharomyces cerevisiae, resulting in the inability to grow on typical synthetic growth medium unless it is supplemented with very high concentrations of potassium. Selection for spontaneous suppressors that restored growth of trk1Δ trk2Δ cells on K+-limiting medium led to the isolation of cells with unusual gain-of-function mutations in the glucose transporter genes HXT1 and HXT3 and the glucose/galactose transporter gene GAL2. 86Rb uptake assays demonstrated that the suppressor mutations conferred increased uptake of the ion. In addition to K+, the mutant hexose transporters also conferred permeation of other cations, including Na+. Because the selection strategy required such gain of function, mutations that disrupted transporter maturation or localization to the plasma membrane were avoided. Thus, the importance of specific sites in glucose transport could be independently assessed by testing for the ability of the mutant transporter to restore glucose-dependent growth to cells containing null alleles of all of the known functional glucose transporter genes. Twelve sites, most of which are conserved among eukaryotic hexose transporters, were revealed to be essential for glucose transport. Four of these have previously been shown to be essential for glucose transport by animal or plant transporters. Eight represented sites not previously known to be crucial for glucose uptake. Each suppressor mutant harbored a single mutation that altered an amino acid(s) within or immediately adjacent to a putative transmembrane domain of the transporter. Seven of 38 independent suppressor mutations consisted of in-frame insertions or deletions. The nature of the insertions and deletions revealed a striking DNA template dependency: each insertion generated a trinucleotide repeat, and each deletion involved the removal of a repeated nucleotide sequence. PMID:9447989

An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

PubMed

Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

2017-07-01

We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

Preimplantation diagnosis for neurofibromatosis.

PubMed

Verlinsky, Yury; Rechitsky, Svetlana; Verlinsky, Oleg; Chistokhina, Anna; Sharapova, Tatyana; Masciangelo, Christina; Levy, Michael; Kaplan, Brian; Lederer, Kevin; Kuliev, Anver

2002-01-01

Preimplantation genetic diagnosis (PGD) has recently been performed for inherited cancer predisposition determined by p53 tumour suppressor gene mutations, suggesting the usefulness of PGD for late onset disorders with genetic predisposition, including those caused by the germline mutations of other tumour suppressor genes. Here PGD was performed for two couples, one at risk for producing a child with maternally derived neurofibromatosis type I (NF1), and the other with paternally derived neurofibromatosis type II (NF2). The procedure involved a standard IVF protocol, combined with testing of oocytes or embryos prior to their transfer back to the patients. Maternal mutation Trp-->Ter (TGG-->TGA) in exon 29 of the NF1 gene was tested by sequential PCR analysis of the first and second polar bodies, and paternal L141P mutation in exon 4 of the NF2 gene by embryo biopsy at the cleavage stage. In both cases, multiplex nested PCR was applied, involving NF1 and NF2 mutation analysis simultaneously with the 3 and 2 linked markers, respectively. Of 57 oocytes tested in four PGD cycles for NF1 mutation, 26 mutation-free oocytes were detected, from which eight were preselected for transfer, two in each cycle. These produced two clinical pregnancies, one confirmed to be mutation free by chorionic villus sampling but ending in a stillbirth, and the other still ongoing. Of 18 embryos analysed in a cycle performed for NF2 mutation, eight mutation-free embryos were detected, three of which were transferred back to the patient, resulting in a singleton pregnancy and the birth of a mutation-free child. This suggests that PGD is a useful approach for avoiding the birth of children with inherited cancer predisposition, determined by NF1 and NF2 gene mutations.

NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

PubMed

Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

2003-01-01

The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

Function of the ING family of PHD proteins in cancer.

PubMed

Gong, Wei; Suzuki, Keiko; Russell, Michael; Riabowol, Karl

2005-05-01

The ING genes encode a family of at least seven proteins with conserved plant homeodomain (PHD)-type zinc fingers in their C-termini. The founding member, ING1, is capable of binding to and affecting the activity of histone acetyltransferase (HAT), histone deacetylase (HDAC), and factor acetyltransferase (FAT) protein complexes. Some ING proteins are involved in transcriptional regulation of genes, such as the p53-inducible genes p21 and Bax. Others have been found to affect post-translational modifications, exemplified by the ING2-induced acetylation of p53 on the same site deacetylated by the Sir2 HDAC. Upon UV irradiation, ING1 causes cell cycle arrest and interacts with proliferating cell nuclear antigen to promote DNA repair or induce apoptosis in cells to prevent tumorigenesis depending upon the severity of DNA damage. It is very likely that, by linking DNA repair, apoptosis and chromatin remodeling to the transcriptional regulation of critical genes, ING1 exerts it tumor suppressor functions by helping maintain genomic stability. Therefore, ING proteins, which are down-regulated in a broad variety of cancer types, are able to restrict cell growth and proliferation, induce apoptosis, and modulate cell cycle progression, which strongly supports the notion that ING family proteins act as class II tumor suppressors.

The metastasis suppressor RARRES3 as an endogenous inhibitor of the immunoproteasome expression in breast cancer cells

NASA Astrophysics Data System (ADS)

Anderson, Alison M.; Kalimutho, Murugan; Harten, Sarah; Nanayakkara, Devathri M.; Khanna, Kum Kum; Ragan, Mark A.

2017-01-01

In breast cancer metastasis, the dynamic continuum involving pro- and anti-inflammatory regulators can become compromised. Over 600 genes have been implicated in metastasis to bone, lung or brain but how these genes might contribute to perturbation of immune function is poorly understood. To gain insight, we adopted a gene co-expression network approach that draws on the functional parallels between naturally occurring bone marrow-derived mesenchymal stem cells (BM-MSCs) and cancer stem cells (CSCs). Our network analyses indicate a key role for metastasis suppressor RARRES3, including potential to regulate the immunoproteasome (IP), a specialized proteasome induced under inflammatory conditions. Knockdown of RARRES3 in near-normal mammary epithelial and breast cancer cell lines increases overall transcript and protein levels of the IP subunits, but not of their constitutively expressed counterparts. RARRES3 mRNA expression is controlled by interferon regulatory factor IRF1, an inducer of the IP, and is sensitive to depletion of the retinoid-related receptor RORA that regulates various physiological processes including immunity through modulation of gene expression. Collectively, these findings identify a novel regulatory role for RARRES3 as an endogenous inhibitor of IP expression, and contribute to our evolving understanding of potential pathways underlying breast cancer driven immune modulation.

Molecular Pathways: Hippo Signaling, a Critical Tumor Suppressor.

PubMed

Sebio, Ana; Lenz, Heinz-Josef

2015-11-15

The Salvador-Warts-Hippo pathway controls cell fate and tissue growth. The main function of the Hippo pathway is to prevent YAP and TAZ translocation to the nucleus where they induce the transcription of genes involved in cell proliferation, survival, and stem cell maintenance. Hippo signaling is, thus, a complex tumor suppressor, and its deregulation is a key feature in many cancers. Recent mounting evidence suggests that the overexpression of Hippo components can be useful prognostic biomarkers. Moreover, Hippo signaling appears to be intimately linked to some of the most important signaling pathways involved in cancer development and progression. A better understanding of the Hippo pathway is thus essential to untangle tumor biology and to develop novel anticancer therapies. Here, we comment on the progress made in understanding Hippo signaling and its connections, and also on how new drugs modulating this pathway, such as Verteporfin and C19, are highly promising cancer therapeutics. ©2015 American Association for Cancer Research.

Dexamethasone Stimulated Gene Expression in Peripheral Blood is a Sensitive Marker for Glucocorticoid Receptor Resistance in Depressed Patients

PubMed Central

Menke, Andreas; Arloth, Janine; Pütz, Benno; Weber, Peter; Klengel, Torsten; Mehta, Divya; Gonik, Mariya; Rex-Haffner, Monika; Rubel, Jennifer; Uhr, Manfred; Lucae, Susanne; Deussing, Jan M; Müller-Myhsok, Bertram; Holsboer, Florian; Binder, Elisabeth B

2012-01-01

Although gene expression profiles in peripheral blood in major depression are not likely to identify genes directly involved in the pathomechanism of affective disorders, they may serve as biomarkers for this disorder. As previous studies using baseline gene expression profiles have provided mixed results, our approach was to use an in vivo dexamethasone challenge test and to compare glucocorticoid receptor (GR)-mediated changes in gene expression between depressed patients and healthy controls. Whole genome gene expression data (baseline and following GR-stimulation with 1.5 mg dexamethasone p.o.) from two independent cohorts were analyzed to identify gene expression pattern that would predict case and control status using a training (N=18 cases/18 controls) and a test cohort (N=11/13). Dexamethasone led to reproducible regulation of 2670 genes in controls and 1151 transcripts in cases. Several genes, including FKBP5 and DUSP1, previously associated with the pathophysiology of major depression, were found to be reliable markers of GR-activation. Using random forest analyses for classification, GR-stimulated gene expression outperformed baseline gene expression as a classifier for case and control status with a correct classification of 79.1 vs 41.6% in the test cohort. GR-stimulated gene expression performed best in dexamethasone non-suppressor patients (88.7% correctly classified with 100% sensitivity), but also correctly classified 77.3% of the suppressor patients (76.7% sensitivity), when using a refined set of 19 genes. Our study suggests that in vivo stimulated gene expression in peripheral blood cells could be a promising molecular marker of altered GR-functioning, an important component of the underlying pathology, in patients suffering from depressive episodes. PMID:22237309

Molecular biology of pancreatic cancer.

PubMed

Zavoral, Miroslav; Minarikova, Petra; Zavada, Filip; Salek, Cyril; Minarik, Marek

2011-06-28

In spite of continuous research efforts directed at early detection and treatment of pancreatic cancer, the outlook for patients affected by the disease remains dismal. With most cases still being diagnosed at advanced stages, no improvement in survival prognosis is achieved with current diagnostic imaging approaches. In the absence of a dominant precancerous condition, several risk factors have been identified including family history, chronic pancreatitis, smoking, diabetes mellitus, as well as certain genetic disorders such as hereditary pancreatitis, cystic fibrosis, familial atypical multiple mole melanoma, and Peutz-Jeghers and Lynch syndromes. Most pancreatic carcinomas, however, remain sporadic. Current progress in experimental molecular techniques has enabled detailed understanding of the molecular processes of pancreatic cancer development. According to the latest information, malignant pancreatic transformation involves multiple oncogenes and tumor-suppressor genes that are involved in a variety of signaling pathways. The most characteristic aberrations (somatic point mutations and allelic losses) affect oncogenes and tumor-suppressor genes within RAS, AKT and Wnt signaling, and have a key role in transcription and proliferation, as well as systems that regulate the cell cycle (SMAD/DPC, CDKN2A/p16) and apoptosis (TP53). Understanding of the underlying molecular mechanisms should promote development of new methodology for early diagnosis and facilitate improvement in current approaches for pancreatic cancer treatment.

TUSC7 acts as a tumor suppressor in colorectal cancer.

PubMed

Ren, Weidan; Chen, Shuo; Liu, Guiwei; Wang, Xuesong; Ye, Haopeng; Xi, Yanguo

2017-01-01

Increasing studies showed that long non-coding RNAs (lncRNAs) played important roles in the development and progression of tumors. Previous evidences suggested that Tumor suppressor candidate 7 (TUSC7) was involved in several tumors initiation. However, the role of TUSC7 in colorectal cancer is still unknown. In this study, we indicated that the expression of TUSC7 was downregulated in colorectal cancer cell lines and tissues. Moreover, the expression of TUSC7 was lower in the high-grade (Dukes C and D) colorectal cancer patients compared to that in the low-grade colorectal cancer patients (Dukes A and B). Colorectal cancer patients with a lower level of TUSC7 expression had worse overall survival rate. Elevated expression of TUSC7 suppressed SW480 and HT29 cell proliferation and invasion. In addition, we demonstrated that overexpression of TUSC7 inhibited the expression of miR-10a and enhanced the expression of PTEN and EphA8, which were the direct target genes of miR-10a. Furthermore, the expression of miR-10a was upregulated in colorectal cancer cell lines and tissues. TUSC7 suppressed colorectal cancer cell proliferation and invasion partly through targeting miR-10a. These results suggested that TUSC7 played as a tumor suppressor gene in colorectal cancer partly through inhibiting miR-10a expression.

TUSC7 acts as a tumor suppressor in colorectal cancer

PubMed Central

Ren, Weidan; Chen, Shuo; Liu, Guiwei; Wang, Xuesong; Ye, Haopeng; Xi, Yanguo

2017-01-01

Increasing studies showed that long non-coding RNAs (lncRNAs) played important roles in the development and progression of tumors. Previous evidences suggested that Tumor suppressor candidate 7 (TUSC7) was involved in several tumors initiation. However, the role of TUSC7 in colorectal cancer is still unknown. In this study, we indicated that the expression of TUSC7 was downregulated in colorectal cancer cell lines and tissues. Moreover, the expression of TUSC7 was lower in the high-grade (Dukes C and D) colorectal cancer patients compared to that in the low-grade colorectal cancer patients (Dukes A and B). Colorectal cancer patients with a lower level of TUSC7 expression had worse overall survival rate. Elevated expression of TUSC7 suppressed SW480 and HT29 cell proliferation and invasion. In addition, we demonstrated that overexpression of TUSC7 inhibited the expression of miR-10a and enhanced the expression of PTEN and EphA8, which were the direct target genes of miR-10a. Furthermore, the expression of miR-10a was upregulated in colorectal cancer cell lines and tissues. TUSC7 suppressed colorectal cancer cell proliferation and invasion partly through targeting miR-10a. These results suggested that TUSC7 played as a tumor suppressor gene in colorectal cancer partly through inhibiting miR-10a expression. PMID:28979678

Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells.

PubMed

Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

2013-03-01

RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. © 2013 Blackwell Publishing Ltd.

Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells

PubMed Central

Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

2013-01-01

RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. PMID:23301723

The ALD6 gene product is indispensable for providing NADPH in yeast cells lacking glucose-6-phosphate dehydrogenase activity.

PubMed

Grabowska, Dorota; Chelstowska, Anna

2003-04-18

Reducing equivalents in the form of NADPH are essential for many enzymatic steps involved in the biosynthesis of cellular macromolecules. An adequate level of NADPH is also required to protect cells against oxidative stress. The major enzymatic source of NADPH in the cell is the reaction catalyzed by glucose-6-phosphate dehydrogenase, the first enzyme in the pentose phosphate pathway. Disruption of the ZWF1 gene, encoding glucose-6-phosphate dehydrogenase in the yeast Saccharomyces cerevisiae, results in methionine auxotrophy and increased sensitivity to oxidizing agents. It is assumed that both phenotypes are due to an NADPH deficiency in the zwf1Delta strain. We used a Met(-) phenotype displayed by the zwf1Delta strain to look for multicopy suppressors of this deletion. We found that overexpression of the ALD6 gene coding for cytosolic acetaldehyde dehydrogenase, which utilizes NADP(+) as its cofactor, restores the Met(+) phenotype of the zwf1Delta strain. Another multicopy suppressor identified in our screen, the ZMS1 gene encoding a putative transcription factor, regulates the level of ALD6 expression. A strain bearing a double ZWF1 ALD6 gene disruption is not viable. Thus, our results indicate the reaction catalyzed by Ald6p as an important source of reducing equivalents in the yeast cells.

Meningioma in Down Syndrome.

PubMed

Yamamoto, Takahiro; Shinojima, Naoki; Todaka, Tatemi; Nishikawa, Shigeyuki; Yano, Shigetoshi; Kuratsu, Jun-ichi

2015-09-01

Down syndrome comprises multiple malformations and is due to trisomy of chromosome 21. There is epidemiologic evidence that individuals with Down syndrome are at decreased risk for solid tumors including brain tumors. It has been suggested that some genes expressed on the extra copy of chromosome 21 act as tumor suppressor genes and contribute to protection against tumorigenesis. We report the first case to our knowledge of a patient with Down syndrome, an 8-year-old boy, with an intracranial meningioma, in which the status of chromosome 21 was examined. The diagnosis was based on histologic examination of the surgically resected tumor. Postoperatively, the patient's neurologic status improved, and there was no tumor regrowth in the next 2 years. Fluorescence in situ hybridization for chromosome 22 confirmed high allele loss involving the neurofibromin 2 gene locus, a finding typical in meningiomas. Fluorescence in situ hybridization also revealed chromosome 21 heterogeneity in tumor cells; not only cells with trisomy 21 but also cells with disomy and monosomy 21 were present. All blood cells from the patient manifested trisomy 21. Deletion of the chromosome 21 allele may be associated with tumorigenesis of meningioma in Down syndrome. This supports the hypothesis that some genes whose expression is increased on the extra copy of chromosome 21 function as tumor suppressor genes and that they contribute to the reduced tumor incidence in individuals with Down syndrome. Copyright © 2015 Elsevier Inc. All rights reserved.

Cloning and characterization of three suppressors of cytokine signaling (SOCS) genes from the Pacific oyster, Crassostrea gigas.

PubMed

Li, Jun; Zhang, Yang; Zhang, Yuehuan; Liu, Ying; Xiang, Zhiming; Qu, Fufa; Yu, Ziniu

2015-06-01

Members of the suppressor of cytokine signaling (SOCS) family are crucial for the control of a variety of signal transduction pathways that are involved in the immunity, growth and development of organisms. However, in mollusks, the identity and function of SOCS proteins remain largely unclear. In the present study, three SOCS genes, CgSOCS2, CgSOCS5 and CgSOCS7, have been identified by searching and analyzing the Pacific oyster genome. Structural analysis indicated that the CgSOCS share conserved functional domains with their vertebrate counterparts. Phylogenetic analysis showed that the three SOCS genes clustered into two distinct groups, the type I and II subfamilies, indicating that these subfamilies had common ancestors. Tissue-specific expression results showed that the three genes were constitutively expressed in all examined tissues and were highly expressed in immune-related tissues, such as the hemocytes, gills and digestive gland. The expression of CgSOCS can also be induced to varying degrees in hemocytes after challenge with pathogen-associated molecular patterns (PAMPs). Moreover, dual-luciferase reporter assays showed that the over-expression of CgSOCS2 and CgSOCS7, but not CgSOC5, can activate an NF-κB reporter gene. Collectively, these results demonstrated that the CgSOCS might play an important role in the innate immune responses of the Pacific oyster. Copyright © 2015 Elsevier Ltd. All rights reserved.

SET oncoprotein accumulation regulates transcription through DNA demethylation and histone hypoacetylation.

PubMed

Almeida, Luciana O; Neto, Marinaldo P C; Sousa, Lucas O; Tannous, Maryna A; Curti, Carlos; Leopoldino, Andreia M

2017-04-18

Epigenetic modifications are essential in the control of normal cellular processes and cancer development. DNA methylation and histone acetylation are major epigenetic modifications involved in gene transcription and abnormal events driving the oncogenic process. SET protein accumulates in many cancer types, including head and neck squamous cell carcinoma (HNSCC); SET is a member of the INHAT complex that inhibits gene transcription associating with histones and preventing their acetylation. We explored how SET protein accumulation impacts on the regulation of gene expression, focusing on DNA methylation and histone acetylation. DNA methylation profile of 24 tumour suppressors evidenced that SET accumulation decreased DNA methylation in association with loss of 5-methylcytidine, formation of 5-hydroxymethylcytosine and increased TET1 levels, indicating an active DNA demethylation mechanism. However, the expression of some suppressor genes was lowered in cells with high SET levels, suggesting that loss of methylation is not the main mechanism modulating gene expression. SET accumulation also downregulated the expression of 32 genes of a panel of 84 transcription factors, and SET directly interacted with chromatin at the promoter of the downregulated genes, decreasing histone acetylation. Gene expression analysis after cell treatment with 5-aza-2'-deoxycytidine (5-AZA) and Trichostatin A (TSA) revealed that histone acetylation reversed transcription repression promoted by SET. These results suggest a new function for SET in the regulation of chromatin dynamics. In addition, TSA diminished both SET protein levels and SET capability to bind to gene promoter, suggesting that administration of epigenetic modifier agents could be efficient to reverse SET phenotype in cancer.

Hamartomas from patients with tuberous sclerosis show loss of heterozygosity for chromosome 9q34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Green, A.J.; Sepp, T.; Yates, J.R.W.

1994-09-01

We have previously shown allele loss in hamartomas from cases of tuberous sclerosis (TSC) for markers in the region of the recently characterized TSC2 gene on chromosome 16p13.3. Germline deletions in the TSC2 gene have been shown in 5% of patients with TSC. These data strongly suggest that the TSC2 gene acts as a tumor suppressor gene. We hypothesised that hamartomas from patients with TSC can also show allele loss for markers on chromosome 9q34 in the region of the TSC1 gene. We studied 7 hamartomas (3 renal angiomyolipomas, 3 giant cell astrocytomas, and a cardiac rhabdomyoma) from 7 casesmore » of TSC, none of which showed allele loss for markers on chromosome 16p13.3. Eight microsatellite markers were analyzed, comprising from centromeric to telomeric, ASS - D9S64 - D9S149 -D9S150 - DBH - D9S66 - D9S114 - D9S67. Two hamartomas (one renal angiomyolipoma and one giant cell astrocytoma) showed allele loss for at least two markers. The region of allele loss involved the TSC1 locus, but did not include D9S149 or D9S67. We have shown allele loss in two of seven TSC hamartomas in the region of the TSC1 gene on 9q34. Based on this deletion mapping, we suggest that the TSC1 gene on 9a34, like the TSC2 gene, acts as a tumor suppressor gene.« less

Ssb1 chaperone is a [PSI+] prion-curing factor.

PubMed

Chacinska, A; Szczesniak, B; Kochneva-Pervukhova, N V; Kushnirov, V V; Ter-Avanesyan, M D; Boguta, M

2001-04-01

Yeast SUP7' or SUP11 nonsense suppressors have no phenotypic expression in strains deficient in the isopentenylation of A37 in tRNA. Here we show that such strains spontaneously produce cells with a nonsense suppressor phenotype which is related to the cytoplasmically inherited determinant and manifests all the key features of the [PSI+] prion. A screen of a multicopy yeast genomic library for genes that inactivate the [PSI+]-related suppressor phenotype resulted in the isolation of the SSB1 gene. Moreover, we demonstrate that multicopy plasmid encoding the Ssb1 chaperone cures cells of the [PSI+] prion.

An evidence-based knowledgebase of metastasis suppressors to identify key pathways relevant to cancer metastasis

PubMed Central

Zhao, Min; Li, Zhe; Qu, Hong

2015-01-01

Metastasis suppressor genes (MS genes) are genes that play important roles in inhibiting the process of cancer metastasis without preventing growth of the primary tumor. Identification of these genes and understanding their functions are critical for investigation of cancer metastasis. Recent studies on cancer metastasis have identified many new susceptibility MS genes. However, the comprehensive illustration of diverse cellular processes regulated by metastasis suppressors during the metastasis cascade is lacking. Thus, the relationship between MS genes and cancer risk is still unclear. To unveil the cellular complexity of MS genes, we have constructed MSGene (http://MSGene.bioinfo-minzhao.org/), the first literature-based gene resource for exploring human MS genes. In total, we manually curated 194 experimentally verified MS genes and mapped to 1448 homologous genes from 17 model species. Follow-up functional analyses associated 194 human MS genes with epithelium/tissue morphogenesis and epithelia cell proliferation. In addition, pathway analysis highlights the prominent role of MS genes in activation of platelets and coagulation system in tumor metastatic cascade. Moreover, global mutation pattern of MS genes across multiple cancers may reveal common cancer metastasis mechanisms. All these results illustrate the importance of MSGene to our understanding on cell development and cancer metastasis. PMID:26486520

3D view to tumor suppression: Lkb1, polarity and the arrest of oncogenic c-Myc.

PubMed

Partanen, Johanna I; Nieminen, Anni I; Klefstrom, Juha

2009-03-01

Machiavelli wrote, in his famous political treatise Il Principe, about disrupting organization by planting seeds of dissension or by eliminating necessary support elements. Tumor cells do exactly that by disrupting the organized architecture of epithelial cell layers during progression from contained benign tumor to full-blown invasive cancer. However, it is still unclear whether tumor cells primarily break free by activating oncogenes powerful enough to cause chaos or by eliminating tumor suppressor genes guarding the order of the epithelial organization. Studies in Drosophila have exposed genes that encode key regulators of the epithelial apicobasal polarity and which, upon inactivation, cause disorganization of the epithelial layers and promote unscheduled cell proliferation. These polarity regulator/tumor suppressor proteins, which include products of neoplastic tumor suppressor genes (nTSGs), are carefully positioned in polarized epithelial cells to maintain the order of epithelial structures and to impose a restraint on cell proliferation. In this review, we have explored the presence and prevalence of somatic mutations in the human counterparts of Drosophila polarity regulator/tumor suppressor genes across the human cancers. The screen points out LKB1, which is a causal genetic lesion in Peutz-Jeghers cancer syndrome, a gene mutated in certain sporadic cancers and a human homologue of the fly polarity gene par-4. We review the evidence linking Lkb1 protein to polarity regulation in the scope of our recent results suggesting a coupled role for Lkb1 as an architect of organized acinar structures and a suppressor of oncogenic c-Myc. We finally present models to explain how Lkb1-dependent formation of epithelial architecture is coupled to suppression of normal and oncogene-induced proliferation.

Identification of yeast genes that confer resistance to chitosan oligosaccharide (COS) using chemogenomics

PubMed Central

2012-01-01

Background Chitosan oligosaccharide (COS), a deacetylated derivative of chitin, is an abundant, and renewable natural polymer. COS has higher antimicrobial properties than chitosan and is presumed to act by disrupting/permeabilizing the cell membranes of bacteria, yeast and fungi. COS is relatively non-toxic to mammals. By identifying the molecular and genetic targets of COS, we hope to gain a better understanding of the antifungal mode of action of COS. Results Three different chemogenomic fitness assays, haploinsufficiency (HIP), homozygous deletion (HOP), and multicopy suppression (MSP) profiling were combined with a transcriptomic analysis to gain insight in to the mode of action and mechanisms of resistance to chitosan oligosaccharides. The fitness assays identified 39 yeast deletion strains sensitive to COS and 21 suppressors of COS sensitivity. The genes identified are involved in processes such as RNA biology (transcription, translation and regulatory mechanisms), membrane functions (e.g. signalling, transport and targeting), membrane structural components, cell division, and proteasome processes. The transcriptomes of control wild type and 5 suppressor strains overexpressing ARL1, BCK2, ERG24, MSG5, or RBA50, were analyzed in the presence and absence of COS. Some of the up-regulated transcripts in the suppressor overexpressing strains exposed to COS included genes involved in transcription, cell cycle, stress response and the Ras signal transduction pathway. Down-regulated transcripts included those encoding protein folding components and respiratory chain proteins. The COS-induced transcriptional response is distinct from previously described environmental stress responses (i.e. thermal, salt, osmotic and oxidative stress) and pre-treatment with these well characterized environmental stressors provided little or any resistance to COS. Conclusions Overexpression of the ARL1 gene, a member of the Ras superfamily that regulates membrane trafficking, provides protection against COS-induced cell membrane permeability and damage. We found that the ARL1 COS-resistant over-expression strain was as sensitive to Amphotericin B, Fluconazole and Terbinafine as the wild type cells and that when COS and Fluconazole are used in combination they act in a synergistic fashion. The gene targets of COS identified in this study indicate that COS’s mechanism of action is different from other commonly studied fungicides that target membranes, suggesting that COS may be an effective fungicide for drug-resistant fungal pathogens. PMID:22727066

The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development.

PubMed

Ortega-Molina, Ana; Boss, Isaac W; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A; Gascoyne, Randy D; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M; Wendel, Hans-Guido

2015-10-01

The gene encoding the lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma and diffuse large B cell lymphoma; however, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center involution and impedes B cell differentiation and class switch recombination. Integrative genomic analyses indicate that KMT2D affects methylation of lysine 4 on histone H3 (H3K4) and expression of a set of genes, including those in the CD40, JAK-STAT, Toll-like receptor and B cell receptor signaling pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3 and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell-activating pathways.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peltomaeki, Paeivi, E-mail: Paivi.Peltomaki@Helsinki.Fi

Cancer is traditionally viewed as a disease of abnormal cell proliferation controlled by a series of mutations. Mutations typically affect oncogenes or tumor suppressor genes thereby conferring growth advantage. Genomic instability facilitates mutation accumulation. Recent findings demonstrate that activation of oncogenes and inactivation of tumor suppressor genes, as well as genomic instability, can be achieved by epigenetic mechanisms as well. Unlike genetic mutations, epimutations do not change the base sequence of DNA and are potentially reversible. Similar to genetic mutations, epimutations are associated with specific patterns of gene expression that are heritable through cell divisions. Knudson's hypothesis postulates that inactivationmore » of tumor suppressor genes requires two hits, with the first hit occurring either in somatic cells (sporadic cancer) or in the germline (hereditary cancer) and the second one always being somatic. Studies on hereditary and sporadic forms of colorectal carcinoma have made it evident that, apart from genetic mutations, epimutations may serve as either hit or both. Furthermore, recent next-generation sequencing studies show that epigenetic genes, such as those encoding histone modifying enzymes and subunits for chromatin remodeling systems, are themselves frequent targets of somatic mutations in cancer and can act like tumor suppressor genes or oncogenes. This review discusses genetic vs. epigenetic origin of cancer, including cancer susceptibility, in light of recent discoveries. Situations in which mutations and epimutations occur to serve analogous purposes are highlighted.« less

Metastasis Suppressor Genes: At the Interface Between the Environment and Tumor Cell Growth

PubMed Central

Hurst, Douglas R.; Welch, Danny R.

2013-01-01

The molecular mechanisms and genetic programs required for cancer metastasis are sometimes overlapping, but components are clearly distinct from those promoting growth of a primary tumor. Every sequential, rate-limiting step in the sequence of events leading to metastasis requires coordinated expression of multiple genes, necessary signaling events, and favorable environmental conditions or the ability to escape negative selection pressures. Metastasis suppressors are molecules that inhibit the process of metastasis without preventing growth of the primary tumor. The cellular processes regulated by metastasis suppressors are diverse and function at every step in the metastatic cascade. As we gain knowledge into the molecular mechanisms of metastasis suppressors and cofactors with which they interact, we learn more about the process, including appreciation that some are potential targets for therapy of metastasis, the most lethal aspect of cancer. Until now, metastasis suppressors have been described largely by their function. With greater appreciation of their biochemical mechanisms of action, the importance of context is increasingly recognized especially since tumor cells exist in myriad microenvironments. In this review, we assemble the evidence that selected molecules are indeed suppressors of metastasis, collate the data defining the biochemical mechanisms of action, and glean insights regarding how metastasis suppressors regulate tumor cell communication to–from microenvironments. PMID:21199781

A tumor suppressor locus within 3p14-p12 mediates rapid cell death of renal cell carcinoma in vivo.

PubMed Central

Sanchez, Y; el-Naggar, A; Pathak, S; Killary, A M

1994-01-01

High frequency loss of alleles and cytogenetic aberrations on the short arm of chromosome 3 have been documented in renal cell carcinoma (RCC). Potentially, three distinct regions on 3p could encode tumor suppressor genes involved in the genesis of this cancer. We report that the introduction of a centric fragment of 3p, encompassing 3p14-q11, into a highly malignant RCC cell line resulted in a dramatic suppression of tumor growth in athymic nude mice. Another defined deletion hybrid contained the region 3p12-q24 of the introduced human chromosome and failed to suppress tumorigenicity. These data functionally define a tumor suppressor locus, nonpapillary renal carcinoma-1 (NRC-1), within 3p14-p12, the most proximal region of high frequency allele loss in sporadic RCC as well as the region containing the translocation breakpoint in familial RCC. Furthermore, we provide functional evidence that NRC-1 controls the growth of RCC cells by inducing rapid cell death in vivo. Images PMID:8159756

PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

ERIC Educational Resources Information Center

Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

2009-01-01

Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

Metastasis Suppressor Gene Inactivates Actin-Based Mechanism of Tumor Cell Motility | Center for Cancer Research

Cancer.gov

Metastasis is responsible for up to 90 percent of all cancer-related deaths. Though proteins derived from nearly a dozen metastasis suppressor genes have been discovered over the past 15 years, strategies for exploiting the proteins in metastasis-prevention therapies has been hampered by the lack of knowledge regarding the mechanisms underlying the proteins’ interactions with

Identification and functional analysis of the BIM interactome; new clues on its possible involvement in Epstein-Barr Virus-associated diseases.

PubMed

Rouka, Erasmia; Kyriakou, Despoina

2015-12-01

Epigenetic deregulation is a common feature in the pathogenesis of Epstein-Barr Virus (EBV)-related lymphomas and carcinomas. Previous studies have demonstrated a strong association between EBV latency in B-cells and epigenetic silencing of the tumor suppressor gene BIM. This study aimed to the construction and functional analysis of the BIM interactome in order to identify novel host genes that may be targeted by EBV. Fifty-nine unique interactors were found to compose the BIM gene network. Ontological analysis at the pathway level highlighted infectious diseases along with neuropathologies. These results underline the possible interplay between the BIM interactome and EBV-associated disorders.

The inability of Bacillus licheniformis perR mutant to grow is mainly due to the lack of PerR-mediated fur repression.

PubMed

Kim, Jung-Hoon; Yang, Yoon-Mo; Ji, Chang-Jun; Ryu, Su-Hyun; Won, Young-Bin; Ju, Shin-Yeong; Kwon, Yumi; Lee, Yeh-Eun; Youn, Hwan; Lee, Jin-Won

2017-06-01

PerR, a member of Fur family protein, is a metal-dependent H 2 O 2 sensing transcription factor that regulates genes involved in peroxide stress response. Industrially important bacterium Bacillus licheniformis contains three PerR-like proteins (PerR BL , PerR2, and PerR3) compared to its close relative Bacillus subtilis. Interestingly, unlike other bacteria including B. subtilis, no authentic perR BL null mutant could be established for B. licheniformis. Thus, we constructed a conditional perR BL mutant using a xylose-inducible promoter, and investigated the genes under the control of PerR BL . PerR BL regulon genes include katA, mrgA, ahpC, pfeT, hemA, fur, and perR as observed for PerR BS . However, there is some variation in the expression levels of fur and hemA genes between B. subtilis and B. licheniformis in the derepressed state. Furthermore, katA, mrgA, and ahpC are strongly induced, whereas the others are only weakly or not induced by H 2 O 2 treatment. In contrast to the B. subtilis perR null mutant which frequently gives rise to large colony phenotype mainly due to the loss of katA, the suppressors of B. licheniformis perR mutant, which can form colonies on LB agar, were all catalase-positive. Instead, many of the suppressors showed increased levels of siderophore production, suggesting that the suppressor mutation is linked to the fur gene. Consistent with this, perR fur double mutant could grow on LB agar without Fe supplementation, whereas perR katA double mutant could only grow on LB agar with Fe supplementation. Taken together, our data suggest that in B. licheniformis, despite the similarity in PerR BL and PerR BS regulon genes, perR is an essential gene required for growth and that the inability of perR null mutant to grow is mainly due to elevated expression of Fur.

Role of melatonin in the epigenetic regulation of breast cancer.

PubMed

Korkmaz, Ahmet; Sanchez-Barcelo, Emilio J; Tan, Dun-Xian; Reiter, Russel J

2009-05-01

The oncostatic properties of melatonin as they directly or indirectly involve epigenetic mechanisms of cancer are reviewed with a special focus on breast cancer. Five lines of evidence suggest that melatonin works via epigenetic processes: (1) melatonin influences transcriptional activity of nuclear receptors (ERalpha, GR and RAR) involved in the regulation of breast cancer cell growth; (2) melatonin down-regulates the expression of genes responsible for the local synthesis or activation of estrogens including aromatase, an effect which may be mediated by methylation of the CYP19 gene or deacetylation of CYP19 histones; (3) melatonin inhibits telomerase activity and expression induced by either natural estrogens or xenoestrogens; (4) melatonin modulates the cell cycle through the inhibition of cyclin D1 expression; (5) melatonin influences circadian rhythm disturbances dependent on alterations of the light/dark cycle (i.e., light at night) with the subsequent deregulation of PER2 which acts as a tumor suppressor gene.

Modulator of Apoptosis 1 (MOAP-1) Is a Tumor Suppressor Protein Linked to the RASSF1A Protein*

PubMed Central

Law, Jennifer; Salla, Mohamed; Zare, Alaa; Wong, Yoke; Luong, Le; Volodko, Natalia; Svystun, Orysya; Flood, Kayla; Lim, Jonathan; Sung, Miranda; Dyck, Jason R. B.; Tan, Chong Teik; Su, Yu-Chin; Yu, Victor C.; Mackey, John; Baksh, Shairaz

2015-01-01

Modulator of apoptosis 1 (MOAP-1) is a BH3-like protein that plays key roles in cell death or apoptosis. It is an integral partner to the tumor suppressor protein, Ras association domain family 1A (RASSF1A), and functions to activate the Bcl-2 family pro-apoptotic protein Bax. Although RASSF1A is now considered a bona fide tumor suppressor protein, the role of MOAP-1 as a tumor suppressor protein has yet to be determined. In this study, we present several lines of evidence from cancer databases, immunoblotting of cancer cells, proliferation, and xenograft assays as well as DNA microarray analysis to demonstrate the role of MOAP-1 as a tumor suppressor protein. Frequent loss of MOAP-1 expression, in at least some cancers, appears to be attributed to mRNA down-regulation and the rapid proteasomal degradation of MOAP-1 that could be reversed utilizing the proteasome inhibitor MG132. Overexpression of MOAP-1 in several cancer cell lines resulted in reduced tumorigenesis and up-regulation of genes involved in cancer regulatory pathways that include apoptosis (p53, Fas, and MST1), DNA damage control (poly(ADP)-ribose polymerase and ataxia telangiectasia mutated), those within the cell metabolism (IR-α, IR-β, and AMP-activated protein kinase), and a stabilizing effect on microtubules. The loss of RASSF1A (an upstream regulator of MOAP-1) is one of the earliest detectable epigenetically silenced tumor suppressor proteins in cancer, and we speculate that the additional loss of function of MOAP-1 may be a second hit to functionally compromise the RASSF1A/MOAP-1 death receptor-dependent pathway and drive tumorigenesis. PMID:26269600

DNA Fragmentation Factor 45 (DFF45) Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line1

PubMed Central

Yang, Hong Wei; Chen, Ying Zhang; Piao, Hui Ying; Takita, Junko; Soeda, Eiichi; Hayashi, Yasuhide

2001-01-01

Abstract Recently, loss of heterozygosity (LOH) studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p) in neuroblastoma (NB). To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45) gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT)-polymerase chain reaction (PCR) and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region. PMID:11420752

LARG at chromosome 11q23 has functional characteristics of a tumor suppressor in human breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ong, Danny C.T.; Rudduck, Christina; Chin, Koei

2008-05-06

Deletion of 11q23-q24 is frequent in a diverse variety of malignancies, including breast and colorectal carcinoma, implicating the presence of a tumor suppressor gene at that chromosomal region. We show here that LARG, from 11q23, has functional characteristics of a tumor suppressor. We examined a 6-Mb region on 11q23 by high-resolution deletion mapping, utilizing both loss of heterozygosity (LOH) analysis and microarray comparative genomic hybridization (CGH). LARG (also called ARHGEF12), identified from the analyzed region, was underexpressed in 34% of primary breast carcinomas and 80% of breast cancer cell lines including the MCF-7 line. Multiplex ligation-dependent probe amplification on 30more » primary breast cancers and six breast cancer cell lines showed that LARG had the highest frequency of deletion compared to the BCSC-1 and TSLC1 genes, two known candidate tumor suppressor genes from 11q. In vitro analysis of breast cancer cell lines that underexpress LARG showed that LARG could be reactivated by trichostatin A, a histone deacetylase inhibitor, but not by 5-Aza-2{prime}-deoxycytidine, a demethylating agent. Bisulfite sequencing and quantitative high-throughput analysis of DNA methylation confirmed the lack of CpG island methylation in LARG in breast cancer. Restoration of LARG expression in MCF-7 cells by stable transfection resulted in reduced proliferation and colony formation, suggesting that LARG has functional characteristics of a tumor suppressor gene.« less

Targeted deletion of MKK4 in cancer cells: a detrimental phenotype manifests as decreased experimental metastasis and suggests a counterweight to the evolution of tumor-suppressor loss.

PubMed

Cunningham, Steven C; Gallmeier, Eike; Hucl, Tomas; Dezentje, David A; Calhoun, Eric S; Falco, Geppino; Abdelmohsen, Kotb; Gorospe, Myriam; Kern, Scott E

2006-06-01

Tumor-suppressors have commanded attention due to the selection for their inactivating mutations in human tumors. However, relatively little is understood about the inverse, namely, that tumors do not select for a large proportion of seemingly favorable mutations in tumor-suppressor genes. This could be explained by a detrimental phenotype accruing in a cell type-specific manner to most cells experiencing a biallelic loss. For example, MKK4, a tumor suppressor gene distinguished by a remarkably consistent mutational rate across diverse tumor types and an unusually high rate of loss of heterozygosity, has the surprisingly low rate of genetic inactivation of only approximately 5%. To explore this incongruity, we engineered a somatic gene knockout of MKK4 in human cancer cells. Although the null cells resembled the wild-type cells regarding in vitro viability and proliferation in plastic dishes, there was a marked difference in a more relevant in vivo model of experimental metastasis and tumorigenesis. MKK4(-/-) clones injected i.v. produced fewer lung metastases than syngeneic MKK4-competent cells (P = 0.0034). These findings show how cell type-specific detrimental phenotypes can offer a paradoxical and yet key counterweight to the selective advantage attained by cells as they experiment with genetic null states during tumorigenesis, the resultant balance then determining the observed biallelic mutation rate for a given tumor-suppressor gene.

Interallelic Complementation at the Suppressor of Forked Locus of Drosophila Reveals Complementation between Suppressor of Forked Proteins Mutated in Different Regions

PubMed Central

Simonelig, M.; Elliott, K.; Mitchelson, A.; O'Hare, K.

1996-01-01

The Su(f) protein of Drosophila melanogaster shares extensive homologies with proteins from yeast (RNA14) and man (77 kD subunit of cleavage stimulation factor) that are required for 3' end processing of mRNA. These homologies suggest that su(f) is involved in mRNA 3' end formation and that some aspects of this process are conserved throughout eukaryotes. We have investigated the genetic and molecular complexity of the su(f) locus. The su(f) gene is transcribed to produce three RNAs and could encode two proteins. Using constructs that contain different parts of the locus, we show that only the larger predicted gene product of 84 kD is required for the wild-type function of su(f). Some lethal alleles of su(f) complement to produce viable combinations. The structures of complementing and noncomplementing su(f) alleles indicate that 84-kD Su(f) proteins mutated in different domains can act in combination for partial su(f) function. Our results suggest protein-protein interaction between or within wild-type Su(f) molecules. PMID:8846900

The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development

PubMed Central

Ortega-Molina, Ana; Boss, Isaac W.; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W.; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A.; Gascoyne, Randy D.; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M.; Wendel, Hans-Guido

2015-01-01

The lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL). However, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center (GC) involution, impedes B cell differentiation and class switch recombination (CSR). Integrative genomic analyses indicate that KMT2D affects H3K4 methylation and expression of a specific set of genes including those in the CD40, JAK-STAT, Toll-like receptor, and B cell receptor pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3, and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell activating pathways. PMID:26366710

Microarray analysis of long non-coding RNA expression profiles in monocytic myeloid-derived suppressor cells in Echinococcus granulosus-infected mice.

PubMed

Yu, Aiping; Wang, Ying; Yin, Jianhai; Zhang, Jing; Cao, Shengkui; Cao, Jianping; Shen, Yujuan

2018-05-30

Cystic echinococcosis is a worldwide chronic zoonotic disease caused by infection with the larval stage of Echinococcus granulosus. Previously, we found significant accumulation of myeloid-derived suppressor cells (MDSCs) in E. granulosus infection mouse models and that they play a key role in immunosuppressing T lymphocytes. Here, we compared the long non-coding RNA (lncRNA) and mRNA expression patterns between the splenic monocytic MDSCs (M-MDSCs) of E. granulosus protoscoleces-infected mice and normal mice using microarray analysis. LncRNA functions were predicted using Gene Ontology enrichment and the Kyoto Encyclopedia of Genes and Genomes pathway analysis. Cis- and trans-regulation analyses revealed potential relationships between the lncRNAs and their target genes or related transcription factors. We found that 649 lncRNAs were differentially expressed (fold change ≥ 2, P < 0.05): 582 lncRNAs were upregulated and 67 lncRNAs were downregulated; respectively, 28 upregulated mRNAs and 1043 downregulated mRNAs were differentially expressed. The microarray data was validated by quantitative reverse transcription-PCR. The results indicated that mRNAs co-expressed with the lncRNAs are mainly involved in regulating the actin cytoskeleton, Salmonella infection, leishmaniasis, and the vascular endothelial growth factor (VEGF) signaling pathway. The lncRNA NONMMUT021591 was predicted to cis-regulate the retinoblastoma gene (Rb1), whose expression is associated with abnormal M-MDSCs differentiation. We found that 372 lncRNAs were predicted to interact with 60 transcription factors; among these, C/EBPβ (CCAAT/enhancer binding protein beta) was previously demonstrated to be a transcription factor of MDSCs. Our study identified dysregulated lncRNAs in the M-MDSCs of E. granulosus infection mouse models; they might be involved in M-MDSC-derived immunosuppression in related diseases.

Metastasis Suppressor Gene Inactivates Actin-Based Mechanism of Tumor Cell Motility | Center for Cancer Research

Cancer.gov

Metastasis is responsible for up to 90 percent of all cancer-related deaths. Though proteins derived from nearly a dozen metastasis suppressor genes have been discovered over the past 15 years, strategies for exploiting the proteins in metastasis-prevention therapies has been hampered by the lack of knowledge regarding the mechanisms underlying the proteins’ interactions with other proteins.

Frameshift Suppression in SACCHAROMYCES CEREVISIAE. IV. New Suppressors among Spontaneous Co-Revertants of the Group II HIS4-206 and LEU2-3 Frameshift Mutations

PubMed Central

Gaber, Richard F.; Culbertson, Michael R.

1982-01-01

ICR-induced frameshift mutations at the his4 locus in Saccharomyces cerevisiae have been classified into several groups on the basis of their reversion and suppression properties. One group of externally suppressible his4 mutations, designated Group II, have been shown to contain +1 G:C insertions in glycine codons and are suppressed by any one of five suppressor mutations described previously (SUF1, SUF3, SUF4, SUF5, and SUF6). The suppressor genes are believed to encode glycine tRNAs containing four base anticodons.—An analysis of spontaneous co-revertants of the Group II frameshift mutations his4-206 and leu2-3 has revealed the existence of eleven new Group II-specific suppressor genes (SUF15 through SUF25). The locations of the new suppressor loci on the yeast genetic map have been determined.—By comparing the ability or inability of Group II-specific suppressors mapping at 16 different loci to suppress different Group II his4 mutations, two subclasses of suppressors have been defined. One subclass suppresses his4-38 and his4-519, which contain the altered four base mRNA codons 5'-GGGU-3' and 5'-GGGG-3', respectively. The other subclass suppresses his4-38, but fails to suppress his4-519. The mechanism of tRNA-mediated frameshift suppression and the molecular basis for this division of the suppressors into two subclasses is discussed. PMID:6757051

The Regulatory Mechanisms of Tumor Suppressor P16INK4A and Relevance to Cancer†

PubMed Central

Li, Junan; Poi, Ming Jye; Tsai, Ming-Daw

2011-01-01

P16INK4A (also known as P16 and MTS1), a protein consisting exclusively of four ankyrin repeats, is recognized as a tumor suppressor mainly due to the prevalence of genetic inactivation of the p16INK4A (or CDKN2A) gene in virtually all types of human cancers. However, it has also been shown that elevated expression (up-regulation) of P16 is involved in cellular senescence, aging, and cancer progression, indicating that the regulation of P16 is critical for its function. Here, we discuss the regulatory mechanisms of P16 function at the DNA level, the transcription level, and the posttranscriptional level, as well as their implications in the structure-function relationship of P16 and in human cancers. PMID:21619050

Transcriptional deregulation of homeobox gene ZHX2 in Hodgkin lymphoma.

PubMed

Nagel, Stefan; Schneider, Björn; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; Macleod, Roderick A F

2012-05-01

Recently, we identified a novel chromosomal rearrangement in Hodgkin lymphoma (HL), t(4;8)(q27;q24), which targets homeobox gene ZHX2 at the recurrent breakpoint 8q24. This aberration deletes the far upstream region of ZHX2 and results in silenced transcription pinpointing loss of activatory elements. Here, we have looked for potential binding sites within this deleted region to analyze the transcriptional deregulation of this tumor suppressor gene in B-cell malignancies. SiRNA-mediated knockdown and reporter gene analyses identified two transcription factors, homeodomain protein MSX1 and bZIP protein XBP1, directly regulating ZHX2 expression. Furthermore, MSX1-cofactor histone H1C mediated repression of ZHX2 and showed enhanced expression levels in cell line L-1236. As demonstrated by fluorescence in situ hybridization and genomic array analysis, the gene loci of MSX1 at 4p16 and H1C at 6p22 were rearranged in several HL cell lines, correlating with their altered expression activity. The expression of XBP1 was reduced in 6/7 HL cell lines as compared to primary hematopoietic cells. Taken together, our results demonstrate multiple mechanisms decreasing expression of tumor suppressor gene ZHX2 in HL cell lines: loss of enhancing binding sites, reduced expression of activators MSX1 and XBP1, and overexpression of MSX1-corepressor H1C. Moreover, chromosomal deregulations of genes involved in this regulative network highlight their role in development and malignancy of B-cells. Copyright © 2011 Elsevier Ltd. All rights reserved.

Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors.

PubMed

Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart

2014-01-01

The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions or 3' untranslated regions. Among these, 11 genes had been previously associated with cancer, with 4 genes being known tumor suppressors: DCC, PDZD2, MAGI1, and DACT2. We validated the APA in three out of three cases with quantitative real-time-PCR. Our findings suggest that changes of APA pattern in these 16 genes could be involved in the tumorigenesis of SI-NETs. Furthermore, they also point to APA as a new target for both diagnostic and treatment of SI-NETs. The identified genes with APA specific to the SI-NETs could be further tested as diagnostic markers and drug targets for disease prevention and treatment.

Alternative Polyadenylation of Tumor Suppressor Genes in Small Intestinal Neuroendocrine Tumors

PubMed Central

Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart

2014-01-01

The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3′ untranslated regions. Additionally, APA can also produce mRNAs containing different 3′-terminal coding regions. Therefore, APA alters both the repertoire and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3′ truncation of mRNA coding regions or 3′ untranslated regions. Among these, 11 genes had been previously associated with cancer, with 4 genes being known tumor suppressors: DCC, PDZD2, MAGI1, and DACT2. We validated the APA in three out of three cases with quantitative real-time-PCR. Our findings suggest that changes of APA pattern in these 16 genes could be involved in the tumorigenesis of SI-NETs. Furthermore, they also point to APA as a new target for both diagnostic and treatment of SI-NETs. The identified genes with APA specific to the SI-NETs could be further tested as diagnostic markers and drug targets for disease prevention and treatment. PMID:24782827

MiR-339 and especially miR-766 reactivate the expression of tumor suppressor genes in colorectal cancer cell lines through DNA methyltransferase 3B gene inhibition.

PubMed

Afgar, Ali; Fard-Esfahani, Pezhman; Mehrtash, Amirhosein; Azadmanesh, Kayhan; Khodarahmi, Farnaz; Ghadir, Mahdis; Teimoori-Toolabi, Ladan

2016-11-01

It is observed that upregulation of DNMT3B enzyme in some cancers, including colon cancer, could lead to silencing of tumor suppressor genes. MiR-339 and miR-766 have been predicted to target 3'UTR of DNMT3B gene. Luciferase reporter assay validated that individual and co-transfection of miR-766 and miR-339 into the HEK293T cell reduced luciferase activity to 26% ± 0.41%, 43% ± 0.42 and 64% ± 0.52%, respectively, compared to the control (P < 0.05). Furthermore, transduction of miR-339 and miR-766 expressing viruses into colon cancer cell lines (SW480 and HCT116) decreased DNMT3B expression (1.5, 3-fold) and (3, 4-fold), respectively. In addition, DNA methylation of some tumor suppressor genes decreased. Expression of these genes such as SFRP1 (2 and 1.6-fold), SFRP2 (0.07 and 4-fold), WIF1 (0.05 and 4-fold), and DKK2 (2 and 4-fold) increased in SW-339 and SW-766 cell lines; besides, expression increments for these genes in HCT-339 and HCT-766 cell lines were (2.8, 4-fold), (0.005, 1.5-fold), (1.7 and 3-fold) and (0.04, 1.7-fold), respectively. Also, while in SW-766, cell proliferation reduced to 2.8% and 21.7% after 24 and 48 hours, respectively, SW-339 showed no reduced proliferation. Meanwhile, HCT-766 and HCT-339 showed (3.5%, 12.8%) and (18.8%, 33.9%) reduced proliferation after 24 and 48 hours, respectively. Finally, targeting DNMT3B by these miRs, decreased methylation of tumor suppressor genes such as SFRP1, SFRP2, WIF1 and DKK2 in the mentioned cell lines, and returned the expression of these tumor suppressor genes which can contribute to lethal effect on colon cancer cells and reducing tumorigenicity of these cells.

The Receptor Tyrosine Kinase EphA2 Is a Direct Target Gene of Hypermethylated in Cancer 1 (HIC1)*

PubMed Central

Foveau, Bénédicte; Boulay, Gaylor; Pinte, Sébastien; Van Rechem, Capucine; Rood, Brian R.; Leprince, Dominique

2012-01-01

The tumor suppressor gene hypermethylated in cancer 1 (HIC1), which encodes a transcriptional repressor, is epigenetically silenced in many human tumors. Here, we show that ectopic expression of HIC1 in the highly malignant MDA-MB-231 breast cancer cell line severely impairs cell proliferation, migration, and invasion in vitro. In parallel, infection of breast cancer cell lines with a retrovirus expressing HIC1 also induces decreased mRNA and protein expression of the tyrosine kinase receptor EphA2. Moreover, chromatin immunoprecipitation (ChIP) and sequential ChIP experiments demonstrate that endogenous HIC1 proteins are bound, together with the MTA1 corepressor, to the EphA2 promoter in WI38 cells. Taken together, our results identify EphA2 as a new direct target gene of HIC1. Finally, we observe that inactivation of endogenous HIC1 through RNA interference in normal breast epithelial cells results in the up-regulation of EphA2 and is correlated with increased cellular migration. To conclude, our results involve the tumor suppressor HIC1 in the transcriptional regulation of the tyrosine kinase receptor EphA2, whose ligand ephrin-A1 is also a HIC1 target gene. Thus, loss of the regulation of this Eph pathway through HIC1 epigenetic silencing could be an important mechanism in the pathogenesis of epithelial cancers. PMID:22184117

Identifying Breast Tumor Suppressors Using in Vitro and in Vivo RNAi Screens

DTIC Science & Technology

2011-10-01

vivo RNA interference screen, breast cancer , tumor suppressor, leukemia inhibitory factor receptor (LIFR) 16. SECURITY CLASSIFICATION OF: 17...The identification of these genes will improve the understanding of the causes of breast cancer , which may lead to therapeutic advancements for... breast cancer prevention and treatment. BODY Objective 1: Identification of breast tumor suppressors using in vitro and in vivo RNAi screens

Myxovirus resistance, osteopontin and suppressor of cytokine signaling 3 polymorphisms predict hepatitis C virus therapy response in an admixed patient population: comparison with IL28B.

PubMed

Angelo, Ana Luiza Dias; Cavalcante, Lourianne Nascimento; Abe-Sandes, Kiyoko; Machado, Taísa Bonfim; Lemaire, Denise Carneiro; Malta, Fernanda; Pinho, João Renato; Lyra, Luiz Guilherme Costa; Lyra, Andre Castro

2013-10-01

Suppressor of cytokine signaling 3, myxovirus resistance protein and osteopontin gene polymorphisms may influence the therapeutic response in patients with chronic hepatitis C, and an association with IL28 might increase the power to predict sustained virologic response. Our aims were to evaluate the association between myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 gene polymorphisms in combination with IL28B and to assess the therapy response in hepatitis C patients treated with pegylated-interferon plus ribavirin. Myxovirus resistance protein, osteopontin, suppressor of cytokine signaling 3 and IL28B polymorphisms were analyzed by PCR-restriction fragment length polymorphism, direct sequencing and real-time PCR. Ancestry was determined using genetic markers. We analyzed 181 individuals, including 52 who were sustained virologic responders. The protective genotype frequencies among the sustained virologic response group were as follows: the G/G suppressor of cytokine signaling 3 (rs4969170) (62.2%); T/T osteopontin (rs2853744) (60%); T/T osteopontin (rs11730582) (64.3%); and the G/T myxovirus resistance protein (rs2071430) genotype (54%). The patients who had ≥3 of the protective genotypes from the myxovirus resistance protein, the suppressor of cytokine signaling 3 and osteopontin had a greater than 90% probability of achieving a sustained response (p<0.0001). The C/C IL28B genotype was present in 58.8% of the subjects in this group. The sustained virological response rates increased to 85.7% and 91.7% by analyzing C/C IL28B with the T/T osteopontin genotype at rs11730582 and the G/G suppressor of cytokine signaling 3 genotype, respectively. Genetic ancestry analysis revealed an admixed population. Hepatitis C genotype 1 patients who were responders to interferon-based therapy had a high frequency of multiple protective polymorphisms in the myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 genes. The combined analysis of the suppressor of cytokine signaling 3 and IL28B genotypes more effectively predicted sustained virologic response than IL28B analysis alone.

