Sample records for suppressor mutations affecting

  1. Identification and analysis of mutational hotspots in oncogenes and tumour suppressors.

    PubMed

    Baeissa, Hanadi; Benstead-Hume, Graeme; Richardson, Christopher J; Pearl, Frances M G

    2017-03-28

    The key to interpreting the contribution of a disease-associated mutation in the development and progression of cancer is an understanding of the consequences of that mutation both on the function of the affected protein and on the pathways in which that protein is involved. Protein domains encapsulate function and position-specific domain based analysis of mutations have been shown to help elucidate their phenotypes. In this paper we examine the domain biases in oncogenes and tumour suppressors, and find that their domain compositions substantially differ. Using data from over 30 different cancers from whole-exome sequencing cancer genomic projects we mapped over one million mutations to their respective Pfam domains to identify which domains are enriched in any of three different classes of mutation; missense, indels or truncations. Next, we identified the mutational hotspots within domain families by mapping small mutations to equivalent positions in multiple sequence alignments of protein domainsWe find that gain of function mutations from oncogenes and loss of function mutations from tumour suppressors are normally found in different domain families and when observed in the same domain families, hotspot mutations are located at different positions within the multiple sequence alignment of the domain. By considering hotspots in tumour suppressors and oncogenes independently, we find that there are different specific positions within domain families that are particularly suited to accommodate either a loss or a gain of function mutation. The position is also dependent on the class of mutation.We find rare mutations co-located with well-known functional mutation hotspots, in members of homologous domain superfamilies, and we detect novel mutation hotspots in domain families previously unconnected with cancer. The results of this analysis can be accessed through the MOKCa database (http://strubiol.icr.ac.uk/extra/MOKCa).

  2. Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

    PubMed

    Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

    2011-12-01

    Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

  3. Genetic Characterization of the SufJ Frameshift Suppressor in SALMONELLA TYPHIMURIUM

    PubMed Central

    Bossi, Lionello; Kohno, Tadahiko; Roth, John R.

    1983-01-01

    A new suppressor of +1 frameshift mutations has been isolated in Salmonella typhimurium. This suppressor, sufJ, maps at minute 89 on the Salmonella genetic map between the argH and rpo(rif) loci, closely linked to the gene for the ochre suppressor tyrU(supM). The suppressor mutation is dominant to its wild-type allele, consistent with the suppressor phenotype being caused by an altered tRNA species. The sufJ map position coincides with that of a threonine tRNA(ACC/U) gene; the suppressor has been shown to read the related fourbase codons ACCU, ACCC, ACCA.—The ability of sufJ to correct one particular mutation depends on the presence of a hisT mutation which causes a defect in tRNA modification. This requirement is allele specific, since other frameshift mutations can be corrected by sufJ regardless of the state of the hisT locus.—Strains carrying both a sufJ and a hisT mutation are acutely sensitive to growth inhibition by uracil; the inhibition is reversed by arginine. This behavior is characteristic of strains with mutations affecting the arginine-uracil biosynthetic enzyme carbamyl phosphate synthetase. The combination of two mutations affecting tRNA structure may reduce expression of the structural gene for this enzyme (pyrA). PMID:6188650

  4. A mutation in the neurofibromatosis type 2 tumor-suppressor gene, giving rise to widely different clinical phenotypes in two unrelated individuals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bourn, D.; Carter, S.A.; Goodship, J.

    The authors have sought mutations in the recently identified neurofibromatosis type 2 (NF2) tumor-suppressor gene in a large panel of NF2 patients, using PCR-based SSCP and heteroduplex analysis, followed by cloning and sequencing of appropriate PCR products. Two unrelated NF2 patients were found to have identical nonsense mutations caused by a C-to-T transition in a CpG dinucleotide that is a potential mutational hot spot in the NF2 tumor-suppressor gene. Unexpectedly, the two individuals had widely different clinical phenotypes, representing the severe Wishart and mild Gardner clinical subtypes. Analysis of DNA samples from different tissues of the mildly affected patient suggestsmore » that he is a somatic mosaic for the mutation. 26 refs., 3 figs.« less

  5. Suppressor Mutations for Presenilin 1 Familial Alzheimer Disease Mutants Modulate γ-Secretase Activities.

    PubMed

    Futai, Eugene; Osawa, Satoko; Cai, Tetsuo; Fujisawa, Tomoya; Ishiura, Shoichi; Tomita, Taisuke

    2016-01-01

    γ-Secretase is a multisubunit membrane protein complex containing presenilin (PS1) as a catalytic subunit. Familial Alzheimer disease (FAD) mutations within PS1 were analyzed in yeast cells artificially expressing membrane-bound substrate, amyloid precursor protein, or Notch fused to Gal4 transcriptional activator. The FAD mutations, L166P and G384A (Leu-166 to Pro and Gly-384 to Ala substitution, respectively), were loss-of-function in yeast. We identified five amino acid substitutions that suppress the FAD mutations. The cleavage of amyloid precursor protein or Notch was recovered by the secondary mutations. We also found that secondary mutations alone activated the γ-secretase activity. FAD mutants with suppressor mutations, L432M or S438P within TMD9 together with a missense mutation in the second or sixth loops, regained γ-secretase activity when introduced into presenilin null mouse fibroblasts. Notably, the cells with suppressor mutants produced a decreased amount of Aβ42, which is responsible for Alzheimer disease. These results indicate that the yeast system is useful to screen for mutations and chemicals that modulate γ-secretase activity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

    PubMed

    Xayarath, Bobbi; Yother, Janet

    2007-05-01

    Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

  7. A chemotactic signaling surface on CheY defined by suppressors of flagellar switch mutations.

    PubMed Central

    Roman, S J; Meyers, M; Volz, K; Matsumura, P

    1992-01-01

    CheY is the response regulator protein that interacts with the flagellar switch apparatus to modulate flagellar rotation during chemotactic signaling. CheY can be phosphorylated and dephosphorylated in vitro, and evidence indicates that CheY-P is the activated form that induces clockwise flagellar rotation, resulting in a tumble in the cell's swimming pattern. The flagellar switch apparatus is a complex macromolecular structure composed of at least three gene products, FliG, FliM, and FliN. Genetic analysis of Escherichia coli has identified fliG and fliM as genes in which mutations occur that allele specifically suppress cheY mutations, indicating interactions among these gene products. We have generated a class of cheY mutations selected for dominant suppression of fliG mutations. Interestingly, these cheY mutations dominantly suppressed both fliG and fliM mutations; this is consistent with the idea that the CheY protein interacts with both switch gene products during signaling. Biochemical characterization of wild-type and suppressor CheY proteins did not reveal altered phosphorylation properties or evidence for phosphorylation-dependent CheY multimerization. These data indicate that suppressor CheY proteins are specifically altered in the ability to transduce chemotactic signals to the switch at some point subsequent to phosphorylation. Physical mapping of suppressor amino acid substitutions on the crystal structure of CheY revealed a high degree of spatial clustering, suggesting that this region of CheY is a signaling surface that transduces chemotactic signals to the switch. Images PMID:1400175

  8. Suppressor Mutation Analysis of the Sensory Rhodopsin I-Transducer Complex: Insights into the Color-Sensing Mechanism

    PubMed Central

    Jung, Kwang-Hwan; Spudich, John L.

    1998-01-01

    The molecular complex containing the phototaxis receptor sensory rhodopsin I (SRI) and transducer protein HtrI (halobacterial transducer for SRI) mediates color-sensitive phototaxis responses in the archaeon Halobacterium salinarum. One-photon excitation of the complex by orange light elicits attractant responses, while two-photon excitation (orange followed by near-UV light) elicits repellent responses in swimming cells. Several mutations in SRI and HtrI cause an unusual mutant phenotype, called orange-light-inverted signaling, in which the cell produces a repellent response to normally attractant light. We applied a selection procedure for intragenic and extragenic suppressors of orange-light-inverted mutants and identified 15 distinct second-site mutations that restore the attractant response. Two of the 3 suppressor mutations in SRI are positioned at the cytoplasmic ends of helices F and G, and 12 suppressor mutations in HtrI cluster at the cytoplasmic end of the second HtrI transmembrane helix (TM2). Nearly all suppressors invert the normally repellent response to two-photon stimulation to an attractant response when they are expressed with their suppressible mutant alleles or in an otherwise wild-type strain. The results lead to a model for control of flagellar reversal by the SRI-HtrI complex. The model invokes an equilibrium between the A (reversal-inhibiting) and R (reversal-stimulating) conformers of the signaling complex. Attractant light and repellent light shift the equilibrium toward the A and R conformers, respectively, and mutations are proposed to cause intrinsic shifts in the equilibrium in the dark form of the complex. Differences in the strength of the two-photon signal inversion and in the allele specificity of suppression are correlated, and this correlation can be explained in terms of different values of the equilibrium constant (Keq) for the conformational transition in different mutants and mutant-suppressor pairs. PMID:9555883

  9. Structural studies of p53 inactivation by DNA-contact mutations and its rescue by suppressor mutations via alternative protein–DNA interactions

    PubMed Central

    Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora

    2013-01-01

    A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845

  10. A Restricted Spectrum of Mutations in the SMAD4 Tumor-Suppressor Gene Underlies Myhre Syndrome

    PubMed Central

    Caputo, Viviana; Cianetti, Luciano; Niceta, Marcello; Carta, Claudio; Ciolfi, Andrea; Bocchinfuso, Gianfranco; Carrani, Eugenio; Dentici, Maria Lisa; Biamino, Elisa; Belligni, Elga; Garavelli, Livia; Boccone, Loredana; Melis, Daniela; Andria, Generoso; Gelb, Bruce D.; Stella, Lorenzo; Silengo, Margherita; Dallapiccola, Bruno; Tartaglia, Marco

    2012-01-01

    Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor β and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth. PMID:22243968

  11. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  12. Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer.

    PubMed

    Mlakar, Vid; Berginc, Gasper; Volavsek, Metka; Stor, Zdravko; Rems, Miran; Glavac, Damjan

    2009-08-13

    Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC), it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin.

  13. Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer

    PubMed Central

    2009-01-01

    Background Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC), it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. Methods We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. Results We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Conclusion Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin. PMID:19678923

  14. Frameshift Suppression in SACCHAROMYCES CEREVISIAE. IV. New Suppressors among Spontaneous Co-Revertants of the Group II HIS4-206 and LEU2-3 Frameshift Mutations

    PubMed Central

    Gaber, Richard F.; Culbertson, Michael R.

    1982-01-01

    ICR-induced frameshift mutations at the his4 locus in Saccharomyces cerevisiae have been classified into several groups on the basis of their reversion and suppression properties. One group of externally suppressible his4 mutations, designated Group II, have been shown to contain +1 G:C insertions in glycine codons and are suppressed by any one of five suppressor mutations described previously (SUF1, SUF3, SUF4, SUF5, and SUF6). The suppressor genes are believed to encode glycine tRNAs containing four base anticodons.—An analysis of spontaneous co-revertants of the Group II frameshift mutations his4-206 and leu2-3 has revealed the existence of eleven new Group II-specific suppressor genes (SUF15 through SUF25). The locations of the new suppressor loci on the yeast genetic map have been determined.—By comparing the ability or inability of Group II-specific suppressors mapping at 16 different loci to suppress different Group II his4 mutations, two subclasses of suppressors have been defined. One subclass suppresses his4-38 and his4-519, which contain the altered four base mRNA codons 5'-GGGU-3' and 5'-GGGG-3', respectively. The other subclass suppresses his4-38, but fails to suppress his4-519. The mechanism of tRNA-mediated frameshift suppression and the molecular basis for this division of the suppressors into two subclasses is discussed. PMID:6757051

  15. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    ERIC Educational Resources Information Center

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  16. Remarkable stabilization of a psychrotrophic RNase HI by a combination of thermostabilizing mutations identified by the suppressor mutation method.

    PubMed

    Tadokoro, Takashi; Matsushita, Kyoko; Abe, Yumi; Rohman, Muhammad Saifur; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori

    2008-08-05

    Ribonuclease HI from the psychrotrophic bacterium Shewanella oneidensis MR-1 (So-RNase HI) is much less stable than Escherichia coli RNase HI (Ec-RNase HI) by 22.4 degrees C in T m and 12.5 kJ mol (-1) in Delta G(H 2O), despite their high degrees of structural and functional similarity. To examine whether the stability of So-RNase HI increases to a level similar to that of Ec-RNase HI via introduction of several mutations, the mutations that stabilize So-RNase HI were identified by the suppressor mutation method and combined. So-RNase HI and its variant with a C-terminal four-residue truncation (154-RNase HI) complemented the RNase H-dependent temperature-sensitive (ts) growth phenotype of E. coli strain MIC3001, while 153-RNase HI with a five-residue truncation could not. Analyses of the activity and stability of these truncated proteins suggest that 153-RNase HI is nonfunctional in vivo because of a great decrease in stability. Random mutagenesis of 153-RNase HI using error-prone PCR, followed by screening for the revertants, allowed us to identify six single suppressor mutations that make 153-RNase HI functional in vivo. Four of them markedly increased the stability of the wild-type protein by 3.6-6.7 degrees C in T m and 1.7-5.2 kJ mol (-1) in Delta G(H 2O). The effects of these mutations were nearly additive, and combination of these mutations increased protein stability by 18.7 degrees C in T m and 12.2 kJ mol (-1) in Delta G(H 2O). These results suggest that several residues are not optimal for the stability of So-RNase HI, and their replacement with other residues strikingly increases it to a level similar to that of the mesophilic counterpart.

  17. Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

    PubMed Central

    Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

    2010-01-01

    RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

  18. Mutations in eukaryotic release factors 1 and 3 act as general nonsense suppressors in Drosophila.

    PubMed Central

    Chao, Anna T; Dierick, Herman A; Addy, Tracie M; Bejsovec, Amy

    2003-01-01

    In a screen for suppressors of the Drosophila wingless(PE4) nonsense allele, we isolated mutations in the two components that form eukaryotic release factor. eRF1 and eRF3 comprise the translation termination complex that recognizes stop codons and catalyzes the release of nascent polypeptide chains from ribosomes. Mutations disrupting the Drosophila eRF1 and eRF3 show a strong maternal-effect nonsense suppression due to readthrough of stop codons and are zygotically lethal during larval stages. We tested nonsense mutations in wg and in other embryonically acting genes and found that different stop codons can be suppressed but only a subset of nonsense alleles are subject to suppression. We suspect that the context of the stop codon is significant: nonsense alleles sensitive to suppression by eRF1 and eRF3 encode stop codons that are immediately followed by a cytidine. Such suppressible alleles appear to be intrinsically weak, with a low level of readthrough that is enhanced when translation termination is disrupted. Thus the eRF1 and eRF3 mutations provide a tool for identifying nonsense alleles that are leaky. Our findings have important implications for assigning null mutant phenotypes and for selecting appropriate alleles to use in suppressor screens. PMID:14573473

  19. Identification of new adventitious rooting mutants amongst suppressors of the Arabidopsis thaliana superroot2 mutation.

    PubMed

    Pacurar, Daniel Ioan; Pacurar, Monica Lacramioara; Bussell, John Desmond; Schwambach, Joseli; Pop, Tiberia Ioana; Kowalczyk, Mariusz; Gutierrez, Laurent; Cavel, Emilie; Chaabouni, Salma; Ljung, Karin; Fett-Neto, Arthur Germano; Pamfil, Doru; Bellini, Catherine

    2014-04-01

    The plant hormone auxin plays a central role in adventitious rooting and is routinely used with many economically important, vegetatively propagated plant species to promote adventitious root initiation and development on cuttings. Nevertheless the molecular mechanisms through which it acts are only starting to emerge. The Arabidopsis superroot2-1 (sur2-1) mutant overproduces auxin and, as a consequence, develops excessive adventitious roots in the hypocotyl. In order to increase the knowledge of adventitious rooting and of auxin signalling pathways and crosstalk, this study performed a screen for suppressors of superroot2-1 phenotype. These suppressors provide a new resource for discovery of genetic players involved in auxin signalling pathways or at the crosstalk of auxin and other hormones or environmental signals. This study reports the identification and characterization of 26 sur2-1 suppressor mutants, several of which were identified as mutations in candidate genes involved in either auxin biosynthesis or signalling. In addition to confirming the role of auxin as a central regulator of adventitious rooting, superroot2 suppressors indicated possible crosstalk with ethylene signalling in this process.

  20. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed Central

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  1. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  2. Loss of Elongation-Like Factor 1 Spontaneously Induces Diverse, RNase H-Related Suppressor Mutations in Schizosaccharomyces pombe.

    PubMed

    Marayati, Bahjat F; Drayton, Alena L; Tucker, James F; Huckabee, Reid H; Anderson, Alicia M; Pease, James B; Zeyl, Clifford W; Zhang, Ke

    2018-05-29

    A healthy individual may carry a detrimental genetic trait that is masked by another genetic mutation. Such suppressive genetic interactions, in which a mutant allele either partially or completely restores the fitness defect of a particular mutant, tend to occur between genes that have a confined functional connection. Here we investigate a self-recovery phenotype in Schizosaccharomyces pombe , mediated by suppressive genetic interactions that can be amplified during cell culture. Cells without Elf1, an AAA+ family ATPase, have severe growth defects initially, but quickly recover growth rates near to those of wild-type strains by acquiring suppressor mutations. elf1Δ cells accumulate RNAs within the nucleus and display effects of genome instability such as sensitivity to DNA damage, increased incidence of lagging chromosomes, and mini-chromosome loss. Notably, the rate of phenotypic recovery was further enhanced in elf1Δ cells when RNase H activities were abolished and significantly reduced upon overexpression of RNase H1, suggesting that loss of Elf1-related genome instability can be resolved by RNase H activities, likely through eliminating the potentially mutagenic DNA-RNA hybrids caused by RNA nuclear accumulation. Using whole genome sequencing, we mapped a few consistent suppressors of elf1Δ including mutated Cue2, Rpl2702, and SPBPJ4664.02, suggesting previously unknown functional connections between Elf1 and these proteins. Our findings describe a mechanism by which cells bearing mutations that cause fitness defects and genome instability may accelerate the fitness recovery of their population through quickly acquiring suppressors. We propose that this mechanism may be universally applicable to all microorganisms in large-population cultures. Copyright © 2018, Genetics.

  3. Mobility of the maize suppressor-mutator element in transgenic tobacco cells.

    PubMed Central

    Masson, P; Fedoroff, N V

    1989-01-01

    Maize Suppressor-mutator (Spm) transposable elements have been introduced into tobacco cells and a visual assay for Spm activity has been developed using a bacterial beta-glucuronidase gene. The Spm element is mobile in tobacco and can trans-activate excision of a transposition-defective Spm (dSpm) element either from a different site on the same transforming Ti plasmid or from a second plasmid. An Spm element expressed from the stronger cauliflower mosaic virus 35S promoter trans-activates transposition of a dSpm element earlier after its introduction into tobacco cells than an element expressed from its own promoter. Images PMID:2538837

  4. Ring structure amino acids affect the suppressor activity of melon aphid-borne yellows virus P0 protein.

    PubMed

    Han, Yan-Hong; Xiang, Hai-Ying; Wang, Qian; Li, Yuan-Yuan; Wu, Wen-Qi; Han, Cheng-Gui; Li, Da-Wei; Yu, Jia-Lin

    2010-10-10

    Melon aphid-borne yellows virus (MABYV) is a newly identified polerovirus occurring in China. Here, we demonstrate that the MABYV encoded P0 (P0(MA)) protein is a strong suppressor of post-transcriptional gene silencing (PTGS) with activity comparable to tobacco etch virus (TEV) HC-Pro. In addition we have shown that the LP F-box motif present at the N-terminus of P0(MA) is required for suppressor activity. Detailed mutational analyses on P0(MA) revealed that changing the conserved Trp 212 with non-ring structured amino acids altered silencing suppressor functions. Ala substitutions at positions 12 and 211 for Phe had no effect on P0 suppression-activity, whereas Arg and Glu substitutions had greatly decreased suppressor activity. Furthermore, substitutions targeting Phe at position 30 also resulted in reduced P0 suppression-activity. Altogether, these results suggest that ring structured Trp/Phe residues in P0 have important roles in suppressor activity. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Frameshift Suppression in SACCHAROMYCES CEREVISIAE. III. Isolation and Genetic Properties of Group III Suppressors

    PubMed Central

    Cummins, Claudia M.; Gaber, Richard F.; Culbertson, Michael R.; Mann, Richard; Fink, Gerald R.

    1980-01-01

    Suppressors of ICR-induced mutations that exhibit behavior similar to bacterial frameshift suppressors have been identified in the yeast Saccharomyces cerevisiae. The yeast suppressors have been divided into two groups. Previous evidence indicated that suppressors of one group (Group II: SUF1, SUF3, SUF4, SUF5 and SUF6) represent mutations in the structural genes for glycyl-tRNA's. Suppressors of the other group (Group III: SUF2 and SUF7) were less well characterized. Although they suppressed some ICR-revertible mutations, they failed to suppress Group II frameshift mutations. This communication provides a more thorough characterization of the Group III suppressors and describes the isolation and properties of four new suppressors in that group (SUF8, SUF9, SUF10 and suf11).——In our original study, Group III suppressors were isolated as revertants of the Group III mutations his4–712 and his4–713. All suppressors obtained as ICR-induced revertants of these mutations mapped at the SUF2 locus near the centromere of chromosome III. Suppressors mapping at other loci were obtained in this study by analyzing spontaneous and UV-induced revertants of the Group III mutations. SUF2 and SUF10 suppress both Group III his4 mutations, whereas SUF7, SUF8, SUF9 and suf11 suppress his4–713, but not his4–712. All of the suppressors except suf11 are dominant in diploids homozygous for his4-713. The suppressors fail to suppress representative UAA, UAG and UGA nonsense mutations.——SUF9 is linked to the centromere of chromosome VI, and SUF10 is linked to the centromere of chromosome XIV. A triploid mapping procedure was used to determine the chromosome locations of SUF7 and SUF8. Subsequent standard crosses revealed linkage of SUF7 to cdc5 on chromosome XIII and linkage of SUF8 to cdc12 and pet3 on chromosome VIII. PMID:7009319

  6. Mutations in a signal sequence for the thylakoid membrane identify multiple protein transport pathways and nuclear suppressors

    PubMed Central

    1994-01-01

    The apparatus that permits protein translocation across the internal thylakoid membranes of chloroplasts is completely unknown, even though these membranes have been the subject of extensive biochemical analysis. We have used a genetic approach to characterize the translocation of Chlamydomonas cytochrome f, a chloroplast-encoded protein that spans the thylakoid once. Mutations in the hydrophobic core of the cytochrome f signal sequence inhibit the accumulation of cytochrome f, lead to an accumulation of precursor, and impair the ability of Chlamydomonas cells to grow photosynthetically. One hydrophobic core mutant also reduces the accumulation of other thylakoid membrane proteins, but not those that translocate completely across the membrane. These results suggest that the signal sequence of cytochrome f is required and is involved in one of multiple insertion pathways. Suppressors of two signal peptide mutations describe at least two nuclear genes whose products likely describe the translocation apparatus, and selected second-site chloroplast suppressors further define regions of the cytochrome f signal peptide. PMID:8034740

  7. Novel p53 tumour suppressor mutations in cases of spindle cell sarcoma, pleomorphic sarcoma and fibrosarcoma in cats.

    PubMed

    Mayr, B; Reifinger, M; Alton, K; Schaffner, G

    1998-06-01

    Twenty feline neoplasms were sequenced in the region from exons 5 to 8 for the presence of tumour suppressor gene p53 mutations. In a spindle cell sarcoma of the bladder, a missense mutation (codon 164 AAG-->GAG, lysine-->glutamic acid) in exon 5 was detected. In a pleomorphic sarcoma, a 23 bp deletion involving the splicing junction between intron 5 and exon 6 was observed. In a fibrosarcoma, a 6 bp deletion of p53 covering 2 bp of exon 7 and 4 bp of intron 7, including the splicing junction, was found. The study demonstrates three new p53 mutations in different types of sarcomas in cats.

  8. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    PubMed

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  9. Analysis of fluG mutations that affect light-dependent conidiation in Aspergillus nidulans.

    PubMed Central

    Yager, L N; Lee, H O; Nagle, D L; Zimmerman, J E

    1998-01-01

    Conidiation in Aspergillus nidulans is induced by exposure to red light but can also be induced by blue light in certain mutant strains. We have isolated a mutation in the fluG gene that abolishes responsiveness to red light but does not affect the response to blue light. It has been shown that the veA1 (velvet) mutation allows conidiation to occur in the absence of light. We have identified three other fluG mutations that suppress the veA1 phenotype; these double mutants do not conidiate in the dark. The mutations described here define two new phenotypic classes of fluG alleles that display abnormal responses to light. We have characterized these mutations with respect to their molecular identity and to their effect on fluG transcription. Although it has been shown that fluG is required for the synthesis of an extracellular factor that directs conidiation, we do not detect this factor under conditions that promote conidiation in the veA1 suppressors. Furthermore, extracellular rescue is not observed in fluG deletion strains containing the wild-type veA allele. We propose that a genetic interaction between fluG and veA influences the production of the extracellular signal and regulates the initiation of conidiation. PMID:9691036

  10. Dominant suppressor mutation bypasses the sphingolipid requirement for growth of Saccharomyces cells at low pH: role of the CWP2 gene.

    PubMed

    Skrzypek, M; Lester, R L; Spielmann, P; Zingg, N; Shelling, J; Dickson, R C

    2000-11-01

    Strains of Saccharomyces cerevisiae termed sphingolipid compensatory (SLC) do not grow at low pH when the cells lack sphingolipids. To begin to understand why sphingolipids are required for growth at low pH, we isolated derivatives of SLC strains, termed low pH resistant (LprR), carrying the LPR suppressor gene that allows growth at pH 4.1 when cells lack sphingolipids. Suppression is due to mutation of a single nuclear gene. The LPR suppressor gene functions, at least in part, by enhancing the ability of cells lacking sphingolipids to generate a net efflux of protons in suspension fluid with a pH range of 4.0-6.0. The LPR suppressor gene also enables cells lacking sphingolipids to maintain their intracellular pH near neutrality when the pH of the suspension fluid is low, unlike cells lacking the suppressor gene, which cannot maintain their intracellular pH in the face of a low external pH. These results demonstrate that some functions(s) of sphingolipids necessary for growth at low pH can be bypassed by a suppressor mutation. Attempts to clone the LPR suppressor gene were not successful, but they led to the isolation of the CWP2 gene, which encodes a major mannoprotein component of the outer cell wall. It was isolated because an increased copy number has the unusual property of increasing the frequency at which LprR strains arise. As we show here, part of the reason for this effect is that the CWP2 gene is essential for generating a net efflux of protons and for controlling intracellular pH in LprR strains that lack sphingolipids. These results suggest new cellular functions for the Cwp2 protein.

  11. Multi-layered mutation in hedgehog-related genes in Gorlin syndrome may affect the phenotype.

    PubMed

    Onodera, Shoko; Saito, Akiko; Hasegawa, Daigo; Morita, Nana; Watanabe, Katsuhito; Nomura, Takeshi; Shibahara, Takahiko; Ohba, Shinsuke; Yamaguchi, Akira; Azuma, Toshifumi

    2017-01-01

    Gorlin syndrome is a genetic disorder of autosomal dominant inheritance that predisposes the affected individual to a variety of disorders that are attributed largely to heterozygous germline patched1 (PTCH1) mutations. PTCH1 is a hedgehog (Hh) receptor as well as a repressor, mutation of which leads to constitutive activation of Hh pathway. Hh pathway encompasses a wide variety of cellular signaling cascades, which involve several molecules; however, no associated genotype-phenotype correlations have been reported. Recently, mutations in Suppressor of fused homolog (SUFU) or PTCH2 were reported in patients with Gorlin syndrome. These facts suggest that multi-layered mutations in Hh pathway may contribute to the development of Gorlin syndrome. We demonstrated multiple mutations of Hh-related genes in addition to PTCH1, which possibly act in an additive or multiplicative manner and lead to Gorlin syndrome. High-throughput sequencing was performed to analyze exome sequences in four unrelated Gorlin syndrome patient genomes. Mutations in PTCH1 gene were detected in all four patients. Specific nucleotide variations or frameshift variations of PTCH1 were identified along with the inferred amino acid changes in all patients. We further filtered 84 different genes which are closely related to Hh signaling. Fifty three of these had enough coverage of over ×30. The sequencing results were filtered and compared to reduce the number of sequence variants identified in each of the affected individuals. We discovered three genes, PTCH2, BOC, and WNT9b, with mutations with a predicted functional impact assessed by MutationTaster2 or PolyPhen-2 (Polymorphism Phenotyping v2) analysis. It is noticeable that PTCH2 and BOC are Hh receptor molecules. No significant mutations were observed in SUFU. Multi-layered mutations in Hh pathway may change the activation level of the Hh signals, which may explain the wide phenotypic variability of Gorlin syndrome.

  12. ssaD1, a suppressor of secA51(Ts) that renders growth of Escherichia coli cold sensitive, is an early amber mutation in the transcription factor gene nusB.

    PubMed Central

    Rajapandi, T.; Oliver, D.

    1994-01-01

    Complementation analysis of the ssaD1 mutation, isolated as a suppressor of the secA51(Ts) mutation that renders growth of Escherichia coli cold sensitive, was used to show that ssaD corresponds to nusB, a gene known to be important in transcription antitermination. DNA sequence analysis of the ssaD1 allele showed that it creates an amber mutation in the 15th codon of nusB. Analysis of the effect of different levels of NusB protein on secA transcription and translation suggested that NusB plays little or no role in the control of secA expression. Accordingly, mechanisms by which nusB inactivation can lead to suppression of secA51(Ts) and secY24(Ts) mutations without affecting secA expression need to be considered. PMID:8021230

  13. The Generation and Genetic Analysis of Suppressors of Lethal Mutations in the Caenorhabditis Elegans Rol-3(v) Gene

    PubMed Central

    Barbazuk, W. B.; Johnsen, R. C.; Baillie, D. L.

    1994-01-01

    The Caenorhabditis elegans rol-3(e754) mutation is a member of a general glass of mutations affecting gross morphology, presumably through disruption of the nematode cuticle. Adult worms homozygous for rol-3(e754) exhibit rotation about their long axis associated with a left-hand twisted cuticle, musculature, gut and ventral nerve cord. Our laboratory previously isolated 12 recessive lethal alleles of rol-3. All these lethal alleles cause an arrest in development at either early or mid-larval stages, suggesting that the rol-3 gene product performs an essential developmental function. Furthermore, through the use of the heterochronic mutants lin-14 and lin-29, we have established that the expression of rol-3(e754)'s adult specific visible function is not dependent on the presence of an adult cuticle. In an attempt to understand rol-3's developmental role we sought to identify other genes whose products interact with that of rol-3. Toward this end, we generated eight EMS induced and two gamma irradiation-induced recessive suppressors of the temperature sensitive (ts) mid-larval lethal phenotype of rol-3(s1040ts). These suppressors define two complementation groups srl-1 II and srl-2 III; and, while they suppress the rol-3(s1040) lethality, they do not suppress the adult specific visible rolling phenotype. Furthermore, there is a complex genetic interaction between srl-2 and srl-1 such that srl-2(s2506) fails to complement all srl alleles tested. These results suggest that srl-1 and srl-2 may share a common function and, thus, possibly constitute members of the same gene family. Mutations in both srl-1 and srl-2 produce no obvious hermaphrodite phenotypes in the absence of rol-3(s1040ts); however, males homozygous for either srl-1 or srl-2 display aberrant tail morphology. We present evidence suggesting that the members of srl-2 are not allele specific with respect to their suppression of rol-3 lethality, and that rol-3 may act in some way to influence proper

  14. Somatic mutations affect key pathways in lung adenocarcinoma

    PubMed Central

    Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

    2009-01-01

    Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

  15. RET is a potential tumor suppressor gene in colorectal cancer

    PubMed Central

    Luo, Yanxin; Tsuchiya, Karen D.; Park, Dong Il; Fausel, Rebecca; Kanngurn, Samornmas; Welcsh, Piri; Dzieciatkowski, Slavomir; Wang, Jianping; Grady, William M.

    2012-01-01

    Cancer arises as the consequence of mutations and epigenetic alterations that activate oncogenes and inactivate tumor suppressor genes. Through a genome-wide screen for methylated genes in colon neoplasms, we identified aberrantly methylated RET in colorectal cancer. RET, a transmembrane receptor tyrosine kinase and a receptor for the GDNF-family ligands, was one of the first oncogenes to be identified and has been shown to be an oncogene in thyroid cancer and pheochromocytoma. However, unexpectedly, we found RET is methylated in 27% of colon adenomas and in 63% of colorectal cancers, and now provide evidence that RET has tumor suppressor activity in colon cancer. The aberrant methylation of RET correlates with decreased RET expression, whereas the restoration of RET in colorectal cancer cell lines results in apoptosis. Furthermore, in support of a tumor suppressor function of RET, mutant RET has also been found in primary colorectal cancer. We now show that these mutations inactivate RET, which is consistent with RET being a tumor suppressor gene in the colon. These findings suggest that the aberrant methylation of RET and the mutational inactivation of RET promote colorectal cancer formation and that RET can serve as a tumor suppressor gene in the colon. Moreover, the increased frequency of methylated RET in colon cancers compared to adenomas suggests RET inactivation is involved in the progression of colon adenomas to cancer. PMID:22751117

  16. Identifying pathways affected by cancer mutations.

    PubMed

    Iengar, Prathima

    2017-12-16

    Mutations in 15 cancers, sourced from the COSMIC Whole Genomes database, and 297 human pathways, arranged into pathway groups based on the processes they orchestrate, and sourced from the KEGG pathway database, have together been used to identify pathways affected by cancer mutations. Genes studied in ≥15, and mutated in ≥10 samples of a cancer have been considered recurrently mutated, and pathways with recurrently mutated genes have been considered affected in the cancer. Novel doughnut plots have been presented which enable visualization of the extent to which pathways and genes, in each pathway group, are targeted, in each cancer. The 'organismal systems' pathway group (including organism-level pathways; e.g., nervous system) is the most targeted, more than even the well-recognized signal transduction, cell-cycle and apoptosis, and DNA repair pathway groups. The important, yet poorly-recognized, role played by the group merits attention. Pathways affected in ≥7 cancers yielded insights into processes affected. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

    PubMed

    Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

    2003-01-01

    The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

  18. Mutations in the LKB1 tumour suppressor are frequently detected in tumours from Caucasian but not Asian lung cancer patients.

    PubMed

    Koivunen, J P; Kim, J; Lee, J; Rogers, A M; Park, J O; Zhao, X; Naoki, K; Okamoto, I; Nakagawa, K; Yeap, B Y; Meyerson, M; Wong, K-K; Richards, W G; Sugarbaker, D J; Johnson, B E; Jänne, P A

    2008-07-22

    Somatic mutations of LKB1 tumour suppressor gene have been detected in human cancers including non-small cell lung cancer (NSCLC). The relationship between LKB1 mutations and clinicopathological characteristics and other common oncogene mutations in NSCLC is inadequately described. In this study we evaluated tumour specimens from 310 patients with NSCLC including those with adenocarcinoma, adenosquamous carcinoma, and squamous cell carcinoma histologies. Tumours were obtained from patients of US (n=143) and Korean (n=167) origin and screened for LKB1, KRAS, BRAF, and EGFR mutations using RT-PCR-based SURVEYOR-WAVE method followed by Sanger sequencing. We detected mutations in the LKB1 gene in 34 tumours (11%). LKB1 mutation frequency was higher in NSCLC tumours of US origin (17%) compared with 5% in NSCLCs of Korean origin (P=0.001). They tended to occur more commonly in adenocarcinomas (13%) than in squamous cell carcinomas (5%) (P=0.066). LKB1 mutations associated with smoking history (P=0.007) and KRAS mutations (P=0.042) were almost mutually exclusive with EGFR mutations (P=0.002). The outcome of stages I and II NSCLC patients treated with surgery alone did not significantly differ based on LKB1 mutation status. Our study provides clinical and molecular characteristics of NSCLC, which harbour LKB1 mutations.

  19. Frameshift Suppression in SACCHAROMYCES CEREVISIAE. V. Isolation and Genetic Properties of Nongroup-Specific Suppressors

    PubMed Central

    Culbertson, Michael R.; Gaber, Richard F.; Cummins, Claudia M.

    1982-01-01

    Two classes of frameshift suppressors distributed at 22 different loci were identified in previous studies in the yeast Saccharomyces cerevisiae. These suppressors exhibited allele-specific suppression of +1 G:C insertion mutations in either glycine or proline codons, designated as group II and group III frameshift mutations, respectively. Genes corresponding to representative suppressors of each group have been shown to encode altered glycine or proline tRNAs containing four base anticodons.—This communication reports the existence of a third class of frameshift suppressor that exhibits a wider range in specificity of suppression. The suppressors map at three loci, suf12, suf13, and suf14, which are located on chromosomes IV, XV, and XIV, respectively. The phenotypes of these suppressors suggest that suppression may be mediated by genes other than those encoding the primary structure of glycine or proline tRNAs. PMID:6757053

  20. Somatic mutations in cancer: Stochastic versus predictable.

    PubMed

    Gold, Barry

    2017-02-01

    The origins of human cancers remain unclear except for a limited number of potent environmental mutagens, such as tobacco and UV light, and in rare cases, familial germ line mutations that affect tumor suppressor genes or oncogenes. A significant component of cancer etiology has been deemed stochastic and correlated with the number of stem cells in a tissue, the number of times the stem cells divide and a low incidence of random DNA polymerase errors that occur during each cell division. While somatic mutations occur during each round of DNA replication, mutations in cancer driver genes are not stochastic. Out of a total of 2843 codons, 1031 can be changed to stop codons by a single base substitution in the tumor suppressor APC gene, which is mutated in 76% of colorectal cancers (CRC). However, the nonsense mutations, which comprise 65% of all the APC driver mutations in CRC, are not random: 43% occur at Arg CGA codons, although they represent <3% of the codons. In TP53, CGA codons comprise <3% of the total 393 codons but they account for 72% and 39% of the mutations in CRC and ovarian cancer OVC, respectively. This mutation pattern is consistent with the kinetically slow, but not stochastic, hydrolytic deamination of 5-methylcytosine residues at specific methylated CpG sites to afford T·G mismatches that lead to C→T transitions and stop codons at CGA. Analysis of nonsense mutations in CRC, OVC and a number of other cancers indicates the need to expand the predictable risk factors for cancer to include, in addition to random polymerase errors, the methylation status of gene body CGA codons in tumor suppressor genes. Copyright © 2017. Published by Elsevier B.V.