Transcriptome analyses reveal SR45 to be a neutral splicing regulator and a suppressor of innate immunity in Arabidopsis thaliana.

PubMed

Zhang, Xiao-Ning; Shi, Yifei; Powers, Jordan J; Gowda, Nikhil B; Zhang, Chong; Ibrahim, Heba M M; Ball, Hannah B; Chen, Samuel L; Lu, Hua; Mount, Stephen M

2017-10-11

Regulation of pre-mRNA splicing diversifies protein products and affects many biological processes. Arabidopsis thaliana Serine/Arginine-rich 45 (SR45), regulates pre-mRNA splicing by interacting with other regulatory proteins and spliceosomal subunits. Although SR45 has orthologs in diverse eukaryotes, including human RNPS1, the sr45-1 null mutant is viable. Narrow flower petals and reduced seed formation suggest that SR45 regulates genes involved in diverse processes, including reproduction. To understand how SR45 is involved in the regulation of reproductive processes, we studied mRNA from the wild-type and sr45-1 inflorescences using RNA-seq, and identified SR45-bound RNAs by immunoprecipitation. Using a variety of bioinformatics tools, we identified a total of 358 SR45 differentially regulated (SDR) genes, 542 SR45-dependent alternative splicing (SAS) events, and 1812 SR45-associated RNAs (SARs). There is little overlap between SDR genes and SAS genes, and neither set of genes is enriched for flower or seed development. However, transcripts from reproductive process genes are significantly overrepresented in SARs. In exploring the fate of SARs, we found that a total of 81 SARs are subject to alternative splicing, while 14 of them are known Nonsense-Mediated Decay (NMD) targets. Motifs related to GGNGG are enriched both in SARs and near different types of SAS events, suggesting that SR45 recognizes this motif directly. Genes involved in plant defense are significantly over-represented among genes whose expression is suppressed by SR45, and sr45-1 plants do indeed show enhanced immunity. We find that SR45 is a suppressor of innate immunity. We find that a single motif (GGNGG) is highly enriched in both RNAs bound by SR45 and in sequences near SR45- dependent alternative splicing events in inflorescence tissue. We find that the alternative splicing events regulated by SR45 are enriched for this motif whether the effect of SR45 is activation or repression of the particular event. Thus, our data suggests that SR45 acts to control splice site choice in a way that defies simple categorization as an activator or repressor of splicing.

A mutation in the neurofibromatosis type 2 tumor-suppressor gene, giving rise to widely different clinical phenotypes in two unrelated individuals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bourn, D.; Carter, S.A.; Goodship, J.

The authors have sought mutations in the recently identified neurofibromatosis type 2 (NF2) tumor-suppressor gene in a large panel of NF2 patients, using PCR-based SSCP and heteroduplex analysis, followed by cloning and sequencing of appropriate PCR products. Two unrelated NF2 patients were found to have identical nonsense mutations caused by a C-to-T transition in a CpG dinucleotide that is a potential mutational hot spot in the NF2 tumor-suppressor gene. Unexpectedly, the two individuals had widely different clinical phenotypes, representing the severe Wishart and mild Gardner clinical subtypes. Analysis of DNA samples from different tissues of the mildly affected patient suggestsmore » that he is a somatic mosaic for the mutation. 26 refs., 3 figs.« less

A retroviral mutagenesis screen reveals strong cooperation between Bcl11a overexpression and loss of the Nf1 tumor suppressor gene

PubMed Central

Yin, Bin; Delwel, Ruud; Valk, Peter J.; Wallace, Margaret R.; Loh, Mignon L.; Shannon, Kevin M.

2009-01-01

NF1 inactivation occurs in specific human cancers, including juvenile myelomonocytic leukemia, an aggressive myeloproliferative disorder of childhood. However, evidence suggests that Nf1 loss alone does not cause leukemia. We therefore hypothesized that inactivation of the Nf1 tumor suppressor gene requires cooperating mutations to cause acute leukemia. To search for candidate genes that cooperate with Nf1 deficiency in leukemogenesis, we performed a forward genetic screen using retroviral insertion mutagenesis in Nf1 mutant mice. We identified 43 common proviral insertion sites that contain candidate genes involved in leukemogenesis. One of these genes, Bcl11a, confers a growth advantage in cultured Nf1 mutant hematopoietic cells and causes early onset of leukemia of either myeloid or lymphoid lineage in mice when expressed in Nf1-deficient bone marrow. Bcl11a-expressing cells display compromised p21Cip1 induction, suggesting that Bcl11a's oncogenic effects are mediated, in part, through suppression of p21Cip1. Importantly, Bcl11a is expressed in human chronic myelomonocytic leukemia and juvenile myelomonocytic leukemia samples. A subset of AML patients, who had poor outcomes, of 16 clusters, displayed high levels of BCL11A in leukemic cells. These findings suggest that deregulated Bcl11a cooperates with Nf1 in leukemogenesis, and a therapeutic strategy targeting the BCL11A pathway may prove beneficial in the treatment of leukemia. PMID:18948576

Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers

PubMed Central

Brait, Mariana; Ling, Shizhang; Nagpal, Jatin K.; Chang, Xiaofei; Park, Hannah Lui; Lee, Juna; Okamura, Jun; Yamashita, Keishi; Sidransky, David; Kim, Myoung Sook

2012-01-01

The human cysteine dioxygenase 1 (CDO1) gene is a non-heme structured, iron-containing metalloenzyme involved in the conversion of cysteine to cysteine sulfinate, and plays a key role in taurine biosynthesis. In our search for novel methylated gene promoters, we have analyzed differential RNA expression profiles of colorectal cancer (CRC) cell lines with or without treatment of 5-aza-2′-deoxycytidine. Among the genes identified, the CDO1 promoter was found to be differentially methylated in primary CRC tissues with high frequency compared to normal colon tissues. In addition, a statistically significant difference in the frequency of CDO1 promoter methylation was observed between primary normal and tumor tissues derived from breast, esophagus, lung, bladder and stomach. Downregulation of CDO1 mRNA and protein levels were observed in cancer cell lines and tumors derived from these tissue types. Expression of CDO1 was tightly controlled by promoter methylation, suggesting that promoter methylation and silencing of CDO1 may be a common event in human carcinogenesis. Moreover, forced expression of full-length CDO1 in human cancer cells markedly decreased the tumor cell growth in an in vitro cell culture and/or an in vivo mouse model, whereas knockdown of CDO1 increased cell growth in culture. Our data implicate CDO1 as a novel tumor suppressor gene and a potentially valuable molecular marker for human cancer. PMID:23028699

Mechanisms of Breast Carcinogenesis Involving Wild-Type p53

DTIC Science & Technology

2001-09-01

Nelson, C. E., Gryka , M . A., Litwak, G., Gebhardt, M ., level of p53 that was expressed in the cells in both these studies Bressac, B., Ozturk, M ., Baker...14 Publication resulting from this research: 1. Resnick-Silverman, L., S. St Clair, M . Maurer, K...activation by the tumor suppressor protein p53. Genes Dev 12:2102-7. 2. Tang, H. Y., K. Zhao, J. F. Pizzolato, M . Fonarev, J. C. Langer, and J. J

RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

PubMed Central

van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

2018-01-01

To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

Sporadic renal angiomyolipoma in a patient with Birt-Hogg-Dubé: chaperones in pathogenesis.

PubMed

Sager, Rebecca A; Woodford, Mark R; Shapiro, Oleg; Mollapour, Mehdi; Bratslavsky, Gennady

2018-04-24

Birt-Hogg-Dubé (BHD) is an autosomal dominant genetic syndrome caused by germline mutations in the FLCN gene that predisposes patients to develop renal tumors. Renal angiomyolipoma (AML) is not a renal tumor sub-type associated with BHD. AML is, however, a common phenotypic manifestation of Tuberous Sclerosis Complex (TSC) syndrome caused by mutations in either the TSC1 or TSC2 tumor suppressor genes. Previous case reports of renal AML in patients with BHD have speculated on the molecular and clinical overlap of these two syndromes as a result of described involvement of the gene products in the mTOR pathway. Our recent work provided a new molecular link between these two syndromes by identifying FLCN and Tsc2 as clients of the molecular chaperone Hsp90. Folliculin interacting proteins FNIP1/2 and Tsc1 are important for FLCN and Tsc2 stability as new Hsp90 co-chaperones. Here we present a case of sporadic AML as a result of somatic Tsc1/2 loss in a patient with BHD. We further demonstrate that FNIP1 and Tsc1 are capable of compensating for each other in the chaperoning of mutated FLCN tumor suppressor. Our findings demonstrate interconnectivity and compensatory mechanisms between the BHD and TSC pathways.

Histone deacetylase inhibitor belinostat represses survivin expression through reactivation of transforming growth factor beta (TGFbeta) receptor II leading to cancer cell death.

PubMed

Chowdhury, Sanjib; Howell, Gillian M; Teggart, Carol A; Chowdhury, Aparajita; Person, Jonathan J; Bowers, Dawn M; Brattain, Michael G

2011-09-02

Survivin is a cancer-associated gene that functions to promote cell survival, cell division, and angiogenesis and is a marker of poor prognosis. Histone deacetylase inhibitors induce apoptosis and re-expression of epigenetically silenced tumor suppressor genes in cancer cells. In association with increased expression of the tumor suppressor gene transforming growth factor β receptor II (TGFβRII) induced by the histone deacetylase inhibitor belinostat, we observed repressed survivin expression. We investigated the molecular mechanisms involved in survivin down-regulation by belinostat downstream of reactivation of TGFβ signaling. We identified two mechanisms. At early time points, survivin protein half-life was decreased with its proteasomal degradation. We observed that belinostat activated protein kinase A at early time points in a TGFβ signaling-dependent mechanism. After longer times (48 h), survivin mRNA was also decreased by belinostat. We made the novel observation that belinostat mediated cell death through the TGFβ/protein kinase A signaling pathway. Induction of TGFβRII with concomitant survivin repression may represent a significant mechanism in the anticancer effects of this drug. Therefore, patient populations exhibiting high survivin expression with epigenetically silenced TGFβRII might potentially benefit from the use of this histone deacetylase inhibitor.

RDR1 and SGS3, components of RNA-mediated gene silencing, are required for the regulation of cuticular wax biosynthesis in developing inflorescence stems of Arabidopsis.

PubMed

Lam, Patricia; Zhao, Lifang; McFarlane, Heather E; Aiga, Mytyl; Lam, Vivian; Hooker, Tanya S; Kunst, Ljerka

2012-08-01

The cuticle is a protective layer that coats the primary aerial surfaces of land plants and mediates plant interactions with the environment. It is synthesized by epidermal cells and is composed of a cutin polyester matrix that is embedded and covered with cuticular waxes. Recently, we have discovered a novel regulatory mechanism of cuticular wax biosynthesis that involves the ECERIFERUM7 (CER7) ribonuclease, a core subunit of the exosome. We hypothesized that at the onset of wax production, the CER7 ribonuclease degrades an mRNA specifying a repressor of CER3, a wax biosynthetic gene whose protein product is required for wax formation via the decarbonylation pathway. In the absence of this repressor, CER3 is expressed, leading to wax production. To identify the putative repressor of CER3 and to unravel the mechanism of CER7-mediated regulation of wax production, we performed a screen for suppressors of the cer7 mutant. Our screen resulted in the isolation of components of the RNA-silencing machinery, RNA-DEPENDENT RNA POLYMERASE1 and SUPPRESSOR OF GENE SILENCING3, implicating RNA silencing in the control of cuticular wax deposition during inflorescence stem development in Arabidopsis (Arabidopsis thaliana).

Tumor suppressor roles of CENP-E and Nsl1 in Drosophila epithelial tissues.

PubMed

Clemente-Ruiz, Marta; Muzzopappa, Mariana; Milán, Marco

2014-01-01

Depletion of spindle assembly checkpoint (SAC) genes in Drosophila epithelial tissues leads to JNK-dependent programmed cell death and additional blockade of the apoptotic program drives tumorigenesis. A recent report proposes that chromosomal instability (CIN) is not the driving force in the tumorigenic response of the SAC-deficient tissue, and that checkpoint proteins exert a SAC-independent tumor suppressor role. This notion is based on observations that the depletion of CENP-E levels or prevention of Bub3 from binding to the kinetochore in Drosophila tissues unable to activate the apoptotic program induces CIN but does not cause hyperproliferation. Here we re-examined this proposal. In contrast to the previous report, we observed that depletion of CENP-E or Nsl1-the latter mediating kinetochore targeting of Bub3-in epithelial tissues unable to activate the apoptotic program induces significant levels of aneuploidy and drives tumor-like growth. The induction of the JNK transcriptional targets Wingless, a mitogenic molecule, and MMP1, a matrix metaloproteinase 1 involved in basement membrane degradation was also observed in these tumors. An identical response of the tissue was previously detected upon depletion of several SAC genes or genes involved in spindle assembly, chromatin condensation, and cytokinesis, all of which have been described to cause CIN. All together, these results reinforce the role of CIN in driving tumorigenesis in Drosophila epithelial tissues and question the proposed SAC-independent roles of checkpoint proteins in suppressing tumorigenesis. Differences in aneuploidy rates might explain the discrepancy between the previous report and our results.

Transducer of ERBB2.1 (TOB1) as a Tumor Suppressor: A Mechanistic Perspective.

PubMed

Lee, Hun Seok; Kundu, Juthika; Kim, Ryong Nam; Shin, Young Kee

2015-12-15

Transducer of ERBB2.1 (TOB1) is a tumor-suppressor protein, which functions as a negative regulator of the receptor tyrosine-kinase ERBB2. As most of the other tumor suppressor proteins, TOB1 is inactivated in many human cancers. Homozygous deletion of TOB1 in mice is reported to be responsible for cancer development in the lung, liver, and lymph node, whereas the ectopic overexpression of TOB1 shows anti-proliferation, and a decrease in the migration and invasion abilities on cancer cells. Biochemical studies revealed that the anti-proliferative activity of TOB1 involves mRNA deadenylation and is associated with the reduction of both cyclin D1 and cyclin-dependent kinase (CDK) expressions and the induction of CDK inhibitors. Moreover, TOB1 interacts with an oncogenic signaling mediator, β-catenin, and inhibits β-catenin-regulated gene transcription. TOB1 antagonizes the v-akt murine thymoma viral oncogene (AKT) signaling and induces cancer cell apoptosis by activating BCL2-associated X (BAX) protein and inhibiting the BCL-2 and BCL-XL expressions. The tumor-specific overexpression of TOB1 results in the activation of other tumor suppressor proteins, such as mothers against decapentaplegic homolog 4 (SMAD4) and phosphatase and tensin homolog-10 (PTEN), and blocks tumor progression. TOB1-overexpressing cancer cells have limited potential of growing as xenograft tumors in nude mice upon subcutaneous implantation. This review addresses the molecular basis of TOB1 tumor suppressor function with special emphasis on its regulation of intracellular signaling pathways.

Arid1a Inactivation in an Apc and Pten-defective Mouse Ovarian Cancer Model Enhances Epithelial Differentiation and Prolongs Survival

PubMed Central

Zhai, Yali; Kuick, Rork; Tipton, Courtney; Wu, Rong; Sessine, Michael; Wang, Zhong; Baker, Suzanne J.; Fearon, Eric R.; Cho, Kathleen R.

2015-01-01

Inactivation of the ARID1A tumor suppressor gene is frequent in ovarian endometrioid (OEC) and clear cell carcinomas (OCCC), often in conjunction with mutations activating the PI3K/AKT and/or canonical Wnt signaling pathways. Prior work has shown that conditional bi-allelic inactivation of the Apc and Pten tumor suppressor genes in the mouse ovarian surface epithelium (OSE) promotes outgrowth of tumors that reflect the biological behavior and gene expression profiles of human OECs harboring comparable Wnt and PI3K/AKT pathway defects, though the mouse tumors are more poorly differentiated than their human tumor counterparts. We found that conditional inactivation of one or both Arid1a alleles in OSE concurrently with Apc and Pten inactivation unexpectedly prolonged survival of tumor-bearing mice and promoted striking epithelial differentiation of the cancer cells, resulting in morphological features akin to those in human OECs. Enhanced epithelial differentiation was linked to reduced expression of mesenchymal markers N-cadherin and vimentin, and increased expression of epithelial markers Crb3 and E-cadherin. Global gene expression profiling showed enrichment for genes associated with mesenchymal-to-epithelial transition in the Arid1a-deficient tumors. We also found that an activating (E545K) Pik3ca mutation, unlike Pten inactivation or Pik3ca H1047R mutation, cannot cooperate with Arid1a loss to promote ovarian cancer development in the mouse. Our results indicate the Arid1a tumor suppressor gene has a key role in regulating OEC differentiation, and paradoxically the mouse cancers with more initiating tumor suppressor gene defects had a less aggressive phenotype than cancers arising from fewer gene alterations. PMID:26279473

The microRNAs involved in human myeloid differentiation and myelogenous/myeloblastic leukemia

PubMed Central

Wang, Xiao-Shuang; Zhang, Jun-Wu

2008-01-01

Abstract MicroRNAs (miRNAs) are endogenously expressed, functional RNAs that interact with native coding mRNAs to cleave mRNA or repress translation. Several miRNAs contribute to normal haematopoietic processes and some miRNAs act both as tumour suppressors and oncogenes in the pathology of haematological malignancies. While most effort is engaged in identifying and investigating the target genes of miRNAs, miRNA gene promoter methylation or transcriptional regulation is another important field of investigation, since these two main mechanisms can form a regulatory circuit. This review focuses on recent researches on miRNAs with important roles in myeloid cells. PMID:18554315

Compositions and methods involving methyladenosine phosphorylase in the diagnosis and treatment of proliferative disorders

DOEpatents

Olopade, Olufunmilayo I.

2007-03-20

Disclosed are novel nucleic acid and peptide compositions comprising methylthioadenosine phosphorylase (MTAP) and methods of use for MTAP amino acid sequences and DNA segments comprising MTAP in the diagnosis of human cancers and development of MTAP-specific antibodies. Also disclosed are methods for the diagnosis and treatment of tumors and other proliferative cell disorders, and identification of tumor suppressor genes and gene products from the human 9p21-p22 chromosome region. Such methods are useful in the diagnosis of multiple tumor types such as bladder cancer, lung cancer, breast cancer, pancreatic cancer, brain tumors, lymphomas, gliomas, melanomas, and leukemias.

Genetic Alterations in Gastric Cancer Associated with Helicobacter pylori Infection.

PubMed

Rivas-Ortiz, Claudia I; Lopez-Vidal, Yolanda; Arredondo-Hernandez, Luis Jose Rene; Castillo-Rojas, Gonzalo

2017-01-01

Gastric cancer is a world health problem and depicts the fourth leading mortality cause from malignancy in Mexico. Causation of gastric cancer is not only due to the combined effects of environmental factors and genetic variants. Recent molecular studies have transgressed a number of genes involved in gastric carcinogenesis. The aim of this review is to understand the recent basics of gene expression in the development of the process of gastric carcinogenesis. Genetic variants, polymorphisms, desoxyribonucleic acid methylation, and genes involved in mediating inflammation have been associated with the development of gastric carcinogenesis. Recently, these genes (interleukin 10, Il-17, mucin 1, β-catenin, CDX1, SMAD4, SERPINE1, hypoxia-inducible factor 1 subunit alpha, GSK3β, CDH17, matrix metalloproteinase 7, RUNX3, RASSF1A, TFF1, HAI-2, and COX-2) have been studied in association with oncogenic activation or inactivation of tumor suppressor genes. All these mechanisms have been investigated to elucidate the process of gastric carcinogenesis, as well as their potential use as biomarkers and/or molecular targets to treatment of disease.

Genetic Alterations in Gastric Cancer Associated with Helicobacter pylori Infection

PubMed Central

Rivas-Ortiz, Claudia I.; Lopez-Vidal, Yolanda; Arredondo-Hernandez, Luis Jose Rene; Castillo-Rojas, Gonzalo

2017-01-01

Gastric cancer is a world health problem and depicts the fourth leading mortality cause from malignancy in Mexico. Causation of gastric cancer is not only due to the combined effects of environmental factors and genetic variants. Recent molecular studies have transgressed a number of genes involved in gastric carcinogenesis. The aim of this review is to understand the recent basics of gene expression in the development of the process of gastric carcinogenesis. Genetic variants, polymorphisms, desoxyribonucleic acid methylation, and genes involved in mediating inflammation have been associated with the development of gastric carcinogenesis. Recently, these genes (interleukin 10, Il-17, mucin 1, β-catenin, CDX1, SMAD4, SERPINE1, hypoxia-inducible factor 1 subunit alpha, GSK3β, CDH17, matrix metalloproteinase 7, RUNX3, RASSF1A, TFF1, HAI-2, and COX-2) have been studied in association with oncogenic activation or inactivation of tumor suppressor genes. All these mechanisms have been investigated to elucidate the process of gastric carcinogenesis, as well as their potential use as biomarkers and/or molecular targets to treatment of disease. PMID:28512631

Cadherin-6 is a putative tumor suppressor and target of epigenetically dysregulated miR-429 in cholangiocarcinoma

PubMed Central

Goeppert, Benjamin; Ernst, Christina; Baer, Constance; Roessler, Stephanie; Renner, Marcus; Mehrabi, Arianeb; Hafezi, Mohammadreza; Pathil, Anita; Warth, Arne; Stenzinger, Albrecht; Weichert, Wilko; Bähr, Marion; Will, Rainer; Schirmacher, Peter; Plass, Christoph; Weichenhan, Dieter

2016-01-01

ABSTRACT Cholangiocarcinoma (CC) is a rare malignancy of the extrahepatic or intrahepatic biliary tract with an outstanding poor prognosis. Non-surgical therapeutic regimens result in minimally improved survival of CC patients. Global genomic analyses identified a few recurrently mutated genes, some of them in genes involved in epigenetic patterning. In a previous study, we demonstrated global DNA methylation changes in CC, indicating major contribution of epigenetic alterations to cholangiocarcinogenesis. Here, we aimed at the identification and characterization of CC-related, differentially methylated regions (DMRs) in potential microRNA promoters and of genes targeted by identified microRNAs. Twenty-seven hypermethylated and 13 hypomethylated potential promoter regions of microRNAs, known to be associated with cancer-related pathways like Wnt, ErbB, and PI3K-Akt signaling, were identified. Selected DMRs were confirmed in 2 independent patient cohorts. Inverse correlation between promoter methylation and expression suggested miR-129-2 and members of the miR-200 family (miR-200a, miR-200b, and miR-429) as novel tumor suppressors and oncomiRs, respectively, in CC. Tumor suppressor genes deleted in liver cancer 1 (DLC1), F-box/WD-repeat-containing protein 7 (FBXW7), and cadherin-6 (CDH6) were identified as presumed targets in CC. Tissue microarrays of a representative and well-characterized cohort of biliary tract cancers (n=212) displayed stepwise downregulation of CDH6 and association with poor patient outcome. Ectopic expression of CDH6 on the other hand, delayed growth in the CC cell lines EGI-1 and TFK-1, together suggesting a tumor suppressive function of CDH6. Our work represents a valuable repository for the study of epigenetically altered miRNAs in cholangiocarcinogenesis and novel putative, CC-related tumor suppressive miRNAs and oncomiRs. PMID:27593557

Frequent germline deleterious mutations in DNA repair genes in familial prostate cancer cases are associated with advanced disease.

PubMed

Leongamornlert, D; Saunders, E; Dadaev, T; Tymrakiewicz, M; Goh, C; Jugurnauth-Little, S; Kozarewa, I; Fenwick, K; Assiotis, I; Barrowdale, D; Govindasami, K; Guy, M; Sawyer, E; Wilkinson, R; Antoniou, A C; Eeles, R; Kote-Jarai, Z

2014-03-18

Prostate cancer (PrCa) is one of the most common diseases to affect men worldwide and among the leading causes of cancer-related death. The purpose of this study was to use second-generation sequencing technology to assess the frequency of deleterious mutations in 22 tumour suppressor genes in familial PrCa and estimate the relative risk of PrCa if these genes are mutated. Germline DNA samples from 191 men with 3 or more cases of PrCa in their family were sequenced for 22 tumour suppressor genes using Agilent target enrichment and Illumina technology. Analysis for genetic variation was carried out by using a pipeline consisting of BWA, Genome Analysis Toolkit (GATK) and ANNOVAR. Clinical features were correlated with mutation status using standard statistical tests. Modified segregation analysis was used to determine the relative risk of PrCa conferred by the putative loss-of-function (LoF) mutations identified. We discovered 14 putative LoF mutations in 191 samples (7.3%) and these mutations were more frequently associated with nodal involvement, metastasis or T4 tumour stage (P=0.00164). Segregation analysis of probands with European ancestry estimated that LoF mutations in any of the studied genes confer a relative risk of PrCa of 1.94 (95% CI: 1.56-2.42). These findings show that LoF mutations in DNA repair pathway genes predispose to familial PrCa and advanced disease and therefore warrants further investigation. The clinical utility of these findings will become increasingly important as targeted screening and therapies become more widespread.

APC alterations are frequently involved in the pathogenesis of acinar cell carcinoma of the pancreas, mainly through gene loss and promoter hypermethylation.

PubMed

Furlan, Daniela; Sahnane, Nora; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Marando, Alessandro; Zhang, Lizhi; Vanoli, Alessandro; Casnedi, Selenia; Adsay, Volkan; Notohara, Kenji; Albarello, Luca; Asioli, Sofia; Sessa, Fausto; Capella, Carlo; La Rosa, Stefano

2014-05-01

Genetic and epigenetic alterations involved in the pathogenesis of pancreatic acinar cell carcinomas (ACCs) are poorly characterized, including the frequency and role of gene-specific hypermethylation, chromosome aberrations, and copy number alterations (CNAs). A subset of ACCs is known to show alterations in the APC/β-catenin pathway which includes mutations of APC gene. However, it is not known whether, in addition to mutation, loss of APC gene function can occur through alternative genetic and epigenetic mechanisms such as gene loss or promoter methylation. We investigated the global methylation profile of 34 tumor suppressor genes, CNAs of 52 chromosomal regions, and APC gene alterations (mutation, methylation, and loss) together with APC mRNA level in 45 ACCs and related peritumoral pancreatic tissues using methylation-specific multiplex ligation probe amplification (MS-MLPA), fluorescence in situ hybridization (FISH), mutation analysis, and reverse transcription-droplet digital PCR. ACCs did not show an extensive global gene hypermethylation profile. RASSF1 and APC were the only two genes frequently methylated. APC mutations were found in only 7 % of cases, while APC loss and methylation were more frequently observed (48 and 56 % of ACCs, respectively). APC mRNA low levels were found in 58 % of cases and correlated with CNAs. In conclusion, ACCs do not show extensive global gene hypermethylation. APC alterations are frequently involved in the pathogenesis of ACCs mainly through gene loss and promoter hypermethylation, along with reduction of APC mRNA levels.

Epigenetics in myeloid derived suppressor cells: a sheathed sword towards cancer

PubMed Central

Zhang, Chao; Wang, Shuo; Liu, Yufeng; Yang, Cheng

2016-01-01

Myeloid-derived suppressor cells (MDSCs), a heterogeneous population of cells composed of progenitors and precursors to myeloid cells, are deemed to participate in the development of tumor-favoring immunosuppressive microenvironment. Thus, the regulatory strategies targeting MDSCs' expansion, differentiation, accumulation and function could possibly be effective “weapons” in anti-tumor immunotherapies. Epigenetic mechanisms, which involve DNA modification, covalent histone modification and RNA interference, result in the heritable down-regulation or silencing of gene expression without a change in DNA sequences. Epigenetic modification of MDSC's functional plasticity leads to the remodeling of its characteristics, therefore reframing the microenvironment towards countering tumor growth and metastasis. This review summarized the pertinent findings on the DNA methylation, covalent histone modification, microRNAs and small interfering RNAs targeting MDSC in cancer genesis, progression and metastasis. The potentials as well as possible obstacles in translating into anti-cancer therapeutics were also discussed. PMID:27458169

PAQR-2 Regulates Fatty Acid Desaturation during Cold Adaptation in C. elegans

PubMed Central

Svensk, Emma; Ståhlman, Marcus; Andersson, Carl-Henrik; Johansson, Maja; Borén, Jan; Pilon, Marc

2013-01-01

C. elegans PAQR-2 is homologous to the insulin-sensitizing adiponectin receptors in mammals, and essential for adaptation to growth at 15°C, a low but usually acceptable temperature for this organism. By screening for novel paqr-2 suppressors, we identified mutations in genes involved in phosphatidylcholine synthesis (cept-1, pcyt-1 and sams-1) and fatty acid metabolism (ech-7, hacd-1, mdt-15, nhr-49 and sbp-1). We then show genetic evidence that paqr-2, phosphatidylcholines, sbp-1 and Δ9-desaturases form a cold adaptation pathway that regulates the increase in unsaturated fatty acids necessary to retain membrane fluidity at low temperatures. This model is supported by the observations that the paqr-2 suppressors normalize the levels of saturated fatty acids, and that low concentrations of detergents that increase membrane fluidity can rescue the paqr-2 mutant. PMID:24068966

PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.

PubMed

Svensk, Emma; Ståhlman, Marcus; Andersson, Carl-Henrik; Johansson, Maja; Borén, Jan; Pilon, Marc

2013-01-01

C. elegans PAQR-2 is homologous to the insulin-sensitizing adiponectin receptors in mammals, and essential for adaptation to growth at 15°C, a low but usually acceptable temperature for this organism. By screening for novel paqr-2 suppressors, we identified mutations in genes involved in phosphatidylcholine synthesis (cept-1, pcyt-1 and sams-1) and fatty acid metabolism (ech-7, hacd-1, mdt-15, nhr-49 and sbp-1). We then show genetic evidence that paqr-2, phosphatidylcholines, sbp-1 and Δ9-desaturases form a cold adaptation pathway that regulates the increase in unsaturated fatty acids necessary to retain membrane fluidity at low temperatures. This model is supported by the observations that the paqr-2 suppressors normalize the levels of saturated fatty acids, and that low concentrations of detergents that increase membrane fluidity can rescue the paqr-2 mutant.

Cycling with BRCA2 from DNA repair to mitosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Hyunsook, E-mail: HL212@snu.ac.kr

Genetic integrity in proliferating cells is guaranteed by the harmony of DNA replication, appropriate DNA repair, and segregation of the duplicated genome. Breast cancer susceptibility gene BRCA2 is a unique tumor suppressor that is involved in all three processes. Hence, it is critical in genome maintenance. The functions of BRCA2 in DNA repair and homology-directed recombination (HDR) have been reviewed numerous times. Here, I will briefly go through the functions of BRCA2 in HDR and focus on the emerging roles of BRCA2 in telomere homeostasis and mitosis, then discuss how BRCA2 exerts distinct functions in a cell-cycle specific manner inmore » the maintenance of genomic integrity. - Highlights: • BRCA2 is a multifaceted tumor suppressor and is crucial in genetic integrity. • BRCA2 exerts distinct functions in cell cycle-specific manner. • Mitotic kinases regulate diverse functions of BRCA2 in mitosis and cytokinesis.« less

Downregulated microRNA-510-5p acts as a tumor suppressor in renal cell carcinoma.

PubMed

Chen, Duqun; Li, Yuchi; Yu, Zuhu; Li, Yifan; Su, Zhengming; Ni, Liangchao; Yang, Shangqi; Gui, Yaoting; Lai, Yongqing

2015-08-01

MicroRNA (miR)-510-5p has been demonstrated to be involved in a number of types of malignancy; however, the function of miR-510-5p in renal cancer remains unclear. The present study aimed to determine the expression of miR-510-5p in renal cell carcinoma (RCC) specimens and analyzed the impact of miR-510-5p on renal cancer by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, wound scratch and apoptosis assays. The results showed that miR-510-5p was significantly downregulated in RCC specimens compared with normal renal specimens. Overexpression of miR-510-5p by synthetic mature mimics reduced cell proliferation and migration and induced an increase in cell apoptosis, indicating that miR-510-5p may act as a tumor suppressor in RCC. The present study firstly revealed that downregulated miR-510-5p functioned as a tumor suppressor by reducing cellular proliferation and migration, and inducing apoptosis in RCC. Further research is required to define target genes of miR-510-5p to determine the cellular mechanism of miR-510-5p in the carcinogenesis of RCC.

The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.

PubMed

Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi

2005-07-01

Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.

CMTM5 exhibits tumor suppressor activity through promoter methylation in oral squamous cell carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Heyu; Nan, Xu; Li, Xuefen

Highlights: • Down-regulation of CMTM5 expression in OSCC tissues was found. • The promoter methylation status of CMTM5 was measured. • CMTM5-v1 inhibited cell proliferation and migration and induced apoptosis. • CMTM5 might act as a putative tumor suppressor gene in OSCC. - Abstract: Oral squamous cell carcinoma (OSCC) is one of the most common types of malignancies in the head and neck region. CKLF-like MARVEL transmembrane domain-containing member 5 (CMTM5) has been recently implicated as a tumor suppressor gene in several cancer types. Herein, we examined the expression and function of CMTM5 in oral squamous cell carcinoma. CMTM5 wasmore » down-regulated in oral squamous cell lines and tumor samples from patients with promoter methylation. Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored CMTM5 expression. In the OSCC cell lines CAL27 and GNM, the ectopic expression of CMTM5-v1 strongly inhibited cell proliferation and migration and induced apoptosis. In addition, CMTM5-v1 inhibited tumor formation in vivo. Therefore, CMTM5 might act as a putative tumor suppressor gene through promoter methylation in oral squamous cell carcinoma.« less

Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

PubMed

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

2010-03-15

Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

Constitutional 3p26.3 terminal microdeletion in an adolescent with neuroblastoma.

PubMed

Pezzolo, Annalisa; Sementa, Angela Rita; Lerone, Margherita; Morini, Martina; Ognibene, Marzia; Defferrari, Raffaella; Mazzocco, Katia; Conte, Massimo; Gigliotti, Anna Rita; Garaventa, Alberto; Pistoia, Vito; Varesio, Luigi

2017-05-04

Neuroblastoma (NB) is a common and often lethal cancer of early childhood that accounts for 10% of pediatric cancer mortality. Incidence peaks in infancy and then rapidly declines, with less than 5% of cases diagnosed in children and adolescents ≥ 10 y. There is increasing evidence that NB has unique biology and an chronic disease course in older children and adolescents, but ultimately dismal survival. We describe a rare constitutional 3p26.3 terminal microdeletion which occurred in an adolescent with NB, with apparently normal phenotype without neurocognitive defects. We evaluated the association of expression of genes involved in the microdeletion with NB patient outcomes using R2 platform. We screened NB patient's tumor cells for CHL1 protein expression using immunofluorescence. Constitutional and tumor DNA were tested by array-comparative genomic hybridization and single nucleotide-polymorphism-array analyses. Peripheral blood mononuclear cells from the patient showed a 2.54 Mb sub-microscopic constitutional terminal 3p deletion that extended to band p26.3. The microdeletion 3p disrupted the CNTN4 gene and the neighboring CNTN6 and CHL1 genes were hemizygously deleted, each of these genes encode neuronal cell adhesion molecules. Low expression of CNTN6 and CNTN4 genes did not stratify NB patients, whereas low CHL1 expression characterized 417 NB patients having worse overall survival. CHL1 protein expression on tumor cells from the patient was weaker than positive control. This is the first report of a constitutional 3p26.3 deletion in a NB patient. Since larger deletions of 3p, indicative of the presence of one or more tumor suppressor genes in this region, occur frequently in neuroblastoma, our results pave the way to the identification of one putative NB suppressor genes mapping in 3p26.3.

Suppressors of dGTP Starvation in Escherichia coli

PubMed Central

Itsko, Mark

2017-01-01

ABSTRACT dGTP starvation, a newly discovered phenomenon in which Escherichia coli cells are starved specifically for the DNA precursor dGTP, leads to impaired growth and, ultimately, cell death. Phenomenologically, it represents an example of nutritionally induced unbalanced growth: cell mass amplifies normally as dictated by the nutritional status of the medium, but DNA content growth is specifically impaired. The other known example of such a condition, thymineless death (TLD), involves starvation for the DNA precursor dTTP, which has been found to have important chemotherapeutic applications. Experimentally, dGTP starvation is induced by depriving an E. coli gpt optA1 strain of its required purine source, hypoxanthine. In our studies of this phenomenon, we noted the emergence of a relatively high frequency of suppressor mutants that proved resistant to the treatment. To study such suppressors, we used next-generation sequencing on a collection of independently obtained mutants. A significant fraction was found to carry a defect in the PurR transcriptional repressor, controlling de novo purine biosynthesis, or in its downstream purEK operon. Thus, upregulation of de novo purine biosynthesis appears to be a major mode of overcoming the lethal effects of dGTP starvation. In addition, another large fraction of the suppressors contained a large tandem duplication of a 250- to 300-kb genomic region that included the purEK operon as well as the acrAB-encoded multidrug efflux system. Thus, the suppressive effects of the duplications could potentially involve beneficial effects of a number of genes/operons within the amplified regions. IMPORTANCE Concentrations of the four precursors for DNA synthesis (2′-deoxynucleoside-5′-triphosphates [dNTPs]) are critical for both the speed of DNA replication and its accuracy. Previously, we investigated consequences of dGTP starvation, where the DNA precursor dGTP was specifically reduced to a low level. Under this condition, E. coli cells continued cell growth but eventually developed a DNA replication defect, leading to cell death due to formation of unresolvable DNA structures. Nevertheless, dGTP-starved cultures eventually resumed growth due to the appearance of resistant mutants. Here, we used whole-genome DNA sequencing to identify the responsible suppressor mutations. We show that the majority of suppressors can circumvent death by upregulating purine de novo biosynthesis, leading to restoration of dGTP to acceptable levels. PMID:28373271

Positive selection of deleterious alleles through interaction with a sex-ratio suppressor gene in African Buffalo: a plausible new mechanism for a high frequency anomaly.

PubMed

van Hooft, Pim; Greyling, Ben J; Getz, Wayne M; van Helden, Paul D; Zwaan, Bas J; Bastos, Armanda D S

2014-01-01

Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer) population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations), we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has important implications for our understanding not only of the evolutionary and ecological dynamics of sex-ratio distorters and suppressors, but also of the functioning of deleterious and sexually-antagonistic alleles, and their impact on population viability.

TAD disruption as oncogenic driver

PubMed Central

Valton, Anne-Laure; Dekker, Job

2016-01-01

Topologically Associating Domains (TADs) are conserved during evolution and play roles in guiding and constraining long-range regulation of gene expression. Disruption of TAD boundaries results in aberrant gene expression by exposing genes to inappropriate regulatory elements. Recent studies have shown that TAD disruption is often found in cancer cells and contributes to oncogenesis through two mechanisms. One mechanism locally disrupts domains by deleting or mutating a TAD boundary leading to fusion of the two adjacent TADs. The other mechanism involves genomic rearrangements that break up TADs and creates new ones without directly affecting TAD boundaries. Understanding the mechanisms by which TADs form and control long-range chromatin interactions will therefore not only provide insights into the mechanism of gene regulation in general, but will also reveal how genomic rearrangements and mutations in cancer genomes can lead to misregulation of oncogenes and tumor suppressors. PMID:27111891

Epigenetic Targeting of Granulin in Hepatoma Cells by Synthetic CRISPR dCas9 Epi-suppressors.

PubMed

Wang, Hong; Guo, Rui; Du, Zhonghua; Bai, Ling; Li, Lingyu; Cui, Jiuwei; Li, Wei; Hoffman, Andrew R; Hu, Ji-Fan

2018-06-01

The CRISPR-associated Cas9 system can modulate disease-causing alleles both in vivo and ex vivo, raising the possibility of therapeutic genome editing. In addition to gene targeting, epigenetic modulation by the catalytically inactive dCas9 may also be a potential form of cancer therapy. Granulin (GRN), a potent pluripotent mitogen and growth factor that promotes cancer progression by maintaining self-renewal of hepatic stem cancer cells, is upregulated in hepatoma tissues and is associated with decreased tumor survival in patients with hepatoma. We synthesized a group of dCas9 epi-suppressors to target GRN by tethering the C terminus of dCas9 with three epigenetic suppressor genes: DNMT3a (DNA methyltransferase), EZH2 (histone 3 lysine 27 methyltransferase), and KRAB (the Krüppel-associated box transcriptional repression domain). In conjunction with guide RNAs (gRNAs), the dCas9 epi-suppressors caused significant decreases in GRN mRNA abundance in Hep3B hepatoma cells. These dCas9 epi-suppressors initiated de novo CpG DNA methylation in the GRN promoter, and they produced histone codes that favor gene suppression, including decreased H3K4 methylation, increased H3K9 methylation, and enhanced HP1a binding. Epigenetic knockdown of GRN led to the inhibition of cell proliferation, decreased tumor sphere formation, and reduced cell invasion. These changes were achieved at least partially through the MMP/TIMP pathway. This study thus demonstrates the potential utility of using dCas9 epi-suppressors in the development of epigenetic targeting against tumors. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Genome-Wide Profile of Pleural Mesothelioma versus Parietal and Visceral Pleura: The Emerging Gene Portrait of the Mesothelioma Phenotype

PubMed Central

Røe, Oluf Dimitri; Anderssen, Endre; Helge, Eli; Pettersen, Caroline Hild; Olsen, Karina Standahl; Sandeck, Helmut; Haaverstad, Rune; Lundgren, Steinar; Larsson, Erik

2009-01-01

Background Malignant pleural mesothelioma is considered an almost incurable tumour with increasing incidence worldwide. It usually develops in the parietal pleura, from mesothelial lining or submesothelial cells, subsequently invading the visceral pleura. Chromosomal and genomic aberrations of mesothelioma are diverse and heterogenous. Genome-wide profiling of mesothelioma versus parietal and visceral normal pleural tissue could thus reveal novel genes and pathways explaining its aggressive phenotype. Methodology and Principal Findings Well-characterised tissue from five mesothelioma patients and normal parietal and visceral pleural samples from six non-cancer patients were profiled by Affymetrix oligoarray of 38 500 genes. The lists of differentially expressed genes tested for overrepresentation in KEGG PATHWAYS (Kyoto Encyclopedia of Genes and Genomes) and GO (gene ontology) terms revealed large differences of expression between visceral and parietal pleura, and both tissues differed from mesothelioma. Cell growth and intrinsic resistance in tumour versus parietal pleura was reflected in highly overexpressed cell cycle, mitosis, replication, DNA repair and anti-apoptosis genes. Several genes of the “salvage pathway” that recycle nucleobases were overexpressed, among them TYMS, encoding thymidylate synthase, the main target of the antifolate drug pemetrexed that is active in mesothelioma. Circadian rhythm genes were expressed in favour of tumour growth. The local invasive, non-metastatic phenotype of mesothelioma, could partly be due to overexpression of the known metastasis suppressors NME1 and NME2. Down-regulation of several tumour suppressor genes could contribute to mesothelioma progression. Genes involved in cell communication were down-regulated, indicating that mesothelioma may shield itself from the immune system. Similarly, in non-cancer parietal versus visceral pleura signal transduction, soluble transporter and adhesion genes were down-regulated. This could represent a genetical platform of the parietal pleura propensity to develop mesothelioma. Conclusions Genome-wide microarray approach using complex human tissue samples revealed novel expression patterns, reflecting some important features of mesothelioma biology that should be further explored. PMID:19662092

Improvement of fermentation ability under baking-associated stress conditions by altering the POG1 gene expression in baker's yeast.

PubMed

Sasano, Yu; Haitani, Yutaka; Hashida, Keisuke; Oshiro, Satoshi; Shima, Jun; Takagi, Hiroshi

2013-08-01

During the bread-making process, yeast cells are exposed to many types of baking-associated stress. There is thus a demand within the baking industry for yeast strains with high fermentation abilities under these stress conditions. The POG1 gene, encoding a putative transcription factor involved in cell cycle regulation, is a multicopy suppressor of the yeast Saccharomyces cerevisiae E3 ubiquitin ligase Rsp5 mutant. The pog1 mutant is sensitive to various stresses. Our results suggested that the POG1 gene is involved in stress tolerance in yeast cells. In this study, we showed that overexpression of the POG1 gene in baker's yeast conferred increased fermentation ability in high-sucrose-containing dough, which is used for sweet dough baking. Furthermore, deletion of the POG1 gene drastically increased the fermentation ability in bread dough after freeze-thaw stress, which would be a useful characteristic for frozen dough baking. Thus, the engineering of yeast strains to control the POG1 gene expression level would be a novel method for molecular breeding of baker's yeast. Copyright © 2013 Elsevier B.V. All rights reserved.

Redox-Directed Cancer Therapeutics: Molecular Mechanisms and Opportunities

PubMed Central

2009-01-01

Abstract Redox dysregulation originating from metabolic alterations and dependence on mitogenic and survival signaling through reactive oxygen species represents a specific vulnerability of malignant cells that can be selectively targeted by redox chemotherapeutics. This review will present an update on drug discovery, target identification, and mechanisms of action of experimental redox chemotherapeutics with a focus on pro- and antioxidant redox modulators now in advanced phases of preclinal and clinical development. Recent research indicates that numerous oncogenes and tumor suppressor genes exert their functions in part through redox mechanisms amenable to pharmacological intervention by redox chemotherapeutics. The pleiotropic action of many redox chemotherapeutics that involves simultaneous modulation of multiple redox sensitive targets can overcome cancer cell drug resistance originating from redundancy of oncogenic signaling and rapid mutation. Moreover, some redox chemotherapeutics may function according to the concept of synthetic lethality (i.e., drug cytotoxicity is confined to cancer cells that display loss of function mutations in tumor suppressor genes or upregulation of oncogene expression). The impressive number of ongoing clinical trials that examine therapeutic performance of novel redox drugs in cancer patients demonstrates that redox chemotherapy has made the crucial transition from bench to bedside. Antioxid. Redox Signal. 11, 3013–3069. PMID:19496700

Posttransplant Lymphoproliferative Disorders

PubMed Central

Ibrahim, Hazem A. H.; Naresh, Kikkeri N.

2012-01-01

Posttransplant lymphoproliferative disorders (PTLDs) are a group of diseases that range from benign polyclonal to malignant monoclonal lymphoid proliferations. They arise secondary to treatment with immunosuppressive drugs given to prevent transplant rejection. Three main pathologic subsets/stages of evolution are recognised: early, polymorphic, and monomorphic lesions. The pathogenesis of PTLDs seems to be multifactorial. Among possible infective aetiologies, the role of EBV has been studied in depth, and the virus is thought to play a central role in driving the proliferation of EBV-infected B cells that leads to subsequent development of the lymphoproliferative disorder. It is apparent, however, that EBV is not solely responsible for the “neoplastic” state. Accumulated genetic alterations of oncogenes and tumour suppressor genes (deletions, mutations, rearrangements, and amplifications) and epigenetic changes (aberrant hypermethylation) that involve tumour suppressor genes are integral to the pathogenesis. Antigenic stimulation also plays an evident role in the pathogenesis of PTLDs. Plasmacytoid dendritic cells (PDCs) that are critical to fight viral infections have been thought to play a pathogenetically relevant role in PTLDs. Furthermore, regulatory T cells (Treg cells), which are modulators of immune reactions once incited, seem to have an important role in PTLDs where antigenic stimulation is key for the pathogenesis. PMID:22570658

Exclusion of a major role for the PTEN tumour-suppressor gene in breast carcinomas

PubMed Central

Freihoff, D; Kempe, A; Beste, B; Wappenschmidt, B; Kreyer, E; Hayashi, Y; Meindl, A; Krebs, D; Wiestler, O D; Deimling, A von; Schmutzler, R K

1999-01-01

PTEN is a novel tumour-suppressor gene located on chromosomal band 10q23.3. This region displays frequent loss of heterozygosity (LOH) in a variety of human neoplasms including breast carcinomas. The detection of PTEN mutations in Cowden disease and in breast carcinoma cell lines suggests that PTEN may be involved in mammary carcinogenesis. We here report a mutational analysis of tumour specimens from 103 primary breast carcinomas and constitutive DNA from 25 breast cancer families. The entire coding region of PTEN was screened by single-strand conformation polymorphism (SSCP) analysis and direct sequencing using intron-based primers. No germline mutations could be identified in the breast cancer families and only one sporadic carcinoma carried a PTEN mutation at one allele. In addition, all sporadic tumours were analysed for homozygous deletions by differential polymerase chain reaction (PCR) and for allelic loss using the microsatellite markers D10S215, D10S564 and D10S573. No homozygous deletions were detected and only 10 out of 94 informative tumours showed allelic loss in the PTEN region. These results suggest that PTEN does not play a major role in breast cancer formation. 1999 Cancer Research Campaign PMID:10070865

A methods review on use of nonsense suppression to study 3′ end formation and other aspects of tRNA biogenesis

PubMed Central

Rijal, Keshab; Maraia, Richard J.; Arimbasseri, Aneeshkumar G.

2014-01-01

Suppressor tRNAs bear anticodon mutations that allow them to decode premature stop codons in metabolic marker gene mRNAs, that can be used as in vivo reporters of functional tRNA biogenesis. Here, we review key components of a suppressor tRNA system specific to S. pombe and its adaptations for use to study specific steps in tRNA biogenesis. Eukaryotic tRNA biogenesis begins with transcription initiation by RNA polymerase (pol) III. The nascent pre-tRNAs must undergo folding, 5′ and 3′ processing to remove the leader and trailer, nuclear export, and splicing if applicable, while multiple complex chemical modifications occur throughout the process. We review evidence that precursor-tRNA processing begins with transcription termination at the oligo(T) terminator element, which forms a 3′ oligo(U) tract on the nascent RNA, a sequence-specific binding site for the RNA chaperone, La protein. The processing pathway bifurcates depending on a poorly understood property of pol III termination that determines the 3′ oligo(U) length and therefore the affinity for La. We thus review the pol III termination process and the factors involved including advances using gene-specific random mutagenesis by dNTP analogs that identify key residues important for transcription termination in certain pol III subunits. The review ends with a ‘technical approaches’ section that includes a parts lists of suppressor-tRNA alleles, strains and plasmids, and graphic examples of its diverse uses. PMID:25447915

Genetic Determinants for Promoter Hypermethylation in the Lungs of Smokers: A Candidate Gene-Based Study

PubMed Central

Leng, Shuguang; Stidley, Christine A.; Liu, Yushi; Edlund, Christopher K.; Willink, Randall P.; Han, Younghun; Landi, Maria Teresa; Thun, Michael; Picchi, Maria A.; Bruse, Shannon E.; Crowell, Richard E.; Van Den Berg, David; Caporaso, Neil E.; Amos, Christopher I.; Siegfried, Jill M.; Tesfaigzi, Yohannes; Gilliland, Frank D.; Belinsky, Steven A.

2011-01-01

The detection of tumor suppressor gene promoter methylation in sputum-derived exfoliated cells predicts early lung cancer. Here we identified genetic determinants for this epigenetic process and examined their biological effects on gene regulation. A two-stage approach involving discovery and replication was employed to assess the association between promoter hypermethylation of a 12-gene panel and common variation in 40 genes involved in carcinogen metabolism, regulation of methylation, and DNA damage response in members of the Lovelace Smokers Cohort (n=1434). Molecular validation of three identified variants was conducted using primary bronchial epithelial cells. Association of study-wide significance (P<8.2×10−5) was identified for rs1641511, rs3730859, and rs1883264 in TP53, LIG1, and BIK, respectively. These SNPs were significantly associated with altered expression of the corresponding genes in primary bronchial epithelial cells. In addition, rs3730859 in LIG1 was also moderately associated with increased risk for lung cancer among Caucasian smokers. Together, our findings suggest that genetic variation in DNA replication and apoptosis pathways impacts the propensity for gene promoter hypermethylation in the aerodigestive tract of smokers. The incorporation of genetic biomarkers for gene promoter hypermethylation with clinical and somatic markers may improve risk assessment models for lung cancer. PMID:22139380

Hunting for Novel X-Linked Breast Cancer Suppressor Genes in Mouse and Human

DTIC Science & Technology

2007-03-01

display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 01/03/07 2 . REPORT TYPE...and correlated significantly with HER- 2 over-expression, regardless of the status of HER- 2 amplification. In toto, the data demonstrate that FOXP3...is an X-linked breast cancer suppressor gene and an important regulator of the HER- 2 /ErbB2 oncogene. 15. SUBJECT TERMS No subject terms provided 16

Differential Splicing of Oncogenes and Tumor Suppressor Genes in African- and Caucasian-American Populations: Contributing Factor in Prostate Cancer Disparities

DTIC Science & Technology

2015-10-01

Populations: Contributing Factor in Prostate Cancer Disparities? PRINCIPAL INVESTIGATOR: Norman H Lee, Ph.D. CONTRACTING ORGANIZATION: George Washington...Prostate Cancer Disparities? 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Norman H Lee, PhD; Bi-Dar Wang, PhD; Jacqueline Olender (PhD graduate...suppressor genes in prostate cancer disparities between African American (AA) and Caucasian American (CA) prostate cancer (PCa). In year 1 of this award

Identification of Two Candidate Tumor Suppressor Genes on Chromosome 17p13.3: Assessment of Their Roles in Breast and Ovarian Carcinogenesis.

DTIC Science & Technology

1998-08-01

has also been reported in primitive neuroectodermal tumors (19), carcinoma of the cervix uteri (20), medulloblastoma, osteosarcoma (21), astrocytoma...Knudson, A. G., Jr. Oncogenes and tumor-suppressor genes. In: W. J. Hoskins, C. A. Perez, and R. C. Young (eds.), Principles and Practice of... Young , B. D., Nakayama, K., and Steiner, D. F. Processing of wild-type and mutant proinsulin-like growth factor-IA by subtilisin-related proprotein

Bypassing Iron Storage in Endodermal Vacuoles Rescues the Iron Mobilization Defect in the natural resistance associated-macrophage protein3natural resistance associated-macrophage protein4 Double Mutant1[OPEN

PubMed Central

Mary, Viviane; Schnell Ramos, Magali; Gillet, Cynthia; Socha, Amanda L.; Giraudat, Jérôme; Agorio, Astrid; Merlot, Sylvain; Clairet, Colin; Kim, Sun A.; Punshon, Tracy; Guerinot, Mary Lou; Thomine, Sébastien

2015-01-01

To improve seed iron (Fe) content and bioavailability, it is crucial to decipher the mechanisms that control Fe storage during seed development. In Arabidopsis (Arabidopsis thaliana) seeds, most Fe is concentrated in insoluble precipitates, with phytate in the vacuoles of cells surrounding the vasculature of the embryo. NATURAL RESISTANCE ASSOCIATED-MACROPHAGE PROTEIN3 (AtNRAMP3) and AtNRAMP4 function redundantly in Fe retrieval from vacuoles during germination. When germinated under Fe-deficient conditions, development of the nramp3nramp4 double mutant is arrested as a consequence of impaired Fe mobilization. To identify novel genes involved in seed Fe homeostasis, we screened an ethyl methanesulfonate-mutagenized population of nramp3nramp4 seedlings for mutations suppressing their phenotypes on low Fe. Here, we report that, among the suppressors, two independent mutations in the VACUOLAR IRON TRANSPORTER1 (AtVIT1) gene caused the suppressor phenotype. The AtVIT1 transporter is involved in Fe influx into vacuoles of endodermal and bundle sheath cells. This result establishes a functional link between Fe loading in vacuoles by AtVIT1 and its remobilization by AtNRAMP3 and AtNRAMP4. Moreover, analysis of subcellular Fe localization indicates that simultaneous disruption of AtVIT1, AtNRAMP3, and AtNRAMP4 limits Fe accumulation in vacuolar globoids. PMID:26232490

Small RNA-induced INTS6 gene up-regulation suppresses castration-resistant prostate cancer cells by regulating β-catenin signaling.

PubMed

Chen, Hong; Shen, Hai-Xiang; Lin, Yi-Wei; Mao, Ye-Qing; Liu, Ben; Xie, Li-Ping

2018-06-12

Small RNAs play an important role in gene regulatory networks. The gene suppressive effect of small RNAs was previously the dominant focus of studies, but during the recent decade, small RNA-induced gene activation has been reported and has become a notable gene manipulation technique. In this study, a putative tumor suppressor, INTS6, was activated by introducing a promoter-targeted small RNA (dsRNA-915) into castration-resistant prostate cancer (CRPC) cells. Unique dynamics associated with the gene upregulation phenomenon was observed. Following gene activation, cell proliferation and motility were suppressed in vitro. Downregulation of Wnt/β-catenin signaling was observed during the activation period, and the impairment of β-catenin degradation reversed the tumor suppressor effects of INTS6. These results suggest the potential application of small activating RNAs in targeted gene therapy for CRPC.

The Epigenetics of Kidney Cancer and Bladder Cancer

PubMed Central

Hoffman, Amanda M.; Cairns, Paul

2012-01-01

Summary This review focuses on the epigenetic alterations of aberrant promoter hypermethylation of genes, histone modifications or RNA interference in cancer cells. The current knowledge of hypermethylation of allele(s) in classical tumor suppressor genes in inherited and sporadic cancer, candidate tumor suppressor and other cancer genes is summarized gene by gene. Global and array-based studies of tumor cell hypermethylation are discussed. The importance of standardization of scoring of the methylation status of a gene is highlighted. The histone marks associated with hypermethylated genes, and the microRNAs with dysregulated expression, in kidney or bladder tumor cells are also discussed. Kidney cancer has the highest mortality rate of the genitourinary cancers. There are management issues with the high recurrence rate of superficial bladder cancer while muscle invasive bladder cancer has a poor prognosis. These clinical problems are the basis for translational application of gene hypermethylation to the diagnosis and prognosis of kidney and bladder cancer. PMID:22126150

SOX14 activates the p53 signaling pathway and induces apoptosis in a cervical carcinoma cell line

PubMed Central

Stanisavljevic, Danijela; Petrovic, Isidora; Vukovic, Vladanka; Schwirtlich, Marija; Gredic, Marija; Stevanovic, Milena

2017-01-01

SOX14 is a member of the SOX family of transcription factors mainly involved in the regulation of neural development. Recently, it became evident that SOX14 is one of four hypermethylated genes in cervical carcinoma, considered as a tumor suppressor candidate in this type of malignancy. In this paper we elucidated the role of SOX14 in the regulation of malignant properties of cervical carcinoma cells in vitro. Functional analysis performed in HeLa cells revealed that SOX14 overexpression decreased viability and promoted apoptosis through altering the expression of apoptosis related genes. Our results demonstrated that overexpression of SOX14 initiated accumulation of p53, demonstrating potential cross-talk between SOX14 and the p53 signaling pathway. Further analysis unambiguously showed that SOX14 triggered posttranslational modification of p53 protein, as detected by the significantly increased level of phospho-p53 (Ser-15) in SOX14-overexpressing HeLa cells. Moreover, the obtained results revealed that SOX14 activated p53 protein, which was confirmed by elevated p21Waf1/Cip1, a well known target gene of p53. This study advances our understanding about the role of SOX14 and might explain the molecular mechanism by which this transcription factor could exert tumor suppressor properties in cervical carcinoma. PMID:28926586

Genome-wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma.

PubMed

Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J; Almutairi, Bader; Etchevers, Heather C; McConville, Carmel; Malik, Karim T A; Brown, Keith W

2017-04-01

Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome-wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome-wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down-regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest-expressing tumors had reduced relapse-free survival. Our functional studies showed that knock-down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc.

Genome‐wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma

PubMed Central

Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.

2016-01-01

Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318

Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

PubMed Central

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

2010-01-01

Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

SASH1: a candidate tumor suppressor gene on chromosome 6q24.3 is downregulated in breast cancer.

PubMed

Zeller, Constanze; Hinzmann, Bernd; Seitz, Susanne; Prokoph, Helmuth; Burkhard-Goettges, Elke; Fischer, Jörg; Jandrig, Burkhard; Schwarz, Lope-Estevez; Rosenthal, André; Scherneck, Siegfried

2003-05-15

Loss of heterozygosity (LOH) and in silico expression analysis were applied to identify genes significantly downregulated in breast cancer within the genomic interval 6q23-25. Systematic comparison of candidate EST sequences with genomic sequences from this interval revealed the genomic structure of a potential target gene on 6q24.3, which we called SAM and SH3 domain containing 1 (SASH1). Loss of the gene-internal marker D6S311, found in 30% of primary breast cancer, was significantly correlated with poor survival and increase in tumor size. Two SASH1 transcripts of approximately 4.4 and 7.5 kb exist and are predominantly transcribed in the human breast, lung, thyroid, spleen, placenta and thymus. In breast cancer cell lines, SASH1 is only expressed at low levels. SASH1 is downregulated in the majority (74%) of breast tumors in comparison with corresponding normal breast epithelial tissues. In addition, SASH1 is also downregulated in tumors of the lung and thyroid. Analysis of the protein domain structure revealed that SASH1 is a member of a recently described family of SH3/SAM adapter molecules and thus suggests a role in signaling pathways. We assume that SASH1 is a new tumor suppressor gene possibly involved in tumorigenesis of breast and other solid cancers. We were unable to find mutations in the coding region of the gene in primary breast cancers showing LOH within the critical region. We therefore hypothesize that other mechanisms as for instance methylation of the promoter region of SASH1 are responsible for the loss of expression of SASH1 in primary and metastatic breast cancer.

Genetic characterization of frameshift suppressors with new decoding properties.

PubMed Central

Hughes, D; Thompson, S; O'Connor, M; Tuohy, T; Nichols, B P; Atkins, J F

1989-01-01

Suppressor mutants that cause ribosomes to shift reading frame at specific and new sequences are described. Suppressors for trpE91, the only known suppressible -1 frameshift mutant, have been isolated in Escherichia coli and in Salmonella typhimurium. E. coli hopR acts on trpE91 within the 9-base-pair sequence GGA GUG UGA, is dominant, and is located at min 52 on the chromosome. Its Salmonella homolog maps at an equivalent position and arises as a rarer class in that organism as compared with E. coli. The Salmonella suppressor, hopE, believed to be in a duplicate copy of the same gene, maps at min 17. The +1 suppressor, sufT, acts at the nonmonotonous sequence CCGU, is dominant, and maps at min 59 on the Salmonella chromosome. PMID:2644219

Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

PubMed Central

Cheng, J; Haas, M

1990-01-01

Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

Sleep quality and methylation status of selected tumor suppressor genes among nurses and midwives.

PubMed

Bukowska-Damska, Agnieszka; Reszka, Edyta; Kaluzny, Pawel; Wieczorek, Edyta; Przybek, Monika; Zienolddiny, Shanbeh; Peplonska, Beata

2018-01-01

Chronic sleep restriction may affect metabolism, hormone secretion patterns and inflammatory responses. Limited reports suggest also epigenetic effects, such as changes in DNA methylation profiles. The study aims to assess the potential association between poor sleep quality or sleep duration and the levels of 5-methylcytosine in the promoter regions of selected tumor suppressor genes. A cross-sectional study was conducted on 710 nurses and midwives aged 40-60 years. Data from interviews regarding sleep habits and potential confounders were used. The methylation status of tumor suppressor genes was determined via qMSP reactions using DNA samples derived from leucocytes. No significant findings were observed in the total study population or in the two subgroups of women stratified by the current system of work. A borderline significance association was observed between a shorter duration of sleep and an increased methylation level in CDKN2A among day working nurses and midwives. Further studies are warranted to explore this under-investigated topic.

Functional conservation of the human EXT1 tumor suppressor gene and its Drosophila homolog tout velu.

PubMed

Dasgupta, Ujjaini; Dixit, Bharat L; Rusch, Melissa; Selleck, Scott; The, Inge

2007-08-01

Heparan sulfate proteoglycans play a vital role in signaling of various growth factors in both Drosophila and vertebrates. In Drosophila, mutations in the tout velu (ttv) gene, a homolog of the mammalian EXT1 tumor suppressor gene, leads to abrogation of glycosaminoglycan (GAG) biosynthesis. This impairs distribution and signaling activities of various morphogens such as Hedgehog (Hh), Wingless (Wg), and Decapentaplegic (Dpp). Mutations in members of the exostosin (EXT) gene family lead to hereditary multiple exostosis in humans leading to bone outgrowths and tumors. In this study, we provide genetic and biochemical evidence that the human EXT1 (hEXT1) gene is conserved through species and can functionally complement the ttv mutation in Drosophila. The hEXT1 gene was able to rescue a ttv null mutant to adulthood and restore GAG biosynthesis.

Tamoxifen induces the expression of maspin through estrogen receptor-alpha.

PubMed

Liu, Zesheng; Shi, Heidi Y; Nawaz, Zafar; Zhang, Ming

2004-06-08

Maspin (mammary serine protease inhibitor) is a tumor suppressor gene that plays an important role in inhibiting tumor growth, invasion and metastasis. Maspin expression is down regulated at transcription level in primary and metastatic breast tumor cells. Previous studies on hormonal regulation of maspin prompt us to test whether an estrogen antagonist tamoxifen (TAM) can exert its anti-tumor function by up regulating maspin gene expression. For this purpose, we first tested whether maspin promoter could be activated in normal and several breast tumor cells. We then carried out a series of promoter analysis in which estrogen receptors and TAM were reconstituted in an in vitro cell culture system. Here we report our new finding that tumor suppresser gene maspin is one of the TAM target genes. TAM induces a maspin/luciferase reporter in cell culture and this induction requires the presence of (estrogen receptor alpha) ERalpha but not estrogen receptor-beta (ERbeta). Maspin promoter deletion and mutation analysis showed that the cis element(s) within a region between -90and+87 bp but not the HRE site (-272 bp) was involved in TAM induction of maspin expression. TAM bound ERalpha may directly control maspin gene expression through the interaction with cofactor (s). Analysis using several ERalpha mutants showed that the N-terminal A/B motif (AF-1) was critical for maspin basal level transcription activation. An ERalpha mutant with point mutations at DNA binding domain abolished estrogen induction of an ERE-luciferase reporter but was still active in activating maspin promoter by TAM. LBD-AF2 domain was required for ERalpha-dependent TAM induction. Deletion of LBD-AF2 or a point mutation in the ERalpha LBD-AF2 region (LBDmtL539A) completely abolished the activation of maspin promoter, suggesting that TAM induction of maspin involves the recruitment of cofactor(s) by ERalpha to the maspin promoter region. This finding indicates that one of the pathways for cancer prevention and tumor inhibition by TAM is mediated through the activation of tumor suppressor gene maspin in breast cancer.

TAD disruption as oncogenic driver.

PubMed

Valton, Anne-Laure; Dekker, Job

2016-02-01

Topologically Associating Domains (TADs) are conserved during evolution and play roles in guiding and constraining long-range regulation of gene expression. Disruption of TAD boundaries results in aberrant gene expression by exposing genes to inappropriate regulatory elements. Recent studies have shown that TAD disruption is often found in cancer cells and contributes to oncogenesis through two mechanisms. One mechanism locally disrupts domains by deleting or mutating a TAD boundary leading to fusion of the two adjacent TADs. The other mechanism involves genomic rearrangements that break up TADs and creates new ones without directly affecting TAD boundaries. Understanding the mechanisms by which TADs form and control long-range chromatin interactions will therefore not only provide insights into the mechanism of gene regulation in general, but will also reveal how genomic rearrangements and mutations in cancer genomes can lead to misregulation of oncogenes and tumor suppressors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

PubMed

Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

2001-01-01

The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or insertions (nine of 22, 41%), a microrearrangement (one of 22, 5%), and single nucleotide substitutions (12 of 22, 56%). In addition, we analyzed the functional characteristics of seven unique mutant p16 proteins identified in this study by assessing their ability to inhibit cyclin-dependent kinase 4 activity. Six of the seven mutant proteins tested exhibited reduced function compared with wild-type p16, ranging from minor decreases of function (twofold to eightfold) in four samples to total loss of function (29- to 38-fold decrease) in two other samples. Overall, somatic mutation of the INK4a/ARF tumor suppressor locus, resulting in functionally deficient p16 and possibly p14(ARF) proteins, seems to be a prevalent event in the development of SCCHN. Mol. Carcinog. 30:26-36, 2001. Copyright 2001 Wiley-Liss, Inc.

Oncogenes and tumor suppressors in the molecular pathogenesis of acute promyelocytic leukemia.

PubMed

Pandolfi, P P

2001-04-01

Acute promyelocytic leukemia (APL) is associated with reciprocal chromosomal translocations always involving the retinoic acid receptor alpha (RARalpha) gene on chromosome 17 and variable partner genes (X genes) on distinct chromosomes. RARalpha fuses to the PML gene in the vast majority of APL cases, and in a few cases to the PLZF, NPM, NuMA and Stat5b genes, respectively, leading to the generation of RARalpha-X: and X:-RARalpha fusion genes. Both fusion proteins can exert oncogenic functions through their ability to interfere with the activities of X and RARalpha proteins. Here, it will be discussed in detail how an extensive biochemical analysis as well as a systematic in vivo genetic approach in the mouse has allowed the definition of the multiple oncogenic activities of PML-RARalpha, and how it has become apparent that this oncoprotein is able to impair RARalpha at the transcription level and the tumor suppressive function of the PML protein.

Loss of neurofibromatosis type 1 (NF1) gene expression in pheochromocytomas from patients without NF1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geist, R.T.; Gutmann, D.H.; Moley, J.F.

The neurofibromatosis type 1 (NF1) gene encodes a tumor suppressor protein, termed neurofibromin. Loss of NF1 gene expression has been reported in Schwann cell tumors (neurofibrosarcomas) from patients with NF1 as well as malignant and neuroblastomas from patients without NF1. Previously, we demonstrated the lack of neurofibromin expression in six pheochromocytomas from patients with NF1, suggesting that neurofibromin loss is associated with the progression to neoplasia in pheochromocytomas in these patients. The lack of NF1 gene expression in NF1 patient pheochromocytomas supports the notion that neurofibromin might be an essential regulator of cell growth in these cells. To determine whethermore » NF1 gene expression is similarly altered in pheochromocytomas from patients without NF1, twenty pheochromocytomas were examined for the presence of NF1 RNA by reverse-transcribed PCR (RT-PCR). Lack of NF1 gene expression was documented in four of these twenty tumors (20%) which corresponds to previously reported numbers for malignant melanomas and neuroblastomas in non-NF1 patients. Of these twenty pheochromocytomas, one of four sporadic tumors, one of ten tumors from patients with MEN2A, one of four tumors from patients with MEN2B, and one of two tumors from patients with von Hippel-Lindau syndrome demonstrated loss of NF1 gene expression. In all cases, the quality and quantity of tumor RNA was determined by RT-PCR amplification using primers which amplify cyclophilin RNA. We previously demonstrated that these tumors do not harbor activating mutations of the N-ras, K-ras or H-ras proto-oncogenes. These results suggest that loss of NF1 gene expression is frequently associated with the progression to neoplasia in tumors derived from adrenal medullary tissue in patients without clinical manifestations of neurofibromatosis and supports the notion that neurofibromin is a tumor suppressor gene product involved in the pathogenesis of a wide variety of tumor types.« less

Identification of Novel Androgen-Regulated Pathways and mRNA Isoforms through Genome-Wide Exon-Specific Profiling of the LNCaP Transcriptome

PubMed Central

Carling, Phillippa J.; Buist, Thomas; Zhang, Chaolin; Grellscheid, Sushma N.; Armstrong, Kelly; Stockley, Jacqueline; Simillion, Cedric; Gaughan, Luke; Kalna, Gabriela; Zhang, Michael Q.; Robson, Craig N.; Leung, Hing Y.; Elliott, David J.

2011-01-01

Androgens drive the onset and progression of prostate cancer (PCa) by modulating androgen receptor (AR) transcriptional activity. Although several microarray-based studies have identified androgen-regulated genes, here we identify in-parallel global androgen-dependent changes in both gene and alternative mRNA isoform expression by exon-level analyses of the LNCaP transcriptome. While genome-wide gene expression changes correlated well with previously-published studies, we additionally uncovered a subset of 226 novel androgen-regulated genes. Gene expression pathway analysis of this subset revealed gene clusters associated with, and including the tyrosine kinase LYN, as well as components of the mTOR (mammalian target of rapamycin) pathway, which is commonly dysregulated in cancer. We also identified 1279 putative androgen-regulated alternative events, of which 325 (∼25%) mapped to known alternative splicing events or alternative first/last exons. We selected 30 androgen-dependent alternative events for RT-PCR validation, including mRNAs derived from genes encoding tumour suppressors and cell cycle regulators. Of seven positively-validating events (∼23%), five events involved transcripts derived from alternative promoters of known AR gene targets. In particular, we found a novel androgen-dependent mRNA isoform derived from an alternative internal promoter within the TSC2 tumour suppressor gene, which is predicted to encode a protein lacking an interaction domain required for mTOR inhibition. We confirmed that expression of this alternative TSC2 mRNA isoform was directly regulated by androgens, and chromatin immunoprecipitation indicated recruitment of AR to the alternative promoter region at early timepoints following androgen stimulation, which correlated with expression of alternative transcripts. Together, our data suggest that alternative mRNA isoform expression might mediate the cellular response to androgens, and may have roles in clinical PCa. PMID:22194994

Identification of early target genes of aflatoxin B1 in human hepatocytes, inter-individual variability and comparison with other genotoxic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Josse, Rozenn; Dumont, Julie; Fautrel, Alain

Gene expression profiling has recently emerged as a promising approach to identify early target genes and discriminate genotoxic carcinogens from non-genotoxic carcinogens and non-carcinogens. However, early gene changes induced by genotoxic compounds in human liver remain largely unknown. Primary human hepatocytes and differentiated HepaRG cells were exposed to aflatoxin B1 (AFB1) that induces DNA damage following enzyme-mediated bioactivation. Gene expression profile changes induced by a 24 h exposure of these hepatocyte models to 0.05 and 0.25 μM AFB1 were analyzed by using oligonucleotide pangenomic microarrays. The main altered signaling pathway was the p53 pathway and related functions such as cellmore » cycle, apoptosis and DNA repair. Direct involvement of the p53 protein in response to AFB1 was verified by using siRNA directed against p53. Among the 83 well-annotated genes commonly modulated in two pools of three human hepatocyte populations and HepaRG cells, several genes were identified as altered by AFB1 for the first time. In addition, a subset of 10 AFB1-altered genes, selected upon basis of their function or tumor suppressor role, was tested in four human hepatocyte populations and in response to other chemicals. Although they exhibited large variable inter-donor fold-changes, several of these genes, particularly FHIT, BCAS3 and SMYD3, were found to be altered by various direct and other indirect genotoxic compounds and unaffected by non-genotoxic compounds. Overall, this comprehensive analysis of early gene expression changes induced by AFB1 in human hepatocytes identified a gene subset that included several genes representing potential biomarkers of genotoxic compounds. -- Highlights: ► Gene expression profile changes induced by aflatoxin B1 in human hepatocytes. ► AFB1 modulates various genes including tumor suppressor genes and proto-oncogenes. ► Important inter-individual variations in the response to AFB1. ► Some genes also altered by other genotoxic compounds requiring or not bioactivation.« less

Mechanisms of the HRSL3 tumor suppressor function in ovarian carcinoma cells.

PubMed

Nazarenko, Irina; Schäfer, Reinhold; Sers, Christine

2007-04-15

HRSL3 (also known as H-REV107-1) belongs to a class II tumor suppressor gene family and is downregulated in several human tumors including ovarian carcinomas. To unravel the mechanism of HRSL3 tumor suppressor action, we performed a yeast two-hybrid screen and identified the alpha-isoform of the regulatory subunit A of protein phosphatase 2A (PR65alpha) as a new interaction partner of HRSL3. Interaction between HRSL3 and PR65alpha was confirmed in vitro and by co-immunoprecipitation in mammalian cells. We demonstrate that HRSL3 binds to the endogenous PR65alpha, thereby partially sequestering the catalytic subunit PR36 from the PR65 protein complex, and inhibiting PP2A catalytic activity. Furthermore, binding of HRSL3 to PR65 induces apoptosis in ovarian carcinoma cells in a caspase-dependent manner. Using several mutant HRSL3 constructs, we identified the N-terminal proline-rich region within the HRSL3 protein as the domain that is relevant for both binding of PR65alpha and induction of programmed cell death. This suggests that the negative impact of HRSL3 onto PP2A activity is important for the HRSL3 pro-apoptotic function and indicates a role of PP2A in survival of human ovarian carcinomas. The analysis of distinct PP2A target molecules revealed PKCzeta as being involved in HRSL3 action. These data implicate HRSL3 as a signaling regulatory molecule, which is functionally involved in the oncogenic network mediating growth and survival of ovarian cancer cells.

The Quest for the 1p36 Tumor Suppressor

PubMed Central

Bagchi, Anindya; Mills, Alea A.

2010-01-01

Genomic analyses of late-stage human cancers have uncovered deletions encompassing 1p36, thereby providing an extensive body of literature supporting the idea that a potent tumor suppressor resides in this interval. Although a number of genes have been proposed as 1p36 candidate tumor suppressors, convincing evidence that their encoded products protect from cancer has been scanty. A recent functional study identified CHD5 as a novel tumor suppressor mapping to 1p36. Here we discuss evidence supporting CHD5’s tumor suppressive role. Together, these findings suggest that strategies designed to enhance CHD5 activity could provide novel approaches for treating a broad range of human malignancies. PMID:18413720

Update on Genetic Conditions Affecting the Skin and the Kidneys

PubMed Central

Reimer, Antonia; He, Yinghong; Has, Cristina

2018-01-01

Genetic conditions affecting the skin and kidney are clinically and genetically heterogeneous, and target molecular components present in both organs. The molecular pathology involves defects of cell–matrix adhesion, metabolic or signaling pathways, as well as tumor suppressor genes. This article gives a clinically oriented overview of this group of disorders, highlighting entities which have been recently described, as well as the progress made in understanding well-known entities. The genetic bases as well as molecular cell biological mechanisms are described, with therapeutic applications. PMID:29552546

[Metastasis tumors of the central nervous system: molecular biology].

PubMed

Bello, M Josefa; González-Gómez, P; Rey, J A

2004-12-01

Metastases in the nervous system represent an important and growing problem in the clinical practice, being the cause of a great mortality in the developed countries. This article reviews the few data available on the molecular mechanisms involved in the pathogenesis of these tumours, leading to oncogene activation, inactivation of tumour suppressor genes, not only by the classical mechanisms, but also by the tumour cell epigenetic balance alteration. We conclude that all this knowledge will lead in the future to a better diagnosis, treatment and clinic evolution of these patients.

BAX Inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives.

PubMed

Hückelhoven, R

2004-05-01

BAX Inhibitor-1 (BI-1) was originally described as testis enhanced gene transcript in mammals. Functional screening in yeast for human proteins that can inhibit the cell death provoking function of BAX, a proapoptotic Bcl-2 family member, led to functional characterisation and renaming of BI-1. The identification of functional homologues of BI-1 in plants and yeast widened the understanding of BI-1 function as an ancient suppressor of programmed cell death. BI-1 is one of the few cell death suppressors conserved in animals and plants. Computer predictions and experimental data together suggest that BI-1 is a membrane spanning protein with 6 to 7 transmembrane domains and a cytoplasmic C-terminus sticking in the endoplasmatic reticulum and nuclear envelope. Proteins similar to BI-1 are present in other eukaryotes, bacteria, and even viruses encode BI-1 like proteins. BI-1 is involved in development, response to biotic and abiotic stress and probably represents an indispensable cell protectant. BI-1 appears to suppress cell death induced by mitochondrial dysfunction, reactive oxygen species or elevated cytosolic Ca(2+) levels. This review focuses on the present understanding about BI-1 and suggests potential directions for further analyses of this increasingly noticed protein.

The Genetics of a Small Autosomal Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. III. Hypomorphic and Hypermorphic Mutations Affecting the Expression of Hairless

PubMed Central

Ashburner, Michael

1982-01-01

A lethal locus (l(2)br7;35B6-10), near Adh on chromosome arm 2L of D. melanogaster, is identified with Plunkett's dominant suppressor of Hairless (H). Of eight new alleles, seven act as dominant suppressors of H, the eighth is a dominant enhancer of H. One of the suppressor alleles is both a leaky lethal and a weak suppressor of H. Confirming Nash (1970), deletions of l(2)br7 are dominant suppressors, and duplications are dominant enhancers of H. A simple model is proposed to account for the interaction of l(2)br7 and H, assuming that amorphic (or hypomorphic) alleles of l(2)br7 suppress H and that hypermorphic alleles enhance H. PMID:6816670

Proto-oncogene FBI-1 (Pokemon/ZBTB7A) represses transcription of the tumor suppressor Rb gene via binding competition with Sp1 and recruitment of co-repressors.

PubMed

Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

2008-11-28

FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp -308 to -188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp -65 to -56) and GC-box 2 (bp -18 to -9), the latter of which is also bound by FBI-1. We found that FRE3 (bp -244 to -236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression.

The context of transcription start site regions is crucial for transcription of a plant tRNA(Lys)(UUU) gene group both in vitro and in vivo.

PubMed

Yukawa, Yasushi; Akama, Kazuhito; Noguchi, Kanta; Komiya, Masaaki; Sugiura, Masahiro

2013-01-10

Nuclear tRNA genes are transcribed by RNA polymerase III. The A- and B-boxes located within the transcribed regions are essential promoter elements for nuclear tRNA gene transcription. The Arabidopsis genome contains ten annotated genes encoding identical tRNA(Lys)(UUU) molecules, which are scattered on the five chromosomes. In this study, we prepared ten tDNA constructs including each of the tRNA(Lys)(UUU) coding sequences with their individual 5' and 3' flanking sequences, and assayed tRNA expression using an in vitro RNA polymerase III-dependent transcription system. Transcription levels differed significantly among the ten genes and two of the tRNA genes were transcribed at a very low level, despite possessing A- and B-boxes identical to those of the other tRNA genes. To examine whether the in vitro results were reproducible in vivo, the 5' flanking sequence of an amber suppressor tRNA gene was then replaced with those of the ten tRNA(Lys) genes. An in vivo experiment based on an amber suppressor tRNA that mediates suppression of a premature amber codon in a β-glucuronidase (GUS) reporter gene in plant tissues generated nearly identical results to those obtained in vitro. Analysis of mutated versions of the amber suppressor tRNA gene, which contained base substitutions around the transcription start site (TSS), showed that the context around the transcription start sites is a crucial determinant for transcription of plant tRNA(Lys)(UUU) both in vitro and in vivo. The above transcription regulation by context around TSS differed between tRNA genes and other Pol III-dependent genes. Copyright © 2012 Elsevier B.V. All rights reserved.

FgPrp4 Kinase Is Important for Spliceosome B-Complex Activation and Splicing Efficiency in Fusarium graminearum

PubMed Central

Jiang, Cong; Li, Yang; Li, Chaohui; Liu, Huiquan; Kang, Zhensheng; Xu, Jin-Rong

2016-01-01

PRP4 encodes the only kinase among the spliceosome components. Although it is an essential gene in the fission yeast and other eukaryotic organisms, the Fgprp4 mutant was viable in the wheat scab fungus Fusarium graminearum. Deletion of FgPRP4 did not block intron splicing but affected intron splicing efficiency in over 60% of the F. graminearum genes. The Fgprp4 mutant had severe growth defects and produced spontaneous suppressors that were recovered in growth rate. Suppressor mutations were identified in the PRP6, PRP31, BRR2, and PRP8 orthologs in nine suppressor strains by sequencing analysis with candidate tri-snRNP component genes. The Q86K mutation in FgMSL1 was identified by whole genome sequencing in suppressor mutant S3. Whereas two of the suppressor mutations in FgBrr2 and FgPrp8 were similar to those characterized in their orthologs in yeasts, suppressor mutations in Prp6 and Prp31 orthologs or FgMSL1 have not been reported. Interestingly, four and two suppressor mutations identified in FgPrp6 and FgPrp31, respectively, all are near the conserved Prp4-phosphorylation sites, suggesting that these mutations may have similar effects with phosphorylation by Prp4 kinase. In FgPrp31, the non-sense mutation at R464 resulted in the truncation of the C-terminal 130 aa region that contains all the conserved Prp4-phosphorylation sites. Deletion analysis showed that the N-terminal 310-aa rich in SR residues plays a critical role in the localization and functions of FgPrp4. We also conducted phosphoproteomics analysis with FgPrp4 and identified S289 as the phosphorylation site that is essential for its functions. These results indicated that FgPrp4 is critical for splicing efficiency but not essential for intron splicing, and FgPrp4 may regulate pre-mRNA splicing by phosphorylation of other components of the tri-snRNP although itself may be activated by phosphorylation at S289. PMID:27058959

Breast carcinoma metastasis suppressor gene 1 (BRMS1): update on its role as the suppressor of cancer metastases.

PubMed

Kodura, Magdalena Anna; Souchelnytskyi, Serhiy

2015-12-01

BRMS1 was discovered over a decade ago as a potential tumor suppressor gene. In this review, we summarize the recent findings about the structure of BRMS1, mechanisms of its action and a role of BRMS1 in the cancer progression. As a suppressor of metastasis, BRMS1 has demonstrated a variety of ways to act on the cell functions, such as cell migration, invasiveness, angiogenesis, cell survival, cytoskeleton rearrangements, cell adhesion, and immune recognition. This variety of effects is a likely reason behind the robustness of anti-metastatic influence of BRMS1. Intracellular signaling mechanisms employed by BRMS1 include regulation of transcription, EGF/HER2 signaling, and expression of NF-kB, fascin, osteopontin, and IL-6. Recently reported clinical studies confirm that BRMS1 can indeed be used as a prognostic marker. Approaches to employ BRMS1 in a development of anti-cancer treatment have also been made. The studies reviewed here with respect to BRMS1 structure, cellular effects, intracellular signaling, and clinical value consolidate the importance of BRMS1 in the development of metastasis.

VGLL3 expression is associated with a tumor suppressor phenotype in epithelial ovarian cancer.

PubMed

Gambaro, Karen; Quinn, Michael C J; Wojnarowicz, Paulina M; Arcand, Suzanna L; de Ladurantaye, Manon; Barrès, Véronique; Ripeau, Jean-Sébastien; Killary, Ann M; Davis, Elaine C; Lavoie, Josée; Provencher, Diane M; Mes-Masson, Anne-Marie; Chevrette, Mario; Tonin, Patricia N

2013-06-01

Previous studies have implicated vestigial like 3 (VGLL3), a chromosome 3p12.3 gene that encodes a putative transcription co-factor, as a candidate tumor suppressor gene (TSG) in high-grade serous ovarian carcinomas (HGSC), the most common type of epithelial ovarian cancer. A complementation analysis based on microcell-mediated chromosome transfer (MMCT) using a centric fragment of chromosome 3 (der3p12-q12.1) into the OV-90 ovarian cancer cell line haploinsufficient for 3p and lacking VGLL3 expression was performed to assess the effect on tumorigenic potential and growth characteristics. Genetic characterization of the derived MMCT hybrids revealed that only the hybrid that contained an intact VGLL3 locus exhibited alterations of tumorigenic potential in a nude mouse xenograft model and various in vitro growth characteristics. Only stable OV-90 transfectant clones expressing low levels of VGLL3 were derived. These clones exhibited an altered cytoplasmic morphology characterized by numerous single membrane bound multivesicular-bodies (MVB) that were not attributed to autophagy. Overexpression of VGLL3 in OV-90 was achieved using a lentivirus-based tetracycline inducible gene expression system, which also resulted in MVB formation in the infected cell population. Though there was no significant differences in various in vitro and in vivo growth characteristics in a comparison of VGLL3-expressing clones with empty vector transfectant controls, loss of VGLL3 expression was observed in tumors derived from mouse xenograft models. VGLL3 gene and protein expression was significantly reduced in HGSC samples (>98%, p < 0.05) relative to either normal ovarian surface epithelial cells or epithelial cells of the fallopian tube, possible tissues of origin of HGSC. Also, there appeared to be to be more cases with higher staining levels in stromal tissue component from HGSC cases that had a prolonged disease-free survival. The results taken together suggest that VGLL3 is involved in tumor suppressor pathways, a feature that is characterized by the absence of VGLL3 expression in HGSC samples. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Application of advanced cytometric and molecular technologies to minimal residual disease monitoring

NASA Astrophysics Data System (ADS)

Leary, James F.; He, Feng; Reece, Lisa M.

2000-04-01

Minimal residual disease monitoring presents a number of theoretical and practical challenges. Recently it has been possible to meet some of these challenges by combining a number of new advanced biotechnologies. To monitor the number of residual tumor cells requires complex cocktails of molecular probes that collectively provide sensitivities of detection on the order of one residual tumor cell per million total cells. Ultra-high-speed, multi parameter flow cytometry is capable of analyzing cells at rates in excess of 100,000 cells/sec. Residual tumor selection marker cocktails can be optimized by use of receiver operating characteristic analysis. New data minimizing techniques when combined with multi variate statistical or neural network classifications of tumor cells can more accurately predict residual tumor cell frequencies. The combination of these techniques can, under at least some circumstances, detect frequencies of tumor cells as low as one cell in a million with an accuracy of over 98 percent correct classification. Detection of mutations in tumor suppressor genes requires insolation of these rare tumor cells and single-cell DNA sequencing. Rare residual tumor cells can be isolated at single cell level by high-resolution single-cell cell sorting. Molecular characterization of tumor suppressor gene mutations can be accomplished using a combination of single- cell polymerase chain reaction amplification of specific gene sequences followed by TA cloning techniques and DNA sequencing. Mutations as small as a single base pair in a tumor suppressor gene of a single sorted tumor cell have been detected using these methods. Using new amplification procedures and DNA micro arrays it should be possible to extend the capabilities shown in this paper to screening of multiple DNA mutations in tumor suppressor and other genes on small numbers of sorted metastatic tumor cells.

The human ARF tumor suppressor senses blastema activity and suppresses epimorphic tissue regeneration

PubMed Central

Hesse, Robert G; Kouklis, Gayle K; Ahituv, Nadav; Pomerantz, Jason H

2015-01-01

The control of proliferation and differentiation by tumor suppressor genes suggests that evolution of divergent tumor suppressor repertoires could influence species’ regenerative capacity. To directly test that premise, we humanized the zebrafish p53 pathway by introducing regulatory and coding sequences of the human tumor suppressor ARF into the zebrafish genome. ARF was dormant during development, in uninjured adult fins, and during wound healing, but was highly expressed in the blastema during epimorphic fin regeneration after amputation. Regenerative, but not developmental signals resulted in binding of zebrafish E2f to the human ARF promoter and activated conserved ARF-dependent Tp53 functions. The context-dependent activation of ARF did not affect growth and development but inhibited regeneration, an unexpected distinct tumor suppressor response to regenerative versus developmental environments. The antagonistic pleiotropic characteristics of ARF as both tumor and regeneration suppressor imply that inducing epimorphic regeneration clinically would require modulation of ARF –p53 axis activation. DOI: http://dx.doi.org/10.7554/eLife.07702.001 PMID:26575287

Ring structure amino acids affect the suppressor activity of melon aphid-borne yellows virus P0 protein.

PubMed

Han, Yan-Hong; Xiang, Hai-Ying; Wang, Qian; Li, Yuan-Yuan; Wu, Wen-Qi; Han, Cheng-Gui; Li, Da-Wei; Yu, Jia-Lin

2010-10-10

Melon aphid-borne yellows virus (MABYV) is a newly identified polerovirus occurring in China. Here, we demonstrate that the MABYV encoded P0 (P0(MA)) protein is a strong suppressor of post-transcriptional gene silencing (PTGS) with activity comparable to tobacco etch virus (TEV) HC-Pro. In addition we have shown that the LP F-box motif present at the N-terminus of P0(MA) is required for suppressor activity. Detailed mutational analyses on P0(MA) revealed that changing the conserved Trp 212 with non-ring structured amino acids altered silencing suppressor functions. Ala substitutions at positions 12 and 211 for Phe had no effect on P0 suppression-activity, whereas Arg and Glu substitutions had greatly decreased suppressor activity. Furthermore, substitutions targeting Phe at position 30 also resulted in reduced P0 suppression-activity. Altogether, these results suggest that ring structured Trp/Phe residues in P0 have important roles in suppressor activity. Copyright © 2010 Elsevier Inc. All rights reserved.

DNA repair and tumorigenesis: lessons from hereditary cancer syndromes.

PubMed

Heinen, Christopher D; Schmutte, Christoph; Fishel, Richard

2002-01-01

The discovery that alterations of the DNA mismatch repair system (MMR) were linked to the common human cancer susceptibility syndrome hereditary nonpolyposis colon cancer (HNPCC) resulted in the declaration of a third class of genes involved in tumor development. In addition to oncogenes and tumor suppressors, alterations of DNA repair genes involved in maintaining genomic stability were found to be a clear cause of tum the level of the single nucleotides or chromosomes. This observation suggested that the establishment of genomic instability, termed the Mutator Phenotype, was an important aspect of tumor development.(1,2) Since the initial identification of the human MutS homolog hMSH2 nearly a decade ago,(3,4) more links have been described between human cancers and genes involved in maintaining genomic stability. Work in recent years has revealed that DNA repair proteins may also function in signaling pathways that provoke cell cycle arrest and apoptosis. This review will focus on the genetic and biochemical functions of DNA repair genes linked to hereditary cancer predisposition characterized by genomic instability (Table 1). Interestingly, the protein products of these genes have been directly or indirectly linked to the DNA damage-induce cell cycle arrest and apoptosis. We conclude that a robust connection between DNA repair proteins and damage-induced apoptosis may be as important for tumorigenesis as their role in maintaining genome stability.

Contextualizing the Genes Altered in Bladder Neoplasms in Pediatric andTeen Patients Allows Identifying Two Main Classes of Biological ProcessesInvolved and New Potential Therapeutic Targets

PubMed Central

Porrello, A.; Piergentili, R. b

2016-01-01

Research on bladder neoplasms in pediatric and teen patients (BNPTP) has described 21 genes, which are variously involved in this disease and are mostly responsible for deregulated cell proliferation. However, due to the limited number of publications on this subject, it is still unclear what type of relationships there are among these genes and which are the chances that, while having different molecular functions, they i) act as downstream effector genes of well-known pro- or anti- proliferative stimuli and/or interplay with biochemical pathways having oncological relevance or ii) are specific and, possibly, early biomarkers of these pathologies. A Gene Ontology (GO)-based analysis showed that these 21 genes are involved in biological processes, which can be split into two main classes: cell regulation-based and differentiation/development-based. In order to understand the involvement/overlapping with main cancer-related pathways, we performed a meta-analysis dependent on the 189 oncogenic signatures of the Molecular Signatures Database (OSMSD) curated by the Broad Institute. We generated a binary matrix with 53 gene signatures having at least one hit; this analysis i) suggests that some genes of the original list show inconsistencies and might need to be experimentally re- assessed or evaluated as biomarkers (in particular, ACTA2) and ii) allows hypothesizing that important (proto)oncogenes (E2F3, ERBB2/HER2, CCND1, WNT1, and YAP1) and (putative) tumor suppressors (BRCA1, RBBP8/CTIP, and RB1-RBL2/p130) may participate in the onset of this disease or worsen the observed phenotype, thus expanding the list of possible molecular targets for the treatment of BNPTP. PMID:27013923

RNA sequencing-based analysis of gallbladder cancer reveals the importance of the liver X receptor and lipid metabolism in gallbladder cancer

PubMed Central

Zuo, Mingxin; Rashid, Asif; Wang, Ying; Jain, Apurva; Li, Donghui; Behari, Anu; Kapoor, Vinay Kumar; Koay, Eugene J.; Chang, Ping; Vauthey, Jean Nicholas; Li, Yanan; Espinoza, Jaime A.; Roa, Juan Carlos; Javle, Milind

2016-01-01

Gallbladder cancer (GBC) is an aggressive malignancy. Although surgical resection may be curable, most patients are diagnosed at an advanced unresectable disease stage. Cholelithiasis is the major risk factor; however the pathogenesis of the disease, from gallstone cholecystitis to cancer, is still not understood. To understand the molecular genetic underpinnings of this cancer and explore novel therapeutic targets for GBC, we examined the key genes and pathways involved in GBC using RNA sequencing. We performed gene expression analysis of 32 cases of surgically-resected GBC along with normal gallbladder tissue controls. We observed that 519 genes were differentially expressed between GBC and normal GB mucosal controls. The liver X receptor (LXR)/retinoid X receptor (RXR) and farnesoid X receptor (FXR) /RXR pathways were the top canonical pathways involved in GBC. Key genes in these pathways, including SERPINB3 and KLK1, were overexpressed in GBC, especially in female GBC patients. Additionally, ApoA1 gene expression suppressed in GBC as compared with normal control tissues. LXR and FXR genes, known to be important in lipid metabolism also function as tumor suppressors and their down regulation appears to be critical for GBC pathogenesis. LXR agonists may have therapeutic value and as potential therapeutic targets. PMID:27167107

Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes

PubMed Central

Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo

2010-01-01

We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513

[Alterations of c-Myc and c-erbB-2 genes in ovarian tumours].

PubMed

Pastor, Tibor; Popović, Branka; Gvozdenović, Ana; Boro, Aleksandar; Petrović, Bojana; Novaković, Ivana; Puzović, Dragana; Luković, Ljiljana; Milasin, Jelena

2009-01-01

According to clinical and epidemiological studies, ovarian cancer ranks fifth in cancer deaths among women. The causes of ovarian cancer remain largely unknown but various factors may increase the risk of developing it, such as age, family history of cancer, childbearing status etc. This cancer results from a succession of genetic alterations involving oncogenes and tumour suppressor genes, which have a critical role in normal cell growth regulation. Mutations and/or overexpression of three oncogenes, c-erbB-2, c-Myc and K-ras, and of the tumour suppressor gene p53, have been frequently observed in a sporadic ovarian cancer. The aim of the present study was to analyse c-Myc and c-erbB-2 oncogene alterations, specifically amplification, as one of main mechanisms of their activation in ovarian cancers and to establish a possible association with the pathogenic process. DNA was isolated from 15 samples of malignant and 5 benign ovarian tumours, using proteinase K digestion, followed by phenol-chloroform isoamyl extraction and ethanol precipitation. C-Myc and c-erbB-2 amplification were detected by differential PCR. The level of gene copy increase was measured using the Scion image software. The amplification of both c-Myc and c-erbB-2 was detected in 26.7% of ovarian epithelial carcinoma specimens. Only one tumour specimen concomitantly showed increased gene copy number for both studied genes. Interestingly, besides amplification, gene deletion was also detected (26.7% for c-erbB-2). Most of the ovarian carcinomas with alterations in c-Myc and c-erbB-2 belonged to advanced FIGO stages. The amplification of c-Myc and c-erbB-2 oncogenes in ovarian epithelial carcinomas is most probably a late event in the pathogenesis conferring these tumours a more aggressive biological behaviour. Similarly, gene deletions point to genomic instability in epithelial carcinomas in higher clinical stages as the result of clonal evolution and selection.

Loss of heterozygosity and methylation of multiple tumor suppressor genes on chromosome 3 in hepatocellular carcinoma.

PubMed

Zhang, Xiaoying; Li, Hiu Ming; Liu, Zhiyan; Zhou, Gengyin; Zhang, Qinghui; Zhang, Tingguo; Zhang, Jianping; Zhang, Cuijuan

2013-01-01

Genetic and epigenetic alterations are the two key mechanisms in the development of hepatocellular carcinoma (HCC). However, how they contribute to hepatocarcinogenesis and the correlation between them has not been fully elucidated. A total of 48 paired HCCs and noncancerous tissues were used to detect loss of heterozygosity (LOH) and the methylation profiles of five tumor suppressor genes (RASSF1A, BLU, FHIT, CRBP1, and HLTF) on chromosome 3 by using polymerase chain reaction (PCR) and methylation-specific PCR. Gene expression was analyzed by immunohistochemistry and reverse transcription (RT)-PCR. Sixteen of 48 (33.3 %) HCCs had LOH on at least one locus on chromosome 3, and two smallest common deleted regions (3p22.3-24.3 and 3p12.3-14.2) were identified. RASSF1A, BLU, and FHIT showed very high frequencies of methylation in HCCs (100, 81.3, and 64.6 %, respectively) and noncancerous tissues, but not in liver tissues from control patients. Well-differentiated HCCs showed high methylation frequencies of these genes but very low frequencies of LOH. Furthermore, BLU methylation was associated with an increased level of alpha-fetoprotein, and FHIT methylation was inversely correlated with HCC recurrence. In comparison, CRBP1 showed moderate frequencies of methylation, while HLTF showed low frequencies of methylation, and CRBP1 methylation occurred mainly in elderly patients. Treatment with 5-aza-2'-deoxycytidine demethylated at least one of these genes and restored their expression in a DNA methylation-dependent or -independent manner. Hypermethylation of RASSF1A, BLU, and FHIT is a common and very early event in hepatocarcinogenesis; CRBP1 methylation may also be involved in the later stage. Although LOH was not too frequent on chromosome 3, it may play a role as another mechanism in hepatocarcinogenesis.

Transcription factor FOXA2-centered transcriptional regulation network in non-small cell lung cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jang, Sang-Min; An, Joo-Hee; Kim, Chul-Hong

2015-08-07

Lung cancer is the leading cause of cancer-mediated death. Although various therapeutic approaches are used for lung cancer treatment, these mainly target the tumor suppressor p53 transcription factor, which is involved in apoptosis and cell cycle arrest. However, p53-targeted therapies have limited application in lung cancer, since p53 is found to be mutated in more than half of lung cancers. In this study, we propose tumor suppressor FOXA2 as an alternative target protein for therapies against lung cancer and reveal a possible FOXA2-centered transcriptional regulation network by identifying new target genes and binding partners of FOXA2 by using various screeningmore » techniques. The genes encoding Glu/Asp-rich carboxy-terminal domain 2 (CITED2), nuclear receptor subfamily 0, group B, member 2 (NR0B2), cell adhesion molecule 1 (CADM1) and BCL2-associated X protein (BAX) were identified as putative target genes of FOXA2. Additionally, the proteins including highly similar to heat shock protein HSP 90-beta (HSP90A), heat shock 70 kDa protein 1A variant (HSPA1A), histone deacetylase 1 (HDAC1) and HDAC3 were identified as novel interacting partners of FOXA2. Moreover, we showed that FOXA2-dependent promoter activation of BAX and p21 genes is significantly reduced via physical interactions between the identified binding partners and FOXA2. These results provide opportunities to understand the FOXA2-centered transcriptional regulation network and novel therapeutic targets to modulate this network in p53-deficient lung cancer. - Highlights: • Identification of new target genes of FOXA2. • Identifications of novel interaction proteins of FOXA2. • Construction of FOXA2-centered transcriptional regulatory network in non-small cell lung cancer.« less

Association of P53 gene polymorphism with gastric cancer in Northern Iran as a high-risk region.

PubMed

Hedayatizadeh-Omran, Akbar; Alizadeh-Navaei, Reza; Janbabaei, Ghasem; Omrani-Nava, Versa; Hasheminasab, Yahya; Amjadi, Omolbanin; Tehrani, Mohsen

2018-05-01

Gastric cancer has the fourth highest morbidity rate of all cancers worldwide. Genetic factors including alterations in oncogenes and tumor suppressor genes serve an important role in gastric cancer development and progression. The P53 gene acts as a tumor suppressor gene by regulating the cell cycle, DNA transcription and repair, apoptosis, senescence and genome stability. In addition to somatic P53 mutations in cancer development, germline polymorphisms are also involved in different malignancies. The polymorphism of P53 at codon 72 (Arg72Pro) is established as a common variant that increases susceptibility to various cancers. The present case-control study was conducted to evaluate the possible association between this P53 polymorphism and gastric cancer in the Iranian population. A total of 59 patients with gastric cancer and 59 healthy controls were enrolled in the present study. Genomic DNA was extracted from peripheral blood mononuclear cells and genotype analysis was performed using a polymerase chain reaction-based restriction fragment length polymorphism assay. Genotype frequencies did not differ significantly between the patients and controls (P=0.4); the frequencies of the three genotypes Arg/Arg, Arg/Pro and Pro/Pro in gastric cancer patients were 28.8, 49.2 and 22.0%, and in controls were 37.3, 49.2 and 13.6%. Additionally, there were no differences in genotype frequencies based on tumor location, histological differentiation or tumor stage. Based on these findings, it may be concluded that the P53 codon 72 polymorphism does not contribute to gastric cancer susceptibility in Northern Iran.

Electric pulses used in electrochemotherapy and electrogene therapy do not significantly change the expression profile of genes involved in the development of cancer in malignant melanoma cells.

PubMed

Mlakar, Vid; Todorovic, Vesna; Cemazar, Maja; Glavac, Damjan; Sersa, Gregor

2009-08-26

Electroporation is a versatile method for in vitro or in vivo delivery of different molecules into cells. However, no study so far has analysed the effects of electric pulses used in electrochemotherapy (ECT pulses) or electric pulses used in electrogene therapy (EGT pulses) on malignant cells. We studied the effect of ECT and EGT pulses on human malignant melanoma cells in vitro in order to understand and predict the possible effect of electric pulses on gene expression and their possible effect on cell behaviour. We used microarrays with 2698 different oligonucleotides to obtain the expression profile of genes involved in apoptosis and cancer development in a malignant melanoma cell line (SK-MEL28) exposed to ECT pulses and EGT pulses. Cells exposed to ECT pulses showed a 68.8% average survival rate, while cells exposed to EGT pulses showed a 31.4% average survival rate. Only seven common genes were found differentially expressed in cells 16 h after exposure to ECT and EGT pulses. We found that ECT and EGT pulses induce an HSP70 stress response mechanism, repress histone protein H4, a major protein involved in chromatin assembly, and down-regulate components involved in protein synthesis. Our results show that electroporation does not significantly change the expression profile of major tumour suppressor genes or oncogenes of the cell cycle. Moreover, electroporation also does not changes the expression of genes involved in the stability of DNA, supporting current evidence that electroporation is a safe method that does not promote tumorigenesis. However, in spite of being considered an isothermal method, it does to some extent induce stress, which resulted in the expression of the environmental stress response mechanism, HSP70.

Potential role of TRIM3 as a novel tumour suppressor in colorectal cancer (CRC) development.

PubMed

Piao, Mei-Yu; Cao, Hai-Long; He, Na-Na; Xu, Meng-Que; Dong, Wen-Xiao; Wang, Wei-Qiang; Wang, Bang-Mao; Zhou, Bing

2016-01-01

Colorectal cancer (CRC) is the third leading cause of cancer-related mortality in the United States. Recent cancer genome-sequencing efforts and complementary functional studies have led to the identification of a collection of candidate 'driver' genes involved in CRC tumorigenesis. Tripartite motif (TRIM3) is recently identified as a tumour suppressor in glioblastoma but this tumour-suppressive function has not been investigated in CRC. In this study, we investigated the potential role of TRIM3 as a tumour suppressor in CRC development by manipulating the expression of TRIM3 in two authentic CRC cell lines, HCT116 and DLD1, followed by various functional assays, including cell proliferation, colony formation, scratch wound healing, soft agar, and invasion assays. Xenograft experiment was performed to examine in vivo tumour-suppressive properties of TRIM3. Small-interfering RNA (siRNA) mediated knockdown of TRIM3 conferred growth advantage in CRC cells. In contrast, overexpression of TRIM3 affected cell survival, cell migration, anchorage independent growth and invasive potential in CRC cells. In addition, TRIM3 was found to be down-regulated in human colon cancer tissues compared with matched normal colon tissues. Overexpression of TRIM3 significantly inhibited tumour growth in vivo using xenograft mouse models. Mechanistic investigation revealed that TRIM3 can regulate p53 protein level through its stabilisation. TRIM3 functions as a tumour suppressor in CRC progression. This tumour-suppressive function is exerted partially through regulation of p53 protein. Therefore, this protein may represent a novel therapeutic target for prevention or intervention of CRC.

Driver gene classification reveals a substantial overrepresentation of tumor suppressors among very large chromatin-regulating proteins.

PubMed

Waks, Zeev; Weissbrod, Omer; Carmeli, Boaz; Norel, Raquel; Utro, Filippo; Goldschmidt, Yaara

2016-12-23

Compiling a comprehensive list of cancer driver genes is imperative for oncology diagnostics and drug development. While driver genes are typically discovered by analysis of tumor genomes, infrequently mutated driver genes often evade detection due to limited sample sizes. Here, we address sample size limitations by integrating tumor genomics data with a wide spectrum of gene-specific properties to search for rare drivers, functionally classify them, and detect features characteristic of driver genes. We show that our approach, CAnceR geNe similarity-based Annotator and Finder (CARNAF), enables detection of potentially novel drivers that eluded over a dozen pan-cancer/multi-tumor type studies. In particular, feature analysis reveals a highly concentrated pool of known and putative tumor suppressors among the <1% of genes that encode very large, chromatin-regulating proteins. Thus, our study highlights the need for deeper characterization of very large, epigenetic regulators in the context of cancer causality.

Genes, dreams, and cancer.

PubMed Central

Sikora, K.

1994-01-01

There have been tremendous advances in our understanding of cancer from the application of molecular biology over the past decade. The disease is caused by a series of defects in the genes that accelerate growth--oncogenes--and those that slow down cellular turnover--tumour suppressor genes. The proteins they encode provide a promising hunting ground in which to design and test new anticancer drugs. Several treatment strategies are now under clinical trial entailing direct gene transfer. These include the use of gene marking to detect minimal residual disease, the production of novel cancer vaccines by the insertion of genes which uncloak cancer cells so making them visible to the host's immune system, the isolation and coupling of cancer specific molecular switches upstream of drug activating genes, and the correction of aberrant oncogenes or tumour suppressor genes. The issues in these approaches are likely to have a profound impact on the management of cancer patients as we enter the next century. Images p1221-a PMID:8180542

Epimutation and cancer: A new carcinogenic mechanism of Lynch syndrome

PubMed Central

BANNO, KOUJI; KISU, IORI; YANOKURA, MEGUMI; TSUJI, KOSUKE; MASUDA, KENTA; UEKI, ARISA; KOBAYASHI, YUSUKE; YAMAGAMI, WATARU; NOMURA, HIROYUKI; TOMINAGA, EIICHIRO; SUSUMU, NOBUYUKI; AOKI, DAISUKE

2012-01-01

Epimutation is defined as abnormal transcriptional repression of active genes and/or abnormal activation of usually repressed genes caused by errors in epigenetic gene repression. Epimutation arises in somatic cells and the germline, and constitutional epimutation may also occur. Epimutation is the first step of tumorigenesis and can be a direct cause of carcinogenesis. Cancers associated with epimutation include Lynch syndrome (hereditary non-polyposis colorectal cancer, HNPCC), chronic lymphocytic leukemia, breast cancer and ovarian cancer. Epimutation has been shown for many tumor suppressor genes, including RB, VHL, hMLH1, APC and BRCA1, in sporadic cancers. Methylation has recently been shown in DNA from normal tissues and peripheral blood in cases of sporadic colorectal cancer and many studies show constitutive epimutation in cancers. Epimutation of DNA mismatch repair (MMR) genes (BRCA1, hMLH1 and hMSH2) involved in development familial cancers has also been found. These results have led to a focus on epimutation as a novel oncogenic mechanism. PMID:22735547

MicroRNAs as New Characters in the Plot between Epigenetics and Prostate Cancer.

PubMed

Paone, Alessio; Galli, Roberta; Fabbri, Muller

2011-01-01

Prostate cancer (PCA) still represents a leading cause of death. An increasing number of studies have documented that microRNAs (miRNAs), a subgroup of non-coding RNAs with gene regulatory functions, are differentially expressed in PCA respect to the normal tissue counterpart, suggesting their involvement in prostate carcinogenesis and dissemination. Interestingly, it has been shown that miRNAs undergo the same regulatory mechanisms than any other protein coding gene, including epigenetic regulation. In turn, miRNAs can also affect the expression of oncogenes and tumor suppressor genes by targeting effectors of the epigenetic machinery, therefore indirectly affecting the epigenetic controls on these genes. Among the genes that undergo this complex regulation, there is the androgen receptor (AR), a key therapeutic target for PCA. This review will focus on the role of epigenetically regulated and epigenetically regulating miRNAs in PCA and on the fine regulation of AR expression, as mediated by this miRNA-epigenetics interaction.

Immunohistochemical detection of tumor suppressor gene p53 protein in feline injection site-associated sarcomas.

PubMed

Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M

2001-03-01

Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.