  1. Mutations in the LKB1 tumour suppressor are frequently detected in tumours from Caucasian but not Asian lung cancer patients

    PubMed Central

    Koivunen, J P; Kim, J; Lee, J; Rogers, A M; Park, J O; Zhao, X; Naoki, K; Okamoto, I; Nakagawa, K; Yeap, B Y; Meyerson, M; Wong, K-K; Richards, W G; Sugarbaker, D J; Johnson, B E; Jänne, P A

    2008-01-01

    Somatic mutations of LKB1 tumour suppressor gene have been detected in human cancers including non-small cell lung cancer (NSCLC). The relationship between LKB1 mutations and clinicopathological characteristics and other common oncogene mutations in NSCLC is inadequately described. In this study we evaluated tumour specimens from 310 patients with NSCLC including those with adenocarcinoma, adenosquamous carcinoma, and squamous cell carcinoma histologies. Tumours were obtained from patients of US (n=143) and Korean (n=167) origin and screened for LKB1, KRAS, BRAF, and EGFR mutations using RT—PCR-based SURVEYOR-WAVE method followed by Sanger sequencing. We detected mutations in the LKB1 gene in 34 tumours (11%). LKB1 mutation frequency was higher in NSCLC tumours of US origin (17%) compared with 5% in NSCLCs of Korean origin (P=0.001). They tended to occur more commonly in adenocarcinomas (13%) than in squamous cell carcinomas (5%) (P=0.066). LKB1 mutations associated with smoking history (P=0.007) and KRAS mutations (P=0.042) were almost mutually exclusive with EGFR mutations (P=0.002). The outcome of stages I and II NSCLC patients treated with surgery alone did not significantly differ based on LKB1 mutation status. Our study provides clinical and molecular characteristics of NSCLC, which harbour LKB1 mutations. PMID:18594528

  2. The Promiscuous sumA Missense Suppressor from Salmonella enterica Has an Intriguing Mechanism of Action

    PubMed Central

    Cole, Ashley E.; Hani, Fatmah M.; Altman, Ronni; Meservy, Megan; Roth, John R.; Altman, Elliot

    2017-01-01

    While most missense suppressors have very narrow specificities and only suppress the allele against which they were isolated, the sumA missense suppressor from Salmonella enterica serovar Typhimurium is a promiscuous or broad-acting missense suppressor that suppresses numerous missense mutants. The sumA missense suppressor was identified as a glyV tRNA Gly3(GAU/C) missense suppressor that can recognize GAU or GAC aspartic acid codons and insert a glycine amino acid instead of aspartic acid. In addition to rescuing missense mutants caused by glycine to aspartic acid changes as expected, sumA could also rescue a number of other missense mutants as well by changing a neighboring (contacting) aspartic acid to glycine, which compensated for the other amino acid change. Thus the ability of sumA to rescue numerous missense mutants was due in part to the large number of glycine codons in genes that can be mutated to an aspartic acid codon and in part to the general tolerability and/or preference for glycine amino acids in proteins. Because the glyV tRNA Gly3(GAU/C) missense suppressor has also been extensively characterized in Escherichia coli as the mutA mutator, we demonstrated that all gain-of-function mutants isolated in a glyV tRNA Gly3(GAU/C) missense suppressor are transferable to a wild-type background and thus the increased mutation rates, which occur in glyV tRNA Gly3(GAU/C) missense suppressors, are not due to the suppression of these mutants. PMID:27974497

  3. Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

    PubMed

    Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

    2016-11-04

    Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

  4. Epigenetics provides a new generation of oncogenes and tumour-suppressor genes

    PubMed Central

    Esteller, M

    2006-01-01

    Cancer is nowadays recognised as a genetic and epigenetic disease. Much effort has been devoted in the last 30 years to the elucidation of the ‘classical' oncogenes and tumour-suppressor genes involved in malignant cell transformation. However, since the acceptance that major disruption of DNA methylation, histone modification and chromatin compartments are a common hallmark of human cancer, epigenetics has come to the fore in cancer research. One piece is still missing from the story: are the epigenetic genes themselves driving forces on the road to tumorigenesis? We are in the early stages of finding the answer, and the data are beginning to appear: knockout mice defective in DNA methyltransferases, methyl-CpG-binding proteins and histone methyltransferases strongly affect the risk of cancer onset; somatic mutations, homozygous deletions and methylation-associated silencing of histone acetyltransferases, histone methyltransferases and chromatin remodelling factors are being found in human tumours; and the first cancer-prone families arising from germline mutations in epigenetic genes, such as hSNF5/INI1, have been described. Even more importantly, all these ‘new' oncogenes and tumour-suppressor genes provide novel molecular targets for designed therapies, and the first DNA-demethylating agents and inhibitors of histone deacetylases are reaching the bedside of patients with haematological malignancies. PMID:16404435

  5. Point mutations in the tumor suppressor Smad4/DPC4 enhance its phosphorylation by GSK3 and reversibly inactivate TGF-β signaling

    PubMed Central

    Demagny, Hadrien; De Robertis, Edward M

    2016-01-01

    The tumor suppressor Smad4/DPC4 is an essential transcription factor in the TGF-β pathway and is frequently mutated or deleted in prostate, colorectal, and pancreatic carcinomas. We recently discovered that Smad4 activity and stability are regulated by the FGF/EGF and Wnt signaling pathways through a series of MAPK and GSK3 phosphorylation sites located in its linker region. In the present study, we report that loss-of-function associated with 2 point mutations commonly found in colorectal and pancreatic cancers results from enhanced Smad4 phosphorylation by GSK3, generating a phosphodegron that leads to subsequent β-TrCP–mediated polyubiquitination and proteasomal degradation. Using chemical GSK3 inhibitors, we show that Smad4 point mutant proteins can be stabilized and TGF-β signaling restored in cancer cells harboring such mutations. PMID:27308538

  6. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

    PubMed Central

    Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

    2016-01-01

    Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs, and our experimental data from clinical samples, we discovered broad H3K4me3 (wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity together leading to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Broad H3K4me3 conserved across normal cells may represent pan-cancer tumor suppressors, such as P53 and PTEN, whereas cell-type-specific broad H3K4me3 may indicate cell-identity genes and cell-type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 in cancers is associated with repression of tumor suppressors. Together, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of novel tumor suppressors. PMID:26301496

  7. Escherichia coli tatC mutations that suppress defective twin-arginine transporter signal peptides.

    PubMed

    Strauch, Eva-Maria; Georgiou, George

    2007-11-23

    In vitro studies have suggested that the TatBC complex serves as the receptor for signal peptides targeted for export via the twin-arginine translocation (Tat) pathway. Substitution of the hallmark twin-arginine dipeptide with two lysines abrogates export of physiological substrates in all organisms. We report the isolation and characterization of suppressor mutations that allow export of an ssTor(KK)-GFP-SsrA tripartite fusion. We identified two amino acid suppressor mutations in the first cytoplasmic loop of TatC. In addition, two other amino acids in the first cytoplasmic loop exhibit epistatic suppression. Surprisingly, we also identified a suppressor mutation predicted to lie within the second periplasmic loop of TatC, a region that is not expected to interact directly with the signal peptide. The suppressor mutations allowed export of the native Esherichia coli Tat substrate trimethylamine N-oxide reductase with a twin-lysine substitution in its signal sequence. The cytoplasmic suppressor mutations conferred SDS sensitivity and partial filamentation, indicating that Tat export of authentic substrates was impaired.

  8. Mutation that blocks ATP binding creates a pseudokinase stabilizing the scaffolding function of kinase suppressor of Ras, CRAF and BRAF.

    PubMed

    Hu, Jiancheng; Yu, Haiyang; Kornev, Alexandr P; Zhao, Jianping; Filbert, Erin L; Taylor, Susan S; Shaw, Andrey S

    2011-04-12

    Because mutations in RAS and BRAF represent the most common mutations found in human tumors, identification of inhibitors has been a major goal. Surprisingly, new oncogenic BRAF specific inhibitors inhibit cells transformed with mutated BRAF but paradoxically stimulate the growth of cells transformed with RAS. Here, we show that the mechanism for activation is via drug-induced dimer formation between CRAF and kinase suppressor of Ras (KSR)1. To understand the function of KSR1, we generated a KSR1 mutant that cannot bind ATP but stabilizes the closed, active conformation of KSR1. Molecular modeling suggested that the mutant stabilizes the two hydrophobic spines critical for the closed active conformation. We, therefore, could use the mutant to discriminate between the scaffold versus kinase functions of KSR1. The KSR1 mutant bound constitutively to RAF and mitogen-activated protein kinase kinase (MEK) but could not reconstitute activity suggesting that the catalytic activity of KSR1 is required for its function. Analogous mutations in BRAF and CRAF allowed us to test the generality of the model. The mutation induced changes consistent with the active, closed conformation of both kinases and confirmed that BRAF functions distinctly from CRAF in the MAP kinase pathway. Not only does this work suggest that KSR1 may function as a kinase, we anticipate that the mutation that we generated may be broadly applicable to stabilize the closed conformation of other kinases many of which may also form dimers.

  9. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  10. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor-suppressor genes.

    PubMed

    Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

    2015-10-01

    Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs and our experimental data from clinical samples, we discovered broad peaks for trimethylation of histone H3 at lysine 4 (H3K4me3; wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity, which together lead to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Genes with broad H3K4me3 peaks conserved across normal cells may represent pan-cancer tumor suppressors, such as TP53 and PTEN, whereas genes with cell type-specific broad H3K4me3 peaks may represent cell identity genes and cell type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 peaks in cancers is associated with repression of tumor suppressors. Thus, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of new tumor suppressors.

  11. Suppressor Analysis of the Fusogenic Lambda Spanins.

    PubMed

    Cahill, Jesse; Rajaure, Manoj; Holt, Ashley; Moreland, Russell; O'Leary, Chandler; Kulkarni, Aneesha; Sloan, Jordan; Young, Ry

    2017-07-15

    The final step of lysis in phage λ infections of Escherichia coli is mediated by the spanins Rz and Rz1. These proteins form a complex that bridges the cell envelope and that has been proposed to cause fusion of the inner and outer membranes. Accordingly, mutations that block spanin function are found within coiled-coil domains and the proline-rich region, motifs essential in other fusion systems. To gain insight into spanin function, pseudorevertant alleles that restored plaque formation for lysis-defective mutants of Rz and Rz1 were selected. Most second-site suppressors clustered within a coiled-coil domain of Rz near the outer leaflet of the cytoplasmic membrane and were not allele specific. Suppressors largely encoded polar insertions within the hydrophobic core of the coiled-coil interface. Such suppressor changes resulted in decreased proteolytic stability of the Rz double mutants in vivo Unlike the wild type, in which lysis occurs while the cells retain a rod shape, revertant alleles with second-site suppressor mutations supported lysis events that were preceded by spherical cell formation. This suggests that destabilization of the membrane-proximal coiled coil restores function for defective spanin alleles by increasing the conformational freedom of the complex at the cost of its normal, all-or-nothing functionality. IMPORTANCE Caudovirales encode cell envelope-spanning proteins called spanins, which are thought to fuse the inner and outer membranes during phage lysis. Recent genetic analysis identified the functional domains of the lambda spanins, which are similar to class I viral fusion proteins. While the pre- and postfusion structures of model fusion systems have been well characterized, the intermediate structure(s) formed during the fusion reaction remains elusive. Genetic analysis would be expected to identify functional connections between intermediates. Since most membrane fusion systems are not genetically tractable, only few such

  12. Missense Mutations Allow a Sequence-Blind Mutant of SpoIIIE to Successfully Translocate Chromosomes during Sporulation.

    PubMed

    Bose, Baundauna; Reed, Sydney E; Besprozvannaya, Marina; Burton, Briana M

    2016-01-01

    SpoIIIE directionally pumps DNA across membranes during Bacillus subtilis sporulation and vegetative growth. The sequence-reading domain (γ domain) is required for directional DNA transport, and its deletion severely impairs sporulation. We selected suppressors of the spoIIIEΔγ sporulation defect. Unexpectedly, many suppressors were intragenic missense mutants, and some restore sporulation to near-wild-type levels. The mutant proteins are likely not more abundant, faster at translocating DNA, or sequence-sensitive, and rescue does not involve the SpoIIIE homolog SftA. Some mutants behave differently when co-expressed with spoIIIEΔγ, consistent with the idea that some, but not all, variants may form mixed oligomers. In full-length spoIIIE, these mutations do not affect sporulation, and yet the corresponding residues are rarely found in other SpoIIIE/FtsK family members. The suppressors do not rescue chromosome translocation defects during vegetative growth, indicating that the role of the γ domain cannot be fully replaced by these mutations. We present two models consistent with our findings: that the suppressors commit to transport in one arbitrarily-determined direction or delay spore development. It is surprising that missense mutations somehow rescue loss of an entire domain with a complex function, and this raises new questions about the mechanism by which SpoIIIE pumps DNA and the roles SpoIIIE plays in vivo.

  13. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

    PubMed

    Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

    2015-01-01

    A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

  14. The molecular pathogenesis of schwannomatosis, a paradigm for the co-involvement of multiple tumour suppressor genes in tumorigenesis.

    PubMed

    Kehrer-Sawatzki, Hildegard; Farschtschi, Said; Mautner, Victor-Felix; Cooper, David N

    2017-02-01

    Schwannomatosis is characterized by the predisposition to develop multiple schwannomas and, less commonly, meningiomas. Despite the clinical overlap with neurofibromatosis type 2 (NF2), schwannomatosis is not caused by germline NF2 gene mutations. Instead, germline mutations of either the SMARCB1 or LZTR1 tumour suppressor genes have been identified in 86% of familial and 40% of sporadic schwannomatosis patients. In contrast to patients with rhabdoid tumours, which are due to complete loss-of-function SMARCB1 mutations, individuals with schwannomatosis harbour predominantly hypomorphic SMARCB1 mutations which give rise to the synthesis of mutant proteins with residual function that do not cause rhabdoid tumours. Although biallelic mutations of SMARCB1 or LZTR1 have been detected in the tumours of patients with schwannomatosis, the classical two-hit model of tumorigenesis is insufficient to account for schwannoma growth, since NF2 is also frequently inactivated in these tumours. Consequently, tumorigenesis in schwannomatosis must involve the mutation of at least two different tumour suppressor genes, an occurrence frequently mediated by loss of heterozygosity of large parts of chromosome 22q harbouring not only SMARCB1 and LZTR1 but also NF2. Thus, schwannomatosis is paradigmatic for a tumour predisposition syndrome caused by the concomitant mutational inactivation of two or more tumour suppressor genes. This review provides an overview of current models of tumorigenesis and mutational patterns underlying schwannomatosis that will ultimately help to explain the complex clinical presentation of this rare disease.

  15. How mutation affects evolutionary games on graphs

    PubMed Central

    Allen, Benjamin; Traulsen, Arne; Tarnita, Corina E.; Nowak, Martin A.

    2011-01-01

    Evolutionary dynamics are affected by population structure, mutation rates and update rules. Spatial or network structure facilitates the clustering of strategies, which represents a mechanism for the evolution of cooperation. Mutation dilutes this effect. Here we analyze how mutation influences evolutionary clustering on graphs. We introduce new mathematical methods to evolutionary game theory, specifically the analysis of coalescing random walks via generating functions. These techniques allow us to derive exact identity-by-descent (IBD) probabilities, which characterize spatial assortment on lattices and Cayley trees. From these IBD probabilities we obtain exact conditions for the evolution of cooperation and other game strategies, showing the dual effects of graph topology and mutation rate. High mutation rates diminish the clustering of cooperators, hindering their evolutionary success. Our model can represent either genetic evolution with mutation, or social imitation processes with random strategy exploration. PMID:21473871

  16. Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

    PubMed Central

    Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

    1994-01-01

    To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

  17. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    PubMed Central

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

    2013-01-01

    To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol−1 (15.1 kJ mol−1). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared

  18. Selection of tRNA(Asp) amber suppressor mutants having alanine, arginine, glutamine, and lysine identity.

    PubMed Central

    Martin, F; Reinbolt, J; Dirheimer, G; Gangloff, J; Eriani, G

    1996-01-01

    Elements that confer identity to a tRNA in the cellular environment, where all aminoacyl-tRNA synthetases are competing for substrates, may be delineated by in vivo experiments using suppressor tRNAs. Here we describe the selection of active Escherichia coli tRNAAsp amber mutants and analyze their identity. Starting from a library containing randomly mutated tRNA(CUA)Asp genes, we isolated four amber suppressors presenting either lysine, alanine, or glutamine activity. Two of them, presenting mainly alanine or lysine activity, were further submitted to a second round of mutagenesis selection in order to improve their efficiency of suppression. Eleven suppressors were isolated, each containing two or three mutations. Ten presented identities of the two parental mutants, whereas one had switched from lysine to arginine identity. Analysis of the different mutants revealed (or confirmed for some nucleotides) their role as positive and/or negative determinants in AlaRS, LysRS, and ArgRS recognition. More generally, it appears that tRNAAsp presents identity characteristics closely related to those of tRNALys, as well as a structural basis for acquiring alanine or arginine identity upon moderate mutational changes; these consist of addition or suppression of the corresponding positive or negative determinants, as well as tertiary interactions. Failure to isolate aspartic acid-inserting suppressors is probably due to elimination of the important G34 identity element and its replacement by an antideterminant when changing the anticodon of the tRNAAsp to the CUA triplet. PMID:8809018

  19. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.

    PubMed

    Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A

    1990-11-30

    Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.

  20. Monoallelic mutation analysis (MAMA) for identifying germline mutations.

    PubMed

    Papadopoulos, N; Leach, F S; Kinzler, K W; Vogelstein, B

    1995-09-01

    Dissection of germline mutations in a sensitive and specific manner presents a continuing challenge. In dominantly inherited diseases, mutations occur in only one allele and are often masked by the normal allele. Here we report the development of a sensitive and specific diagnostic strategy based on somatic cell hybridization termed MAMA (monoallelic mutation analysis). We have demonstrated the utility of this strategy in two different hereditary colorectal cancer syndromes, one caused by a defective tumour suppressor gene on chromosome 5 (familial adenomatous polyposis, FAP) and the other caused by a defective mismatch repair gene on chromosome 2 (hereditary non-polyposis colorectal cancer, HNPCC).

  1. Improved amber and opal suppressor tRNAs for incorporation of unnatural amino acids in vivo. Part 2: Evaluating suppression efficiency

    PubMed Central

    Rodriguez, Erik A.; Lester, Henry A.; Dougherty, Dennis A.

    2007-01-01

    The incorporation of unnatural amino acids into proteins is a valuable tool for addition of biophysical probes, bio-orthogonal functionalities, and photoreactive cross-linking agents, although these approaches often require quantities of protein that are difficult to access with chemically aminoacylated tRNAs. THG73 is an amber suppressor tRNA that has been used extensively, incorporating over 100 residues in 20 proteins. In vitro studies have shown that the Escherichia coli Asn amber suppressor (ENAS) suppresses better than THG73. However, we report here that ENAS suppresses with <26% of the efficiency of THG73 in Xenopus oocytes. We then tested the newly developed Tetrahymena thermophila Gln amber suppressor (TQAS) tRNA library, which contains mutations in the second to fourth positions of the acceptor stem. The acceptor stem mutations have no adverse effect on suppression efficiency and, in fact, can increase the suppression efficiency. Combining mutations causes an averaging of suppression efficiency, and increased suppression efficiency does not correlate with increased ΔG of the acceptor stem. We created a T. thermophila opal suppressor, TQOpS′, which shows ∼50% suppression efficiency relative to THG73. The TQAS tRNA library, composed of functional suppressor tRNAs, has been created and will allow for screening in eukaryotic cells, where rapid analysis of large libraries is not feasible. PMID:17698637

  2. Tumor suppressors: enhancers or suppressors of regeneration?

    PubMed Central

    Pomerantz, Jason H.; Blau, Helen M.

    2013-01-01

    Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544

  3. SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

    PubMed

    Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

    2015-04-23

    With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

  4. Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

    DTIC Science & Technology

    2000-04-01

    Genes, LOH Mapping, Chromosome 17, Physical Mapping, Genetic Mapping, CDNA Screening, Humans, Anatomical 81 Samples, Mutation Detection, Breast Cancer...According to the established model for LOH involving tumor suppressor genes, the allele remaining in the tumor sample would harbor the deleterious mutation ...sequencing on an AB1373A sequencer (Applied Biosystems, Foster City, CA). As none of the samples we have sequenced have revealed any mutations , we have

  5. P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.

    PubMed

    He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M

    2000-09-26

    P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.

  6. The Potential for Tumor Suppressor Gene Therapy in Head and Neck Cancer

    PubMed Central

    Birkeland, Andrew C.; Ludwig, Megan L.; Spector, Matthew E.; Brenner, J. Chad

    2016-01-01

    Head and neck squamous cell carcinoma remains a highly morbid and fatal disease. Importantly, genomic sequencing of head and neck cancers has identified frequent mutations in tumor suppressor genes. While targeted therapeutics increasingly are being investigated in head and neck cancer, the majority of these agents are against overactive/overexpressed oncogenes. Therapy to restore lost tumor suppressor gene function remains a key and under-addressed niche in trials for head and neck cancer. Recent advances in gene editing have captured the interest of both the scientific community and the public. As our technology for gene editing and gene expression modulation improves, addressing lost tumor suppressor gene function in head and neck cancers is becoming a reality. This review will summarize new techniques, challenges to implementation, future directions, and ethical ramifications of gene therapy in head and neck cancer. PMID:26896601

  7. G673 could be a novel mutational hot spot for intragenic suppressors of pheS5 lesion in Escherichia coli.

    PubMed

    Ponmani, Thangaraj; Munavar, M Hussain

    2014-06-01

    The pheS5 Ts mutant of Escherichia coli defined by a G293 → A293 transition, which is responsible for thermosensitive Phenylalanyl-tRNA synthetase has been well studied at both biochemical and molecular level but genetic analyses pertaining to suppressors of pheS5 were hard to come by. Here we have systematically analyzed a spectrum of Temperature-insensitive derivatives isolated from pheS5 Ts mutant and identified two intragenic suppressors affecting the same base pair coordinate G673 (pheS19 defines G673 → T673 ; Gly225 → Cys225 and pheS28 defines G673 → C673 ; Gly225 → Arg225). In fact in the third derivative, the intragenic suppressor originally named pheS43 (G673 → C673 transversion) is virtually same as pheS28. In the fourth case, the very pheS5 lesion itself has got changed from A293 → T293 (named pheS40). Cloning of pheS(+), pheS5, pheS5-pheS19, pheS5-pheS28 alleles into pBR322 and introduction of these clones into pheS5 mutant revealed that excess of double mutant protein is not at all good for the survival of cells at 42°C. These results clearly indicate a pivotal role for Gly225 in the structural/functional integrity of alpha subunit of E. coli PheRS enzyme and it is proposed that G673 might define a hot spot for intragenic suppressors of pheS5. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  8. Structure-Based Analysis Reveals Cancer Missense Mutations Target Protein Interaction Interfaces.

    PubMed

    Engin, H Billur; Kreisberg, Jason F; Carter, Hannah

    2016-01-01

    Recently it has been shown that cancer mutations selectively target protein-protein interactions. We hypothesized that mutations affecting distinct protein interactions involving established cancer genes could contribute to tumor heterogeneity, and that novel mechanistic insights might be gained into tumorigenesis by investigating protein interactions under positive selection in cancer. To identify protein interactions under positive selection in cancer, we mapped over 1.2 million nonsynonymous somatic cancer mutations onto 4,896 experimentally determined protein structures and analyzed their spatial distribution. In total, 20% of mutations on the surface of known cancer genes perturbed protein-protein interactions (PPIs), and this enrichment for PPI interfaces was observed for both tumor suppressors (Odds Ratio 1.28, P-value < 10(-4)) and oncogenes (Odds Ratio 1.17, P-value < 10(-3)). To study this further, we constructed a bipartite network representing structurally resolved PPIs from all available human complexes in the Protein Data Bank (2,864 proteins, 3,072 PPIs). Analysis of frequently mutated cancer genes within this network revealed that tumor-suppressors, but not oncogenes, are significantly enriched with functional mutations in homo-oligomerization regions (Odds Ratio 3.68, P-Value < 10(-8)). We present two important examples, TP53 and beta-2-microglobulin, for which the patterns of somatic mutations at interfaces provide insights into specifically perturbed biological circuits. In patients with TP53 mutations, patient survival correlated with the specific interactions that were perturbed. Moreover, we investigated mutations at the interface of protein-nucleotide interactions and observed an unexpected number of missense mutations but not silent mutations occurring within DNA and RNA binding sites. Finally, we provide a resource of 3,072 PPI interfaces ranked according to their mutation rates. Analysis of this list highlights 282 novel candidate cancer

  9. Structural Basis of Merlin Tumor Suppressor Functions in Neurofibromatosis-2

    DTIC Science & Technology

    2013-10-01

    Neurofibromatosis -2 PRINCIPAL INVESTIGATOR: Tina Izard CONTRACTING ORGANIZATION: The Scripps Research Institute La Jolla, CA 92037-1000...30September2012-29September2013 4. TITLE AND SUBTITLE Structural Basis of Merlin Tumor Suppressor Functions in Neurofibromatosis -2 5a. CONTRACT...14. ABSTRACT Loss-of-function mutations in the neurofibromatosis -2 (NF2) gene lead to familial and sporadic neurological malignancies in man

  10. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    PubMed

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  11. Screening mosaic F1 females for mutations affecting zebrafish heart induction and patterning.

    PubMed

    Alexander, J; Stainier, D Y; Yelon, D

    1998-01-01

    The genetic pathways underlying the induction and anterior-posterior patterning of the heart are poorly understood. The recent emergence of the zebrafish model system now allows a classical genetic approach to such challenging problems in vertebrate development. Two large-scale screens for mutations affecting zebrafish embryonic development have recently been completed; among the hundreds of mutations identified were several that affect specific aspects of cardiac morphogenesis, differentiation, and function. However, very few mutations affecting induction and/or anterior-posterior patterning of the heart were identified. We hypothesize that a directed approach utilizing molecular markers to examine these particular steps of heart development will uncover additional such mutations. To test this hypothesis, we are conducting two parallel screens for mutations that affect either the induction or the anterior-posterior patterning of the zebrafish heart. As an indicator of cardiac induction, we examine expression of nkx2.5, the earliest known marker of precardiac mesoderm; to assess anterior-posterior patterning, we distinguish ventricle from atrium with antibodies that recognize different myosin heavy chain isoforms. In order to expedite the examination of a large number of mutations, we are screening the haploid progeny of mosaic F1 females. In these ongoing screens, we have identified four mutations that affect nkx2.5 expression as well as 21 that disrupt either ventricular or atrial development and thus far have recovered several of these mutations, demonstrating the value of our approach. Future analysis of these and other cardiac mutations will provide further insight into the processes of induction and anterior-posterior patterning of the heart.

  12. Protein Domain-Level Landscape of Cancer-Type-Specific Somatic Mutations

    PubMed Central

    Yang, Fan; Petsalaki, Evangelia; Rolland, Thomas; Hill, David E.; Vidal, Marc; Roth, Frederick P.

    2015-01-01

    Identifying driver mutations and their functional consequences is critical to our understanding of cancer. Towards this goal, and because domains are the functional units of a protein, we explored the protein domain-level landscape of cancer-type-specific somatic mutations. Specifically, we systematically examined tumor genomes from 21 cancer types to identify domains with high mutational density in specific tissues, the positions of mutational hotspots within these domains, and the functional and structural context where possible. While hotspots corresponding to specific gain-of-function mutations are expected for oncoproteins, we found that tumor suppressor proteins also exhibit strong biases toward being mutated in particular domains. Within domains, however, we observed the expected patterns of mutation, with recurrently mutated positions for oncogenes and evenly distributed mutations for tumor suppressors. For example, we identified both known and new endometrial cancer hotspots in the tyrosine kinase domain of the FGFR2 protein, one of which is also a hotspot in breast cancer, and found new two hotspots in the Immunoglobulin I-set domain in colon cancer. Thus, to prioritize cancer mutations for further functional studies aimed at more precise cancer treatments, we have systematically correlated mutations and cancer types at the protein domain level. PMID:25794154

  13. Mutations in Elongation Factor Ef-1α Affect the Frequency of Frameshifting and Amino Acid Misincorporation in Saccharomyces Cerevisiae

    PubMed Central

    Sandbaken, M. G.; Culbertson, M. R.

    1988-01-01

    A mutational analysis of the eukaryotic elongation factor EF-1α indicates that this protein functions to limit the frequency of errors during genetic code translation. We found that both amino acid misincorporation and reading frame errors are controlled by EF-1α. In order to examine the function of this protein, the TEF2 gene, which encodes EF-1α in Saccharomyces cerevisiae, was mutagenized in vitro with hydroxylamine. Sixteen independent TEF2 alleles were isolated by their ability to suppress frameshift mutations. DNA sequence analysis identified eight different sites in the EF-1α protein that elevate the frequency of mistranslation when mutated. These sites are located in two different regions of the protein. Amino acid substitutions located in or near the GTP-binding and hydrolysis domain of the protein cause suppression of frameshift and nonsense mutations. These mutations may effect mistranslation by altering the binding or hydrolysis of GTP. Amino acid substitutions located adjacent to a putative aminoacyl-tRNA binding region also suppress frameshift and nonsense mutations. These mutations may alter the binding of aminoacyl-tRNA by EF-1α. The identification of frameshift and nonsense suppressor mutations in EF-1α indicates a role for this protein in limiting amino acid misincorporation and reading frame errors. We suggest that these types of errors are controlled by a common mechanism or closely related mechanisms. PMID:3066688

  14. Statistical Methods for Identifying Sequence Motifs Affecting Point Mutations

    PubMed Central

    Zhu, Yicheng; Neeman, Teresa; Yap, Von Bing; Huttley, Gavin A.

    2017-01-01

    Mutation processes differ between types of point mutation, genomic locations, cells, and biological species. For some point mutations, specific neighboring bases are known to be mechanistically influential. Beyond these cases, numerous questions remain unresolved, including: what are the sequence motifs that affect point mutations? How large are the motifs? Are they strand symmetric? And, do they vary between samples? We present new log-linear models that allow explicit examination of these questions, along with sequence logo style visualization to enable identifying specific motifs. We demonstrate the performance of these methods by analyzing mutation processes in human germline and malignant melanoma. We recapitulate the known CpG effect, and identify novel motifs, including a highly significant motif associated with A→G mutations. We show that major effects of neighbors on germline mutation lie within ±2 of the mutating base. Models are also presented for contrasting the entire mutation spectra (the distribution of the different point mutations). We show the spectra vary significantly between autosomes and X-chromosome, with a difference in T→C transition dominating. Analyses of malignant melanoma confirmed reported characteristic features of this cancer, including statistically significant strand asymmetry, and markedly different neighboring influences. The methods we present are made freely available as a Python library https://bitbucket.org/pycogent3/mutationmotif. PMID:27974498

  15. Construction and Characterization of Human Mammary Epithelial Cell Lines Containing Mutations in the p53 or BRCA1 Genes

    DTIC Science & Technology

    1999-01-01

    development of breast cancers. To study the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway, we have...the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway. The consequences of transduction of these...proposed three approaches for constructing p53-deficient cells; i.e., by mutating the p53 gene directly, by abrogating the protein’s normal cellular

  16. Mutations in the Atp1p and Atp3p subunits of yeast ATP synthase differentially affect respiration and fermentation in Saccharomyces cerevisiae.

    PubMed

    Francis, Brian R; White, Karen H; Thorsness, Peter E

    2007-04-01

    ATP1-111, a suppressor of the slow-growth phenotype of yme1Delta lacking mitochondrial DNA is due to the substitution of phenylalanine for valine at position 111 of the alpha-subunit of mitochondrial ATP synthase (Atp1p in yeast). The suppressing activity of ATP1-111 requires intact beta (Atp2p) and gamma (Atp3p) subunits of mitochondrial ATP synthase, but not the stator stalk subunits b (Atp4p) and OSCP (Atp5p). ATP1-111 and other similarly suppressing mutations in ATP1 and ATP3 increase the growth rate of wild-type strains lacking mitochondrial DNA. These suppressing mutations decrease the growth rate of yeast containing an intact mitochondrial chromosome on media requiring oxidative phosphorylation, but not when grown on fermentable media. Measurement of chronological aging of yeast in culture reveals that ATP1 and ATP3 suppressor alleles in strains that contain mitochondrial DNA are longer lived than the isogenic wild-type strain. In contrast, the chronological life span of yeast cells lacking mitochondrial DNA and containing these mutations is shorter than that of the isogenic wild-type strain. Spore viability of strains bearing ATP1-111 is reduced compared to wild type, although ATP1-111 enhances the survival of spores that lacked mitochondrial DNA.

  17. Targeted deletion of MKK4 in cancer cells: a detrimental phenotype manifests as decreased experimental metastasis and suggests a counterweight to the evolution of tumor-suppressor loss.

    PubMed

    Cunningham, Steven C; Gallmeier, Eike; Hucl, Tomas; Dezentje, David A; Calhoun, Eric S; Falco, Geppino; Abdelmohsen, Kotb; Gorospe, Myriam; Kern, Scott E

    2006-06-01

    Tumor-suppressors have commanded attention due to the selection for their inactivating mutations in human tumors. However, relatively little is understood about the inverse, namely, that tumors do not select for a large proportion of seemingly favorable mutations in tumor-suppressor genes. This could be explained by a detrimental phenotype accruing in a cell type-specific manner to most cells experiencing a biallelic loss. For example, MKK4, a tumor suppressor gene distinguished by a remarkably consistent mutational rate across diverse tumor types and an unusually high rate of loss of heterozygosity, has the surprisingly low rate of genetic inactivation of only approximately 5%. To explore this incongruity, we engineered a somatic gene knockout of MKK4 in human cancer cells. Although the null cells resembled the wild-type cells regarding in vitro viability and proliferation in plastic dishes, there was a marked difference in a more relevant in vivo model of experimental metastasis and tumorigenesis. MKK4(-/-) clones injected i.v. produced fewer lung metastases than syngeneic MKK4-competent cells (P = 0.0034). These findings show how cell type-specific detrimental phenotypes can offer a paradoxical and yet key counterweight to the selective advantage attained by cells as they experiment with genetic null states during tumorigenesis, the resultant balance then determining the observed biallelic mutation rate for a given tumor-suppressor gene.

  18. Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.

    PubMed

    de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri

    2018-03-01

    To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  19. SETD2 is recurrently mutated in whole-exome sequenced canine osteosarcoma.

    PubMed

    Sakthikumar, Sharadha; Elvers, Ingegerd; Kim, Jaegil; Arendt, Maja L; Thomas, Rachael; Turner-Maier, Jason; Swofford, Ross; Johnson, Jeremy; Schumacher, Steven E; Alföldi, Jessica; Axelsson, Erik; Couto, Guillermo; Kisseberth, William; Pettersson, Mats E; Getz, Gad; Meadows, Jennifer R S; Modiano, Jaime F; Breen, Matthew; Kierczak, Marcin; Forsberg-Nilsson, Karin; Marinescu, Voichita D; Lindblad-Toh, Kerstin

    2018-05-03

    Osteosarcoma (OSA) is a debilitating bone cancer that affects humans, especially children and adolescents. A homologous form of OSA spontaneously occurs in dogs, and its differential incidence observed across breeds allows for the investigation of tumor mutations in the context of multiple genetic backgrounds. Using whole-exome sequencing and dogs from three susceptible breeds (22 golden retrievers, 21 Rottweilers, and 23 greyhounds), we found that OSA tumors show a high frequency of somatic copy number alterations (SCNA) affecting key oncogenes and tumor suppressor genes. The across-breed results are similar to what has been observed for human OSA, but the disease frequency and somatic mutation counts vary in the three breeds. For all breeds, three mutational signatures (one of which has not been previously reported), and eleven significantly mutated genes were identified. TP53 was the most frequently altered gene (83% of dogs have either mutations or SCNA in TP53), recapitulating observations in human OSA. The second most frequently mutated gene, histone methyltransferase SETD2, has known roles in multiple cancers, but has not previously been strongly implicated in OSA. This study points to the likely importance of histone modifications in OSA and highlights the strong genetic similarities between human and dog OSA, suggesting that canine OSA may serve as an excellent model for developing treatment strategies in both species. Copyright ©2018, American Association for Cancer Research.

  20. Frequent germline deleterious mutations in DNA repair genes in familial prostate cancer cases are associated with advanced disease.

    PubMed

    Leongamornlert, D; Saunders, E; Dadaev, T; Tymrakiewicz, M; Goh, C; Jugurnauth-Little, S; Kozarewa, I; Fenwick, K; Assiotis, I; Barrowdale, D; Govindasami, K; Guy, M; Sawyer, E; Wilkinson, R; Antoniou, A C; Eeles, R; Kote-Jarai, Z

    2014-03-18

    Prostate cancer (PrCa) is one of the most common diseases to affect men worldwide and among the leading causes of cancer-related death. The purpose of this study was to use second-generation sequencing technology to assess the frequency of deleterious mutations in 22 tumour suppressor genes in familial PrCa and estimate the relative risk of PrCa if these genes are mutated. Germline DNA samples from 191 men with 3 or more cases of PrCa in their family were sequenced for 22 tumour suppressor genes using Agilent target enrichment and Illumina technology. Analysis for genetic variation was carried out by using a pipeline consisting of BWA, Genome Analysis Toolkit (GATK) and ANNOVAR. Clinical features were correlated with mutation status using standard statistical tests. Modified segregation analysis was used to determine the relative risk of PrCa conferred by the putative loss-of-function (LoF) mutations identified. We discovered 14 putative LoF mutations in 191 samples (7.3%) and these mutations were more frequently associated with nodal involvement, metastasis or T4 tumour stage (P=0.00164). Segregation analysis of probands with European ancestry estimated that LoF mutations in any of the studied genes confer a relative risk of PrCa of 1.94 (95% CI: 1.56-2.42). These findings show that LoF mutations in DNA repair pathway genes predispose to familial PrCa and advanced disease and therefore warrants further investigation. The clinical utility of these findings will become increasingly important as targeted screening and therapies become more widespread.

  1. Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

    PubMed

    Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

    2014-09-01

    Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

  2. Identification of mutations in Colombian patients affected with Fabry disease.

    PubMed

    Uribe, Alfredo; Mateus, Heidi Eliana; Prieto, Juan Carlos; Palacios, Maria Fernanda; Ospina, Sandra Yaneth; Pasqualim, Gabriela; da Silveira Matte, Ursula; Giugliani, Roberto

    2015-12-15

    Fabry Disease (FD) is an X-linked inborn error of glycosphingolipid catabolism, caused by a deficiency of the lisosomal α-galactosidase A (AGAL). The disorder leads to a vascular disease secondary to the involvement of kidney, heart and the central nervous system. The mutation analysis is a valuable tool for diagnosis and genetic counseling. Although more than 600 mutations have been identified, most mutations are private. Our objective was to describe the analysis of nine Colombian patients with Fabry disease by automated sequencing of the seven exons of the GLA gene. Two novel mutations were identified in two patients affected with the classical subtype of FD, in addition to other 6 mutations previously reported. The present study confirms the heterogeneity of mutations in Fabry disease and the importance of molecular analysis for genetic counseling, female heterozygotes detection as well as therapeutic decisions. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. SMARCB1/INI1 germline mutations contribute to 10% of sporadic schwannomatosis.

    PubMed

    Rousseau, Guillaume; Noguchi, Tetsuro; Bourdon, Violaine; Sobol, Hagay; Olschwang, Sylviane

    2011-01-24

    Schwannomatosis is a disease characterized by multiple non-vestibular schwannomas. Although biallelic NF2 mutations are found in schwannomas, no germ line event is detected in schwannomatosis patients. In contrast, germline mutations of the SMARCB1 (INI1) tumor suppressor gene were described in familial and sporadic schwannomatosis patients. To delineate the SMARCB1 gene contribution, the nine coding exons were sequenced in a series of 56 patients affected with a variable number of non-vestibular schwannomas. Nine variants scattered along the sequence of SMARCB1 were identified. Five of them were classified as deleterious. All five patients carrying a SMARCB1 mutation had more multiple schwannomas, corresponding to 10.2% of patients with schwannomatosis. They were also diagnosed before 35 years of age. These results suggest that patients with schwannomas have a significant probability of carrying a SMARCB1 mutation. Combined with data available from other studies, they confirm the clinical indications for genetic screening of the SMARCB1 gene.

  4. SMARCB1/INI1 germline mutations contribute to 10% of sporadic schwannomatosis

    PubMed Central

    2011-01-01

    Background Schwannomatosis is a disease characterized by multiple non-vestibular schwannomas. Although biallelic NF2 mutations are found in schwannomas, no germ line event is detected in schwannomatosis patients. In contrast, germline mutations of the SMARCB1 (INI1) tumor suppressor gene were described in familial and sporadic schwannomatosis patients. Methods To delineate the SMARCB1 gene contribution, the nine coding exons were sequenced in a series of 56 patients affected with a variable number of non-vestibular schwannomas. Results Nine variants scattered along the sequence of SMARCB1 were identified. Five of them were classified as deleterious. All five patients carrying a SMARCB1 mutation had more multiple schwannomas, corresponding to 10.2% of patients with schwannomatosis. They were also diagnosed before 35 years of age. Conclusions These results suggest that patients with schwannomas have a significant probability of carrying a SMARCB1 mutation. Combined with data available from other studies, they confirm the clinical indications for genetic screening of the SMARCB1 gene. PMID:21255467

  5. Unfurling of the band 4.1, ezrin, radixin, moesin (FERM) domain of the merlin tumor suppressor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yogesha, S.D.; Sharff, Andrew J.; Giovannini, Marco

    The merlin-1 tumor suppressor is encoded by the Neurofibromatosis-2 (Nf2) gene and loss-of-function Nf2 mutations lead to nervous system tumors in man and to several tumor types in mice. Merlin is an ERM (ezrin, radixin, moesin) family cytoskeletal protein that interacts with other ERM proteins and with components of cell-cell adherens junctions (AJs). Merlin stabilizes the links of AJs to the actin cytoskeleton. Thus, its loss destabilizes AJs, promoting cell migration and invasion, which in Nf2{sup +/-} mice leads to highly metastatic tumors. Paradoxically, the 'closed' conformation of merlin-1, where its N-terminal four-point-one, ezrin, radixin, moesin (FERM) domain binds tomore » its C-terminal tail domain, directs its tumor suppressor functions. Here we report the crystal structure of the human merlin-1 head domain when crystallized in the presence of its tail domain. Remarkably, unlike other ERM head-tail interactions, this structure suggests that binding of the tail provokes dimerization and dynamic movement and unfurling of the F2 motif of the FERM domain. We conclude the 'closed' tumor suppressor conformer of merlin-1 is in fact an 'open' dimer whose functions are disabled by Nf2 mutations that disrupt this architecture.« less

  6. Large-scale mapping of mutations affecting zebrafish development.

    PubMed

    Geisler, Robert; Rauch, Gerd-Jörg; Geiger-Rudolph, Silke; Albrecht, Andrea; van Bebber, Frauke; Berger, Andrea; Busch-Nentwich, Elisabeth; Dahm, Ralf; Dekens, Marcus P S; Dooley, Christopher; Elli, Alexandra F; Gehring, Ines; Geiger, Horst; Geisler, Maria; Glaser, Stefanie; Holley, Scott; Huber, Matthias; Kerr, Andy; Kirn, Anette; Knirsch, Martina; Konantz, Martina; Küchler, Axel M; Maderspacher, Florian; Neuhauss, Stephan C; Nicolson, Teresa; Ober, Elke A; Praeg, Elke; Ray, Russell; Rentzsch, Brit; Rick, Jens M; Rief, Eva; Schauerte, Heike E; Schepp, Carsten P; Schönberger, Ulrike; Schonthaler, Helia B; Seiler, Christoph; Sidi, Samuel; Söllner, Christian; Wehner, Anja; Weiler, Christian; Nüsslein-Volhard, Christiane

    2007-01-09

    Large-scale mutagenesis screens in the zebrafish employing the mutagen ENU have isolated several hundred mutant loci that represent putative developmental control genes. In order to realize the potential of such screens, systematic genetic mapping of the mutations is necessary. Here we report on a large-scale effort to map the mutations generated in mutagenesis screening at the Max Planck Institute for Developmental Biology by genome scanning with microsatellite markers. We have selected a set of microsatellite markers and developed methods and scoring criteria suitable for efficient, high-throughput genome scanning. We have used these methods to successfully obtain a rough map position for 319 mutant loci from the Tübingen I mutagenesis screen and subsequent screening of the mutant collection. For 277 of these the corresponding gene is not yet identified. Mapping was successful for 80 % of the tested loci. By comparing 21 mutation and gene positions of cloned mutations we have validated the correctness of our linkage group assignments and estimated the standard error of our map positions to be approximately 6 cM. By obtaining rough map positions for over 300 zebrafish loci with developmental phenotypes, we have generated a dataset that will be useful not only for cloning of the affected genes, but also to suggest allelism of mutations with similar phenotypes that will be identified in future screens. Furthermore this work validates the usefulness of our methodology for rapid, systematic and inexpensive microsatellite mapping of zebrafish mutations.