Cystatin E/M Suppresses Tumor Cell Growth through Cytoplasmic Retention of NF-κB

PubMed Central

Soh, Hendrick; Venkatesan, Natarajan; Veena, Mysore S.; Ravichandran, Sandhiya; Zinabadi, Alborz; Basak, Saroj K.; Parvatiyar, Kislay; Srivastava, Meera; Liang, Li-Jung; Gjertson, David W.; Torres, Jorge Z.; Moatamed, Neda A.

2016-01-01

We and others have shown that the cystatin E/M gene is inactivated in primary human tumors, pointing to its role as a tumor suppressor gene. However, the molecular mechanism of tumor suppression is not yet understood. Using plasmid-directed cystatin E/M gene overexpression, a lentivirus-mediated tetracycline-inducible vector system, and human papillomavirus 16 (HPV 16) E6 and E7 gene-immortalized normal human epidermal keratinocytes, we demonstrated intracellular and non-cell-autonomous apoptotic growth inhibition of tumor cell lines and that growth inhibition is associated with cytoplasmic retention of NF-κB. We further demonstrated decreased phosphorylation of IκB kinase (IKKβ) and IκBα in the presence of tumor necrosis factor alpha (TNF-α), confirming the role of cystatin E/M in the regulation of the NF-κB signaling pathway. Growth suppression of nude mouse xenograft tumors carrying a tetracycline-inducible vector system was observed with the addition of doxycycline in drinking water, confirming that the cystatin E/M gene is a tumor suppressor gene. Finally, immunohistochemical analyses of cervical carcinoma in situ and primary tumors have shown a statistically significant inverse relationship between the expression of cystatin E/M and cathepsin L and a direct relationship between the loss of cystatin E/M expression and nuclear expression of NF-κB. We therefore propose that the cystatin E/M suppressor gene plays an important role in the regulation of NF-κB. PMID:27090639

A chemotactic signaling surface on CheY defined by suppressors of flagellar switch mutations.

PubMed Central

Roman, S J; Meyers, M; Volz, K; Matsumura, P

1992-01-01

CheY is the response regulator protein that interacts with the flagellar switch apparatus to modulate flagellar rotation during chemotactic signaling. CheY can be phosphorylated and dephosphorylated in vitro, and evidence indicates that CheY-P is the activated form that induces clockwise flagellar rotation, resulting in a tumble in the cell's swimming pattern. The flagellar switch apparatus is a complex macromolecular structure composed of at least three gene products, FliG, FliM, and FliN. Genetic analysis of Escherichia coli has identified fliG and fliM as genes in which mutations occur that allele specifically suppress cheY mutations, indicating interactions among these gene products. We have generated a class of cheY mutations selected for dominant suppression of fliG mutations. Interestingly, these cheY mutations dominantly suppressed both fliG and fliM mutations; this is consistent with the idea that the CheY protein interacts with both switch gene products during signaling. Biochemical characterization of wild-type and suppressor CheY proteins did not reveal altered phosphorylation properties or evidence for phosphorylation-dependent CheY multimerization. These data indicate that suppressor CheY proteins are specifically altered in the ability to transduce chemotactic signals to the switch at some point subsequent to phosphorylation. Physical mapping of suppressor amino acid substitutions on the crystal structure of CheY revealed a high degree of spatial clustering, suggesting that this region of CheY is a signaling surface that transduces chemotactic signals to the switch. Images PMID:1400175

Functional analysis of a weak viral RNA silencing suppressor using two GFP variants as silencing inducers.

PubMed

Mann, Krin S; Dietzgen, Ralf G

2017-01-01

RNA silencing in plants can be triggered by the introduction of an exogenous gene. Green fluorescent protein (GFP) has been widely used as a visual reporter to study RNA silencing and viral-mediated suppression of RNA silencing in the model plant Nicotiana benthamiana. In transgenic N. benthamiana plants expressing an endoplasmic reticulum targeted GFP variant (16c) known as mGFP5, RNA silencing can be induced by ectopic over-expression of mGFP5. However, other GFP variants can also be used to induce GFP silencing in these plants. We compared the efficiency to induce local and systemic silencing of two commonly used GFP variants: enhanced GFP (eGFP) and mGFP5. Using lettuce necrotic yellows virus (LNYV) P protein to suppress GFP silencing, we demonstrate that eGFP gene, which is 76% identical at the nucleotide level to the endogenously expressed mGFP5 in 16c plants, triggers silencing more slowly and concurrently prolongs detectable silencing suppressor activity of the weak LNYV P suppressor, compared to the homologous mGFP5 gene. The use of eGFP as RNA silencing inducer in wild type or 16c plants appears to be a useful tool in identifying and analysing weak viral RNA silencing suppressor proteins whose activity might otherwise have been masked when challenged by a stronger RNA silencing response. We also show that reducing the dosage of strong dsRNA silencing inducers in conjunction with their homologous GFP targets facilitates the discovery and analysis of "weaker" RNA silencing suppressor activities. Copyright © 2016 Elsevier B.V. All rights reserved.

MicroRNA-31 inhibits RhoA-mediated tumor invasion and chemotherapy resistance in MKN-45 gastric adenocarcinoma cells.

PubMed

Korourian, Alireza; Roudi, Raheleh; Shariftabrizi, Ahmad; Madjd, Zahra

2017-12-01

microRNAs are small single-stranded non-coding RNA molecules which modify gene expression by silencing potential target genes. The aberrant expression of RhoA, a small GTPase protein of Rho family, is involved in gastric cancer tumorigenesis. Since miR-31 is a pleomorphic molecule, we evaluated the miR-31/RhoA axis in inducing the malignant phenotype of gastric cancer cells MKN-45. Also, the clinicopathological significance of RhoA was investigated in a well-defined collection of gastric carcinomas which were embedded in tissue microarray blocks. Induction of miR-31 in MKN-45 followed by suppression of RhoA expression resulted in increased sensitivity to 5-fluorouracil, inhibition of cell proliferation, and invasion compared to the control groups. Immunohistochemical analysis in gastric adenocarcinoma patients' samples showed significantly higher expression of RhoA in diffuse versus intestinal subtype tumors ( P = 0.009), poorly differentiated versus well and moderately differentiated tumors ( P = 0.03) and the presence of vascular invasion versus the absence of vascular invasion ( P = 0.04). Our findings suggest a critical role for miR-31, as a tumor suppressor gene, in gastric cancer tumorigenesis by targeting the RhoA. Impact statement Gastric cancer ranks as the third leading cause of cancer-associated deaths worldwide. The RhoA gene encodes a small GTPase protein of Rho family (RhoA) that its dysregulation is associated with cell motility and invasion. A strong line of evidence supports the regulation of RhoA by a number of miRs, including miR-31 in tumors. Our findings revealed that miR-31 is involved in gastric cancer tumorigenesis as a tumor suppressor gene. Through down-regulation of RhoA, miR-31 decreased cell proliferation, migration, and invasion in gastric cancer cells. In addition, induction of miR-31 increased sensitivity to 5-FU; thus, increasing its tissue concentrations could be a potential target for treatment of gastric cancer in the future.

MicroRNA-31 inhibits RhoA-mediated tumor invasion and chemotherapy resistance in MKN-45 gastric adenocarcinoma cells

PubMed Central

Korourian, Alireza; Roudi, Raheleh; Shariftabrizi, Ahmad

2017-01-01

microRNAs are small single-stranded non-coding RNA molecules which modify gene expression by silencing potential target genes. The aberrant expression of RhoA, a small GTPase protein of Rho family, is involved in gastric cancer tumorigenesis. Since miR-31 is a pleomorphic molecule, we evaluated the miR-31/RhoA axis in inducing the malignant phenotype of gastric cancer cells MKN-45. Also, the clinicopathological significance of RhoA was investigated in a well-defined collection of gastric carcinomas which were embedded in tissue microarray blocks. Induction of miR-31 in MKN-45 followed by suppression of RhoA expression resulted in increased sensitivity to 5-fluorouracil, inhibition of cell proliferation, and invasion compared to the control groups. Immunohistochemical analysis in gastric adenocarcinoma patients’ samples showed significantly higher expression of RhoA in diffuse versus intestinal subtype tumors (P = 0.009), poorly differentiated versus well and moderately differentiated tumors (P = 0.03) and the presence of vascular invasion versus the absence of vascular invasion (P = 0.04). Our findings suggest a critical role for miR-31, as a tumor suppressor gene, in gastric cancer tumorigenesis by targeting the RhoA. Impact statement Gastric cancer ranks as the third leading cause of cancer-associated deaths worldwide. The RhoA gene encodes a small GTPase protein of Rho family (RhoA) that its dysregulation is associated with cell motility and invasion. A strong line of evidence supports the regulation of RhoA by a number of miRs, including miR-31 in tumors. Our findings revealed that miR-31 is involved in gastric cancer tumorigenesis as a tumor suppressor gene. Through down-regulation of RhoA, miR-31 decreased cell proliferation, migration, and invasion in gastric cancer cells. In addition, induction of miR-31 increased sensitivity to 5-FU; thus, increasing its tissue concentrations could be a potential target for treatment of gastric cancer in the future. PMID:28836853

Direct role for the RNA polymerase domain of T7 primase in primer delivery

PubMed Central

Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

2010-01-01

Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755

Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

PubMed

Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

2017-01-01

The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Super-Enhancers and Broad H3K4me3 Domains Form Complex Gene Regulatory Circuits Involving Chromatin Interactions.

PubMed

Cao, Fan; Fang, Yiwen; Tan, Hong Kee; Goh, Yufen; Choy, Jocelyn Yeen Hui; Koh, Bryan Thean Howe; Hao Tan, Jiong; Bertin, Nicolas; Ramadass, Aroul; Hunter, Ewan; Green, Jayne; Salter, Matthew; Akoulitchev, Alexandre; Wang, Wilson; Chng, Wee Joo; Tenen, Daniel G; Fullwood, Melissa J

2017-05-19

Stretched histone regions, such as super-enhancers and broad H3K4me3 domains, are associated with maintenance of cell identity and cancer. We connected super-enhancers and broad H3K4me3 domains in the K562 chronic myelogenous leukemia cell line as well as the MCF-7 breast cancer cell line with chromatin interactions. Super-enhancers and broad H3K4me3 domains showed higher association with chromatin interactions than their typical counterparts. Interestingly, we identified a subset of super-enhancers that overlap with broad H3K4me3 domains and show high association with cancer-associated genes including tumor suppressor genes. Besides cell lines, we could observe chromatin interactions by a Chromosome Conformation Capture (3C)-based method, in primary human samples. Several chromatin interactions involving super-enhancers and broad H3K4me3 domains are constitutive and can be found in both cancer and normal samples. Taken together, these results reveal a new layer of complexity in gene regulation by super-enhancers and broad H3K4me3 domains.

Role of the retinoblastoma protein in cell cycle arrest mediated by a novel cell surface proliferation inhibitor

NASA Technical Reports Server (NTRS)

Enebo, D. J.; Fattaey, H. K.; Moos, P. J.; Johnson, T. C.; Spooner, B. S. (Principal Investigator)

1994-01-01

A novel cell regulatory sialoglycopeptide (CeReS-18), purified from the cell surface of bovine cerebral cortex cells has been shown to be a potent and reversible inhibitor of proliferation of a wide array of fibroblasts as well as epithelial-like cells and nontransformed and transformed cells. To investigate the possible mechanisms by which CeReS-18 exerts its inhibitory action, the effect of the inhibitor on the posttranslational regulation of the retinoblastoma susceptibility gene product (RB), a tumor suppressor gene, has been examined. It is shown that CeReS-18 mediated cell cycle arrest of both human diploid fibroblasts (HSBP) and mouse fibroblasts (Swiss 3T3) results in the maintenance of the RB protein in the hypophosphorylated state, consistent with a late G1 arrest site. Although their normal nontransformed counterparts are sensitive to cell cycle arrest mediated by CeReS-18, cell lines lacking a functional RB protein, through either genetic mutation or DNA tumor virus oncoprotein interaction, are less sensitive. The refractory nature of these cells is shown to be independent of specific surface receptors for the inhibitor, and another tumor suppressor gene (p53) does not appear to be involved in the CeReS-18 inhibition of cell proliferation. The requirement for a functional RB protein product, in order for CeReS-18 to mediate cell cycle arrest, is discussed in light of regulatory events associated with density-dependent growth inhibition.

Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke

1997-05-01

Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less

Two suppressors of RNA silencing encoded by cereal-infecting members of the family Luteoviridae.

PubMed

Liu, Yan; Zhai, Hao; Zhao, Kun; Wu, Beilei; Wang, Xifeng

2012-08-01

Several members of the family Luteoviridae are important pathogens of cultivated plant species of the family Gramineae. In this study, we explored RNA-silencing suppressors (RSSs) encoded by two cereal-infecting luteoviruses: barley yellow dwarf virus and wheat yellow dwarf virus (BYDV and WYDV, respectively). The P0 protein of WYDV-GPV (P0(GPV)) and the P6 protein of BYDV-GAV (P6(GAV)) displayed RSS activities when expressed in agro-infiltrated leaves of Nicotiana benthamiana, by their local ability to inhibit post-transcriptional gene silencing of GFP. Analysis of GFP, mRNA and GFP-specific small interfering RNA indicated that both P0(GPV) and P6(GAV) are suppressors of silencing that can restrain not only local but also systemic gene silencing. This is the first report of RSS activity of the P6 protein in a member of the genus Luteovirus.

Oncogene activation and tumor suppressor gene inactivation find their sites of expression in the changes in time and space of the age-adjusted cancer incidence rate.

PubMed

Kodama, M; Kodama, T; Murakami, M

2000-01-01

The purpose of the present investigation is to elucidate the relation between the distribution pattern of the age-adjusted incidence rate (AAIR) changes in time and space of 15 tumors of bothe sexes and the locations of centers of centripetal-(oncogene type) and centrifugal-(tumoe suppressor gene type) forces. The fitness of the observed log AAIR data sets to the oncogene type- and the tumor suppressor gene type-equilibrium models and the locations of 2 force centers were calculated by applying the least square method of Gauss to log AAIR pair data series with and without topological data manipulations, which are so designed as to let log AAIR pair data series fit to 2 variant (x, y) frameworks, the Rect-coordinates and the Para-coordinates. The 2 variant (x, y) coordinates are defined each as an (x, y) framework with its X axis crossed at a right angle to the regression line of the original log AAIR data (the Rect-coordinates) and as another framework with its X axis run in parallel with the regression line of the original log AAIR pair data series (the Para-coordinates). The fitness test of log AAIR data series to either the oncogene activation type equilibrium model (r = -1.000) or the tumor suppressor gene inactivation type (r = 1.000) was conducted for each of the male-female type pair data and the female-male type data, for each of log AAIR changes in space and log AAIR changes in time, and for each of the 3 (x, y) frameworks in a given neoplasia of both sexes. The results obtained are given as follows: 1) The positivity rates of the fitness test to the oncogene type equilibrium model and the tumor suppressor gene type model were each 63.3% and 56.7% with the log AAIR changes in space, and 73.3% and 73.3% with log AAIR changes in time, as tested in 15 human neoplasias of both sexes. 2) Evidence was presented to indicate that the clearance of oncogene activation and tumor suppressor gene inactivation is the sine qua non premise of carciniogenesis. 3) The r profile in which the correlation coefficient r, a measure of fitness to the 2 equilibrium models, is converted to either +(r > 0) or -(0 > r) for each of the original-, the Rect-, and the Para-coordinates was found to be informative in identifying a group of tumors with sex discrimination of cancer risk (log AAIR changes in space) or another group of environmental hormone-linked tumors (log AAIR changes in time and space)--a finding to indicate that the r-profile of a given tumor, when compared with other neoplasias, may provide a clue to investigating the biological behavior of the tumor. 4) The recent risk increase of skin cancer of both sexes, being classified as an example of environmental hormone-linked neoplasias, was found to commit its ascension of cancer risk along the direction of the centrifugal forces of the time- and space-linked tumor suppressor gene inactivation plotted in the 2-dimension diagram. In conclusion, the centripetal force of oncogene activation and centrifugal force of tumor suppressor gene inactivation found their sites of expression in the distribution pattern of a cancer risk parameter, log AAIR, of a given neoplasias of both sexes on the 2-dimension diagram. The application of the least square method of Gauss to the log AAIR changes in time and space, and also with and without topological modulations of the original sets, when presented in terms of the r-profile, was found to be informative in understanding behavioral characteristics of human neoplaisias.

Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors*S⃞

PubMed Central

Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

2008-01-01

FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

CRISPR-mediated direct mutation of cancer genes in the mouse liver

PubMed Central

Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S.; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G.; Zhang, Feng; Anderson, Daniel G.; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem (ES) cells1. Here we describe a new method of cancer model generation using the CRISPR/Cas system in vivo in wild-type mice. We have used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs)2–4 to the liver and directly target the tumor suppressor genes Pten5 and p536, alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology7, 8. Simultaneous targeting of Pten and p53 induced liver tumors that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumor tissue revealed insertion or deletion (indel) mutations of the tumor suppressor genes, including bi-allelic mutations of both Pten and p53 in tumors. Furthermore, co-injection of Cas9 plasmids harboring sgRNAs targeting the β-Catenin gene (Ctnnb1) and a single-stranded DNA (ssDNA) oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-Catenin. This study demonstrates the feasibility of direct mutation of tumor suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics. PMID:25119044

CRISPR-mediated direct mutation of cancer genes in the mouse liver.

PubMed

Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G; Zhang, Feng; Anderson, Daniel G; Sharp, Phillip A; Jacks, Tyler

2014-10-16

The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem cells. Here we describe a new method of cancer model generation using the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system in vivo in wild-type mice. We used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs) to the liver that directly target the tumour suppressor genes Pten (ref. 5) and p53 (also known as TP53 and Trp53) (ref. 6), alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology. Simultaneous targeting of Pten and p53 induced liver tumours that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumour tissue revealed insertion or deletion mutations of the tumour suppressor genes, including bi-allelic mutations of both Pten and p53 in tumours. Furthermore, co-injection of Cas9 plasmids harbouring sgRNAs targeting the β-catenin gene and a single-stranded DNA oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-catenin. This study demonstrates the feasibility of direct mutation of tumour suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics.

CDKN2B expression and subcutaneous adipose tissue expandability: Possible influence of the 9p21 atherosclerosis locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Svensson, Per-Arne; Wahlstrand, Björn; Olsson, Maja

2014-04-18

Highlights: • The tumor suppressor gene CDKN2B is highly expressed in human adipose tissue. • Risk alleles at the 9p21 locus modify CDKN2B expression in a BMI-dependent fashion. • There is an inverse relationship between expression of CDKN2B and adipogenic genes. • CDKN2B expression influences to postprandial triacylglycerol clearance. • CDKN2B expression in adipose tissue is linked to markers of hepatic steatosis. - Abstract: Risk alleles within a gene desert at the 9p21 locus constitute the most prevalent genetic determinant of cardiovascular disease. Previous research has demonstrated that 9p21 risk variants influence gene expression in vascular tissues, yet the biologicalmore » mechanisms by which this would mediate atherosclerosis merits further investigation. To investigate possible influences of this locus on other tissues, we explored expression patterns of 9p21-regulated genes in a panel of multiple human tissues and found that the tumor suppressor CDKN2B was highly expressed in subcutaneous adipose tissue (SAT). CDKN2B expression was regulated by obesity status, and this effect was stronger in carriers of 9p21 risk alleles. Covariation between expression of CDKN2B and genes implemented in adipogenesis was consistent with an inhibitory effect of CDKN2B on SAT proliferation. Moreover, studies of postprandial triacylglycerol clearance indicated that CDKN2B is involved in down-regulation of SAT fatty acid trafficking. CDKN2B expression in SAT correlated with indicators of ectopic fat accumulation, including markers of hepatic steatosis. Among genes regulated by 9p21 risk variants, CDKN2B appears to play a significant role in the regulation of SAT expandability, which is a strong determinant of lipotoxicity and therefore might contribute to the development of atherosclerosis.« less

Alterations of the PPP2R1B gene located at 11q23 in human colorectal cancers

PubMed Central

Takagi, Y; Futamura, M; Yamaguchi, K; Aoki, S; Takahashi, T; Saji, S

2000-01-01

BACKGROUND/AIMS—In 1998 the PPP2R1B gene encoding the A subunit of the serine/threonine protein phosphatase was identified as a putative tumour suppressor gene in lung and colon cancer in the chromosome region 11q22-24. The aim of the present study was to determine the type of alterations in primary rectal cancers as well as colon cancers and the correlation between these alterations and clinicopathological data.
METHODS—Mutation analyses of the PPP2R1B gene sequence encoding the binding sites of the catalytic C subunit (Huntington elongation A subunit TOR (HEAT) repeats 11-15) and partial binding sites of the regulatory B subunit were carried out on cDNA samples from 30 primary colorectal cancer specimens and corresponding normal tissues using a combination of the polymerase chain reaction and subsequent direct DNA sequencing.
RESULTS—Five missense mutations producing amino acid substitutions were detected in the four colon cancer cases (13.3%; four of 30 colorectal cancers): 15glycine (GGT) to alanine (GCT) and 499leucine (TTA) to isoleucine (ATA) in the same case, and 498valine (GTG) to glutamic acid (GAG), 500valine (GTA) to glycine (GGA), and 365serine (TCT) to proline (CCT). Of these five mutations, three (60%) were located in HEAT repeat 13 and four (80%) showed T to other nucleotide substitutions. In addition, a normal polymorphism, 478leucine, was found. No correlation was found between these mutations and clinicopathological data.
CONCLUSION—Our results suggest that the PPP2R1B gene is one of the true targets at 11q23, and its inactivation is involved in the development of all types of colorectal cancers.


Keywords: PPP2R1B gene; colorectal cancer; tumour suppressor gene; protein phosphatase PMID:10896920

Roles of plant hormones and anti-apoptosis genes during drought stress in rice (Oryza sativa L.).

PubMed

Ubaidillah, Mohammad; Safitri, Fika Ayu; Jo, Jun-Hyeon; Lee, Sang-Kyu; Hussain, Adil; Mun, Bong-Gyu; Chung, Il Kyung; Yun, Byung-Wook; Kim, Kyung-Min

2016-12-01

We previously identified the rice (Oryza sativa) senescence-associated gene OsSAP which encodes a highly conserved protein involved in anti-apoptotic activity. This novel Bax suppressor-related gene regulates tolerance to multiple stresses in yeast. Here, we show the effects of drought stress on leaf and root tissues of plants over-expressing OsSAP in relation to the levels of phytohormones, abscisic acid (ABA), jasmonic acid (JA), indole-3-carboxylic acid (ICA), gibberellic acid (GA 3 ), and zeatin. Results showed that rice plants over-expressing SAP were tolerant to drought stress compared to wild type and the plants over-expressing AtBI-1, which is a homolog of the human Bax inhibitor-1 in Arabidopsis. ABA and JA levels in OsSAP and AtBI-1 transgenic plants consistently increased up to at least 3 days after drought treatment, whereas lower GA 3 levels were recorded during early drought period. Comparison between control and transgenic plants overexpressing anti-apoptosis genes OsSAP and AtBI-1 resulted in different patterns of hormone levels, indicating that these genes are involved in the plant responses to drought stress and present an opportunity for further study on drought stress tolerance in rice and other plant species.

Thermo-labile stability of sigmaH (Spo0H) in temperature-sensitive spo0H mutants of Bacillus subtilis can be suppressed by mutations in RNA polymerase beta subunit.

PubMed

Ohashi, Y; Sugimaru, K; Nanamiya, H; Sebata, T; Asai, K; Yoshikawa, H; Kawamura, F

1999-03-18

We isolated novel temperature-sensitive mutants of spo0H, spo0H1 and spo0H5, having E61K and G30E amino-acid substitutions within the sigmaH protein, respectively, and located in the highly conserved region, "2", among prokaryotic sigma factors that participates in binding to core enzyme of RNA polymerase. These mutants showed a sporulation-deficient phenotype at 43 degrees C. Moreover, we successfully isolated suppressor mutants that were spontaneously generated from the spo0H mutants. Our genetic analysis of these suppressor mutations revealed that the suppressor mutations are within the rpoB gene coding for the beta subunit of RNA polymerase. The mutations caused single amino-acid substitutions, E857A and P1055S, in rpoB18 and rpoB532 mutants that were generated from spo0H1 and spo0H5, respectively. Whereas the sigmaH-dependent expression of a spo0A-bgaB fusion was greatly reduced in both spo0H mutants, their expression was partially restored in the suppressor mutants at 43 degrees C. Western blot analysis showed that the level of sigmaH protein in the wild type increased between T0 and T2 and decreased after T3, while the level of sigmaH protein in spo0H mutants was greatly reduced throughout growth, indicating that the mutant sigmaH proteins were rapidly degraded by some unknown proteolytic enzyme(s). The analysis of the half-life of sigmaH protein showed that the short life of sigmaH in spo0H mutants is prolonged in the suppressor mutants. These findings suggest that, at least to some extent, the process of E-sigmaH formation may be involved in stabilization of sigmaH at the onset of sporulation.

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

PubMed

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

A DERL3-associated defect in the degradation of SLC2A1 mediates the Warburg effect

PubMed Central

Lopez-Serra, Paula; Marcilla, Miguel; Villanueva, Alberto; Ramos-Fernandez, Antonio; Palau, Anna; Leal, Lucía; Wahi, Jessica E.; Setien-Baranda, Fernando; Szczesna, Karolina; Moutinho, Catia; Martinez-Cardus, Anna; Heyn, Holger; Sandoval, Juan; Puertas, Sara; Vidal, August; Sanjuan, Xavier; Martinez-Balibrea, Eva; Viñals, Francesc; Perales, Jose C.; Bramsem, Jesper B.; Ørntoft, Torben F.; Andersen, Claus L.; Tabernero, Josep; McDermott, Ultan; Boxer, Matthew B.; Heiden, Matthew G. Vander; Albar, Juan Pablo; Esteller, Manel

2014-01-01

Cancer cells possess aberrant proteomes that can arise by the disruption of genes involved in physiological protein degradation. Here we demonstrate the presence of promoter CpG island hypermethylation-linked inactivation of DERL3 (Derlin-3), a key gene in the endoplasmic reticulum-associated protein degradation pathway, in human tumours. The restoration of in vitro and in vivo DERL3 activity highlights the tumour suppressor features of the gene. Using the stable isotopic labelling of amino acids in cell culture workflow for differential proteome analysis, we identify SLC2A1 (glucose transporter 1, GLUT1) as a downstream target of DERL3. Most importantly, SLC2A1 overexpression mediated by DERL3 epigenetic loss contributes to the Warburg effect in the studied cells and pinpoints a subset of human tumours with greater vulnerability to drugs targeting glycolysis. PMID:24699711

Role of microRNA-7 in digestive system malignancy.

PubMed

Chen, Wan-Qun; Hu, Ling; Chen, Geng-Xin; Deng, Hai-Xia

2016-01-15

There are several malignancies of the digestive system (including gastric, pancreatic and colorectal cancers, and hepatocellular carcinoma), which are the most common types of cancer and a major cause of death worldwide. MicroRNA (miR)-7 is abundant in the pancreas, playing an important role in pancreatic development and endocrine function. Expression of miR-7 is downregulated in digestive system malignancies compared with normal tissue. Although there are contrasting results for miR-7 expression, almost all research reveals that miR-7 is a tumor suppressor, by targeting various genes in specific pathways. Moreover, miR-7 can target different genes simultaneously in different malignancies of the digestive system. By acting on many cytokines, miR-7 is also involved in many gastrointestinal inflammatory diseases as a significant carcinogenic factor. Consequently, miR-7 might be a biomarker or therapeutic target gene in digestive system malignancies.

A theoretical approach to sound propagation and radiation for ducts with suppressors

NASA Technical Reports Server (NTRS)

Rice, E. J.; Sawdy, D. T.

1981-01-01

The several phenomena involved in theoretical prediction of the far-field sound radiation attenuation from an acoustically lined duct were studied. These include absorption by the suppressor, termination reflections, and far-field radiation. Extensive parametric studies show that the suppressor absorption performance can be correlated with mode cut-off ratio or angle of propagation. The other phenomena can be shown to depend explicitly upon mode cut-off ratio. A complete system can thus be generated which can be used to evaluate aircraft sound suppressors and which can be related to the sound source through the cut-off ratio-acoustic power distribution. Although the method is most fully developed for inlet suppressors, several aft radiated noise phenomena are also discussed. This simplified suppressor design and evaluation method is summarized, the recent improvements in the technique are presented, and areas where further refinement is necessary are discussed. Noise suppressor data from engine experiments are compared with the theoretical calculations.

UBE2QL1 is Disrupted by a Constitutional Translocation Associated with Renal Tumor Predisposition and is a Novel Candidate Renal Tumor Suppressor Gene

PubMed Central

Wake, Naomi C; Ricketts, Christopher J; Morris, Mark R; Prigmore, Elena; Gribble, Susan M; Skytte, Anne-Bine; Brown, Michael; Clarke, Noel; Banks, Rosamonde E; Hodgson, Shirley; Turnell, Andrew S; Maher, Eamonn R; Woodward, Emma R

2013-01-01

Investigation of rare familial forms of renal cell carcinoma (RCC) has led to the identification of genes such as VHL and MET that are also implicated in the pathogenesis of sporadic RCC. In order to identify a novel candidate renal tumor suppressor gene, we characterized the breakpoints of a constitutional balanced translocation, t(5;19)(p15.3;q12), associated with familial RCC and found that a previously uncharacterized gene UBE2QL1 was disrupted by the chromosome 5 breakpoint. UBE2QL1 mRNA expression was downregulated in 78.6% of sporadic RCC and, although no intragenic mutations were detected, gene deletions and promoter region hypermethylation were detected in 17.3% and 20.3%, respectively, of sporadic RCC. Reexpression of UBE2QL1 in a deficient RCC cell line suppressed anchorage-independent growth. UBE2QL1 shows homology to the E2 class of ubiquitin conjugating enzymes and we found that (1) UBE2QL1 possesses an active-site cysteine (C88) that is monoubiquitinated in vivo, and (2) UBE2QL1 interacts with FBXW7 (an F box protein providing substrate recognition to the SCF E3 ubiquitin ligase) and facilitates the degradation of the known FBXW7 targets, CCNE1 and mTOR. These findings suggest UBE2QL1 as a novel candidate renal tumor suppressor gene. PMID:24000165

HPV16 integration probably contributes to cervical oncogenesis through interrupting tumor suppressor genes and inducing chromosome instability.

PubMed

Zhao, Jun-Wei; Fang, Fang; Guo, Yi; Zhu, Tai-Lin; Yu, Yun-Yun; Kong, Fan-Fei; Han, Ling-Fei; Chen, Dong-Sheng; Li, Fang

2016-11-25

The integration of human papilloma virus (HPV) into host genome is one of the critical steps that lead to the progression of precancerous lesion into cancer. However, the mechanisms and consequences of such integration events are poorly understood. This study aims to explore those questions by studying high risk HPV16 integration in women with cervical intraepithelial neoplasia (CIN) and cervical squamous cell carcinoma (SCC). Specifically, HPV integration status of 13 HPV16-infected patients were investigated by ligation-mediated PCR (DIPS-PCR) followed by DNA sequencing. In total, 8 HPV16 integration sites were identified inside or around genes associated with cancer development. In particular, the well-studied tumor suppressor genes SCAI was found to be integrated by HPV16, which would likely disrupt its expression and therefore facilitate the migration of tumor. On top of that, we observed several cases of chromosome translocation events coincide with HPV integration, which suggests the existence of chromosome instability. Additionally, short overlapping sequences were observed between viral derived and host derived fragments in viral-cellular junctions, indicating that integration was mediated by micro homology-mediated DNA repair pathway. Overall, our study suggests a model in which HPV16 might contribute to oncogenesis not only by disrupting tumor suppressor genes, but also by inducing chromosome instability.

The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening[OPEN

PubMed Central

Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui

2017-01-01

The plant hormone ethylene is critical for ripening in climacteric fruits, including apple (Malus domestica). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1, an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2, encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3, encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1. This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1. Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. PMID:28550149

The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening.

PubMed

Li, Tong; Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui; Wang, Aide

2017-06-01

The plant hormone ethylene is critical for ripening in climacteric fruits, including apple ( Malus domestica ). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1 , an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2 , encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3 , encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1 This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1 Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. © 2017 American Society of Plant Biologists. All rights reserved.

Loss of heterozygosity at 7q22 and mutation analysis of the CDP gene in human epithelial ovarian tumors.

PubMed

Neville, P J; Thomas, N; Campbell, I G

2001-02-01

Many tumor types including that of the ovary show loss of heterozygosity (LOH) on chromosome arm 7q, which suggests the existence of at least one tumor suppressor gene (TSG) on this chromosome arm. We have studied the region surrounding the putative tumor suppressor gene CUTL1 at 7q22 in 127 epithelial ovarian tumors. LOH was found across 7q22 in 31% of malignant and 14% of benign ovarian tumors. In 16% of the tumors the LOH appeared to be centered on the CUTL1 gene. This gene has been implicated previously as a TSG in both uterine leiomyomas and breast carcinoma. However, mutation analysis of the CUTL1 gene in 47 tumors with 7q22 LOH failed to identify any somatic alterations in the coding regions. This finding suggests that CUTL1 may not be the target of the 7q22 LOH in ovarian cancers.

Prognostic value of the expression of tumor suppressor genes p53, p21, p16 and prb, and Ki-67 labelling in high grade astrocytomas treated with radiotherapy.

PubMed

Kirla, R; Salminen, E; Huhtala, S; Nuutinen, J; Talve, L; Haapasalo, H; Kalimo, H

2000-01-01

Cumulative inactivation of tumor suppressor genes and/or amplification of oncogenes lead to progressively more malignant astrocytic tumors. We have analyzed the significance of tumor suppressor genes p53, p21, p16 and retinoblastoma protein (pRb) and proliferative activity for survival in 77 high grade astrocytic tumors. After operation, the patients--25 anaplastic astrocytomas (AA) and 52 glioblastomas (GBs)--were treated with similar radiotherapy. The expression of the suppressor genes and the proliferative activity were analyzed immunohistochemically. p53 immunopositivity was found in 44% of AAs and 46% of GBs. Tumors with aberrant p53 expression had lower proliferation indices than p53 immunonegative tumors. Neither p53 expression nor p21 immunonegativity (52% of AAs and 48% of GBs) correlated with survival. p16 immunostaining was negative in 16% of AAs and in 44% of GBs, and it correlated inversely with survival in both uni- and multivariate analyses. pRb immunostaining was negative only in 8% of both AAs and GBs and the absence of p16 and pRb were mutually exclusive. Ki-67 labelling index (LI) was significantly higher in GBs (26.8%) than in AAs (20.3%), and in multivariate analysis it was an independent prognostic factor for survival. In 48% of AAs Ki-67 LI exceeded 20% and this subset of AAs had similar prognosis as GB. In high grade astrocytic tumors p16 immunonegativity was an independent indicator of poor prognosis in addition to the previously established patient's age, histopathology and Ki-67 LI. Furthermore, there was a subset of AAs with a high proliferation rate (> 20%) in which the histopathological hallmarks of GB were lacking, but which had similarly dismal prognosis as GB.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed Central

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

ROOT HAIR DEFECTIVE SIX-LIKE4 (RSL4) promotes root hair elongation by transcriptionally regulating the expression of genes required for cell growth.

PubMed

Vijayakumar, Priya; Datta, Sourav; Dolan, Liam

2016-12-01

ROOT HAIR DEFECTIVE SIX-LIKE4 (RSL4) is necessary and sufficient for root hair elongation in Arabidopsis thaliana. Root hair length is determined by the duration for which RSL4 protein is present in the developing root hair. The aim of this research was to identify genes regulated by RSL4 that affect root hair growth. To identify genes regulated by RSL4, we identified genes whose expression was elevated by induction of RSL4 activity in the presence of an inhibitor of translation. Thirty-four genes were identified as putative targets of RSL transcriptional regulation, and the results suggest that the activities of SUPPRESSOR OF ACTIN (SAC1), EXOCSYT SUBUNIT 70A1 (EXO70A1), PEROXIDASE7 (PRX7) and CALCIUM-DEPENDENT PROTEIN KINASE11 (CPK11) are required for root hair elongation. These data indicate that RSL4 controls cell growth by controlling the expression of genes encoding proteins involved in cell signalling, cell wall modification and secretion. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Physical and functional mapping of a tumor suppressor locus for renal cell carcinoma within chromosome 3p12.

PubMed

Lott, S T; Lovell, M; Naylor, S L; Killary, A M

1998-08-15

Using a functional genetic approach, we previously identified a novel genetic locus, NRC-1 (Nonpapillary Renal Cell Carcinoma 1), that mediated tumor suppression and rapid cell death of renal cell carcinoma (RCC) cells in vivo. For these experiments, a defined subchromosomal fragment of human chromosome 3p was transferred into a sporadic RCC cell line via microcell fusion, and microcell hybrid clones were tested for tumorigenicity in vivo. The results indicated functional evidence for a novel tumor suppressor locus within the 3p14-p12 interval known to contain the most common fragile site of the human genome (FRA3B), the FHIT gene, and the breakpoint region associated with the familial form of RCC. We now report the physical mapping of the NRC-1 critical region by detailed microsatellite analyses of novel microcell hybrid clones containing transferred fragments of chromosome 3p in the RCC cell background that were phenotypically suppressed or unsuppressed for tumorigenicity in vivo. The results limit the region containing the tumor suppressor locus within chromosome 3p12. The FHIT gene, FRA3B, and the familial RCC breakpoint region were excluded from the NRC-1 critical region. Furthermore, the NRC-1 locus falls within a well-characterized homozygous deletion region of 5-7 Mb associated with a small cell lung carcinoma cell line, U2020, suggesting that a more general tumor suppressor gene may reside in this region.

Frameshift Suppression in SACCHAROMYCES CEREVISIAE. III. Isolation and Genetic Properties of Group III Suppressors

PubMed Central

Cummins, Claudia M.; Gaber, Richard F.; Culbertson, Michael R.; Mann, Richard; Fink, Gerald R.

1980-01-01

Suppressors of ICR-induced mutations that exhibit behavior similar to bacterial frameshift suppressors have been identified in the yeast Saccharomyces cerevisiae. The yeast suppressors have been divided into two groups. Previous evidence indicated that suppressors of one group (Group II: SUF1, SUF3, SUF4, SUF5 and SUF6) represent mutations in the structural genes for glycyl-tRNA's. Suppressors of the other group (Group III: SUF2 and SUF7) were less well characterized. Although they suppressed some ICR-revertible mutations, they failed to suppress Group II frameshift mutations. This communication provides a more thorough characterization of the Group III suppressors and describes the isolation and properties of four new suppressors in that group (SUF8, SUF9, SUF10 and suf11).——In our original study, Group III suppressors were isolated as revertants of the Group III mutations his4–712 and his4–713. All suppressors obtained as ICR-induced revertants of these mutations mapped at the SUF2 locus near the centromere of chromosome III. Suppressors mapping at other loci were obtained in this study by analyzing spontaneous and UV-induced revertants of the Group III mutations. SUF2 and SUF10 suppress both Group III his4 mutations, whereas SUF7, SUF8, SUF9 and suf11 suppress his4–713, but not his4–712. All of the suppressors except suf11 are dominant in diploids homozygous for his4-713. The suppressors fail to suppress representative UAA, UAG and UGA nonsense mutations.——SUF9 is linked to the centromere of chromosome VI, and SUF10 is linked to the centromere of chromosome XIV. A triploid mapping procedure was used to determine the chromosome locations of SUF7 and SUF8. Subsequent standard crosses revealed linkage of SUF7 to cdc5 on chromosome XIII and linkage of SUF8 to cdc12 and pet3 on chromosome VIII. PMID:7009319

Effects of a suppressor tone on distortion product otoacoustic emissions fine structure: why a universal suppressor level is not a practical solution to obtaining single-generator DP-grams.

PubMed

Dhar, Sumitrajit; Shaffer, Lauren A

2004-12-01

The use of a suppressor tone has been proposed as the method of choice in obtaining single-generator distortion product (DP) grams, the speculation being that such DP grams will be more predictive of hearing thresholds. Current distortion product otoacoustic emissions (DPOAE) theory points to the ear canal DPOAE signal being a complex interaction between multiple components. The effectiveness of a suppressor tone is predicted to be dependent entirely on the relative levels of these components. We examine the validity of using a suppressor tone through a detailed examination of the effects of a suppressor on DPOAE fine structure in individual ears. DPOAE fine structure, recorded in 10 normal-hearing individuals with a suppressor tone at 45, 55, and 65 dB SPL, was compared with recordings without a suppressor. Behavioral hearing thresholds were also measured in the same subjects, using 2-dB steps. The effect of the suppressor tone on DPOAE fine structure varied between ears and was dependent on frequency within ears. Correlation between hearing thresholds and DPOAE level measured without a suppressor was similar to previous reports. The effects of the suppressor are explained in the theoretical framework of a model involving multiple DPOAE components. Our results suggest that a suppressor tone can have highly variable effects on fine structure across individuals or even across frequency within one ear, thereby making the use of a suppressor less viable as a clinical tool for obtaining single-generator DP grams.

High-resolution array comparative genomic hybridization analysis of human bronchial and salivary adenoid cystic carcinoma.

PubMed

Bernheim, Alain; Toujani, Saloua; Saulnier, Patrick; Robert, Thomas; Casiraghi, Odile; Validire, Pierre; Temam, Stéphane; Menard, Philippe; Dessen, Philippe; Fouret, Pierre

2008-05-01

Adenoid cystic carcinoma (ACC) is a rare but distinctive tumor. Oligonucleotide array comparative genomic hybridization has been applied for cataloging genomic copy number alterations (CNAs) in 17 frozen salivary or bronchial tumors. Only four whole chromosome CNAs were found, and most cases had 2-4 segmental CNAs. No high level amplification was observed. There were recurrent gains at 7p15.2, 17q21-25, and 22q11-13, and recurrent losses at 1p35, 6q22-25, 8q12-13, 9p21, 12q12-13, and 17p11-13. The minimal region of gain at 7p15.2 contained the HOXA cluster. The minimal common regions of deletions contained the CDKN2A/CDKN2B, TP53, and LIMA1 tumor suppressor genes. The recurrent deletion at 8q12.3-13.1 contained no straightforward tumor suppressor gene, but the MIRN124A2 microRNA gene, whose product regulates MMP2 and CDK6. Among unique CNAs, gains harbored CCND1, KIT/PDGFRA/KDR, MDM2, and JAK2. The CNAs involving CCND1, MDM2, KIT, CDKN2A/2B, and TP53 were validated by FISH and/or multiplex ligation-dependent probe amplification. Although most tumors overexpressed cyclin D1 compared with surrounding glands, the only case to overexpress MDM2 had the corresponding CNA. In conclusion, our report suggests that ACC is characterized by a relatively low level of structural complexity. Array CGH and immunohistochemical data implicate MDM2 as the oncogene targeted at 12q15. The gain at 4q12 warrants further exploration as it contains a cluster of receptor kinase genes (KIT/PDGFRA/KDR), whose products can be responsive to specific therapies.

Clinicopathological features and pituitary homeobox 1 gene expression in the progression and prognosis of cutaneous malignant melanoma.

PubMed

Barut, Figen; Udul, Perihan; Kokturk, Furuzan; Kandemir, Nilufer Onak; Keser, Sevinc Hallac; Ozdamar, Sukru Oguz

2016-10-01

The evidence that PITX1 (pituitary homeobox 1) is a significant tumor suppressor in human cancer remains largely circumstantial, but it clearly warrants further study as little is known about the tumor-inhibitory roles of PITX1 in cutaneous malignant melanoma. The aims of this study were to investigate PITX1 gene expression in patients with cutaneous malignant melanoma and to evaluate its potential relevance to clinicopathological characteristics and tumor cell proliferation. Clinicopathological findings of patients with cutaneous malignant melanoma were analyzed retrospectively. PITX1 and Ki-67 expression were detected by immunohistochemistry in malignant melanoma and healthy tissue samples from each patient. Labeling indices were calculated based on PITX1 gene and Ki-67 expression. The correlation between PITX1and Ki-67 expressions was analyzed in cutaneous malignant melanoma cases. The relationship between PITX1 expression intensity and clinicopathological characteristics was also analyzed. PITX1 expression was observed in all (100%) normal healthy skin tissue samples. In addition, PITX1 expression was found in 56 (80%) and was absent in 14 (20%) of the 70 cutaneous malignant melanoma cases. Ki-67 positive expression was only detected in the 14 (20%) PITX1-negative cases. PITX1-positive tumor cells were observed on the surface, but Ki-67 positive tumor cells were observed in deeper zones of the tumor nests. PITX1 expression was downregulated in human cutaneous malignant melanoma lesions compared with healthy skin tissue, but Ki-67 expression was upregulated in concordance with the progression of cutaneous malignant melanoma. PITX1 expression may be involved in tumor progression and is a potential tumor suppressor gene and prognostic marker for cutaneous malignant melanoma. Copyright © 2016. Published by Elsevier Taiwan.

Pharmacological mimicking of caloric restriction elicits epigenetic reprogramming of differentiated cells to stem-like self-renewal states.

PubMed

Oliveras-Ferraros, Cristina; Vazquez-Martin, Alejandro; Menendez, Javier A

2010-10-01

Networks of oncogenes and tumor suppressor genes that control cancer cell proliferation also regulate stem cell renewal and possibly stem cell aging. Because (de)differentiation processes might dictate tumor cells to retrogress to a more stem-like state in response to aging-relevant epigenetic and/or environmental players, we recently envisioned that cultured human cancer cells might be used as reliable models to test the ability of antiaging interventions for promoting the initiation and maintenance of self-renewing divisions. Cancer cell lines naturally bearing undetectable amounts of stem/progenitor-like cell populations were continuously cultured in the presence of the caloric restriction mimetic metformin for several months. Microarray technology was employed to profile expression of genes related to the identification, growth, and differentiation of stem cells. Detection of functionally related gene groups using a pathway analysis package provided annotated genetic signatures over- and underexpressed in response to pharmacological mimicking of caloric restriction. By following this methodological approach, we recently obtained data fitting a model in which, in response to chronic impairment of cellular bioenergetics imposed by metformin-induced mitochondrial uncoupling as assessed by the phosphorylation state of cAMP-response element binding protein (CREB), tumor cells can retrogress from a differentiated state to a more CD44(+) stem-like primitive state epigenetically governed by the Polycomb-group suppressor BMI1-a crucial "stemness" gene involved in the epigenetic maintenance of adult stem cells. These findings might provide a novel molecular avenue to investigate if antiaging benefits from caloric restriction mimetics might relate to their ability to epigenetically reprogram stemness while prolonging the capacity of stem-like cell states to proliferate, differentiate, and replace mature cells in adult aging tissues.

The genetic locus NRC-1 within chromosome 3p12 mediates tumor suppression in renal cell carcinoma independently of histological type, tumor microenvironment, and VHL mutation.

PubMed

Lovell, M; Lott, S T; Wong, P; El-Naggar, A; Tucker, S; Killary, A M

1999-05-01

Human chromosome 3p cytogenetic abnormalities and loss of heterozygosity have been observed at high frequency in the nonpapillary form of sporadic renal cell carcinoma (RCC). The von Hippel-Lindau (VHL) gene has been identified as a tumor suppressor gene for RCC at 3p25, and functional studies as well as molecular genetic and cytogenetic analyses have suggested as many as two or three additional regions of 3p that could harbor tumor suppressor genes for sporadic RCC. We have previously functionally defined a novel genetic locus nonpapillary renal carcinoma-1 (NRC-1) within chromosome 3p12, distinct from the VHL gene, that mediates tumor suppression and rapid cell death of RCC cells in vivo. We now report the suppression of tumorigenicity of RCC cells in vivo after the transfer of a defined centric 3p fragment into different histological types of RCC. Results document the functional involvement of NRC-1 in not only different cell types of RCC (i.e., clear cell, mixed granular cell/clear cell, and sarcomatoid types) but also in papillary RCC, a less frequent histological type of RCC for which chromosome 3p LOH and genetic aberrations have only rarely been observed. We also report that the tumor suppression observed in functional genetic screens was independent of the microenvironment of the tumor, further supporting a role for NRC-1 as a more general mediator of in vivo growth control. Furthermore, this report demonstrates the first functional evidence for a VHL-independent pathway to tumorigenesis in the kidney via the genetic locus NRC-1.

Sequence and expression variation in SUPPRESSOR of OVEREXPRESSION of CONSTANS 1 (SOC1): homeolog evolution in Indian Brassicas.

PubMed

Sri, Tanu; Mayee, Pratiksha; Singh, Anandita

2015-09-01

Whole genome sequence analyses allow unravelling such evolutionary consequences of meso-triplication event in Brassicaceae (∼14-20 million years ago (MYA)) as differential gene fractionation and diversification in homeologous sub-genomes. This study presents a simple gene-centric approach involving microsynteny and natural genetic variation analysis for understanding SUPPRESSOR of OVEREXPRESSION of CONSTANS 1 (SOC1) homeolog evolution in Brassica. Analysis of microsynteny in Brassica rapa homeologous regions containing SOC1 revealed differential gene fractionation correlating to reported fractionation status of sub-genomes of origin, viz. least fractionated (LF), moderately fractionated 1 (MF1) and most fractionated (MF2), respectively. Screening 18 cultivars of 6 Brassica species led to the identification of 8 genomic and 27 transcript variants of SOC1, including splice-forms. Co-occurrence of both interrupted and intronless SOC1 genes was detected in few Brassica species. In silico analysis characterised Brassica SOC1 as MADS intervening, K-box, C-terminal (MIKC(C)) transcription factor, with highly conserved MADS and I domains relative to K-box and C-terminal domain. Phylogenetic analyses and multiple sequence alignments depicting shared pattern of silent/non-silent mutations assigned Brassica SOC1 homologs into groups based on shared diploid base genome. In addition, a sub-genome structure in uncharacterised Brassica genomes was inferred. Expression analysis of putative MF2 and LF (Brassica diploid base genome A (AA)) sub-genome-specific SOC1 homeologs of Brassica juncea revealed near identical expression pattern. However, MF2-specific homeolog exhibited significantly higher expression implying regulatory diversification. In conclusion, evidence for polyploidy-induced sequence and regulatory evolution in Brassica SOC1 is being presented wherein differential homeolog expression is implied in functional diversification.

A novel genome-wide in vivo screen for metastatic suppressors in human colon cancer identifies the positive WNT-TCF pathway modulators TMED3 and SOX12

PubMed Central

Duquet, Arnaud; Melotti, Alice; Mishra, Sonakshi; Malerba, Monica; Seth, Chandan; Conod, Arwen; Ruiz i Altaba, Ariel

2014-01-01

The progression of tumors to the metastatic state involves the loss of metastatic suppressor functions. Finding these, however, is difficult as in vitro assays do not fully predict metastatic behavior, and the majority of studies have used cloned cell lines, which do not reflect primary tumor heterogeneity. Here, we have designed a novel genome-wide screen to identify metastatic suppressors using primary human tumor cells in mice, which allows saturation screens. Using this unbiased approach, we have tested the hypothesis that endogenous colon cancer metastatic suppressors affect WNT-TCF signaling. Our screen has identified two novel metastatic suppressors: TMED3 and SOX12, the knockdown of which increases metastatic growth after direct seeding. Moreover, both modify the type of self-renewing spheroids, but only knockdown of TMED3 also induces spheroid cell spreading and lung metastases from a subcutaneous xenograft. Importantly, whereas TMED3 and SOX12 belong to different families involved in protein secretion and transcriptional regulation, both promote endogenous WNT-TCF activity. Treatments for advanced or metastatic colon cancer may thus not benefit from WNT blockers, and these may promote a worse outcome. PMID:24920608

Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

PubMed

Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

2017-03-01

The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha-LSL transcript accumulation was also detected in leaves and floral primordia at early stages of development. These results were corroborated by qRT-PCR analyses that evidenced high levels of Ha-LSL transcripts in very young leaves and disc flowers, suggesting a role of Ha-LSL for the early outgrowth of lateral primordia.

THE ACTION OF RADIATION AND OTHER MUTAGENIC AGENTS (1) IN INDUCING MUTATION IN DROSOPHILA FEMALES, AND (2) IN CONTROLLING THE ACTION OF SPECIFIC GENES RESPONSIBLE FOR SUPPRESSING UNCONTROLLED GROWTH. Report Covering 9-Year Period, May 1, 1953-April 30, 1962

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glass, H.B.

1962-02-01

Studies of the comparative mutagenic effects of ionizing radiations on males and females of Drosophila melanogaster are described. Sex-linked recessive lethal mutations were induced in nitrogen, air, and oxygen at doses of obtained in spermatozoa were uniformly about one-third higher than the frequencies obtained for the same dose and condition of atmosphere in mature oocytes. The relative frequencies of recessive autosomal lethals in mature male and female germ cells were identical with the relative fre quencies of sex-linked recessive lethals. In studies of point mutations and deficiencies involving specific loci, the rates in the male germ cells exceeded those inmore » the female germ cells by a proportion equal to that found to apply to autosomal and sex-linked recessive lethals. Spontaneous mutation rates were determined for a number of specific loci marked by recessive genes used in the tested stocks. Fertility was lost in both males and females when they were x-rayed as 80-hr-old larvae and bred upon emerging as adults. Females recovered their fertility rapidly but the males did so at a much slower rate. The brown; scarlet'' stock was found to carry two mutants each suppressed by a particular suppressor gene. It was concluded that the two suppressors act along different metabolic pathways departing from tryplophan, but both involving an x-ray-sensitive step. A study was made of the effects on the life span of two different mating regimens: immediate and deferred. It was found that the lines previously subjected to immediate mating significantly outlived the lines previously subjected to deferred mating when the mating regimen in the test was immediate mating. Exactly the opposite happened when the mating regimen in the test was deferred mating. (M.C.G.)« less

Tumor suppressor BRCA1 is expressed in prostate cancer and controls IGF-I receptor (IGF-IR) gene transcription in an androgen receptor-dependent manner

PubMed Central

Schayek, Hagit; Haugk, Kathy; Sun, Shihua; True, Lawrence D.; Plymate, Stephen R.; Werner, Haim

2010-01-01

Purpose The insulin-like growth factor (IGF) system plays an important role in prostate cancer. The BRCA1 gene encodes a transcription factor with tumor suppressor activity. The involvement of BRCA1 in prostate cancer, however, has not yet been elucidated. The purpose of the present study was to examine the functional correlations between BRCA1 and the IGF system in prostate cancer. Experimental Design An immunohistochemical analysis of BRCA1 was performed on Tissue Microarrays comprising 203 primary prostate cancer specimens. In addition, BRCA1 levels were measured in prostate cancer xenografts and in cell lines representing early stages of the disease (P69 cells) and advanced stages (M12 cells). The ability of BRCA1 to regulate IGF-IR expression was studied by coexpression experiments using a BRCA1 expression vector along with an IGF-IR promoter-luciferase reporter. Results We found significantly elevated BRCA1 levels in prostate cancer in comparison to histologically normal prostate tissue (p < 0.001). In addition, an inverse correlation between BRCA1 and IGF-IR levels was observed in the AR-negative P69 and M12 prostate cancer-derived cell lines. Coexpression experiments in M12 cells revealed that BRCA1 was able to suppress IGF-IR promoter activity and endogenous IGF-IR levels. On the other hand, BRCA1 enhanced IGF-IR levels in LnCaP C4-2 cells expressing an endogenous AR. Conclusions We provide evidence that BRCA1 differentially regulates IGF-IR expression in AR positive and negative prostate cancer cells. The mechanism of action of BRCA1 involves modulation of IGF-IR gene transcription. In addition, immunohistochemical data is consistent with a potential survival role of BRCA1 in prostate cancer. PMID:19223505

Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans.

PubMed

Dickinson, Peter J; York, Dan; Higgins, Robert J; LeCouteur, Richard A; Joshi, Nikhil; Bannasch, Danika

2016-07-01

Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. © 2016 American Association of Neuropathologists, Inc. All rights reserved.

Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans

PubMed Central

York, Dan; Higgins, Robert J.; LeCouteur, Richard A.; Joshi, Nikhil; Bannasch, Danika

2016-01-01

Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041

Frequent epigenetic inactivation of chromosome 3p candidate tumor suppressor genes in gallbladder carcinoma.