  7. [Mutation analysis for a pedigree affected with keratitis-ichthyosis-deafness syndrome].

    PubMed

    Li, Lulu; Li, Yuan; Lin, Wei; Zhao, Xiuli

    2017-10-10

    To identify mutation of GJB2 gene and provide genetic counseling for a family affected with keratitis-ichthyosis-deafness (KID) syndrome. Genomic DNA was extracted from peripheral blood samples with a standard phenol-chloroform method. PCR and Sanger sequencing were used to analyze potential mutation in the proband. Suspected mutation was verified with a PCR-high-resolution melting (PCR-HRM) method. T-clone sequencing was applied to determine the parental origin of the mutation. A heterozygous mutation, c.148G>A (p.Asp50Asn), which is located in the exon 1 of the GJB2 gene, was found in the proband. The results was confirmed by HRM analysis. Cloning sequencing suggested that the mutation was derived from the father's germline. The hot-spot mutation c.148G>A (p.Asp50Asn) in the GJB2 gene probably underlies the KID syndrome in this Chinese family. A PCR-HRM method has been established to rapidly detect common mutations associated with this disease.

  8. Analysis of alterations of oncogenes and tumor suppressor genes in chronic lymphocytic leukemia.

    PubMed Central

    Gaidano, G.; Newcomb, E. W.; Gong, J. Z.; Tassi, V.; Neri, A.; Cortelezzi, A.; Calori, R.; Baldini, L.; Dalla-Favera, R.

    1994-01-01

    B cell chronic lymphocytic leukemia (B-CLL) represents the most frequent adult leukemia in the Western world. The molecular pathogenesis of B-CLL is largely unknown. Although initial reports on small panels of cases had suggested a role for Bcl-1 and Bcl-2 oncogene activation in B-CLL, later investigations failed to confirm these data. Among tumor suppressor genes, p53 mutations have been reported in a fraction of cases. In this study, we have attempted a conclusive definition of the involvement of dominantly acting oncogenes (Bcl-1 and Bcl-2) and tumor suppressor loci (p53, 6q-) in 100 cases of B-CLL selected for their CD5 positivity and Rai's stage (0 to IV). Rearrangements of Bcl-1 and Bcl-2 and deletions of 6q and 17p were analyzed by Southern blot using multiple probes. Mutational analysis (single strand conformation polymorphism and polymerase chain reaction direct sequencing) was used to assay p53 inactivation. No alterations of Bcl-1 or Bcl-2 were detected in the 100 cases tested. Mutations of p53 were found in 10/100 cases without any significant association with clinical stage. Deletions of 6q were present in 4/100 cases. Overall, our data indicate that: 1) contrary to previous reports, Bcl-1 and Bcl-2 rearrangements are not involved in CD5+ B-CLL pathogenesis and 2) p53 mutations are present in 10% of cases at all stages of the disease. Images Figure 1 Figure 2 Figure 3 PMID:8203469

  9. Structural investigation of nucleophosmin interaction with the tumor suppressor Fbw7γ.

    PubMed

    Di Matteo, A; Franceschini, M; Paiardini, A; Grottesi, A; Chiarella, S; Rocchio, S; Di Natale, C; Marasco, D; Vitagliano, L; Travaglini-Allocatelli, C; Federici, L

    2017-09-18

    Nucleophosmin (NPM1) is a multifunctional nucleolar protein implicated in ribogenesis, centrosome duplication, cell cycle control, regulation of DNA repair and apoptotic response to stress stimuli. The majority of these functions are played through the interactions with a variety of protein partners. NPM1 is frequently overexpressed in solid tumors of different histological origin. Furthermore NPM1 is the most frequently mutated protein in acute myeloid leukemia (AML) patients. Mutations map to the C-terminal domain and lead to the aberrant and stable localization of the protein in the cytoplasm of leukemic blasts. Among NPM1 protein partners, a pivotal role is played by the tumor suppressor Fbw7γ, an E3-ubiquitin ligase that degrades oncoproteins like c-MYC, cyclin E, Notch and c-jun. In AML with NPM1 mutations, Fbw7γ is degraded following its abnormal cytosolic delocalization by mutated NPM1. This mechanism also applies to other tumor suppressors and it has been suggested that it may play a key role in leukemogenesis. Here we analyse the interaction between NPM1 and Fbw7γ, by identifying the protein surfaces implicated in recognition and key aminoacids involved. Based on the results of computational methods, we propose a structural model for the interaction, which is substantiated by experimental findings on several site-directed mutants. We also extend the analysis to two other NPM1 partners (HIV Tat and CENP-W) and conclude that NPM1 uses the same molecular surface as a platform for recognizing different protein partners. We suggest that this region of NPM1 may be targeted for cancer treatment.

  10. Structural investigation of nucleophosmin interaction with the tumor suppressor Fbw7γ

    PubMed Central

    Di Matteo, A; Franceschini, M; Paiardini, A; Grottesi, A; Chiarella, S; Rocchio, S; Di Natale, C; Marasco, D; Vitagliano, L; Travaglini-Allocatelli, C; Federici, L

    2017-01-01

    Nucleophosmin (NPM1) is a multifunctional nucleolar protein implicated in ribogenesis, centrosome duplication, cell cycle control, regulation of DNA repair and apoptotic response to stress stimuli. The majority of these functions are played through the interactions with a variety of protein partners. NPM1 is frequently overexpressed in solid tumors of different histological origin. Furthermore NPM1 is the most frequently mutated protein in acute myeloid leukemia (AML) patients. Mutations map to the C-terminal domain and lead to the aberrant and stable localization of the protein in the cytoplasm of leukemic blasts. Among NPM1 protein partners, a pivotal role is played by the tumor suppressor Fbw7γ, an E3-ubiquitin ligase that degrades oncoproteins like c-MYC, cyclin E, Notch and c-jun. In AML with NPM1 mutations, Fbw7γ is degraded following its abnormal cytosolic delocalization by mutated NPM1. This mechanism also applies to other tumor suppressors and it has been suggested that it may play a key role in leukemogenesis. Here we analyse the interaction between NPM1 and Fbw7γ, by identifying the protein surfaces implicated in recognition and key aminoacids involved. Based on the results of computational methods, we propose a structural model for the interaction, which is substantiated by experimental findings on several site-directed mutants. We also extend the analysis to two other NPM1 partners (HIV Tat and CENP-W) and conclude that NPM1 uses the same molecular surface as a platform for recognizing different protein partners. We suggest that this region of NPM1 may be targeted for cancer treatment. PMID:28920929

  11. Deep mutational scanning identifies sites in influenza nucleoprotein that affect viral inhibition by MxA

    PubMed Central

    Ashenberg, Orr; Padmakumar, Jai

    2017-01-01

    The innate-immune restriction factor MxA inhibits influenza replication by targeting the viral nucleoprotein (NP). Human influenza virus is more resistant than avian influenza virus to inhibition by human MxA, and prior work has compared human and avian viral strains to identify amino-acid differences in NP that affect sensitivity to MxA. However, this strategy is limited to identifying sites in NP where mutations that affect MxA sensitivity have fixed during the small number of documented zoonotic transmissions of influenza to humans. Here we use an unbiased deep mutational scanning approach to quantify how all single amino-acid mutations to NP affect MxA sensitivity in the context of replication-competent virus. We both identify new sites in NP where mutations affect MxA resistance and re-identify mutations known to have increased MxA resistance during historical adaptations of influenza to humans. Most of the sites where mutations have the greatest effect are almost completely conserved across all influenza A viruses, and the amino acids at these sites confer relatively high resistance to MxA. These sites cluster in regions of NP that appear to be important for its recognition by MxA. Overall, our work systematically identifies the sites in influenza nucleoprotein where mutations affect sensitivity to MxA. We also demonstrate a powerful new strategy for identifying regions of viral proteins that affect inhibition by host factors. PMID:28346537

  12. Fine mapping of the NRC-1 tumor suppressor locus within chromosome 3p12.

    PubMed

    Zhang, Kun; Lott, Steven T; Jin, Li; Killary, Ann McNeill

    2007-08-31

    Identification of tumor suppressor genes based on physical mapping exercises has proven to be a challenging endeavor, due to the difficulty of narrowing regions of loss of heterozygosity (LOH), infrequency of homozygous deletions, and the labor-intensive characterization process for screening candidates in a given genomic interval. We previously defined a chromosome 3p12 tumor suppressor locus NRC-1 (Nonpapillary Renal Carcinoma-1) by functional complementation experiments in which renal cell carcinoma microcell hybrids containing introduced normal chromosome 3p fragments were either suppressed or unsuppressed for tumorigenicity following injection into athymic nude mice. We now present the fine-scale physical mapping of NRC-1 using a QPCR-based approach for measuring copy number at sequence tagged sites (STS) which allowed a sub-exon mapping resolution. Using STS-QPCR and a novel statistical algorithm, the NRC-1 locus was narrowed to 4.615-Mb with the distal boundary mapping within a 38-Kb interval between exon 3 and exon 4 of the DUTT1/Robo1 gene, currently the only candidate tumor suppressor gene in the interval. Further mutational screening and gene expression analyses indicate that DUTT1/ROBO1 is not involved in the tumor suppressor activity of NRC-1, suggesting that there are at least two important tumor suppressor genes within the chromosome 3p12 interval.

  13. The RasGAP Gene, RASAL2, is a Tumor and Metastasis Suppressor

    PubMed Central

    McLaughlin, Sara Koenig; Olsen, Sarah Naomi; Dake, Benjamin; De Raedt, Thomas; Lim, Elgene; Bronson, Roderick Terry; Beroukhim, Rameen; Polyak, Kornelia; Brown, Myles; Kuperwasser, Charlotte; Cichowski, Karen

    2013-01-01

    SUMMARY RAS genes are commonly mutated in cancer; however, RAS mutations are rare in breast cancer, despite the fact that Ras and ERK are frequently hyperactivated. Here we report that the RasGAP gene, RASAL2, functions as a tumor and metastasis suppressor. RASAL2 is mutated or suppressed in human breast cancer and RASAL2 ablation promotes tumor growth, progression, and metastasis in mouse models. In human breast cancer RASAL2-loss is associated with metastatic disease, low RASAL2 levels correlate with recurrence of luminal B tumors, and RASAL2 ablation promotes metastasis of luminal mouse tumors. Additional data reveal a broader role for RASAL2 inactivation in other tumor-types. These studies highlight the expanding role of RasGAPs and reveal an alternative mechanism of activating Ras in cancer. PMID:24029233

  14. The classical pink-eyed dilution mutation affects angiogenic responsiveness.

    PubMed

    Rogers, Michael S; Boyartchuk, Victor; Rohan, Richard M; Birsner, Amy E; Dietrich, William F; D'Amato, Robert J

    2012-01-01

    Angiogenesis is the process by which new blood vessels are formed from existing vessels. Mammalian populations, including humans and mice, harbor genetic variations that alter angiogenesis. Angiogenesis-regulating gene variants can result in increased susceptibility to multiple angiogenesis-dependent diseases in humans. Our efforts to dissect the complexity of the genetic diversity that regulates angiogenesis have used laboratory animals due to the availability of genome sequence for many species and the ability to perform high volume controlled breeding. Using the murine corneal micropocket assay, we have observed more than ten-fold difference in angiogenic responsiveness among various mouse strains. This degree of difference is observed with either bFGF or VEGF induced corneal neovascularization. Ongoing mapping studies have identified multiple loci that affect angiogenic responsiveness in several mouse models. In this study, we used F2 intercrosses between C57BL/6J and the 129 substrains 129P1/ReJ and 129P3/J, as well as the SJL/J strain, where we have identified new QTLs that affect angiogenic responsiveness. In the case of AngFq5, on chromosome 7, congenic animals were used to confirm the existence of this locus and subcongenic animals, combined with a haplotype-based mapping approach that identified the pink-eyed dilution mutation as a candidate polymorphism to explain AngFq5. The ability of mutations in the pink-eyed dilution gene to affect angiogenic response was demonstrated using the p-J allele at the same locus. Using this allele, we demonstrate that pink-eyed dilution mutations in Oca2 can affect both bFGF and VEGF-induced corneal angiogenesis.

  15. Cytogenetic correlates of TET2 mutations in 199 patients with myeloproliferative neoplasms

    PubMed Central

    Hussein, Kebede; Abdel-Wahab, Omar; Lasho, Terra L.; Van Dyke, Daniel L.; Levine, Ross L.; Hanson, Curtis A.; Pardanani, Animesh; Tefferi, Ayalew

    2015-01-01

    TET2 is a putative tumor suppressor gene located at chromosome 4q24. TET2 mutations were recently described in several myeloid neoplasms but correlations with cytogenetic findings have not been studied. Among a recently described cohort of patients with myeloproliferative neoplasms (MPN) who underwent TET2 mutation analysis, 199 had information on karyotype at diagnosis or time of TET2 testing: 71 polycythemia vera (PV), 55 primary myelofibrosis (PMF), 43 essential thrombocythemia (ET), 13 post-PV MF, 7 post-ET MF, and 10 blast phase MPN. Forty eight patients (24%) exhibited abnormal karyotype: 15 favorable (sole 20q-, 13q-, or +9), 8 unfavorable (complex karyotype or sole +8), and 25 “other” cytogenetic abnormalities. We found no significant difference either in the incidence or type of cytogenetic abnormalities between TET2 mutated (n = 25) and unmutated (n = 174) cases. Seventy nine patients, including 14 with TET2 mutations, underwent follow-up cytogenetic testing and the findings were again not affected by TET2 mutational status. We conclude that TET2 mutated MPN patients are not cytogenetically different than their TET2 unmutated counterparts. PMID:19957346

  16. Flight velocity effects on jet noise of several variations of a 48-tube suppressor installed on a plug nozzle

    NASA Technical Reports Server (NTRS)

    Burley, R. R.; Head, V. L.

    1974-01-01

    Because of the relatively high takeoff speeds of supersonic transport aircraft, it is important to know if the flight velocity affects the noise level of suppressor nozzles. To investigate this, a modified F-106B aircraft was used to conduct a series of flyover and static tests on a 48-tube suppressor installed on an uncooled plug nozzle. Comparison of flyover and static spectra indicated that flight velocity had little effect on the noise suppression of the 48-tube suppressor configuration. However, flight velocity adversely affected noise suppression of the 48-tube suppressor with an acoustic shroud and plug installed.

  17. MLH1 mutations differentially affect meiotic functions in Saccharomyces cerevisiae.

    PubMed Central

    Hoffmann, Eva R; Shcherbakova, Polina V; Kunkel, Thomas A; Borts, Rhona H

    2003-01-01

    To test whether missense mutations in the cancer susceptibility gene MLH1 adversely affect meiosis, we examined 14 yeast MLH1 mutations for effects on meiotic DNA transactions and gamete viability in the yeast Saccharomyces cerevisiae. Mutations analogous to those associated with hereditary nonpolyposis colorectal cancer (HNPCC) or those that reduce Mlh1p interactions with ATP or DNA all impair replicative mismatch repair as measured by increased mutation rates. However, their effects on meiotic heteroduplex repair, crossing over, chromosome segregation, and gametogenesis vary from complete loss of meiotic functions to no meiotic defect, and mutants defective in one meiotic process are not necessarily defective in others. DNA binding and ATP binding but not ATP hydrolysis are required for meiotic crossing over. The results reveal clear separation of different Mlh1p functions in mitosis and meiosis, and they suggest that some, but not all, MLH1 mutations may be a source of human infertility. PMID:12618391

  18. Suppressor Analysis Reveals a Role for SecY in the SecA2-Dependent Protein Export Pathway of Mycobacteria

    PubMed Central

    Ligon, Lauren S.; Rigel, Nathan W.; Romanchuk, Artur; Jones, Corbin D.

    2013-01-01

    All bacteria use the conserved Sec pathway to transport proteins across the cytoplasmic membrane, with the SecA ATPase playing a central role in the process. Mycobacteria are part of a small group of bacteria that have two SecA proteins: the canonical SecA (SecA1) and a second, specialized SecA (SecA2). The SecA2-dependent pathway exports a small subset of proteins and is required for Mycobacterium tuberculosis virulence. The mechanism by which SecA2 drives export of proteins across the cytoplasmic membrane remains poorly understood. Here we performed suppressor analysis on a dominant negative secA2 mutant (secA2 K129R) of the model mycobacterium Mycobacterium smegmatis to better understand the pathway used by SecA2 to export proteins. Two extragenic suppressor mutations were identified as mapping to the promoter region of secY, which encodes the central component of the canonical Sec export channel. These suppressor mutations increased secY expression, and this effect was sufficient to alleviate the secA2 K129R phenotype. We also discovered that the level of SecY protein was greatly diminished in the secA2 K129R mutant, but at least partially restored in the suppressors. Furthermore, the level of SecY in a suppressor strongly correlated with the degree of suppression. Our findings reveal a detrimental effect of SecA2 K129R on SecY, arguing for an integrated system in which SecA2 works with SecY and the canonical Sec translocase to export proteins. PMID:23913320

  19. Mutation of von Hippel–Lindau Tumour Suppressor and Human Cardiopulmonary Physiology

    PubMed Central

    Smith, Thomas G; Brooks, Jerome T; Balanos, George M; Lappin, Terence R; Layton, D. Mark; Leedham, Dawn L; Liu, Chun; Maxwell, Patrick H; McMullin, Mary F; McNamara, Christopher J; Percy, Melanie J; Pugh, Christopher W; Ratcliffe, Peter J; Talbot, Nick P; Treacy, Marilyn; Robbins, Peter A

    2006-01-01

    Background The von Hippel–Lindau tumour suppressor protein–hypoxia-inducible factor (VHL–HIF) pathway has attracted widespread medical interest as a transcriptional system controlling cellular responses to hypoxia, yet insights into its role in systemic human physiology remain limited. Chuvash polycythaemia has recently been defined as a new form of VHL-associated disease, distinct from the classical VHL-associated inherited cancer syndrome, in which germline homozygosity for a hypomorphic VHL allele causes a generalised abnormality in VHL–HIF signalling. Affected individuals thus provide a unique opportunity to explore the integrative physiology of this signalling pathway. This study investigated patients with Chuvash polycythaemia in order to analyse the role of the VHL–HIF pathway in systemic human cardiopulmonary physiology. Methods and Findings Twelve participants, three with Chuvash polycythaemia and nine controls, were studied at baseline and during hypoxia. Participants breathed through a mouthpiece, and pulmonary ventilation was measured while pulmonary vascular tone was assessed echocardiographically. Individuals with Chuvash polycythaemia were found to have striking abnormalities in respiratory and pulmonary vascular regulation. Basal ventilation and pulmonary vascular tone were elevated, and ventilatory, pulmonary vasoconstrictive, and heart rate responses to acute hypoxia were greatly increased. Conclusions The features observed in this small group of patients with Chuvash polycythaemia are highly characteristic of those associated with acclimatisation to the hypoxia of high altitude. More generally, the phenotype associated with Chuvash polycythaemia demonstrates that VHL plays a major role in the underlying calibration and homeostasis of the respiratory and cardiovascular systems, most likely through its central role in the regulation of HIF. PMID:16768548

  20. [Identification of a HPGD mutation in three families affected with primary hypertrophic osteoarthropathy].

    PubMed

    Zhang, Wanying; Wang, Tao; Huang, Shuaiwu; Zhao, Xiuli

    2018-04-10

    To detect mutation of HPGD gene among three pedigrees affected with primary hypertrophic osteoarthropathy (PHO) by DNA sequencing and high-resolution melting (HRM) analysis. Genomic DNA was extracted from peripheral blood samples collected from the pedigrees. PCR and direct sequencing were carried out to identify potential mutations of the HPGD gene. Amplicons containing the mutation spot were generated by nested PCR. The products were then subjected to HRM analysis using the HR-1 instrument. Direct sequencing was carried out in family members and healthy individuals to confirm the result of HRM analysis. A homozygous mutation c.310_311delCT was detected in 2 affected probands, while a heterozygous mutation c.310_311delCT was detected in the third proband. HRM analysis of the fragments encompassing HPGD exon 3 showed 3 curve patterns representing three different genotypes, i.e., the wild type, the c.310_311delCT homozygote, and the c.310_311delCT heterozygote. Result of DNA sequencing was consistent with that of the HRM analysis and phenotype of the subjects. The c.310_311delCT mutation may be the most prevalent mutation among Chinese population. HRM analysis has provided an optimized method for genetic testing of HPGD mutation for its simplicity, rapid turnover and high sensitivity.

  1. CRISPR-mediated direct mutation of cancer genes in the mouse liver

    PubMed Central

    Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S.; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G.; Zhang, Feng; Anderson, Daniel G.; Sharp, Phillip A.; Jacks, Tyler

    2014-01-01

    The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem (ES) cells1. Here we describe a new method of cancer model generation using the CRISPR/Cas system in vivo in wild-type mice. We have used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs)2–4 to the liver and directly target the tumor suppressor genes Pten5 and p536, alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology7, 8. Simultaneous targeting of Pten and p53 induced liver tumors that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumor tissue revealed insertion or deletion (indel) mutations of the tumor suppressor genes, including bi-allelic mutations of both Pten and p53 in tumors. Furthermore, co-injection of Cas9 plasmids harboring sgRNAs targeting the β-Catenin gene (Ctnnb1) and a single-stranded DNA (ssDNA) oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-Catenin. This study demonstrates the feasibility of direct mutation of tumor suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics. PMID:25119044

  2. CRISPR-mediated direct mutation of cancer genes in the mouse liver.

    PubMed

    Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G; Zhang, Feng; Anderson, Daniel G; Sharp, Phillip A; Jacks, Tyler

    2014-10-16

    The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem cells. Here we describe a new method of cancer model generation using the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system in vivo in wild-type mice. We used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs) to the liver that directly target the tumour suppressor genes Pten (ref. 5) and p53 (also known as TP53 and Trp53) (ref. 6), alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology. Simultaneous targeting of Pten and p53 induced liver tumours that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumour tissue revealed insertion or deletion mutations of the tumour suppressor genes, including bi-allelic mutations of both Pten and p53 in tumours. Furthermore, co-injection of Cas9 plasmids harbouring sgRNAs targeting the β-catenin gene and a single-stranded DNA oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-catenin. This study demonstrates the feasibility of direct mutation of tumour suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics.

  3. The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.

    PubMed

    Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi

    2005-07-01

    Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.

  4. Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold.

    PubMed

    Gao, Jinpeng; Wallis, James G; Browse, John

    2015-09-01

    The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C-6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  5. Activating mutations affecting the Dbl homology domain of SOS2 cause Noonan syndrome

    PubMed Central

    Cordeddu, Viviana; Yin, Jiani C.; Gunnarsson, Cecilia; Virtanen, Carl; Drunat, Séverine; Lepri, Francesca; De Luca, Alessandro; Rossi, Cesare; Ciolfi, Andrea; Pugh, Trevor J.; Bruselles, Alessandro; Priest, James R.; Pennacchio, Len A.; Lu, Zhibin; Danesh, Arnavaz; Quevedo, Rene; Hamid, Alaa; Martinelli, Simone; Pantaleoni, Francesca; Gnazzo, Maria; Daniele, Paola; Lissewski, Christina; Bocchinfuso, Gianfranco; Stella, Lorenzo; Odent, Sylvie; Philip, Nicole; Faivre, Laurence; Vlckova, Marketa; Seemanova, Eva; Digilio, Cristina; Zenker, Martin; Zampino, Giuseppe; Verloes, Alain; Dallapiccola, Bruno; Roberts, Amy E.; Cavé, Hélène; Gelb, Bruce D.; Neel, Benjamin G.; Tartaglia, Marco

    2015-01-01

    The RASopathies constitute a family of autosomal dominant disorders whose major features include facial dysmorphism, cardiac defects, reduced postnatal growth, variable cognitive deficits, ectodermal and skeletal anomalies, and susceptibility to certain malignancies. Noonan syndrome (NS), the commonest RASopathy, is genetically heterogeneous and caused by functional dysregulation of signal transducers and regulatory proteins with roles in the RAS/extracellular signal-regulated kinase (ERK) signal transduction pathway. Mutations in known disease genes account for approximately 80% of affected individuals. Here, we report that missense mutations altering son of sevenless, Drosophila, homolog 2 (SOS2), which encodes a RAS guanine nucleotide exchange factor, occur in a small percentage of subjects with NS. Four missense mutations were identified in five unrelated sporadic cases and families transmitting NS. Disease-causing mutations affected three conserved residues located in the Dbl homology domain, of which two are directly involved in the intramolecular binding network maintaining SOS2 in its auto-inhibited conformation. All mutations were found to promote enhanced signaling from RAS to ERK. Similar to NS-causing SOS1 mutations, the phenotype associated with SOS2 defects is characterized by normal development and growth, as well as marked ectodermal involvement. Unlike SOS1 mutations, however, those in SOS2 are restricted to the Dbl homology domain. PMID:26173643

  6. Understanding the tumor suppressor PTEN in chronic alcoholism and hepatocellular carcinoma.

    PubMed

    Shearn, Colin T; Petersen, Dennis R

    2015-01-01

    The tumor suppressor phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a phosphatidylinositol (PtdIns) phosphatase that regulates Akt activation via PtdIns 3 kinase. Changes in PTEN expression and/or activity have been identified in a variety of chronic hepatocellular disorders including obesity, NAFLD, NASH, and alcoholism. In cancer biology, PTEN is frequently mutated or deleted in a wide variety of tumors. Mutations, decreased promoter activity, and decreased expression in PTEN are frequently identified in patients with hepatocellular carcinoma. While the majority of research on PTEN concerns obesity and NASH, PTEN clearly has a role in hepatic insulin sensitivity and in the development of steatosis during chronic alcoholism. Yet, in chronic alcoholics and HCC, very little is known concerning PTEN mutation/deletion or low PTEN expression. This review is focused on an overview of the current knowledge on molecular mechanisms of dysregulation of PTEN expression/activity in the liver and their relationship to development of ethanol-induced hepatocellular damage and cancer.

  7. In vivo replication of an ICP34.5 second-site suppressor mutant following corneal infection correlates with in vitro regulation of eIF2 alpha phosphorylation.

    PubMed

    Ward, Stephen L; Scheuner, Donalyn; Poppers, Jeremy; Kaufman, Randal J; Mohr, Ian; Leib, David A

    2003-04-01

    In animal models of herpes simplex virus type 1 (HSV-1) infection, ICP34.5-null viruses are avirulent and also fail to grow in a variety of cultured cells due to their inability to prevent RNA-dependent protein kinase (PKR)-mediated inhibition of protein synthesis. We show here that the inability of ICP34.5 mutants to grow in vitro is due specifically to the accumulation of phosphorylated eIF2 alpha. Mutations suppressing the in vitro phenotype of ICP34.5-null mutants have been described which map to the unique short region of the HSV-1 genome, resulting in dysregulated expression of the US11 gene. Despite the inability of the suppressor mutation to suppress the avirulent phenotype of the ICP34.5-null parental virus following intracranial inoculation, the suppressor mutation enhanced virus growth in the cornea, trigeminal ganglia, and periocular skin following corneal infection compared to that with the ICP34.5-null virus. The phosphorylation state of eIF2 alpha following in vitro infection with the suppressor virus was examined to determine if in vivo differences could be attributed to differential regulation of eIF2 alpha phosphorylation. The suppressor virus prevented accumulation of phosphorylated eIF2 alpha, while the wild-type virus substantially reduced eIF2 alpha phosphorylation levels. These data suggest that US11 functions as a PKR antagonist in vivo, although its activity may be modulated by tissue-specific differences in translation regulation.

  8. In Vivo Replication of an ICP34.5 Second-Site Suppressor Mutant following Corneal Infection Correlates with In Vitro Regulation of eIF2α Phosphorylation

    PubMed Central

    Ward, Stephen L.; Scheuner, Donalyn; Poppers, Jeremy; Kaufman, Randal J.; Mohr, Ian; Leib, David A.

    2003-01-01

    In animal models of herpes simplex virus type 1 (HSV-1) infection, ICP34.5-null viruses are avirulent and also fail to grow in a variety of cultured cells due to their inability to prevent RNA-dependent protein kinase (PKR)-mediated inhibition of protein synthesis. We show here that the inability of ICP34.5 mutants to grow in vitro is due specifically to the accumulation of phosphorylated eIF2α. Mutations suppressing the in vitro phenotype of ICP34.5-null mutants have been described which map to the unique short region of the HSV-1 genome, resulting in dysregulated expression of the US11 gene. Despite the inability of the suppressor mutation to suppress the avirulent phenotype of the ICP34.5-null parental virus following intracranial inoculation, the suppressor mutation enhanced virus growth in the cornea, trigeminal ganglia, and periocular skin following corneal infection compared to that with the ICP34.5-null virus. The phosphorylation state of eIF2α following in vitro infection with the suppressor virus was examined to determine if in vivo differences could be attributed to differential regulation of eIF2α phosphorylation. The suppressor virus prevented accumulation of phosphorylated eIF2α, while the wild-type virus substantially reduced eIF2α phosphorylation levels. These data suggest that US11 functions as a PKR antagonist in vivo, although its activity may be modulated by tissue-specific differences in translation regulation. PMID:12663769

  9. The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas.

    PubMed

    Sunaoshi, Masaaki; Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J; Morioka, Takamitsu; Kaminishi, Mutsumi; Shang, Yi; Nishimura, Mayumi; Shimada, Yoshiya; Tachibana, Akira; Kakinuma, Shizuko

    2015-09-01

    Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2a and Ikaros are a prominent feature of young adult irradiation-induced T-cell lymphoma, tumors arising after irradiation from infancy suffer a second hit in Pten by mis-segregation or recombination. This is the first report showing an influence of age-at-exposure on genomic alterations of tumor suppressor genes and their relative involvement in radiation-induced T-cell lymphoma. These data are important for considering the risks

  10. Identification of novel mutational drivers reveals oncogene dependencies in multiple myeloma.

    PubMed

    Walker, Brian A; Mavrommatis, Konstantinos; Wardell, Christopher P; Ashby, T Cody; Bauer, Michael; Davies, Faith E; Rosenthal, Adam; Wang, Hongwei; Qu, Pingping; Hoering, Antje; Samur, Mehmet; Towfic, Fadi; Ortiz, Maria; Flynt, Erin; Yu, Zhinuan; Yang, Zhihong; Rozelle, Dan; Obenauer, John; Trotter, Matthew; Auclair, Daniel; Keats, Jonathan; Bolli, Niccolo; Fulciniti, Mariateresa; Szalat, Raphael; Moreau, Philippe; Durie, Brian; Stewart, A Keith; Goldschmidt, Hartmut; Raab, Marc S; Einsele, Hermann; Sonneveld, Pieter; San Miguel, Jesus; Lonial, Sagar; Jackson, Graham H; Anderson, Kenneth C; Avet-Loiseau, Herve; Munshi, Nikhil; Thakurta, Anjan; Morgan, Gareth J

    2018-06-08

    Understanding the profile of oncogene and tumor suppressor gene mutations with their interactions and impact on the prognosis of multiple myeloma (MM) can improve the definition of disease subsets and identify pathways important in disease pathobiology. Using integrated genomics of 1,273 newly diagnosed patients with multiple myeloma we identify 63 driver genes, some of which are novel including IDH1 , IDH2 , HUWE1 , KLHL6 , and PTPN11 Oncogene mutations are significantly more clonal than tumor suppressor mutations, indicating they may exert a bigger selective pressure. Patients with more mutations in driver genes are associated with a worse outcome, as are those with identified mechanisms of genomic instability. Oncogenic dependencies were identified between mutations in driver genes, common regions of copy number change, and primary translocation and hyperdiploidy events. These dependencies included associations with t(4;14) and mutations in FGFR3 , DIS3 and PRKD2 ; t(11;14) with mutations in CCND1 and IRF4 ; t(14;16) with mutations in MAF , BRAF , DIS3 and ATM ; and hyperdiploidy with gain 11q, mutations in FAM46C and MYC rearrangements. These associations indicate that the genomic landscape of myeloma is pre-determined by the primary events upon which further dependencies are built, giving rise to a non-random accumulation of genetic hits. Understanding these dependencies may elucidate potential evolutionary patterns and lead to better treatment regimens. Copyright © 2018 American Society of Hematology.

  11. Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors

    PubMed Central

    Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József

    2006-01-01

    RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105

  12. Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes.

    PubMed

    Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

    2016-05-26

    Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes.

  13. Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes

    PubMed Central

    Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A.; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

    2016-01-01

    Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes. PMID:27225414

  14. CVID-associated TACI mutations affect autoreactive B cell selection and activation

    PubMed Central

    Romberg, Neil; Chamberlain, Nicolas; Saadoun, David; Gentile, Maurizio; Kinnunen, Tuure; Ng, Yen Shing; Virdee, Manmeet; Menard, Laurence; Cantaert, Tineke; Morbach, Henner; Rachid, Rima; Martinez-Pomar, Natalia; Matamoros, Nuria; Geha, Raif; Grimbacher, Bodo; Cerutti, Andrea; Cunningham-Rundles, Charlotte; Meffre, Eric

    2013-01-01

    Common variable immune deficiency (CVID) is an assorted group of primary diseases that clinically manifest with antibody deficiency, infection susceptibility, and autoimmunity. Heterozygous mutations in the gene encoding the tumor necrosis factor receptor superfamily member TACI are associated with CVID and autoimmune manifestations, whereas two mutated alleles prevent autoimmunity. To assess how the number of TACI mutations affects B cell activation and tolerance checkpoints, we analyzed healthy individuals and CVID patients carrying one or two TACI mutations. We found that TACI interacts with the cleaved, mature forms of TLR7 and TLR9 and plays an important role during B cell activation and the central removal of autoreactive B cells in healthy donors and CVID patients. However, only subjects with a single TACI mutation displayed a breached immune tolerance and secreted antinuclear antibodies (ANAs). These antibodies were associated with the presence of circulating B cell lymphoma 6–expressing T follicular helper (Tfh) cells, likely stimulating autoreactive B cells. Thus, TACI mutations may favor CVID by altering B cell activation with coincident impairment of central B cell tolerance, whereas residual B cell responsiveness in patients with one, but not two, TACI mutations enables autoimmune complications. PMID:24051380

  15. A Genetic Analysis of the Suppressor 2 of Zeste Complex of Drosophila Melanogaster

    PubMed Central

    Wu, C. T.; Howe, M.

    1995-01-01

    The zeste(1) (z(1)) mutation of Drosophila melanogaster produces a mutant yellow eye color instead of the wild-type red. Genetic and molecular data suggest that z(1) achieves this change by altering expression of the wild-type white gene in a manner that exhibits transvection effects. There exist suppressor and enhancer mutations that modify the z(1) eye color, and this paper summarizes our studies of those belonging to the Suppressor 2 of zeste complex [Su(z)2-C]. The Su(z)2-C consists of at least three subregions called Psc (Posterior sex combs), Su(z)2 and Su(z)2D (Distal). The products of these subregions are proposed to act at the level of chromatin. Complementation analyses predict that the products are functionally similar and interacting. The alleles of Psc define two overlapping phenotypic classes, the hopeful and hapless. The distinctions between these two classes and the intragenic complementation seen among some of the Psc alleles are consistent with a multidomain structure for the product of Psc. Psc is a member of the homeotic Polycomb group of genes. A general discussion of the Polycomb and trithorax group of genes, position-effect variegation, transvection, chromosome pairing and chromatin structure is presented. PMID:7635282

  16. Trinucleotide Insertions, Deletions, and Point Mutations in Glucose Transporters Confer K+ Uptake in Saccharomyces cerevisiae

    PubMed Central

    Liang, Hong; Ko, Christopher H.; Herman, Todd; Gaber, Richard F.

    1998-01-01

    Deletion of TRK1 and TRK2 abolishes high-affinity K+ uptake in Saccharomyces cerevisiae, resulting in the inability to grow on typical synthetic growth medium unless it is supplemented with very high concentrations of potassium. Selection for spontaneous suppressors that restored growth of trk1Δ trk2Δ cells on K+-limiting medium led to the isolation of cells with unusual gain-of-function mutations in the glucose transporter genes HXT1 and HXT3 and the glucose/galactose transporter gene GAL2. 86Rb uptake assays demonstrated that the suppressor mutations conferred increased uptake of the ion. In addition to K+, the mutant hexose transporters also conferred permeation of other cations, including Na+. Because the selection strategy required such gain of function, mutations that disrupted transporter maturation or localization to the plasma membrane were avoided. Thus, the importance of specific sites in glucose transport could be independently assessed by testing for the ability of the mutant transporter to restore glucose-dependent growth to cells containing null alleles of all of the known functional glucose transporter genes. Twelve sites, most of which are conserved among eukaryotic hexose transporters, were revealed to be essential for glucose transport. Four of these have previously been shown to be essential for glucose transport by animal or plant transporters. Eight represented sites not previously known to be crucial for glucose uptake. Each suppressor mutant harbored a single mutation that altered an amino acid(s) within or immediately adjacent to a putative transmembrane domain of the transporter. Seven of 38 independent suppressor mutations consisted of in-frame insertions or deletions. The nature of the insertions and deletions revealed a striking DNA template dependency: each insertion generated a trinucleotide repeat, and each deletion involved the removal of a repeated nucleotide sequence. PMID:9447989

  17. Evidence that the recA441 (tif-1) mutant of Escherichia coli K-12 contains a thermosensitive intragenic suppressor of RecA constitutive protease activity.

    PubMed

    Wang, W B; Tessman, E S

    1985-07-01

    The recA441 mutant of Escherichia coli, which has been thought to have thermoinducible constitutive RecA protease activity, is known to have two mutations within recA. We show here that the mutation that alters codon 38 actually confers temperature-independent constitutive protease activity; the second mutation in recA441, which is at codon 298, appears to be acting as a temperature-sensitive suppressor of the protease activity.

  18. BRG1 and LKB1: tales of two tumor suppressor genes on chromosome 19p and lung cancer.

    PubMed

    Rodriguez-Nieto, Salvador; Sanchez-Cespedes, Montse

    2009-04-01

    Losses of heterozygosity (LOH) of the short arm of chromosome 19 are frequent in lung cancer, suggesting that one or more tumor suppressor genes are present in this region. The LKB1 gene, also called STK11, is somatically inactivated through point mutations and large deletions in lung tumors, demonstrating that LKB1 is a target of the LOH of this chromosomal arm. Data from several independent groups have provided information about the profiles of lung tumors with LKB1 inactivation and it is generally agreed that this alteration strongly predominates in non-small cell lung cancer, in particular adenocarcinomas, in smokers. The LKB1 protein has serine-threonine kinase activity and is involved in the regulation of the cell energetic checkpoint through the phosphorylation and activation of adenosine monophosphate-dependent kinase (AMPK). LKB1 is also involved in other processes such as cell polarization, probably through substrates other than AMPK. Interestingly, another gene on chromosome 19p, BRG1, encoding a component of the SWI/SNF chromatin-remodeling complex, has emerged as a tumor suppressor gene that is altered in lung tumors. Similar to LKB1, BRG1 is somatically inactivated by point mutations or large deletions in lung tumors featuring LOH of chromosome 19p. These observations suggest an important role for BRG1 in lung cancer and highlight the need to further our understanding of the function of Brahma/SWI2-related gene 1 (BRG1) in cancer. Finally, simultaneous mutations at LKB1 and BRG1 are common in lung cancer cells, which exemplifies how a single event, LOH of chromosome 19p in this instance, targets two different tumor suppressors.