PubMed

Riquelme, Erick; Tang, Moying; Baez, Sergio; Diaz, Alfonso; Pruyas, Martha; Wistuba, Ignacio I; Corvalan, Alejandro

2007-05-18

Gallbladder carcinoma (GBC) is a highly malignant neoplasm that represents the leading cause of death for cancer in Chilean females. There is limited information about the molecular abnormalities involved in its pathogenesis. We have identified a number of molecular changes in GBC, including frequent allelic losses at chromosome 3p regions. Four distinct 3p sites (3p12, 3p14.2, 3p21.3 and 3p22-24) with frequent and early allelic losses in the sequential pathogenesis of this neoplasm have been detected. We investigated epigenetic and genetic abnormalities in GBC affecting 6 candidate tumor suppressor genes (TSG) located in chromosome 3p, including DUTT1 (3p12), FHIT (3p14.2), BLU, RASSF1A, SEMA3B and hMLH1 (3p21.3). DNA extracted from frozen tissue obtained from 50 surgical resected GBCs was examined for gene promoter methylation using MSP (methylation-specific PCR) technique after bisulfite treatment in all 6 genes. In addition, we performed PCR-based mutation examination using SSCP in FHIT and RASSF1A genes and loss of heterozygosity (LOH) analysis using microdissected tissue in a subset of tumors for the 3p21.3 region with 8 microsatellite markers. A very high frequency of GBC methylation was detected in SEMA3B (46/50, 92%) and FHIT (33/50, 66%), intermediate incidences in BLU (13/50, 26%) and DUTT1 (11/50, 22%) and very low frequencies in RASSF1A (4/50, 8%) and hMLH1 (2/50, 4%). Allelic loss at 3p21.3 was found in nearly half of the GBCs examined. We conclude that epigenetic inactivation by abnormal promoter methylation is a frequent event in chromosome 3p candidate TSGs in GBC pathogenesis, especially affecting genes SEMA3B (3p21.3) and FHIT (3p14.2).

Epigenetic regulation of multiple tumor-related genes leads to suppression of breast tumorigenesis by dietary genistein.

PubMed

Li, Yuanyuan; Chen, Huaping; Hardy, Tabitha M; Tollefsbol, Trygve O

2013-01-01

Breast cancer is one of the most lethal diseases in women; however, the precise etiological factors are still not clear. Genistein (GE), a natural isoflavone found in soybean products, is believed to be a potent chemopreventive agent for breast cancer. One of the most important mechanisms for GE inhibition of breast cancer may involve its potential in impacting epigenetic processes allowing reversal of aberrant epigenetic events during breast tumorigenesis. To investigate epigenetic regulation for GE impedance of breast tumorigenesis, we monitored epigenetic alterations of several key tumor-related genes in an established breast cancer transformation system. Our results show that GE significantly inhibited cell growth in a dose-dependent manner in precancerous breast cells and breast cancer cells, whereas it exhibited little effect on normal human mammary epithelial cells. Furthermore, GE treatment increased expression of two crucial tumor suppressor genes, p21(WAF1) (p21) and p16(INK4a) (p16), although it decreased expression of two tumor promoting genes, BMI1 and c-MYC. GE treatment led to alterations of histone modifications in the promoters of p21 and p16 as well as the binding ability of the c-MYC-BMI1 complex to the p16 promoter contributing to GE-induced epigenetic activation of these tumor suppressor genes. In addition, an orally-fed GE diet prevented breast tumorigenesis and inhibited breast cancer development in breast cancer mice xenografts. Our results suggest that genistein may repress early breast tumorigenesis by epigenetic regulation of p21 and p16 by impacting histone modifications as well as the BMI1-c-MYC complex recruitment to the regulatory region in the promoters of these genes. These studies will facilitate more effective use of soybean product in breast cancer prevention and also help elucidate the mechanisms during the process of early breast tumorigenesis.

Structural Basis of Merlin Tumor Suppressor Functions in Neurofibromatosis-2

DTIC Science & Technology

2013-10-01

Neurofibromatosis -2 PRINCIPAL INVESTIGATOR: Tina Izard CONTRACTING ORGANIZATION: The Scripps Research Institute La Jolla, CA 92037-1000...30September2012-29September2013 4. TITLE AND SUBTITLE Structural Basis of Merlin Tumor Suppressor Functions in Neurofibromatosis -2 5a. CONTRACT...14. ABSTRACT Loss-of-function mutations in the neurofibromatosis -2 (NF2) gene lead to familial and sporadic neurological malignancies in man

Stromal loss of TGFβ drives cancer growth in the epithelium via inflammation | Center for Cancer Research

Cancer.gov

Interactions between epithelial and stromal cells play an important role in cancer development and progression. Epithelial cancers develop when changes occur to tumor suppressor genes in stromal fibroblast cells. For example, loss of tumor suppressor, p53, in stromal fibroblasts leads to p53 inactivation in the epithelium in a prostate cancer model, and disruption of the

Recurrent selection on the Winters sex-ratio genes in Drosophila simulans.

PubMed

Kingan, Sarah B; Garrigan, Daniel; Hartl, Daniel L

2010-01-01

Selfish genes, such as meiotic drive elements, propagate themselves through a population without increasing the fitness of host organisms. X-linked (or Y-linked) meiotic drive elements reduce the transmission of the Y (X) chromosome and skew progeny and population sex ratios, leading to intense conflict among genomic compartments. Drosophila simulans is unusual in having a least three distinct systems of X chromosome meiotic drive. Here, we characterize naturally occurring genetic variation at the Winters sex-ratio driver (Distorter on the X or Dox), its progenitor gene (Mother of Dox or MDox), and its suppressor gene (Not Much Yang or Nmy), which have been previously mapped and characterized. We survey three North American populations as well as 13 globally distributed strains and present molecular polymorphism data at the three loci. We find that all three genes show signatures of selection in North America, judging from levels of polymorphism and skews in the site-frequency spectrum. These signatures likely result from the biased transmission of the driver and selection on the suppressor for the maintenance of equal sex ratios. Coalescent modeling indicates that the timing of selection is more recent than the age of the alleles, suggesting that the driver and suppressor are coevolving under an evolutionary "arms race." None of the Winters sex-ratio genes are fixed in D. simulans, and at all loci we find ancestral alleles, which lack the gene insertions and exhibit high levels of nucleotide polymorphism compared to the derived alleles. In addition, we find several "null" alleles that have mutations on the derived Dox background, which result in loss of drive function. We discuss the possible causes of the maintenance of presence-absence polymorphism in the Winters sex-ratio genes.

Modulation of Genetic and Epigenetic Biomarkers of Colorectal Cancer in Humans by Black Raspberries: A Phase I Pilot Study

PubMed Central

Wang, Li-Shu; Arnold, Mark; Huang, Yi-Wen; Sardo, Christine; Seguin, Claire; Martin, Edward; Huang, Tim H.-M.; Riedl, Ken; Schwartz, Steven; Frankel, Wendy; Pearl, Dennis; Xu, Yiqing; Winston, John; Yang, Guang-Yu; Stoner, Gary

2010-01-01

Purpose This study evaluated the effects of black raspberries (BRBs) on biomarkers of tumor development in the human colon and rectum including methylation of relevant tumor suppressor genes, cell proliferation, apoptosis, angiogenesis and expression of Wnt pathway genes. Experimental Design Biopsies of adjacent normal tissues and colorectal adenocarcinomas were taken from 20 patients before and after oral consumption of BRB powder (60g/day) for 1-to-9 wks. Methylation status of promoter regions of five tumor suppressor genes was quantified. Protein expression of DNA methyltransferase 1 (DNMT1) and genes associated with cell proliferation, apoptosis, angiogenesis, and Wnt signaling were measured. Results The methylation of three Wnt inhibitors, SFRP2, SFRP5, and WIF1, upstream genes in Wnt pathway, and PAX6a, a developmental regulator, was modulated in a protective direction by BRBs in normal tissues and in colorectal tumors only in patients who received an average of 4 wks of BRB treatment, but not in all 20 patients with 1-to-9 wks of BRB treatment. This was associated with decreased expression of DNMT1. BRBs modulated expression of genes associated with Wnt pathway, proliferation, apoptosis and angiogenesis in a protective direction. Conclusions These data provide evidence of the ability of BRBs to demethylate tumor suppressor genes and to modulate other biomarkers of tumor development in the human colon and rectum. While demethylation of genes did not occur in colorectal tissues from all treated patients, the positive results with the secondary endpoints suggest that additional studies of BRBs for the prevention of colorectal cancer in humans now appear warranted. PMID:21123457

Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

PubMed

Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

2016-11-04

Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

Molecular changes preceding endometrial and ovarian cancer: a study of consecutive endometrial specimens from Lynch syndrome surveillance.

PubMed

Niskakoski, Anni; Pasanen, Annukka; Lassus, Heini; Renkonen-Sinisalo, Laura; Kaur, Sippy; Mecklin, Jukka-Pekka; Bützow, Ralf; Peltomäki, Päivi

2018-03-27

Molecular alterations preceding endometrial and ovarian cancer and the sequence of events are unknown. Consecutive specimens from lifelong surveillance for Lynch syndrome provides a natural setting to address such questions. To molecularly define the multistep gynecological tumorigenesis, DNA mismatch repair gene mutation carriers with endometrial or ovarian carcinoma or endometrial hyperplasia were identified from a nation-wide registry and endometrial biopsy specimens taken from these individuals during 20 years of screening were collected. A total of 213 endometrial and ovarian specimens from Lynch syndrome individuals and 197 histology-matched (non-serous) samples from sporadic cases were available for this investigation. The specimens were profiled for markers linked to endometrial and ovarian tumorigenesis, including ARID1A protein expression, mismatch repair status, and tumor suppressor gene promoter methylation. In Lynch syndrome-associated endometrial and ovarian carcinomas, ARID1A protein was lost in 61-100% and mismatch repair was deficient in 97-100%, compared to 0-17% and 14-44% in sporadic cases (P = 0.000). ARID1A loss appeared in complex hyperplasia and deficient mismatch repair and tumor suppressor gene promoter methylation in histologically normal endometrium. Despite quantitative differences between Lynch syndrome and sporadic cases, ARID1A expression, mismatch repair, and tumor suppressor gene promoter methylation divided endometrial samples from both patient groups into three categories of increasing abnormality, comprising normal endometrium and simple hyperplasia (I), complex hyperplasia with or without atypia (II), and endometrial cancer (III). Complex hyperplasias without vs. with atypia were molecularly indistinguishable. In conclusion, surveillance specimens from Lynch syndrome identify mismatch repair deficiency, tumor suppressor gene promoter methylation, and ARID1A loss as early changes in tumor development. Our findings are clinically relevant for the classification of endometrial hyperplasias and have potential implications in cancer prevention in Lynch syndrome and beyond.

Notch signaling: switching an oncogene to a tumor suppressor

PubMed Central

Lobry, Camille; Oh, Philmo; Mansour, Marc R.; Look, A. Thomas

2014-01-01

The Notch signaling pathway is a regulator of self-renewal and differentiation in several tissues and cell types. Notch is a binary cell-fate determinant, and its hyperactivation has been implicated as oncogenic in several cancers including breast cancer and T-cell acute lymphoblastic leukemia (T-ALL). Recently, several studies also unraveled tumor-suppressor roles for Notch signaling in different tissues, including tissues where it was before recognized as an oncogene in specific lineages. Whereas involvement of Notch as an oncogene in several lymphoid malignancies (T-ALL, B-chronic lymphocytic leukemia, splenic marginal zone lymphoma) is well characterized, there is growing evidence involving Notch signaling as a tumor suppressor in myeloid malignancies. It therefore appears that Notch signaling pathway’s oncogenic or tumor-suppressor abilities are highly context dependent. In this review, we summarize and discuss latest advances in the understanding of this dual role in hematopoiesis and the possible consequences for the treatment of hematologic malignancies. PMID:24608975

MiR-21 plays an Important Role in Radiation Induced Carcinogenesis in BALB/c Mice by Directly Targeting the Tumor Suppressor Gene Big-h3

PubMed Central

Liu, Cong; Li, Bailong; Cheng, Ying; Lin, Jing; Hao, Jun; Zhang, Shuyu; Mitchel, R.E.J.; Sun, Ding; Ni, Jin; Zhao, Luqian; Gao, Fu; Cai, Jianming

2011-01-01

Dysregulation of certain microRNAs (miRNAs) in cancer can promote tumorigenesis, metastasis and invasion. However, the functions and targets of only a few mammalian miRNAs are known. In particular, the miRNAs that participates in radiation induced carcinogenesis and the miRNAs that target the tumor suppressor gene Big-h3 remain undefined. Here in this study, using a radiation induced thymic lymphoma model in BALB/c mice, we found that the tumor suppressor gene Big-h3 is down-regulated and miR-21 is up-regulated in radiation induced thymic lymphoma tissue samples. We also found inverse correlations between Big-h3 protein and miR-21 expression level among different tissue samples. Furthermore, our data indicated that miR-21 could directly target Big-h3 in a 3′UTR dependent manner. Finally, we found that miR-21 could be induced by TGFβ, and miR-21 has both positive and negative effects in regulating TGFβ signaling. We conclude that miR-21 participates in radiation induced carcinogenesis and it regulates TGFβ signaling. PMID:21494432

E6 and E7 gene silencing results in decreased methylation of tumor suppressor genes and induces phenotype transformation of human cervical carcinoma cell lines

PubMed Central

Long, Jia; Shen, Danbei; Zhou, Wuqing; Zhou, Qiyan; Yang, Jia; Jiang, Mingjun

2015-01-01

In SiHa and CaSki cells, E6 and E7-targeting shRNA specifically and effectively knocked down human papillomavirus (HPV) 16 E6 and E7 at the transcriptional level, reduced the E6 and E7 mRNA levels by more than 80% compared with control cells that expressed a scrambled-sequence shRNA. E6 and E7 repression resulted in down-regulation of DNA methyltransferase mRNA and protein expression, decreased DNA methylation and increased mRNA expression levels of tumor suppressor genes, induced a certain apoptosis and inhibited proliferation in E6 and E7 shRNA-infected SiHa and CaSki cells compared with the uninfected cells. Repression of E6 and E7 oncogenes resulted in restoration of DNA methyltransferase suppressor pathways and induced apoptosis in HPV16-positive cervical carcinoma cell lines. Our findings suggest that the potential carcinogenic mechanism of HPV16 through influencing DNA methylation pathway to activate the development of cervical cancer exist, and maybe as a candidate therapeutic strategy for cervical and other HPV-associated cancers. PMID:26329329

Genetics Home Reference: primary macronodular adrenal hyperplasia

MedlinePlus

... too rapidly or in an uncontrolled way. ARMC5 gene mutations are believed to impair the protein's tumor-suppressor ... endocrine glands, including the adrenal glands. The GNAS gene mutations that cause PMAH are believed to result in ...

N-terminal RASSF family

PubMed Central

Underhill-Day, Nicholas; Hill, Victoria

2011-01-01

Epigenetic inactivation of tumor suppressor genes is a hallmark of cancer development. RASSF1A (Ras Association Domain Family 1 isoform A) tumor suppressor gene is one of the most frequently epigenetically inactivated genes in a wide range of adult and children's cancers and could be a useful molecular marker for cancer diagnosis and prognosis. RASSF1A has been shown to play a role in several biological pathways, including cell cycle control, apoptosis and microtubule dynamics. RASSF2, RASSF4, RASSF5 and RASSF6 are also epigenetically inactivated in cancer but have not been analyzed in as wide a range of malignancies as RASSF1A. Recently four new members of the RASSF family were identified these are termed N-Terminal RASSF genes (RASSF7–RASSF10). Molecular and biological analysis of these newer members has just begun. This review highlights what we currently know in respects to structural, functional and molecular properties of the N-Terminal RASSFs. PMID:21116130

Role of Molecular Biology in Cancer Treatment: A Review Article.

PubMed

Imran, Aman; Qamar, Hafiza Yasara; Ali, Qurban; Naeem, Hafsa; Riaz, Mariam; Amin, Saima; Kanwal, Naila; Ali, Fawad; Sabar, Muhammad Farooq; Nasir, Idrees Ahmad

2017-11-01

Cancer is a genetic disease and mainly arises due to a number of reasons include activation of onco-genes, malfunction of tumor suppressor genes or mutagenesis due to external factors. This article was written from the data collected from PubMed, Nature, Science Direct, Springer and Elsevier groups of journals. Oncogenes are deregulated form of normal proto-oncogenes required for cell division, differentiation and regulation. The conversion of proto-oncogene to oncogene is caused due to translocation, rearrangement of chromosomes or mutation in gene due to addition, deletion, duplication or viral infection. These oncogenes are targeted by drugs or RNAi system to prevent proliferation of cancerous cells. There have been developed different techniques of molecular biology used to diagnose and treat cancer, including retroviral therapy, silencing of oncogenes and mutations in tumor suppressor genes. Among all the techniques used, RNAi, zinc finger nucleases and CRISPR hold a brighter future towards creating a Cancer Free World.

Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

PubMed

Zhao, Yongzhong; Epstein, Richard J

2013-01-01

Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

Impact of microRNAs on regulatory networks and pathways in human colorectal carcinogenesis and development of metastasis

PubMed Central

2013-01-01

Background Qualitative alterations or abnormal expression of microRNAs (miRNAs) in colon cancer have mainly been demonstrated in primary tumors. Poorly overlapping sets of oncomiRs, tumor suppressor miRNAs and metastamiRs have been linked with distinct stages in the progression of colorectal cancer. To identify changes in both miRNA and gene expression levels among normal colon mucosa, primary tumor and liver metastasis samples, and to classify miRNAs into functional networks, in this work miRNA and gene expression profiles in 158 samples from 46 patients were analysed. Results Most changes in miRNA and gene expression levels had already manifested in the primary tumors while these levels were almost stably maintained in the subsequent primary tumor-to-metastasis transition. In addition, comparing normal tissue, tumor and metastasis, we did not observe general impairment or any rise in miRNA biogenesis. While only few mRNAs were found to be differentially expressed between primary colorectal carcinoma and liver metastases, miRNA expression profiles can classify primary tumors and metastases well, including differential expression of miR-10b, miR-210 and miR-708. Of 82 miRNAs that were modulated during tumor progression, 22 were involved in EMT. qRT-PCR confirmed the down-regulation of miR-150 and miR-10b in both primary tumor and metastasis compared to normal mucosa and of miR-146a in metastases compared to primary tumor. The upregulation of miR-201 in metastasis compared both with normal and primary tumour was also confirmed. A preliminary survival analysis considering differentially expressed miRNAs suggested a possible link between miR-10b expression in metastasis and patient survival. By integrating miRNA and target gene expression data, we identified a combination of interconnected miRNAs, which are organized into sub-networks, including several regulatory relationships with differentially expressed genes. Key regulatory interactions were validated experimentally. Specific mixed circuits involving miRNAs and transcription factors were identified and deserve further investigation. The suppressor activity of miR-182 on ENTPD5 gene was identified for the first time and confirmed in an independent set of samples. Conclusions Using a large dataset of CRC miRNA and gene expression profiles, we describe the interplay of miRNA groups in regulating gene expression, which in turn affects modulated pathways that are important for tumor development. PMID:23987127

Trichostatin A, a histone deacetylase inhibitor, suppresses JAK2/STAT3 signaling via inducing the promoter-associated histone acetylation of SOCS1 and SOCS3 in human colorectal cancer cells.

PubMed

Xiong, Hua; Du, Wan; Zhang, Yan-Jie; Hong, Jie; Su, Wen-Yu; Tang, Jie-Ting; Wang, Ying-Chao; Lu, Rong; Fang, Jing-Yuan

2012-02-01

Aberrant janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling is involved in the oncogenesis of several cancers. Suppressors of cytokine signaling (SOCS) genes and SH2-containing protein tyrosine phosphatase 1 (SHP1) proteins, which are negative regulators of JAK/STAT signaling, have been reported to have tumor suppressor functions. However, in colorectal cancer (CRC) cells, the mechanisms that regulate SOCS and SHP1 genes, and the cause of abnormalities in the JAK/STAT signaling pathway, remain largely unknown. The present study shows that trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, leads to the hyperacetylation of histones associated with the SOCS1 and SOCS3 promoters, but not the SHP1 promoter in CRC cells. This indicates that histone modifications are involved in the regulation of SOCS1 and SOCS3. Moreover, upregulation of SOCS1 and SOCS3 expression was achieved using TSA, which also significantly downregulated JAK2/STAT3 signaling in CRC cells. We also demonstrate that TSA suppresses the growth of CRC cells, and induces G1 cell cycle arrest and apoptosis through the regulation of downstream targets of JAK2/STAT3 signaling, including Bcl-2, survivin and p16(ink4a) . Therefore, our data demonstrate that TSA may induce SOCS1 and SOCS3 expression by inducing histone modifications and consequently inhibits JAK2/STAT3 signaling in CRC cells. These results also establish a mechanistic link between the inhibition of JAK2/STAT3 signaling and the anticancer action of TSA in CRC cells. Copyright © 2011 Wiley Periodicals, Inc.

Molecular mechanisms in cancer induction and prevention.

PubMed Central

Borek, C

1993-01-01

Chemical and physical carcinogens, present in our environment and encountered in a variety of occupations, produce damage to DNA. X-rays produced direct ionizations and indirect hydroxyl radical attack. UV light in the short wavelength is specifically absorbed by unsaturated bonds in DNA, RNA, and proteins. There are a number of genetic sites that are specifically affected by environmental agents, and an increased sensitivity is found in certain genetic diseases. The development of a fully malignant tumor involves the activation or altered expression of oncogenes or the inactivation of tumor-suppressor genes that control normal cellular development. Mutations in the p53 tumor-suppressor gene are common in diverse types of cancer and could perhaps provide clues to the etiology of some cancers and to the effect of various environmental and occupational carcinogens in cancer development. The fact that environmental factors are involved to a great extent in cancer suggest that cancer may be preventable. Experimental as well as epidemiological data indicate that a variety of nutritional factors can act as anticarcinogens and inhibit the process of cancer development and reduce cancer risk. The interaction of cells with a number of environmental and occupational genotoxic substances such as X-rays, UV light, and a variety of chemicals including ozone results in an enhanced generation of free oxygen radicals and in modified pro-oxidant states. A number of nutritional factors such as vitamins A, C, E, beta-carotene, and micronutrients such as selenium act as antioxidants and anticarcinogens. Certain hormones such as thyroid hormones enhance oxidative processes and act as a co-transforming factor in carcinogenesis.(ABSTRACT TRUNCATED AT 250 WORDS) Images FIGURE 1. FIGURE 2. PMID:8143624

The SUD1 gene encodes a putative E3 ubiquitin ligase and is a positive regulator of 3-hydroxy-3-methylglutaryl coenzyme a reductase activity in Arabidopsis.

PubMed

Doblas, Verónica G; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M; Botella, Miguel A

2013-02-01

The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum-associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals.

Structural basis of gene regulation by the Grainyhead/CP2 transcription factor family

PubMed Central

Ming, Qianqian; Roske, Yvette; Schuetz, Anja; Walentin, Katharina; Ibraimi, Ibraim; Schmidt-Ott, Kai M

2018-01-01

Abstract Grainyhead (Grh)/CP2 transcription factors are highly conserved in multicellular organisms as key regulators of epithelial differentiation, organ development and skin barrier formation. In addition, they have been implicated as being tumor suppressors in a variety of human cancers. Despite their physiological importance, little is known about their structure and DNA binding mode. Here, we report the first structural study of mammalian Grh/CP2 factors. Crystal structures of the DNA-binding domains of grainyhead-like (Grhl) 1 and Grhl2 reveal a closely similar conformation with immunoglobulin-like core. Both share a common fold with the tumor suppressor p53, but differ in important structural features. The Grhl1 DNA-binding domain binds duplex DNA containing the consensus recognition element in a dimeric arrangement, supporting parsimonious target-sequence selection through two conserved arginine residues. We elucidate the molecular basis of a cancer-related mutation in Grhl1 involving one of these arginines, which completely abrogates DNA binding in biochemical assays and transcriptional activation of a reporter gene in a human cell line. Thus, our studies establish the structural basis of DNA target-site recognition by Grh transcription factors and reveal how tumor-associated mutations inactivate Grhl proteins. They may serve as points of departure for the structure-based development of Grh/CP2 inhibitors for therapeutic applications. PMID:29309642

The SUD1 Gene Encodes a Putative E3 Ubiquitin Ligase and Is a Positive Regulator of 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Activity in Arabidopsis[C][W

PubMed Central

Doblas, Verónica G.; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M.; Botella, Miguel A.

2013-01-01

The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum–associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals. PMID:23404890

The Downregulation of the Expression of CD147 by Tumor Suppressor REIC/Dkk-3, and Its Implication in Human Prostate Cancer Cell Growth Inhibition.

PubMed

Mori, Akihiro; Watanabe, Masami; Sadahira, Takuya; Kobayashi, Yasuyuki; Ariyoshi, Yuichi; Ueki, Hideo; Wada, Koichiro; Ochiai, Kazuhiko; Li, Shun-Ai; Nasu, Yasutomo

2017-04-01

The cluster of differentiation 147 (CD147), also known as EMMPRIN, is a key molecule that promotes cancer progression. We previously developed an adenoviral vector encoding a tumor suppressor REIC/Dkk-3 gene (Ad-REIC) for cancer gene therapy. The therapeutic effects are based on suppressing the growth of cancer cells, but, the underlying molecular mechanism has not been fully clarified. To elucidate this mechanism, we investigated the effects of Ad-REIC on the expression of CD147 in LNCaP prostate cancer cells. Western blotting revealed that the expression of CD147 was significantly suppressed by Ad-REIC. Ad-REIC also suppressed the cell growth of LNCaP cells. Since other researchers have demonstrated that phosphorylated mitogen-activated protein kinases (MAPKs) and c-Myc protein positively regulate the expression of CD147, we investigated the correlation between the CD147 level and the activation of MAPK and c-Myc expression. Unexpectedly, no positive correlation was observed between CD147 and its possible regulators, suggesting that another signaling pathway was involved in the downregulation of CD147. This is the first study to show the downregulation of CD147 by Ad-REIC in prostate cancer cells. At least some of the therapeutic effects of Ad-REIC may be due to the downregulation of the cancer-progression factor, CD147.

Evidence that noncoding RNA dutA is a multicopy suppressor of Dictyostelium discoideum STAT protein Dd-STATa.

PubMed

Shimada, Nao; Kawata, Takefumi

2007-06-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism.

Evidence that Noncoding RNA dutA Is a Multicopy Suppressor of Dictyostelium discoideum STAT Protein Dd-STATa▿

PubMed Central

Shimada, Nao; Kawata, Takefumi

2007-01-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism. PMID:17435008

Drosophila SLC22A transporter is a memory suppressor gene that influences cholinergic neurotransmission to the mushroom bodies

PubMed Central

Gai, Yunchao; Liu, Ze; Cervantes-Sandoval, Isaac; Davis, Ronald L.

2016-01-01

SUMMARY The mechanisms that constrain memory formation are of special interest because they provide insights into the brain’s memory management systems and potential avenues for correcting cognitive disorders. RNAi knockdown in the Drosophila mushroom body neurons (MBn) of a newly discovered memory suppressor gene, Solute Carrier DmSLC22A, a member of the organic cation transporter family, enhances olfactory memory expression, while overexpression inhibits it. The protein localizes to the dendrites of the MBn, surrounding the presynaptic terminals of cholinergic afferent fibers from projection neurons (Pn). Cell-based expression assays show that this plasma membrane protein transports cholinergic compounds with the highest affinity among several in vitro substrates. Feeding flies choline or inhibiting acetylcholinesterase in Pn enhances memory; an effect blocked by overexpression of the transporter in the MBn. The data argue that DmSLC22A is a memory suppressor protein that limits memory formation by helping to terminate cholinergic neurotransmission at the Pn:MBn synapse. PMID:27146270

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

PubMed Central

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

miRNA Involved in Six1-Induced Breast Cancer

DTIC Science & Technology

2013-05-01

populations7. Interestingly, we have also demonstrated that Six1 is capable of switching TGFβ from a tumor suppressor to a tumor promoter9, however the...may be the mechanism by which Six1 switches TGFβ signaling from a tumor suppressor to a tumor promoter. In addition we also sought to determine if...signaling from a tumor suppressor to a tumor promoter, this is known as the TGFβ paradox. Previous research has described the miR106b-25 cluster as

The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas.

PubMed

Sunaoshi, Masaaki; Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J; Morioka, Takamitsu; Kaminishi, Mutsumi; Shang, Yi; Nishimura, Mayumi; Shimada, Yoshiya; Tachibana, Akira; Kakinuma, Shizuko

2015-09-01

Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2a and Ikaros are a prominent feature of young adult irradiation-induced T-cell lymphoma, tumors arising after irradiation from infancy suffer a second hit in Pten by mis-segregation or recombination. This is the first report showing an influence of age-at-exposure on genomic alterations of tumor suppressor genes and their relative involvement in radiation-induced T-cell lymphoma. These data are important for considering the risks associated with childhood exposure to radiation. Copyright © 2015 Elsevier B.V. All rights reserved.

Detection of doublecortin domain-containing 2 (DCDC2), a new candidate tumor suppressor gene of hepatocellular carcinoma, by triple combination array analysis

PubMed Central

2013-01-01

Background To detect genes correlated with hepatocellular carcinoma (HCC), we developed a triple combination array consisting of methylation array, gene expression array and single nucleotide polymorphism (SNP) array analysis. Methods A surgical specimen obtained from a 68-year-old female HCC patient was analyzed by triple combination array, which identified doublecortin domain-containing 2 (DCDC2) as a candidate tumor suppressor gene of HCC. Subsequently, samples from 48 HCC patients were evaluated for their DCDC2 methylation and expression status using methylation specific PCR (MSP) and semi-quantitative reverse transcriptase (RT) PCR, respectively. Then, we investigated the relationship between clinicopathological factors and methylation status of DCDC2. Results DCDC2 was revealed to be hypermethylated (methylation value 0.846, range 0–1.0) in cancer tissue, compared with adjacent normal tissue (0.212) by methylation array in the 68-year-old female patient. Expression array showed decreased expression of DCDC2 in cancerous tissue. SNP array showed that the copy number of chromosome 6p22.1, in which DCDC2 resides, was normal. MSP revealed hypermethylation of the promoter region of DCDC2 in 41 of the tumor samples. DCDC2 expression was significantly decreased in the cases with methylation (P = 0.048). Furthermore, the methylated cases revealed worse prognosis for overall survival than unmethylated cases (P = 0.048). Conclusions The present study indicates that triple combination array is an effective method to detect novel genes related to HCC. We propose that DCDC2 is a tumor suppressor gene of HCC. PMID:24034596

Overexpression of Klotho suppresses liver cancer progression and induces cell apoptosis by negatively regulating wnt/β-catenin signaling pathway.

PubMed

Sun, Huidong; Gao, Yanchao; Lu, Kemei; Zhao, Guimei; Li, Xuehua; Li, Zhu; Chang, Hong

2015-10-24

Klotho is a discovered aging suppressor gene, and its overexpression in mice extends the life span of the animal. Recently, Klotho is also identified as a tumor suppressor gene in variety of tumors; however, the potential role and the antitumor mechanism remain unclarified in liver cancers. RT-PCR and western blotting analysis were used to detect the expression of Klotho, β-catenin, C-myc, and Cyclin D1. MTT assay was used to detect the survival rates of HepG2 and SMMC-7721 cells. Colony formation assay was used to test the proliferation ability in Klotho transfected cells. FACS was used to detect the cell apoptosis rate in different groups. The results showed that lower expression of Klotho were found in liver cancer cell lines than the immortalized liver cell L02. Also, MTT assay results found that overexpression or recombinant Klotho administration suppressed the proliferation of liver cancer cells HepG2 and SMMC-7721. Moreover, the colony formation assay results showed that the number of colonies was significantly lower in the cells with transfection with pCMV-Klotho than the controls. Thus, functional analysis demonstrated that Klotho expression inhibited the proliferation of liver cancer cells and Klotho worked as an important antitumor gene in tumor progression. Next, the mechanism was partly clarified that Klotho expression induced cell apoptosis in HepG2 and SMMC-7721 cells, and this phenomenon was mainly involved in the Wnt/β-catenin signaling pathway. The western blotting analysis revealed that overexpression or recombinant administration of Klotho obviously decreased the expression levels of β-catenin, C-myc, and Cyclin D1 in HepG2 cells. Most importantly, the antitumor mechanism for Klotho due to that overexpression of Klotho not only decreased the endogenous β-catenin levels but also inhibited the nuclear translocation of β-catenin to delay the cell cycle progression. Klotho was a tumor suppressor gene, and overexpression of Klotho suppressed the proliferation of liver cancer cells partly due to negative regulation of Wnt/β-catenin signaling pathway. So, Klotho might be used as a potential target, and the study will contribute to treatment for therapy of liver cancer patients.

Suppressor of sable [Su(s)] and Wdr82 down-regulate RNA from heat-shock-inducible repetitive elements by a mechanism that involves transcription termination

PubMed Central

Brewer-Jensen, Paul; Wilson, Carrie B.; Abernethy, John; Mollison, Lonna; Card, Samantha

2016-01-01

Although RNA polymerase II (Pol II) productively transcribes very long genes in vivo, transcription through extragenic sequences often terminates in the promoter-proximal region and the nascent RNA is degraded. Mechanisms that induce early termination and RNA degradation are not well understood in multicellular organisms. Here, we present evidence that the suppressor of sable [su(s)] regulatory pathway of Drosophila melanogaster plays a role in this process. We previously showed that Su(s) promotes exosome-mediated degradation of transcripts from endogenous repeated elements at an Hsp70 locus (Hsp70-αβ elements). In this report, we identify Wdr82 as a component of this process and show that it works with Su(s) to inhibit Pol II elongation through Hsp70-αβ elements. Furthermore, we show that the unstable transcripts produced during this process are polyadenylated at heterogeneous sites that lack canonical polyadenylation signals. We define two distinct regions that mediate this regulation. These results indicate that the Su(s) pathway promotes RNA degradation and transcription termination through a novel mechanism. PMID:26577379

A sex-ratio meiotic drive system in Drosophila simulans. II: an X-linked distorter.

PubMed

Tao, Yun; Araripe, Luciana; Kingan, Sarah B; Ke, Yeyan; Xiao, Hailian; Hartl, Daniel L

2007-11-06

The evolution of heteromorphic sex chromosomes creates a genetic condition favoring the invasion of sex-ratio meiotic drive elements, resulting in the biased transmission of one sex chromosome over the other, in violation of Mendel's first law. The molecular mechanisms of sex-ratio meiotic drive may therefore help us to understand the evolutionary forces shaping the meiotic behavior of the sex chromosomes. Here we characterize a sex-ratio distorter on the X chromosome (Dox) in Drosophila simulans by genetic and molecular means. Intriguingly, Dox has very limited coding capacity. It evolved from another X-linked gene, which also evolved de nova. Through retrotransposition, Dox also gave rise to an autosomal suppressor, not much yang (Nmy). An RNA interference mechanism seems to be involved in the suppression of the Dox distorter by the Nmy suppressor. Double mutant males of the genotype dox; nmy are normal for both sex-ratio and spermatogenesis. We postulate that recurrent bouts of sex-ratio meiotic drive and its subsequent suppression might underlie several common features observed in the heterogametic sex, including meiotic sex chromosome inactivation and achiasmy.

Tombusvirus-based vector systems to permit over-expression of genes or that serve as sensors of antiviral RNA silencing in plants.

PubMed

Shamekova, Malika; Mendoza, Maria R; Hsieh, Yi-Cheng; Lindbo, John; Omarov, Rustem T; Scholthof, Herman B

2014-03-01

A next generation Tomato bushy stunt virus (TBSV) coat protein gene replacement vector system is described that can be applied by either RNA inoculation or through agroinfiltration. A vector expressing GFP rapidly yields high levels of transient gene expression in inoculated leaves of various plant species, as illustrated for Nicotiana benthamiana, cowpea, tomato, pepper, and lettuce. A start-codon mutation to down-regulate the dose of the P19 silencing suppressor reduces GFP accumulation, whereas mutations that result in undetectable levels of P19 trigger rapid silencing of GFP. Compared to existing virus vectors the TBSV system has a unique combination of a very broad host range, rapid and high levels of replication and gene expression, and the ability to regulate its suppressor. These features are attractive for quick transient assays in numerous plant species for over-expression of genes of interest, or as a sensor to monitor the efficacy of antiviral RNA silencing. Copyright © 2014. Published by Elsevier Inc.

SIRT3 is a Mitochondrial Tumor Suppressor and Genetic Loss Results in a Murine Model for ER/PR-Positive Mammary Tumors Connecting Metabolism and Carcinogenesis Mitochondrial Tumor Suppressor. Revision

DTIC Science & Technology

2013-11-01

dependent gene expression, as shown by co-transfection assays using an HRE luciferase reporter (Fig. 4b, bar 1 vs. 2). In addition, exposure to NAC...transfected with p3x- HRE -luciferase with or without NAC or stigmatellin and 40 hours afterwards luciferase levels were determined. (c) MTCLT3

VHL and Hypoxia Signaling: Beyond HIF in Cancer

PubMed Central

Zhang, Jing

2018-01-01

Von Hippel-Lindau (VHL) is an important tumor suppressor that is lost in the majority of clear cell carcinoma of renal cancer (ccRCC). Its regulatory pathway involves the activity of E3 ligase, which targets hypoxia inducible factor α (including HIF1α and HIF2α) for proteasome degradation. In recent years, emerging literature suggests that VHL also possesses other HIF-independent functions. This review will focus on VHL-mediated signaling pathways involving the latest identified substrates/binding partners, including N-Myc downstream-regulated gene 3 (NDRG3), AKT, and G9a, etc., and their physiological roles in hypoxia signaling and cancer. We will also discuss the crosstalk between VHL and NF-κB signaling. Lastly, we will review the latest findings on targeting VHL signaling in cancer. PMID:29562667

The Promiscuous sumA Missense Suppressor from Salmonella enterica Has an Intriguing Mechanism of Action

PubMed Central

Cole, Ashley E.; Hani, Fatmah M.; Altman, Ronni; Meservy, Megan; Roth, John R.; Altman, Elliot

2017-01-01

While most missense suppressors have very narrow specificities and only suppress the allele against which they were isolated, the sumA missense suppressor from Salmonella enterica serovar Typhimurium is a promiscuous or broad-acting missense suppressor that suppresses numerous missense mutants. The sumA missense suppressor was identified as a glyV tRNA Gly3(GAU/C) missense suppressor that can recognize GAU or GAC aspartic acid codons and insert a glycine amino acid instead of aspartic acid. In addition to rescuing missense mutants caused by glycine to aspartic acid changes as expected, sumA could also rescue a number of other missense mutants as well by changing a neighboring (contacting) aspartic acid to glycine, which compensated for the other amino acid change. Thus the ability of sumA to rescue numerous missense mutants was due in part to the large number of glycine codons in genes that can be mutated to an aspartic acid codon and in part to the general tolerability and/or preference for glycine amino acids in proteins. Because the glyV tRNA Gly3(GAU/C) missense suppressor has also been extensively characterized in Escherichia coli as the mutA mutator, we demonstrated that all gain-of-function mutants isolated in a glyV tRNA Gly3(GAU/C) missense suppressor are transferable to a wild-type background and thus the increased mutation rates, which occur in glyV tRNA Gly3(GAU/C) missense suppressors, are not due to the suppression of these mutants. PMID:27974497

Aryl Hydrocarbon Receptor Plays Protective Roles against High Fat Diet (HFD)-induced Hepatic Steatosis and the Subsequent Lipotoxicity via Direct Transcriptional Regulation of Socs3 Gene Expression*

PubMed Central

Wada, Taira; Sunaga, Hiroshi; Miyata, Kazuki; Shirasaki, Haruno; Uchiyama, Yuki; Shimba, Shigeki

2016-01-01

Aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor regulating the expression of genes involved in xenobiotic response. Recent studies have suggested that AhR plays essential roles not only in xenobiotic detoxification but also energy metabolism. Thus, in this study, we studied the roles of AhR in lipid metabolism. Under high fat diet (HFD) challenge, liver-specific AhR knock-out (AhR LKO) mice exhibited severe steatosis, inflammation, and injury in the liver. Gene expression analysis and biochemical study revealed that de novo lipogenesis activity was significantly increased in AhR LKO mice. In contrast, induction of suppressor of cytokine signal 3 (Socs3) expression by HFD was attenuated in the livers of AhR LKO mice. Rescue of the Socs3 gene in the liver of AhR LKO mice cancelled the HFD-induced hepatic lipotoxicities. Promoter analysis established Socs3 as novel transcriptional target of AhR. These results indicated that AhR plays a protective role against HFD-induced hepatic steatosis and the subsequent lipotoxicity effects, such as inflammation, and that the mechanism of protection involves the direct transcriptional regulation of Socs3 expression by AhR. PMID:26865635

DNA methylation of ESR-1 and N-33 in colorectal mucosa of patients with ulcerative colitis (UC).

PubMed

Arasaradnam, Ramesh P; Khoo, Kevin; Bradburn, Mike; Mathers, John C; Kelly, Seamus B

2010-07-01

Epigenetic marking such as DNA methylation influence gene transcription and chromosomal stability and may also be affected by environmental exposures. Few studies exist on alteration in DNA methylation profiles (genomic and gene specific methylation) in patients with Ulcerative Colitis (UC) and no studies exist that assess its relationship with lifestyle exposures. The methylation level of both ESR-1 and N-33 genes were significantly higher in UC subjects compared with controls (7.9% vs. 5.9%; p = 0.015 and 66% vs. 9.3%; p < 0.001 respectively). There was no detectable difference in global DNA methylation between patients with UC and age and sex matched controls. No associations between indices of DNA methylation and anthropometric measures or smoking patterns were detected. To assess genomic methylation and promoter methylation of the ESR-1 (oestrogen receptor-1) and N-33 (tumor suppressor candidate-3) genes in the macroscopically normal mucosa of UC patients as well as to investigate effects of anthropometric and lifestyle exposures on DNA methylation. Sixty eight subjects were recruited (24 UC and 44 age and sex matched controls). Colorectal mucosal biopsies were obtained and DNA was extracted. Genomic DNA methylation was quantified using the tritium-labelled cytosine extension assay (3[H] dCTP) while gene specific methylation was quantified using the COBRA method. For the first time, we have shown increased methylation in the promoter regions of the putative tumor suppressor gene N-33 in macroscopically normal mucosa of patients with UC. In addition, we have confirmed that methylation of ESR-1 promoter is higher in UC patients compared with age and sex matched controls. These findings suggest that inactivation through methylation of the putative tumor suppressor genes N-33 and ESR-1 may not be associated with colorectal carcinogenesis in UC.

Characterization of the gene encoding pinin/DRS/memA and evidence for its potential tumor suppressor function.

PubMed

Shi, Y; Ouyang, P; Sugrue, S P

2000-01-13

Several cell adhesion-related proteins have been shown to act as tumor-suppressors (TS) in the neoplastic progression of epithelial-derived tumors. Pinin/DRS/memA was first identified in our laboratory and it was shown to be a cell adhesion-related molecule. Our previous study demonstrated that restoration of pinin expression in transformed cells not only positively influenced cellular adhesive properties but also reversed the transformed phenotype to more epithelial-like. Here, we show by FISH analysis that the gene locus for pinin is within 14q13. The alignment of the pinin gene with STS markers localized the gene to the previously identified TS locus D14S75-D14S288. Northern analyses revealed diminished pinin mRNA in renal cell carcinomas (RCC) and certain cancer cell lines. Immunohistochemical examination of tumor samples demonstrated absent or greatly reduced pinin in transitional cell carcinoma (TCC) and RCC tumors. TCC-derived J82 cells as well as EcR-293 cells transfected with full-length pinin cDNA demonstrated inhibition of anchorage-independent growth of cells in soft agar. Furthermore, methylation analyses revealed that aberrant methylation of pinin CpG islands was correlated with decreased/absent pinin expression in a subset of tumor tissues. These data lend significant support to the hypothesis that pinin/DRS/memA may act as a tumor suppressor in certain types of cancers.

Differential gene expression pattern in human mammary epithelial cells induced by realistic organochlorine mixtures described in healthy women and in women diagnosed with breast cancer.

PubMed

Rivero, Javier; Henríquez-Hernández, Luis Alberto; Luzardo, Octavio P; Pestano, José; Zumbado, Manuel; Boada, Luis D; Valerón, Pilar F

2016-03-30

Organochlorine pesticides (OCs) have been associated with breast cancer development and progression, but the mechanisms underlying this phenomenon are not well known. In this work, we evaluated the effects exerted on normal human mammary epithelial cells (HMEC) by the OC mixtures most frequently detected in healthy women (H-mixture) and in women diagnosed with breast cancer (BC-mixture), as identified in a previous case-control study developed in Spain. Cytotoxicity and gene expression profile of human kinases (n=68) and non-kinases (n=26) were tested at concentrations similar to those described in the serum of those cases and controls. Although both mixtures caused a down-regulation of genes involved in the ATP binding process, our results clearly indicate that both mixtures may exert a very different effect on the gene expression profile of HMEC. Thus, while BC-mixture up-regulated the expression of oncogenes associated to breast cancer (GFRA1 and BHLHB8), the H-mixture down-regulated the expression of tumor suppressor genes (EPHA4 and EPHB2). Our results indicate that the composition of the OC mixture could play a role in the initiation processes of breast cancer. In addition, the present results suggest that subtle changes in the composition and levels of pollutants involved in environmentally relevant mixtures might induce very different biological effects, which explain, at least partially, why some mixtures seem to be more carcinogenic than others. Nonetheless, our findings confirm that environmentally relevant pollutants may modulate the expression of genes closely related to carcinogenic processes in the breast, reinforcing the role exerted by environment in the regulation of genes involved in breast carcinogenesis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Identification and characterization of suppressors of plant cell death (SPD) effectors from Magnaporthe oryzae.

PubMed

Sharpee, William; Oh, Yeonyee; Yi, Mihwa; Franck, William; Eyre, Alex; Okagaki, Laura H; Valent, Barbara; Dean, Ralph A

2017-08-01

Phytopathogenic microorganisms, including the fungal pathogen Magnaporthe oryzae, secrete a myriad of effector proteins to facilitate infection. Utilizing the transient expression of candidate effectors in the leaves of the model plant Nicotiana benthamiana, we identified 11 suppressors of plant cell death (SPD) effectors from M. oryzae that were able to block the host cell death reaction induced by Nep1. Ten of these 11 were also able to suppress BAX-mediated plant cell death. Five of the 11 SPD genes have been identified previously as either essential for the pathogenicity of M. oryzae, secreted into the plant during disease development, or as suppressors or homologues of other characterized suppressors. In addition, of the remaining six, we showed that SPD8 (previously identified as BAS162) was localized to the rice cytoplasm in invaded and surrounding uninvaded cells during biotrophic invasion. Sequence analysis of the 11 SPD genes across 43 re-sequenced M. oryzae genomes revealed that SPD2, SPD4 and SPD7 have nucleotide polymorphisms amongst the isolates. SPD4 exhibited the highest level of nucleotide diversity of any currently known effector from M. oryzae in addition to the presence/absence polymorphisms, suggesting that this gene is potentially undergoing selection to avoid recognition by the host. Taken together, we have identified a series of effectors, some of which were previously unknown or whose function was unknown, that probably act at different stages of the infection process and contribute to the virulence of M. oryzae. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santhanam, U.; Ray, A.; Sehgal, P.B.

1991-09-01

The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

A Novel Method for Gene-Specific Enhancement of Protein Translation by Targeting 5’UTRs of Selected Tumor Suppressors

PubMed Central

Master, Adam; Wójcicka, Anna; Giżewska, Kamilla; Popławski, Piotr; Williams, Graham R.; Nauman, Alicja

2016-01-01

Background Translational control is a mechanism of protein synthesis regulation emerging as an important target for new therapeutics. Naturally occurring microRNAs and synthetic small inhibitory RNAs (siRNAs) are the most recognized regulatory molecules acting via RNA interference. Surprisingly, recent studies have shown that interfering RNAs may also activate gene transcription via the newly discovered phenomenon of small RNA-induced gene activation (RNAa). Thus far, the small activating RNAs (saRNAs) have only been demonstrated as promoter-specific transcriptional activators. Findings We demonstrate that oligonucleotide-based trans-acting factors can also specifically enhance gene expression at the level of protein translation by acting at sequence-specific targets within the messenger RNA 5’-untranslated region (5’UTR). We designed a set of short synthetic oligonucleotides (dGoligos), specifically targeting alternatively spliced 5’UTRs in transcripts expressed from the THRB and CDKN2A suppressor genes. The in vitro translation efficiency of reporter constructs containing alternative TRβ1 5’UTRs was increased by up to more than 55-fold following exposure to specific dGoligos. Moreover, we found that the most folded 5’UTR has higher translational regulatory potential when compared to the weakly folded TRβ1 variant. This suggests such a strategy may be especially applied to enhance translation from relatively inactive transcripts containing long 5’UTRs of complex structure. Significance This report represents the first method for gene-specific translation enhancement using selective trans-acting factors designed to target specific 5’UTR cis-acting elements. This simple strategy may be developed further to complement other available methods for gene expression regulation including gene silencing. The dGoligo-mediated translation-enhancing approach has the potential to be transferred to increase the translation efficiency of any suitable target gene and may have future application in gene therapy strategies to enhance expression of proteins including tumor suppressors. PMID:27171412

Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, W.C.; Stanford, D.R.; Hopper, A.K.

1996-06-01

To understand the role of Los1p in pre-tRNA splicing, we sought los1 multicopy suppressors. We found SOL1 that suppresses both point and null LOS1 mutations. Since, when fused to the Gal4p DNA-binding domain, Los1p activates transcription, we tested whether Los1p regulates SOL1. We found that los1 mutants have depleted levels of SOL1 mRNA and Sol1p. Thus, LOS1 appears to positively regulate SOL1. SOL1 belongs to a multigene family with at least two additional members, SOL2 and SOL3. Sol proteins have extensive similarity to an unusual group of glucose-6-phosphate dehydrogenases (G6PDs). As the similarities are restricted to areas separate from themore » catalytic domain, these G6PDs may have more than one function. The SOL gene disruptions negatively affect tRNA-mediated nonsense suppression and the severity increases with the number of mutant SOL genes. However, tRNA levels do not vary with either multicopy SOL genes or with SOL disruptions. Therefore, the Sol proteins affect tRNA expression/function at steps other than transcription or splicing. We propose that LOS1 regulates gene products involved in tRNA expression/function as well as pre-tRNA splicing. 64 refs., 6 figs., 6 tabs.« less

Induced DNA demethylation by targeting Ten-Eleven Translocation 2 to the human ICAM-1 promoter

PubMed Central

Chen, Hui; Kazemier, Hinke G; de Groote, Marloes L.; Ruiters, Marcel H. J.; Xu, Guo-Liang; Rots, Marianne G.

2014-01-01

Increasing evidence indicates that active DNA demethylation is involved in several processes in mammals, resulting in developmental stage-specificity and cell lineage-specificity. The recently discovered Ten-Eleven Translocation (TET) dioxygenases are accepted to be involved in DNA demethylation by initiating 5-mC oxidation. Aberrant DNA methylation profiles are associated with many diseases. For example in cancer, hypermethylation results in silencing of tumor suppressor genes. Such silenced genes can be re-expressed by epigenetic drugs, but this approach has genome-wide effects. In this study, fusions of designer DNA binding domains to TET dioxygenase family members (TET1, -2 or -3) were engineered to target epigenetically silenced genes (ICAM-1, EpCAM). The effects on targeted CpGs’ methylation and on expression levels of the target genes were assessed. The results indicated demethylation of targeted CpG sites in both promoters for targeted TET2 and to a lesser extent for TET1, but not for TET3. Interestingly, we observed re-activation of transcription of ICAM-1. Thus, our work suggests that we provided a mechanism to induce targeted DNA demethylation, which facilitates re-activation of expression of the target genes. Furthermore, this Epigenetic Editing approach is a powerful tool to investigate functions of epigenetic writers and erasers and to elucidate consequences of epigenetic marks. PMID:24194590

Expression of Hormonal Carcinogenesis Genes and Related Regulatory microRNAs in Uterus and Ovaries of DDT-Treated Female Rats.

PubMed

Kalinina, T S; Kononchuk, V V; Gulyaeva, L F

2017-10-01

The insecticide dichlorodiphenyltrichloroethane (DDT) is a nonmutagenic xenobiotic compound able to exert estrogen-like effects resulting in activation of estrogen receptor-α (ERα) followed by changed expression of its downstream target genes. In addition, studies performed over recent years suggest that DDT may also influence expression of microRNAs. However, an impact of DDT on expression of ER, microRNAs, and related target genes has not been fully elucidated. Here, using real-time PCR, we assessed changes in expression of key genes involved in hormonal carcinogenesis as well as potentially related regulatory oncogenic/tumor suppressor microRNAs and their target genes in the uterus and ovaries of female Wistar rats during single and chronic multiple-dose DDT exposure. We found that applying DDT results in altered expression of microRNAs-221, -222, -205, -126a, and -429, their target genes (Pten, Dicer1), as well as genes involved in hormonal carcinogenesis (Esr1, Pgr, Ccnd1, Cyp19a1). Notably, Cyp19a1 expression seems to be also regulated by microRNAs-221, -222, and -205. The data suggest that epigenetic effects induced by DDT as a potential carcinogen may be based on at least two mechanisms: (i) activation of ERα followed by altered expression of the target genes encoding receptor Pgr and Ccnd1 as well as impaired expression of Cyp19a1, affecting, thereby, cell hormone balance; and (ii) changed expression of microRNAs resulting in impaired expression of related target genes including reduced level of Cyp19a1 mRNA.

Electric pulses used in electrochemotherapy and electrogene therapy do not significantly change the expression profile of genes involved in the development of cancer in malignant melanoma cells

PubMed Central

2009-01-01

Background Electroporation is a versatile method for in vitro or in vivo delivery of different molecules into cells. However, no study so far has analysed the effects of electric pulses used in electrochemotherapy (ECT pulses) or electric pulses used in electrogene therapy (EGT pulses) on malignant cells. We studied the effect of ECT and EGT pulses on human malignant melanoma cells in vitro in order to understand and predict the possible effect of electric pulses on gene expression and their possible effect on cell behaviour. Methods We used microarrays with 2698 different oligonucleotides to obtain the expression profile of genes involved in apoptosis and cancer development in a malignant melanoma cell line (SK-MEL28) exposed to ECT pulses and EGT pulses. Results Cells exposed to ECT pulses showed a 68.8% average survival rate, while cells exposed to EGT pulses showed a 31.4% average survival rate. Only seven common genes were found differentially expressed in cells 16 h after exposure to ECT and EGT pulses. We found that ECT and EGT pulses induce an HSP70 stress response mechanism, repress histone protein H4, a major protein involved in chromatin assembly, and down-regulate components involved in protein synthesis. Conclusion Our results show that electroporation does not significantly change the expression profile of major tumour suppressor genes or oncogenes of the cell cycle. Moreover, electroporation also does not changes the expression of genes involved in the stability of DNA, supporting current evidence that electroporation is a safe method that does not promote tumorigenesis. However, in spite of being considered an isothermal method, it does to some extent induce stress, which resulted in the expression of the environmental stress response mechanism, HSP70. PMID:19709437

Biochemical and Functional Interactions of Human Papillomavirus Proteins with Polycomb Group Proteins

PubMed Central

McLaughlin-Drubin, Margaret E.; Munger, Karl

2013-01-01

The role of enzymes involved in polycomb repression of gene transcription has been studied extensively in human cancer. Polycomb repressive complexes mediate oncogene-induced senescence, a principal innate cell-intrinsic tumor suppressor pathway that thwarts expansion of cells that have suffered oncogenic hits. Infections with human cancer viruses including human papillomaviruses (HPVs) and Epstein-Barr virus can trigger oncogene-induced senescence, and the viruses have evolved strategies to abrogate this response in order to establish an infection and reprogram their host cells to establish a long-term persistent infection. As a consequence of inhibiting polycomb repression and evading oncogene induced-senescence, HPV infected cells have an altered epigenetic program as evidenced by aberrant homeobox gene expression. Similar alterations are frequently observed in non-virus associated human cancers and may be harnessed for diagnosis and therapy. PMID:23673719

MicroRNA in Metabolic Re-Programming and Their Role in Tumorigenesis

PubMed Central

Tomasetti, Marco; Amati, Monica; Santarelli, Lory; Neuzil, Jiri

2016-01-01

The process of metabolic re-programing is linked to the activation of oncogenes and/or suppression of tumour suppressor genes, which are regulated by microRNAs (miRNAs). The interplay between oncogenic transformation-driven metabolic re-programming and modulation of aberrant miRNAs further established their critical role in the initiation, promotion and progression of cancer by creating a tumorigenesis-prone microenvironment, thus orchestrating processes of evasion to apoptosis, angiogenesis and invasion/migration, as well metastasis. Given the involvement of miRNAs in tumour development and their global deregulation, they may be perceived as biomarkers in cancer of therapeutic relevance. PMID:27213336

The RasGAP Gene, RASAL2, is a Tumor and Metastasis Suppressor

PubMed Central

McLaughlin, Sara Koenig; Olsen, Sarah Naomi; Dake, Benjamin; De Raedt, Thomas; Lim, Elgene; Bronson, Roderick Terry; Beroukhim, Rameen; Polyak, Kornelia; Brown, Myles; Kuperwasser, Charlotte; Cichowski, Karen

2013-01-01

SUMMARY RAS genes are commonly mutated in cancer; however, RAS mutations are rare in breast cancer, despite the fact that Ras and ERK are frequently hyperactivated. Here we report that the RasGAP gene, RASAL2, functions as a tumor and metastasis suppressor. RASAL2 is mutated or suppressed in human breast cancer and RASAL2 ablation promotes tumor growth, progression, and metastasis in mouse models. In human breast cancer RASAL2-loss is associated with metastatic disease, low RASAL2 levels correlate with recurrence of luminal B tumors, and RASAL2 ablation promotes metastasis of luminal mouse tumors. Additional data reveal a broader role for RASAL2 inactivation in other tumor-types. These studies highlight the expanding role of RasGAPs and reveal an alternative mechanism of activating Ras in cancer. PMID:24029233

A complex interaction of imprinted and maternal-effect genes modifies sex determination in Odd Sex (Ods) mice.