  19. Suppressors of dGTP Starvation in Escherichia coli

    PubMed Central

    Itsko, Mark

    2017-01-01

    . coli cells continued cell growth but eventually developed a DNA replication defect, leading to cell death due to formation of unresolvable DNA structures. Nevertheless, dGTP-starved cultures eventually resumed growth due to the appearance of resistant mutants. Here, we used whole-genome DNA sequencing to identify the responsible suppressor mutations. We show that the majority of suppressors can circumvent death by upregulating purine de novo biosynthesis, leading to restoration of dGTP to acceptable levels. PMID:28373271

  20. Suppressors of systemin signaling identify genes in the tomato wound response pathway.

    PubMed Central

    Howe, G A; Ryan, C A

    1999-01-01

    In tomato plants, systemic induction of defense genes in response to herbivory or mechanical wounding is regulated by an 18-amino-acid peptide signal called systemin. Transgenic plants that overexpress prosystemin, the systemin precursor, from a 35S::prosystemin (35S::prosys) transgene exhibit constitutive expression of wound-inducible defense proteins including proteinase inhibitors and polyphenol oxidase. To study further the role of (pro)systemin in the wound response pathway, we isolated and characterized mutations that suppress 35S::prosys-mediated phenotypes. Ten recessive, extragenic suppressors were identified. Two of these define new alleles of def-1, a previously identified mutation that blocks both wound- and systemin-induced gene expression and renders plants susceptible to herbivory. The remaining mutants defined four loci designated Spr-1, Spr-2, Spr-3, and Spr-4 (for Suppressed in 35S::prosystemin-mediated responses). spr-3 and spr-4 mutants were not significantly affected in their response to either systemin or mechanical wounding. In contrast, spr-1 and spr-2 plants lacked systemic wound responses and were insensitive to systemin. These results confirm the function of (pro)systemin in the transduction of systemic wound signals and further establish that wounding, systemin, and 35S::prosys induce defensive gene expression through a common signaling pathway defined by at least three genes (Def-1, Spr-1, and Spr-2). PMID:10545469

  1. Sun exposure causes somatic second-hit mutations and angiofibroma development in tuberous sclerosis complex

    PubMed Central

    Tyburczy, Magdalena E.; Wang, Ji-an; Li, Shaowei; Thangapazham, Rajesh; Chekaluk, Yvonne; Moss, Joel; Kwiatkowski, David J.; Darling, Thomas N.

    2014-01-01

    Tuberous sclerosis complex (TSC) is characterized by the formation of tumors in multiple organs and is caused by germline mutation in one of two tumor suppressor genes, TSC1 and TSC2. As for other tumor suppressor gene syndromes, the mechanism of somatic second-hit events in TSC tumors is unknown. We grew fibroblast-like cells from 29 TSC skin tumors from 22 TSC subjects and identified germline and second-hit mutations in TSC1/TSC2 using next-generation sequencing. Eighteen of 22 (82%) subjects had a mutation identified, and 8 of the 18 (44%) subjects were mosaic with mutant allele frequencies of 0 to 19% in normal tissue DNA. Multiple tumors were available from four patients, and in each case, second-hit mutations in TSC2 were distinct indicating they arose independently. Most remarkably, 7 (50%) of the 14 somatic point mutations were CC>TT ultraviolet ‘signature’ mutations, never seen as a TSC germline mutation. These occurred exclusively in facial angiofibroma tumors from sun-exposed sites. These results implicate UV-induced DNA damage as a cause of second-hit mutations and development of TSC facial angiofibromas and suggest that measures to limit UV exposure in TSC children and adults should reduce the frequency and severity of these lesions. PMID:24271014

  2. DA-Raf, a dominant-negative antagonist of the Ras-ERK pathway, is a putative tumor suppressor.

    PubMed

    Kanno, Emiri; Kawasaki, Osamu; Takahashi, Kazuya; Takano, Kazunori; Endo, Takeshi

    2018-01-01

    Activating mutations of RAS genes, particularly KRAS, are detected with high frequency in human tumors. Mutated Ras proteins constitutively activate the ERK pathway (Raf-MEK-ERK phosphorylation cascade), leading to cellular transformation and tumorigenesis. DA-Raf1 (DA-Raf) is a splicing variant of A-Raf and contains the Ras-binding domain (RBD) but lacks the kinase domain. Accordingly, DA-Raf antagonizes the Ras-ERK pathway in a dominant-negative fashion and suppresses constitutively activated K-Ras-induced cellular transformation. Thus, we have addressed whether DA-Raf serves as a tumor suppressor of Ras-induced tumorigenesis. DA-Raf(R52Q), which is generated from a single nucleotide polymorphism (SNP) in the RBD, and DA-Raf(R52W), a mutant detected in a lung cancer, neither bound to active K-Ras nor interfered with the activation of the ERK pathway. They were incapable of suppressing activated K-Ras-induced cellular transformation and tumorigenesis in mice, in which K-Ras-transformed cells were transplanted. Furthermore, although DA-Raf was highly expressed in lung alveolar epithelial type 2 (AE2) cells, its expression was silenced in AE2-derived lung adenocarcinoma cell lines with oncogenic KRAS mutations. These results suggest that DA-Raf represents a tumor suppressor protein against Ras-induced tumorigenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Tumor suppressor molecules and methods of use

    DOEpatents

    Welch, Peter J.; Barber, Jack R.

    2004-09-07

    The invention provides substantially pure tumor suppressor nucleic acid molecules and tumor suppressor polypeptides. The invention also provides hairpin ribozymes and antibodies selective for these tumor suppressor molecules. Also provided are methods of detecting a neoplastic cell in a sample using detectable agents specific for the tumor suppressor nucleic acids and polypeptides.

  4. The human ARF tumor suppressor senses blastema activity and suppresses epimorphic tissue regeneration

    PubMed Central

    Hesse, Robert G; Kouklis, Gayle K; Ahituv, Nadav; Pomerantz, Jason H

    2015-01-01

    The control of proliferation and differentiation by tumor suppressor genes suggests that evolution of divergent tumor suppressor repertoires could influence species’ regenerative capacity. To directly test that premise, we humanized the zebrafish p53 pathway by introducing regulatory and coding sequences of the human tumor suppressor ARF into the zebrafish genome. ARF was dormant during development, in uninjured adult fins, and during wound healing, but was highly expressed in the blastema during epimorphic fin regeneration after amputation. Regenerative, but not developmental signals resulted in binding of zebrafish E2f to the human ARF promoter and activated conserved ARF-dependent Tp53 functions. The context-dependent activation of ARF did not affect growth and development but inhibited regeneration, an unexpected distinct tumor suppressor response to regenerative versus developmental environments. The antagonistic pleiotropic characteristics of ARF as both tumor and regeneration suppressor imply that inducing epimorphic regeneration clinically would require modulation of ARF –p53 axis activation. DOI: http://dx.doi.org/10.7554/eLife.07702.001 PMID:26575287

  5. Evidence that the recA441 (tif-1) mutant of Escherichia coli K-12 contains a thermosensitive intragenic suppressor of RecA constitutive protease activity.

    PubMed Central

    Wang, W B; Tessman, E S

    1985-01-01

    The recA441 mutant of Escherichia coli, which has been thought to have thermoinducible constitutive RecA protease activity, is known to have two mutations within recA. We show here that the mutation that alters codon 38 actually confers temperature-independent constitutive protease activity; the second mutation in recA441, which is at codon 298, appears to be acting as a temperature-sensitive suppressor of the protease activity. Images PMID:3891740

  6. Identification and Characterization of Mutations Affecting Sporulation in Saccharomyces Cerevisiae

    PubMed Central

    Smith, L. M.; Robbins, L. G.; Kennedy, A.; Magee, P. T.

    1988-01-01

    Mutations affecting the synthesis of the sporulation amyloglucosidase were isolated in a homothallic strain of Saccharomyces cerevisiae, SCMS7-1. Two were found, both of which were deficient in sporulation at 34°. One, SL484, sporulated to 50% normal levels at 30° but less than 5% at 34° or 22°. The other, SL641, failed to sporulate at any temperature. Both mutants were blocked before premeiotic DNA synthesis, and both complemented spo1, spo3, and spo7. Genetic analysis of the mutation in SL484 indicated linkage to TRP5 and placed the gene 10 map units from TRP5 on chromosome VII. A plasmid containing an insert which complements the mutation in SL484 fails to complement SL641. We therefore conclude that these two mutations are in separate genes and we propose to call these genes SPO17 and SPO18. These two genes are (with SPO7, SPO8, and SPO9) among the earliest identified in the sporulation pathway and may interact directly with the positive and negative regulators RME and IME. PMID:3147221

  7. Mutations affecting gyrase in Haemophilus influenzae.

    PubMed Central

    Setlow, J K; Cabrera-Juárez, E; Albritton, W L; Spikes, D; Mutschler, A

    1985-01-01

    Mutants separately resistant to novobiocin, coumermycin, nalidixic acid, and oxolinic acid contained gyrase activity as measured in vitro that was resistant to the antibiotics, indicating that the mutations represented structural alterations of the enzyme. One Novr mutant contained an altered B subunit of the enzyme, as judged by the ability of a plasmid, pNov1, containing the mutation to complement a temperature-sensitive gyrase B mutation in Escherichia coli and to cause novobiocin resistance in that strain. Three other Novr mutations did not confer antibiotic resistance to the gyrase but appeared to increase the amount of active enzyme in the cell. One of these, novB1, could only act in cis, whereas a new mutation, novC, could act in trans. An RNA polymerase mutation partially substituted for the novB1 mutation, suggesting that novB1 may be a mutation in a promoter region for the B subunit gene. Growth responses of strains containing various combinations of mutations on plasmids or on the chromosome indicated that low-level resistance to novobiocin or coumermycin may have resulted from multiple copies of wild-type genes coding for the gyrase B subunit, whereas high-level resistance required a structural change in the gyrase B gene and was also dependent on alteration in a regulatory region. When there was mismatch at the novB locus, with the novB1 mutation either on a plasmid or the chromosome, and the corresponding wild-type gene present in trans, chromosome to plasmid recombination during transformation was much higher than when the genes matched, probably because plasmid to chromosome recombination, eliminating the plasmid, was inhibited by the mismatch. PMID:2997115

  8. A Recurrent Mutation in PARK2 Is Associated with Familial Lung Cancer

    PubMed Central

    Xiong, Donghai; Wang, Yian; Kupert, Elena; Simpson, Claire; Pinney, Susan M.; Gaba, Colette R.; Mandal, Diptasri; Schwartz, Ann G.; Yang, Ping; de Andrade, Mariza; Pikielny, Claudio; Byun, Jinyoung; Li, Yafang; Stambolian, Dwight; Spitz, Margaret R.; Liu, Yanhong; Amos, Christopher I.; Bailey-Wilson, Joan E.; Anderson, Marshall; You, Ming

    2015-01-01

    PARK2, a gene associated with Parkinson disease, is a tumor suppressor in human malignancies. Here, we show that c.823C>T (p.Arg275Trp), a germline mutation in PARK2, is present in a family with eight cases of lung cancer. The resulting amino acid change, p.Arg275Trp, is located in the highly conserved RING finger 1 domain of PARK2, which encodes an E3 ubiquitin ligase. Upon further analysis, the c.823C>T mutation was detected in three additional families affected by lung cancer. The effect size for PARK2 c.823C>T (odds ratio = 5.24) in white individuals was larger than those reported for variants from lung cancer genome-wide association studies. These data implicate this PARK2 germline mutation as a genetic susceptibility factor for lung cancer. Our results provide a rationale for further investigations of this specific mutation and gene for evaluation of the possibility of developing targeted therapies against lung cancer in individuals with PARK2 variants by compensating for the loss-of-function effect caused by the associated variation. PMID:25640678

  9. The callipyge mutation and other genes that affect muscle hypertrophy in sheep

    PubMed Central

    2005-01-01

    Genetic strategies to improve the profitability of sheep operations have generally focused on traits for reproduction. However, natural mutations exist in sheep that affect muscle growth and development, and the exploitation of these mutations in breeding strategies has the potential to significantly improve lamb-meat quality. The best-documented mutation for muscle development in sheep is callipyge (CLPG), which causes a postnatal muscle hypertrophy that is localized to the pelvic limbs and loin. Enhanced skeletal muscle growth is also observed in animals with the Carwell (or rib-eye muscling) mutation, and a double-muscling phenotype has been documented for animals of the Texel sheep breed. However, the actual mutations responsible for these muscular hypertrophy phenotypes in sheep have yet to be identified, and further characterization of the genetic basis for these phenotypes will provide insight into the biological control of muscle growth and body composition. PMID:15601596

  10. Psychological Distress, Anxiety, and Depression of Cancer-Affected BRCA1/2 Mutation Carriers: a Systematic Review.

    PubMed

    Ringwald, Johanna; Wochnowski, Christina; Bosse, Kristin; Giel, Katrin Elisabeth; Schäffeler, Norbert; Zipfel, Stephan; Teufel, Martin

    2016-10-01

    Understanding the intermediate- and long-term psychological consequences of genetic testing for cancer patients has led to encouraging research, but a clear consensus of the psychosocial impact and clinical routine for cancer-affected BRCA1 and BRCA2 mutation carriers is still missing. We performed a systematic review of intermediate- and long-term studies investigating the psychological impact like psychological distress, anxiety, and depression in cancer-affected BRCA mutation carriers compared to unaffected mutation carriers. This review included the screening of 1243 studies. Eight intermediate- and long-term studies focusing on distress, anxiety, and depression symptoms among cancer-affected mutation carriers at least six months after the disclosure of genetic testing results were included. Studies reported a great variety of designs, methods, and patient outcomes. We found evidence indicating that cancer-affected mutation carriers experienced a negative effect in relation to psychological well-being in terms of an increase in symptoms of distress, anxiety, and depression in the first months after test disclosure. In the intermediate- and long-term, no significant clinical relevant symptoms occurred. However, none of the included studies used specific measurements, which can clearly identify psychological burdens of cancer-affected mutation carriers. We concluded that current well-implemented distress screening instruments are not sufficient for precisely identifying the psychological burden of genetic testing. Therefore, future studies should implement coping strategies, specific personality structures, the impact of genetic testing, supportive care needs and disease management behaviour to clearly screen for the possible intermediate- and long-term psychological impact of a positive test disclosure.

  11. Myeloid neoplasms with germline DDX41 mutation.

    PubMed

    Cheah, Jesse J C; Hahn, Christopher N; Hiwase, Devendra K; Scott, Hamish S; Brown, Anna L

    2017-08-01

    Recently, DDX41 mutations have been identified both as germline and acquired somatic mutations in families with multiple cases of late-onset myelodysplastic syndrome (MDS) and/or acute myeloid leukemia. The majority of germline mutations are frameshift mutations suggesting loss of function with DDX41 acting as a tumor suppressor, and there is a common somatic missense mutation found in a majority of germline mutated tumors. Clinically, DDX41 mutations lead to development of high-risk MDS at an age similar to that observed in sporadic cohorts, presenting a unique challenge to hematologists in recognizing the familial context. Functionally, DDX41 has been shown to contribute to multiple pathways and processes including mRNA splicing, innate immunity and rRNA processing. Mutations in DDX41 result in aberrations to each of these in ways that could potentially impact on tumorigenesis-initiation, maintenance or progression. This review discusses the various molecular, clinical and biological aspects of myeloid malignancy predisposition due to DDX41 mutation and highlights how each of these suggest potential therapeutic opportunities through the use of pathway-specific inhibitors.

  12. Mendelian and non-mendelian mutations affecting surface antigen expression in Paramecium tetraurelia.

    PubMed Central

    Epstein, L M; Forney, J D

    1984-01-01

    A screening procedure was devised for the isolation of X-ray-induced mutations affecting the expression of the A immobilization antigen (i-antigen) in Paramecium tetraurelia. Two of the mutations isolated by this procedure proved to be in modifier genes. The two genes are unlinked to each other and unlinked to the structural A i-antigen gene. These are the first modifier genes identified in a Paramecium sp. that affect surface antigen expression. Another mutation was found to be a deletion of sequences just downstream from the A i-antigen gene. In cells carrying this mutation, the A i-antigen gene lies in close proximity to the end of a macronuclear chromosome. The expression of the A i-antigen is not affected in these cells, demonstrating that downstream sequences are not important for the regulation and expression of the A i-antigen gene. A stable cell line was also recovered which shows non-Mendelian inheritance of a macronuclear deletion of the A i-antigen gene. This mutant does not contain the gene in its macronucleus, but contains a complete copy of the gene in its micronucleus. In the cytoplasm of wild-type animals, the micronuclear gene is included in the developing macronucleus; in the cytoplasm of the mutant, the incorporation of the A i-antigen gene into the macronucleus is inhibited. This is the first evidence that a mechanism is available in ciliates to control the expression of a gene by regulating its incorporation into developing macronuclei. Images PMID:6092921

  13. Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster

    PubMed Central

    Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur

    1987-01-01

    The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645

  14. Exercise-induced mitochondrial p53 repairs mtDNA mutations in mutator mice.

    PubMed

    Safdar, Adeel; Khrapko, Konstantin; Flynn, James M; Saleem, Ayesha; De Lisio, Michael; Johnston, Adam P W; Kratysberg, Yevgenya; Samjoo, Imtiaz A; Kitaoka, Yu; Ogborn, Daniel I; Little, Jonathan P; Raha, Sandeep; Parise, Gianni; Akhtar, Mahmood; Hettinga, Bart P; Rowe, Glenn C; Arany, Zoltan; Prolla, Tomas A; Tarnopolsky, Mark A

    2016-01-01

    Human genetic disorders and transgenic mouse models have shown that mitochondrial DNA (mtDNA) mutations and telomere dysfunction instigate the aging process. Epidemiologically, exercise is associated with greater life expectancy and reduced risk of chronic diseases. While the beneficial effects of exercise are well established, the molecular mechanisms instigating these observations remain unclear. Endurance exercise reduces mtDNA mutation burden, alleviates multisystem pathology, and increases lifespan of the mutator mice, with proofreading deficient mitochondrial polymerase gamma (POLG1). We report evidence for a POLG1-independent mtDNA repair pathway mediated by exercise, a surprising notion as POLG1 is canonically considered to be the sole mtDNA repair enzyme. Here, we show that the tumor suppressor protein p53 translocates to mitochondria and facilitates mtDNA mutation repair and mitochondrial biogenesis in response to endurance exercise. Indeed, in mutator mice with muscle-specific deletion of p53, exercise failed to prevent mtDNA mutations, induce mitochondrial biogenesis, preserve mitochondrial morphology, reverse sarcopenia, or mitigate premature mortality. Our data establish a new role for p53 in exercise-mediated maintenance of the mtDNA genome and present mitochondrially targeted p53 as a novel therapeutic modality for diseases of mitochondrial etiology.

  15. Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells.

    PubMed

    Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

    2013-03-01

    RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. © 2013 Blackwell Publishing Ltd.

  16. Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells

    PubMed Central

    Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

    2013-01-01

    RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. PMID:23301723

  17. Novel genes and mutations in patients affected by recurrent pregnancy loss.

    PubMed

    Quintero-Ronderos, Paula; Mercier, Eric; Fukuda, Michiko; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Vaiman, Daniel; Gris, Jean-Christophe; Laissue, Paul

    2017-01-01

    Recurrent pregnancy loss is a frequently occurring human infertility-related disease affecting ~1% of women. It has been estimated that the cause remains unexplained in >50% cases which strongly suggests that genetic factors may contribute towards the phenotype. Concerning its molecular aetiology numerous studies have had limited success in identifying the disease's genetic causes. This might have been due to the fact that hundreds of genes are involved in each physiological step necessary for guaranteeing reproductive success in mammals. In such scenario, next generation sequencing provides a potentially interesting tool for research into recurrent pregnancy loss causative mutations. The present study involved whole-exome sequencing and an innovative bioinformatics analysis, for the first time, in 49 unrelated women affected by recurrent pregnancy loss. We identified 27 coding variants (22 genes) potentially related to the phenotype (41% of patients). The affected genes, which were enriched by potentially deleterious sequence variants, belonged to distinct molecular cascades playing key roles in implantation/pregnancy biology. Using a quantum chemical approach method we established that mutations in MMP-10 and FGA proteins led to substantial energetic modifications suggesting an impact on their functions and/or stability. The next generation sequencing and bioinformatics approaches presented here represent an efficient way to find mutations, having potentially moderate/strong functional effects, associated with recurrent pregnancy loss aetiology. We consider that some of these variants (and genes) represent probable future biomarkers for recurrent pregnancy loss.

  18. Functional conservation of the human EXT1 tumor suppressor gene and its Drosophila homolog tout velu.

    PubMed

    Dasgupta, Ujjaini; Dixit, Bharat L; Rusch, Melissa; Selleck, Scott; The, Inge

    2007-08-01

    Heparan sulfate proteoglycans play a vital role in signaling of various growth factors in both Drosophila and vertebrates. In Drosophila, mutations in the tout velu (ttv) gene, a homolog of the mammalian EXT1 tumor suppressor gene, leads to abrogation of glycosaminoglycan (GAG) biosynthesis. This impairs distribution and signaling activities of various morphogens such as Hedgehog (Hh), Wingless (Wg), and Decapentaplegic (Dpp). Mutations in members of the exostosin (EXT) gene family lead to hereditary multiple exostosis in humans leading to bone outgrowths and tumors. In this study, we provide genetic and biochemical evidence that the human EXT1 (hEXT1) gene is conserved through species and can functionally complement the ttv mutation in Drosophila. The hEXT1 gene was able to rescue a ttv null mutant to adulthood and restore GAG biosynthesis.

  19. A Novel NHERF1 Mutation in Human Breast Cancer and Effects on Malignant Progression.

    PubMed

    Yang, Xiaomei; Du, Guifang; Yu, Zhen; Si, Yang; Martin, Tracey A; He, Junqi; Cheng, Shan; Jiang, Wen G

    2017-01-01

    Na + /H + exchanger regulatory factor 1 (NHERF1) has been reported to interact with post-synaptic density protein/Drosophila disc large tumour suppressor/zonula occludens 1 protein (PDZ) binding proteins by its two PDZ domains. These associations have effects on cellular signal transductions. NHERF1 has also been indicated as a cancer-related gene in several solid tumour types. We identified a novel mutation (A190D), of the PDZ2 domain of NHERF1 in breast cancer tissues. NHERF1 A190D mutation abolished NHERF1 modulation of proliferation and migration. In this study, we found that NHERF1 A190D mutation increased nuclear localisation of the protein compared to wild-type NHERF1. It has been reported that YES-associated protein (YAP) interacts with NHERF1. Here we found that NHERF1 A190D mutation increased the binding affinity between NHERF1 and YAP, which inhibited the phosphorylation of YAP. These data suggest that wild-type NHERF1 acts as a tumour suppressor, while NHERF1 A190D mutation abolishes the tumour-suppressive effect in cancer cells, due to A190D mutation-mediated nuclear NHERF1 translocation and induction of YAP phosphorylation. Copyright© 2017 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  20. T antigen mutations are a human tumor-specific signature for Merkel cell polyomavirus

    PubMed Central

    Shuda, Masahiro; Feng, Huichen; Kwun, Hyun Jin; Rosen, Steven T.; Gjoerup, Ole; Moore, Patrick S.; Chang, Yuan

    2008-01-01

    Merkel cell polyomavirus (MCV) is a virus discovered in our laboratory at the University of Pittsburgh that is monoclonally integrated into the genome of ≈80% of human Merkel cell carcinomas (MCCs). Transcript mapping was performed to show that MCV expresses transcripts in MCCs similar to large T (LT), small T (ST), and 17kT transcripts of SV40. Nine MCC tumor-derived LT genomic sequences have been examined, and all were found to harbor mutations prematurely truncating the MCV LT helicase. In contrast, four presumed episomal viruses from nontumor sources did not possess this T antigen signature mutation. Using coimmunoprecipitation and origin replication assays, we show that tumor-derived virus mutations do not affect retinoblastoma tumor suppressor protein (Rb) binding by LT but do eliminate viral DNA replication capacity. Identification of an MCC cell line (MKL-1) having monoclonal MCV integration and the signature LT mutation allowed us to functionally test both tumor-derived and wild type (WT) T antigens. Only WT LT expression activates replication of integrated MCV DNA in MKL-1 cells. Our findings suggest that MCV-positive MCC tumor cells undergo selection for LT mutations to prevent autoactivation of integrated virus replication that would be detrimental to cell survival. Because these mutations render the virus replication-incompetent, MCV is not a “passenger virus” that secondarily infects MCC tumors. PMID:18812503

  1. Mutations at Several Loci Cause Increased Expression of Ribonucleotide Reductase in Escherichia coli

    PubMed Central

    Feeney, Morgan Anne; Ke, Na

    2012-01-01

    Production of deoxyribonucleotides for DNA synthesis is an essential and tightly regulated process. The class Ia ribonucleotide reductase (RNR), the product of the nrdAB genes, is required for aerobic growth of Escherichia coli. In catalyzing the reduction of ribonucleotides, two of the cysteines of RNR become oxidized, forming a disulfide bond. To regenerate active RNR, the cell uses thioredoxins and glutaredoxins to reduce the disulfide bond. Strains that lack thioredoxins 1 and 2 and glutaredoxin 1 do not grow because RNR remains in its oxidized, inactive form. However, suppressor mutations that lead to RNR overproduction allow glutaredoxin 3 to reduce sufficient RNR for growth of these mutant strains. We previously described suppressor mutations in the dnaA and dnaN genes that had such effects. Here we report the isolation of new mutations that lead to increased levels of RNR. These include mutations that were not known to influence production of RNR previously, such as a mutation in the hda gene and insertions in the nrdAB promoter region of insertion elements IS1 and IS5. Bioinformatic analysis raises the possibility that IS element insertion in this region represents an adaptive mechanism in nrdAB regulation in E. coli and closely related species. We also characterize mutations altering different amino acids in DnaA and DnaN from those isolated before. PMID:22247510

  2. Comprehensive assessment of cancer missense mutation clustering in protein structures.

    PubMed

    Kamburov, Atanas; Lawrence, Michael S; Polak, Paz; Leshchiner, Ignaty; Lage, Kasper; Golub, Todd R; Lander, Eric S; Getz, Gad

    2015-10-06

    Large-scale tumor sequencing projects enabled the identification of many new cancer gene candidates through computational approaches. Here, we describe a general method to detect cancer genes based on significant 3D clustering of mutations relative to the structure of the encoded protein products. The approach can also be used to search for proteins with an enrichment of mutations at binding interfaces with a protein, nucleic acid, or small molecule partner. We applied this approach to systematically analyze the PanCancer compendium of somatic mutations from 4,742 tumors relative to all known 3D structures of human proteins in the Protein Data Bank. We detected significant 3D clustering of missense mutations in several previously known oncoproteins including HRAS, EGFR, and PIK3CA. Although clustering of missense mutations is often regarded as a hallmark of oncoproteins, we observed that a number of tumor suppressors, including FBXW7, VHL, and STK11, also showed such clustering. Beside these known cases, we also identified significant 3D clustering of missense mutations in NUF2, which encodes a component of the kinetochore, that could affect chromosome segregation and lead to aneuploidy. Analysis of interaction interfaces revealed enrichment of mutations in the interfaces between FBXW7-CCNE1, HRAS-RASA1, CUL4B-CAND1, OGT-HCFC1, PPP2R1A-PPP2R5C/PPP2R2A, DICER1-Mg2+, MAX-DNA, SRSF2-RNA, and others. Together, our results indicate that systematic consideration of 3D structure can assist in the identification of cancer genes and in the understanding of the functional role of their mutations.

  3. Comprehensive assessment of cancer missense mutation clustering in protein structures

    PubMed Central

    Kamburov, Atanas; Lawrence, Michael S.; Polak, Paz; Leshchiner, Ignaty; Lage, Kasper; Golub, Todd R.; Lander, Eric S.; Getz, Gad

    2015-01-01

    Large-scale tumor sequencing projects enabled the identification of many new cancer gene candidates through computational approaches. Here, we describe a general method to detect cancer genes based on significant 3D clustering of mutations relative to the structure of the encoded protein products. The approach can also be used to search for proteins with an enrichment of mutations at binding interfaces with a protein, nucleic acid, or small molecule partner. We applied this approach to systematically analyze the PanCancer compendium of somatic mutations from 4,742 tumors relative to all known 3D structures of human proteins in the Protein Data Bank. We detected significant 3D clustering of missense mutations in several previously known oncoproteins including HRAS, EGFR, and PIK3CA. Although clustering of missense mutations is often regarded as a hallmark of oncoproteins, we observed that a number of tumor suppressors, including FBXW7, VHL, and STK11, also showed such clustering. Beside these known cases, we also identified significant 3D clustering of missense mutations in NUF2, which encodes a component of the kinetochore, that could affect chromosome segregation and lead to aneuploidy. Analysis of interaction interfaces revealed enrichment of mutations in the interfaces between FBXW7-CCNE1, HRAS-RASA1, CUL4B-CAND1, OGT-HCFC1, PPP2R1A-PPP2R5C/PPP2R2A, DICER1-Mg2+, MAX-DNA, SRSF2-RNA, and others. Together, our results indicate that systematic consideration of 3D structure can assist in the identification of cancer genes and in the understanding of the functional role of their mutations. PMID:26392535

  4. Exonuclease mutations in DNA polymerase epsilon reveal replication strand specific mutation patterns and human origins of replication

    PubMed Central

    Shinbrot, Eve; Henninger, Erin E.; Weinhold, Nils; Covington, Kyle R.; Göksenin, A. Yasemin; Schultz, Nikolaus; Chao, Hsu; Doddapaneni, HarshaVardhan; Muzny, Donna M.; Gibbs, Richard A.; Sander, Chris; Pursell, Zachary F.

    2014-01-01

    Tumors with somatic mutations in the proofreading exonuclease domain of DNA polymerase epsilon (POLE-exo*) exhibit a novel mutator phenotype, with markedly elevated TCT→TAT and TCG→TTG mutations and overall mutation frequencies often exceeding 100 mutations/Mb. Here, we identify POLE-exo* tumors in numerous cancers and classify them into two groups, A and B, according to their mutational properties. Group A mutants are found only in POLE, whereas Group B mutants are found in POLE and POLD1 and appear to be nonfunctional. In Group A, cell-free polymerase assays confirm that mutations in the exonuclease domain result in high mutation frequencies with a preference for C→A mutation. We describe the patterns of amino acid substitutions caused by POLE-exo* and compare them to other tumor types. The nucleotide preference of POLE-exo* leads to increased frequencies of recurrent nonsense mutations in key tumor suppressors such as TP53, ATM, and PIK3R1. We further demonstrate that strand-specific mutation patterns arise from some of these POLE-exo* mutants during genome duplication. This is the first direct proof of leading strand-specific replication by human POLE, which has only been demonstrated in yeast so far. Taken together, the extremely high mutation frequency and strand specificity of mutations provide a unique identifier of eukaryotic origins of replication. PMID:25228659

  5. K-ras Mutations as the Earliest Driving Force in a Subset of Colorectal Carcinomas

    PubMed Central

    MARGETIS, NIKOLAOS; KOULOUKOUSSA, MYRSINI; PAVLOU, KYRIAKI; VRAKAS, SPYRIDON; MARIOLIS-SAPSAKOS, THEODOROS

    2017-01-01

    K-ras oncogene is a key factor in colorectal cancer. Based on published and our data we propose that K-ras could be the oncogene responsible for the inactivation of the tumor-suppressor gene APC, currently considered as the initial step in colorectal tumorigenesis. K-ras fulfills the criteria of the oncogene-induced DNA damage model, as it can provoke well- established causes for inactivating tumor-suppressors, i.e. DNA double-strand breaks (causing allele deletion) and ROS production (responsible for point mutation). The model we propose is a variation of the currently existing model and hypothesizes that, in a subgroup of colorectal carcinomas, K-ras mutation may precede APC inactivation, representing the earliest driving force and, probably, an early biomarker of colorectal carcinogenesis. This observation is clinically useful, since it may modify the preventive colorectal cancer strategy, restricting numerically patients undergoing colonoscopies to those bearing K-ras mutation in their colorectum, either in benign polyps or the normal accompanying mucosa. PMID:28652417

  6. A molecular description of mutations affecting the pollen component of the Nicotiana alata S locus.

    PubMed Central

    Golz, J F; Su, V; Clarke, A E; Newbigin, E

    1999-01-01

    Mutations affecting the self-incompatibility response of Nicotiana alata were generated by irradiation. Mutants in the M1 generation were selected on the basis of pollen tube growth through an otherwise incompatible pistil. Twelve of the 18 M1 plants obtained from the mutagenesis screen were self-compatible. Eleven self-compatible plants had mutations affecting only the pollen function of the S locus (pollen-part mutants). The remaining self-compatible plant had a mutation affecting only the style function of the S locus (style-part mutant). Cytological examination of the pollen-part mutant plants revealed that 8 had an extra chromosome (2n + 1) and 3 did not. The pollen-part mutation in 7 M1 plants was followed in a series of crosses. DNA blot analysis using probes for S-RNase genes (encoding the style function of the S locus) indicated that the pollen-part mutation was associated with an extra S allele in 4 M1 plants. In 3 of these plants, the extra S allele was located on the additional chromosome. There was no evidence of an extra S allele in the 3 remaining M1 plants. The breakdown of self-incompatibility in plants with an extra S allele is discussed with reference to current models of the molecular basis of self-incompatibility. PMID:10388830

  7. Mechanisms of regulation of cell-mediated immunity. III. The characterization of azobenzenearsonate-specific suppressor T-cell- derived-suppressor factors

    PubMed Central

    1979-01-01

    Delayed type hypersensitivity to the hapten azobenzenearsonate (ABA) can be induced and suppressed by the administration of hapten-coupled syngeneic spleen cells by the appropriate route. Suppressor T cells stimulated by the intravenous administration of ABA-coupled spleen cells have been shown to produce a discrete subcellular factor(s) which is capable of suppressing delayed type hypersensitivity to azobenzenearsonate in the mouse. Such suppressor factors may be produced by the mechanical disruption of suppressor cells or by placing such suppressor cells in culture for 24 h. The suppressor factor(s) (SF) derived from ABA-specific suppressor cells exhibit biological specificity for the suppression of ABA delayed type hypersensitivity (DTH), but not trinitro-phenyl DTH, as well as the capacity to bind to ABA immunoadsorbents. Passage of suppressor factor(s) over reverse immunoadsorbents utilizing a rabbit anti-mouse F(ab')2 antiserum demonstrated that the antigen-specific T-cell derived SF does not bear conventional immunoglobulin markers. The suppressor factor(s) are not immunoglobulin molecules was further demonstrated by the inability of anti-ABA antibodies to suppress ABA DTH. Gel filtration of ABA suppressor factor(s) showed that the majority of the suppressive activity was present in a fraction with molecular weight ranging between 6.8 x 10(4) and 3.3 x 10(4) daltons. We also analyzed for the presence of determinants encoded by the H-2 major histocompatibility complex (MHC) and found that immunoadsorbents prepared utilizing antisera capable of interacting with gene products of the whole or selected gene regions of H-2 MHC, i.e., B10.D2 anti-B10.A and B10 anti- B10.A immunoadsorbents, retained the suppressive activity of ABA-SF. Elution of such columns with glycine HCl buffers (pH 2.8) permitted recovery of specific suppressive activity. Taken collectively such data supports the notion that suppressor T-cell-derived ABA suppressor factors have antigen

  8. The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.

    PubMed

    Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C

    2007-09-18

    Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.

  9. Prevalence of GJB2 Mutations in Affected Individuals from United Arab Emirates with Autosomal Recessive Nonsyndromic Hearing Loss.

    PubMed

    Tlili, Abdelaziz; Al Mutery, Abdullah; Kamal Eddine Ahmad Mohamed, Walaa; Mahfood, Mona; Hadj Kacem, Hassen

    2017-11-01

    Mutations in the gap junction protein beta 2 (GJB2) gene are responsible for more cases of nonsyndromic recessive hearing loss than any other gene. The purpose of our study was to evaluate the prevalence of GJB2 mutations among affected individuals from United Arab Emirates (UAE). There were 50 individuals diagnosed with hereditary hearing loss and 120 healthy individuals enrolled in the study. The Sanger sequencing method was used to screen the GJB2 coding region in all affected individuals. The c.-1G>A variant was determined by the polymerase chain reaction-restriction fragment length polymorphism method in normal individuals. Nine cases with bi-allelic mutations and three cases with mono-allelic mutations were detected in 12 out of 50 patients (24%). The homozygous mutation c.35delG was identified as the cause of hearing loss in six participants (12%). The mutation c.506G>A was identified in three affected individuals (6%). The allelic frequency (14%) and low percentage of individuals that were homozygous (2%) for the c.35delG mutation suggest that there are other genes responsible for nonsyndromic deafness in the UAE population. The results reported here are a preliminary step in collecting epidemiological data regarding autosomal recessive nonsyndromic hearing loss related to GJB2 gene mutations among the UAE population. The c.35delG mutation of the GJB2 gene is the most frequently seen causative mutation in the UAE and is followed by the p.Cys169Tyr mutation.

  10. Identical mutations of the p53 tumor suppressor gene in the gliomatous and the sarcomatous components of gliosarcomas suggest a common origin from glial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biernat, W.; Aguzzi, A.; Sure, U.

    Gliosarcomas are morphologically heterogeneous tumors of the central nervous system composed of gliomatous and sarcomatous components. The histogenesis of the latter is still a matter of debate. As mutations of the p53 tumor suppressor gene represent an early event in the development of gliomas, we attempted to determine whether both components of gliosarcomas share identical alterations of the p53 gene. Using single-strand conformation analysis (SSCA) and direct DNA sequencing of the p53 gene, we analyzed dissected gliomatous and sarcomatous parts of 12 formalin-fixed, paraffin-embedded gliosarcomas. The two tumors that contained a p53 alteration were found to carry the identical mutationmore » (exon 5; codon 151, CCC {r_arrow} TCC; codon 173, GTG {r_arrow} GTA) in the gliomatous and the sarcomatous components. These findings suggest a common origin of the two cellular components from neoplastic glial cells. 37 refs., 3 figs., 1 tab.« less

  11. A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

    PubMed

    Dhanasekar, P; Reddy, K S

    2015-02-01

    Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

  12. Merlin Isoforms 1 and 2 Both Act as Tumour Suppressors and Are Required for Optimal Sperm Maturation

    PubMed Central

    Zoch, Ansgar; Mayerl, Steffen; Schulz, Alexander; Greither, Thomas; Frappart, Lucien; Rübsam, Juliane; Heuer, Heike; Giovannini, Marco; Morrison, Helen

    2015-01-01

    The tumour suppressor Merlin, encoded by the gene NF2, is frequently mutated in the autosomal dominant disorder neurofibromatosis type II, characterised primarily by the development of schwannoma and other glial cell tumours. However, NF2 is expressed in virtually all analysed human and rodent organs, and its deletion in mice causes early embryonic lethality. Additionally, NF2 encodes for two major isoforms of Merlin of unknown functionality. Specifically, the tumour suppressor potential of isoform 2 remains controversial. In this study, we used Nf2 isoform-specific knockout mouse models to analyse the function of each isoform during development and organ homeostasis. We found that both isoforms carry full tumour suppressor functionality and can completely compensate the loss of the other isoform during development and in most adult organs. Surprisingly, we discovered that spermatogenesis is strictly dependent on the presence of both isoforms. While the testis primarily expresses isoform 1, we noticed an enrichment of isoform 2 in spermatogonial stem cells. Deletion of either isoform was found to cause decreased sperm quality as observed by maturation defects and head/midpiece abnormalities. These defects led to impaired sperm functionality as assessed by decreased sperm capacitation. Thus, we describe spermatogenesis as a new Nf2-dependent process. Additionally, we provide for the first time in vivo evidence for equal tumour suppressor potentials of Merlin isoform 1 and isoform 2. PMID:26258444

  13. Immunohistochemical detection of tumor suppressor gene p53 protein in feline injection site-associated sarcomas.

    PubMed

    Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M

    2001-03-01

    Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.

  14. Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. | Office of Cancer Genomics

    Cancer.gov

    Noncoding mutations in cancer genomes are frequent but challenging to interpret. PVT1 encodes an oncogenic lncRNA, but recurrent translocations and deletions in human cancers suggest alternative mechanisms. Here, we show that the PVT1 promoter has a tumor-suppressor function that is independent of PVT1 lncRNA. CRISPR interference of PVT1 promoter enhances breast cancer cell competition and growth in vivo.

  15. MITOSTATIN, a putative tumor suppressor on chromosome 12q24.1, is downregulated in human bladder and breast cancer.

    PubMed

    Vecchione, A; Fassan, M; Anesti, V; Morrione, A; Goldoni, S; Baldassarre, G; Byrne, D; D'Arca, D; Palazzo, J P; Lloyd, J; Scorrano, L; Gomella, L G; Iozzo, R V; Baffa, R

    2009-01-15

    Allelic deletions on human chromosome 12q24 are frequently reported in a variety of malignant neoplasms, indicating the presence of a tumor suppressor gene(s) in this chromosomal region. However, no reasonable candidate has been identified so far. In this study, we report the cloning and functional characterization of a novel mitochondrial protein with tumor suppressor activity, henceforth designated MITOSTATIN. Human MITOSTATIN was found within a 3.2-kb transcript, which encoded a approximately 62 kDa, ubiquitously expressed protein with little homology to any known protein. We found homozygous deletions and mutations of MITOSTATIN gene in approximately 5 and approximately 11% of various cancer-derived cells and solid tumors, respectively. When transiently overexpressed, MITOSTATIN inhibited colony formation, tumor cell growth and was proapoptotic, all features shared by established tumor suppressor genes. We discovered a specific link between MITOSTATIN overexpression and downregulation of Hsp27. Conversely, MITOSTATIN knockdown cells showed an increase in cell growth and cell survival rates. Finally, MITOSTATIN expression was significantly reduced in primary bladder and breast tumors, and its reduction was associated with advanced tumor stages. Our findings support the hypothesis that MITOSTATIN has many hallmarks of a classical tumor suppressor in solid tumors and may play an important role in cancer development and progression.