PubMed

Poirier, Christophe; Qin, Yangjun; Adams, Carolyn P; Anaya, Yanett; Singer, Jonathan B; Hill, Annie E; Lander, Eric S; Nadeau, Joseph H; Bishop, Colin E

2004-11-01

The transgenic insertional mouse mutation Odd Sex (Ods) represents a model for the long-range regulation of Sox9. The mutation causes complete female-to-male sex reversal by inducing a male-specific expression pattern of Sox9 in XX Ods/+ embryonic gonads. We previously described an A/J strain-specific suppressor of Ods termed Odsm1(A). Here we show that phenotypic sex depends on a complex interaction between the suppressor and the transgene. Suppression can be achieved only if the transgene is transmitted paternally. In addition, the suppressor itself exhibits a maternal effect, suggesting that it may act on chromatin in the early embryo.

A Complex Interaction of Imprinted and Maternal-Effect Genes Modifies Sex Determination in Odd Sex (Ods) Mice

PubMed Central

Poirier, Christophe; Qin, Yangjun; Adams, Carolyn P.; Anaya, Yanett; Singer, Jonathan B.; Hill, Annie E.; Lander, Eric S.; Nadeau, Joseph H.; Bishop, Colin E.

2004-01-01

The transgenic insertional mouse mutation Odd Sex (Ods) represents a model for the long-range regulation of Sox9. The mutation causes complete female-to-male sex reversal by inducing a male-specific expression pattern of Sox9 in XX Ods/+ embryonic gonads. We previously described an A/J strain-specific suppressor of Ods termed Odsm1A. Here we show that phenotypic sex depends on a complex interaction between the suppressor and the transgene. Suppression can be achieved only if the transgene is transmitted paternally. In addition, the suppressor itself exhibits a maternal effect, suggesting that it may act on chromatin in the early embryo. PMID:15579706

The Metastasis Suppressor, N-MYC Downstream-regulated Gene-1 (NDRG1), Down-regulates the ErbB Family of Receptors to Inhibit Downstream Oncogenic Signaling Pathways*

PubMed Central

Kovacevic, Zaklina; Menezes, Sharleen V.; Sahni, Sumit; Kalinowski, Danuta S.; Bae, Dong-Hun; Lane, Darius J. R.; Richardson, Des R.

2016-01-01

N-MYC downstream-regulated gene-1 (NDRG1) is a potent growth and metastasis suppressor that acts through its inhibitory effects on a wide variety of cellular signaling pathways, including the TGF-β pathway, protein kinase B (AKT)/PI3K pathway, RAS, etc. To investigate the hypothesis that its multiple effects could be regulated by a common upstream effector, the role of NDRG1 on the epidermal growth factor receptor (EGFR) and other members of the ErbB family, namely human epidermal growth factor receptor 2 (HER2) and human epidermal growth factor receptor 3 (HER3), was examined. We demonstrate that NDRG1 markedly decreased the expression and activation of EGFR, HER2, and HER3 in response to the epidermal growth factor (EGF) ligand, while also inhibiting formation of the EGFR/HER2 and HER2/HER3 heterodimers. In addition, NDRG1 also decreased activation of the downstream MAPKK in response to EGF. Moreover, novel anti-tumor agents of the di-2-pyridylketone class of thiosemicarbazones, namely di-2-pyridylketone 4,4-dimethyl-3-thiosemicarbazone and di-2-pyridylketone 4-cyclohexyl-4-methyl-3-thiosemicarbazone, which markedly up-regulate NDRG1, were found to inhibit EGFR, HER2, and HER3 expression and phosphorylation in cancer cells. However, the mechanism involved appeared dependent on NDRG1 for di-2-pyridylketone 4,4-dimethyl-3-thiosemicarbazone, but was independent of this metastasis suppressor for di-2-pyridylketone 4-cyclohexyl-4-methyl-3-thiosemicarbazone. This observation demonstrates that small structural changes in thiosemicarbazones result in marked alterations in molecular targeting. Collectively, these results reveal a mechanism for the extensive downstream effects on cellular signaling attributed to NDRG1. Furthermore, this study identifies a novel approach for the treatment of tumors resistant to traditional EGFR inhibitors. PMID:26534963

A Violaxanthin Deepoxidase Interacts with a Viral Suppressor of RNA Silencing to Inhibit Virus Amplification1[OPEN

PubMed Central

Chen, Ling; Yan, Zhaoling; Cheng, Yuqin; Jiao, Zhiyuan; Sun, Biao

2017-01-01

RNA silencing plays a critical role against viral infection. To counteract this antiviral silencing, viruses have evolved various RNA silencing suppressors. Meanwhile, plants have evolved counter-counter defense strategies against RNA silencing suppression (RSS). In this study, the violaxanthin deepoxidase protein of maize (Zea mays), ZmVDE, was shown to interact specifically with the helper component-proteinase (HC-Pro; a viral RNA silencing suppressor) of Sugarcane mosaic virus (SCMV) via its mature protein region by yeast two-hybrid assay, which was confirmed by coimmunoprecipitation in Nicotiana benthamiana cells. It was demonstrated that amino acids 101 to 460 in HC-Pro and the amino acid glutamine-292 in ZmVDE mature protein were essential for this interaction. The mRNA levels of ZmVDE were down-regulated 75% to 65% at an early stage of SCMV infection. Interestingly, ZmVDE, which normally localized in the chloroplasts and cytoplasm, could relocalize to HC-Pro-containing aggregate bodies in the presence of HC-Pro alone or SCMV infection. In addition, ZmVDE could attenuate the RSS activity of HC-Pro in a specific protein interaction-dependent manner. Subsequently, transient silencing of the ZmVDE gene facilitated SCMV RNA and coat protein accumulation. Taken together, our results suggest that ZmVDE interacts with SCMV HC-Pro and attenuates its RSS activity, contributing to decreased SCMV accumulation. This study demonstrates that a host factor can be involved in secondary defense responses against viral infection in monocot plants. PMID:29021224

IBR5 Modulates Temperature-Dependent, R Protein CHS3-Mediated Defense Responses in Arabidopsis.

PubMed

Liu, Jingyan; Yang, Haibian; Bao, Fei; Ao, Kevin; Zhang, Xiaoyan; Zhang, Yuelin; Yang, Shuhua

2015-10-01

Plant responses to low temperature are tightly associated with defense responses. We previously characterized the chilling-sensitive mutant chs3-1 resulting from the activation of the Toll and interleukin 1 receptor-nucleotide binding-leucine-rich repeat (TIR-NB-LRR)-type resistance (R) protein harboring a C-terminal LIM (Lin-11, Isl-1 and Mec-3 domains) domain. Here we report the identification of a suppressor of chs3, ibr5-7 (indole-3-butyric acid response 5), which largely suppresses chilling-activated defense responses. IBR5 encodes a putative dual-specificity protein phosphatase. The accumulation of CHS3 protein at chilling temperatures is inhibited by the IBR5 mutation. Moreover, chs3-conferred defense phenotypes were synergistically suppressed by mutations in HSP90 and IBR5. Further analysis showed that IBR5, with holdase activity, physically associates with CHS3, HSP90 and SGT1b (Suppressor of the G2 allele of skp1) to form a complex that protects CHS3. In addition to the positive role of IBR5 in regulating CHS3, IBR5 is also involved in defense responses mediated by R genes, including SNC1 (Suppressor of npr1-1, Constitutive 1), RPS4 (Resistance to P. syringae 4) and RPM1 (Resistance to Pseudomonas syringae pv. maculicola 1). Thus, the results of the present study reveal a role for IBR5 in the regulation of multiple R protein-mediated defense responses.

Lack of NF1 gene expression in a sporadic schwannoma from a patient without neurofibromatosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norton, K.K.; Dowton, B.; Silow-Santiago, I.

The neurofibromatosis type 1 (NF1) gene encodes a tumor suppressor protein, neurofibromin, which is expressed at high levels in Schwann cells and other adult tissues. Loss of NF1 gene expression has been reported in Schwann cell tumors (neurofibrosarcomas) from patients with NF1 and its loss is associated with increased proliferation of these cells. We examined one spinal schwannoma from a patient without clinical features of neurofibromatosis type 1 or 2. The tumor was a typical schwannoma confirmed by standard neuropathologic criteria and expressed S100 by immunocytochemistry. NF1 gene expression in this tumor was examined by in situ hybridization using anmore » NF1-specific riboprobe, Northern blot analysis and reverse-transcribed (RT) PCR. Little or no expression of NF1 RNA could be detected using these methods whereas abundant expression of S100, cyclophilin and beta-action RNA was found in the tumor. Fibroblast and Schwann cells were then individually cultured from this schwannoma and the RNA extracted for Northern blot and RT-PCR analysis. In these cultured Schwann cells both from early and late passages, abundant expression of NF1 RNA could be detected. It is unlikely that our culture technique preferentially expanded {open_quotes}normal{close_quotes} Schwann cells, since NF1 acts as a tumor suppressor gene and its presence would not confer any growth advantage over the tumor-derived, neurofibromin-negative Schwann cells which presumably have an increased proliferation rate. Similarly, the conditions used to expand these Schwann cells do not result in increased NF1 gene expression as shown in previous studies. These results suggest that, in some tumors, expression of the NF1 gene can be downregulated by factors produced within the tumor and that this type of tumor suppressor gene downregulation may represent another mechanism other than mutation for turning off the expression of these growth-suppressing genes and allowing for cell proliferation in tumors.« less

Modulation and Expression of Tumor Suppressor Genes by Environmental Agents.

DTIC Science & Technology

1996-12-01

were developed to evaluate alterations in the retinoblastoma gene in retinoblastoma and hepatocarcinomas following induction with known environmental...Tumors (3) Hepatocarcinomas (4) MRb-1 + + + + MRb-2 + + MRb-3 + + + + MRb-4 + + MRb-5 + + MRb-6 + + + + ** Studies in progress Figure 25. Screening of

Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene.

PubMed

Bardin, S D; Voegele, R T; Finan, T M

1998-08-01

Rhizobium meliloti mutants defective in the phoCDET-encoded phosphate transport system form root nodules on alfalfa plants that fail to fix nitrogen (Fix-). We have previously reported that two classes of second-site mutations can suppress the Fix- phenotype of phoCDET mutants to Fix+. Here we show that one of these suppressor loci (sfx1) contains two genes, orfA and pit, which appear to form an operon transcribed in the order orfA-pit. The Pit protein is homologous to various phosphate transporters, and we present evidence that three suppressor mutations arose from a single thymidine deletion in a hepta-thymidine sequence centered 54 nucleotides upstream of the orfA transcription start site. This mutation increased the level of orfA-pit transcription. These data, together with previous biochemical evidence, show that the orfA-pit genes encode a Pi transport system that is expressed in wild-type cells grown with excess Pi but repressed in cells under conditions of Pi limitation. In phoCDET mutant cells, orfA-pit expression is repressed, but this repression is alleviated by the second-site suppressor mutations. Suppression increases orfA-pit expression compensating for the deficiencies in phosphate assimilation and symbiosis of the phoCDET mutants.

A Genetic Analysis of the Suppressor 2 of Zeste Complex of Drosophila Melanogaster

PubMed Central

Wu, C. T.; Howe, M.

1995-01-01

The zeste(1) (z(1)) mutation of Drosophila melanogaster produces a mutant yellow eye color instead of the wild-type red. Genetic and molecular data suggest that z(1) achieves this change by altering expression of the wild-type white gene in a manner that exhibits transvection effects. There exist suppressor and enhancer mutations that modify the z(1) eye color, and this paper summarizes our studies of those belonging to the Suppressor 2 of zeste complex [Su(z)2-C]. The Su(z)2-C consists of at least three subregions called Psc (Posterior sex combs), Su(z)2 and Su(z)2D (Distal). The products of these subregions are proposed to act at the level of chromatin. Complementation analyses predict that the products are functionally similar and interacting. The alleles of Psc define two overlapping phenotypic classes, the hopeful and hapless. The distinctions between these two classes and the intragenic complementation seen among some of the Psc alleles are consistent with a multidomain structure for the product of Psc. Psc is a member of the homeotic Polycomb group of genes. A general discussion of the Polycomb and trithorax group of genes, position-effect variegation, transvection, chromosome pairing and chromatin structure is presented. PMID:7635282

Suppressor of gamma response 1 (SOG1) encodes a putative transcription factor governing multiple responses to DNA damage

PubMed Central

Yoshiyama, Kaoru; Conklin, Phillip A.; Huefner, Neil D.; Britt, Anne B.

2009-01-01

The Arabidopsis sog1-1 (suppressor of gamma response) mutant was originally isolated as a second-site suppressor of the radiosensitive phenotype of seeds defective in the repair endonuclease XPF. Here, we report that SOG1 encodes a putative transcription factor. This gene is a member of the NAC domain [petunia NAM (no apical meristem) and Arabidopsis ATAF1, 2 and CUC2] family (a family of proteins unique to land plants). Hundreds of genes are normally up-regulated in Arabidopsis within an hour of treatment with ionizing radiation; the induction of these genes requires the damage response protein kinase ATM, but not the related kinase ATR. Here, we find that SOG1 is also required for this transcriptional up-regulation. In contrast, the SOG1-dependent checkpoint response observed in xpf mutant seeds requires ATR, but does not require ATM. Thus, phenotype of the sog1-1 mutant mimics aspects of the phenotypes of both atr and atm mutants in Arabidopsis, suggesting that SOG1 participates in pathways governed by both of these sensor kinases. We propose that, in plants, signals related to genomic stress are processed through a single, central transcription factor, SOG1. PMID:19549833

Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family.

PubMed

Shen, W C; Stanford, D R; Hopper, A K

1996-06-01

To understand the role of Los1p in pre-tRNA splicing, we sought los1 multicopy suppressors. We found SOL1 that suppresses both point and null LOS1 mutations. Since, when fused to the Ga14p DNA-binding domain, Los1p activates transcription, we tested whether Los1p regulates SOL1. We found that las1 mutants have depleted levels of SOL1 mRNA and Sol1p. Thus, LOS1 appears to positively regulate SOL1. SOL1 belongs to a multigene family with at least two additional members, SOL2 and SOL3. Sol proteins have extensive similarity to an unusual group of glucose-6-phosphate dehydrogenases. As the similarities are restricted to areas separate from the catalytic domain, these G6PDs may have more than one function. The SOL family appears to be unessential since cells with a triple disruption of all three SOL genes are viable. SOL gene disruptions negatively affect tRNA-mediated nonsense suppression and the severity increases with the number of mutant SOL genes. However, tRNA levels do not vary with either multicopy SOL genes or with SOL disruptions. Therefore, the Sol proteins affect tRNA expression/ function at steps other than transcription or splicing. We propose that LOS1 regulates gene products involved in tRNA expression/function as well as pre-tRNA splicing.

Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

PubMed Central

Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

2015-01-01

In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

Functional characterization of EZH2β reveals the increased complexity of EZH2 isoforms involved in the regulation of mammalian gene expression

PubMed Central

2013-01-01

Background Histone methyltransferase enhancer of zeste homologue 2 (EZH2) forms an obligate repressive complex with suppressor of zeste 12 and embryonic ectoderm development, which is thought, along with EZH1, to be primarily responsible for mediating Polycomb-dependent gene silencing. Polycomb-mediated repression influences gene expression across the entire gamut of biological processes, including development, differentiation and cellular proliferation. Deregulation of EZH2 expression is implicated in numerous complex human diseases. To date, most EZH2-mediated function has been primarily ascribed to a single protein product of the EZH2 locus. Results We report that the EZH2 locus undergoes alternative splicing to yield at least two structurally and functionally distinct EZH2 methyltransferases. The longest protein encoded by this locus is the conventional enzyme, which we refer to as EZH2α, whereas EZH2β, characterized here, represents a novel isoform. We find that EZH2β localizes to the cell nucleus, complexes with embryonic ectoderm development and suppressor of zeste 12, trimethylates histone 3 at lysine 27, and mediates silencing of target promoters. At the cell biological level, we find that increased EZH2β induces cell proliferation, demonstrating that this protein is functional in the regulation of processes previously attributed to EZH2α. Biochemically, through the use of genome-wide expression profiling, we demonstrate that EZH2β governs a pattern of gene repression that is often ontologically redundant from that of EZH2α, but also divergent for a wide variety of specific target genes. Conclusions Combined, these results demonstrate that an expanded repertoire of EZH2 writers can modulate histone code instruction during histone 3 lysine 27-mediated gene silencing. These data support the notion that the regulation of EZH2-mediated gene silencing is more complex than previously anticipated and should guide the design and interpretation of future studies aimed at understanding the biochemical and biological roles of this important family of epigenomic regulators. PMID:23448518

Genetic Polymorphisms of Metastasis Suppressor Gene NME1 and Breast Cancer Survival

PubMed Central

Qu, Shimian; Long, Jirong; Cai, Qiuyin; Shu, Xiao-Ou; Cai, Hui; Gao, Yu-Tang; Zheng, Wei

2009-01-01

Purpose Ample evidence supports an important role of tumor metastasis suppressor genes in cancer metastatic processes. We evaluated the association of genetic polymorphisms of tumor metastasis suppressor gene NME1 with breast cancer prognosis in a follow-up study of patients with primary breast cancer and further investigated the functions of these polymorphisms. Experimental Design NME1 genotypes were analyzed in a cohort of 1134 breast cancer patients recruited as part of the Shanghai Breast Cancer Study who were followed for a median of 7.1 years. In vitro biochemical analyses were carried out to examine the function of NME1 gene polymorphisms. Results Single nucleotide polymorphisms (SNPs) in the promoter region of the NME1 gene were found to be associated with breast cancer prognosis. Patients carrying the C allele in rs16949649 were associated with higher breast cancer-specific mortality (HR =1.4, 95% CI =1.1–1.9) as compared to those carrying the wild-type allele, and the association was more evident in patients with an early stage cancer (HR=1.7, 95% CI =1.2–2.5). SNP rs2302254 was also associated with breast cancer prognosis, and the association was statistically significant for the risk of breast cancer relapse, metastasis, and death (HR=1.3, 95% CI, 1.0–1.6). In vitro biochemical analyses showed that minor alleles in rs2302254 and rs3760468, which is in strong linkage disequilibrium with rs16949646, altered nuclear proteins binding capacity and reduced NME1 promoter activity, supporting the results from an association study of these SNPs with breast cancer survival. Conclusion Promoter polymorphisms in the NME1 gene may alter its expression and influence breast cancer survival. PMID:18676749

Arabidopsis WRKY46, WRKY54, and WRKY70 Transcription Factors Are Involved in Brassinosteroid-Regulated Plant Growth and Drought Responses

PubMed Central

Chen, Jiani; Nolan, Trevor M.; Zhang, Mingcai; Tong, Hongning; Xin, Peiyong; Chu, Jinfang; Li, Zhaohu

2017-01-01

Plant steroid hormones, brassinosteroids (BRs), play important roles in growth and development. BR signaling controls the activities of BRASSINOSTERIOD INSENSITIVE1-EMS-SUPPRESSOR1/BRASSINAZOLE-RESISTANT1 (BES1/BZR1) family transcription factors. Besides the role in promoting growth, BRs are also implicated in plant responses to drought stress. However, the molecular mechanisms by which BRs regulate drought response have just begun to be revealed. The functions of WRKY transcription factors in BR-regulated plant growth have not been established, although their roles in stress responses are well documented. Here, we found that three Arabidopsis thaliana group III WRKY transcription factors, WRKY46, WRKY54, and WRKY70, are involved in both BR-regulated plant growth and drought response as the wrky46 wrky54 wrky70 triple mutant has defects in BR-regulated growth and is more tolerant to drought stress. RNA-sequencing analysis revealed global roles of WRKY46, WRKY54, and WRKY70 in promoting BR-mediated gene expression and inhibiting drought responsive genes. WRKY54 directly interacts with BES1 to cooperatively regulate the expression of target genes. In addition, WRKY54 is phosphorylated and destabilized by GSK3-like kinase BR-INSENSITIVE2, a negative regulator in the BR pathway. Our results therefore establish WRKY46/54/70 as important signaling components that are positively involved in BR-regulated growth and negatively involved in drought responses. PMID:28576847

ABERRANT SPLICING OF A BRAIN-ENRICHED ALTERNATIVE EXON ELIMINATES TUMOR SUPPRESSOR FUNCTION AND PROMOTES ONCOGENE FUNCTION DURING BRAIN TUMORIGENESIS

PubMed Central

Bredel, Markus; Ferrarese, Roberto; Harsh, Griffith R.; Yadav, Ajay K.; Bug, Eva; Maticzka, Daniel; Reichardt, Wilfried; Masilamani, Anie P.; Dai, Fangping; Kim, Hyunsoo; Hadler, Michael; Scholtens, Denise M.; Yu, Irene L.Y.; Beck, Jürgen; Srinivasasainagendra, Vinodh; Costa, Fabrizio; Baxan, Nicoleta; Pfeifer, Dietmar; Elverfeldt, Dominik v.; Backofen, Rolf; Weyerbrock, Astrid; Duarte, Christine W.; He, Xiaolin; Prinz, Marco; Chandler, James P.; Vogel, Hannes; Chakravarti, Arnab; Rich, Jeremy N.; Carro, Maria S.

2014-01-01

BACKGROUND: Tissue-specific alternative splicing is known to be critical to emergence of tissue identity during development, yet its role in malignant transformation is undefined. Tissue-specific splicing involves evolutionary-conserved, alternative exons, which represent only a minority of total alternative exons. Many, however, have functional features that influence activity in signaling pathways to profound biological effect. Given that tissue-specific splicing has a determinative role in brain development and the enrichment of genes containing tissue-specific exons for proteins with roles in signaling and development, it is thus plausible that changes in such exons could rewire normal neurogenesis towards malignant transformation. METHODS: We used integrated molecular genetic and cell biology analyses, computational biology, animal modeling, and clinical patient profiles to characterize the effect of aberrant splicing of a brain-enriched alternative exon in the membrane-binding tumor suppressor Annexin A7 (ANXA7) on oncogene regulation and brain tumorigenesis. RESULTS: We show that aberrant splicing of a tissue-specific cassette exon in ANXA7 diminishes endosomal targeting and consequent termination of the signal of the EGFR oncoprotein during brain tumorigenesis. Splicing of this exon is mediated by the ribonucleoprotein Polypyrimidine Tract-Binding Protein 1 (PTBP1), which is normally repressed during brain development but, we find, is excessively expressed in glioblastomas through either gene amplification or loss of a neuron-specific microRNA, miR-124. Silencing of PTBP1 attenuates both malignancy and angiogenesis in a stem cell-derived glioblastoma animal model characterized by a high native propensity to generate tumor endothelium or vascular pericytes to support tumor growth. We show that EGFR amplification and PTBP1 overexpression portend a similarly poor clinical outcome, further highlighting the importance of PTBP1-mediated activation of EGFR. CONCLUSIONS: Our data illustrate how anomalous splicing of a tissue-regulated exon in a constituent of an oncogenic signaling pathway eliminates its tumor suppressor function and promotes tumorigenesis. This paradigm of malignant glial transformation as a consequence of tissue-specific alternative exon splicing in a tumor suppressor, may have widespread applicability in explaining how changes in critical tissue-specific regulatory mechanisms reprogram normal development to oncogenesis. SECONDARY CATEGORY: n/a.

The RB-related gene Rb2/p130 in neuroblastoma differentiation and in B-myb promoter down-regulation.

PubMed

Raschellà, G; Tanno, B; Bonetto, F; Negroni, A; Claudio, P P; Baldi, A; Amendola, R; Calabretta, B; Giordano, A; Paggi, M G

1998-05-01

The retinoblastoma family of nuclear factors is composed of RB, the prototype of the tumour suppressor genes and of the strictly related genes p107 and Rb2/p130. The three genes code for proteins, namely pRb, p107 and pRb2/p130, that share similar structures and functions. These proteins are expressed, often simultaneously, in many cell types and are involved in the regulation of proliferation and differentiation. We determined the expression and the phosphorylation of the RB family gene products during the DMSO-induced differentiation of the N1E-115 murine neuroblastoma cells. In this system, pRb2/p130 was strongly up-regulated during mid-late differentiation stages, while, on the contrary, pRb and p107 resulted markedly decreased at late stages. Differentiating N1E-115 cells also showed a progressive decrease in B-myb levels, a proliferation-related protein whose constitutive expression inhibits neuronal differentiation. Transfection of each of the RB family genes in these cells was able, at different degrees, to induce neuronal differentiation, to inhibit [3H]thymidine incorporation and to down-regulate the activity of the B-myb promoter.

LATS2 tumour specific mutations and down-regulation of the gene in non-small cell carcinoma.

PubMed

Strazisar, Mojca; Mlakar, Vid; Glavac, Damjan

2009-06-01

LATS2 is a new member of the LATS tumour suppressor family. The human LATS2 gene is located at chromosome 13q11-12, a hot spot (67%) for loss of heterozygosity (LOH) in non-small cell lung cancer (NSCLC). We screened 129 non-small cell lung cancer samples and 13 lung cancer cell lines, initially for mutations in the LATS2 gene and subsequently for mutations in P53 and K-RAS genes. Either polymorphisms or mutations were identified in over 50 percent of analysed tumours. A novel missense mutation, S1073R, and a large deletion of 8 amino acids in the PAPA-repeat region were detected in 9 and 2 NSCLC tumours, respectively. Those mutations were not identified in the 13 lung cancer cell lines. Mutations were tumour specific and were absent from adjacent normal tissue and healthy controls. Down-regulation of the LATS2 gene was observed in most NSCLC tumours but was not related to any mutation or polymorphism. Tumours with a LATS2 mutation often also harbour a P53 but not K-RAS gene mutation and were mostly in an advanced stage of development, with regional lymph node involvement.

Nucleophosmin: a versatile molecule associated with hematological malignancies.

PubMed

Naoe, Tomoki; Suzuki, Tatsuya; Kiyoi, Hitoshi; Urano, Takeshi

2006-10-01

Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. In hematological malignancies, the NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. The NPM1 gene on 5q35 is translocated with the anaplastic lymphoma kinase (ALK) gene in anaplastic large cell lymphoma with t(2;5). The MLF1 and RARA genes are fused with NPM1 in myelodysplastic syndrome and acute myeloid leukemia (AML) with t(3;5) and acute promyelocytic leukemia with t(5;17), respectively. In each fused protein, the N-terminal NPM portion is associated with oligomerization of a partner protein leading to altered signal transduction or transcription. Recently, mutations of exon 12 have been found in a significant proportion of de novo AML, especially in those with a normal karyotype. Mutant NPM is localized aberrantly in the cytoplasm, but the molecular mechanisms for leukemia remain to be studied. Studies of knock-out mice have revealed new aspects regarding NPM1 as a tumor-suppressor gene. This review focuses on the clinical significance of the NPM1 gene in hematological malignancies and newly discovered roles of NPM associated with oncogenesis.

DLEU2 encodes an antisense RNA for the putative bicistronic RFP2/LEU5 gene in humans and mouse.

PubMed

Corcoran, Martin M; Hammarsund, Marianne; Zhu, Chaoyong; Lerner, Mikael; Kapanadze, Bagrat; Wilson, Bill; Larsson, Catharina; Forsberg, Lars; Ibbotson, Rachel E; Einhorn, Stefan; Oscier, David G; Grandér, Dan; Sangfelt, Olle

2004-08-01

Our group previously identified two novel genes, RFP2/LEU5 and DLEU2, within a 13q14.3 genomic region of loss seen in various malignancies. However, no specific inactivating mutations were found in these or other genes in the vicinity of the deletion, suggesting that a nonclassical tumor-suppressor mechanism may be involved. Here, we present data showing that the DLEU2 gene encodes a putative noncoding antisense RNA, with one exon directly overlapping the first exon of the RFP2/LEU5 gene in the opposite orientation. In addition, the RFP2/LEU5 transcript can be alternatively spliced to produce either several monocistronic transcripts or a putative bicistronic transcript encoding two separate open-reading frames, adding to the complexity of the locus. The finding that these gene structures are conserved in the mouse, including the putative bicistronic RFP2/LEU5 transcript as well as the antisense relationship with DLEU2, further underlines the significance of this unusual organization and suggests a biological function for DLEU2 in the regulation of RFP2/LEU5. Copyright 2004 Wiley-Liss, Inc.

The role of LKB1 in lung cancer.

PubMed

Sanchez-Cespedes, Montse

2011-09-01

In humans, the LKB1 gene is located on the short arm of chromosome 19, which is frequently deleted in lung tumors. Unlike most cancers of sporadic origin, in non-small cell lung cancer (NSCLC) nearly half of the tumors harbor somatic and homozygous inactivating mutations in LKB1. In NSCLC, LKB1 inactivation strongly predominates in adenocarcinomas from smokers and coexists with mutations at other important cancer genes, including KRAS and TP53. Remarkably, LKB1 alterations frequently occur simultaneously with inactivation at another important tumor suppressor gene, BRG1 (also called SMARCA4), which is also located on chromosome 19p. The present review considers the frequency and pattern of LKB1 mutations in lung cancer and the distinct biological pathways in which the LKB1 protein is involved in the development of this type of cancer. Finally, the possible clinical applications in cancer management, especially in lung cancer treatment, associated with the presence of absence of LKB1 are discussed.

Pathogenic Germline Variants in 10,389 Adult Cancers.

PubMed

Huang, Kuan-Lin; Mashl, R Jay; Wu, Yige; Ritter, Deborah I; Wang, Jiayin; Oh, Clara; Paczkowska, Marta; Reynolds, Sheila; Wyczalkowski, Matthew A; Oak, Ninad; Scott, Adam D; Krassowski, Michal; Cherniack, Andrew D; Houlahan, Kathleen E; Jayasinghe, Reyka; Wang, Liang-Bo; Zhou, Daniel Cui; Liu, Di; Cao, Song; Kim, Young Won; Koire, Amanda; McMichael, Joshua F; Hucthagowder, Vishwanathan; Kim, Tae-Beom; Hahn, Abigail; Wang, Chen; McLellan, Michael D; Al-Mulla, Fahd; Johnson, Kimberly J; Lichtarge, Olivier; Boutros, Paul C; Raphael, Benjamin; Lazar, Alexander J; Zhang, Wei; Wendl, Michael C; Govindan, Ramaswamy; Jain, Sanjay; Wheeler, David; Kulkarni, Shashikant; Dipersio, John F; Reimand, Jüri; Meric-Bernstam, Funda; Chen, Ken; Shmulevich, Ilya; Plon, Sharon E; Chen, Feng; Ding, Li

2018-04-05

We conducted the largest investigation of predisposition variants in cancer to date, discovering 853 pathogenic or likely pathogenic variants in 8% of 10,389 cases from 33 cancer types. Twenty-one genes showed single or cross-cancer associations, including novel associations of SDHA in melanoma and PALB2 in stomach adenocarcinoma. The 659 predisposition variants and 18 additional large deletions in tumor suppressors, including ATM, BRCA1, and NF1, showed low gene expression and frequent (43%) loss of heterozygosity or biallelic two-hit events. We also discovered 33 such variants in oncogenes, including missenses in MET, RET, and PTPN11 associated with high gene expression. We nominated 47 additional predisposition variants from prioritized VUSs supported by multiple evidences involving case-control frequency, loss of heterozygosity, expression effect, and co-localization with mutations and modified residues. Our integrative approach links rare predisposition variants to functional consequences, informing future guidelines of variant classification and germline genetic testing in cancer. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Genetic predisposition to peripheral nerve neoplasia: Diagnostic criteria and pathogenesis of neurofibromatoses, Carney complex, and related syndromes

PubMed Central

Rodriguez, Fausto J.; Stratakis, Constantine A.; Evans, D Gareth

2013-01-01

Neoplasms of the peripheral nerve sheath represent essential clinical manifestations of the syndromes known as the neurofibromatoses. Although involvement of multiple organ systems, including skin, central nervous system and skeleton, may also be conspicuous, peripheral nerve neoplasia is often the most important and frequent cause of morbidity in these patients. Clinical characteristics of neurofibromatosis type 1 (NF1) and neurofibromatosis type 2 (NF2) have been extensively described and studied during the last century, and the identification of mutations in the NF1 and NF2 genes by contemporary molecular techniques have created a separate multidisciplinary field in genetic medicine. In schwannomatosis, the most recent addition to the neurofibromatosis group, peripheral nervous system involvement is the exclusive (or almost exclusive) clinical manifestation. Although the majority of cases of schwannomatosis are sporadic, approximately a third occur in families and a subset of these has recently been associated with germline mutations in the tumor suppressor gene SMARCB1/INI1. Other curious syndromes that involve the peripheral nervous system are associated with predominant endocrine manifestations, and include Carney Complex and MEN2b, secondary to inactivating mutations in the PRKAR1A gene in a subset, and activating mutations in RET respectively. In this review, we provide a concise update on the diagnostic criteria, pathology and molecular pathogenesis of these enigmatic syndromes in relation to peripheral nerve sheath neoplasia. PMID:22210082

Genetic predisposition to peripheral nerve neoplasia: diagnostic criteria and pathogenesis of neurofibromatoses, Carney complex, and related syndromes.

PubMed

Rodriguez, Fausto J; Stratakis, Constantine A; Evans, D Gareth

2012-03-01

Neoplasms of the peripheral nerve sheath represent essential clinical manifestations of the syndromes known as the neurofibromatoses. Although involvement of multiple organ systems, including skin, central nervous system, and skeleton, may also be conspicuous, peripheral nerve neoplasia is often the most important and frequent cause of morbidity in these patients. Clinical characteristics of neurofibromatosis type 1 (NF1) and neurofibromatosis type 2 (NF2) have been extensively described and studied during the last century, and the identification of mutations in the NF1 and NF2 genes by contemporary molecular techniques have created a separate multidisciplinary field in genetic medicine. In schwannomatosis, the most recent addition to the neurofibromatosis group, peripheral nervous system involvement is the exclusive (or almost exclusive) clinical manifestation. Although the majority of cases of schwannomatosis are sporadic, approximately one-third occur in families and a subset of these has recently been associated with germline mutations in the tumor suppressor gene SMARCB1/INI1. Other curious syndromes that involve the peripheral nervous system are associated with predominant endocrine manifestations, and include Carney complex and MEN2b, secondary to inactivating mutations in the PRKAR1A gene in a subset, and activating mutations in RET, respectively. In this review, we provide a concise update on the diagnostic criteria, pathology and molecular pathogenesis of these enigmatic syndromes in relation to peripheral nerve sheath neoplasia.

Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi

PubMed Central

van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.

2014-01-01

The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815

Adenovirus Small E1A Employs the Lysine Acetylases p300/CBP and Tumor Suppressor Rb to Repress Select Host Genes and Promote Productive Virus Infection

PubMed Central

Ferrari, Roberto; Gou, Dawei; Jawdekar, Gauri; Johnson, Sarah A.; Nava, Miguel; Su, Trent; Yousef, Ahmed F.; Zemke, Nathan R.; Pellegrini, Matteo; Kurdistani, Siavash K.; Berk, Arnold J.

2015-01-01

SUMMARY Oncogenic transformation by adenovirus small e1a depends on simultaneous interactions with the host lysine acetylases p300/CBP and the tumor suppressor RB. How these interactions influence cellular gene expression remains unclear. We find that e1a displaces RBs from E2F transcription factors and promotes p300 acetylation of RB1 K873/K874 to lock it into a repressing conformation that interacts with repressive chromatin-modifying enzymes. These repressing p300-e1a-RB1 complexes specifically interact with host genes that have unusually high p300 association within the gene body. The TGFβ-, TNF-, and interleukin-signaling pathway components are enriched among such p300-targeted genes. The p300-e1a-RB1 complex condenses chromatin in a manner dependent on HDAC activity, p300 lysine acetylase activity, the p300 bromodomain, and RB K873/K874 and e1a K239 acetylation to repress host genes that would otherwise inhibit productive virus infection. Thus, adenovirus employs e1a to repress host genes that interfere with viral replication. PMID:25525796

Identical mutations of the p53 tumor suppressor gene in the gliomatous and the sarcomatous components of gliosarcomas suggest a common origin from glial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biernat, W.; Aguzzi, A.; Sure, U.

Gliosarcomas are morphologically heterogeneous tumors of the central nervous system composed of gliomatous and sarcomatous components. The histogenesis of the latter is still a matter of debate. As mutations of the p53 tumor suppressor gene represent an early event in the development of gliomas, we attempted to determine whether both components of gliosarcomas share identical alterations of the p53 gene. Using single-strand conformation analysis (SSCA) and direct DNA sequencing of the p53 gene, we analyzed dissected gliomatous and sarcomatous parts of 12 formalin-fixed, paraffin-embedded gliosarcomas. The two tumors that contained a p53 alteration were found to carry the identical mutationmore » (exon 5; codon 151, CCC {r_arrow} TCC; codon 173, GTG {r_arrow} GTA) in the gliomatous and the sarcomatous components. These findings suggest a common origin of the two cellular components from neoplastic glial cells. 37 refs., 3 figs., 1 tab.« less

SIRT3 is a Mitochondrial Tumor Suppressor and Genetic Loss Results in a Murine Model for ER/PR-Positive Mammary Tumors Connecting Metabolism and Carcinogenesis SIRT3 is a Mitochondrial Tumor Suppressor

DTIC Science & Technology

2012-09-01

well as HIF-1α dependent gene expression, as shown by co-transfection assays using an HRE luciferase reporter (Fig. 4b, bar 1 vs. 2). In addition...MEFs were co-transfected with p3x- HRE -luciferase with or without NAC or stigmatellin and 40 hours afterwards luciferase levels were determined. (c

Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. | Office of Cancer Genomics

Cancer.gov

Noncoding mutations in cancer genomes are frequent but challenging to interpret. PVT1 encodes an oncogenic lncRNA, but recurrent translocations and deletions in human cancers suggest alternative mechanisms. Here, we show that the PVT1 promoter has a tumor-suppressor function that is independent of PVT1 lncRNA. CRISPR interference of PVT1 promoter enhances breast cancer cell competition and growth in vivo.

Distinct organization of the candidate tumor suppressor gene RFP2 in human and mouse: multiple mRNA isoforms in both species- and human-specific antisense transcript RFP2OS.

PubMed

Baranova, Ancha; Hammarsund, Marianne; Ivanov, Dmitry; Skoblov, Mikhail; Sangfelt, Olle; Corcoran, Martin; Borodina, Tatiana; Makeeva, Natalia; Pestova, Anna; Tyazhelova, Tatiana; Nazarenko, Svetlana; Gorreta, Francesco; Alsheddi, Tariq; Schlauch, Karen; Nikitin, Eugene; Kapanadze, Bagrat; Shagin, Dmitry; Poltaraus, Andrey; Ivanovich Vorobiev, Andrey; Zabarovsky, Eugene; Lukianov, Sergey; Chandhoke, Vikas; Ibbotson, Rachel; Oscier, David; Einhorn, Stefan; Grander, Dan; Yankovsky, Nick

2003-12-04

In the present study, we describe the human and mouse RFP2 gene structure, multiple RFP2 mRNA isoforms in the two species that have different 5' UTRs and a human-specific antisense transcript RFP2OS. Since the human RFP2 5' UTR is not conserved in mouse, these findings might indicate a different regulation of RFP2 in the two species. The predicted human and mouse RFP2 proteins are shown to contain a tripartite RING finger-B-box-coiled-coil domain (RBCC), also known as a TRIM domain, and therefore belong to a subgroup of RING finger proteins that are often involved in developmental and tumorigenic processes. Because homozygous deletions of chromosomal region 13q14.3 are found in a number of malignancies, including chronic lymphocytic leukemia (CLL) and multiple myeloma (MM), we suggest that RFP2 might be involved in tumor development. This study provides necessary information for evaluation of the role of RFP2 in malignant transformation and other biological processes.

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

PubMed Central

Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

2011-01-01

RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

PubMed

Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

2011-04-29

RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

Roles of long non-coding RNAs in gastric cancer metastasis

PubMed Central

Yang, Zi-Guo; Gao, Ling; Guo, Xiao-Bo; Shi, Yu-Long

2015-01-01

Gastric cancer is the second leading cause of cancer-related deaths. Metastasis, which is an important element of gastric cancer, leads to a high mortality rate and to a poor prognosis. Gastric cancer metastasis has a complex progression that involves multiple biological processes. The comprehensive mechanisms of metastasis remain unclear, though traditional regulation modulates the molecular functions associated with metastasis. Long non-coding RNAs (lncRNAs) have a role in different gene regulatory pathways by epigenetic modification and by transcriptional and post-transcription regulation. lncRNAs participate in various diseases, including Alzheimer’s disease, cardiovascular disease, and cancer. The altered expressions of certain lncRNAs are linked to gastric cancer metastasis and invasion, as with tumor suppressor genes or oncogenes. Studies have partly elucidated the roles of lncRNAs as biomarkers and in therapies, as well as their gene regulatory mechanisms. However, comprehensive knowledge regarding the functional mechanisms of gene regulation in metastatic gastric cancer remains scarce. To provide a theoretical basis for therapeutic intervention in metastatic gastric cancer, we reviewed the functions of lncRNAs and their regulatory roles in gastric cancer metastasis. PMID:25954095

Gene therapy and gastrointestinal cancer: concepts and clinical facts.

PubMed

Hauses, M; Schackert, H K

1999-10-01

Principles of the treatment of gastrointestinal cancer with gene therapy evolved from the advent of techniques in molecular biology, from increasing insights into the molecular basis of tumorigenesis and from the need to develop more efficient treatment modalities. Any gene therapy approach has to take two major tasks into consideration: the therapeutic gene has to be delivered into the target cell population with high efficiency, specificity and safety, and has to act in a way that provides a benefit to the patient. Data on 22 clinical trials on malignancies of the gastrointestinal tract are available. They utilize a variety of gene-delivery methods and target cell populations, and there is considerable variety among their strategies. Gene transfer is performed by injection of naked plasmid DNA and by use of DNA-liposome complexes and viral vectors. In some cases, the gene transfer is carried out ex vivo and the patients receive genetically modified cells, whereas other approaches deliver the vector to the target cell population in vivo. The theoretical concepts of gene therapy can be divided into three groups. One approach makes use of suicide genes comprising bacterial or viral genes that convert a nontoxic prodrug into a highly cytotoxic chemotherapeutic agent at the tumor site. This approach aims at higher therapeutic specificity and fewer side effects than with the systemic delivery of cytotoxic agents. The second strategy makes an attempt to invoke the immune system to destroy malignant cells. Different strategies, such as immunization with genetically modified tumor cells or transfer of new genes to T cells, are considered to have clinical benefits. The major advantage of these immunotherapeutic approaches is the systemic effect both on the primary tumor and on metastases. The third strategy evolved from the insight that cancer is a genetic disease caused by activation of oncogenes or inactivation of tumor-suppressor genes. Compensation of genetic defects by the downregulation of activated oncogenes or the restoration of tumor-suppressor-gene functions may be able to revert the malignant phenotype of cancer cells. Of the 22 gene-therapy trials, 17 trials focus on immunotherapy. Only two trials make use of suicide genes and, in three trials, a functional copy of the p53 tumor-suppressor gene was reintroduced into malignant cells. Modalities for gene transfer and the strategies underlying gene therapy will be discussed in the context of gastrointestinal malignancies and the potential benefits for patients.

Use of Polyamine Derivatives as Selective Histone Deacetylase Inhibitors

PubMed Central

Woster, Patrick M.

2014-01-01

Histone acetylation and deacetylation, mediated by histone acetyltransferase and the 11 isoforms of histone deacetylase, play an important role in gene expression. Histone deacetylase inhibitors have found utility in the treatment of cancer by promoting the reexpression of aberrantly silenced genes that code for tumor suppressor factors. It is unclear which of the 11 histone deacetylase isoforms are important in human cancer. We have designed a series of polyaminohydroxamic acid (PAHA) and polyaminobenzamide (PABA) histone deacetylase inhibitors that exhibit selectivity among four histone deacetylase isoforms. Although all of the active inhibitors promote reexpression of tumor suppressor factors, they produce variable cellular effects ranging from stimulation of growth to cytostasis and cytotoxicity. This chapter describes the procedures used to quantify the global and isoform-specific inhibition caused by these inhibitors, and techniques used to measure cellular effects such as reexpression of tumor suppressor proteins and hyperacetylation of histones H3 and H4. Procedures are also described to examine the ability of PAHAs and PABAs to utilize the polyamine transport system and to induce overexpression of the early apoptotic factor annexin A1. PMID:21318894

Raf Kinase Inhibitory Protein (RKIP) as a Metastasis Suppressor: Regulation of Signaling Networks in Cancer

PubMed Central

Yesilkanal, Ali E.; Rosner, Marsha R.

2015-01-01

Cancer is one of the deadliest diseases worldwide, accounting for about 8 million deaths a year. For solid tumors, cancer patients die as a result of the metastatic spread of the tumor to the rest of the body. Therefore, there is a clinical need for understanding the molecular and cellular basis of metastasis, identifying patients whose tumors are more likely to metastasize, and developing effective therapies against metastatic progression. Over the years, Raf kinase inhibitory protein (RKIP) has emerged as a natural suppressor of the metastatic process, constituting a tool for studying metastasis and its clinical outcomes. Here, we review RKIP’s role as a metastasis suppressor and the signaling networks and genes regulated by RKIP in metastatic, triple-negative breast cancer. We also highlight the clinical implications and power of building gene signatures based on RKIP-regulated signaling modules in identifying cancer patients that are at higher risk for metastases. Finally, we highlight the potential of RKIP as a tool for developing new therapeutic strategies in cancer treatment. PMID:25597354

Clinical prognostic value of DNA methylation in hepatoblastoma: Four novel tumor suppressor candidates.

PubMed

Honda, Shohei; Minato, Masashi; Suzuki, Hiromu; Fujiyoshi, Masato; Miyagi, Hisayuki; Haruta, Masayuki; Kaneko, Yasuhiko; Hatanaka, Kanako C; Hiyama, Eiso; Kamijo, Takehiko; Okada, Tadao; Taketomi, Akinobu

2016-06-01

Hepatoblastoma (HB) is very rare but the most common malignant neoplasm of the liver occurring in children. Despite improvements in therapy, outcomes for patients with advanced HB that is refractory to standard preoperative chemotherapy remain unsatisfactory. To improve the survival rate among this group, identification of novel prognostic markers and therapeutic targets is needed. We have previously reported that altered DNA methylation patterns are of biological and clinical importance in HB. In the present study, using genome-wide methylation analysis and bisulfite pyrosequencing with specimens from HB tumors, we detected nine methylated genes. We then focused on four of those genes, GPR180, MST1R, OCIAD2, and PARP6, because they likely encode tumor suppressors and their increase of methylation was associated with a poor prognosis. The methylation status of the four genes was also associated with age at diagnosis, and significant association with the presence of metastatic tumors was seen in three of the four genes. Multivariate analysis revealed that the presence of metastatic tumors and increase of methylation of GPR180 were independent prognostic factors affecting event-free survival. These findings indicate that the four novel tumor suppressor candidates are potentially useful molecular markers predictive of a poor outcome in HB patients, which may serve as the basis for improved therapeutic strategies when clinical trials are carried out. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

The two single nucleotide polymorphisms in the H37/RBM5 tumour suppressor gene at 3p21.3 correlated with different subtypes of non-small cell lung cancers

PubMed Central

Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.

2007-01-01

Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309

Photochemical internalization-mediated nonviral gene transfection: polyamine core-shell nanoparticles as gene carrier

NASA Astrophysics Data System (ADS)

Zamora, Genesis; Wang, Frederick; Sun, Chung-Ho; Trinidad, Anthony; Kwon, Young Jik; Cho, Soo Kyung; Berg, Kristian; Madsen, Steen J.; Hirschberg, Henry

2014-10-01

The overall objective of the research was to investigate the utility of photochemical internalization (PCI) for the enhanced nonviral transfection of genes into glioma cells. The PCI-mediated introduction of the tumor suppressor gene phosphatase and tensin homolog (PTEN) or the cytosine deaminase (CD) pro-drug activating gene into U87 or U251 glioma cell monolayers and multicell tumor spheroids were evaluated. In the study reported here, polyamine-DNA gene polyplexes were encapsulated in a nanoparticle (NP) with an acid degradable polyketal outer shell. These NP synthetically mimic the roles of viral capsid and envelope, which transport and release the gene, respectively. The effects of PCI-mediated suppressor and suicide genes transfection efficiency employing either "naked" polyplex cores alone or as NP-shelled cores were compared. PCI was performed with the photosensitizer AlPcS2a and λ=670-nm laser irradiance. The results clearly demonstrated that the PCI can enhance the delivery of both the PTEN or CD genes in human glioma cell monolayers and multicell tumor spheroids. The transfection efficiency, as measured by cell survival and inhibition of spheroid growth, was found to be significantly greater at suboptimal light and DNA levels for shelled NPs compared with polyamine-DNA polyplexes alone.

Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes.

PubMed

Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

2016-05-26

Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes.

Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes

PubMed Central

Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A.; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

2016-01-01

Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes. PMID:27225414

Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma.

PubMed

Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen

2012-03-01

PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

Genetics of Primary Intraocular Tumors

PubMed Central

Nagarkatti-Gude, Nisha; Wang, Yujuan; Ali, Mohammad Javed; Honavar, Santosh G.; Jager, Martine J.; Chan, Chi-Chao

2012-01-01

Primary intraocular neoplasms are tumors that originate within the eye. The most common malignant primary intraocular tumor in adults is uveal melanoma and the second is primary intraocular lymphoma or vitreoretinal (intraocular) lymphoma. The most common malignant intraocular tumor in children is retinoblastoma. Genetics plays a vital role in the diagnosis and detection of ocular tumors. In uveal melanoma, monosomy 3 is the most common genetic alteration and somatic mutations of BAP1, a tumor suppressor gene, have been reported in nearly 50% of primary uveal melanomas. The retinoblastoma gene RB1 is the prototype tumor suppressor gene—mutations in RB1 alleles lead to inactivated RB protein and the development of retinoblastoma. Immunoglobulin heavy chain (IgH) or T-cell receptor (TCR) gene rearrangement is observed in B-cell or T-cell primary vitreoretinal lymphoma, respectively. Other factors related to the genetics of these three common malignancies in the eye are discussed and reviewed. PMID:22834783

PU.1 is a major transcriptional activator of the tumour suppressor gene LIMD1

PubMed Central

Foxler, Daniel E.; James, Victoria; Shelton, Samuel J.; Vallim, Thomas Q. de A.; Shaw, Peter E.; Sharp, Tyson V.

2011-01-01

LIMD1 is a tumour suppressor gene (TSG) down regulated in ∼80% of lung cancers with loss also demonstrated in breast and head and neck squamous cell carcinomas. LIMD1 is also a candidate TSG in childhood acute lymphoblastic leukaemia. Mechanistically, LIMD1 interacts with pRB, repressing E2F-driven transcription as well as being a critical component of microRNA-mediated gene silencing. In this study we show a CpG island within the LIMD1 promoter contains a conserved binding motif for the transcription factor PU.1. Mutation of the PU.1 consensus reduced promoter driven transcription by 90%. ChIP and EMSA analysis demonstrated that PU.1 specifically binds to the LIMD1 promoter. siRNA depletion of PU.1 significantly reduced endogenous LIMD1 expression, demonstrating that PU.1 is a major transcriptional activator of LIMD1. PMID:21402070

[Exon-intron structure of the fet5+ gene of Schizosaccharomyces pombe and physical mapping of genome encompassing regions].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1998-01-01

Plasmid pYUK3 bearing the fet5+ gene of Schizosaccharomyces pombe was isolated from a genomic library of the fission yeast, and a detailed physical map of the whole genomic insert (ca. 9.6 Kbp) was constructed. The primary structure of the fet5+ gene and its flanking regions is established. The gene contains a single 45-bp intron in its distal part. A typical TATA-box (TATAAG) was found in the 5'-noncoding region ca. 50 bp upstream of the putative start of transcription, and the 3'-noncoding region contains AT-rich palindromes, which are probably involved in termination of the fet5+ transcription. A previously unidentified gene of Sz. pombe encoding a protein with some similarity to one of the transcriptional activators from the TBP (TATA-binding protein) group of SPT factors of transcription was found in the vicinity of the fet5+ gene. Taking into account that cDNA of the fet5(+)-gene was isolated as a suppressor of the genetic-defect of nuclear RNA polymerases I-III (Bioorg. Khim., 1997, vol. 23, No 3, pp. 234-237), this vicinity may be the first evidence of possible clustering, in the genome of the fission yeast, of genes participating in transcription regulation.

Therapeutic strategy with artificially-designed i-lncRNA targeting multiple oncogenic microRNAs exhibits effective antitumor activity in diffuse large B-cell lymphoma.

PubMed

Su, Yinghan; Sun, Bin; Lin, Xuejing; Zhao, Xinying; Ji, Weidan; He, Miaoxia; Qian, Haihua; Song, Xianmin; Yang, Jianmin; Wang, Jianmin; Chen, Jie

2016-08-02

In diffuse large B-cell lymphoma (DLBCL), many oncogenic microRNAs (OncomiRs) are highly expressed to promote disease development and progression by inhibiting the expression and function of certain tumor suppressor genes, and these OncomiRs comprise a promising new class of molecular targets for the treatment of DLBCL. However, most current therapeutic studies have focused on a single miRNA, with limited treatment outcomes. In this study, we generated tandem sequences of 10 copies of the complementary binding sequences to 13 OncomiRs and synthesized an interfering long non-coding RNA (i-lncRNA). The highly-expressed i-lncRNA in DLBCL cells would compete with the corresponding mRNAs of OncomiR target genes for binding OncomiRs, thereby effectively consuming a large amount of OncomiRs and protecting many tumor suppressor genes. The in vitro experiments confirmed that the i-lncRNA expression significantly inhibited cell proliferation, induced cell cycle arrest and apoptosis in DLBCL cell lines, mainly through upregulating the expression of PTEN, p27kip1, TIMP3, RECK and downregulating the expression of p38/MAPK, survivin, CDK4, c-myc. In the established SUDHL-4 xenografts in nude mice, the treatment strategy involving adenovirus-mediated i-lncRNA expression significantly inhibited the growth of DLBCL xenografts. Therefore, this treatment would specifically target the carcinogenic effects of many OncomiRs that are usually expressed in DLBCL and not in normal cells, such a strategy could improve anti-tumor efficacy and safety and may be a good prospect for clinical applications.

Up-regulation of tumor suppressor carcinoembryonic antigen-related cell adhesion molecule 1 in human colon cancer Caco-2 cells following repetitive exposure to dietary levels of a polyphenol-rich chokeberry juice.

PubMed

Bermúdez-Soto, María J; Larrosa, Mar; Garcia-Cantalejo, Jesús M; Espín, Juan C; Tomás-Barberan, Francisco A; García-Conesa, María T

2007-04-01

Consumption of berries and red fruits rich in polyphenols may contribute to the reduction of colon cancer through mechanisms not yet understood. In this study, we investigated the response of subconfluent Caco-2 cells (a human colon carcinoma model) to repetitive exposure (2 h a day for a 4-day period) of a subtoxic dose of a chokeberry (Aronia melanocarpa) juice containing mixed polyphenols. To mimic physiological conditions, we subjected the chokeberry juice to in vitro gastric and pancreatic digestion. The effects on viability, proliferation and cell cycle were determined, and changes in the expression of genes in response to the chokeberry treatment were screened using Affymetrix oligonucleotide microarrays. Exposure to the chokeberry juice inhibited Caco-2 cell proliferation by causing G(2)/M cell cycle arrest. We detected changes in the expression of a group of genes involved in cell growth and proliferation and cell cycle regulation, as well as those associated to colorectal cancer. A selection of these genes was further confirmed by quantitative RT-PCR. Among these, the tumor suppressor carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1), whose expression is known to be reduced in the majority of early adenomas and carcinomas, was up-regulated by the treatment both at the mRNA and protein levels (as shown by flow cytometry analysis). CEACAM1, with a significant regulatory role on cell proliferation of particular interest at early stages of cancer development, may be a potential target for chemoprevention by food components such as those present in polyphenol-rich fruits.

Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.

PubMed

de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri

2018-03-01

To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

LACTB, a novel epigenetic silenced tumor suppressor, inhibits colorectal cancer progression by attenuating MDM2-mediated p53 ubiquitination and degradation.

PubMed

Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui

2018-06-13

Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.

Genetic regulation by NLA and microRNA827 for maintaining nitrate-dependent phosphate homeostasis in arabidopsis.

PubMed

Kant, Surya; Peng, Mingsheng; Rothstein, Steven J

2011-03-01

Plants need abundant nitrogen and phosphorus for higher yield. Improving plant genetics for higher nitrogen and phosphorus use efficiency would save potentially billions of dollars annually on fertilizers and reduce global environmental pollution. This will require knowledge of molecular regulators for maintaining homeostasis of these nutrients in plants. Previously, we reported that the NITROGEN LIMITATION ADAPTATION (NLA) gene is involved in adaptive responses to low-nitrogen conditions in Arabidopsis, where nla mutant plants display abrupt early senescence. To understand the molecular mechanisms underlying NLA function, two suppressors of the nla mutation were isolated that recover the nla mutant phenotype to wild type. Map-based cloning identified these suppressors as the phosphate (Pi) transport-related genes PHF1 and PHT1.1. In addition, NLA expression is shown to be regulated by the low-Pi induced microRNA miR827. Pi analysis revealed that the early senescence in nla mutant plants was due to Pi toxicity. These plants accumulated over five times the normal Pi content in shoots specifically under low nitrate and high Pi but not under high nitrate conditions. Also the Pi overaccumulator pho2 mutant shows Pi toxicity in a nitrate-dependent manner similar to the nla mutant. Further, the nitrate and Pi levels are shown to have an antagonistic crosstalk as displayed by their differential effects on flowering time. The results demonstrate that NLA and miR827 have pivotal roles in regulating Pi homeostasis in plants in a nitrate-dependent fashion.

Molecular screening of compounds to the predicted Protein-Protein Interaction site of Rb1-E7 with p53- E6 in HPV

PubMed Central

Shaikh, Faraz; Sanehi, Parvish; Rawal, Rakesh

2012-01-01

Cervical cancer is malignant neoplasm of the cervix uteri or cervical area. Human Papillomaviruses (HPVs) which are heterogeneous groups of small double stranded DNA viruses are considered as the primary cause of cervical cancer, involved in 90% of all Cervical Cancers. Two early HPV genes, E6 and E7, are known to play crucial role in tumor formation. E6 binds with p53 and prevents its translocation and thereby inhibit the ability of p53 to activate or repress target genes. E7 binds to hypophosphorylated Rb and thereby induces cells to enter into premature S-phase by disrupting Rb-E2F complexes. The strategy of the research work was to target the site of interaction of Rb1 -E7 & p53-E6. A total of 88 compounds were selected for molecular screening, based on comprehensive literature survey for natural compounds with anti-cancer activity. Molecular docking analysis was carried out with Molegro Virtual Docker, to screen the 88 chosen compounds and rank them according to their binding affinity towards the site of interaction of the viral oncoproteins and human tumor suppressor proteins. The docking result revealed that Nicandrenone a member of Withanolides family of chemical compounds as the most likely molecule that can be used as a candidate drug against HPV induced cervical cancer. Abbreviations HPV - Human Papiloma Virus, HTSP - Human Tumor Suppressor Proteins, VOP - Viral oncoproteins. PMID:22829740

p53 mediated transcriptional regulation of long non-coding RNA by 1-hydroxy-1-norresistomycin triggers intrinsic apoptosis in adenocarcinoma lung cancer.

PubMed

Ramalingam, Vaikundamoorthy; Varunkumar, Krishnamoorthy; Ravikumar, Vilwanathan; Rajaram, Rajendran

2018-05-01

Over a few decades, systemic chemotherapy and surgery are the only treatment options for lung cancer. Due to limited efficacy and overall poor survival of patients, it is necessary to develop a newer therapeutic strategy which specifically targets cancer cell proliferation pathway. Deciphering the role of long non-coding RNAs (lncRNAs) in tumorigenesis and pathogenesis of cancer cells has recently emerged. In the present study, marine actinomycetes derived 1-hydroxy-1-norresistomycin (HNM) was used to enhance the expression of lncRNAs through p53 transcriptional regulation and induced intrinsic apoptosis in non-small cell lung cancer cells. Initially, concentration dependent treatment with HNM has increased the ROS generation in mitochondria and sensitizes the mitochondrial membrane potential. Further, HNM downregulates the numerous oncogenes which regulate cancer cell proliferation, metastasis and invasion and tumor suppressor genes which are involved in intrinsic apoptosis confirmed with adopting techniques such as RT-PCR and western blot analysis. Moreover, ChIP assay results showed that HNM upregulates the p53 mediated transcriptional regulation of lncRNAs lead to apoptosis of cancer cells through cell cycle arrest and inhibition of proliferation. In conclusion, HNM found to be a potential therapeutic agent for treatment of lung cancer via suppression of oncogenes and expression of wide range of tumor suppressor genes are might have significant implications in cancer treatment and drug development. Copyright © 2018 Elsevier B.V. All rights reserved.

The expanding universe of p53 targets.

PubMed

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

Methylation and microRNA-mediated epigenetic regulation of SOCS3

PubMed Central

Boosani, Chandra S.; Agrawal, Devendra K.

2017-01-01

Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267

Role of RNA Interference (RNAi) in Dengue Virus Replication and Identification of NS4B as an RNAi Suppressor

PubMed Central

Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan

2013-01-01

RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001

MYC association with cancer risk and a new model of MYC-mediated repression.

PubMed

Cole, Michael D

2014-07-01

MYC is one of the most frequently mutated and overexpressed genes in human cancer but the regulation of MYC expression and the ability of MYC protein to repress cellular genes (including itself) have remained mysterious. Recent genome-wide association studies show that many genetic polymorphisms associated with disease risk map to distal regulatory elements that regulate the MYC promoter through large chromatin loops. Cancer risk-associated single-nucleotide polymorphisms (SNPs) contain more potent enhancer activity, promoting higher MYC levels and a greater risk of disease. The MYC promoter is also subject to complex regulatory circuits and limits its own expression by a feedback loop. A model for MYC autoregulation is discussed which involves a signaling pathway between the PTEN (phosphatase and tensin homolog) tumor suppressor and repressive histone modifications laid down by the EZH2 methyltransferase. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Physical mapping of chromosome 17p13.3 in the region of a putative tumor suppressor gene important in medulloblastoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

McDonald, J.D.; Daneshvar, L.; Willert, J.R.

1994-09-01

Deletion mapping of a medulloblastoma tumor panel revealed loss of distal chromosome 17p13.3 sequences in tumors from 14 of 32 patients (44%). Of the 14 tumors showing loss of heterozygosity by restriction fragment length polymorphism analysis, 14 of 14 (100%) displayed loss of the telomeric marker p144-D6 (D17S34), while a probe for the ABR gene on 17p13.3 was lost in 7 of 8 (88%) informative cases. Using pulsed-field gel electrophoresis, we localized the polymorphic marker (VNTR-A) of the ABR gene locus to within 220 kb of the p144-D6 locus. A cosmid contig constructed in this region was used to demonstratemore » by fluorescence in situ hybridization that the ABR gene is oriented transcriptionally 5{prime} to 3{prime} toward the telomere. This report provides new physical mapping data for the ABR gene, which has not been previously shown to be deleted in medulloblastoma. These results provide further evidence for the existence of a second tumor suppressor gene distinct from p53 on distal chromosome 17p. 12 refs., 3 figs.« less

Frequent genomic imbalances suggest commonly altered tumour genes in human hepatocarcinogenesis

PubMed Central

Niketeghad, F; Decker, H J; Caselmann, W H; Lund, P; Geissler, F; Dienes, H P; Schirmacher, P

2001-01-01

Hepatocellular carcinoma (HCC) is one of the most frequent-occurring malignant tumours worldwide, but molecular changes of tumour DNA, with the exception of viral integrations and p53 mutations, are poorly understood. In order to search for common macro-imbalances of genomic tumour DNA, 21 HCCs and 3 HCC-cell lines were characterized by comparative genomic hybridization (CGH), subsequent database analyses and in selected cases by fluorescence in situ hybridization (FISH). Chromosomal subregions of 1q, 8q, 17q and 20q showed frequent gains of genomic material, while losses were most prevalent in subregions of 4q, 6q, 13q and 16q. Deleted regions encompass tumour suppressor genes, like RB-1 and the cadherin gene cluster, some of them previously identified as potential target genes in HCC development. Several potential growth- or transformation-promoting genes located in chromosomal subregions showed frequent gains of genomic material. The present study provides a basis for further genomic and expression analyses in HCCs and in addition suggests chromosome 4q to carry a so far unidentified tumour suppressor gene relevant for HCC development. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11531255

Sponge non-metastatic Group I Nme gene/protein - structure and function is conserved from sponges to humans

PubMed Central

2011-01-01

Background Nucleoside diphosphate kinases NDPK are evolutionarily conserved enzymes present in Bacteria, Archaea and Eukarya, with human Nme1 the most studied representative of the family and the first identified metastasis suppressor. Sponges (Porifera) are simple metazoans without tissues, closest to the common ancestor of all animals. They changed little during evolution and probably provide the best insight into the metazoan ancestor's genomic features. Recent studies show that sponges have a wide repertoire of genes many of which are involved in diseases in more complex metazoans. The original function of those genes and the way it has evolved in the animal lineage is largely unknown. Here we report new results on the metastasis suppressor gene/protein homolog from the marine sponge Suberites domuncula, NmeGp1Sd. The purpose of this study was to investigate the properties of the sponge Group I Nme gene and protein, and compare it to its human homolog in order to elucidate the evolution of the structure and function of Nme. Results We found that sponge genes coding for Group I Nme protein are intron-rich. Furthermore, we discovered that the sponge NmeGp1Sd protein has a similar level of kinase activity as its human homolog Nme1, does not cleave negatively supercoiled DNA and shows nonspecific DNA-binding activity. The sponge NmeGp1Sd forms a hexamer, like human Nme1, and all other eukaryotic Nme proteins. NmeGp1Sd interacts with human Nme1 in human cells and exhibits the same subcellular localization. Stable clones expressing sponge NmeGp1Sd inhibited the migratory potential of CAL 27 cells, as already reported for human Nme1, which suggests that Nme's function in migratory processes was engaged long before the composition of true tissues. Conclusions This study suggests that the ancestor of all animals possessed a NmeGp1 protein with properties and functions similar to evolutionarily recent versions of the protein, even before the appearance of true tissues and the origin of tumors and metastasis. PMID:21457554

The GATA transcription factor gene gtaG is required for terminal differentiation in Dictyostelium.

PubMed

Katoh-Kurasawa, Mariko; Santhanam, Balaji; Shaulsky, Gad

2016-03-09

The GATA transcription factor GtaG is conserved in Dictyostelids and essential for terminal differentiation in Dictyostelium discoideum, but its function is not well understood. Here we show that gtaG is expressed in prestalk cells at the anterior region of fingers and in the extending stalk during culmination. The gtaG - phenotype is cell-autonomous in prestalk cells and non-cell-autonomous in prespore cells. Transcriptome analyses reveal that GtaG regulates prestalk gene expression during cell differentiation before culmination and is required for progression into culmination. GtaG-dependent genes include genetic suppressors of the Dd-STATa-defective phenotype as well as Dd-STATa target-genes, including extra cellular matrix genes. We show that GtaG may be involved in the production of two culmination-signaling molecules, cyclic di-GMP and the spore differentiation factor SDF-1 and that addition of c-di-GMP rescues the gtaG - culmination and spore formation deficiencies. We propose that GtaG is a regulator of terminal differentiation that functions in concert with Dd-STATa and controls culmination through regulating c-di-GMP and SDF-1 production in prestalk cells. © 2016. Published by The Company of Biologists Ltd.

Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.

PubMed

Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad

2016-09-01

Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.

Tumor suppressor C-RASSF proteins.

PubMed

Iwasa, Hiroaki; Hossain, Shakhawoat; Hata, Yutaka

2018-05-01

Human genome has ten genes that are collectedly called Ras association domain family (RASSF). RASSF is composed of two subclasses, C-RASSF and N-RASSF. Both N-RASSF and C-RASSF encode Ras association domain-containing proteins and are frequently suppressed by DNA hypermethylation in human cancers. However, C-RASSF and N-RASSF are quite different. Six C-RASSF proteins (RASSF1-6) are characterized by a C-terminal coiled-coil motif named Salvador/RASSF/Hippo domain, while four N-RASSF proteins (RASSF7-10) lack it. C-RASSF proteins interact with mammalian Ste20-like kinases-the core kinases of the tumor suppressor Hippo pathway-and cross-talk with this pathway. Some of them share the same interacting molecules such as MDM2 and exert the tumor suppressor role in similar manners. Nevertheless, each C-RASSF protein has distinct characters. In this review, we summarize our current knowledge of how C-RASSF proteins play tumor suppressor roles and discuss the similarities and differences among C-RASSF proteins.

Silencing of TESTIN by dense biallelic promoter methylation is the most common molecular event in childhood acute lymphoblastic leukaemia

PubMed Central

2010-01-01

Background Aberrant promoter DNA methylation has been reported in childhood acute lymphoblastic leukaemia (ALL) and has the potential to contribute to its onset and outcome. However, few reports demonstrate consistent, prevalent and dense promoter methylation, associated with tumour-specific gene silencing. By screening candidate genes, we have detected frequent and dense methylation of the TESTIN (TES) promoter. Results Bisulfite sequencing showed that 100% of the ALL samples (n = 20) were methylated at the TES promoter, whereas the matched remission (n = 5), normal bone marrow (n = 6) and normal PBL (n = 5) samples were unmethylated. Expression of TES in hyperdiploid, TEL-AML+, BCR-ABL+, and E2A-PBX+ subtypes of B lineage ALL was markedly reduced compared to that in normal bone marrow progenitor cells and in B cells. In addition TES methylation and silencing was demonstrated in nine out of ten independent B ALL propagated as xenografts in NOD/SCID mice. Conclusion In total, 93% of B ALL samples (93 of 100) demonstrated methylation with silencing or reduced expression of the TES gene. Thus, TES is the most frequently methylated and silenced gene yet reported in ALL. TES, a LIM domain-containing tumour suppressor gene and component of the focal adhesion complex, is involved in adhesion, motility, cell-to-cell interactions and cell signalling. Our data implicate TES methylation in ALL and provide additional evidence for the involvement of LIM domain proteins in leukaemogenesis. PMID:20573277

p21WAF1 and tumourigenesis: 20 years after.

PubMed

Warfel, Noel A; El-Deiry, Wafik S

2013-01-01

This review provides an overview of the structure, regulation and physiological functions of p21, the product of the cyclin-dependent kinase inhibitor 1A (CDKN1A) gene, with a focus on its dual role in promoting and repressing biological processes that are hallmarks of tumourigenesis. Recent work has provided a better understanding of the molecular mechanisms of how oncogenic signalling pathways influence p21 expression. In response to cellular stimuli, p21 expression is tightly regulated at transcriptional and post-translational levels through mechanisms involving RNA stabilization, phosphorylation and ubiquitination. As a result, growing evidence reveals that several important tumour suppressor and oncogenic signalling pathways alter p21 expression to elicit their effects on cell cycle progression and survival. Thus, p21 expression can both promote and inhibit tumourigenic processes, depending on the cellular context. Since its discovery, it has become increasingly clear that p21 can function as both a classical tumour suppressor and an oncogene. In order to effectively utilize p21 as a therapeutic target, it will be necessary to design therapeutic strategies that preferentially block the ability of p21 to promote senescence, stem cell renewal and cyclin/CDK activation, while leaving its tumour suppressive functions intact.

Deficiency of Suppressor Enhancer Lin12 1 Like (SEL1L) in Mice Leads to Systemic Endoplasmic Reticulum Stress and Embryonic Lethality*

PubMed Central

Francisco, Adam B.; Singh, Rajni; Li, Shuai; Vani, Anish K.; Yang, Liu; Munroe, Robert J.; Diaferia, Giuseppe; Cardano, Marina; Biunno, Ida; Qi, Ling; Schimenti, John C.; Long, Qiaoming

2010-01-01

Stress in the endoplasmic reticulum (ER) plays an important causal role in the pathogenesis of several chronic diseases such as Alzheimer, Parkinson, and diabetes mellitus. Insight into the genetic determinants responsible for ER homeostasis will greatly facilitate the development of therapeutic strategies for the treatment of these debilitating diseases. Suppressor enhancer Lin12 1 like (SEL1L) is an ER membrane protein and was thought to be involved in the quality control of secreted proteins. Here we show that the mice homozygous mutant for SEL1L were embryonic lethal. Electron microscopy studies revealed a severely dilated ER in the fetal liver of mutant embryos, indicative of alteration in ER homeostasis. Consistent with this, several ER stress responsive genes were significantly up-regulated in the mutant embryos. Mouse embryonic fibroblast cells deficient in SEL1L exhibited activated unfolded protein response at the basal state, impaired ER-associated protein degradation, and reduced protein secretion. Furthermore, markedly increased apoptosis was observed in the forebrain and dorsal root ganglions of mutant embryos. Taken together, our results demonstrate an essential role for SEL1L in protein quality control during mouse embryonic development. PMID:20197277

Deficiency of suppressor enhancer Lin12 1 like (SEL1L) in mice leads to systemic endoplasmic reticulum stress and embryonic lethality.

PubMed

Francisco, Adam B; Singh, Rajni; Li, Shuai; Vani, Anish K; Yang, Liu; Munroe, Robert J; Diaferia, Giuseppe; Cardano, Marina; Biunno, Ida; Qi, Ling; Schimenti, John C; Long, Qiaoming

2010-04-30

Stress in the endoplasmic reticulum (ER) plays an important causal role in the pathogenesis of several chronic diseases such as Alzheimer, Parkinson, and diabetes mellitus. Insight into the genetic determinants responsible for ER homeostasis will greatly facilitate the development of therapeutic strategies for the treatment of these debilitating diseases. Suppressor enhancer Lin12 1 like (SEL1L) is an ER membrane protein and was thought to be involved in the quality control of secreted proteins. Here we show that the mice homozygous mutant for SEL1L were embryonic lethal. Electron microscopy studies revealed a severely dilated ER in the fetal liver of mutant embryos, indicative of alteration in ER homeostasis. Consistent with this, several ER stress responsive genes were significantly up-regulated in the mutant embryos. Mouse embryonic fibroblast cells deficient in SEL1L exhibited activated unfolded protein response at the basal state, impaired ER-associated protein degradation, and reduced protein secretion. Furthermore, markedly increased apoptosis was observed in the forebrain and dorsal root ganglions of mutant embryos. Taken together, our results demonstrate an essential role for SEL1L in protein quality control during mouse embryonic development.

The novel 19q13 KRAB zinc-finger tumour suppressor ZNF382 is frequently methylated in oesophageal squamous cell carcinoma and antagonises Wnt/β-catenin signalling.

PubMed

Zhang, Chong; Xiang, Tingxiu; Li, Shuman; Ye, Lin; Feng, Yixiao; Pei, Lijiao; Li, Lili; Wang, Xiangyu; Sun, Ran; Tao, Qian; Ren, Guosheng

2018-05-14

Zinc finger proteins (ZFPs) are the largest transcription factor family in mammals. About one-third of ZFPs are Krüppel-associated box domain (KRAB)-ZFPs and involved in the regulation of cell differentiation/proliferation/apoptosis and neoplastic transformation. We recently identified ZNF382 as a novel KRAB-ZFP epigenetically inactivated in multiple cancers due to frequent promoter CpG methylation. However, its epigenetic alterations, biological functions/mechanism and clinical significance in oesophageal squamous cell carcinoma (ESCC) are still unknown. Here, we demonstrate that ZNF382 expression was suppressed in ESCC due to aberrant promoter methylation, but highly expressed in normal oesophagus tissues. ZNF382 promoter methylation is correlated with ESCC differentiation levels. Restoration of ZNF382 expression in silenced ESCC cells suppressed tumour cell proliferation and metastasis through inducing cell apoptosis. Importantly, ZNF382 suppressed Wnt/β-catenin signalling and downstream target gene expression, likely through binding directly to FZD1 and DVL2 promoters. In summary, our findings demonstrate that ZNF382 functions as a bona fide tumour suppressor inhibiting ESCC pathogenesis through inhibiting the Wnt/β-catenin signalling pathway.

Molecular mechanisms of long noncoding RNAs on gastric cancer

PubMed Central

Li, Tianwen; Mo, Xiaoyan; Fu, Liyun; Xiao, Bingxiu; Guo, Junming

2016-01-01

Long noncoding RNAs (lncRNAs) are non-protein coding transcripts longer than 200 nucleotides. Aberrant expression of lncRNAs has been found associated with gastric cancer, one of the most malignant tumors. By complementary base pairing with mRNAs or forming complexes with RNA binding proteins (RBPs), some lncRNAs including GHET1, MALAT1, and TINCR may mediate mRNA stability and splicing. Other lncRNAs, such as BC032469, GAPLINC, and HOTAIR, participate in the competing endogenous RNA (ceRNA) network. Under certain circumstances, ANRIL, GACAT3, H19, MEG3, and TUSC7 exhibit their biological roles by associating with microRNAs (miRNAs). By recruiting histone-modifying complexes, ANRIL, FENDRR, H19, HOTAIR, MALAT1, and PVT1 may inhibit the transcription of target genes in cis or trans. Through these mechanisms, lncRNAs form RNA-dsDNA triplex. CCAT1, GAPLINC, GAS5, H19, MEG3, and TUSC7 play oncogenic or tumor suppressor roles by correlated with tumor suppressor P53 or onco-protein c-Myc, respectively. In conclusion, interaction with DNA, RNA and proteins is involved in lncRNAs’ participation in gastric tumorigenesis and development. PMID:26788991

AICAR Antiproliferative Properties Involve the AMPK-Independent Activation of the Tumor Suppressors LATS 1 and 2.

PubMed

Philippe, Chloé; Pinson, Benoît; Dompierre, Jim; Pantesco, Véronique; Viollet, Benoît; Daignan-Fornier, Bertrand; Moenner, Michel

2018-06-01

AICAR (Acadesine) is a pharmacological precursor of purine nucleotide biosynthesis with anti-tumoral properties. Although recognized as an AMP mimetic activator of the protein kinase AMPK, the AICAR monophosphate derivative ZMP was also shown to mediate AMPK-independent effects. In order to unveil these AMPK-independent functions, we performed a transcriptomic analysis in AMPKα1/α2 double knockout murine embryonic cells. Kinetic analysis of the cellular response to AICAR revealed the up-regulation of the large tumor suppressor kinases (Lats) 1 and 2 transcripts, followed by the repression of numerous genes downstream of the transcriptional regulators Yap1 and Taz. This transcriptional signature, together with the observation of increased levels in phosphorylation of Lats1 and Yap1 proteins, suggested that the Hippo signaling pathway was activated by AICAR. This effect was observed in both fibroblasts and epithelial cells. Knockdown of Lats1/2 prevented the cytoplasmic delocalization of Yap1/Taz proteins in response to AICAR and conferred a higher resistance to the drug. These results indicate that activation of the most downstream steps of the Hippo cascade participates to the antiproliferative effects of AICAR. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control

PubMed Central

Zhao, Bin; Wei, Xiaomu; Li, Weiquan; Udan, Ryan S.; Yang, Qian; Kim, Joungmok; Xie, Joe; Ikenoue, Tsuneo; Yu, Jindan; Li, Li; Zheng, Pan; Ye, Keqiang; Chinnaiyan, Arul; Halder, Georg; Lai, Zhi-Chun; Guan, Kun-Liang

2007-01-01

The Hippo pathway plays a key role in organ size control by regulating cell proliferation and apoptosis in Drosophila. Although recent genetic studies have shown that the Hippo pathway is regulated by the NF2 and Fat tumor suppressors, the physiological regulations of this pathway are unknown. Here we show that in mammalian cells, the transcription coactivator YAP (Yes-associated protein), is inhibited by cell density via the Hippo pathway. Phosphorylation by the Lats tumor suppressor kinase leads to cytoplasmic translocation and inactivation of the YAP oncoprotein. Furthermore, attenuation of this phosphorylation of YAP or Yorkie (Yki), the Drosophila homolog of YAP, potentiates their growth-promoting function in vivo. Moreover, YAP overexpression regulates gene expression in a manner opposite to cell density, and is able to overcome cell contact inhibition. Inhibition of YAP function restores contact inhibition in a human cancer cell line bearing deletion of Salvador (Sav), a Hippo pathway component. Interestingly, we observed that YAP protein is elevated and nuclear localized in some human liver and prostate cancers. Our observations demonstrate that YAP plays a key role in the Hippo pathway to control cell proliferation in response to cell contact. PMID:17974916

Nonhistone protein acetylation as cancer therapy targets

PubMed Central

Singh, Brahma N; Zhang, Guanghua; Hwa, Yi L; Li, Jinping; Dowdy, Sean C; Jiang, Shi-Wen

2012-01-01

Acetylation and deacetylation are counteracting, post-translational modifications that affect a large number of histone and nonhistone proteins. The significance of histone acetylation in the modification of chromatin structure and dynamics, and thereby gene transcription regulation, has been well recognized. A steadily growing number of nonhistone proteins have been identified as acetylation targets and reversible lysine acetylation in these proteins plays an important role(s) in the regulation of mRNA stability, protein localization and degradation, and protein–protein and protein–DNA interactions. The recruitment of histone acetyltransferases (HATs) and histone deacetylases (HDACs) to the transcriptional machinery is a key element in the dynamic regulation of genes controlling cellular proliferation, differentiation and apoptosis. Many nonhistone proteins targeted by acetylation are the products of oncogenes or tumor-suppressor genes and are directly involved in tumorigenesis, tumor progression and metastasis. Aberrant activity of HDACs has been documented in several types of cancers and HDAC inhibitors (HDACi) have been employed for therapeutic purposes. Here we review the published literature in this field and provide updated information on the regulation and function of nonhistone protein acetylation. While concentrating on the molecular mechanism and pathways involved in the addition and removal of the acetyl moiety, therapeutic modalities of HDACi are also discussed. PMID:20553216

In Vitro Protective Effects of Lycium barbarum Berries Cultivated in Umbria (Italy) on Human Hepatocellular Carcinoma Cells.

PubMed

Ceccarini, M R; Vannini, S; Cataldi, S; Moretti, M; Villarini, M; Fioretti, B; Albi, E; Beccari, T; Codini, M

2016-01-01

Lycium barbarum is a famous plant in the traditional Chinese medicine. The plant is known to have health-promoting bioactive components. The properties of Lycium barbarum berries cultivated in Umbria (Italy) and their effect on human hepatocellular carcinoma cells (HepG2) have been investigated in this work. The obtained results demonstrated that the Lycium barbarum berries from Umbria region display high antioxidant properties evaluated by total phenolic content and ORAC method, on hydrophilic and lipophilic fractions. Moreover, on HepG2 cell line Lycium barbarum berries extract did not change cell viability analyzed by MTT and Trypan blue exclusion assay and did not induce genotoxic effect analyzed by comet assay. Furthermore, it was demonstrated, for the first time, that the berries extract showed a protective effect on DNA damage, expressed as antigenotoxic activity in vitro . Finally, Lycium barbarum berries extract was able to modulate the expression of genes involved in oxidative stress, proliferation, apoptosis, and cancer. In particular, downexpression of genes involved in tumor migration and invasion (CCL5), in increased risk of metastasis and antiapoptotic signal (DUSP1), and in carcinogenesis (GPx-3 and PTGS1), together with overexpression of tumor suppressor gene (MT3), suggested that Umbrian Lycium barbarum berries could play a protective role against hepatocellular carcinoma.

Tumour suppressor menin is essential for development of the pancreatic endocrine cells.

PubMed

Fontanière, Sandra; Duvillié, Bertrand; Scharfmann, Raphaël; Carreira, Christine; Wang, Zhao-Qi; Zhang, Chang-Xian

2008-11-01

Mutations of the multiple endocrine neoplasia type 1 (MEN1) gene predispose patients to MEN1 that affects mainly endocrine tissues, suggesting important physiological functions of the gene in adult endocrine cells. Homozygous disruption of Men1 in mice causes embryonic lethality, whereas the eventual involvement of the gene in embryonic development of the endocrine cells remains unknown. Here, we show that homozygous Men1 knockout mice demonstrate a reduced number of glucagon-positive cells in the E12.5 pancreatic bud associated with apoptosis, whereas the exocrine pancreas development in these mice is not affected. Our data suggest that menin is involved in the survival of the early pancreatic endocrine cells during the first developmental transition. Furthermore, chimerism assay revealed that menin has an autonomous and specific effect on the development of islet cells. In addition, using pancreatic bud culture mimicking the differentiation of alpha- and beta-cells during the second transition, we show that loss of menin leads to the failure of endocrine cell development, altered pancreatic structure and a markedly decreased number of cells expressing neurogenin 3, indicating that menin is also required at this stage of the endocrine pancreas development. Taken together, our results suggest that menin plays an indispensable role in the development of the pancreatic endocrine cells.

Somatic mutations in cancer: Stochastic versus predictable.

PubMed

Gold, Barry

2017-02-01

The origins of human cancers remain unclear except for a limited number of potent environmental mutagens, such as tobacco and UV light, and in rare cases, familial germ line mutations that affect tumor suppressor genes or oncogenes. A significant component of cancer etiology has been deemed stochastic and correlated with the number of stem cells in a tissue, the number of times the stem cells divide and a low incidence of random DNA polymerase errors that occur during each cell division. While somatic mutations occur during each round of DNA replication, mutations in cancer driver genes are not stochastic. Out of a total of 2843 codons, 1031 can be changed to stop codons by a single base substitution in the tumor suppressor APC gene, which is mutated in 76% of colorectal cancers (CRC). However, the nonsense mutations, which comprise 65% of all the APC driver mutations in CRC, are not random: 43% occur at Arg CGA codons, although they represent <3% of the codons. In TP53, CGA codons comprise <3% of the total 393 codons but they account for 72% and 39% of the mutations in CRC and ovarian cancer OVC, respectively. This mutation pattern is consistent with the kinetically slow, but not stochastic, hydrolytic deamination of 5-methylcytosine residues at specific methylated CpG sites to afford T·G mismatches that lead to C→T transitions and stop codons at CGA. Analysis of nonsense mutations in CRC, OVC and a number of other cancers indicates the need to expand the predictable risk factors for cancer to include, in addition to random polymerase errors, the methylation status of gene body CGA codons in tumor suppressor genes. Copyright © 2017. Published by Elsevier B.V.

Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

PubMed

Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

2016-11-01

We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Metformin inhibits epithelial–mesenchymal transition in prostate cancer cells: Involvement of the tumor suppressor miR30a and its target gene SOX4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jing; Shen, Chengwu; Wang, Lin

2014-09-26

Highlights: • Metformin inhibits TGF-β-induced EMT in prostate cancer (PCa) cells. • Metformin upregulates tumor suppressor miR30a and downregulates SOX4 in PCa cells. • SOX4 is a target gene of miR30a. - Abstract: Tumor metastasis is the leading cause of mortality and morbidity of prostate cancer (PCa) patients. Epithelial–mesenchymal transition (EMT) plays a critical role in cancer progression and metastasis. Recent evidence suggested that diabetic patients treated with metformin have lower PCa risk and better prognosis. This study was aimed to investigate the effects of metformin on EMT in PCa cells and the possible microRNA (miRNA)-based mechanisms. MiRNAs have beenmore » shown to regulate various processes of cancer metastasis. We herein showed that metformin significantly inhibits proliferation of Vcap and PC-3 cells, induces G0/G1 cell cycle arrest and inhibits invasiveness and motility capacity of Vcap cells. Metformin could inhibit TGF-β-induced EMT in Vcap cells, as manifested by inhibition of the increase of N-cadherin (p = 0.013), Vimentin (p = 0.002) and the decrease of E-cadherin (p = 0.0023) and β-catenin (p = 0.034) at mRNA and protein levels. Notably, we demonstrated significant upregulation of miR30a levels by metformin (P < 0.05) and further experiments indicated that miR30a significantly inhibits proliferation and EMT process of Vcap cells. Interestingly, we identified that SOX4, a previously reported oncogenic transcriptional factor and modulator of EMT, is a direct target gene of miR30a. Finally, we screened the expression of miR30a and SOX4 in 84 PCa cases with radical prostatectomy. Of note, SOX4 overexpression is significantly associated with decreased levels of miR30a in PCa cases. In all, our study suggested that inhibition of EMT by metformin in PCa cells may involve upregulation of miR30a and downregulation of SOX4.« less

Structure-Based Analysis Reveals Cancer Missense Mutations Target Protein Interaction Interfaces.

PubMed

Engin, H Billur; Kreisberg, Jason F; Carter, Hannah

2016-01-01

Recently it has been shown that cancer mutations selectively target protein-protein interactions. We hypothesized that mutations affecting distinct protein interactions involving established cancer genes could contribute to tumor heterogeneity, and that novel mechanistic insights might be gained into tumorigenesis by investigating protein interactions under positive selection in cancer. To identify protein interactions under positive selection in cancer, we mapped over 1.2 million nonsynonymous somatic cancer mutations onto 4,896 experimentally determined protein structures and analyzed their spatial distribution. In total, 20% of mutations on the surface of known cancer genes perturbed protein-protein interactions (PPIs), and this enrichment for PPI interfaces was observed for both tumor suppressors (Odds Ratio 1.28, P-value < 10(-4)) and oncogenes (Odds Ratio 1.17, P-value < 10(-3)). To study this further, we constructed a bipartite network representing structurally resolved PPIs from all available human complexes in the Protein Data Bank (2,864 proteins, 3,072 PPIs). Analysis of frequently mutated cancer genes within this network revealed that tumor-suppressors, but not oncogenes, are significantly enriched with functional mutations in homo-oligomerization regions (Odds Ratio 3.68, P-Value < 10(-8)). We present two important examples, TP53 and beta-2-microglobulin, for which the patterns of somatic mutations at interfaces provide insights into specifically perturbed biological circuits. In patients with TP53 mutations, patient survival correlated with the specific interactions that were perturbed. Moreover, we investigated mutations at the interface of protein-nucleotide interactions and observed an unexpected number of missense mutations but not silent mutations occurring within DNA and RNA binding sites. Finally, we provide a resource of 3,072 PPI interfaces ranked according to their mutation rates. Analysis of this list highlights 282 novel candidate cancer genes that encode proteins participating in interactions that are perturbed recurrently across tumors. In summary, mutation of specific protein interactions is an important contributor to tumor heterogeneity and may have important implications for clinical outcomes.

Cancer gene discovery: exploiting insertional mutagenesis

PubMed Central

Ranzani, Marco; Annunziato, Stefano; Adams, David J.; Montini, Eugenio

2013-01-01

Insertional mutagenesis has been utilized as a functional forward genetics screen for the identification of novel genes involved in the pathogenesis of human cancers. Different insertional mutagens have been successfully used to reveal new cancer genes. For example, retroviruses (RVs) are integrating viruses with the capacity to induce the deregulation of genes in the neighborhood of the insertion site. RVs have been employed for more than 30 years to identify cancer genes in the hematopoietic system and mammary gland. Similarly, another tool that has revolutionized cancer gene discovery is the cut-and-paste transposons. These DNA elements have been engineered to contain strong promoters and stop cassettes that may function to perturb gene expression upon integration proximal to genes. In addition, complex mouse models characterized by tissue-restricted activity of transposons have been developed to identify oncogenes and tumor suppressor genes that control the development of a wide range of solid tumor types, extending beyond those tissues accessible using RV-based approaches. Most recently, lentiviral vectors (LVs) have appeared on the scene for use in cancer gene screens. LVs are replication defective integrating vectors that have the advantage of being able to infect non-dividing cells, in a wide range of cell types and tissues. In this review, we describe the various insertional mutagens focusing on their advantages/limitations and we discuss the new and promising tools that will improve the insertional mutagenesis screens of the future. PMID:23928056

CNVs affecting cancer predisposing genes (CPGs) detected as incidental findings in routine germline diagnostic chromosomal microarray (CMA) testing.

PubMed

Innes, Josie; Reali, Lisa; Clayton-Smith, Jill; Hall, Georgina; Lim, Derek Hk; Burghel, George J; French, Kim; Khan, Unzela; Walker, Daniel; Lalloo, Fiona; Evans, D Gareth R; McMullan, Dominic; Maher, Eamonn R; Woodward, Emma R

2018-02-01

Identification of CNVs through chromosomal microarray (CMA) testing is the first-line investigation in individuals with learning difficulties/congenital abnormalities. Although recognised that CMA testing may identify CNVs encompassing a cancer predisposition gene (CPG), limited information is available on the frequency and nature of such results. We investigated CNV gains and losses affecting 39 CPGs in 3366 pilot index case individuals undergoing CMA testing, and then studied an extended cohort (n=10 454) for CNV losses at 105 CPGs and CNV gains at 9 proto-oncogenes implicated in inherited cancer susceptibility. In the pilot cohort, 31/3366 (0.92%) individuals had a CNV involving one or more of 16/39 CPGs. 30/31 CNVs involved a tumour suppressor gene (TSG), and 1/30 a proto-oncogene (gain of MET ). BMPR1A , TSC2 and TMEM127 were affected in multiple cases. In the second stage analysis, 49/10 454 (0.47%) individuals in the extended cohort had 50 CNVs involving 24/105 CPGs. 43/50 CNVs involved a TSG and 7/50 a proto-oncogene (4 gains, 3 deletions). The most frequently involved genes, FLCN (n=10) and SDHA (n=7), map to the Smith-Magenis and cri-du-chat regions, respectively. Incidental identification of a CNV involving a CPG is not rare and poses challenges for future cancer risk estimation. Prospective data collection from CPG-CNV cohorts ascertained incidentally and through syndromic presentations is required to determine the risks posed by specific CNVs. In particular, ascertainment and investigation of adults with CPG-CNVs and adults with learning disability and cancer, could provide important information to guide clinical management and surveillance. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

CHL1 gene acts as a tumor suppressor in human neuroblastoma.

PubMed

Ognibene, Marzia; Pagnan, Gabriella; Marimpietri, Danilo; Cangelosi, Davide; Cilli, Michele; Benedetti, Maria Chiara; Boldrini, Renata; Garaventa, Alberto; Frassoni, Francesco; Eva, Alessandra; Varesio, Luigi; Pistoia, Vito; Pezzolo, Annalisa

2018-05-25

Neuroblastoma is an aggressive, relapse-prone childhood tumor of the sympathetic nervous system that accounts for 15% of pediatric cancer deaths. A distal portion of human chromosome 3p is often deleted in neuroblastoma, this region may contain one or more putative tumor suppressor genes. A 2.54 Mb region at 3p26.3 encompassing the smallest region of deletion pinpointed CHL1 gene, the locus for neuronal cell adhesion molecule close homolog of L1. We found that low CHL1 expression predicted poor outcome in neuroblastoma patients. Here we have used two inducible cell models to analyze the impact of CHL1 on neuroblastoma biology. Over-expression of CHL1 induced neurite-like outgrowth and markers of neuronal differentiation in neuroblastoma cells, halted tumor progression, inhibited anchorage-independent colony formation, and suppressed the growth of human tumor xenografts. Conversely, knock-down of CHL1 induced neurite retraction and activation of Rho GTPases, enhanced cell proliferation and migration, triggered colony formation and anchorage-independent growth, accelerated growth in orthotopic xenografts mouse model. Our findings demonstrate unambiguously that CHL1 acts as a regulator of proliferation and differentiation of neuroblastoma cells through inhibition of the MAPKs and Akt pathways. CHL1 is a novel candidate tumor suppressor in neuroblastoma, and its associated pathways may represent a promising target for future therapeutic interventions.

Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.

PubMed

Hickman, Mark J; Petti, Allegra A; Ho-Shing, Olivia; Silverman, Sanford J; McIsaac, R Scott; Lee, Traci A; Botstein, David

2011-11-01

A yeast strain lacking Met4p, the primary transcriptional regulator of the sulfur assimilation pathway, cannot synthesize methionine. This apparently simple auxotroph did not grow well in rich media containing excess methionine, forming small colonies on yeast extract/peptone/dextrose plates. Faster-growing large colonies were abundant when overnight cultures were plated, suggesting that spontaneous suppressors of the growth defect arise with high frequency. To identify the suppressor mutations, we used genome-wide single-nucleotide polymorphism and standard genetic analyses. The most common suppressors were loss-of-function mutations in OPI1, encoding a transcriptional repressor of phospholipid metabolism. Using a new system that allows rapid and specific degradation of Met4p, we could study the dynamic expression of all genes following loss of Met4p. Experiments using this system with and without Opi1p showed that Met4 activates and Opi1p represses genes that maintain levels of S-adenosylmethionine (SAM), the substrate for most methyltransferase reactions. Cells lacking Met4p grow normally when either SAM is added to the media or one of the SAM synthetase genes is overexpressed. SAM is used as a methyl donor in three Opi1p-regulated reactions to create the abundant membrane phospholipid, phosphatidylcholine. Our results show that rapidly growing cells require significant methylation, likely for the biosynthesis of phospholipids.

RASSF10 is epigenetically silenced and functions as a tumor suppressor in gastric cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Ziran; Chen, Xia; Chen, Ji

2013-03-22

Highlights: ► Epigenetic silencing of RASSF10 gene expression in GC cells. ► RASSF10 overexpression inhibits cell growth in vitro and in vivo. ► RASSF10 induces apoptosis in GC cells. ► RASSF10 inhibits Wnt/β-catenin signaling pathway. -- Abstract: Ras association domain family (RASSF) proteins are encoded by several tumor suppressor genes that are frequently silenced in human cancers. In this study, we investigated RASSF10 as a target of epigenetic inactivation and examined its functions as a tumor suppressor in gastric cancer. RASSF10 was silenced in six out of eight gastric cancer cell lines. Loss or downregulation of RASSF10 expression was associatedmore » with promoter hypermethylation, and could be restored by a demethylating agent. Overexpression of RASSF10 in gastric cancer cell lines (JRST, BGC823) suppressed cell growth and colony formation, and induced apoptosis, whereas RASSF10 depletion promoted cell growth. In xenograft animal experiments, RASSF10 overexpression effectively repressed tumor growth. Mechanistic investigations revealed that RASSF10 inhibited tumor growth by blocking activation of β-catenin and its downstream targets including c-Myc, cyclinD1, cyclinE1, peroxisome proliferator-activated receptor δ, transcription factor 4, transcription factor 1 and CD44. In conclusion, the results of this study provide insight into the role of RASSF10 as a novel functional tumor suppressor in gastric cancer through inhibition of the Wnt/β-catenin signaling pathway.« less

Adenovirus-mediated p53 gene delivery inhibits 9L glioma growth in rats.

PubMed

Badie, B; Drazan, K E; Kramar, M H; Shaked, A; Black, K L

1995-06-01

Adenoviral vectors have recently been shown to effectively deliver genes into a variety of tissues. Since these vectors have some advantages over the more extensively investigated retroviruses, we studied the effect of two replication-defective adenovectors bearing human wild type tumor suppressor gene p53 (Adp53) and Escherichia coli beta-galactosidase gene (AdLacZ) on 9L glioma cells. Successful in vitro gene transfer was shown by DNA polymerase chain reaction (PCR), and expression was confirmed by reverse transcriptase RNA PCR and Western blot analyses. Transduction of 9L cells with the Adp53 inhibited cell growth and induced phenotypic changes consistent with cell death at low titers, while AdLacZ caused cytopathic changes only at high titers. Stereotactic injection of AdLacZ (10(7) plaque forming units) into tumor bed stained 25 to 30% of tumor cells at the site of vector delivery. Injection of Adp53 (10(7) plaque forming units), but not AdLacZ (controls), into established 4-day old 9L glioma brain tumors decreased tumor volume by 40% after 14 days. As a step toward gene therapy of brain tumors using replication-defective adenoviruses, these data support the use of tumor suppressor gene transfer for in vivo treatment of whole animal brain tumor models.

Adenovirus small E1A employs the lysine acetylases p300/CBP and tumor suppressor Rb to repress select host genes and promote productive virus infection.

PubMed

Ferrari, Roberto; Gou, Dawei; Jawdekar, Gauri; Johnson, Sarah A; Nava, Miguel; Su, Trent; Yousef, Ahmed F; Zemke, Nathan R; Pellegrini, Matteo; Kurdistani, Siavash K; Berk, Arnold J

2014-11-12

Oncogenic transformation by adenovirus small e1a depends on simultaneous interactions with the host lysine acetylases p300/CBP and the tumor suppressor RB. How these interactions influence cellular gene expression remains unclear. We find that e1a displaces RBs from E2F transcription factors and promotes p300 acetylation of RB1 K873/K874 to lock it into a repressing conformation that interacts with repressive chromatin-modifying enzymes. These repressing p300-e1a-RB1 complexes specifically interact with host genes that have unusually high p300 association within the gene body. The TGF-β, TNF-, and interleukin-signaling pathway components are enriched among such p300-targeted genes. The p300-e1a-RB1 complex condenses chromatin in a manner dependent on HDAC activity, p300 lysine acetylase activity, the p300 bromodomain, and RB K873/K874 and e1a K239 acetylation to repress host genes that would otherwise inhibit productive virus infection. Thus, adenovirus employs e1a to repress host genes that interfere with viral replication. Copyright © 2014 Elsevier Inc. All rights reserved.

Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

PubMed

Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

2000-12-15

Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

Mutations of the Birt–Hogg–Dubé gene in patients with multiple lung cysts and recurrent pneumothorax

PubMed Central

Gunji, Yoko; Akiyoshi, Taeko; Sato, Teruhiko; Kurihara, Masatoshi; Tominaga, Shigeru; Takahashi, Kazuhisa; Seyama, Kuniaki

2007-01-01

Rationale Birt–Hogg–Dubé (BHD) syndrome, a rare inherited autosomal genodermatosis first recognised in 1977, is characterised by fibrofolliculomas of the skin, an increased risk of renal tumours and multiple lung cysts with spontaneous pneumothorax. The BHD gene, a tumour suppressor gene located at chromosome 17p11.2, has recently been shown to be defective. Recent genetic studies revealed that clinical pictures of the disease may be variable and may not always present the full expression of the phenotypes. Objectives We hypothesised that mutations of the BHD gene are responsible for patients who have multiple lung cysts of which the underlying causes have not yet been elucidated. Methods We studied eight patients with lung cysts, without skin and renal disease; seven of these patients have a history of spontaneous pneumothorax and five have a family history of pneumothorax. The BHD gene was examined using PCR, denaturing high‐performance liquid chromatography and direct sequencing. Main results We found that five of the eight patients had a BHD germline mutation. All mutations were unique and four of them were novel, including three different deletions or insertions detected in exons 6, 12 and 13, respectively and one splice acceptor site mutation in intron 5 resulting in an in‐frame deletion of exon 6. Conclusions We found that germline mutations of the BHD gene are involved in some patients with multiple lung cysts and pneumothorax. Pulmonologists should be aware that BHD syndrome can occur as an isolated phenotype with pulmonary involvement. PMID:17496196

Frequent epigenetic inactivation of KIBRA, an upstream member of the Salvador/Warts/Hippo (SWH) tumor suppressor network, is associated with specific genetic event in B-cell acute lymphocytic leukemia

PubMed Central

Hill, Victoria K; Dunwell, Thomas; Catchpoole, Daniel; Krex, Dietmar; Brini, Anna T; Griffiths, Mike; Craddock, Charles; Maher, Eamonn R

2011-01-01

The WW-domain containing protein KIBRA has recently been identified as a new member of the Salvador/Warts/Hippo (SWH) pathway in Drosophila and is shown to act as a tumor suppressor gene in Drosophila. This pathway is conserved in humans and members of the pathway have been shown to act as tumor suppressor genes in mammalian systems. We determined the methylation status of the 5′ CpG island associated with the KIBRA gene in human cancers. In a large panel of cancer cell lines representing common epithelial cancers KIBRA was unmethylated. But in pediatric acute lymphocytic leukemia (ALL) cell lines KIBRA showed frequent hypermethylation and silencing of gene expression, which could be reversed by treatment with 5-aza-2′-deoxycytidine. In ALL patient samples KIBRA was methylated in 70% B-ALL but was methylated in <20% T-ALL leukemia (p = 0.0019). In B-ALL KIBRA methylation was associated with ETV6/RUNX1 [t(12;21) (p13;q22)] chromosomal translocation (p = 0.0082) phenotype, suggesting that KIBRA may play an important role in t(12;21) leukemogenesis. In ALL paired samples at diagnosis and remission KIBRA methylation was seen in diagnostic but not in any of the remission samples accompanied by loss of KIBRA expression in disease state compared to patients in remission. Hence KIBRA methylation occurs frequently in B-cell acute lymphocytic leukemia but not in epithelial cancers and is linked to specific genetic event in B-ALL. PMID:21173572

P53 Suppression of Homologous Recombination and Tumorigenesis

DTIC Science & Technology

2012-01-01

mutation acted on both rad51 dependent gene conversion events and deletion events (6). Willers et al. also showed an increase in recombination...suffer from sarcomas. MEFs from these mice show aneuploidy, allelic loss and gene amplification. Most of these germline mutations are missense...the absence of tumor suppressor gene activity, such as p53, results in increased genomic instability and increased cancer predisposition

Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii.

PubMed

Lin, Huawen; Zhang, Zhengyan; Iomini, Carlo; Dutcher, Susan K

2018-03-01

Intraflagellar transport moves proteins in and out of flagella/cilia and it is essential for the assembly of these organelles. Using whole-genome sequencing, we identified splice site mutations in two IFT genes, IFT81 ( fla9 ) and IFT121 ( ift121-2 ), which lead to flagellar assembly defects in the unicellular green alga Chlamydomonas reinhardtii The splicing defects in these ift mutants are partially corrected by mutations in two conserved spliceosome proteins, DGR14 and FRA10. We identified a dgr14 deletion mutant, which suppresses the 3' splice site mutation in IFT81 , and a frameshift mutant of FRA10 , which suppresses the 5' splice site mutation in IFT121 Surprisingly, we found dgr14-1 and fra10 mutations suppress both splice site mutations. We suggest these two proteins are involved in facilitating splice site recognition/interaction; in their absence some splice site mutations are tolerated. Nonsense mutations in SMG1 , which is involved in nonsense-mediated decay, lead to accumulation of aberrant transcripts and partial restoration of flagellar assembly in the ift mutants. The high density of introns and the conservation of noncore splicing factors, together with the ease of scoring the ift mutant phenotype, make Chlamydomonas an attractive organism to identify new proteins involved in splicing through suppressor screening. © 2018 The Authors.

Trefoil factor family peptides--friends or foes?

PubMed

Busch, Maike; Dünker, Nicole

2015-12-01

Trefoil factor family (TFF) peptides are a group of molecules bearing a characteristic three-loop trefoil domain. They are mainly secreted in mucous epithelia together with mucins but are also synthesized in the nervous system. For many years, TFF peptides were only known for their wound healing and protective function, e.g. in epithelial protection and restitution. However, experimental evidence has emerged supporting a pivotal role of TFF peptides in oncogenic transformation, tumorigenesis and metastasis. Deregulated expression of TFF peptides at the gene and protein level is obviously implicated in numerous cancers, and opposing functions as oncogenes and tumor suppressors have been described. With regard to the regulation of TFF expression, epigenetic mechanisms as well as the involvement of various miRNAs are new, promising aspects in the field of cancer research. This review will summarize current knowledge about the expression and regulation of TFF peptides and the involvement of TFF peptides in tumor biology and cancerogenesis.

Distinct MicroRNA Expression Profile and Targeted Biological Pathways in Functional Myeloid-derived Suppressor Cells Induced by Δ9-Tetrahydrocannabinol in Vivo

PubMed Central

Hegde, Venkatesh L.; Tomar, Sunil; Jackson, Austin; Rao, Roshni; Yang, Xiaoming; Singh, Udai P.; Singh, Narendra P.; Nagarkatti, Prakash S.; Nagarkatti, Mitzi

2013-01-01

Δ9-Tetrahydrocannabinol (THC), the major bioactive component of marijuana, has been shown to induce functional myeloid-derived suppressor cells (MDSCs) in vivo. Here, we studied the involvement of microRNA (miRNA) in this process. CD11b+Gr-1+ MDSCs were purified from peritoneal exudates of mice administered with THC and used for genome-wide miRNA profiling. Expression of CD31 and Ki-67 confirmed that the THC-MDSCs were immature and proliferating. THC-induced MDSCs exhibited distinct miRNA expression signature relative to various myeloid cells and BM precursors. We identified 13 differentially expressed (>2-fold) miRNA in THC-MDSCs relative to control BM precursors. In silico target prediction for these miRNA and pathway analysis using multiple bioinformatics tools revealed significant overrepresentation of Gene Ontology clusters within hematopoiesis, myeloid cell differentiation, and regulation categories. Insulin-like growth factor 1 signaling involved in cell growth and proliferation, and myeloid differentiation pathways were among the most significantly enriched canonical pathways. Among the differentially expressed, miRNA-690 was highly overexpressed in THC-MDSCs (∼16-fold). Transcription factor CCAAT/enhancer-binding protein α (C/EBPα) was identified as a potential functional target of miR-690. Supporting this, C/EBPα expression was attenuated in THC-MDSCs as compared with BM precursors and exhibited an inverse relation with miR-690. miR-690 knockdown using peptide nucleic acid-antagomiR was able to unblock and significantly increase C/EBPα expression establishing the functional link. Further, CD11b+Ly6G+Ly6C+ and CD11b+Ly6G−Ly6C+ purified subtypes showed high levels of miR-690 with attenuated C/EBPα expression. Moreover, EL-4 tumor-elicited MDSCs showed increased miR-690 expression. In conclusion, miRNA are significantly altered during the generation of functional MDSC from BM. Select miRNA such as miR-690 targeting genes involved in myeloid expansion and differentiation likely play crucial roles in this process and therefore in cannabinoid-induced immunosuppression. PMID:24202177

Gene expression meta-analysis identifies chromosomal regions and candidate genes involved in breast cancer metastasis.

PubMed

Thomassen, Mads; Tan, Qihua; Kruse, Torben A

2009-01-01

Breast cancer cells exhibit complex karyotypic alterations causing deregulation of numerous genes. Some of these genes are probably causal for cancer formation and local growth whereas others are causal for the various steps of metastasis. In a fraction of tumors deregulation of the same genes might be caused by epigenetic modulations, point mutations or the influence of other genes. We have investigated the relation of gene expression and chromosomal position, using eight datasets including more than 1200 breast tumors, to identify chromosomal regions and candidate genes possibly causal for breast cancer metastasis. By use of "Gene Set Enrichment Analysis" we have ranked chromosomal regions according to their relation to metastasis. Overrepresentation analysis identified regions with increased expression for chromosome 1q41-42, 8q24, 12q14, 16q22, 16q24, 17q12-21.2, 17q21-23, 17q25, 20q11, and 20q13 among metastasizing tumors and reduced gene expression at 1p31-21, 8p22-21, and 14q24. By analysis of genes with extremely imbalanced expression in these regions we identified DIRAS3 at 1p31, PSD3, LPL, EPHX2 at 8p21-22, and FOS at 14q24 as candidate metastasis suppressor genes. Potential metastasis promoting genes includes RECQL4 at 8q24, PRMT7 at 16q22, GINS2 at 16q24, and AURKA at 20q13.

Chromosomal Translocations: Chicken or Egg? | Center for Cancer Research

Cancer.gov

Many tumor cells have abnormal chromosomes. Some of these abnormalities are caused by chromosomal translocations, which occur when two chromosomes break and incorrectly rejoin, resulting in an exchange of genetic material. Translocations can activate oncogenes, silence tumor suppressor genes, or result in the creation of completely new fusion gene products. While there is

Diet-influenced chromatin modification and expression of chemopreventive genes by the soy peptide, lunasin

USDA-ARS?s Scientific Manuscript database

Epigenetic silencing of tumor suppressors and pro-apoptosis genes in cancer cells, unlike genetic mutations, can potentially be reversed by the use of DNA demethylating agents (to remove methylation marks on the DNA) and HDAC inhibitors (to increase histone acetylation). It is now well established t...

Problem-Solving Test: The Mechanism of Action of a Human Papilloma Virus Oncoprotein

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: human papilloma virus; cervical cancer; oncoproteins; malignant transformation; retinoblastoma protein; cell cycle; quiescent and cycling cells; cyclin/cyclin-dependent kinase (Cdk) complexes; E2F; S-phase genes; enhancer element; proto-oncogenes; tumor suppressor genes; radioactive…

Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.