  16. Noise suppressor for turbo fan jet engines

    NASA Technical Reports Server (NTRS)

    Cheng, D. Y. (Inventor)

    1983-01-01

    A noise suppressor is disclosed for installation on the discharge or aft end of a turbo fan engine. Within the suppressor are fixed annular airfoils which are positioned to reduce the relative velocity between the high temperature fast moving jet exhaust and the low temperature slow moving air surrounding it. Within the suppressor nacelle is an exhaust jet nozzle which constrains the shape of the jet exhaust to a substantially uniform elongate shape irrespective of the power setting of the engine. Fixed ring airfoils within the suppressor nacelle therefore have the same salutary effects irrespective of the power setting at which the engine is operated.

  17. Novel compound heterozygous mutations in CNGA1in a Chinese family affected with autosomal recessive retinitis pigmentosa by targeted sequencing.

    PubMed

    Wang, Min; Gan, Dekang; Huang, Xin; Xu, Gezhi

    2016-07-08

    About 37 genes have been reported to be involved in autosomal recessive retinitis pigmentosa, a hereditary retinal disease. However, causative genes remain unclear in a lot of cases. Two sibs of a Chinese family with ocular disease were diagnosed in Eye and ENT Hospital of Fudan University. Targeted sequencing performed on proband to screen pathogenic mutations. PCR combined Sanger sequencing then performed on eight family members including two affected and six unaffected individuals to determine whether mutations cosegregate with disease. Two affected members exhibited clinical features that fit the criteria of autosomal recessive retinitis pigmentosa. Two heterozygous mutations (NM000087, p.Y82X and p.L89fs) in CNGA1 were revealed on proband. Affected members were compound heterozygotes for the two mutations whereas unaffected members either had no mutation or were heterozygote carriers for only one of the two mutations. That is, these mutations cosegregate with autosomal recessive retinitis pigmentosa. Compound heterozygous mutations (NM000087, p.Y82X and p.L89fs) in exon 6 of CNGA1are pathogenic mutations in this Chinese family. Of which, p.Y82X is firstly reported in patient with autosomal recessive retinitis pigmentosa.

  18. Discovery of Tumor Suppressor Gene Function.

    ERIC Educational Resources Information Center

    Oppenheimer, Steven B.

    1995-01-01

    This is an update of a 1991 review on tumor suppressor genes written at a time when understanding of how the genes work was limited. A recent major breakthrough in the understanding of the function of tumor suppressor genes is discussed. (LZ)

  19. An unusual characteristic "flower-like" pattern: flash suppressor burns.

    PubMed

    Gurcan, Altun

    2012-04-01

    The case on contact shots from firearms with a flash suppressor is rare. When a rifle fitted with a flash suppressor is fired, the emerging soot-laden gas in the barrel escapes from the slits of the flash suppressor. If the shot is contact or near contact, the flash suppressor will produce a characteristic "flower-like" pattern of seared, blackened zones around the entrance. This paper presents the injury pattern of the flash suppressor in a 29-year-old man who committed suicide with a G3 automatic infantry rifle.

  20. New mutations affecting induced mutagenesis in yeast.

    PubMed

    Lawrence, C W; Krauss, B R; Christensen, R B

    1985-01-01

    Previously isolated mutations in baker's yeast, Saccharomyces cerevisiae, that impair induced mutagenesis were all identified with the aid of tests that either exclusively or predominantly detect base-pair substitutions. To avoid this bias, we have screened 11 366 potentially mutant clones for UV-induced reversion of the frameshift allele, his4-38, and have identified 10 mutants that give much reduced yields of revertants. Complementation and recombination tests show that 6 of these carry mutations at the previously known REV1, REV1 and REV3 loci, while the remaining 4 define 3 new genes, REV4 (2 mutations), REV5 and REV6. The rev4 mutations are readily suppressed in many genetic backgrounds and, like the rev5 mutation, impart only a limited deficiency for induced mutagenesis: it is likely, therefore that the REV4+ and REV5+ gene functions are only remotely concerned with this process. The rev6 mutants have a more general deficiency, however, as well as marked sensitivity to UV and an increased spontaneous mutation rate, properties that suggest the REV6 gene is directly involved in mutation induction. The REV5 gene is located about 1 cM proximal to CYC1 on chromosome X.

  1. MEN4 and CDKN1B mutations: the latest of the MEN syndromes.

    PubMed

    Alrezk, Rami; Hannah-Shmouni, Fady; Stratakis, Constantine A

    2017-10-01

    Multiple endocrine neoplasia (MEN) refers to a group of autosomal dominant disorders with generally high penetrance that lead to the development of a wide spectrum of endocrine and non-endocrine manifestations. The most frequent among these conditions is MEN type 1 (MEN1), which is caused by germline heterozygous loss-of-function mutations in the tumor suppressor gene MEN1 MEN1 is characterized by primary hyperparathyroidism (PHPT) and functional or nonfunctional pancreatic neuroendocrine tumors and pituitary adenomas. Approximately 10% of patients with familial or sporadic MEN1-like phenotype do not have MEN1 mutations or deletions. A novel MEN syndrome was discovered, initially in rats (MENX), and later in humans (MEN4), which is caused by germline mutations in the putative tumor suppressor CDKN1B The most common phenotype of the 19 established cases of MEN4 that have been described to date is PHPT followed by pituitary adenomas. Recently, somatic or germline mutations in CDKN1B were also identified in patients with sporadic PHPT, small intestinal neuroendocrine tumors, lymphoma and breast cancer, demonstrating a novel role for CDKN1B as a tumor susceptibility gene for other neoplasms. In this review, we report on the genetic characterization and clinical features of MEN4. © 2017 Society for Endocrinology.

  2. ramR mutations affecting fluoroquinolone susceptibility in epidemic multidrug-resistant Salmonella enterica serovar Kentucky ST198

    PubMed Central

    Baucheron, Sylvie; Le Hello, Simon; Doublet, Benoît; Giraud, Etienne; Weill, François-Xavier; Cloeckaert, Axel

    2013-01-01

    A screening for non-target mutations affecting fluoroquinolone susceptibility was conducted in epidemic multidrug-resistant Salmonella enterica serovar Kentucky ST198. Among a panel of representative isolates (n = 27), covering the epidemic, only three showed distinct mutations in ramR resulting in enhanced expression of genes encoding the AcrAB-TolC efflux system and low increase in ciprofloxacin MIC. No mutations were detected in other regulatory regions of this efflux system. Ciprofloxacin resistance in serovar Kentucky ST198 is thus currently mainly due to multiple target gene mutations. PMID:23914184

  3. Selective Ablation of Tumor Suppressors in Parafollicular C Cells Elicits Medullary Thyroid Carcinoma.

    PubMed

    Song, Hai; Lin, Chuwen; Yao, Erica; Zhang, Kuan; Li, Xiaoling; Wu, Qingzhe; Chuang, Pao-Tien

    2017-03-03

    Among the four different types of thyroid cancer, treatment of medullary thyroid carcinoma poses a major challenge because of its propensity of early metastasis. To further investigate the molecular mechanisms of medullary thyroid carcinoma and discover candidates for targeted therapies, we developed a new mouse model of medullary thyroid carcinoma based on our CGRP CreER mouse line. This system enables gene manipulation in parafollicular C cells in the thyroid, the purported cells of origin of medullary thyroid carcinoma. Selective inactivation of tumor suppressors, such as p53 , Rb , and Pten , in mature parafollicular C cells via an inducible Cre recombinase from CGRP CreER led to development of murine medullary thyroid carcinoma. Loss of Pten accelerated p53 / Rb -induced medullary thyroid carcinoma, indicating interactions between pathways controlled by tumor suppressors. Moreover, labeling differentiated parafollicular C cells by CGRP CreER allows us to follow their fate during malignant transformation to medullary thyroid tumor. Our findings support a model in which mutational events in differentiated parafollicular C cells result in medullary thyroid carcinoma. Through expression analysis including RNA-Seq, we uncovered major signaling pathways and networks that are perturbed following the removal of tumor suppressors. Taken together, these studies not only increase our molecular understanding of medullary thyroid carcinoma but also offer new candidates for designing targeted therapies or other treatment modalities. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Insight into a novel p53 single point mutation (G389E) by Molecular Dynamics Simulations.

    PubMed

    Pirolli, Davide; Carelli Alinovi, Cristiana; Capoluongo, Ettore; Satta, Maria Antonia; Concolino, Paola; Giardina, Bruno; De Rosa, Maria Cristina

    2010-12-30

    The majority of inactivating mutations of p53 reside in the central core DNA binding domain of the protein. In this computational study, we investigated the structural effects of a novel p53 mutation (G389E), identified in a patient with congenital adrenal hyperplasia, which is located within the extreme C-terminal domain (CTD) of p53, an unstructured, flexible region (residues 367-393) of major importance for the regulation of the protein. Based on the three-dimensional structure of a carboxyl-terminal peptide of p53 in complex with the S100B protein, which is involved in regulation of the tumor suppressor activity, a model of wild type (WT) and mutant extreme CTD was developed by molecular modeling and molecular dynamics simulation. It was found that the G389E amino acid replacement has negligible effects on free p53 in solution whereas it significantly affects the interactions of p53 with the S100B protein. The results suggest that the observed mutation may interfere with p53 transcription activation and provide useful information for site-directed mutagenesis experiments.

  5. A germline missense mutation in COQ6 is associated with susceptibility to familial schwannomatosis

    PubMed Central

    Zhang, Keqiang; Lin, Jia-Wei; Wang, Jinhui; Wu, Xiwei; Gao, Hanlin; Hsieh, Yi-Chen; Hwu, Peter; Liu, Yun-Ru; Su, Leila; Chiou, Hung-Yi; Wang, Daidong; Yuan, Yate-Ching; Whang-Peng, Jacqueline; Chiu, Wen-Ta; Yen, Yun

    2014-01-01

    Purpose: Schwannomatosis, a subtype of neurofibromatosis, is characterized by multiple benign, nonvestibular, nonintradermal schwannomas. Although the tumor suppressor SMARCB1 gene has been frequently identified as the underlying genetic cause of half of familial and ~10% of sporadic schwannomatosis, for most other cases, further causative genes remain to be discovered. Herein, we characterize the genome of a schwannomatosis family without constitutional inactivation of the SMARCB1 gene to explore novel genomic alterations predisposing individuals to the familial disease. Methods: We performed whole-genome/exome sequencing on genomic DNA of both schwannomatosis-affected and normal members of the family. Results: We identified a novel missense mutation (p.Asp208His; c.622G>C) in the coenzyme Q10 (CoQ10) biosynthesis monooxygenase 6 gene (COQ6) in schwannomatosis-affected members. The deleterious effects of the COQ6 mutations were validated by their lack of complementation in a coq6-deficient yeast mutant. Our study further indicated that the resultant haploinsufficiency of COQ6 might lead to CoQ10 deficiency and chronic overproduction of reactive oxygen species in Schwann cells. Conclusion: Although the exact oncogenetic mechanisms in this schwannomatosis family remain to be elucidated, our data strongly indicate a probable role of COQ6 mutation and CoQ10 deficiency in the development of familial schwannomatosis. PMID:24763291

  6. A germline missense mutation in COQ6 is associated with susceptibility to familial schwannomatosis.

    PubMed

    Zhang, Keqiang; Lin, Jia-Wei; Wang, Jinhui; Wu, Xiwei; Gao, Hanlin; Hsieh, Yi-Chen; Hwu, Peter; Liu, Yun-Ru; Su, Leila; Chiou, Hung-Yi; Wang, Daidong; Yuan, Yate-Ching; Whang-Peng, Jacqueline; Chiu, Wen-Ta; Yen, Yun

    2014-10-01

    Schwannomatosis, a subtype of neurofibromatosis, is characterized by multiple benign, nonvestibular, nonintradermal schwannomas. Although the tumor suppressor SMARCB1 gene has been frequently identified as the underlying genetic cause of half of familial and ~10% of sporadic schwannomatosis, for most other cases, further causative genes remain to be discovered. Herein, we characterize the genome of a schwannomatosis family without constitutional inactivation of the SMARCB1 gene to explore novel genomic alterations predisposing individuals to the familial disease. We performed whole-genome/exome sequencing on genomic DNA of both schwannomatosis-affected and normal members of the family. We identified a novel missense mutation (p.Asp208His; c.622G>C) in the coenzyme Q10 (CoQ10) biosynthesis monooxygenase 6 gene (COQ6) in schwannomatosis-affected members. The deleterious effects of the COQ6 mutations were validated by their lack of complementation in a coq6-deficient yeast mutant. Our study further indicated that the resultant haploinsufficiency of COQ6 might lead to CoQ10 deficiency and chronic overproduction of reactive oxygen species in Schwann cells. Although the exact oncogenetic mechanisms in this schwannomatosis family remain to be elucidated, our data strongly indicate a probable role of COQ6 mutation and CoQ10 deficiency in the development of familial schwannomatosis.Genet Med 16 10, 787-792.

  7. A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

    PubMed Central

    Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

    2010-01-01

    A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

  8. A rare mutation in AgRP, +79G>A, affects promoter activity.

    PubMed

    Sözen, M A; de Jonge, L H M; Greenway, F; Ravussin, E; Smith, S R; Argyropoulos, G

    2007-06-01

    The agouti-related protein is a powerful orexigenic peptide. A rare mutation, +79G>A, was identified in its minimal promoter in two white carriers. Comparison of the 45-year-old male proband, who was also a carrier of the common Ala67Thr polymorphism, with an age- and weight-matching wild-type population showed marginal differences for resting metabolic rate (RMR) and body mass index. The second carrier however was an obese 57-year-old female with reduced RMR. Functional analysis in hypothalamus- and periphery-derived cell lines showed reduced promoter activity for the +79A allele in the adrenocortical cells only, suggesting that it could affect the peripheral expression levels of AgRP. The +79G>A mutation could predispose to body weight gain (as suggested by the phenotype of the second carrier), but it could only affect the proband at an older age as he may be protected by the Ala67Thr polymorphism that is associated with resistance to late-onset fatness.

  9. Mast cell-deficient Kit(W-sh) "Sash" mutant mice display aberrant myelopoiesis leading to the accumulation of splenocytes that act as myeloid-derived suppressor cells.

    PubMed

    Michel, Anastasija; Schüler, Andrea; Friedrich, Pamela; Döner, Fatma; Bopp, Tobias; Radsak, Markus; Hoffmann, Markus; Relle, Manfred; Distler, Ute; Kuharev, Jörg; Tenzer, Stefan; Feyerabend, Thorsten B; Rodewald, Hans-Reimer; Schild, Hansjörg; Schmitt, Edgar; Becker, Marc; Stassen, Michael

    2013-06-01

    Mast cell-deficient Kit(W-sh) "sash" mice are widely used to investigate mast cell functions. However, mutations of c-Kit also affect additional cells of hematopoietic and nonimmune origin. In this study, we demonstrate that Kit(W-sh) causes aberrant extramedullary myelopoiesis characterized by the expansion of immature lineage-negative cells, common myeloid progenitors, and granulocyte/macrophage progenitors in the spleen. A consistent feature shared by these cell types is the reduced expression of c-Kit. Populations expressing intermediate and high levels of Ly6G, a component of the myeloid differentiation Ag Gr-1, are also highly expanded in the spleen of sash mice. These cells are able to suppress T cell responses in vitro and phenotypically and functionally resemble myeloid-derived suppressor cells (MDSC). MDSC typically accumulate in tumor-bearing hosts and are able to dampen immune responses. Consequently, transfer of MDSC from naive sash mice into line 1 alveolar cell carcinoma tumor-bearing wild-type littermates leads to enhanced tumor progression. However, although it can also be observed in sash mice, accelerated growth of transplanted line 1 alveolar cell carcinoma tumors is a mast cell-independent phenomenon. Thus, the Kit(W-sh) mutation broadly affects key steps in myelopoiesis that may have an impact on mast cell research.

  10. BRCA1, TP53, and CHEK2 germline mutations in uterine serous carcinoma.

    PubMed

    Pennington, Kathryn P; Walsh, Tom; Lee, Ming; Pennil, Christopher; Novetsky, Akiva P; Agnew, Kathy J; Thornton, Anne; Garcia, Rochelle; Mutch, David; King, Mary-Claire; Goodfellow, Paul; Swisher, Elizabeth M

    2013-01-15

    Uterine serous carcinoma (USC) is not recognized as part of any defined hereditary cancer syndrome, and its association with hereditary breast and ovarian carcinoma and Lynch syndrome are uncertain. Using targeted capture and massively parallel genomic sequencing, 151 subjects with USC were assessed for germline mutations in 30 tumor suppressor genes, including BRCA1 (breast cancer 1, early onset), BRCA2, the DNA mismatch repair genes (MLH1 [mutL homolog 1], MSH2 [mutS homolog 2], MSH6, PMS2 [postmeiotic segregation increased 2]), TP53 (tumor protein p53), and 10 other genes in the Fanconi anemia-BRCA pathway. Ten cases with < 10% serous histology were also assessed. Seven subjects (4.6%) carried germline loss-of-function mutations: 3 subjects (2.0%) with mutations in BRCA1, 2 subjects (1.3%) with mutations in TP53, and 2 subjects (1.3%) with mutations in CHEK2 (checkpoint kinase 2). One subject with < 10% serous histology had an MSH6 mutation. Subjects with MSH6 and TP53 mutations had neither personal nor family histories suggestive of Lynch or Li-Fraumeni syndromes. Of the 22 women with USC and a personal history of breast carcinoma, the frequency of BRCA1 mutations was 9%, compared to 0.9% in 119 women with no such history. Approximately 5% of women with USC have germline mutations in 3 different tumor suppressor genes: BRCA1, CHEK2, and TP53. Mutations in DNA mismatch repair genes that cause Lynch syndrome are rare in USC. The germline BRCA1 mutation rate in USC subjects of 2% is higher than expected in a nonfounder population, suggesting that USC is associated with hereditary breast and ovarian carcinoma in a small proportion of cases. Women with USC and breast cancer should be offered genetic testing for BRCA1 and BRCA2 mutations. Copyright © 2012 American Cancer Society.

  11. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    PubMed

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  12. Modulator of Apoptosis 1 (MOAP-1) Is a Tumor Suppressor Protein Linked to the RASSF1A Protein*

    PubMed Central

    Law, Jennifer; Salla, Mohamed; Zare, Alaa; Wong, Yoke; Luong, Le; Volodko, Natalia; Svystun, Orysya; Flood, Kayla; Lim, Jonathan; Sung, Miranda; Dyck, Jason R. B.; Tan, Chong Teik; Su, Yu-Chin; Yu, Victor C.; Mackey, John; Baksh, Shairaz

    2015-01-01

    Modulator of apoptosis 1 (MOAP-1) is a BH3-like protein that plays key roles in cell death or apoptosis. It is an integral partner to the tumor suppressor protein, Ras association domain family 1A (RASSF1A), and functions to activate the Bcl-2 family pro-apoptotic protein Bax. Although RASSF1A is now considered a bona fide tumor suppressor protein, the role of MOAP-1 as a tumor suppressor protein has yet to be determined. In this study, we present several lines of evidence from cancer databases, immunoblotting of cancer cells, proliferation, and xenograft assays as well as DNA microarray analysis to demonstrate the role of MOAP-1 as a tumor suppressor protein. Frequent loss of MOAP-1 expression, in at least some cancers, appears to be attributed to mRNA down-regulation and the rapid proteasomal degradation of MOAP-1 that could be reversed utilizing the proteasome inhibitor MG132. Overexpression of MOAP-1 in several cancer cell lines resulted in reduced tumorigenesis and up-regulation of genes involved in cancer regulatory pathways that include apoptosis (p53, Fas, and MST1), DNA damage control (poly(ADP)-ribose polymerase and ataxia telangiectasia mutated), those within the cell metabolism (IR-α, IR-β, and AMP-activated protein kinase), and a stabilizing effect on microtubules. The loss of RASSF1A (an upstream regulator of MOAP-1) is one of the earliest detectable epigenetically silenced tumor suppressor proteins in cancer, and we speculate that the additional loss of function of MOAP-1 may be a second hit to functionally compromise the RASSF1A/MOAP-1 death receptor-dependent pathway and drive tumorigenesis. PMID:26269600

  13. BRCA1 and BRCA2 germline mutations in lymphoma patients.

    PubMed

    Yossepowitch, Orit; Olvera, Narciso; Satagopan, Jaya M; Huang, Helen; Jhanwar, Sabrina; Rapaport, Beth; Boyd, Jeff; Offit, Kenneth

    2003-01-01

    Mutations in the BRCA1 and BRCA2 tumor suppressor genes are associated with an increased risk for breast and ovarian cancers as well as other types of malignancies. The observation of a germline BRCA1 mutation in an index case with a lymphoid neoplasm in the setting of a family history of breast cancer prompted us to explore the role of BRCA germline mutations as lymphoma susceptibility alleles. A panel of 286 DNA samples from Jewish lymphoma patients was analyzed for the three most frequent BRCA1 and BRCA2 germline mutations in those of Ashkenazi Jewish heritage, and compared to a cohort of 5010 DNA samples from healthy controls. Of the 286 cases, 2 patients carried a germline BRCA mutation; both were diagnosed at an early age with an intermediate grade non-Hodgkin's lymphoma. This data indicate that germline BRCA mutations are not associated with an increased risk for lymphoid malignancies.

  14. Induction of suppressor cells in vitro by Candida albicans.

    PubMed

    Cuff, C F; Rogers, C M; Lamb, B J; Rogers, T J

    1986-06-01

    Normal splenocytes cultured with Formalin-killed Candida albicans were shown to acquire significant suppressor cell activity in a period of 3 days. These cells were found to suppress both the phytohemagglutinin-induced mitogen response as well as the anti-sheep erythrocyte antibody response. Experiments were carried out to determine the nature of the suppressor cell population. Results showed that these cells were not susceptible to treatment with anti-Thy 1 antibody and complement. Panning experiments showed that the suppressor cells were not plastic-adherent or Mac-1 antigen-positive. The suppressor cells were, however, adherent to anti-mouse immunoglobulin (F(ab')2-fragment)-coated dishes. Additional experiments showed that the suppressor cell activity was susceptible to treatment with monoclonal anti-Lyb 2.1 antibody and complement. These results suggest that the suppressor cell induced in vitro by Candida is a member of the B-lymphocyte lineage.

  15. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    PubMed

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  16. F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

    PubMed Central

    Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

    2006-01-01

    Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

  17. P-TEN, the tumor suppressor from human chromosome 10q23, is a dual-specificity phosphatase

    PubMed Central

    Myers, Michael P.; Stolarov, Javor P.; Eng, Charis; Li, Jing; Wang, Steven I.; Wigler, Michael H.; Parsons, Ramon; Tonks, Nicholas K.

    1997-01-01

    Protein tyrosine phosphatases (PTPs) have long been thought to play a role in tumor suppression due to their ability to antagonize the growth promoting protein tyrosine kinases. Recently, a candidate tumor suppressor from 10q23, termed P-TEN, was isolated, and sequence homology was demonstrated with members of the PTP family, as well as the cytoskeletal protein tensin. Here we show that recombinant P-TEN dephosphorylated protein and peptide substrates phosphorylated on serine, threonine, and tyrosine residues, indicating that P-TEN is a dual-specificity phosphatase. In addition, P-TEN exhibited a high degree of substrate specificity, showing selectivity for extremely acidic substrates in vitro. Furthermore, we demonstrate that mutations in P-TEN, identified from primary tumors, tumor cells lines, and a patient with Bannayan–Zonana syndrome, resulted in the ablation of phosphatase activity, demonstrating that enzymatic activity of P-TEN is necessary for its ability to function as a tumor suppressor. PMID:9256433

  18. GENETIC MUTATIONS AFFECTING THE FIRST LINE ERADICATION THERAPY OF Helicobacter pylori-INFECTED EGYPTIAN PATIENTS.

    PubMed

    Ramzy, Iman; Elgarem, Hassan; Hamza, Iman; Ghaith, Doaa; Elbaz, Tamer; Elhosary, Waleed; Mostafa, Gehan; Elzahry, Mohammad A Mohey Eldin

    2016-12-08

    Several genetic mutations affect the first-line triple therapy for Helicobacter pylori. We aimed to study the most common genetic mutations affecting the metronidazole and clarithromycin therapy for H. pylori-infected Egyptian patients. In our study, we included 100 successive dyspeptic patients scheduled for diagnosis through upper gastroscopy at Cairo's University Hospital, Egypt. Gastric biopsies were tested for the presence of H. pylori by detection of the 16S rRNA gene. Positive biopsies were further studied for the presence of the rdxA gene deletion by Polymerase Chain Reaction (PCR), while clarithromycin resistance was investigated by the presence of nucleotide substitutions within H. pylori 23S rRNA V domain using MboII and BsaI to carry out a Restricted Fragment Length Polymorphism (RFLP) assay. Among 70 H. pylori positive biopsies, the rdxA gene deletion was detected in 44/70 (62.9%) samples, while predominance of the A2142G mutations within the H. pylori 23S rRNA V domain was evidenced in 39/70 (55.7%) of the positive H. pylori cases. No statistically significant difference was found between the presence of gene mutations and different factors such as patients 'age, gender, geographic distribution, symptoms and endoscopic findings. Infection with mutated H. pylori strains is considerably high, a finding that imposes care in the use of the triple therapy to treat H. pylori in Egypt, since the guidelines recommend to abandon the standard triple therapy when the primary clarithromycin resistance rate is over 20%1.

  19. Off and back-on again: a tumor suppressor's tale.

    PubMed

    Acosta, Jonuelle; Wang, Walter; Feldser, David M

    2018-06-01

    Tumor suppressor genes play critical roles orchestrating anti-cancer programs that are both context dependent and mechanistically diverse. Beyond canonical tumor suppressive programs that control cell division, cell death, and genome stability, unexpected tumor suppressor gene activities that regulate metabolism, immune surveillance, the epigenetic landscape, and others have recently emerged. This diversity underscores the important roles these genes play in maintaining cellular homeostasis to suppress cancer initiation and progression, but also highlights a tremendous challenge in discerning precise context-specific programs of tumor suppression controlled by a given tumor suppressor. Fortunately, the rapid sophistication of genetically engineered mouse models of cancer has begun to shed light on these context-dependent tumor suppressor activities. By using techniques that not only toggle "off" tumor suppressor genes in nascent tumors, but also facilitate the timely restoration of gene function "back-on again" in disease specific contexts, precise mechanisms of tumor suppression can be revealed in an unbiased manner. This review discusses the development and implementation of genetic systems designed to toggle tumor suppressor genes off and back-on again and their potential to uncover the tumor suppressor's tale.

  20. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    PubMed

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  1. An unusual characteristic “flower-like” pattern: flash suppressor burns

    PubMed Central

    Gurcan, Altun

    2012-01-01

    The case on contact shots from firearms with a flash suppressor is rare. When a rifle fitted with a flash suppressor is fired, the emerging soot-laden gas in the barrel escapes from the slits of the flash suppressor. If the shot is contact or near contact, the flash suppressor will produce a characteristic “flower-like” pattern of seared, blackened zones around the entrance. This paper presents the injury pattern of the flash suppressor in a 29-year-old man who committed suicide with a G3 automatic infantry rifle. PMID:23935280

  2. Exclusion of a major role for the PTEN tumour-suppressor gene in breast carcinomas

    PubMed Central

    Freihoff, D; Kempe, A; Beste, B; Wappenschmidt, B; Kreyer, E; Hayashi, Y; Meindl, A; Krebs, D; Wiestler, O D; Deimling, A von; Schmutzler, R K

    1999-01-01

    PTEN is a novel tumour-suppressor gene located on chromosomal band 10q23.3. This region displays frequent loss of heterozygosity (LOH) in a variety of human neoplasms including breast carcinomas. The detection of PTEN mutations in Cowden disease and in breast carcinoma cell lines suggests that PTEN may be involved in mammary carcinogenesis. We here report a mutational analysis of tumour specimens from 103 primary breast carcinomas and constitutive DNA from 25 breast cancer families. The entire coding region of PTEN was screened by single-strand conformation polymorphism (SSCP) analysis and direct sequencing using intron-based primers. No germline mutations could be identified in the breast cancer families and only one sporadic carcinoma carried a PTEN mutation at one allele. In addition, all sporadic tumours were analysed for homozygous deletions by differential polymerase chain reaction (PCR) and for allelic loss using the microsatellite markers D10S215, D10S564 and D10S573. No homozygous deletions were detected and only 10 out of 94 informative tumours showed allelic loss in the PTEN region. These results suggest that PTEN does not play a major role in breast cancer formation. 1999 Cancer Research Campaign PMID:10070865

  3. Joint analysis of quantitative trait loci and major-effect causative mutations affecting meat quality and carcass composition traits in pigs.

    PubMed

    Cherel, Pierre; Pires, José; Glénisson, Jérôme; Milan, Denis; Iannuccelli, Nathalie; Hérault, Frédéric; Damon, Marie; Le Roy, Pascale

    2011-08-29

    Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08), with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the influence of major-effect mutations on the least affected

  4. Joint analysis of quantitative trait loci and major-effect causative mutations affecting meat quality and carcass composition traits in pigs

    PubMed Central

    2011-01-01

    Background Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08), with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Results Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Conclusions Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the influence of major

  5. Expression of SMARCB1 (INI1) mutations in familial schwannomatosis

    PubMed Central

    Smith, Miriam J.; Walker, James A.; Shen, Yiping; Stemmer-Rachamimov, Anat; Gusella, James F.; Plotkin, Scott R.

    2012-01-01

    Genetic changes in the SMARCB1 tumor suppressor gene have recently been reported in tumors and blood from families with schwannomatosis. Exon scanning of all nine SMARCB1 exons in genomic DNA from our cohort of families meeting the criteria for ‘definite’ or ‘presumptive’ schwannomatosis previously revealed constitutional alterations in 13 of 19 families (68%). Screening of four new familial schwannomatosis probands identified one additional constitutional alteration. We confirmed the presence of mRNA transcripts for two missense alterations, four mutations of conserved splice motifs and two additional mutations, in less conserved sequences, which also affect splicing. Furthermore, we found that transcripts for a rare 3′-untranslated region (c.*82C > T) alteration shared by four unrelated families did not produce splice variants but did show unequal allelic expression, suggesting that the alteration is either causative itself or linked to an unidentified causative mutation. Overexpression studies in cells lacking SMARCB1 suggest that mutant SMARCB1 proteins, like wild-type SMARCB1 protein, retain the ability to suppress cyclin D1 activity. These data, together with the expression of SMARCB1 protein in a proportion of cells from schwannomatosis-related schwannomas, suggest that these tumors develop through a mechanism that is distinct from that of rhabdoid tumors in which SMARCB1 protein is completely absent in tumor cells. PMID:22949514

  6. Expression of SMARCB1 (INI1) mutations in familial schwannomatosis.

    PubMed

    Smith, Miriam J; Walker, James A; Shen, Yiping; Stemmer-Rachamimov, Anat; Gusella, James F; Plotkin, Scott R

    2012-12-15

    Genetic changes in the SMARCB1 tumor suppressor gene have recently been reported in tumors and blood from families with schwannomatosis. Exon scanning of all nine SMARCB1 exons in genomic DNA from our cohort of families meeting the criteria for 'definite' or 'presumptive' schwannomatosis previously revealed constitutional alterations in 13 of 19 families (68%). Screening of four new familial schwannomatosis probands identified one additional constitutional alteration. We confirmed the presence of mRNA transcripts for two missense alterations, four mutations of conserved splice motifs and two additional mutations, in less conserved sequences, which also affect splicing. Furthermore, we found that transcripts for a rare 3'-untranslated region (c.*82C > T) alteration shared by four unrelated families did not produce splice variants but did show unequal allelic expression, suggesting that the alteration is either causative itself or linked to an unidentified causative mutation. Overexpression studies in cells lacking SMARCB1 suggest that mutant SMARCB1 proteins, like wild-type SMARCB1 protein, retain the ability to suppress cyclin D1 activity. These data, together with the expression of SMARCB1 protein in a proportion of cells from schwannomatosis-related schwannomas, suggest that these tumors develop through a mechanism that is distinct from that of rhabdoid tumors in which SMARCB1 protein is completely absent in tumor cells.

  7. Genome-wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma.

    PubMed

    Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J; Almutairi, Bader; Etchevers, Heather C; McConville, Carmel; Malik, Karim T A; Brown, Keith W

    2017-04-01

    Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome-wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome-wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down-regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest-expressing tumors had reduced relapse-free survival. Our functional studies showed that knock-down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc.

  8. Genome‐wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma

    PubMed Central

    Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.

    2016-01-01

    Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318

  9. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC

    PubMed Central

    Kenesi, Erzsébet; Lózsa, Rita

    2017-01-01

    Abstract In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. PMID:28499009

  10. Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome

    PubMed Central

    Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

    2014-01-01

    Germline mutations are responsible for familial cancer syndromes which account for approximately 5–10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22 years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. PMID:23981578

  11. Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

    PubMed

    Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

    2001-01-01

    The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or

  12. Identification of novel mutations of the CHST6 gene in Vietnamese families affected with macular corneal dystrophy in two generations.

    PubMed

    Ha, Nguyen Thanh; Chau, Hoang Minh; Cung, Le Xuan; Thanh, Ton Kim; Fujiki, Keiko; Murakami, Akira; Hiratsuka, Yoshimune; Hasegawa, Nobuko; Kanai, Atsushi

    2003-08-01

    To report the clinical and genetic findings of Vietnamese families affected with macular corneal dystrophy (MCD) in 2 generations. Two families, including 7 patients and 3 unaffected members, were examined clinically. Blood samples were collected. Fifty normal Vietnamese individuals were used as controls. Genomic DNA was extracted from leukocytes. Analysis of the carbohydrate sulfotransferase (CHST6) gene was performed using polymerase chain reaction and direct sequencing. The typical form of MCD was recognized in family B, in which sequencing of CHST6 gene revealed an nt 1067-1068ins(GGCCGTG) mutation (frameshift after 125V) homozygously in MCD patients and heterozygously in the unaffected members. Family N also showed clinical features of MCD, moderate in the mother but severe in the affected son. Sequencing revealed a single heterozygous Arg211Gln in the mother, compound heterozygous Arg211Gln+ Gln82Stop in the affected son, and heterozygous Arg211Gln mutation in the unaffected members. The identified mutations in these pedigrees were excluded from normal controls. The novel frameshift and compound heterozygous mutations might be responsible for MCD in the families studied. The phenotypic variation between affected parents and offspring was unclear. In family N, severe MCD phenotype seen in the affected son may be due the fact that he had an early stop codon mutation (Gln82Stop).

  13. Frequency of SMARCB1 mutations in familial and sporadic schwannomatosis.

    PubMed

    Smith, Miriam J; Wallace, Andrew J; Bowers, Naomi L; Rustad, Cecilie F; Woods, C Geoff; Leschziner, Guy D; Ferner, Rosalie E; Evans, D Gareth R

    2012-05-01

    Mutations of the SMARCB1 gene have been implicated in several human tumour predisposing syndromes. They have recently been identified as an underlying cause of the tumour suppressor syndrome schwannomatosis. There is a much higher rate of mutation detection in familial disease than in sporadic disease. We have carried out extensive genetic testing on a cohort of familial and sporadic patients who fulfilled clinical diagnostic criteria for schwannomatosis. In our current cohort, we identified novel mutations within the SMARCB1 gene and detected several mutations that have been previously identified in other schwannomatosis cohorts. Of the schwannomatosis screens reported to date, including our current dataset, SMARCB1 mutations have been found in 45 % of familial probands and 7 % of sporadic patients. The exon 1 mutation, c.41C >A, and the 3' untranslated region mutation, c.*82C >T, are the most common changes reported in schwannomatosis disease so far, indicating mutation hotspots at both 5' and 3' portions of the gene. SMARCB1 mutations are found in a significant proportion of schwannomatosis patients, but there remains the possibility that further causative genes remain to be found.

  14. A comprehensive functional analysis of PTEN mutations: implications in tumor- and autism-related syndromes.

    PubMed

    Rodríguez-Escudero, Isabel; Oliver, María D; Andrés-Pons, Amparo; Molina, María; Cid, Víctor J; Pulido, Rafael

    2011-11-01

    The PTEN (phosphatase and tensin homolog) phosphatase is unique in mammals in terms of its tumor suppressor activity, exerted by dephosphorylation of the lipid second messenger PIP(3) (phosphatidylinositol 3,4,5-trisphosphate), which activates the phosphoinositide 3-kinase/Akt/mTOR (mammalian target of rapamycin) oncogenic pathway. Loss-of-function mutations in the PTEN gene are frequent in human cancer and in the germline of patients with PTEN hamartoma tumor-related syndromes (PHTSs). In addition, PTEN is mutated in patients with autism spectrum disorders (ASDs), although no functional information on these mutations is available. Here, we report a comprehensive in vivo functional analysis of human PTEN using a heterologous yeast reconstitution system. Ala-scanning mutagenesis at the catalytic loops of PTEN outlined the critical role of residues within the P-catalytic loop for PIP(3) phosphatase activity in vivo. PTEN mutations that mimic the P-catalytic loop of mammalian PTEN-like proteins (TPTE, TPIP, tensins and auxilins) affected PTEN function variably, whereas tumor- or PHTS-associated mutations targeting the PTEN P-loop produced complete loss of function. Conversely, Ala-substitutions, as well as tumor-related mutations at the WPD- and TI-catalytic loops, displayed partial activity in many cases. Interestingly, a tumor-related D92N mutation was partially active, supporting the notion that the PTEN Asp92 residue might not function as the catalytic general acid. The analysis of a panel of ASD-associated hereditary PTEN mutations revealed that most of them did not substantially abrogate PTEN activity in vivo, whereas most of PHTS-associated mutations did. Our findings reveal distinctive functional patterns among PTEN mutations found in tumors and in the germline of PHTS and ASD patients, which could be relevant for therapy.

  15. Mutations Affecting the SAND Domain of DEAF1 Cause Intellectual Disability with Severe Speech Impairment and Behavioral Problems

    PubMed Central

    Vulto-van Silfhout, Anneke T.; Rajamanickam, Shivakumar; Jensik, Philip J.; Vergult, Sarah; de Rocker, Nina; Newhall, Kathryn J.; Raghavan, Ramya; Reardon, Sara N.; Jarrett, Kelsey; McIntyre, Tara; Bulinski, Joseph; Ownby, Stacy L.; Huggenvik, Jodi I.; McKnight, G. Stanley; Rose, Gregory M.; Cai, Xiang; Willaert, Andy; Zweier, Christiane; Endele, Sabine; de Ligt, Joep; van Bon, Bregje W.M.; Lugtenberg, Dorien; de Vries, Petra F.; Veltman, Joris A.; van Bokhoven, Hans; Brunner, Han G.; Rauch, Anita; de Brouwer, Arjan P.M.; Carvill, Gemma L.; Hoischen, Alexander; Mefford, Heather C.; Eichler, Evan E.; Vissers, Lisenka E.L.M.; Menten, Björn; Collard, Michael W.; de Vries, Bert B.A.

    2014-01-01

    Recently, we identified in two individuals with intellectual disability (ID) different de novo mutations in DEAF1, which encodes a transcription factor with an important role in embryonic development. To ascertain whether these mutations in DEAF1 are causative for the ID phenotype, we performed targeted resequencing of DEAF1 in an additional cohort of over 2,300 individuals with unexplained ID and identified two additional individuals with de novo mutations in this gene. All four individuals had severe ID with severely affected speech development, and three showed severe behavioral problems. DEAF1 is highly expressed in the CNS, especially during early embryonic development. All four mutations were missense mutations affecting the SAND domain of DEAF1. Altered DEAF1 harboring any of the four amino acid changes showed impaired transcriptional regulation of the DEAF1 promoter. Moreover, behavioral studies in mice with a conditional knockout of Deaf1 in the brain showed memory deficits and increased anxiety-like behavior. Our results demonstrate that mutations in DEAF1 cause ID and behavioral problems, most likely as a result of impaired transcriptional regulation by DEAF1. PMID:24726472

  16. Identification of a novel FAM83H mutation and microhardness of an affected molar in autosomal dominant hypocalcified amelogenesis imperfecta.

    PubMed

    Hyun, H-K; Lee, S-K; Lee, K-E; Kang, H-Y; Kim, E-J; Choung, P-H; Kim, J-W

    2009-11-01

    To determine the underlying molecular genetic aetiology of a family with the hypocalcified form of amelogenesis imperfecta and to investigate the hardness of the enamel and dentine of a known FAM83H mutation. Mutational screening of the FAM83H on the basis of candidate gene approach was performed. All exons and exon-intron boundaries was amplified and sequenced. A microhardness test was performed to measure the Vickers microhardness value. A novel nonsense mutation (c.1354C>T, p.Q452X) was identified in the last exon of FAM83H, which resulted in soft, uncalcified enamel. The affected enamel was extremely soft (about 17% of the normal control), but the underlying dentine was as hard as the normal control. Mutational analysis revealed a novel mutation in FAM83H gene. Hardness of dentine was not affected by the mutation, whilst the enamel was extremely soft.

  17. Isolation and Genetic Characterization of a Mutation Affecting Ribosomal Resistance to Cycloheximide in Tetrahymena

    PubMed Central

    Ares, Manuel; Bruns, Peter J.

    1978-01-01

    A dominant mutation at a new locus affecting resistance to cycloheximide has been isolated by exploiting a synergistic relationship with a previously known mutation for cycloheximide resistance in Tetrahymena. The new mutation (ChxB) was induced in a line homozygous for ChxA and was recovered from that background by a new technique termed interrupted genomic exclusion. Segregation data from the interrupted genomic exclusion suggest that ChxA and ChxB are separate, linked loci showing 30% recombination. Minimal lethal doses of cycloheximide for the four possible combinations of the wild-type and mutant alleles of these two genes are: wild type 6 µg/ml, ChxA 125 µg/ml, ChxB 10 µg/ml, ChxA-ChxB 175 µg/ml. PMID:730051

  18. Mutational Analysis of Influenza A Virus Nucleoprotein: Identification of Mutations That Affect RNA Replication

    PubMed Central

    Mena, Ignacio; Jambrina, Enrique; Albo, Carmen; Perales, Beatriz; Ortín, Juan; Arrese, Marta; Vallejo, Dolores; Portela, Agustín

    1999-01-01

    The influenza A virus nucleoprotein (NP) is a multifunctional polypeptide which plays a pivotal role in virus replication. To get information on the domains and specific residues involved in the different NP activities, we describe here the preparation and characterization of 20 influenza A virus mutant NPs. The mutations, mostly single-amino-acid substitutions, were introduced in a cDNA copy of the A/Victoria/3/75 NP gene and, in most cases, affected residues located in regions that were highly conserved across the NPs of influenza A, B, and C viruses. The mutant NPs were characterized (i) in vivo (cell culture) by analyzing their intracellular localization and their functionality in replication, transcription, and expression of model RNA templates; and (ii) in vitro by analyzing their RNA-binding and sedimentation properties. The results obtained allowed us to identify both a mutant protein that accumulated in the cytoplasm and mutations that altered the functionality and/or the oligomerization state of the NP polypeptide. Among the mutations that reduced the NP capability to express chloramphenicol acetyltransferase protein from a model viral RNA (vRNA) template, some displayed a temperature-sensitive phenotype. Interestingly, four mutant NPs, which showed a reduced functionality in synthesizing cRNA molecules from a vRNA template, were fully competent to reconstitute complementary ribonucleoproteins (cRNPs) capable of synthesizing vRNAs, which in turn yielded mRNA molecules. Based on the phenotype of these mutants and on previously published observations, it is proposed that these mutant NPs have a reduced capability to interact with the polymerase complex and that this NP-polymerase interaction is responsible for making vRNPs switch from mRNA to cRNA synthesis. PMID:9882320

  19. Treacher Collins syndrome: clinical implications for the paediatrician--a new mutation in a severely affected newborn and comparison with three further patients with the same mutation, and review of the literature.

    PubMed

    Schlump, Jan-Ulrich; Stein, Anja; Hehr, Ute; Karen, Tanja; Möller-Hartmann, Claudia; Elcioglu, Nursel H; Bogdanova, Nadja; Woike, Hartmut Fritz; Lohmann, Dietmar R; Felderhoff-Mueser, Ursula; Linz, Annette; Wieczorek, Dagmar

    2012-11-01

    Treacher Collins syndrome (TCS) is the most common and well-known mandibulofacial dysostosis caused by mutations in at least three genes involved in pre-rRNA transcription, the TCOF1, POLR1D and POLR1C genes. We present a severely affected male individual with TCS with a heterozygous de novo frameshift mutation within the TCOF1 gene (c.790_791delAG,p.Ser264GlnfsX7) and compare the clinical findings with three previously unpublished, milder affected individuals from two families with the same mutation. We elucidate typical clinical features of TCS and its clinical implications for the paediatrician and mandibulofacial surgeon, especially in severely affected individuals and give a short review of the literature. The clinical data of these three families illustrate that the phenotype associated with this specific mutation has a wide intra- and interfamilial variability, which confirms that variable expressivity in carriers of TCOF1 mutations is not a simple consequence of the mutation but might be modified by the combination of genetic, environmental and stochastic factors. Being such a highly complex disease treatment of individuals with TCS should be tailored to the specific needs of each individual, preferably by a multidisciplinary team consisting of paediatricians, craniofacial surgeons and geneticists.

  20. Whole-exome sequencing of primary plasma cell leukemia discloses heterogeneous mutational patterns.

    PubMed

    Cifola, Ingrid; Lionetti, Marta; Pinatel, Eva; Todoerti, Katia; Mangano, Eleonora; Pietrelli, Alessandro; Fabris, Sonia; Mosca, Laura; Simeon, Vittorio; Petrucci, Maria Teresa; Morabito, Fortunato; Offidani, Massimo; Di Raimondo, Francesco; Falcone, Antonietta; Caravita, Tommaso; Battaglia, Cristina; De Bellis, Gianluca; Palumbo, Antonio; Musto, Pellegrino; Neri, Antonino

    2015-07-10

    Primary plasma cell leukemia (pPCL) is a rare and aggressive form of plasma cell dyscrasia and may represent a valid model for high-risk multiple myeloma (MM). To provide novel information concerning the mutational profile of this disease, we performed the whole-exome sequencing of a prospective series of 12 pPCL cases included in a Phase II multicenter clinical trial and previously characterized at clinical and molecular levels. We identified 1, 928 coding somatic non-silent variants on 1, 643 genes, with a mean of 166 variants per sample, and only few variants and genes recurrent in two or more samples. An excess of C > T transitions and the presence of two main mutational signatures (related to APOBEC over-activity and aging) occurring in different translocation groups were observed. We identified 14 candidate cancer driver genes, mainly involved in cell-matrix adhesion, cell cycle, genome stability, RNA metabolism and protein folding. Furthermore, integration of mutation data with copy number alteration profiles evidenced biallelically disrupted genes with potential tumor suppressor functions. Globally, cadherin/Wnt signaling, extracellular matrix and cell cycle checkpoint resulted the most affected functional pathways. Sequencing results were finally combined with gene expression data to better elucidate the biological relevance of mutated genes. This study represents the first whole-exome sequencing screen of pPCL and evidenced a remarkable genetic heterogeneity of mutational patterns. This may provide a contribution to the comprehension of the pathogenetic mechanisms associated with this aggressive form of PC dyscrasia and potentially with high-risk MM.

  1. Two Replicable Suppressor Situations in Personality Research

    ERIC Educational Resources Information Center

    Paulhus, Delroy L.; Robins, Richard W.; Trzesniewski, Kali H.; Tracy, Jessica L.

    2004-01-01

    Suppressor situations occur when the simultaneous inclusion of two predictors improves one or both validities. A common allegation is that suppressor effects rarely replicate and have little substantive import. We present substantive examples from two established research domains to counter this skepticism. In the first domain, we show how…

  2. Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function.

    PubMed

    Drummond, I A; Majumdar, A; Hentschel, H; Elger, M; Solnica-Krezel, L; Schier, A F; Neuhauss, S C; Stemple, D L; Zwartkruis, F; Rangini, Z; Driever, W; Fishman, M C

    1998-12-01

    The zebrafish pronephric kidney provides a simplified model of nephron development and epithelial cell differentiation which is amenable to genetic analysis. The pronephros consists of two nephrons with fused glomeruli and paired pronephric tubules and ducts. Nephron formation occurs after the differentiation of the pronephric duct with both the glomeruli and tubules being derived from a nephron primordium. Fluorescent dextran injection experiments demonstrate that vascularization of the zebrafish pronephros and the onset of glomerular filtration occurs between 40 and 48 hpf. We isolated fifteen recessive mutations that affect development of the pronephros. All have visible cysts in place of the pronephric tubule at 2-2.5 days of development. Mutants were grouped in three classes: (1) a group of twelve mutants with defects in body axis curvature and manifesting the most rapid and severe cyst formation involving the glomerulus, tubule and duct, (2) the fleer mutation with distended glomerular capillary loops and cystic tubules, and (3) the mutation pao pao tang with a normal glomerulus and cysts limited to the pronephric tubules. double bubble was analyzed as a representative of mutations that perturb the entire length of the pronephros and body axis curvature. Cyst formation begins in the glomerulus at 40 hpf at the time when glomerular filtration is established suggesting a defect associated with the onset of pronephric function. Basolateral membrane protein targeting in the pronephric duct epithelial cells is also severely affected, suggesting a failure in terminal epithelial cell differentiation and alterations in electrolyte transport. These studies reveal the similarity of normal pronephric development to kidney organogenesis in all vertebrates and allow for a genetic dissection of genes needed to establish the earliest renal function.

  3. Measurand transient signal suppressor

    NASA Technical Reports Server (NTRS)

    Bozeman, Richard J., Jr. (Inventor)

    1994-01-01

    A transient signal suppressor for use in a controls system which is adapted to respond to a change in a physical parameter whenever it crosses a predetermined threshold value in a selected direction of increasing or decreasing values with respect to the threshold value and is sustained for a selected discrete time interval is presented. The suppressor includes a sensor transducer for sensing the physical parameter and generating an electrical input signal whenever the sensed physical parameter crosses the threshold level in the selected direction. A manually operated switch is provided for adapting the suppressor to produce an output drive signal whenever the physical parameter crosses the threshold value in the selected direction of increasing or decreasing values. A time delay circuit is selectively adjustable for suppressing the transducer input signal for a preselected one of a plurality of available discrete suppression time and producing an output signal only if the input signal is sustained for a time greater than the selected suppression time. An electronic gate is coupled to receive the transducer input signal and the timer output signal and produce an output drive signal for energizing a control relay whenever the transducer input is a non-transient signal which is sustained beyond the selected time interval.

  4. Suppressor Effects of Coping Strategies on Resilience

    ERIC Educational Resources Information Center

    Yoon, Jae ho; Lee, Ji hae; Lee, Chae Yeon; Cho, Minhee; Lee, Sang Min

    2014-01-01

    The purpose of the current study is to demonstrate a significant suppressor effect among coping strategies on resilience. Two different samples were used to replicate the suppressor effect. Participants in the first example were 391 adolescents (middle school students) in Korea, and participants in the second example were 282 young adults…

  5. Mutations in the C-terminal fragment of DnaK affecting peptide binding.

    PubMed Central

    Burkholder, W F; Zhao, X; Zhu, X; Hendrickson, W A; Gragerov, A; Gottesman, M E

    1996-01-01

    Escherichia coli DnaK acts as a molecular chaperone through its ATP-regulated binding and release of polypeptide substrates. Overexpressing a C-terminal fragment (CTF) of DnaK (Gly-384 to Lys-638) containing the polypeptide substrate binding domain is lethal in wild-type E. coli. This dominant-negative phenotype may result from the nonproductive binding of CTF to cellular polypeptide targets of DnaK. Mutations affecting DnaK substrate binding were identified by selecting noncytotoxic CTF mutants followed by in vitro screening. The clustering of such mutations in the three-dimensional structure of CTF suggests the model that loops L1,2 and L4,5 form a rigid core structure critical for interactions with substrate. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855230

  6. Rich Medium Composition Affects Escherichia coli Survival, Glycation, and Mutation Frequency during Long-Term Batch Culture.

    PubMed

    Kram, Karin E; Finkel, Steven E

    2015-07-01

    Bacteria such as Escherichia coli are frequently grown to high density to produce biomolecules for study in the laboratory. To achieve this, cells can be incubated in extremely rich media that increase overall cell yield. In these various media, bacteria may have different metabolic profiles, leading to changes in the amounts of toxic metabolites produced. We have previously shown that stresses experienced during short-term growth can affect the survival of cells during the long-term stationary phase (LTSP). Here, we incubated cells in LB, 2× yeast extract-tryptone (YT), Terrific Broth, or Super Broth medium and monitored survival during the LTSP, as well as other reporters of genetic and physiological change. We observe differential cell yield and survival in all media studied. We propose that differences in long-term survival are the result of changes in the metabolism of components of the media that may lead to increased levels of protein and/or DNA damage. We also show that culture pH and levels of protein glycation, a covalent modification that causes protein damage, affect long-term survival. Further, we measured mutation frequency after overnight incubation and observed a correlation between high mutation frequencies at the end of the log phase and loss of viability after 4 days of LTSP incubation, indicating that mutation frequency is potentially predictive of long-term survival. Since glycation and mutation can be caused by oxidative stress, we measured expression of the oxyR oxidative stress regulator during log-phase growth and found that higher levels of oxyR expression during the log phase are consistent with high mutation frequency and lower cell density during the LTSP. Since these complex rich media are often used when producing large quantities of biomolecules in the laboratory, the observed increase in damage resulting in glycation or mutation may lead to production of a heterogeneous population of plasmids or proteins, which could affect the

  7. Development of Yeast as an In Vivo Test Tube to Characterize a Broad Spectrum of p53 Mutations Associated with Breast Cancer

    DTIC Science & Technology

    2002-10-01

    there is a mutation in the p53 gene itself (4, 5). Interestingly, -80% of p53 mutations are missense changes that lead to single amino acid...substitutions, a feature that distinguishes p53 from other tumor suppressor genes (e.g., APC, NF1, BRCAJ) (6). The incidence of p53 mutations and the types of...intronic promoter is contained within the human mutation hotspot maps of p53: correlation with p53 protein structural and mdm2 gene . Nucleic Acids Res

  8. Tumor suppressor C-RASSF proteins.

    PubMed

    Iwasa, Hiroaki; Hossain, Shakhawoat; Hata, Yutaka

    2018-05-01

    Human genome has ten genes that are collectedly called Ras association domain family (RASSF). RASSF is composed of two subclasses, C-RASSF and N-RASSF. Both N-RASSF and C-RASSF encode Ras association domain-containing proteins and are frequently suppressed by DNA hypermethylation in human cancers. However, C-RASSF and N-RASSF are quite different. Six C-RASSF proteins (RASSF1-6) are characterized by a C-terminal coiled-coil motif named Salvador/RASSF/Hippo domain, while four N-RASSF proteins (RASSF7-10) lack it. C-RASSF proteins interact with mammalian Ste20-like kinases-the core kinases of the tumor suppressor Hippo pathway-and cross-talk with this pathway. Some of them share the same interacting molecules such as MDM2 and exert the tumor suppressor role in similar manners. Nevertheless, each C-RASSF protein has distinct characters. In this review, we summarize our current knowledge of how C-RASSF proteins play tumor suppressor roles and discuss the similarities and differences among C-RASSF proteins.

  9. Mutations affecting the SAND domain of DEAF1 cause intellectual disability with severe speech impairment and behavioral problems.

    PubMed

    Vulto-van Silfhout, Anneke T; Rajamanickam, Shivakumar; Jensik, Philip J; Vergult, Sarah; de Rocker, Nina; Newhall, Kathryn J; Raghavan, Ramya; Reardon, Sara N; Jarrett, Kelsey; McIntyre, Tara; Bulinski, Joseph; Ownby, Stacy L; Huggenvik, Jodi I; McKnight, G Stanley; Rose, Gregory M; Cai, Xiang; Willaert, Andy; Zweier, Christiane; Endele, Sabine; de Ligt, Joep; van Bon, Bregje W M; Lugtenberg, Dorien; de Vries, Petra F; Veltman, Joris A; van Bokhoven, Hans; Brunner, Han G; Rauch, Anita; de Brouwer, Arjan P M; Carvill, Gemma L; Hoischen, Alexander; Mefford, Heather C; Eichler, Evan E; Vissers, Lisenka E L M; Menten, Björn; Collard, Michael W; de Vries, Bert B A

    2014-05-01

    Recently, we identified in two individuals with intellectual disability (ID) different de novo mutations in DEAF1, which encodes a transcription factor with an important role in embryonic development. To ascertain whether these mutations in DEAF1 are causative for the ID phenotype, we performed targeted resequencing of DEAF1 in an additional cohort of over 2,300 individuals with unexplained ID and identified two additional individuals with de novo mutations in this gene. All four individuals had severe ID with severely affected speech development, and three showed severe behavioral problems. DEAF1 is highly expressed in the CNS, especially during early embryonic development. All four mutations were missense mutations affecting the SAND domain of DEAF1. Altered DEAF1 harboring any of the four amino acid changes showed impaired transcriptional regulation of the DEAF1 promoter. Moreover, behavioral studies in mice with a conditional knockout of Deaf1 in the brain showed memory deficits and increased anxiety-like behavior. Our results demonstrate that mutations in DEAF1 cause ID and behavioral problems, most likely as a result of impaired transcriptional regulation by DEAF1. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  10. Effects of a suppressor tone on distortion product otoacoustic emissions fine structure: why a universal suppressor level is not a practical solution to obtaining single-generator DP-grams.

    PubMed

    Dhar, Sumitrajit; Shaffer, Lauren A

    2004-12-01

    The use of a suppressor tone has been proposed as the method of choice in obtaining single-generator distortion product (DP) grams, the speculation being that such DP grams will be more predictive of hearing thresholds. Current distortion product otoacoustic emissions (DPOAE) theory points to the ear canal DPOAE signal being a complex interaction between multiple components. The effectiveness of a suppressor tone is predicted to be dependent entirely on the relative levels of these components. We examine the validity of using a suppressor tone through a detailed examination of the effects of a suppressor on DPOAE fine structure in individual ears. DPOAE fine structure, recorded in 10 normal-hearing individuals with a suppressor tone at 45, 55, and 65 dB SPL, was compared with recordings without a suppressor. Behavioral hearing thresholds were also measured in the same subjects, using 2-dB steps. The effect of the suppressor tone on DPOAE fine structure varied between ears and was dependent on frequency within ears. Correlation between hearing thresholds and DPOAE level measured without a suppressor was similar to previous reports. The effects of the suppressor are explained in the theoretical framework of a model involving multiple DPOAE components. Our results suggest that a suppressor tone can have highly variable effects on fine structure across individuals or even across frequency within one ear, thereby making the use of a suppressor less viable as a clinical tool for obtaining single-generator DP grams.

  11. A mutation in yeast mitochondrial DNA results in a precise excision of the terminal intron of the cytochrome b gene.

    PubMed

    Hill, J; McGraw, P; Tzagoloff, A

    1985-03-25

    The yeast nuclear gene CBP2 was previously proposed to code for a protein necessary for processing of the terminal intron in the cytochrome b pre-mRNA (McGraw, P., and Tzagoloff, A. (1983) J. Biol. Chem. 258, 9459-9468). In the present study we describe a mitochondrial mutation capable of suppressing the respiratory deficiency of cbp2 mutants. The mitochondrial suppressor mutation has been shown to be the result of a precise excision of the last intervening sequence from the cytochrome b gene. Strains with the altered mitochondrial DNA have normal levels of mature cytochrome b mRNA and of cytochrome b and exhibit wild type growth on glycerol. These results confirm that CBP2 codes for a protein specifically required for splicing of the cytochrome b intron and further suggest that absence of the intervening sequence does not noticeably affect the expression of respiratory function in mitochondria.

  12. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    PubMed

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  13. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

    PubMed Central

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

    2011-01-01

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

  14. Reverse engineering of TLX oncogenic transcriptional networks identifies RUNX1 as tumor suppressor in T-ALL.

    PubMed

    Della Gatta, Giusy; Palomero, Teresa; Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Bansal, Mukesh; Carpenter, Zachary W; De Keersmaecker, Kim; Sole, Xavier; Xu, Luyao; Paietta, Elisabeth; Racevskis, Janis; Wiernik, Peter H; Rowe, Jacob M; Meijerink, Jules P; Califano, Andrea; Ferrando, Adolfo A

    2012-02-26

    The TLX1 and TLX3 transcription factor oncogenes have a key role in the pathogenesis of T cell acute lymphoblastic leukemia (T-ALL). Here we used reverse engineering of global transcriptional networks to decipher the oncogenic regulatory circuit controlled by TLX1 and TLX3. This systems biology analysis defined T cell leukemia homeobox 1 (TLX1) and TLX3 as master regulators of an oncogenic transcriptional circuit governing T-ALL. Notably, a network structure analysis of this hierarchical network identified RUNX1 as a key mediator of the T-ALL induced by TLX1 and TLX3 and predicted a tumor-suppressor role for RUNX1 in T cell transformation. Consistent with these results, we identified recurrent somatic loss-of-function mutations in RUNX1 in human T-ALL. Overall, these results place TLX1 and TLX3 at the top of an oncogenic transcriptional network controlling leukemia development, show the power of network analyses to identify key elements in the regulatory circuits governing human cancer and identify RUNX1 as a tumor-suppressor gene in T-ALL.

  15. All-Atom Simulations Reveal How Single-Point Mutations Promote Serpin Misfolding

    NASA Astrophysics Data System (ADS)

    Wang, Fang; Orioli, Simone; Ianeselli, Alan; Spagnolli, Giovanni; a Beccara, Silvio; Gershenson, Anne; Faccioli, Pietro; Wintrode, Patrick L.

    2018-05-01

    Protein misfolding is implicated in many diseases, including the serpinopathies. For the canonical inhibitory serpin {\\alpha}1-antitrypsin (A1AT), mutations can result in protein deficiencies leading to lung disease, and misfolded mutants can accumulate in hepatocytes leading to liver disease. Using all-atom simulations based on the recently developed Bias Functional algorithm we elucidate how wild-type A1AT folds and how the disease-associated S (Glu264Val) and Z (Glu342Lys) mutations lead to misfolding. The deleterious Z mutation disrupts folding at an early stage, while the relatively benign S mutant shows late stage minor misfolding. A number of suppressor mutations ameliorate the effects of the Z mutation and simulations on these mutants help to elucidate the relative roles of steric clashes and electrostatic interactions in Z misfolding. These results demonstrate a striking correlation between atomistic events and disease severity and shine light on the mechanisms driving chains away from their correct folding routes.

  16. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    PubMed

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

    PubMed

    Zhao, Yongzhong; Epstein, Richard J

    2013-01-01

    Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

  18. Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome.

    PubMed

    Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

    2014-01-01

    Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. Mutations in the sigma subunit of E. coli RNA polymerase which affect positive control of transcription.

    PubMed

    Hu, J C; Gross, C A

    1985-01-01

    The sigma subunits of bacterial RNA polymerases are required for the selective initiation of transcription. We have isolated and characterized mutations in rpoD, the gene which encodes the major form of sigma in E. coli, which affect the selectivity of transcription. These mutations increase the expression of araBAD up to 12-fold in the absence of CAP-cAMP. Expression of lac is unaffected, while expression of malT-activated operons is decreased. We determined the DNA sequence of 17 independently isolated mutations, and found that they consist of three different changes in a single CGC arginine codon at position 596 in the sigma polypeptide.

  20. Molecular epidemiology in environmental health: the potential of tumor suppressor gene p53 as a biomarker.

    PubMed Central

    Semenza, J C; Weasel, L H

    1997-01-01

    One of the challenges in environmental health is to attribute a certain health effect to a specific environmental exposure and to establish a cause-effect relationship. Molecular epidemiology offers a new approach to addressing these challenges. Mutations in the tumor suppressor gene p53 can shed light on past environmental exposure, and carcinogenic agents and doses can be distinguished on the basis of mutational spectra and frequency. Mutations in p53 have successfully been used to establish links between dietary aflatoxin exposure and liver cancer, exposure to ultraviolet light and skin cancer, smoking and cancers of the lung and bladder, and vinyl chloride exposure and liver cancer. In lung cancer, carcinogens from tobacco smoke have been shown to form adducts with DNA. The location of these adducts correlates with those positions in the p53 gene that are mutated in lung cancer, confirming a direct etiologic link between exposure and disease. Recent investigations have also explored the use of p53 as a susceptibility marker for cancer. Furthermore, studies in genetic toxicology have taken advantage of animals transgenic for p53 to screen for carcinogens in vivo. In this review, we summarize recent developments in p53 biomarker research and illustrate applications to environmental health. PMID:9114284

  1. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    PubMed

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  2. RB mutation and RAS overexpression induce resistance to NK cell-mediated cytotoxicity in glioma cells.

    PubMed

    Orozco-Morales, Mario; Sánchez-García, Francisco Javier; Golán-Cancela, Irene; Hernández-Pedro, Norma; Costoya, Jose A; de la Cruz, Verónica Pérez; Moreno-Jiménez, Sergio; Sotelo, Julio; Pineda, Benjamín

    2015-01-01

    Several theories aim to explain the malignant transformation of cells, including the mutation of tumor suppressors and proto-oncogenes. Deletion of Rb (a tumor suppressor), overexpression of mutated Ras (a proto-oncogene), or both, are sufficient for in vitro gliomagenesis, and these genetic traits are associated with their proliferative capacity. An emerging hallmark of cancer is the ability of tumor cells to evade the immune system. Whether specific mutations are related with this, remains to be analyzed. To address this issue, three transformed glioma cell lines were obtained (Rb(-/-), Ras(V12), and Rb(-/-)/Ras(V12)) by in vitro retroviral transformation of astrocytes, as previously reported. In addition, Ras(V12) and Rb(-/-)/Ras(V12) transformed cells were injected into SCID mice and after tumor growth two stable glioma cell lines were derived. All these cells were characterized in terms of Rb and Ras gene expression, morphology, proliferative capacity, expression of MHC I, Rae1δ, and Rae1αβγδε, mult1, H60a, H60b, H60c, as ligands for NK cell receptors, and their susceptibility to NK cell-mediated cytotoxicity. Our results show that transformation of astrocytes (Rb loss, Ras overexpression, or both) induced phenotypical and functional changes associated with resistance to NK cell-mediated cytotoxicity. Moreover, the transfer of cell lines of transformed astrocytes into SCID mice increased resistance to NK cell-mediated cytotoxicity, thus suggesting that specific changes in a tumor suppressor (Rb) and a proto-oncogene (Ras) are enough to confer resistance to NK cell-mediated cytotoxicity in glioma cells and therefore provide some insight into the ability of tumor cells to evade immune responses.

  3. Epilepsy due to PNPO mutations: genotype, environment and treatment affect presentation and outcome

    PubMed Central

    Mills, Philippa B.; Camuzeaux, Stephane S.M.; Footitt, Emma J.; Mills, Kevin A.; Gissen, Paul; Fisher, Laura; Das, Krishna B.; Varadkar, Sophia M.; Zuberi, Sameer; McWilliam, Robert; Stödberg, Tommy; Plecko, Barbara; Baumgartner, Matthias R.; Maier, Oliver; Calvert, Sophie; Riney, Kate; Wolf, Nicole I.; Livingston, John H.; Bala, Pronab; Morel, Chantal F.; Feillet, François; Raimondi, Francesco; Del Giudice, Ennio; Chong, W. Kling; Pitt, Matthew

    2014-01-01

    The first described patients with pyridox(am)ine 5’-phosphate oxidase deficiency all had neonatal onset seizures that did not respond to treatment with pyridoxine but responded to treatment with pyridoxal 5’-phosphate. Our data suggest, however, that the clinical spectrum of pyridox(am)ine 5’-phosphate oxidase deficiency is much broader than has been reported in the literature. Sequencing of the PNPO gene was undertaken for a cohort of 82 individuals who had shown a reduction in frequency and severity of seizures in response to pyridoxine or pyridoxal 5’-phosphate. Novel sequence changes were studied using a new cell-free expression system and a mass spectrometry-based assay for pyridoxamine phosphate oxidase. Three groups of patients with PNPO mutations that had reduced enzyme activity were identified: (i) patients with neonatal onset seizures responding to pyridoxal 5’-phosphate (n = 6); (ii) a patient with infantile spasms (onset 5 months) responsive to pyridoxal 5’-phosphate (n = 1); and (iii) patients with seizures starting under 3 months of age responding to pyridoxine (n = 8). Data suggest that certain genotypes (R225H/C and D33V) are more likely to result in seizures that to respond to treatment with pyridoxine. Other mutations seem to be associated with infertility, miscarriage and prematurity. However, the situation is clearly complex with the same combination of mutations being seen in patients who responded and did not respond to pyridoxine. It is possible that pyridoxine responsiveness in PNPO deficiency is affected by prematurity and age at the time of the therapeutic trial. Other additional factors that are likely to influence treatment response and outcome include riboflavin status and how well the foetus has been supplied with vitamin B6 by the mother. For some patients there was a worsening of symptoms on changing from pyridoxine to pyridoxal 5’-phosphate. Many of the mutations in PNPO affected residues involved in binding flavin

  4. Induction of human antigen-specific suppressor factors in vitro.

    PubMed Central

    Kontiainen, S; Woody, J N; Rees, A; Feldmann, M

    1981-01-01

    Based on methods used for the in vitro induction of antigen-specific suppressor cells in the mouse, we have cultured Ficoll-Isopaque-separated human blood cells with high dose of antigen (100 microgram/ml) in Marbrook culture vessels for 4 days. The resulting cells, when further recultured for 24 hr with a low dose of antigen (1 microgram/ml), released into the supernatant material, termed 'suppressor factor', which inhibited, in an antigen-specific manner, the antibody response of mouse spleen cells in culture. The suppressor factor was analysed using immunoabsorbents, and was bound to and eluted from specific antigen, concanavalin A and lentil lectin, anti-human Ia antibodies, and anti-mouse suppressor factor antibodies, but was not bound to antibodies against human IgG. PMID:6169475

  5. Brooke-Spiegler syndrome: report of 10 patients from 8 families with novel germline mutations: evidence of diverse somatic mutations in the same patient regardless of tumor type.

    PubMed

    Sima, Radek; Vanecek, Tomas; Kacerovska, Denisa; Trubac, Pavel; Cribier, Bernard; Rutten, Arno; Vazmitel, Marina; Spagnolo, Dominic V; Litvik, Radek; Vantuchova, Yvetta; Weyers, Wolfgang; Pearce, Robert L; Pearn, John; Michal, Michal; Kazakov, Dmitry V

    2010-06-01

    Brooke-Spiegler syndrome (BSS) is an inherited autosomal dominant disease characterized by the development of multiple adnexal cutaneous neoplasms including spiradenoma, cylindroma, spiradenocylindroma, and trichoepithelioma (cribriform trichoblastoma). BSS patients have various mutations in the CYLD gene, a tumor suppressor gene located on chromosome 16q. Our search of the literature revealed 51 germline CYLD mutations reported to date. Somatic CYLD mutations have rarely been investigated. We studied 10 patients from 8 families with BSS. Analysis of germline mutations of the CYLD gene was performed using either peripheral blood or nontumorous tissue. In addition, 19 formalin-fixed paraffin-embedded tumor samples were analyzed for somatic mutations, including loss of heterozygosity studies. A total of 38 tumors were available for histopathologic review. We have identified 8 novel germline mutations, all of which consisted of substitutions, deletions, and insertions/duplications and all except one led to premature stop codons. The substitution mutation in a single case was also predicted to disrupt protein function and seems causally implicated in tumor formation. We demonstrate for the first time that somatic events, loss of heterozygosity, or sequence mutations may differ among multiple neoplasms even of the same histologic type, occurring in the same patient.

  6. Clinical implementation of integrated whole-genome copy number and mutation profiling for glioblastoma

    PubMed Central

    Ramkissoon, Shakti H.; Bi, Wenya Linda; Schumacher, Steven E.; Ramkissoon, Lori A.; Haidar, Sam; Knoff, David; Dubuc, Adrian; Brown, Loreal; Burns, Margot; Cryan, Jane B.; Abedalthagafi, Malak; Kang, Yun Jee; Schultz, Nikolaus; Reardon, David A.; Lee, Eudocia Q.; Rinne, Mikael L.; Norden, Andrew D.; Nayak, Lakshmi; Ruland, Sandra; Doherty, Lisa M.; LaFrankie, Debra C.; Horvath, Margaret; Aizer, Ayal A.; Russo, Andrea; Arvold, Nils D.; Claus, Elizabeth B.; Al-Mefty, Ossama; Johnson, Mark D.; Golby, Alexandra J.; Dunn, Ian F.; Chiocca, E. Antonio; Trippa, Lorenzo; Santagata, Sandro; Folkerth, Rebecca D.; Kantoff, Philip; Rollins, Barrett J.; Lindeman, Neal I.; Wen, Patrick Y.; Ligon, Azra H.; Beroukhim, Rameen; Alexander, Brian M.; Ligon, Keith L.

    2015-01-01

    Background Multidimensional genotyping of formalin-fixed paraffin-embedded (FFPE) samples has the potential to improve diagnostics and clinical trials for brain tumors, but prospective use in the clinical setting is not yet routine. We report our experience with implementing a multiplexed copy number and mutation-testing program in a diagnostic laboratory certified by the Clinical Laboratory Improvement Amendments. Methods We collected and analyzed clinical testing results from whole-genome array comparative genomic hybridization (OncoCopy) of 420 brain tumors, including 148 glioblastomas. Mass spectrometry–based mutation genotyping (OncoMap, 471 mutations) was performed on 86 glioblastomas. Results OncoCopy was successful in 99% of samples for which sufficient DNA was obtained (n = 415). All clinically relevant loci for glioblastomas were detected, including amplifications (EGFR, PDGFRA, MET) and deletions (EGFRvIII, PTEN, 1p/19q). Glioblastoma patients ≤40 years old had distinct profiles compared with patients >40 years. OncoMap testing reliably identified mutations in IDH1, TP53, and PTEN. Seventy-seven glioblastoma patients enrolled on trials, of whom 51% participated in targeted therapeutic trials where multiplex data informed eligibility or outcomes. Data integration identified patients with complete tumor suppressor inactivation, albeit rarely (5% of patients) due to lack of whole-gene coverage in OncoMap. Conclusions Combined use of multiplexed copy number and mutation detection from FFPE samples in the clinical setting can efficiently replace singleton tests for clinical diagnosis and prognosis in most settings. Our results support incorporation of these assays into clinical trials as integral biomarkers and their potential to impact interpretation of results. Limited tumor suppressor variant capture by targeted genotyping highlights the need for whole-gene sequencing in glioblastoma. PMID:25754088

  7. [Analysis of TGFBI gene mutation in a Chinese family affected with Reis-Bucklers corneal dystrophy].

    PubMed

    Guan, Tao; Zhang, Lingjie; Xu, Dejian; Wu, Haijian; Zheng, Libin

    2017-10-10

    To analyze the clinical features and TGFBI gene mutation in a Chinese family affected with Reis-Bucklers corneal dystrophy. Genomic DNA was extracted from 53 members including 9 patients from the family. The 17 exons and splice region of introns of the TGFBI gene were amplified by PCR and directly sequenced. All family members were subjected to ophthalmologic examination. A heterozygous mutation (R124L) was found in exon 4 of the TGFBI gene among all patients from the family. The same mutation was not found among unaffected family members. The inheritance pattern of the family was identified as autosomal dominant, and the Reis-Bucklers corneal dystrophy in the family was diagnosed as the geographic type. The R124L mutation of the TGFBI gene probably underlies the pathogenesis of Reis-Bucklers corneal dystrophy in this Chinese family. Molecular genetic approach is useful for the proper diagnosis of this type of corneal dystrophy.

  8. RNA splicing factors as oncoproteins and tumor suppressors

    PubMed Central

    Dvinge, Heidi; Kim, Eunhee; Abdel-Wahab, Omar; Bradley, Robert K.

    2016-01-01

    Preface The recent genomic characterization of cancers has revealed recurrent somatic point mutations and copy number changes affecting genes encoding RNA splicing factors. Initial studies of these ‘spliceosomal mutations’ suggest that the proteins bearing these mutations exhibit altered splice site and/or exon recognition preferences relative to their wild-type counterparts, resulting in cancer-specific mis-splicing. Such changes in the splicing machinery may create novel vulnerabilities in cancer cells that can be therapeutically exploited using compounds that can influence the splicing process. Further studies to dissect the biochemical, genomic, and biological effects of spliceosomal mutations are critical for the development of cancer therapies targeted to these mutations. PMID:27282250

  9. A study of the transmission characteristics of suppressor nozzles

    NASA Technical Reports Server (NTRS)

    Ahuja, K. K.; Salikuddin, M.; Burrin, R. H.; Plumbee, H. E., Jr.

    1980-01-01

    The internal noise radiation characteristics for a single stream 12 lobe 24 tube suppressor nozzle, and for a dual stream 36 chute suppressor nozzle were investigated. An equivalent single round conical nozzle and an equivalent coannular nozzle system were also tested to provide a reference for the two suppressors. The technique utilized a high voltage spark discharge as a noise source within the test duct which permitted separation of the incident, reflected and transmitted signals in the time domain. These signals were then Fourier transformed to obtain the nozzle transmission coefficient and the power transfer function. These transmission parameters for the 12 lobe, 24 tube suppressor nozzle and the reference conical nozzle are presented as a function of jet Mach number, duct Mach number polar angle and temperature. Effects of simulated forward flight are also considered for this nozzle. For the dual stream, 36 chute suppressor, the transmission parameters are presented as a function of velocity ratios and temperature ratios. Possible data for the equivalent coaxial nozzle is also presented. Jet noise suppression by these nozzles is also discussed.

  10. Smoking, p53 Mutation, and Lung Cancer

    PubMed Central

    Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.

    2014-01-01

    This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106

  11. Internal deletion of BCOR reveals a tumor suppressor function for BCOR in T lymphocyte malignancies

    PubMed Central

    Tanaka, Tomoyuki; Nakajima-Takagi, Yaeko; Tara, Shiro; Saraya, Atsunori; Koide, Shuhei; Si, Sha; Manabe, Ichiro; Sanada, Masashi; Nakayama, Manabu; Masuko, Masayoshi; Sone, Hirohito

    2017-01-01

    Recurrent inactivating mutations have been identified in various hematological malignancies in the X-linked BCOR gene encoding BCL6 corepressor (BCOR); however, its tumor suppressor function remains largely uncharacterized. We generated mice missing Bcor exon 4, expressing a variant BCOR lacking the BCL6-binding domain. Although the deletion of exon 4 in male mice (BcorΔE4/y) compromised the repopulating capacity of hematopoietic stem cells, BcorΔE4/y thymocytes had augmented proliferative capacity in culture and showed a strong propensity to induce acute T-cell lymphoblastic leukemia (T-ALL), mostly in a Notch-dependent manner. Myc, one of the critical NOTCH1 targets in T-ALL, was highly up-regulated in BcorΔE4/y T-ALL cells. Chromatin immunoprecipitation/DNA sequencing analysis revealed that BCOR was recruited to the Myc promoter and restrained its activation in thymocytes. BCOR also targeted other NOTCH1 targets and potentially antagonized their transcriptional activation. Bcl6-deficient thymocytes behaved in a manner similar to BcorΔE4/y thymocytes. Our results provide the first evidence of a tumor suppressor role for BCOR in the pathogenesis of T lymphocyte malignancies. PMID:28827447

  12. Molecular-genetic diagnostics of von Hippel-Lindau syndrome (VHL) in Bulgaria: first complex mutation event in the VHL gene.

    PubMed

    Glushkova, Maria; Dimova, Petia; Yordanova, Iglika; Todorov, Tihomir; Tourtourikov, Ivan; Mitev, Vanyo; Todorova, Albena

    2018-02-01

    Von Hippel-Lindau syndrome is an autosomal-dominant disease characterized by the formation of various tumours and cysts in many different parts of the body. Von Hippel-Lindau syndrome is caused by VHL gene mutations leading to production of impaired tumor suppressor Von Hippel-Lindau syndrome protein or its complete absence. To study five patients with clinically suspected Von Hippel-Lindau syndrome, who were referred for molecular genetic testing. Sanger sequencing of the coding regions of the VHL gene. Five clinically relevant germline mutations were detected. One of the pathogenic variants has not been previously reported. This novel mutation is a complex mutation event combining a duplication and an indel, rearranging exon 3 of the VHL gene - c. [516_517dupGTCAAGCCT; 532_542delCTGGACATCGTinsATTA], p. (Glu173Serfs*4). Overall, our results showed that the diagnosis of Von Hippel-Lindau syndrome in our country is difficult most probably because of its heterogeneous clinical manifestation and insufficient knowledge on the diagnostic criteria for the disease. From genetic point of view our results add some novel data on the mutation profile of the VHL gene. In order to prove or revise the diagnosis, early genetic testing is strongly recommended in affected patients and their family members to ensure appropriate follow-up and treatment of the malignancies.

  13. PARP inhibitors may affect normal cells in patients with a BRCA mutation | Center for Cancer Research

    Cancer.gov

    PARP inhibition has been approved for treatment of advanced ovarian cancer with BRAC1 and BRAC2 mutations and is being studied in the treatment advanced breast, colorectal, and prostate cancer.  A new study by Center for Cancer Research scientists in the Mouse Cancer Genetics Program and the Laboratory of Genome Integrity, raises concerns that when cancer patients with a BRCA mutation are treated with PARP inhibitors their normal cells may also be affected.  

  14. Genetic characterization of frameshift suppressors with new decoding properties.

    PubMed Central

    Hughes, D; Thompson, S; O'Connor, M; Tuohy, T; Nichols, B P; Atkins, J F

    1989-01-01

    Suppressor mutants that cause ribosomes to shift reading frame at specific and new sequences are described. Suppressors for trpE91, the only known suppressible -1 frameshift mutant, have been isolated in Escherichia coli and in Salmonella typhimurium. E. coli hopR acts on trpE91 within the 9-base-pair sequence GGA GUG UGA, is dominant, and is located at min 52 on the chromosome. Its Salmonella homolog maps at an equivalent position and arises as a rarer class in that organism as compared with E. coli. The Salmonella suppressor, hopE, believed to be in a duplicate copy of the same gene, maps at min 17. The +1 suppressor, sufT, acts at the nonmonotonous sequence CCGU, is dominant, and maps at min 59 on the Salmonella chromosome. PMID:2644219

  15. Molecular dynamics simulations show how the FMRP Ile304Asn mutation destabilizes the KH2 domain structure and affects its function.