PubMed

Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A

1990-11-30

Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.

FOXO/TXNIP pathway is involved in the suppression of hepatocellular carcinoma growth by glutamate antagonist MK-801

PubMed Central

2013-01-01

Background Accumulating evidence has suggested the importance of glutamate signaling in cancer growth, yet the signaling pathway has not been fully elucidated. N-methyl-D-aspartic acid (NMDA) receptor activates intracellular signaling pathways such as the extracellular-signal-regulated kinase (ERK) and forkhead box, class O (FOXO). Suppression of lung carcinoma growth by NMDA receptor antagonists via the ERK pathway has been reported. However, series of evidences suggested the importance of FOXO pathways for the regulation of normal and cancer cell growth. In the liver, FOXO1 play important roles for the cell proliferation such as hepatic stellate cells as well as liver metabolism. Our aim was to investigate the involvement of the FOXO pathway and the target genes in the growth inhibitory effects of NMDA receptor antagonist MK-801 in human hepatocellular carcinoma. Methods Expression of NMDAR1 in cancer cell lines from different tissues was examined by Western blot. NMDA receptor subunits in HepG2, HuH-7, and HLF were examined by reverse transcriptase polymerase chain reaction (RT-PCR), and growth inhibition by MK-801 and NBQX was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The effects of MK-801 on the cell cycle were examined by flow cytometry and Western blot analysis. Expression of thioredoxin-interacting protein (TXNIP) and p27 was determined by real-time PCR and Western blotting. Activation of the FOXO pathway and TXNIP induction were examined by Western blotting, fluorescence microscopy, Chromatin immunoprecipitation (ChIP) assay, and reporter gene assay. The effects of TXNIP on growth inhibition were examined using the gene silencing technique. Results NMDA receptor subunits were expressed in all cell lines examined, and MK-801, but not NBQX, inhibited cell growth of hepatocellular carcinomas. Cell cycle analysis showed that MK-801 induced G1 cell cycle arrest by down-regulating cyclin D1 and up-regulating p27. MK-801 dephosphorylated Thr24 in FOXO1 and induced its nuclear translocation, thus increasing transcription of TXNIP, a tumor suppressor gene. Knock-down of TXNIP ameliorated the growth inhibitory effects of MK-801. Conclusions Our results indicate that functional NMDA receptors are expressed in hepatocellular carcinomas and that the FOXO pathway is involved in the growth inhibitory effects of MK-801. This mechanism could be common in hepatocellular carcinomas examined, but other mechanisms such as ERK pathway could exist in other cancer cells as reported in lung carcinoma cells. Altered expression levels of FOXO target genes including cyclin D1 and p27 may contribute to the inhibition of G1/S cell cycle transition. Induction of the tumor suppressor gene TXNIP plays an important role in the growth inhibition by MK-801. Our report provides new evidence that FOXO-TXNIP pathway play a role in the inhibition of the hepatocellular carcinoma growth by MK-801. PMID:24112473

Analysis of the neurofibromatosis 2 gene reveals molecular variants of meningioma.

PubMed Central

Wellenreuther, R.; Kraus, J. A.; Lenartz, D.; Menon, A. G.; Schramm, J.; Louis, D. N.; Ramesh, V.; Gusella, J. F.; Wiestler, O. D.; von Deimling, A.

1995-01-01

There is evidence from cytogenetic and loss of heterozygosity studies for the involvement of a tumor suppressor gene on chromosome 22 in the formation of meningiomas. Recently, the NF2 gene, which causes neurofibromatosis type 2 and which is located in the affected region on chromosome 22, has been identified. A previous study on 8 of the 17 exons of the NF2 gene described mutations in 16% of meningiomas. We have analyzed the entire coding region of the NF2 gene in 70 sporadic meningiomas and identified 43 mutations in 41 patients. These resulted predominantly in immediate truncation, splicing abnormalities, or an altered reading frame of the predicted protein product. Although there was no evidence for distinct hotspots, all mutations occurred in the first 13 exons, the region of homology with the filopodial proteins moesin, ezrin, and radixin. The association of loss of heterozygosity on chromosome 22 with mutations in the NF2 gene was significant. These data suggest that NF2 represents the meningioma locus on chromosome 22. NF2 mutations occurred significantly more frequently in fibroblastic meningioma (70%) and transitional meningioma (83%) than in meningiothelial meningioma (25%), thus indicating a differential molecular pathogenesis of these meningioma variants. Images Figure 1 PMID:7717450

A Catalogue of Putative cis-Regulatory Interactions Between Long Non-coding RNAs and Proximal Coding Genes Based on Correlative Analysis Across Diverse Human Tumors.

PubMed

Basu, Swaraj; Larsson, Erik

2018-05-31

Antisense transcripts and other long non-coding RNAs are pervasive in mammalian cells, and some of these molecules have been proposed to regulate proximal protein-coding genes in cis For example, non-coding transcription can contribute to inactivation of tumor suppressor genes in cancer, and antisense transcripts have been implicated in the epigenetic inactivation of imprinted genes. However, our knowledge is still limited and more such regulatory interactions likely await discovery. Here, we make use of available gene expression data from a large compendium of human tumors to generate hypotheses regarding non-coding-to-coding cis -regulatory relationships with emphasis on negative associations, as these are less likely to arise for reasons other than cis -regulation. We document a large number of possible regulatory interactions, including 193 coding/non-coding pairs that show expression patterns compatible with negative cis -regulation. Importantly, by this approach we capture several known cases, and many of the involved coding genes have known roles in cancer. Our study provides a large catalog of putative non-coding/coding cis -regulatory pairs that may serve as a basis for further experimental validation and characterization. Copyright © 2018 Basu and Larsson.

Sex chromosome loss and the pseudoautosomal region genes in hematological malignancies

PubMed Central

Weng, Stephanie; Stoner, Samuel A.; Zhang, Dong-Er

2016-01-01

Cytogenetic aberrations, such as chromosomal translocations, aneuploidy, and amplifications, are frequently detected in hematological malignancies. For many of the common autosomal aberrations, the mechanisms underlying their roles in cancer development have been well-characterized. On the contrary, although loss of a sex chromosome is observed in a broad range of hematological malignancies, how it cooperates in disease development is less understood. Nevertheless, it has been postulated that tumor suppressor genes reside on the sex chromosomes. Although the X and Y sex chromosomes are highly divergent, the pseudoautosomal regions are homologous between both chromosomes. Here, we review what is currently known about the pseudoautosomal region genes in the hematological system. Additionally, we discuss implications for haploinsufficiency of critical pseudoautosomal region sex chromosome genes, driven by sex chromosome loss, in promoting hematological malignancies. Because mechanistic studies on disease development rely heavily on murine models, we also discuss the challenges and caveats of existing models, and propose alternatives for examining the involvement of pseudoautosomal region genes and loss of a sex chromosome in vivo. With the widespread detection of loss of a sex chromosome in different hematological malignances, the elucidation of the role of pseudoautosomal region genes in the development and progression of these diseases would be invaluable to the field. PMID:27655702

Parkin in Parkinson's Disease and Cancer: a Double-Edged Sword.

PubMed

Wahabi, Khushnuma; Perwez, Ahmad; Rizvi, Moshahid A

2018-01-18

Parkin for more than a decade has been portrayed as a neuroprotector gene is now increasingly emerging as a multifaceted gene that can exert entirely opposite effects i.e., both cell proliferation and apoptosis. Parkinson's disease, a neurological disease, progresses due to excess in cell death, while, in case of cancer, cell death normally fails to occur. Parkin, an E3 ubiquitin ligase, was first identified as a gene implicated in autosomal recessive juvenile Parkinsonism, but several evidences indicate that Parkin is a tumor suppressor gene, involved in a variety of cancers. It is hard to imagine that two entirely different classes of disease, like cancer and Parkinson's disease, can converge at a critical point attributable to a single gene, Parkin. This mysterious and hidden connection may prove a boon in disguise and has raised hopes that studying the biology of one disease may help to identify novel targets of therapy for the other. In this Parkinson's disease-cancer story, if the detail of Parkin pathway is unraveled and gaps in the storyline are properly filled up, we may end getting an entirely new therapeutic option. This review mainly highlights the recent literature which suggests how Parkin gene regulates the various hallmarks of both the Parkinson's disease and cancer.

[Expression of miR-21 and Its Acat1, Armcx1, and Pten Target Genes in Liver of Female Rats Treated with DDT and Benzo[a]pyrene].

PubMed

Chanyshev, M D; Ushakov, D S; Gulyaeva, L F

2017-01-01

MiR-21 is the most studied cancer-promoting oncomiR, which target numerous tumor suppressor genes associated with proliferation, apoptosis, and invasion. Here we have studied the synthesis of miR-21 and quantified the mRNA and protein levels for miR-21 potential target genes, i.e., Acat1, Armcx1, and Pten, in the livers of female Wistar rats after their treatment with either 1,1-trichloro-2,2-di(4-chlorophenyl)ethane (DDT) or benzo[a]pyrene (BP). The most important finding appears to be the significant decrease in the miR-21 level the day after treatment with DDT with subsequent rebound. These changes are accompanied by an increase and subsequent drop in the levels of mRNAs and proteins of the Acat1, Armcx1, and Pten genes. These observations indicate the involvement of miR-21 in the posttranscriptional regulation of the Acat1, Armcx1, and Pten genes in response to xenobiotics. We hypothesize that the toxic effects of xenobiotics may be indirect and may manifest by inducing epigenetic changes, particularly through the regulation of miRNAs and their target genes.

Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome.

PubMed

Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

2014-01-01

Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome

PubMed Central

Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

2014-01-01

Germline mutations are responsible for familial cancer syndromes which account for approximately 5–10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22 years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. PMID:23981578

Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

PubMed

Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

2005-04-01

The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

PubMed

Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

2014-01-01

Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

Functional Characterization of Duplicated SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1-Like Genes in Petunia

PubMed Central

Preston, Jill C.; Jorgensen, Stacy A.; Jha, Suryatapa G.

2014-01-01

Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes UNSHAVEN (UNS) and FLORAL BINDING PROTEIN 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods. PMID:24787903

ICan: an integrated co-alteration network to identify ovarian cancer-related genes.

PubMed

Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

2015-01-01

Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data.

ICan: An Integrated Co-Alteration Network to Identify Ovarian Cancer-Related Genes

PubMed Central

Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

2015-01-01

Background Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. Results We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). Conclusion In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data. PMID:25803614

High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

PubMed Central

2009-01-01

Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein) in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein). In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus) on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19) gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs) indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor protein. Moreover, plant-derived Nef was purified, with enhanced yield, exploiting a two-step purification protocol. These results represent a first step towards the development of a plant-derived HIV vaccine. PMID:19930574

High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus.

PubMed

Lombardi, Raffaele; Circelli, Patrizia; Villani, Maria Elena; Buriani, Giampaolo; Nardi, Luca; Coppola, Valentina; Bianco, Linda; Benvenuto, Eugenio; Donini, Marcello; Marusic, Carla

2009-11-20

In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein) in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein). In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus) on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19) gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs) indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor protein. Moreover, plant-derived Nef was purified, with enhanced yield, exploiting a two-step purification protocol. These results represent a first step towards the development of a plant-derived HIV vaccine.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vaid, Mudit; Prasad, Ram; Singh, Tripti

Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). Wemore » found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16{sup INK4a} and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin cancer cells. ►Grape seed proanthocyanidins can prevent skin cancer through epigenetic modulation.« less

Stromal loss of TGFβ drives cancer growth in the epithelium via inflammation | Center for Cancer Research

Cancer.gov

Interactions between epithelial and stromal cells play an important role in cancer development and progression. Epithelial cancers develop when changes occur to tumor suppressor genes in stromal fibroblast cells. For example, loss of tumor suppressor, p53, in stromal fibroblasts leads to p53 inactivation in the epithelium in a prostate cancer model, and disruption of the transforming growth factor-b receptor II (TGF-βRII) in stromal fibroblasts results in intraepithelial dysplasia in prostate cancer and invasive squamous cell carcinoma (SCC) in mouse forestomach.

Polymerization of non-complementary RNA: systematic symmetric nucleotide exchanges mainly involving uracil produce mitochondrial RNA transcripts coding for cryptic overlapping genes.

PubMed

Seligmann, Hervé

2013-03-01

Usual DNA→RNA transcription exchanges T→U. Assuming different systematic symmetric nucleotide exchanges during translation, some GenBank RNAs match exactly human mitochondrial sequences (exchange rules listed in decreasing transcript frequencies): C↔U, A↔U, A↔U+C↔G (two nucleotide pairs exchanged), G↔U, A↔G, C↔G, none for A↔C, A↔G+C↔U, and A↔C+G↔U. Most unusual transcripts involve exchanging uracil. Independent measures of rates of rare replicational enzymatic DNA nucleotide misinsertions predict frequencies of RNA transcripts systematically exchanging the corresponding misinserted nucleotides. Exchange transcripts self-hybridize less than other gene regions, self-hybridization increases with length, suggesting endoribonuclease-limited elongation. Blast detects stop codon depleted putative protein coding overlapping genes within exchange-transcribed mitochondrial genes. These align with existing GenBank proteins (mainly metazoan origins, prokaryotic and viral origins underrepresented). These GenBank proteins frequently interact with RNA/DNA, are membrane transporters, or are typical of mitochondrial metabolism. Nucleotide exchange transcript frequencies increase with overlapping gene densities and stop densities, indicating finely tuned counterbalancing regulation of expression of systematic symmetric nucleotide exchange-encrypted proteins. Such expression necessitates combined activities of suppressor tRNAs matching stops, and nucleotide exchange transcription. Two independent properties confirm predicted exchanged overlap coding genes: discrepancy of third codon nucleotide contents from replicational deamination gradients, and codon usage according to circular code predictions. Predictions from both properties converge, especially for frequent nucleotide exchange types. Nucleotide exchanging transcription apparently increases coding densities of protein coding genes without lengthening genomes, revealing unsuspected functional DNA coding potential. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Menin regulates Inhbb expression through an Akt/Ezh2-mediated H3K27 histone modification.

PubMed

Gherardi, Samuele; Ripoche, Doriane; Mikaelian, Ivan; Chanal, Marie; Teinturier, Romain; Goehrig, Delphine; Cordier-Bussat, Martine; Zhang, Chang X; Hennino, Ana; Bertolino, Philippe

2017-04-01

Although Men1 is a well-known tumour suppressor gene, little is known about the functions of Menin, the protein it encodes for. Since few years, numerous publications support a major role of Menin in the control of epigenetics gene regulation. While Menin interaction with MLL complex favours transcriptional activation of target genes through H3K4me3 marks, Menin also represses gene expression via mechanisms involving the Polycomb repressing complex (PRC). Interestingly, Ezh2, the PRC-methyltransferase that catalyses H3K27me3 repressive marks and Menin have been shown to co-occupy a large number of promoters. However, lack of binding between Menin and Ezh2 suggests that another member of the PRC complex is mediating this indirect interaction. Having found that ActivinB - a TGFβ superfamily member encoded by the Inhbb gene - is upregulated in insulinoma tumours caused by Men1 invalidation, we hypothesize that Menin could directly participate in the epigenetic-repression of Inhbb gene expression. Using Animal model and cell lines, we report that loss of Menin is directly associated with ActivinB-induced expression both in vivo and in vitro. Our work further reveals that ActivinB expression is mediated through a direct modulation of H3K27me3 marks on the Inhbb locus in Menin-KO cell lines. More importantly, we show that Menin binds on the promoter of Inhbb gene where it favours the recruitment of Ezh2 via an indirect mechanism involving Akt-phosphorylation. Our data suggests therefore that Menin could take an important part to the Ezh2-epigenetic repressive landscape in many cells and tissues through its capacity to modulate Akt phosphorylation. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of TPA and HTLV-1 Tax on BRCA1 and ERE controlled genes expression.

PubMed

Jabareen, Azhar; Abu-Jaafar, Aya; Abou-Kandil, Ammar; Huleihel, Mahmoud

2017-07-18

Interference with the expression and/or functions of the multifunctional tumor suppressor BRCA1 leads to a high risk of breast and ovarian cancers. BRCA1 expression is usually activated by the estrogen (E2) liganded ERα receptor. Activated ERα is considered as a potent transcription factor which activates various genes expression by 2 pathways. A classical pathway, ERα binds directly to E2-responsive elements (EREs) in the promoters of the responsive genes and a non-classical pathway where ERα indirectly binds with the appropriate gene promoter. In our previous study, HTLV-1Tax was found to strongly inhibit ERα induced BRCA1 expression while stimulating ERα induced ERE dependent genes. TPA is a strong PKC activator which found to induce the expression of HTLV-1. Here we examined the effect of TPA on the expression of BRCA1 and genes controlled by ERE region in MCF-7 cells and on Tax activity on these genes. Our results showed strong stimulatory effect of TPA on both BRCA1 and ERE expression without treatment with E2. Tax did not show any significant effect on these TPA activities. It seems that TPA activation of BRCA1 and ERE expression is dependent on PKC activity but not through the NFκB pathway. However, 53BP1 may be involved in this TPA activity because its overexpression significantly reduced the TPA stimulatory effect on BRCA1 and ERE expression. Additionally, our Chip assay results probably exclude possible involvement of ERα pathway in this TPA activity because TPA did not interfere with the binding of ERα to both BRCA1 promoter and ERE region.

Dissociation of sensitivities to tumor promotion and progression in outbred and inbred SENCAR mice.

PubMed

Gimenez-Conti, I B; Bianchi, A B; Fischer, S M; Reiners, J J; Conti, C J; Slaga, T J

1992-06-15

The sensitivity of outbred SENCAR mice and inbred SENCAR (SSIN) mice to multistage carcinogenesis was studied. Tumors were induced using either 7,12-dimethylbenz[a]anthracene or N-methyl-N'-nitro-N-nitrosoguanidine as initiators and 12-O-tetradecanoylphorbol-13-acetate or benzoyl peroxide as promoting agents. Although the number of papillomas per mouse was higher in SSIN than in outbred SENCAR mice, the number of carcinomas observed in the SSIN strain was significantly lower regardless of the initiator or promoter used. It was also observed that the expression of markers of premalignant progression (i.e., dysplasia, expression of keratin K13, and loss of keratin K1 expression) was markedly suppressed in SSIN papillomas. After 50 wk of promotion with 12-O-tetradecanoylphorbol-13-acetate, the pattern of expression of K13 and K1 in SSIN mice was comparable to the pattern observed in outbred SENCAR mice after 10 to 20 wk of promotion with 12-O-tetradecanoylphorbol-13-acetate. It was also observed that 67% of the tumors induced in SSIN mice by initiation with 7,12-dimethylbenz[a]anthracene exhibited a mutation in codon 61 of the Ha-ras-1 gene. This latter finding suggests that the differences observed in tumor progression between the inbred strain and the outbred stock are not related to a genetic alteration in the Ha-ras-1 gene but rather to an independent event that we have postulated to involve a putative suppressor gene. The data reported here suggest that the putative gene(s) that confers susceptibility to tumor promotion was segregated from the gene(s) involved in tumor progression during selection and inbreeding of the SENCAR mouse stock.

Tumour necrosis factor α (TNF)–TNF receptor 1-inducible cytoprotective proteins in the mouse liver: relevance of suppressors of cytokine signalling

PubMed Central

Sass, Gabriele; Shembade, Noula D.; Tiegs, Gisa

2004-01-01

TNF (tumour necrosis factor α) induces tolerance towards itself in experimental liver injury. Tolerance induction has been shown to be dependent on TNFR1 (TNF receptor 1) signalling, but mechanisms and mediators of TNF-induced hepatic tolerance are unknown. We investigated the TNF-inducible gene-expression profile in livers of TNFR2−/− mice, using cDNA array technology. We found that, out of 793 investigated genes involved in inflammation, cell cycle and signal transduction, 282 were expressed in the mouse liver in response to TNF via TNFR1. Among those, expression of 78 genes was induced, while expression of 60 genes was reduced. We investigated further the cellular expression of the 27 most prominently induced genes, and found that 20 of these genes were up-regulated directly in parenchymal liver cells, representing potentially protective proteins and possible mediators of TNF tolerance. In vitro experiments revealed that overexpression of SOCS1 (silencer of cytokine signalling 1), a member of the SOCS family of proteins, as well as of HO-1 (haem oxygenase-1), but not of SOCS2 or SOCS3, protected isolated primary mouse hepatocytes from TNF-induced apoptosis. The identification of protective genes in hepatocytes is the prerequisite for future development of gene therapies for immune-mediated liver diseases. PMID:15554901

The Role of Drosophila Merlin in the Control of Mitosis Exit and Development

DTIC Science & Technology

2006-07-01

schwannomas and is associated with mutations in the tumor suppressor gene called the neurofibromatosis type 2 (NF2) gene (Chang et al., 2005; Neff...been shown to associate with endocytic compartments and because mutations in the genes , such as clathrin and ff16, that are known to be important... mutations in the Drosophila homologues of the human Neurofibromatosis 2 and yeast CDC42 genes using a simple and efficient reverse-genetic method. Genetics

LKB1 and lung cancer: more than the usual suspects.

PubMed

Shah, Usman; Sharpless, Norman E; Hayes, D Neil

2008-05-15

Often, the problem in cancer research is figuring out how a gene or pathway works in regulating cellular transformation. The question of what RAS activates or PTEN inhibits have been classic dilemmas of modern cancer biology. In these cases, biochemical and genetic studies have provided us with a fairly clear picture of the cancer relevant functions of these genes. For LKB1, a more recently identified human tumor suppressor gene, however, the problem is different. This serine-threonine kinase that is conserved from yeast to mammals seems to play a role in many diverse cellular pathways. Therefore, although elegant functional and genetic approaches have established critical roles for LKB1 in the regulation of metabolism, motility, polarity, and the cell cycle, the role(s) responsible for its true tumor suppressor function(s) is unknown. One is reminded of an Agatha Christie murder mystery where nearly every character in the book has reason to be suspected of committing the crime-there are too many suspects for how LKB1 might repress lung cancer.

The tumor suppressor cybL, a component of the respiratory chain, mediates apoptosis induction.

PubMed

Albayrak, Timur; Scherhammer, Volker; Schoenfeld, Nicole; Braziulis, Erik; Mund, Thomas; Bauer, Manuel K A; Scheffler, Immo E; Grimm, Stefan

2003-08-01

A genetic screen was established to clone apoptosis-inducing genes in a high-throughput format. It led to the isolation of several proapoptotic genes whose proteins are localized to mitochondria. One of the isolated genes is cytochrome bL (cybL also known as SDHC, CII-3, or QPs-1), a component of the respiratory chain complex II. It was further investigated because both cybL and another component of complex II, cybS, have recently been identified as tumor suppressor proteins, some of which act by controlling apoptosis. Our studies reveal that cell death induction by cybL expression is concomitant with a transient inhibition of complex II and the generation of reactive oxygen species. Importantly, cells that are constitutively deficient in cybL are resistant to a variety of proapoptotic cytostatic drugs and to the effects of the Fas receptor. Our results therefore identify complex II as a sensor for apoptosis induction and could explain the unexpected observation that complex II is inactivated in tumors.

The Tumor Suppressor cybL, a Component of the Respiratory Chain, Mediates Apoptosis Induction

PubMed Central

Albayrak, Timur; Scherhammer, Volker; Schoenfeld, Nicole; Braziulis, Erik; Mund, Thomas; Bauer, Manuel K.A.; Scheffler, Immo E.; Grimm, Stefan

2003-01-01

A genetic screen was established to clone apoptosis-inducing genes in a high-throughput format. It led to the isolation of several proapoptotic genes whose proteins are localized to mitochondria. One of the isolated genes is cytochrome bL (cybL also known as SDHC, CII-3, or QPs-1), a component of the respiratory chain complex II. It was further investigated because both cybL and another component of complex II, cybS, have recently been identified as tumor suppressor proteins, some of which act by controlling apoptosis. Our studies reveal that cell death induction by cybL expression is concomitant with a transient inhibition of complex II and the generation of reactive oxygen species. Importantly, cells that are constitutively deficient in cybL are resistant to a variety of proapoptotic cytostatic drugs and to the effects of the Fas receptor. Our results therefore identify complex II as a sensor for apoptosis induction and could explain the unexpected observation that complex II is inactivated in tumors. PMID:12925748

The milk protein α-casein functions as a tumor suppressor via activation of STAT1 signaling, effectively preventing breast cancer tumor growth and metastasis

PubMed Central

Bonuccelli, Gloria; Castello-Cros, Remedios; Capozza, Franco; Martinez-Outschoorn, Ubaldo E.; Lin, Zhao; Tsirigos, Aristotelis; Xuanmao, Jiao; Whitaker-Menezes, Diana; Howell, Anthony; Lisanti, Michael P.; Sotgia, Federica

2012-01-01

Here, we identified the milk protein α-casein as a novel suppressor of tumor growth and metastasis. Briefly, Met-1 mammary tumor cells expressing α-casein showed a ~5-fold reduction in tumor growth and a near 10-fold decrease in experimental metastasis. To identify the molecular mechanism(s), we performed genome-wide transcriptional profiling. Interestingly, our results show that α-casein upregulates gene transcripts associated with interferon/STAT1 signaling and downregulates genes associated with “stemness.” These findings were validated by immunoblot and FACS analysis, which showed the upregulation and hyperactivation of STAT1 and a decrease in the number of CD44(+) “cancer stem cells.” These gene signatures were also able to predict clinical outcome in human breast cancer patients. Thus, we conclude that a lactation-based therapeutic strategy using recombinant α-casein would provide a more natural and non-toxic approach to the development of novel anticancer therapies. PMID:23047602

Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

PubMed Central

Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

2012-01-01

Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

Modelling gene expression profiles related to prostate tumor progression using binary states

PubMed Central

2013-01-01

Background Cancer is a complex disease commonly characterized by the disrupted activity of several cancer-related genes such as oncogenes and tumor-suppressor genes. Previous studies suggest that the process of tumor progression to malignancy is dynamic and can be traced by changes in gene expression. Despite the enormous efforts made for differential expression detection and biomarker discovery, few methods have been designed to model the gene expression level to tumor stage during malignancy progression. Such models could help us understand the dynamics and simplify or reveal the complexity of tumor progression. Methods We have modeled an on-off state of gene activation per sample then per stage to select gene expression profiles associated to tumor progression. The selection is guided by statistical significance of profiles based on random permutated datasets. Results We show that our method identifies expected profiles corresponding to oncogenes and tumor suppressor genes in a prostate tumor progression dataset. Comparisons with other methods support our findings and indicate that a considerable proportion of significant profiles is not found by other statistical tests commonly used to detect differential expression between tumor stages nor found by other tailored methods. Ontology and pathway analysis concurred with these findings. Conclusions Results suggest that our methodology may be a valuable tool to study tumor malignancy progression, which might reveal novel cancer therapies. PMID:23721350

Targeted disruption of the 3p12 gene, Dutt1/Robo1, predisposes mice to lung adenocarcinomas and lymphomas with methylation of the gene promoter.

PubMed

Xian, Jian; Aitchison, Alan; Bobrow, Linda; Corbett, Gerard; Pannell, Richard; Rabbitts, Terence; Rabbitts, Pamela

2004-09-15

The DUTT1 gene is located on human chromosome 3, band p12, within a region of nested homozygous deletions in breast and lung tumors. It is therefore a candidate tumor suppressor gene in humans and is the homologue (ROBO1) of the Drosophila axonal guidance receptor gene, Roundabout. We have shown previously that mice with a targeted homozygous deletion within the Dutt1/Robo1 gene generally die at birth due to incomplete lung development: survivors die within the first year of life with epithelial bronchial hyperplasia as a common feature. Because Dutt1/Robo1 heterozygous mice develop normally, we have determined their tumor susceptibility. Mice with a targeted deletion within one Dutt1/Robo1 allele spontaneously develop lymphomas and carcinomas in their second year of life with a 3-fold increase in incidence compared with controls: invasive lung adenocarcinomas are by far the predominant carcinoma. In addition to the mutant allele, loss of heterozygosity analysis indicates that these tumors retain the structurally normal allele but with substantial methylation of the gene's promoter. Substantial reduction of Dutt1/Robo1 protein expression in tumors is observed by Western blotting and immunohistochemistry. This suggests that Dutt1/Robo1 is a classic tumor suppressor gene requiring inactivation of both alleles to elicit tumorigenesis in these mice.

Imatinib induces up-regulation of NM23, a metastasis suppressor gene, in human Hepatocarcinoma (HepG2) Cell Line

PubMed Central

Keshavarz-Pakseresht, Behta; Shandiz, Seyed Ataollah Sadat; Baghbani-arani, Fahimeh

2017-01-01

Aim: The present study investigated the anti-tumor activity of Imatinib mesylate through modulation of NM23 gene expression in human hepatocellular carcinoma (HepG2) cell line. Background: Hepatocellular carcinoma (HCC) is considered to be the third leading cause of cancer related death worldwide. Down regulation of NM23, a metastasis suppressor gene, has been associated with several types of malignant cancer. Recently, effects of Imatinib mesylate, a first member of tyrosine kinases inhibitors, were indicated in research and treatment of different malignant tumors. Methods: Cell viability was quantitated by MTT assay after HepG2 cells exposure to Imatinib mesylate at various concentrations of 0, 1.56, 3.125, 6.25, 12.5, 25,50μM for 24 hours. Also, quantitative real time PCR technique was applied for the detection of NM23 gene expression in HepG2 cell line. Results: There was a dose dependent increase in the cytotoxicity effect of imatinib. The real time PCR results demonstrated that inhibitory effect of Imatinib mesylate on viability via up regulation of NM23 gene expression compared to GAPDH gene (internal control gene) in cancer cells. Conclusion: According to our findings, imatinib can modulate metastasis by enhancing Nm23 gene expression in human hepatocellular carcinoma (HepG2) cell line. PMID:28331561

Detection of functional protein domains by unbiased genome-wide forward genetic screening.

PubMed

Herzog, Mareike; Puddu, Fabio; Coates, Julia; Geisler, Nicola; Forment, Josep V; Jackson, Stephen P

2018-04-18

Establishing genetic and chemo-genetic interactions has played key roles in elucidating mechanisms by which certain chemicals perturb cellular functions. In contrast to gene disruption/depletion strategies to identify mechanisms of drug resistance, searching for point-mutational genetic suppressors that can identify separation- or gain-of-function mutations has been limited. Here, by demonstrating its utility in identifying chemical-genetic suppressors of sensitivity to the DNA topoisomerase I poison camptothecin or the poly(ADP-ribose) polymerase inhibitor olaparib, we detail an approach allowing systematic, large-scale detection of spontaneous or chemically-induced suppressor mutations in yeast or haploid mammalian cells in a short timeframe, and with potential applications in other haploid systems. In addition to applications in molecular biology research, this protocol can be used to identify drug targets and predict drug-resistance mechanisms. Mapping suppressor mutations on the primary or tertiary structures of protein suppressor hits provides insights into functionally relevant protein domains. Importantly, we show that olaparib resistance is linked to missense mutations in the DNA binding regions of PARP1, but not in its catalytic domain. This provides experimental support to the concept of PARP1 trapping on DNA as the prime source of toxicity to PARP inhibitors, and points to a novel olaparib resistance mechanism with potential therapeutic implications.

Genetic Alterations in Familial Breast Cancer: Mapping and Cloning Genes Other Than BRCAl

DTIC Science & Technology

1997-09-01

predisposition to breast cancer in families. The gene PTEN was successfully cloned by this project, and simultaneously by others (for a different ...with germline translocations’and breast cancer for the identification of tumor suppressor genes. 14. SUBJECT TERMS Breast cancer 17. SECURITY...would limit the statistical power of linkage analysis. Therefore, we decided to integrate linkage analysis with the analysis of germline chromosomal

FANCJ helicase controls the balance between short- and long-tract gene conversions between sister chromatids

PubMed Central

Nath, Sarmi; Somyajit, Kumar; Mishra, Anup; Scully, Ralph

2017-01-01

Abstract The FANCJ DNA helicase is linked to hereditary breast and ovarian cancers as well as bone marrow failure disorder Fanconi anemia (FA). Although FANCJ has been implicated in the repair of DNA double-strand breaks (DSBs) by homologous recombination (HR), the molecular mechanism underlying the tumor suppressor functions of FANCJ remains obscure. Here, we demonstrate that FANCJ deficient human and hamster cells exhibit reduction in the overall gene conversions in response to a site-specific chromosomal DSB induced by I-SceI endonuclease. Strikingly, the gene conversion events were biased in favour of long-tract gene conversions in FANCJ depleted cells. The fine regulation of short- (STGC) and long-tract gene conversions (LTGC) by FANCJ was dependent on its interaction with BRCA1 tumor suppressor. Notably, helicase activity of FANCJ was essential for controlling the overall HR and in terminating the extended repair synthesis during sister chromatid recombination (SCR). Moreover, cells expressing FANCJ pathological mutants exhibited defective SCR with an increased frequency of LTGC. These data unravel the novel function of FANCJ helicase in regulating SCR and SCR associated gene amplification/duplications and imply that these functions of FANCJ are crucial for the genome maintenance and tumor suppression. PMID:28911102

Expression of P53 protein after exposure to ionizing radiation

NASA Astrophysics Data System (ADS)

Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.

2001-10-01

One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.

Role of ribosomal protein mutations in tumor development (Review)

PubMed Central

GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

2016-01-01

Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

40 Years of Research Put p53 in Translation

PubMed Central

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

Genetic Regulation by NLA and MicroRNA827 for Maintaining Nitrate-Dependent Phosphate Homeostasis in Arabidopsis

PubMed Central

Kant, Surya; Peng, Mingsheng; Rothstein, Steven J.

2011-01-01

Plants need abundant nitrogen and phosphorus for higher yield. Improving plant genetics for higher nitrogen and phosphorus use efficiency would save potentially billions of dollars annually on fertilizers and reduce global environmental pollution. This will require knowledge of molecular regulators for maintaining homeostasis of these nutrients in plants. Previously, we reported that the NITROGEN LIMITATION ADAPTATION (NLA) gene is involved in adaptive responses to low-nitrogen conditions in Arabidopsis, where nla mutant plants display abrupt early senescence. To understand the molecular mechanisms underlying NLA function, two suppressors of the nla mutation were isolated that recover the nla mutant phenotype to wild type. Map-based cloning identified these suppressors as the phosphate (Pi) transport-related genes PHF1 and PHT1.1. In addition, NLA expression is shown to be regulated by the low-Pi induced microRNA miR827. Pi analysis revealed that the early senescence in nla mutant plants was due to Pi toxicity. These plants accumulated over five times the normal Pi content in shoots specifically under low nitrate and high Pi but not under high nitrate conditions. Also the Pi overaccumulator pho2 mutant shows Pi toxicity in a nitrate-dependent manner similar to the nla mutant. Further, the nitrate and Pi levels are shown to have an antagonistic crosstalk as displayed by their differential effects on flowering time. The results demonstrate that NLA and miR827 have pivotal roles in regulating Pi homeostasis in plants in a nitrate-dependent fashion. PMID:21455488

Multi-chaperone function modulation and association with cytoskeletal proteins are key features of the function of AIP in the pituitary gland

PubMed Central

Hernández-Ramírez, Laura C.; Morgan, Rhodri M.L.; Barry, Sayka; D’Acquisto, Fulvio; Prodromou, Chrisostomos; Korbonits, Márta

2018-01-01

Despite the well-recognized role of loss-of-function mutations of the aryl hydrocarbon receptor interacting protein gene (AIP) predisposing to pituitary adenomas, the pituitary-specific function of this tumor suppressor remains an enigma. To determine the repertoire of interacting partners for the AIP protein in somatotroph cells, wild-type and variant AIP proteins were used for pull-down/quantitative mass spectrometry experiments against lysates of rat somatotropinoma-derived cells; relevant findings were validated by co-immunoprecipitation and co-localization. Global gene expression was studied in AIP mutation positive and negative pituitary adenomas via RNA microarrays. Direct interaction with AIP was confirmed for three known and six novel partner proteins. Novel interactions with HSPA5 and HSPA9, together with known interactions with HSP90AA1, HSP90AB1 and HSPA8, indicate that the function/stability of multiple chaperone client proteins could be perturbed by a deficient AIP co-chaperone function. Interactions with TUBB, TUBB2A, NME1 and SOD1 were also identified. The AIP variants p.R304* and p.R304Q showed impaired interactions with HSPA8, HSP90AB1, NME1 and SOD1; p.R304* also displayed reduced binding to TUBB and TUBB2A, and AIP-mutated tumors showed reduced TUBB2A expression. Our findings suggest that cytoskeletal organization, cell motility/adhesion, as well as oxidative stress responses, are functions that are likely to be involved in the tumor suppressor activity of AIP. PMID:29507682

Intracellular Activation of Interferon Regulatory Factor-1 by Nanobodies to the Multifunctional (Mf1) Domain*

PubMed Central

Möller, Angeli; Pion, Emmanuelle; Narayan, Vikram; Ball, Kathryn L.

2010-01-01

IRF-1 is a tumor suppressor protein that activates gene expression from a range of promoters in response to stimuli spanning viral infection to DNA damage. Studies on the post-translational regulation of IRF-1 have been hampered by a lack of suitable biochemical tools capable of targeting the endogenous protein. In this study, phage display technology was used to develop a monoclonal nanobody targeting the C-terminal Mf1 domain (residues 301–325) of IRF-1. Intracellular expression of the nanobody demonstrated that the transcriptional activity of IRF-1 is constrained by the Mf1 domain as nanobody binding gave an increase in expression from IRF-1-responsive promoters of up to 8-fold. Furthermore, Mf1-directed nanobodies have revealed an unexpected function for this domain in limiting the rate at which the IRF-1 protein is degraded. Thus, the increase in IRF-1 transcriptional activity observed on nanobody binding is accompanied by a significant reduction in the half-life of the protein. In support of the data obtained using nanobodies, a single point mutation (P325A) involving the C-terminal residue of IRF-1 has been identified, which results in greater transcriptional activity and a significant increase in the rate of degradation. The results presented here support a role for the Mf1 domain in limiting both IRF-1-dependent transcription and the rate of IRF-1 turnover. In addition, the data highlight a route for activation of downstream genes in the IRF-1 tumor suppressor pathway using biologics. PMID:20817723

Developmentally arrested structures preceding cerebellar tumors in von Hippel–Lindau disease

PubMed Central

Shively, Sharon B; Falke, Eric A; Li, Jie; Tran, Maxine G B; Thompson, Eli R; Maxwell, Patrick H; Roessler, Erich; Oldfield, Edward H; Lonser, Russell R; Vortmeyer, Alexander O

2011-01-01

There is increasing evidence that suggests that knockout of tumor-suppressor gene function causes developmental arrest and protraction of cellular differentiation. In the peripheral nervous system of patients with the tumor-suppressor gene disorder, von Hippel–Lindau disease, we have demonstrated developmentally arrested structural elements composed of hemangioblast progenitor cells. Some developmentally arrested structural elements progress to a frank tumor, hemangioblastoma. However, in von Hippel–Lindau disease, hemangioblastomas are frequently observed in the cerebellum, suggesting an origin in the central nervous system. We performed a structural and topographic analysis of cerebellar tissues obtained from von Hippel–Lindau disease patients to identify and characterize developmentally arrested structural elements in the central nervous system. We examined the entire cerebella of five tumor-free von Hippel–Lindau disease patients and of three non-von Hippel–Lindau disease controls. In all, 9 cerebellar developmentally arrested structural elements were detected and topographically mapped in 385 blocks of von Hippel–Lindau disease cerebella. No developmentally arrested structural elements were seen in 214 blocks from control cerebella. Developmentally arrested structural elements are composed of poorly differentiated cells that express hypoxia-inducible factor (HIF)2α, but not HIF1α or brachyury, and preferentially involve the molecular layer of the dorsum cerebelli. For the first time, we identify and characterize developmentally arrested structural elements in the central nervous system of von Hippel–Lindau patients. We provide evidence that developmentally arrested structural elements in the cerebellum are composed of developmentally arrested hemangioblast progenitor cells in the molecular layer of the dorsum cerebelli. PMID:21499240

Polyclonal proliferation of activated suppressor/cytotoxic T cells with transient depression of natural killer cell function in acute infectious mononucleosis.

PubMed Central

Williams, M L; Loughran, T P; Kidd, P G; Starkebaum, G A

1989-01-01

In acute infectious mononucleosis large numbers of atypical lymphocytes proliferate in response to B cells infected with Epstein-Barr virus, generally resulting in a self-limited illness. Although both T-cells and NK cells are known to be involved, the precise origin of the large granular lymphocytes in this disorder is incompletely understood. Using two-colour immunofluorescent flow cytometry, we sequentially examined the phenotype of selected T cell and NK cell subsets from nine patients with infectious mononucleosis. In parallel, we determined whether these lymphocytes utilized a restricted repertoire of the T cell receptor gene and also measured their NK activity. Our results show that in acute infectious mononucleosis there was a greater than three-fold increase in T lymphocytes with the phenotype CD2+, CD3+, CD8+ and DR+. A modest increase in Leu7(HNK1)+ and CD4+ T cells was also seen. In addition, there was a three-fold increase in cells coexpressing CD3- and CD16+, the phenotype reported to represent most NK cells. In spite of this latter finding, however, a marked decrease in NK function was found at the time of diagnosis, gradually returning to normal by day 28. Finally, Southern blot analysis of DNA from patient lymphocytes showed polyclonal rearrangements of the T cell receptor beta chain gene. These studies indicate that the proliferation of activated suppressor/cytotoxic T lymphocytes in acute infectious mononucleosis is polyclonal and is associated with transient depression of NK function. Images Fig. 2 PMID:2527653

Epigenetics and colorectal cancer pathogenesis.

PubMed

Bardhan, Kankana; Liu, Kebin

2013-06-05

Colorectal cancer (CRC) develops through a multistage process that results from the progressive accumulation of genetic mutations, and frequently as a result of mutations in the Wnt signaling pathway. However, it has become evident over the past two decades that epigenetic alterations of the chromatin, particularly the chromatin components in the promoter regions of tumor suppressors and oncogenes, play key roles in CRC pathogenesis. Epigenetic regulation is organized at multiple levels, involving primarily DNA methylation and selective histone modifications in cancer cells. Assessment of the CRC epigenome has revealed that virtually all CRCs have aberrantly methylated genes and that the average CRC methylome has thousands of abnormally methylated genes. Although relatively less is known about the patterns of specific histone modifications in CRC, selective histone modifications and resultant chromatin conformation have been shown to act, in concert with DNA methylation, to regulate gene expression to mediate CRC pathogenesis. Moreover, it is now clear that not only DNA methylation but also histone modifications are reversible processes. The increased understanding of epigenetic regulation of gene expression in the context of CRC pathogenesis has led to development of epigenetic biomarkers for CRC diagnosis and epigenetic drugs for CRC therapy.

Epigenetics and Colorectal Cancer Pathogenesis

PubMed Central

Bardhan, Kankana; Liu, Kebin

2013-01-01

Colorectal cancer (CRC) develops through a multistage process that results from the progressive accumulation of genetic mutations, and frequently as a result of mutations in the Wnt signaling pathway. However, it has become evident over the past two decades that epigenetic alterations of the chromatin, particularly the chromatin components in the promoter regions of tumor suppressors and oncogenes, play key roles in CRC pathogenesis. Epigenetic regulation is organized at multiple levels, involving primarily DNA methylation and selective histone modifications in cancer cells. Assessment of the CRC epigenome has revealed that virtually all CRCs have aberrantly methylated genes and that the average CRC methylome has thousands of abnormally methylated genes. Although relatively less is known about the patterns of specific histone modifications in CRC, selective histone modifications and resultant chromatin conformation have been shown to act, in concert with DNA methylation, to regulate gene expression to mediate CRC pathogenesis. Moreover, it is now clear that not only DNA methylation but also histone modifications are reversible processes. The increased understanding of epigenetic regulation of gene expression in the context of CRC pathogenesis has led to development of epigenetic biomarkers for CRC diagnosis and epigenetic drugs for CRC therapy. PMID:24216997

On the relevance of glycolysis process on brain gliomas.

PubMed

Kounelakis, M G; Zervakis, M E; Giakos, G C; Postma, G J; Buydens, L M C; Kotsiakis, X

2013-01-01

The proposed analysis considers aspects of both statistical and biological validation of the glycolysis effect on brain gliomas, at both genomic and metabolic level. In particular, two independent datasets are analyzed in parallel, one engaging genomic (Microarray Expression) data and the other metabolomic (Magnetic Resonance Spectroscopy Imaging) data. The aim of this study is twofold. First to show that, apart from the already studied genes (markers), other genes such as those involved in the human cell glycolysis significantly contribute in gliomas discrimination. Second, to demonstrate how the glycolysis process can open new ways towards the design of patient-specific therapeutic protocols. The results of our analysis demonstrate that the combination of genes participating in the glycolytic process (ALDOA, ALDOC, ENO2, GAPDH, HK2, LDHA, LDHB, MDH1, PDHB, PFKM, PGI, PGK1, PGM1 and PKLR) with the already known tumor suppressors (PTEN, Rb, TP53), oncogenes (CDK4, EGFR, PDGF) and HIF-1, enhance the discrimination of low versus high-grade gliomas providing high prediction ability in a cross-validated framework. Following these results and supported by the biological effect of glycolytic genes on cancer cells, we address the study of glycolysis for the development of new treatment protocols.

E-Cadherin and Gastric Cancer: Cause, Consequence, and Applications

PubMed Central

Liu, Xin

2014-01-01

E-cadherin (epithelial-cadherin), encoded by the CDH1 gene, is a transmembrane glycoprotein playing a crucial role in maintaining cell-cell adhesion. E-cadherin has been reported to be a tumor suppressor and to be down regulated in gastric cancer. Besides genetic mutations in CDH1 gene to induce hereditary diffuse gastric cancer (HDGC), epigenetic factors such as DNA hypermethylation also contribute to the reduction of E-cadherin in gastric carcinogenesis. In addition, expression of E-cadherin could be mediated by infectious agents such as H. pylori (Helicobacter pylori). As E-cadherin is vitally involved in signaling pathways modulating cell proliferation, survival, invasion, and migration, dysregulation of E-cadherin leads to dysfunction of gastric epithelial cells and contributes to gastric cancer development. Moreover, changes in its expression could reflect pathological conditions of gastric mucosa, making its role in gastric cancer complicated. In this review, we summarize the functions of E-cadherin and the signaling pathways it regulates. We aim to provide comprehensive perspectives in the molecular mechanism of E-cadherin and its involvement in gastric cancer initiation and progression. We also focus on its applications for early diagnosis, prognosis, and therapy in gastric cancer in order to open new avenues in this field. PMID:25184143

Dietary black raspberries modulate DNA methylation in dextran sodium sulfate (DSS)-induced ulcerative colitis

PubMed Central

Wang, Li-Shu

2013-01-01

Ulcerative colitis (UC) is characterized by chronic inflammation of the colon. During inflammation, NF-κB is increased in colonic epithelial cells and in immune cells, leading to increases in proinflammatory cytokines. These events then increase DNA methyltransferases (DNMTs), which silence a subset of tumor suppressor genes by promoter methylation. Negative regulators of the Wnt pathway are frequently methylated in UC, leading to dysregulation of the pathway and, potentially, to colorectal cancer. We determined if black raspberries (BRBs) influence promoter methylation of suppressors in the Wnt pathway in dextran sodium sulfate (DSS)-induced UC. C57BL/6J mice received 1% DSS and were fed either control or 5% BRB diets. Mice were euthanized on days 7, 14 and 28, and their colons, spleen and bone marrow were collected. Berries reduced ulceration at day 28. This was accompanied by decreased staining of macrophages and neutrophils and decreased NF-κB p65 nuclear localization in the colon at all time points. At day 7, BRBs demethylated the promoter of dkk3, leading to its increased messenger RNA (mRNA) expression in colon, spleen and bone marrow. β-Catenin nuclear localization, c-Myc staining as well as protein expression of DNMT3B, histone deacetylases 1 and 2 (HDAC1 and HDAC2) and methyl-binding domain 2 (MBD2) were all decreased in colon; mRNA expression of these four proteins was decreased in bone marrow cells by BRBs. These results suggest that BRBs suppress colonic ulceration by correcting promoter hypermethylation of suppressor genes in the colon, as well as in the spleen and bone marrow that systematically regulate inflammation. Summary: Our results suggest that dietary BRBs suppress colonic ulceration by correcting promoter hypermethylation of suppressor genes in the colon, as well as in the spleen and bone marrow that systematically regulate inflammation in DSS-induced UC. PMID:24067901

hNaa10p contributes to tumorigenesis by facilitating DNMT1-mediated tumor suppressor gene silencing

PubMed Central

Lee, Chung-Fan; Ou, Derick S.-C.; Lee, Sung-Bau; Chang, Liang-Hao; Lin, Ruo-Kai; Li, Ying-Shiuan; Upadhyay, Anup K.; Cheng, Xiaodong; Wang, Yi-Ching; Hsu, Han-Shui; Hsiao, Michael; Wu, Cheng-Wen; Juan, Li-Jung

2010-01-01

Hypermethylation-mediated tumor suppressor gene silencing plays a crucial role in tumorigenesis. Understanding its underlying mechanism is essential for cancer treatment. Previous studies on human N-α-acetyltransferase 10, NatA catalytic subunit (hNaa10p; also known as human arrest-defective 1 [hARD1]), have generated conflicting results with regard to its role in tumorigenesis. Here we provide multiple lines of evidence indicating that it is oncogenic. We have shown that hNaa10p overexpression correlated with poor survival of human lung cancer patients. In vitro, enforced expression of hNaa10p was sufficient to cause cellular transformation, and siRNA-mediated depletion of hNaa10p impaired cancer cell proliferation in colony assays and xenograft studies. The oncogenic potential of hNaa10p depended on its interaction with DNA methyltransferase 1 (DNMT1). Mechanistically, hNaa10p positively regulated DNMT1 enzymatic activity by facilitating its binding to DNA in vitro and its recruitment to promoters of tumor suppressor genes, such as E-cadherin, in vivo. Consistent with this, interaction between hNaa10p and DNMT1 was required for E-cadherin silencing through promoter CpG methylation, and E-cadherin repression contributed to the oncogenic effects of hNaa10p. Together, our data not only establish hNaa10p as an oncoprotein, but also reveal that it contributes to oncogenesis through modulation of DNMT1 function. PMID:20592467

Methylation status as a predictor of intravesical Bacillus Calmette-Guérin (BCG) immunotherapy response of high grade non-muscle invasive bladder tumor.

PubMed

Husek, Petr; Pacovsky, Jaroslav; Chmelarova, Marcela; Podhola, Miroslav; Brodak, Milos

2017-06-01

Genetic and epigenetic alterations play an important role in urothelial cancer pathogenesis. Deeper understanding of these processes could help us achieve better diagnosis and management of this life-threatening disease. The aim of this research was to evaluate the methylation status of selected tumor suppressor genes for predicting BCG response in patients with high grade non-muscle-invasive bladder tumor (NMIBC). We retrospectively evaluated 82 patients with high grade non-muscle-invasive bladder tumor (stage Ta, T1, CIS) who had undergone BCG instillation therapy. We compared epigenetic methylation status in BCG-responsive and BCG-failure groups. We used the MS-MLPA (Methylation-Specific Multiplex Ligation-Dependent Probe Amplification probe sets ME001 and ME004. The control group was 13 specimens of normal urotel (bladder tissue)). Newly identified methylations in high grade NMIBC were found in MUS81a, NTRK1 and PCCA. The methylation status of CDKN2B (P=0.00312 ** ) and MUS81a (P=0.0191 * ) is associated with clinical outcomes of BCG instillation therapy response. CDKN2B and MUS81a unmethylation was found in BCG failure patients. The results show that the methylation status of selected tumor suppressor genes (TSGs) has the potential for predicting BCG response in patients with NMIBC high grade tumors. Tumor suppressor genes such as CDKN2b, MUS81a, PFM-1, MSH6 and THBS1 are very promising for future research.

THE TRANSCRIPTIONAL PROFILE OF THE KIDNEY IN TSC2 HETEROZYGOUS MUTANT LONG EVANS (EKER) RATS COMPARED TO WILD-TYPE

EPA Science Inventory

Hereditary renal cell carcinoma (RCC) in Eker rats results from an inherited insertional mutation in the Tsc2 tumor suppressor gene and provides a valuable experimental model to characterize the function of the Tsc2 gene product, tuberin in vivo. The Tsc2 mutation predisposes the...

A Gene Module-Based eQTL Analysis Prioritizing Disease Genes and Pathways in Kidney Cancer.

PubMed

Yang, Mary Qu; Li, Dan; Yang, William; Zhang, Yifan; Liu, Jun; Tong, Weida

2017-01-01

Clear cell renal cell carcinoma (ccRCC) is the most common and most aggressive form of renal cell cancer (RCC). The incidence of RCC has increased steadily in recent years. The pathogenesis of renal cell cancer remains poorly understood. Many of the tumor suppressor genes, oncogenes, and dysregulated pathways in ccRCC need to be revealed for improvement of the overall clinical outlook of the disease. Here, we developed a systems biology approach to prioritize the somatic mutated genes that lead to dysregulation of pathways in ccRCC. The method integrated multi-layer information to infer causative mutations and disease genes. First, we identified differential gene modules in ccRCC by coupling transcriptome and protein-protein interactions. Each of these modules consisted of interacting genes that were involved in similar biological processes and their combined expression alterations were significantly associated with disease type. Then, subsequent gene module-based eQTL analysis revealed somatic mutated genes that had driven the expression alterations of differential gene modules. Our study yielded a list of candidate disease genes, including several known ccRCC causative genes such as BAP1 and PBRM1 , as well as novel genes such as NOD2, RRM1, CSRNP1, SLC4A2, TTLL1 and CNTN1. The differential gene modules and their driver genes revealed by our study provided a new perspective for understanding the molecular mechanisms underlying the disease. Moreover, we validated the results in independent ccRCC patient datasets. Our study provided a new method for prioritizing disease genes and pathways.

The role of micro-RNAs in hepatocellular carcinoma: from molecular biology to treatment.

PubMed

D'Anzeo, Marco; Faloppi, Luca; Scartozzi, Mario; Giampieri, Riccardo; Bianconi, Maristella; Del Prete, Michela; Silvestris, Nicola; Cascinu, Stefano

2014-05-19

Hepatocellular carcinoma (HCC) is the fifth most common cancer worldwide and the third leading cause of cancer deaths. microRNAs (miRNAs) are evolutionary conserved small non-coding RNA that negatively regulate gene expression and protein translation. Recent evidences have shown that they are involved in many biological processes, from development and cell-cycle regulation to apoptosis. miRNAs can behave as tumor suppressor or promoter of oncogenesis depending on the cellular function of their targets. Moreover, they are frequently dysregulated in HCC. In this review we summarize the latest findings of miRNAs regulation in HCC and their role as potentially diagnostic and prognostic biomarkers for HCC. We highlight development of miRNAs as potential therapeutic targets for HCC.

Global profiling of alternative RNA splicing events provides insights into molecular differences between various types of hepatocellular carcinoma.

PubMed

Tremblay, Marie-Pier; Armero, Victoria E S; Allaire, Andréa; Boudreault, Simon; Martenon-Brodeur, Camille; Durand, Mathieu; Lapointe, Elvy; Thibault, Philippe; Tremblay-Létourneau, Maude; Perreault, Jean-Pierre; Scott, Michelle S; Bisaillon, Martin

2016-08-26

Dysregulations in alternative splicing (AS) patterns have been associated with many human diseases including cancer. In the present study, alterations to the global RNA splicing landscape of cellular genes were investigated in a large-scale screen from 377 liver tissue samples using high-throughput RNA sequencing data. Our study identifies modifications in the AS patterns of transcripts encoded by more than 2500 genes such as tumor suppressor genes, transcription factors, and kinases. These findings provide insights into the molecular differences between various types of hepatocellular carcinoma (HCC). Our analysis allowed the identification of 761 unique transcripts for which AS is misregulated in HBV-associated HCC, while 68 are unique to HCV-associated HCC, 54 to HBV&HCV-associated HCC, and 299 to virus-free HCC. Moreover, we demonstrate that the expression pattern of the RNA splicing factor hnRNPC in HCC tissues significantly correlates with patient survival. We also show that the expression of the HBx protein from HBV leads to modifications in the AS profiles of cellular genes. Finally, using RNA interference and a reverse transcription-PCR screening platform, we examined the implications of cellular proteins involved in the splicing of transcripts involved in apoptosis and demonstrate the potential contribution of these proteins in AS control. This study provides the first comprehensive portrait of global changes in the RNA splicing signatures that occur in hepatocellular carcinoma. Moreover, these data allowed us to identify unique signatures of genes for which AS is misregulated in the different types of HCC.

Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

PubMed Central

2014-01-01

Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

PubMed

Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

2018-03-01

Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.