    PubMed

    Di Marino, Daniele; Achsel, Tilmann; Lacoux, Caroline; Falconi, Mattia; Bagni, Claudia

    2014-01-01

    Mutations or deletions of FMRP, involved in the regulation of mRNA metabolism in brain, lead to the Fragile X syndrome (FXS), the most frequent form of inherited intellectual disability. A severe manifestation of the disease has been associated with the Ile304Asn mutation, located on the KH2 domain of the protein. Several hypotheses have been proposed to explain the possible molecular mechanism responsible for the drastic effect of this mutation in humans. Here, we performed a molecular dynamics simulation and show that the Ile304Asn mutation destabilizes the hydrophobic core producing a partial unfolding of two α-helices and a displacement of a third one. The affected regions show increased residue flexibility and motion. Molecular docking analysis revealed strongly reduced binding to a model single-stranded nucleic acid in agreement with known data that the two partially unfolded helices form the RNA-binding surface. The third helix, which we show here to be also affected, is involved in the PAK1 protein interaction. These two functional binding sites on the KH2 domain do not overlap spatially, and therefore, they can simultaneously bind their targets. Since the Ile304Asn mutation affects both binding sites, this may justify the severe clinical manifestation observed in the patient in which both mRNA metabolism activity and cytoskeleton remodeling would be affected.

  16. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

    PubMed Central

    Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

    2016-01-01

    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

  17. Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis

    PubMed Central

    Hulsebos, Theo J. M.; Plomp, Astrid S.; Wolterman, Ruud A.; Robanus-Maandag, Els C.; Baas, Frank; Wesseling, Pieter

    2007-01-01

    Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofibromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. PMID:17357086

  18. Lethal Giant Larvae 1 Tumour Suppressor Activity Is Not Conserved in Models of Mammalian T and B Cell Leukaemia

    PubMed Central

    Hawkins, Edwin D.; Oliaro, Jane; Ramsbottom, Kelly M.; Ting, Stephen B.; Sacirbegovic, Faruk; Harvey, Michael; Kinwell, Tanja; Ghysdael, Jacques; Johnstone, Ricky W.; Humbert, Patrick O.; Russell, Sarah M.

    2014-01-01

    In epithelial and stem cells, lethal giant larvae (Lgl) is a potent tumour suppressor, a regulator of Notch signalling, and a mediator of cell fate via asymmetric cell division. Recent evidence suggests that the function of Lgl is conserved in mammalian haematopoietic stem cells and implies a contribution to haematological malignancies. To date, direct measurement of the effect of Lgl expression on malignancies of the haematopoietic lineage has not been tested. In Lgl1−/− mice, we analysed the development of haematopoietic malignancies either alone, or in the presence of common oncogenic lesions. We show that in the absence of Lgl1, production of mature white blood cell lineages and long-term survival of mice are not affected. Additionally, loss of Lgl1 does not alter leukaemia driven by constitutive Notch, c-Myc or Jak2 signalling. These results suggest that the role of Lgl1 in the haematopoietic lineage might be restricted to specific co-operating mutations and a limited number of cellular contexts. PMID:24475281

  19. A Tumor-Associated Mutation of FYVE-CENT Prevents Its Interaction with Beclin 1 and Interferes with Cytokinesis

    PubMed Central

    Sagona, Antonia P.; Nezis, Ioannis P.; Bache, Kristi G.; Haglund, Kaisa; Bakken, Anne Cathrine; Skotheim, Rolf I.; Stenmark, Harald

    2011-01-01

    The tumor suppressor activity of Beclin 1 (BECN1), a subunit of class III phosphatidylinositol 3-kinase complex, has been attributed to its regulation of apoptosis and autophagy. Here, we identify FYVE-CENT (ZFYVE26), a phosphatidylinositol 3-phosphate binding protein important for cytokinesis, as a novel interacting protein of Beclin 1. A mutation in FYVE-CENT (R1945Q) associated with breast cancer abolished the interaction between FYVE-CENT and Beclin 1, and reduced the localization of these proteins at the intercellular bridge during cytokinesis. Breast cancer cells containing the FYVE-CENT R1945Q mutation displayed a significant increase in cytokinetic profiles and bi - multinuclear phenotype. Both Beclin 1 and FYVE-CENT were found to be downregulated in advanced breast cancers. These findings suggest a positive feedback loop for recruitment of FYVE-CENT and Beclin 1 to the intercellular bridge during cytokinesis, and reveal a novel potential tumor suppressor mechanism for Beclin 1. PMID:21455500

  20. A tumor-associated mutation of FYVE-CENT prevents its interaction with Beclin 1 and interferes with cytokinesis.

    PubMed

    Sagona, Antonia P; Nezis, Ioannis P; Bache, Kristi G; Haglund, Kaisa; Bakken, Anne Cathrine; Skotheim, Rolf I; Stenmark, Harald

    2011-03-24

    The tumor suppressor activity of Beclin 1 (BECN1), a subunit of class III phosphatidylinositol 3-kinase complex, has been attributed to its regulation of apoptosis and autophagy. Here, we identify FYVE-CENT (ZFYVE26), a phosphatidylinositol 3-phosphate binding protein important for cytokinesis, as a novel interacting protein of Beclin 1. A mutation in FYVE-CENT (R1945Q) associated with breast cancer abolished the interaction between FYVE-CENT and Beclin 1, and reduced the localization of these proteins at the intercellular bridge during cytokinesis. Breast cancer cells containing the FYVE-CENT R1945Q mutation displayed a significant increase in cytokinetic profiles and bi-multinuclear phenotype. Both Beclin 1 and FYVE-CENT were found to be downregulated in advanced breast cancers. These findings suggest a positive feedback loop for recruitment of FYVE-CENT and Beclin 1 to the intercellular bridge during cytokinesis, and reveal a novel potential tumor suppressor mechanism for Beclin 1.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peltomaeki, Paeivi, E-mail: Paivi.Peltomaki@Helsinki.Fi

    Cancer is traditionally viewed as a disease of abnormal cell proliferation controlled by a series of mutations. Mutations typically affect oncogenes or tumor suppressor genes thereby conferring growth advantage. Genomic instability facilitates mutation accumulation. Recent findings demonstrate that activation of oncogenes and inactivation of tumor suppressor genes, as well as genomic instability, can be achieved by epigenetic mechanisms as well. Unlike genetic mutations, epimutations do not change the base sequence of DNA and are potentially reversible. Similar to genetic mutations, epimutations are associated with specific patterns of gene expression that are heritable through cell divisions. Knudson's hypothesis postulates that inactivationmore » of tumor suppressor genes requires two hits, with the first hit occurring either in somatic cells (sporadic cancer) or in the germline (hereditary cancer) and the second one always being somatic. Studies on hereditary and sporadic forms of colorectal carcinoma have made it evident that, apart from genetic mutations, epimutations may serve as either hit or both. Furthermore, recent next-generation sequencing studies show that epigenetic genes, such as those encoding histone modifying enzymes and subunits for chromatin remodeling systems, are themselves frequent targets of somatic mutations in cancer and can act like tumor suppressor genes or oncogenes. This review discusses genetic vs. epigenetic origin of cancer, including cancer susceptibility, in light of recent discoveries. Situations in which mutations and epimutations occur to serve analogous purposes are highlighted.« less

  2. Germline mutations affecting the proofreading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas.

    PubMed

    Palles, Claire; Cazier, Jean-Baptiste; Howarth, Kimberley M; Domingo, Enric; Jones, Angela M; Broderick, Peter; Kemp, Zoe; Spain, Sarah L; Guarino, Estrella; Guarino Almeida, Estrella; Salguero, Israel; Sherborne, Amy; Chubb, Daniel; Carvajal-Carmona, Luis G; Ma, Yusanne; Kaur, Kulvinder; Dobbins, Sara; Barclay, Ella; Gorman, Maggie; Martin, Lynn; Kovac, Michal B; Humphray, Sean; Lucassen, Anneke; Holmes, Christopher C; Bentley, David; Donnelly, Peter; Taylor, Jenny; Petridis, Christos; Roylance, Rebecca; Sawyer, Elinor J; Kerr, David J; Clark, Susan; Grimes, Jonathan; Kearsey, Stephen E; Thomas, Huw J W; McVean, Gilean; Houlston, Richard S; Tomlinson, Ian

    2013-02-01

    Many individuals with multiple or large colorectal adenomas or early-onset colorectal cancer (CRC) have no detectable germline mutations in the known cancer predisposition genes. Using whole-genome sequencing, supplemented by linkage and association analysis, we identified specific heterozygous POLE or POLD1 germline variants in several multiple-adenoma and/or CRC cases but in no controls. The variants associated with susceptibility, POLE p.Leu424Val and POLD1 p.Ser478Asn, have high penetrance, and POLD1 mutation was also associated with endometrial cancer predisposition. The mutations map to equivalent sites in the proofreading (exonuclease) domain of DNA polymerases ɛ and δ and are predicted to cause a defect in the correction of mispaired bases inserted during DNA replication. In agreement with this prediction, the tumors from mutation carriers were microsatellite stable but tended to acquire base substitution mutations, as confirmed by yeast functional assays. Further analysis of published data showed that the recently described group of hypermutant, microsatellite-stable CRCs is likely to be caused by somatic POLE mutations affecting the exonuclease domain.

  3. [Analysis of clinical phenotype and CGH1 gene mutations in a family affected with dopa-responsive dystonia].

    PubMed

    Yan, Yaping; Chen, Xiaohong; Luo, Wei

    2017-04-10

    To explore genetic mutations and clinical features of a pedigree affected with dopa-responsive dystonia. PCR and Sanger sequencing were applied to detect mutations of the GCH1 gene among 7 members from the pedigree. The family was detected to have a known heterozygous mutation of the GCH1 gene (c.550C>T). For the 7 members from the pedigree, the age of onset has ranged from 13 to 60 years. The mother of the proband has carried the same mutation but was still healthy at 80. The symptoms of the other three patients were in slow progression, with diurnal fluctuation which can be improved with sleeping, dystonias of lower limbs, and tremor of both hands. Treatment with small dose of levodopa has resulted in significant improvement of clinical symptoms. By database analysis, the c.550C>T mutation was predicted as probably pathological. The c.550C>T mutation probably underlies the disease in this pedigree. The clinical phenotypes of family members may be variable for their ages of onset. Some may even be symptom free.

  4. Activation of Gαq subunits up-regulates the expression of the tumor suppressor Fhit.

    PubMed

    Zuo, Hao; Chan, Anthony S L; Ammer, Hermann; Wong, Yung H

    2013-12-01

    The tumor suppressor Fhit protein is defective or absent in many tumor cells due to methylation, mutation or deletion of the FHIT gene. Despite numerous attempts to unravel the functions of Fhit, the mechanisms by which the function and expression of Fhit are regulated remain poorly understood. We have recently shown that activated Gαq subunits interact directly with Fhit and enhance its inhibitory effect on cell growth. Here we investigated the regulation of Fhit expression by Gq. Our results showed that Fhit was up-regulated specifically by activating Gα subunits of the Gq subfamily but not by those of the other G protein subfamilies. This up-regulation effect was mediated by a PKC/MEK pathway independent of Src-mediated Fhit Tyr(114) phosphorylation. We further demonstrated that elevated Fhit expression was due to the specific regulation of Fhit protein synthesis in the ribosome by activated Gαq, where the regulations of cap-dependent protein synthesis were apparently not required. Moreover, we showed that activated Gαq could increase cell-cell adhesion through Fhit. These findings provide a possible handle to modulate the level of the Fhit tumor suppressor by manipulating the activity of Gq-coupled receptors. © 2013. Published by Elsevier Inc. All rights reserved.

  5. Heterozygous TGFBR2 mutations in Marfan syndrome

    PubMed Central

    Mizuguchi, Takeshi; Collod-Beroud, Gwenaëlle; Akiyama, Takushi; Abifadel, Marianne; Harada, Naoki; Morisaki, Takayuki; Allard, Delphine; Varret, Mathilde; Claustres, Mireille; Morisaki, Hiroko; Ihara, Makoto; Kinoshita, Akira; Yoshiura, Koh-ichiro; Junien, Claudine; Kajii, Tadashi; Jondeau, Guillaume; Ohta, Tohru; Kishino, Tatsuya; Furukawa, Yoichi; Nakamura, Yusuke; Niikawa, Norio; Boileau, Catherine; Matsumoto, Naomichi

    2004-01-01

    Marfan syndrome (MFS) is an extracellular matrix disorder with cardinal manifestations in the eye, skeleton, and cardiovascular systems and associated with defects in the fibrillin gene (FBN1) at 15q21.1 1. We previously mapped the second locus for MFS (MFS type 2, MFS2, OMIM *154705), at 3p24.2-p25 in a large French family (MS1)2. Identification of a 3p24.1 chromosomal breakpoint disrupting the TGF-beta receptor 2 gene (TGFBR2) in a Japanese MFS patient led us to consider TGFBR2 as the MSF2 gene. We found a Q508Q mutation of TGFBR2 that resulted in abnormal splicing and segregated with MFS2 in MS1. Three other missense mutations were found in four unrelated probands and were shown by luciferase-assays to lead to loss of function of the TGF-β signaling activity on extracellular matrix formation. These results show that heterozygous mutations in TGFBR2, a putative tumor suppressor gene implicated in several malignancies, are also associated with inherited connective-tissue disorders. PMID:15235604

  6. Sporadic infantile epileptic encephalopathy caused by mutations in PCDH19 resembles Dravet syndrome but mainly affects females.

    PubMed

    Depienne, Christel; Bouteiller, Delphine; Keren, Boris; Cheuret, Emmanuel; Poirier, Karine; Trouillard, Oriane; Benyahia, Baya; Quelin, Chloé; Carpentier, Wassila; Julia, Sophie; Afenjar, Alexandra; Gautier, Agnès; Rivier, François; Meyer, Sophie; Berquin, Patrick; Hélias, Marie; Py, Isabelle; Rivera, Serge; Bahi-Buisson, Nadia; Gourfinkel-An, Isabelle; Cazeneuve, Cécile; Ruberg, Merle; Brice, Alexis; Nabbout, Rima; Leguern, Eric

    2009-02-01

    Dravet syndrome (DS) is a genetically determined epileptic encephalopathy mainly caused by de novo mutations in the SCN1A gene. Since 2003, we have performed molecular analyses in a large series of patients with DS, 27% of whom were negative for mutations or rearrangements in SCN1A. In order to identify new genes responsible for the disorder in the SCN1A-negative patients, 41 probands were screened for micro-rearrangements with Illumina high-density SNP microarrays. A hemizygous deletion on chromosome Xq22.1, encompassing the PCDH19 gene, was found in one male patient. To confirm that PCDH19 is responsible for a Dravet-like syndrome, we sequenced its coding region in 73 additional SCN1A-negative patients. Nine different point mutations (four missense and five truncating mutations) were identified in 11 unrelated female patients. In addition, we demonstrated that the fibroblasts of our male patient were mosaic for the PCDH19 deletion. Patients with PCDH19 and SCN1A mutations had very similar clinical features including the association of early febrile and afebrile seizures, seizures occurring in clusters, developmental and language delays, behavioural disturbances, and cognitive regression. There were, however, slight but constant differences in the evolution of the patients, including fewer polymorphic seizures (in particular rare myoclonic jerks and atypical absences) in those with PCDH19 mutations. These results suggest that PCDH19 plays a major role in epileptic encephalopathies, with a clinical spectrum overlapping that of DS. This disorder mainly affects females. The identification of an affected mosaic male strongly supports the hypothesis that cellular interference is the pathogenic mechanism.

  7. A novel dysfunctional germline P53 mutation identified in a family with Li-Fraumeni syndrome.

    PubMed

    Ji, Min; Wang, Lin; Shao, Yuguo; Cao, Wei; Xu, Ting; Chen, Shujie; Wang, Zhiwei; He, Qi; Yang, Kuo

    2018-01-01

    Li-Fraumeni Syndrome (LFS), which is a rare dominantly inherited cancer predisposition syndrome, is associated with germline P53 mutations. Mutations of the tumor suppressor protein P53 are associated with more than 50% of human cancers; however, almost 30% of P53 mutations occur rarely and this has raised questions about their significance. It therefore appeared of particular interest that we identified a novel mutation in a patient suffering from breast cancer and fulfilling the diagnostic criteria of LFS. In this study, a patient with remarkable family history developed breast cancer and was diagnosed with LFS. By performing next-generation sequencing on the patient and subsequent verification by Sanger sequencing among other family members, a new germ-line P53 replication error, a trinucleotide repeat mutation in the coding region, was identified in two generations of this Li-Fraumeni family.

  8. The interplay of mutations and electronic properties in disease-related genes

    NASA Astrophysics Data System (ADS)

    Shih, Chi-Tin; Wells, Stephen A.; Hsu, Ching-Ling; Cheng, Yun-Yin; Römer, Rudolf A.

    2012-02-01

    Electronic properties of DNA are believed to play a crucial role in many phenomena in living organisms, for example the location of DNA lesions by base excision repair (BER) glycosylases and the regulation of tumor-suppressor genes such as p53 by detection of oxidative damage. However, the reproducible measurement and modelling of charge migration through DNA molecules at the nanometer scale remains a challenging and controversial subject even after more than a decade of intense efforts. Here we show, by analysing 162 disease-related genes from a variety of medical databases with a total of almost 20,000 observed pathogenic mutations, a significant difference in the electronic properties of the population of observed mutations compared to the set of all possible mutations. Our results have implications for the role of the electronic properties of DNA in cellular processes, and hint at the possibility of prediction, early diagnosis and detection of mutation hotspots.

  9. Metabolic engineering of an ATP-neutral Embden-Meyerhof-Parnas pathway in Corynebacterium glutamicum: growth restoration by an adaptive point mutation in NADH dehydrogenase.

    PubMed

    Komati Reddy, Gajendar; Lindner, Steffen N; Wendisch, Volker F

    2015-03-01

    Corynebacterium glutamicum uses the Embden-Meyerhof-Parnas pathway of glycolysis and gains 2 mol of ATP per mol of glucose by substrate-level phosphorylation (SLP). To engineer glycolysis without net ATP formation by SLP, endogenous phosphorylating NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was replaced by nonphosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (GapN) from Clostridium acetobutylicum, which irreversibly converts glyceraldehyde-3-phosphate (GAP) to 3-phosphoglycerate (3-PG) without generating ATP. As shown recently (S. Takeno, R. Murata, R. Kobayashi, S. Mitsuhashi, and M. Ikeda, Appl Environ Microbiol 76:7154-7160, 2010, http://dx.doi.org/10.1128/AEM.01464-10), this ATP-neutral, NADPH-generating glycolytic pathway did not allow for the growth of Corynebacterium glutamicum with glucose as the sole carbon source unless hitherto unknown suppressor mutations occurred; however, these mutations were not disclosed. In the present study, a suppressor mutation was identified, and it was shown that heterologous expression of udhA encoding soluble transhydrogenase from Escherichia coli partly restored growth, suggesting that growth was inhibited by NADPH accumulation. Moreover, genome sequence analysis of second-site suppressor mutants that were able to grow faster with glucose revealed a single point mutation in the gene of non-proton-pumping NADH:ubiquinone oxidoreductase (NDH-II) leading to the amino acid change D213G, which was shared by these suppressor mutants. Since related NDH-II enzymes accepting NADPH as the substrate possess asparagine or glutamine residues at this position, D213G, D213N, and D213Q variants of C. glutamicum NDH-II were constructed and were shown to oxidize NADPH in addition to NADH. Taking these findings together, ATP-neutral glycolysis by the replacement of endogenous NAD-dependent GAPDH with NADP-dependent GapN became possible via oxidation of NADPH formed in this pathway by mutant NADPH

  10. FgPrp4 Kinase Is Important for Spliceosome B-Complex Activation and Splicing Efficiency in Fusarium graminearum

    PubMed Central

    Jiang, Cong; Li, Yang; Li, Chaohui; Liu, Huiquan; Kang, Zhensheng; Xu, Jin-Rong

    2016-01-01

    PRP4 encodes the only kinase among the spliceosome components. Although it is an essential gene in the fission yeast and other eukaryotic organisms, the Fgprp4 mutant was viable in the wheat scab fungus Fusarium graminearum. Deletion of FgPRP4 did not block intron splicing but affected intron splicing efficiency in over 60% of the F. graminearum genes. The Fgprp4 mutant had severe growth defects and produced spontaneous suppressors that were recovered in growth rate. Suppressor mutations were identified in the PRP6, PRP31, BRR2, and PRP8 orthologs in nine suppressor strains by sequencing analysis with candidate tri-snRNP component genes. The Q86K mutation in FgMSL1 was identified by whole genome sequencing in suppressor mutant S3. Whereas two of the suppressor mutations in FgBrr2 and FgPrp8 were similar to those characterized in their orthologs in yeasts, suppressor mutations in Prp6 and Prp31 orthologs or FgMSL1 have not been reported. Interestingly, four and two suppressor mutations identified in FgPrp6 and FgPrp31, respectively, all are near the conserved Prp4-phosphorylation sites, suggesting that these mutations may have similar effects with phosphorylation by Prp4 kinase. In FgPrp31, the non-sense mutation at R464 resulted in the truncation of the C-terminal 130 aa region that contains all the conserved Prp4-phosphorylation sites. Deletion analysis showed that the N-terminal 310-aa rich in SR residues plays a critical role in the localization and functions of FgPrp4. We also conducted phosphoproteomics analysis with FgPrp4 and identified S289 as the phosphorylation site that is essential for its functions. These results indicated that FgPrp4 is critical for splicing efficiency but not essential for intron splicing, and FgPrp4 may regulate pre-mRNA splicing by phosphorylation of other components of the tri-snRNP although itself may be activated by phosphorylation at S289. PMID:27058959

  11. Novel Insight into Mutational Landscape of Head and Neck Squamous Cell Carcinoma

    PubMed Central

    Gaykalova, Daria A.; Mambo, Elizabeth; Choudhary, Ashish; Houghton, Jeffery; Buddavarapu, Kalyan; Sanford, Tiffany; Darden, Will; Adai, Alex; Hadd, Andrew; Latham, Gary; Danilova, Ludmila V.; Bishop, Justin; Li, Ryan J.; Westra, William H.; Hennessey, Patrick; Koch, Wayne M.; Ochs, Michael F.; Califano, Joseph A.; Sun, Wenyue

    2014-01-01

    Development of head and neck squamous cell carcinoma (HNSCC) is characterized by accumulation of mutations in several oncogenes and tumor suppressor genes. We have formerly described the mutation pattern of HNSCC and described NOTCH signaling pathway alterations. Given the complexity of the HNSCC, here we extend the previous study to understand the overall HNSCC mutation context and to discover additional genetic alterations. We performed high depth targeted exon sequencing of 51 highly actionable cancer-related genes with a high frequency of mutation across many cancer types, including head and neck. DNA from primary tumor tissues and matched normal tissues was analyzed for 37 HNSCC patients. We identified 26 non-synonymous or stop-gained mutations targeting 11 of 51 selected genes. These genes were mutated in 17 out of 37 (46%) studied HNSCC patients. Smokers harbored 3.2-fold more mutations than non-smokers. Importantly, TP53 was mutated in 30%, NOTCH1 in 8% and FGFR3 in 5% of HNSCC. HPV negative patients harbored 4-fold more TP53 mutations than HPV positive patients. These data confirm prior reports of the HNSCC mutational profile. Additionally, we detected mutations in two new genes, CEBPA and FES, which have not been previously reported in HNSCC. These data extend the spectrum of HNSCC mutations and define novel mutation targets in HNSCC carcinogenesis, especially for smokers and HNSCC without HPV infection. PMID:24667986

  12. Tumor suppressor gene adenomatous polyposis coli downregulates intestinal transport.

    PubMed

    Rexhepaj, Rexhep; Rotte, Anand; Gu, Shuchen; Michael, Diana; Pasham, Venkanna; Wang, Kan; Kempe, Daniela S; Ackermann, Teresa F; Brücher, Björn; Fend, Falko; Föller, Michael; Lang, Florian

    2011-05-01

    Loss of function mutations of the tumor suppressor gene adenomatous polyposis coli (APC) underly the familial adenomatous polyposis. Mice carrying an inactivating mutation in the apc gene (apc (Min/+)) similarly develop intestinal polyposis. APC is effective at least in part by degrading β-catenin and lack of APC leads to markedly enhanced cellular β-catenin levels. β-Catenin has most recently been shown to upregulate the Na+/K+ ATPase. The present study, thus, explored the possibility that APC could influence intestinal transport. The abundance and localization of β-catenin were determined utilizing Western blotting and confocal microscopy, the activity of the electrogenic glucose carrier (SGLT1) was estimated from the glucose-induced current in jejunal segments utilizing Ussing chamber experiments and the Na+/H+ exchanger (NHE3) activity from Na+ -dependent re-alkalinization of cytosolic pH (ΔpH(i)) following an ammonium pulse employing BCECF fluorescence. As a result, β-catenin abundance in intestinal tissue was significantly higher in apc (Min/+) mice than in wild-type mice (apc (+/+)). The β-catenin protein was localized in the basolateral membrane. Both, the glucose-induced current and ΔpH(i) were significantly higher in apc (Min/+) mice than in apc (+/+) mice. In conclusion, intestinal electrogenic transport of glucose and intestinal Na+/H+ exchanger activity are both significantly enhanced in apc (Min/+) mice, pointing to a role of APC in the regulation of epithelial transport.

  13. A novel papillation assay for the identification of genes affecting mutation rate in Pseudomonas putida and other pseudomonads.

    PubMed

    Tagel, Mari; Tavita, Kairi; Hõrak, Rita; Kivisaar, Maia; Ilves, Heili

    2016-08-01

    Formation of microcolonies (papillae) permits easy visual screening of mutational events occurring in single colonies of bacteria. In this study, we have established a novel papillation assay employable in a wide range of pseudomonads including Pseudomonas aeruginosa and Pseudomonas putida for monitoring mutation frequency in distinct colonies. With the aid of this assay, we conducted a genome-wide search for the factors affecting mutation frequency in P. putida. Screening ∼27,000 transposon mutants for increased mutation frequency allowed us to identify 34 repeatedly targeted genes. In addition to genes involved in DNA replication and repair, we identified genes participating in metabolism and transport of secondary metabolites, cell motility, and cell wall synthesis. The highest effect on mutant frequency was observed when truA (tRNA pseudouridine synthase), mpl (UDP-N-acetylmuramate-alanine ligase) or gacS (multi-sensor hybrid histidine kinase) were inactivated. Inactivation of truA elevated the mutant frequency only in growing cells, while the deficiency of gacS affected mainly stationary-phase mutagenesis. Thus, our results demonstrate the feasibility of the assay for isolating mutants with elevated mutagenesis in growing as well as stationary-phase bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. A novel germline inactivating mutation in the CASR gene in an Italian kindred affected by familial hypocalciuric hypercalcemia.

    PubMed

    Falchetti, Alberto; Gozzini, Alessia; Terranegra, Annalisa; Soldati, Laura; Vezzoli, Giuseppe; Leoncini, Gigliola; Giusti, Francesca; Franceschelli, Francesco; Masi, Laura; Tanini, Annalisa; Cavalli, Loredana; Brandi, Maria Luisa

    2012-05-01

    Familial hypocalciuric hypercalcemia (FHH) syndrome is a rare benign condition, inherited as an autosomal dominant trait, in which inactivating mutations of the calcium-sensing receptor (CASR) gene affects the body's ability to regulate calcium homeostasis. Its outcome is featured by increased levels of serum calcium, moderate hypophosphatemia, and inadequately normal or elevated circulating parathyroid hormone levels. Affected patients are mostly asymptomatic and do not benefit from surgical resection of their mildly enlarged parathyroids. We evaluated for hypercalcemia an Italian family that was identified via a young adult male proband referred to our center for parathyroidectomy. The patients and the family members were evaluated both biochemically and genetically as suspected FHH subjects. An in vitro functional study was performed by site-directed mutagenesis, and CASR activity was monitored by measuring intracellular calcium ([Ca(2)(+)](i)). The patient had a novel germline heterozygous CASR mutation (c.361_364GATT; p.D121del/fsX122). The mutation caused a premature stop codon at codon 122, exiting a truncated protein. The biochemical phenotype of all family members carrying the heterozygous deletion was concordant with classic FHH syndrome. Our findings confirm the role of CASR gene mutational analysis to offer a valuable addition for the recognition of FHH in hypercalcemic patients not yet characterized for a positive familial history of hypercalcemia, the only condition that identifies CASR gene mutations in hypercalcemia.

  15. Suppressor of cytokine signaling 1 interacts with oncogenic lymphocyte-specific protein tyrosine kinase.

    PubMed

    Venkitachalam, Srividya; Chueh, Fu-Yu; Leong, King-Fu; Pabich, Samantha; Yu, Chao-Lan

    2011-03-01

    Lymphocyte-specific protein tyrosine kinase (Lck) plays a key role in T cell signal transduction and is tightly regulated by phosphorylation and dephosphorylation. Lck can function as an oncoprotein when overexpressed or constantly activated by mutations. Our previous studies showed that Lck-induced cellular transformation could be suppressed by enforced expression of suppressor of cytokine signaling 1 (SOCS1), a SOCS family member involved in the negative feedback control of cytokine signaling. We observed attenuated Lck kinase activity in SOCS1-expressing cells, suggesting an important role of SOCS in regulating Lck functions. It remains largely unknown whether and how SOCS proteins interact with the oncogenic Lck kinase. Here, we report that among four SOCS family proteins, SOCS1, SOCS2, SOCS3 and CIS (cytokine-inducible SH2 domain containing protein), SOCS1 has the highest affinity in binding to the oncogenic Lck kinase. We identified the positive regulatory phosphotyrosine 394 residue in the kinase domain as the key interacting determinant in Lck. Additionally, the Lck kinase domain alone is sufficient to bind SOCS1. While the SH2 domain in SOCS1 is important in its association with the oncogenic Lck kinase, other functional domains may also contribute to overall binding affinity. These findings provide important mechanistic insights into the role of SOCS proteins as tumor suppressors in cells transformed by oncogenic protein tyrosine kinases.

  16. Suppressor of cytokine signaling 1 interacts with oncogenic lymphocyte-specific protein tyrosine kinase

    PubMed Central

    VENKITACHALAM, SRIVIDYA; CHUEH, FU-YU; LEONG, KING-FU; PABICH, SAMANTHA; YU, CHAO-LAN

    2011-01-01

    Lymphocyte-specific protein tyrosine kinase (Lck) plays a key role in T cell signal transduction and is tightly regulated by phosphorylation and dephosphorylation. Lck can function as an oncoprotein when overexpressed or constantly activated by mutations. Our previous studies showed that Lck-induced cellular transformation could be suppressed by enforced expression of suppressor of cytokine signaling 1 (SOCS1), a SOCS family member involved in the negative feedback control of cytokine signaling. We observed attenuated Lck kinase activity in SOCS1-expressing cells, suggesting an important role of SOCS in regulating Lck functions. It remains largely unknown whether and how SOCS proteins interact with the oncogenic Lck kinase. Here we report that, among four SOCS family proteins, SOCS1, SOCS2, SOCS3 and CIS (cytokine–inducible SH2 domain containing protein), SOCS1 has the highest affinity in binding to the oncogenic Lck kinase. We identify the positive regulatory phospho-tyrosine 394 residue in the kinase domain as the key interacting determinant in Lck. Additionally, the Lck kinase domain alone is sufficient to bind SOCS1. While the SH2 domain in SOCS1 is important in its association with the oncogenic Lck kinase, other functional domains may also contribute to overall binding affinity. These findings provide important mechanistic insights into the role of SOCS proteins as tumor suppressors in cells transformed by oncogenic protein tyrosine kinases. PMID:21234523

  17. Identification and Characterization of Genes That Interact with Lin-12 in Caenorhabditis Elegans

    PubMed Central

    Tax, F. E.; Thomas, J. H.; Ferguson, E. L.; Horvitz, H. R.

    1997-01-01

    We identified and characterized 14 extragenic mutations that suppressed the dominant egg-laying defect of certain lin-12 gain-of-function mutations. These suppressors defined seven genes: sup-17, lag-2, sel-4, sel-5, sel-6, sel-7 and sel-8. Mutations in six of the genes are recessive suppressors, whereas the two mutations that define the seventh gene, lag-2, are semi-dominant suppressors. These suppressor mutations were able to suppress other lin-12 gain-of-function mutations. The suppressor mutations arose at a very low frequency per gene, 10-50 times below the typical loss-of-function mutation frequency. The suppressor mutations in sup-17 and lag-2 were shown to be rare non-null alleles, and we present evidence that null mutations in these two genes cause lethality. Temperature-shift studies for two suppressor genes, sup-17 and lag-2, suggest that both genes act at approximately the same time as lin-12 in specifying a cell fate. Suppressor alleles of six of these genes enhanced a temperature-sensitive loss-of-function allele of glp-1, a gene related to lin-12 in structure and function. Our analysis of these suppressors suggests that the majority of these genes are part of a shared lin-12/glp-1 signal transduction pathway, or act to regulate the expression or stability of lin-12 and glp-1. PMID:9409830

  18. Inhibition of Mycobacterial Infection by the Tumor Suppressor PTEN*

    PubMed Central

    Huang, Guochang; Redelman-Sidi, Gil; Rosen, Neal; Glickman, Michael S.; Jiang, Xuejun

    2012-01-01

    The tumor suppressor PTEN is a lipid phosphatase that is frequently mutated in various human cancers. PTEN suppresses tumor cell proliferation, survival, and growth mainly by inhibiting the PI3K-Akt signaling pathway through dephosphorylation of phosphatidylinositol 3,4,5-triphosphate. In addition to it role in tumor suppression, the PTEN-PI3K pathway controls many cellular functions, some of which may be important for cellular resistance to infection. Currently, the intersection between tumorigenic signaling pathways and cellular susceptibility to infection is not well defined. In this study we report that PTEN signaling regulates infection of both noncancerous and cancerous cells by multiple intracellular mycobacterial pathogens and that pharmacological modulation of PTEN signaling can affect mycobacterial infection. We found that PTEN deficiency renders multiple types of cells hyper-susceptible to infection by Mycoplasma and Mycobacterium bovis Bacillus Calmette-Guérin (BCG). The lipid phosphatase activity of PTEN is required for attenuating infection. Furthermore, we found mycobacterial infection activates host cell Akt phosphorylation, and pharmacological inhibition of Akt or PI3K activity reduced levels of intracellular infection. Intriguingly, inhibition of mTOR, one of the downstream components of the Akt signaling and a promising cancer therapeutic target, also lowered intracellular Bacillus Calmette-Guérin levels in mammary epithelial cancer MCF-7 cells. These findings demonstrate a critical role of PTEN-regulated pathways in pathogen infection. The relationship of PTEN-PI3K-Akt mTOR status and susceptibility to mycobacterial infection suggests that the interaction of mycobacterial pathogens with cancer cells may be influenced by genetic alterations in the tumor cells. PMID:22613768

  19. Thermo-labile stability of sigmaH (Spo0H) in temperature-sensitive spo0H mutants of Bacillus subtilis can be suppressed by mutations in RNA polymerase beta subunit.

    PubMed

    Ohashi, Y; Sugimaru, K; Nanamiya, H; Sebata, T; Asai, K; Yoshikawa, H; Kawamura, F

    1999-03-18

    We isolated novel temperature-sensitive mutants of spo0H, spo0H1 and spo0H5, having E61K and G30E amino-acid substitutions within the sigmaH protein, respectively, and located in the highly conserved region, "2", among prokaryotic sigma factors that participates in binding to core enzyme of RNA polymerase. These mutants showed a sporulation-deficient phenotype at 43 degrees C. Moreover, we successfully isolated suppressor mutants that were spontaneously generated from the spo0H mutants. Our genetic analysis of these suppressor mutations revealed that the suppressor mutations are within the rpoB gene coding for the beta subunit of RNA polymerase. The mutations caused single amino-acid substitutions, E857A and P1055S, in rpoB18 and rpoB532 mutants that were generated from spo0H1 and spo0H5, respectively. Whereas the sigmaH-dependent expression of a spo0A-bgaB fusion was greatly reduced in both spo0H mutants, their expression was partially restored in the suppressor mutants at 43 degrees C. Western blot analysis showed that the level of sigmaH protein in the wild type increased between T0 and T2 and decreased after T3, while the level of sigmaH protein in spo0H mutants was greatly reduced throughout growth, indicating that the mutant sigmaH proteins were rapidly degraded by some unknown proteolytic enzyme(s). The analysis of the half-life of sigmaH protein showed that the short life of sigmaH in spo0H mutants is prolonged in the suppressor mutants. These findings suggest that, at least to some extent, the process of E-sigmaH formation may be involved in stabilization of sigmaH at the onset of sporulation.

  20. Repurposing Pan-HDAC Inhibitors for ARID1A-Mutated Ovarian Cancer.

    PubMed

    Fukumoto, Takeshi; Park, Pyoung Hwa; Wu, Shuai; Fatkhutdinov, Nail; Karakashev, Sergey; Nacarelli, Timothy; Kossenkov, Andrew V; Speicher, David W; Jean, Stephanie; Zhang, Lin; Wang, Tian-Li; Shih, Ie-Ming; Conejo-Garcia, Jose R; Bitler, Benjamin G; Zhang, Rugang

    2018-03-27

    ARID1A, a subunit of the SWI/SNF complex, is among the most frequently mutated genes across cancer types. ARID1A is mutated in more than 50% of ovarian clear cell carcinomas (OCCCs), diseases that have no effective therapy. Here, we show that ARID1A mutation confers sensitivity to pan-HDAC inhibitors such as SAHA in ovarian cancers. This correlated with enhanced growth suppression induced by the inhibition of HDAC2 activity in ARID1A-mutated cells. HDAC2 interacts with EZH2 in an ARID1A status-dependent manner. HDAC2 functions as a co-repressor of EZH2 to suppress the expression of EZH2/ARID1A target tumor suppressor genes such as PIK3IP1 to inhibit proliferation and promote apoptosis. SAHA reduced the growth and ascites of the ARID1A-inactivated OCCCs in both orthotopic and genetic mouse models. This correlated with a significant improvement of survival of mice bearing ARID1A-mutated OCCCs. These findings provided preclinical rationales for repurposing FDA-approved pan-HDAC inhibitors for treating ARID1A-mutated cancers. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. [Identification of a novel splicing mutation of PHEX gene in a pedigree affected with X-linked hypophosphatemia].

    PubMed

    Li, Jie; Xu, Peiwen; Huang, Sexin; Gao, Ming; Zou, Yang; Kang, Ranran; Gao, Yuan

    2017-04-10

    To identify potential mutation of PHEX gene in two patients from a family affected with X-linked hypophosphatemia (XLH). PCR and Sanger sequencing were performed on blood samples from the patients and 100 healthy controls. Reverse transcription-PCR (RT-PCR) was used to determine the mRNA expression in patient samples. A splicing site mutation, IVS21+2T>G, was found in the PHEX gene in both patients but not among the 100 healthy controls. RT-PCR confirmed that exon 21 of the PHEX gene was deleted. The novel splicing mutation IVS21+2T>G of the PHEX gene probably underlies the XLH in this pedigree. At the mRNA level, the mutation has led to removal of exon 21 and shift of the open reading frame (p.Val691fsx), resulting in premature termination of protein translation.

  2. Different inactivating mutations of the mineralocorticoid receptor in fourteen families affected by type I pseudohypoaldosteronism.

    PubMed

    Sartorato, Paola; Lapeyraque, Anne-Laure; Armanini, Decio; Kuhnle, Ursula; Khaldi, Yasmina; Salomon, Rémi; Abadie, Véronique; Di Battista, Eliana; Naselli, Arturo; Racine, Alain; Bosio, Maurizio; Caprio, Massimiliano; Poulet-Young, Véronique; Chabrolle, Jean-Pierre; Niaudet, Patrick; De Gennes, Christiane; Lecornec, Marie-Hélène; Poisson, Elodie; Fusco, Anna Maria; Loli, Paola; Lombès, Marc; Zennaro, Maria-Christina

    2003-06-01

    We have analyzed the human mineralocorticoid receptor (hMR) gene in 14 families with autosomal dominant or sporadic pseudohypoaldosteronism (PHA1), a rare form of mineralocorticoid resistance characterized by neonatal renal salt wasting and failure to thrive. Six heterozygous mutations were detected. Two frameshift mutations in exon 2 (insT1354, del8bp537) and one nonsense mutation in exon 4 (C2157A, Cys645stop) generate truncated proteins due to premature stop codons. Three missense mutations (G633R, Q776R, L979P) differently affect hMR function. The DNA binding domain mutant R633 exhibits reduced maximal transactivation, although its binding characteristics and ED(50) of transactivation are comparable with wild-type hMR. Ligand binding domain mutants R776 and P979 present reduced or absent aldosterone binding, respectively, which is associated with reduced or absent ligand-dependent transactivation capacity. Finally, P979 possesses a transdominant negative effect on wild-type hMR activity, whereas mutations G633R and Q776R probably result in haploinsufficiency in PHA1 patients. We conclude that hMR mutations are a common feature of autosomal dominant PHA1, being found in 70% of our familial cases. Their absence in some families underscores the importance of an extensive investigation of the hMR gene and the role of precise diagnostic procedures to allow for identification of other genes potentially involved in the disease.

  3. Somatic mutations in histiocytic sarcoma identified by next generation sequencing.

    PubMed

    Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo

    2016-08-01

    Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.

  4. Mutation in the Monocarboxylate Transporter 12 Gene Affects Guanidinoacetate Excretion but Does Not Cause Glucosuria.

    PubMed

    Dhayat, Nasser; Simonin, Alexandre; Anderegg, Manuel; Pathare, Ganesh; Lüscher, Benjamin P; Deisl, Christine; Albano, Giuseppe; Mordasini, David; Hediger, Matthias A; Surbek, Daniel V; Vogt, Bruno; Sass, Jörn Oliver; Kloeckener-Gruissem, Barbara; Fuster, Daniel G

    2016-05-01

    A heterozygous mutation (c.643C>A; p.Q215X) in the monocarboxylate transporter 12-encoding gene MCT12 (also known as SLC16A12) that mediates creatine transport was recently identified as the cause of a syndrome with juvenile cataracts, microcornea, and glucosuria in a single family. Whereas the MCT12 mutation cosegregated with the eye phenotype, poor correlation with the glucosuria phenotype did not support a pathogenic role of the mutation in the kidney. Here, we examined MCT12 in the kidney and found that it resides on basolateral membranes of proximal tubules. Patients with MCT12 mutation exhibited reduced plasma levels and increased fractional excretion of guanidinoacetate, but normal creatine levels, suggesting that MCT12 may function as a guanidinoacetate transporter in vivo However, functional studies in Xenopus oocytes revealed that MCT12 transports creatine but not its precursor, guanidinoacetate. Genetic analysis revealed a separate, undescribed heterozygous mutation (c.265G>A; p.A89T) in the sodium/glucose cotransporter 2-encoding gene SGLT2 (also known as SLC5A2) in the family that segregated with the renal glucosuria phenotype. When overexpressed in HEK293 cells, the mutant SGLT2 transporter did not efficiently translocate to the plasma membrane, and displayed greatly reduced transport activity. In summary, our data indicate that MCT12 functions as a basolateral exit pathway for creatine in the proximal tubule. Heterozygous mutation of MCT12 affects systemic levels and renal handling of guanidinoacetate, possibly through an indirect mechanism. Furthermore, our data reveal a digenic syndrome in the index family, with simultaneous MCT12 and SGLT2 mutation. Thus, glucosuria is not part of the MCT12 mutation syndrome. Copyright © 2016 by the American Society of Nephrology.

  5. Germline Missense Mutations Affecting KRAS Isoform B Are Associated with a Severe Noonan Syndrome Phenotype

    PubMed Central

    Carta, Claudio; Pantaleoni, Francesca; Bocchinfuso, Gianfranco; Stella, Lorenzo; Vasta, Isabella; Sarkozy, Anna; Digilio, Cristina; Palleschi, Antonio; Pizzuti, Antonio; Grammatico, Paola; Zampino, Giuseppe; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

    2006-01-01

    Noonan syndrome (NS) is a developmental disorder characterized by short stature, facial dysmorphia, congenital heart disease, and multiple skeletal and hematologic defects. NS is an autosomal dominant trait and is genetically heterogeneous. Gain of function of SHP-2, a protein tyrosine phosphatase that positively modulates RAS signaling, is observed in nearly 50% of affected individuals. Here, we report the identification of heterozygous KRAS gene mutations in two subjects exhibiting a severe NS phenotype with features overlapping those of cardiofaciocutaneous and Costello syndromes. Both mutations were de novo and affected exon 6, which encodes the C-terminal portion of KRAS isoform B but does not contribute to KRAS isoform A. Structural analysis indicated that both substitutions (Val152Gly and Asp153Val) perturb the conformation of the guanine ring–binding pocket of the protein, predicting an increase in the guanine diphosphate/guanine triphosphate (GTP) dissociation rate that would favor GTP binding to the KRASB isoform and bypass the requirement for a guanine nucleotide exchange factor. PMID:16773572

  6. Human germline hedgehog pathway mutations predispose to fatty liver.

    PubMed

    Guillen-Sacoto, Maria J; Martinez, Ariel F; Abe, Yu; Kruszka, Paul; Weiss, Karin; Everson, Joshua L; Bataller, Ramon; Kleiner, David E; Ward, Jerrold M; Sulik, Kathleen K; Lipinski, Robert J; Solomon, Benjamin D; Muenke, Maximilian

    2017-10-01

    Non-alcoholic fatty liver disease (NAFLD) is the most common form of liver disease. Activation of hedgehog (Hh) signaling has been implicated in the progression of NAFLD and proposed as a therapeutic target; however, the effects of Hh signaling inhibition have not been studied in humans with germline mutations that affect this pathway. Patients with holoprosencephaly (HPE), a disorder associated with germline mutations disrupting Sonic hedgehog (SHH) signaling, were clinically evaluated for NAFLD. A combined mouse model of Hh signaling attenuation (Gli2 heterozygous null: Gli2 +/- ) and diet-induced NAFLD was used to examine aspects of NAFLD and hepatic gene expression profiles, including molecular markers of hepatic fibrosis and inflammation. Patients with HPE had a higher prevalence of liver steatosis compared to the general population, independent of obesity. Exposure of Gli2 +/- mice to fatty liver-inducing diets resulted in increased liver steatosis compared to wild-type mice. Similar to humans, this effect was independent of obesity in the mutant mice and was associated with decreased expression of pro-fibrotic and pro-inflammatory genes, and increased expression of PPARγ, a potent anti-fibrogenic and anti-inflammatory regulator. Interestingly, tumor suppressors p53 and p16INK4 were found to be downregulated in the Gli2 +/- mice exposed to a high-fat diet. Our results indicate that germline mutations disrupting Hh signaling promotes liver steatosis, independent of obesity, with reduced fibrosis. While Hh signaling inhibition has been associated with a better NAFLD prognosis, further studies are required to evaluate the long-term effects of mutations affecting this pathway. Lay summary: Non-alcoholic fatty liver disease (NAFLD) is characterized by excess fat deposition in the liver predominantly due to high calorie intake and a sedentary lifestyle. NAFLD progression is usually accompanied by activation of the Sonic hedgehog (SHH) pathway leading to fibrous

  7. Functional and splicing defect analysis of 23 ACVRL1 mutations in a cohort of patients affected by Hereditary Hemorrhagic Telangiectasia

    PubMed Central

    Alaa el Din, Ferdos; Patri, Sylvie; Thoreau, Vincent; Rodriguez-Ballesteros, Montserrat; Hamade, Eva; Bailly, Sabine; Gilbert-Dussardier, Brigitte; Abou Merhi, Raghida; Kitzis, Alain

    2015-01-01

    Hereditary Hemorrhagic Telangiectasia syndrome (HHT) or Rendu-Osler-Weber (ROW) syndrome is an autosomal dominant vascular disorder. Two most common forms of HHT, HHT1 and HHT2, have been linked to mutations in the endoglin (ENG) and activin receptor-like kinase 1 (ACVRL1or ALK1) genes respectively. This work was designed to examine the pathogenicity of 23 nucleotide variations in ACVRL1 gene detected in more than 400 patients. Among them, 14 missense mutations and one intronic variant were novels, and 8 missense mutations were previously identified with questionable implication in HHT2. The functionality of missense mutations was analyzed in response to BMP9 (specific ligand of ALK1), the maturation of the protein products and their localization were analyzed by western blot and fluorescence microscopy. The splicing impairment of the intronic and of two missense mutations was examined by minigene assay. Functional analysis showed that 18 out of 22 missense mutations were defective. Splicing analysis revealed that one missense mutation (c.733A>G, p.Ile245Val) affects the splicing of the harboring exon 6. Similarly, the intronic mutation outside the consensus splicing sites (c.1048+5G>A in intron 7) was seen pathogenic by splicing study. Both mutations induce a frame shift creating a premature stop codon likely resulting in mRNA degradation by NMD surveillance mechanism. Our results confirm the haploinsufficiency model proposed for HHT2. The affected allele of ACVRL1 induces mRNA degradation or the synthesis of a protein lacking the receptor activity. Furthermore, our data demonstrate that functional and splicing analyses together, represent two robust diagnostic tools to be used by geneticists confronted with novel or conflicted ACVRL1 mutations. PMID:26176610

  8. Dynamic analysis of periodic vibration suppressors with multiple secondary oscillators

    NASA Astrophysics Data System (ADS)

    Ma, Jiangang; Sheng, Meiping; Guo, Zhiwei; Qin, Qi

    2018-06-01

    A periodic vibration suppressor with multiple secondary oscillators is examined in this paper to reduce the low-frequency vibration. The band-gap properties of infinite periodic structure and vibration transmission properties of finite periodic structure attached with secondary oscillators with arbitrary degree of freedom are thoroughly analyzed by the plane-wave-expansion method. A simply supported plate with a periodic rectangular array of vibration suppressors is considered. The dynamic model of this periodic structure is established and the equation of harmonic vibration response is theoretically derived and numerically examined. Compared with the simply supported plate without attached suppressors, the proposed plate can obtain better vibration control, and the vibration response can be effectively reduced in several frequency bands owing to the multiple band-gap property. By analyzing the modal properties of the periodic vibration suppressors, the relationship between modal frequencies and the parameters of spring stiffness and mass is established. With the numerical results, the design guidance of the locally resonant structure with multiple secondary oscillators is proposed to provide practical guidance for application. Finally, a practical periodic specimen is designed and fabricated, and then an experiment is carried out to validate the effectiveness of periodic suppressors in the reality. The results show that the experimental band gaps have a good coincidence with those in the theoretical model, and the low-frequency vibration of the plate with periodic suppressors can be effectively reduced in the tuned band gaps. Both the theoretical results and experimental results prove that the design method is effective and the structure with periodic suppressors has a promising application in engineering.

  9. Germline CDKN2A/P16INK4A mutations contribute to genetic determinism of sarcoma.

    PubMed

    Jouenne, Fanélie; Chauvot de Beauchene, Isaure; Bollaert, Emeline; Avril, Marie-Françoise; Caron, Olivier; Ingster, Olivier; Lecesne, Axel; Benusiglio, Patrick; Terrier, Philippe; Caumette, Vincent; Pissaloux, Daniel; de la Fouchardière, Arnaud; Cabaret, Odile; N'Diaye, Birama; Velghe, Amélie; Bougeard, Gaelle; Mann, Graham J; Koscielny, Serge; Barrett, Jennifer H; Harland, Mark; Newton-Bishop, Julia; Gruis, Nelleke; Van Doorn, Remco; Gauthier-Villars, Marion; Pierron, Gaelle; Stoppa-Lyonnet, Dominique; Coupier, Isabelle; Guimbaud, Rosine; Delnatte, Capucine; Scoazec, Jean-Yves; Eggermont, Alexander M; Feunteun, Jean; Tchertanov, Luba; Demoulin, Jean-Baptiste; Frebourg, Thierry; Bressac-de Paillerets, Brigitte

    2017-09-01

    Sarcomas are rare mesenchymal malignancies whose pathogenesis is poorly understood; both environmental and genetic risk factors could contribute to their aetiology. We performed whole-exome sequencing (WES) in a familial aggregation of three individuals affected with soft-tissue sarcoma (STS) without TP53 mutation (Li-Fraumeni-like, LFL) and found a shared pathogenic mutation in CDKN2A tumour suppressor gene. We searched for individuals with sarcoma among 474 melanoma-prone families with a CDKN2A -/+ genotype and for CDKN2A mutations in 190 TP53 -negative LFL families where the index case was a sarcoma. Including the initial family, eight independent sarcoma cases carried a germline mutation in the CDKN2A /p16 INK4A gene. In five out of seven formalin-fixed paraffin-embedded sarcomas, heterozygosity was lost at germline CDKN2A mutations sites demonstrating complete loss of function. As sarcomas are rare in CDKN2A /p16 INK4A carriers, we searched in constitutional WES of nine carriers for potential modifying rare variants and identified three in platelet-derived growth factor receptor ( PDGFRA ) gene. Molecular modelling showed that two never-described variants could impact the PDGFRA extracellular domain structure. Germline mutations in CDKN2A /P16 INK4A , a gene known to predispose to hereditary melanoma, pancreatic cancer and tobacco-related cancers, account also for a subset of hereditary sarcoma. In addition, we identified PDGFRA as a candidate modifier gene. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  10. A theoretical approach to sound propagation and radiation for ducts with suppressors

    NASA Technical Reports Server (NTRS)

    Rice, E. J.; Sawdy, D. T.

    1981-01-01

    The several phenomena involved in theoretical prediction of the far-field sound radiation attenuation from an acoustically lined duct were studied. These include absorption by the suppressor, termination reflections, and far-field radiation. Extensive parametric studies show that the suppressor absorption performance can be correlated with mode cut-off ratio or angle of propagation. The other phenomena can be shown to depend explicitly upon mode cut-off ratio. A complete system can thus be generated which can be used to evaluate aircraft sound suppressors and which can be related to the sound source through the cut-off ratio-acoustic power distribution. Although the method is most fully developed for inlet suppressors, several aft radiated noise phenomena are also discussed. This simplified suppressor design and evaluation method is summarized, the recent improvements in the technique are presented, and areas where further refinement is necessary are discussed. Noise suppressor data from engine experiments are compared with the theoretical calculations.

  11. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.

    PubMed

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  12. Mutation Analysis of Inhibitory Guanine Nucleotide Binding Protein Alpha (GNAI) Loci in Young and Familial Pituitary Adenomas

    PubMed Central

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15–20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1 , GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas. PMID:25291362

  13. How Single-site Mutation Affects HP Lattice Proteins

    NASA Astrophysics Data System (ADS)

    Shi, Guangjie; Landau, David P.; Vogel, Thomas; Wüst, Thomas; Li, Ying Wai

    2014-03-01

    We developed a heuristic method based on Wang-Landauand multicanonical sampling for determining the ground-state degeneracy of HP lattice proteins . Our algorithm allowed the most precise estimations of the (sometimes substantial) ground-state degeneracies of some widely studied HP sequences. We investigated the effects of single-site mutation on specific long HP lattice proteins comprehensively, including structural changes in ground-states, changes of ground-state degeneracy and thermodynamic properties of the systems. Both extremely sensitive and insensitive cases have been observed; consequently, properties such as specific heat, tortuosities etc. may be either largely unaffected or may change significantly due to mutation. More interestingly, mutation can even induce a lower ground-state energy in a few cases. Supported by NSF.

  14. An evidence-based knowledgebase of metastasis suppressors to identify key pathways relevant to cancer metastasis

    PubMed Central

    Zhao, Min; Li, Zhe; Qu, Hong

    2015-01-01

    Metastasis suppressor genes (MS genes) are genes that play important roles in inhibiting the process of cancer metastasis without preventing growth of the primary tumor. Identification of these genes and understanding their functions are critical for investigation of cancer metastasis. Recent studies on cancer metastasis have identified many new susceptibility MS genes. However, the comprehensive illustration of diverse cellular processes regulated by metastasis suppressors during the metastasis cascade is lacking. Thus, the relationship between MS genes and cancer risk is still unclear. To unveil the cellular complexity of MS genes, we have constructed MSGene (http://MSGene.bioinfo-minzhao.org/), the first literature-based gene resource for exploring human MS genes. In total, we manually curated 194 experimentally verified MS genes and mapped to 1448 homologous genes from 17 model species. Follow-up functional analyses associated 194 human MS genes with epithelium/tissue morphogenesis and epithelia cell proliferation. In addition, pathway analysis highlights the prominent role of MS genes in activation of platelets and coagulation system in tumor metastatic cascade. Moreover, global mutation pattern of MS genes across multiple cancers may reveal common cancer metastasis mechanisms. All these results illustrate the importance of MSGene to our understanding on cell development and cancer metastasis. PMID:26486520

  15. The two single nucleotide polymorphisms in the H37/RBM5 tumour suppressor gene at 3p21.3 correlated with different subtypes of non-small cell lung cancers

    PubMed Central

    Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.

    2007-01-01

    Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309

  16. Rapid Detection Method for the Four Most Common CHEK2 Mutations Based on Melting Profile Analysis.

    PubMed

    Borun, Pawel; Salanowski, Kacper; Godlewski, Dariusz; Walkowiak, Jaroslaw; Plawski, Andrzej

    2015-12-01

    CHEK2 is a tumor suppressor gene, and the mutations affecting the functionality of the protein product increase cancer risk in various organs. The elevated risk, in a significant percentage of cases, is determined by the occurrence of one of the four most common mutations in the CHEK2 gene, including c.470T>C (p.I157T), c.444+1G>A (IVS2+1G>A), c.1100delC, and c.1037+1538_1224+328del5395 (del5395). We have developed and validated a rapid and effective method for their detection based on high-resolution melting analysis and comparative-high-resolution melting, a novel approach enabling simultaneous detection of copy number variations. The analysis is performed in two polymerase chain reactions followed by melting analysis, without any additional reagents or handling other than that used in standard high-resolution melting. Validation of the method was conducted in a group of 103 patients with diagnosed breast cancer, a group of 240 unrelated patients with familial history of cancer associated with the CHEK2 gene mutations, and a 100-person control group. The results of the analyses for all three groups were fully consistent with the results from other methods. The method we have developed improves the identification of the CHEK2 mutation carriers, reduces the cost of such analyses, as well as facilitates their implementation. Along with the increased efficiency, the method maintains accuracy and reliability comparable to other more labor-consuming techniques.

  17. Infrared suppressor effect on T63 turboshaft engine performance

    NASA Technical Reports Server (NTRS)

    Bailey, E. E.; Civinskas, K. C.; Walker, C. L.

    1978-01-01

    Tests were conducted to determine if there are performance penalties associated with the installation of infrared (IR) suppressors on the T63-A-700 turboshaft engine. The testing was done in a sea-level, static test cell. The same engine (A-E402808 B) was run with the standard OH-58 aircraft exhaust stacks and with the ejector-type IR suppressors in order to make a valid comparison. Repeatability of the test results for the two configurations was verified by rerunning the conditions over a period of days. Test results showed no measurable difference in performance between the standard exhaust stacks and the IR suppressors.

  18. Genotype-Phenotype Correlation in NF1: Evidence for a More Severe Phenotype Associated with Missense Mutations Affecting NF1 Codons 844-848.

    PubMed

    Koczkowska, Magdalena; Chen, Yunjia; Callens, Tom; Gomes, Alicia; Sharp, Angela; Johnson, Sherrell; Hsiao, Meng-Chang; Chen, Zhenbin; Balasubramanian, Meena; Barnett, Christopher P; Becker, Troy A; Ben-Shachar, Shay; Bertola, Debora R; Blakeley, Jaishri O; Burkitt-Wright, Emma M M; Callaway, Alison; Crenshaw, Melissa; Cunha, Karin S; Cunningham, Mitch; D'Agostino, Maria D; Dahan, Karin; De Luca, Alessandro; Destrée, Anne; Dhamija, Radhika; Eoli, Marica; Evans, D Gareth R; Galvin-Parton, Patricia; George-Abraham, Jaya K; Gripp, Karen W; Guevara-Campos, Jose; Hanchard, Neil A; Hernández-Chico, Concepcion; Immken, LaDonna; Janssens, Sandra; Jones, Kristi J; Keena, Beth A; Kochhar, Aaina; Liebelt, Jan; Martir-Negron, Arelis; Mahoney, Maurice J; Maystadt, Isabelle; McDougall, Carey; McEntagart, Meriel; Mendelsohn, Nancy; Miller, David T; Mortier, Geert; Morton, Jenny; Pappas, John; Plotkin, Scott R; Pond, Dinel; Rosenbaum, Kenneth; Rubin, Karol; Russell, Laura; Rutledge, Lane S; Saletti, Veronica; Schonberg, Rhonda; Schreiber, Allison; Seidel, Meredith; Siqveland, Elizabeth; Stockton, David W; Trevisson, Eva; Ullrich, Nicole J; Upadhyaya, Meena; van Minkelen, Rick; Verhelst, Helene; Wallace, Margaret R; Yap, Yoon-Sim; Zackai, Elaine; Zonana, Jonathan; Zurcher, Vickie; Claes, Kathleen; Martin, Yolanda; Korf, Bruce R; Legius, Eric; Messiaen, Ludwine M

    2018-01-04

    Neurofibromatosis type 1 (NF1), a common genetic disorder with a birth incidence of 1:2,000-3,000, is characterized by a highly variable clinical presentation. To date, only two clinically relevant intragenic genotype-phenotype correlations have been reported for NF1 missense mutations affecting p.Arg1809 and a single amino acid deletion p.Met922del. Both variants predispose to a distinct mild NF1 phenotype with neither externally visible cutaneous/plexiform neurofibromas nor other tumors. Here, we report 162 individuals (129 unrelated probands and 33 affected relatives) heterozygous for a constitutional missense mutation affecting one of five neighboring NF1 codons-Leu844, Cys845, Ala846, Leu847, and Gly848-located in the cysteine-serine-rich domain (CSRD). Collectively, these recurrent missense mutations affect ∼0.8% of unrelated NF1 mutation-positive probands in the University of Alabama at Birmingham (UAB) cohort. Major superficial plexiform neurofibromas and symptomatic spinal neurofibromas were more prevalent in these individuals compared with classic NF1-affected cohorts (both p < 0.0001). Nearly half of the individuals had symptomatic or asymptomatic optic pathway gliomas and/or skeletal abnormalities. Additionally, variants in this region seem to confer a high predisposition to develop malignancies compared with the general NF1-affected population (p = 0.0061). Our results demonstrate that these NF1 missense mutations, although located outside the GAP-related domain, may be an important risk factor for a severe presentation. A genotype-phenotype correlation at the NF1 region 844-848 exists and will be valuable in the management and genetic counseling of a significant number of individuals. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Long non-coding RNA tumor suppressor candidate 7 functions as a tumor suppressor and inhibits proliferation in osteosarcoma.

    PubMed

    Cong, Menglin; Li, Jianmin; Jing, Rui; Li, Zhenzhong

    2016-07-01

    Osteosarcoma is the most common malignant tumor of bone. Recent studies have proven long non-coding RNAs (lncRNAs) play important roles in the tumorigenesis and progression of cancer. However, few lncRNAs have been investigated in osteosarcoma. Here, we reported a novel lncRNA, tumor suppressor candidate 7 (TUSC7), was significantly downregulated in osteosarcoma tissues compared with paired non-tumor tissues and low expression of TUSC7 indicated poor survival (HR = 0.313, 95 % confidence interval (CI) 0.092-0.867) of osteosarcoma patients. Further analysis revealed that loss copy number of TUSC7 was correlated with low expression of TUSC7, and additionally, loss of TUSC7 copy number also indicated poor prognosis (HR = 3.994, 95 % CI 1.147-13.91) of osteosarcoma patients. Two osteosarcoma cell lines, HOS and MG63, were utilized to investigate biological function of TUSC7. Cell counting kit 8 (CCK-8) assay revealed that after silence of TUSC7, cell proliferation ability increased and the colony formation ability also increased. Further results showed that cell cycle was not affected by treatment of si-TUSC7, while the percentage of apoptotic cells decreased. Western blot showed that after silence of TUSC7, the proapoptotic Bcl2 expression was downregulated. Finally, we established xenograft tumor models in nude mice with MG63 cells. Compared with negative control group, silence of TUSC7 significantly promoted tumor growth in vivo. Thus, we demonstrated that TUSC7 could be a potential tumor suppressor in osteosarcoma.

  20. Mutations in the putative calcium-binding domain of polyomavirus VP1 affect capsid assembly

    NASA Technical Reports Server (NTRS)

    Haynes, J. I. 2nd; Chang, D.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Calcium ions appear to play a major role in maintaining the structural integrity of the polyomavirus and are likely involved in the processes of viral uncoating and assembly. Previous studies demonstrated that a VP1 fragment extending from Pro-232 to Asp-364 has calcium-binding capabilities. This fragment contains an amino acid stretch from Asp-266 to Glu-277 which is quite similar in sequence to the amino acids that make up the calcium-binding EF hand structures found in many proteins. To assess the contribution of this domain to polyomavirus structural integrity, the effects of mutations in this region were examined by transfecting mutated viral DNA into susceptible cells. Immunofluorescence studies indicated that although viral protein synthesis occurred normally, infective viral progeny were not produced in cells transfected with polyomavirus genomes encoding either a VP1 molecule lacking amino acids Thr-262 through Gly-276 or a VP1 molecule containing a mutation of Asp-266 to Ala. VP1 molecules containing the deletion mutation were unable to bind 45Ca in an in vitro assay. Upon expression in Escherichia coli and purification by immunoaffinity chromatography, wild-type VP1 was isolated as pentameric, capsomere-like structures which could be induced to form capsid-like structures upon addition of CaCl2, consistent with previous studies. However, although VP1 containing the point mutation was isolated as pentamers which were indistinguishable from wild-type VP1 pentamers, addition of CaCl2 did not result in their assembly into capsid-like structures. Immunogold labeling and electron microscopy studies of transfected mammalian cells provided in vivo evidence that a mutation in this region affects the process of viral assembly.

  1. Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene and VHL-haplotype analysis in patients with presumable congenital erythrocytosis.

    PubMed

    Cario, Holger; Schwarz, Klaus; Jorch, Norbert; Kyank, Ulrike; Petrides, Petro E; Schneider, Dominik T; Uhle, Renate; Debatin, Klaus-Michael; Kohne, Elisabeth

    2005-01-01

    Congenital erythrocytoses or polycythemias are rare and heterogeneous. A homozygous mutation (C598T->Arg200Trp) in the von Hippel-Lindau (VHL) gene was originally identified as the cause of the endemic Chuvash polycythemia. Subsequently this and other mutations in the VHL gene were also detected in several patients of different ethnic origin. Haplotype analyses of the VHL gene suggested a common origin for the Chuvash-type mutation. Thirty-four patients with presumable congenital erythrocytosis due to an unknown underlying disorder were examined for VHL gene mutations and VHL region haplotypes. Four patients were homozygous and one patient heterozygous for the Chuvash-type mutation. One additional patient presented a previously not described heterozygous mutation G311->T VHL in exon 1. The haplotype analyses were in agreement with recently published data for three of the four patients with homozygous mutations as well as for the patient with a heterozygous Chuvash-type mutation. One patient of Turkish origin with homozygous Chuvash-type mutation had a haplotype not previously found in individuals with Chuvash-type mutation. These results confirm that mutations in the VHL gene are responsible for a substantial proportion of patients with congenital erythrocytoses. Erythrocytoses due to a C598->T mutation of the VHL gene are not geographically restricted. The majority of patients with Chuvash polycythemia share a common VHL gene haplotype. The different haplotype in one of the patients with Chuvash-type mutation indicates that this mutation was not spread only from a single founder but developed independently in other individuals.

  2. Landscape of somatic mutations and clonal evolution in mantle cell lymphoma.

    PubMed

    Beà, Sílvia; Valdés-Mas, Rafael; Navarro, Alba; Salaverria, Itziar; Martín-Garcia, David; Jares, Pedro; Giné, Eva; Pinyol, Magda; Royo, Cristina; Nadeu, Ferran; Conde, Laura; Juan, Manel; Clot, Guillem; Vizán, Pedro; Di Croce, Luciano; Puente, Diana A; López-Guerra, Mónica; Moros, Alexandra; Roue, Gael; Aymerich, Marta; Villamor, Neus; Colomo, Lluís; Martínez, Antonio; Valera, Alexandra; Martín-Subero, José I; Amador, Virginia; Hernández, Luis; Rozman, Maria; Enjuanes, Anna; Forcada, Pilar; Muntañola, Ana; Hartmann, Elena M; Calasanz, María J; Rosenwald, Andreas; Ott, German; Hernández-Rivas, Jesús M; Klapper, Wolfram; Siebert, Reiner; Wiestner, Adrian; Wilson, Wyndham H; Colomer, Dolors; López-Guillermo, Armando; López-Otín, Carlos; Puente, Xose S; Campo, Elías

    2013-11-05

    Mantle cell lymphoma (MCL) is an aggressive tumor, but a subset of patients may follow an indolent clinical course. To understand the mechanisms underlying this biological heterogeneity, we performed whole-genome and/or whole-exome sequencing on 29 MCL cases and their respective matched normal DNA, as well as 6 MCL cell lines. Recurrently mutated genes were investigated by targeted sequencing in an independent cohort of 172 MCL patients. We identified 25 significantly mutated genes, including known drivers such as ataxia-telangectasia mutated (ATM), cyclin D1 (CCND1), and the tumor suppressor TP53; mutated genes encoding the anti-apoptotic protein BIRC3 and Toll-like receptor 2 (TLR2); and the chromatin modifiers WHSC1, MLL2, and MEF2B. We also found NOTCH2 mutations as an alternative phenomenon to NOTCH1 mutations in aggressive tumors with a dismal prognosis. Analysis of two simultaneous or subsequent MCL samples by whole-genome/whole-exome (n = 8) or targeted (n = 19) sequencing revealed subclonal heterogeneity at diagnosis in samples from different topographic sites and modulation of the initial mutational profile at the progression of the disease. Some mutations were predominantly clonal or subclonal, indicating an early or late event in tumor evolution, respectively. Our study identifies molecular mechanisms contributing to MCL pathogenesis and offers potential targets for therapeutic intervention.

  3. The Quest for the 1p36 Tumor Suppressor

    PubMed Central

    Bagchi, Anindya; Mills, Alea A.

    2010-01-01

    Genomic analyses of late-stage human cancers have uncovered deletions encompassing 1p36, thereby providing an extensive body of literature supporting the idea that a potent tumor suppressor resides in this interval. Although a number of genes have been proposed as 1p36 candidate tumor suppressors, convincing evidence that their encoded products protect from cancer has been scanty. A recent functional study identified CHD5 as a novel tumor suppressor mapping to 1p36. Here we discuss evidence supporting CHD5’s tumor suppressive role. Together, these findings suggest that strategies designed to enhance CHD5 activity could provide novel approaches for treating a broad range of human malignancies. PMID:18413720

  4. High prevalence of mutations affecting the splicing process in a Spanish cohort with autosomal dominant retinitis pigmentosa

    PubMed Central

    Ezquerra-Inchausti, Maitane; Barandika, Olatz; Anasagasti, Ander; Irigoyen, Cristina; López de Munain, Adolfo; Ruiz-Ederra, Javier

    2017-01-01

    Retinitis pigmentosa is the most frequent group of inherited retinal dystrophies. It is highly heterogeneous, with more than 80 disease-causing genes 27 of which are known to cause autosomal dominant RP (adRP), having been identified. In this study a total of 29 index cases were ascertained based on a family tree compatible with adRP. A custom panel of 31 adRP genes was analysed by targeted next-generation sequencing using the Ion PGM platform in combination with Sanger sequencing. This allowed us to detect putative disease-causing mutations in 14 out of the 29 (48.28%) families analysed. Remarkably, around 38% of all adRP cases analysed showed mutations affecting the splicing process, mainly due to mutations in genes coding for spliceosome factors (SNRNP200 and PRPF8) but also due to splice-site mutations in RHO. Twelve of the 14 mutations found had been reported previously and two were novel mutations found in PRPF8 in two unrelated patients. In conclusion, our results will lead to more accurate genetic counselling and will contribute to a better characterisation of the disease. In addition, they may have a therapeutic impact in the future given the large number of studies currently underway based on targeted RNA splicing for therapeutic purposes. PMID:28045043

  5. Frameshift Suppression in SACCHAROMYCES CEREVISIAE VI. Complete Genetic Map of Twenty-Five Suppressor Genes

    PubMed Central

    Gaber, Richard F.; Mathison, Lorilee; Edelman, Irv; Culbertson, Michael R.

    1983-01-01

    Five previously unmapped frameshift suppressor genes have been located on the yeast genetic map. In addition, we have further characterized the map positions of two suppressors whose approximate locations were determined in an earlier study. These results represent the completion of genetic mapping studies on all 25 of the known frameshift suppressor genes in yeast.—The approximate location of each suppressor gene was initially determined through the use of a set of mapping strains containing 61 signal markers distributed throughout the yeast genome. Standard meiotic linkage was assayed in crosses between strains carrying the suppressors and the mapping strains. Subsequent to these approximate linkage determinations, each suppressor gene was more precisely located in multi-point crosses. The implications of these mapping results for the genomic distribution of frameshift suppressor genes, which include both glycine and proline tRNA genes, are discussed. PMID:17246112

  6. A Point Mutation in Suppressor of Cytokine Signalling 2 (Socs2) Increases the Susceptibility to Inflammation of the Mammary Gland while Associated with Higher Body Weight and Size and Higher Milk Production in a Sheep Model

    PubMed Central

    Rupp, Rachel; Senin, Pavel; Sarry, Julien; Allain, Charlotte; Tasca, Christian; Ligat, Laeticia; Portes, David; Woloszyn, Florent; Bouchez, Olivier; Tabouret, Guillaume; Lebastard, Mathieu; Caubet, Cécile

    2015-01-01

    Mastitis is an infectious disease mainly caused by bacteria invading the mammary gland. Genetic control of susceptibility to mastitis has been widely evidenced in dairy ruminants, but the genetic basis and underlying mechanisms are still largely unknown. We describe the discovery, fine mapping and functional characterization of a genetic variant associated with elevated milk leukocytes count, or SCC, as a proxy for mastitis. After implementing genome-wide association studies, we identified a major QTL associated with SCC on ovine chromosome 3. Fine mapping of the region, using full sequencing with 12X coverage in three animals, provided one strong candidate SNP that mapped to the coding sequence of a highly conserved gene, suppressor of cytokine signalling 2 (Socs2). The frequency of the SNP associated with increased SCC was 21.7% and the Socs2 genotype explained 12% of the variance of the trait. The point mutation induces the p.R96C substitution in the SH2 functional domain of SOCS2 i.e. the binding site of the protein to various ligands, as well-established for the growth hormone receptor GHR. Using surface plasmon resonance we showed that the p.R96C point mutation completely abrogates SOCS2 binding affinity for the phosphopeptide of GHR. Additionally, the size, weight and milk production in p.R96C homozygote sheep, were significantly increased by 24%, 18%, and 4.4%, respectively, when compared to wild type sheep, supporting the view that the point mutation causes a loss of SOCS2 functional activity. Altogether these results provide strong evidence for a causal mutation controlling SCC in sheep and highlight the major role of SOCS2 as a tradeoff between the host’s inflammatory response to mammary infections, and body growth and milk production, which are all mediated by the JAK/STAT signaling pathway. PMID:26658352

  7. A Point Mutation in Suppressor of Cytokine Signalling 2 (Socs2) Increases the Susceptibility to Inflammation of the Mammary Gland while Associated with Higher Body Weight and Size and Higher Milk Production in a Sheep Model.

    PubMed

    Rupp, Rachel; Senin, Pavel; Sarry, Julien; Allain, Charlotte; Tasca, Christian; Ligat, Laeticia; Portes, David; Woloszyn, Florent; Bouchez, Olivier; Tabouret, Guillaume; Lebastard, Mathieu; Caubet, Cécile; Foucras, Gilles; Tosser-Klopp, Gwenola

    2015-12-01

    Mastitis is an infectious disease mainly caused by bacteria invading the mammary gland. Genetic control of susceptibility to mastitis has been widely evidenced in dairy ruminants, but the genetic basis and underlying mechanisms are still largely unknown. We describe the discovery, fine mapping and functional characterization of a genetic variant associated with elevated milk leukocytes count, or SCC, as a proxy for mastitis. After implementing genome-wide association studies, we identified a major QTL associated with SCC on ovine chromosome 3. Fine mapping of the region, using full sequencing with 12X coverage in three animals, provided one strong candidate SNP that mapped to the coding sequence of a highly conserved gene, suppressor of cytokine signalling 2 (Socs2). The frequency of the SNP associated with increased SCC was 21.7% and the Socs2 genotype explained 12% of the variance of the trait. The point mutation induces the p.R96C substitution in the SH2 functional domain of SOCS2 i.e. the binding site of the protein to various ligands, as well-established for the growth hormone receptor GHR. Using surface plasmon resonance we showed that the p.R96C point mutation completely abrogates SOCS2 binding affinity for the phosphopeptide of GHR. Additionally, the size, weight and milk production in p.R96C homozygote sheep, were significantly increased by 24%, 18%, and 4.4%, respectively, when compared to wild type sheep, supporting the view that the point mutation causes a loss of SOCS2 functional activity. Altogether these results provide strong evidence for a causal mutation controlling SCC in sheep and highlight the major role of SOCS2 as a tradeoff between the host's inflammatory response to mammary infections, and body growth and milk production, which are all mediated by the JAK/STAT signaling pathway.

  8. Myosin Transducer Mutations Differentially Affect Motor Function, Myofibril Structure, and the Performance of Skeletal and Cardiac Muscles

    PubMed Central

    Cammarato, Anthony; Dambacher, Corey M.; Knowles, Aileen F.; Kronert, William A.; Bodmer, Rolf

    2008-01-01

    Striated muscle myosin is a multidomain ATP-dependent molecular motor. Alterations to various domains affect the chemomechanical properties of the motor, and they are associated with skeletal and cardiac myopathies. The myosin transducer domain is located near the nucleotide-binding site. Here, we helped define the role of the transducer by using an integrative approach to study how Drosophila melanogaster transducer mutations D45 and Mhc5 affect myosin function and skeletal and cardiac muscle structure and performance. We found D45 (A261T) myosin has depressed ATPase activity and in vitro actin motility, whereas Mhc5 (G200D) myosin has these properties enhanced. Depressed D45 myosin activity protects against age-associated dysfunction in metabolically demanding skeletal muscles. In contrast, enhanced Mhc5 myosin function allows normal skeletal myofibril assembly, but it induces degradation of the myofibrillar apparatus, probably as a result of contractile disinhibition. Analysis of beating hearts demonstrates depressed motor function evokes a dilatory response, similar to that seen with vertebrate dilated cardiomyopathy myosin mutations, and it disrupts contractile rhythmicity. Enhanced myosin performance generates a phenotype apparently analogous to that of human restrictive cardiomyopathy, possibly indicating myosin-based origins for the disease. The D45 and Mhc5 mutations illustrate the transducer's role in influencing the chemomechanical properties of myosin and produce unique pathologies in distinct muscles. Our data suggest Drosophila is a valuable system for identifying and modeling mutations analogous to those associated with specific human muscle disorders. PMID:18045988

  9. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    PubMed

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  10. The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development.

    PubMed

    Ortega-Molina, Ana; Boss, Isaac W; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A; Gascoyne, Randy D; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M; Wendel, Hans-Guido

    2015-10-01

    The gene encoding the lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma and diffuse large B cell lymphoma; however, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center involution and impedes B cell differentiation and class switch recombination. Integrative genomic analyses indicate that KMT2D affects methylation of lysine 4 on histone H3 (H3K4) and expression of a set of genes, including those in the CD40, JAK-STAT, Toll-like receptor and B cell receptor signaling pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3 and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell-activating pathways.

  11. The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development

    PubMed Central

    Ortega-Molina, Ana; Boss, Isaac W.; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W.; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A.; Gascoyne, Randy D.; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M.; Wendel, Hans-Guido

    2015-01-01

    The lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL). However, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center (GC) involution, impedes B cell differentiation and class switch recombination (CSR). Integrative genomic analyses indicate that KMT2D affects H3K4 methylation and expression of a specific set of genes including those in the CD40, JAK-STAT, Toll-like receptor, and B cell receptor pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3, and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell activating pathways. PMID:26366710

  12. The APC tumor suppressor is required for epithelial cell polarization and three-dimensional morphogenesis

    PubMed Central

    Lesko, Alyssa C.; Goss, Kathleen H.; Yang, Frank F.; Schwertner, Adam; Hulur, Imge; Onel, Kenan; Prosperi, Jenifer R.

    2015-01-01

    The Adenomatous Polyposis Coli (APC) tumor suppressor has been previously implicated in the control of apical-basal polarity; yet, the consequence of APC loss-of-function in epithelial polarization and morphogenesis has not been characterized. To test the hypothesis that APC is required for the establishment of normal epithelial polarity and morphogenesis programs, we generated APC-knockdown epithelial cell lines. APC depletion resulted in loss of polarity and multi-layering on permeable supports, and enlarged, filled spheroids with disrupted polarity in 3D culture. Importantly, these effects of APC knockdown were independent of Wnt/β-catenin signaling, but were rescued with either full-length or a carboxy (c)-terminal segment of APC. Moreover, we identified a gene expression signature associated with APC knockdown that points to several candidates known to regulate cell-cell and cell-matrix communication. Analysis of epithelial tissues from mice and humans carrying heterozygous APC mutations further support the importance of APC as a regulator of epithelial behavior and tissue architecture. These data also suggest that the initiation of epithelial-derived tumors as a result of APC mutation or gene silencing may be driven by loss of polarity and dysmorphogenesis. PMID:25578398

  13. The effect of suppressors and muzzle brakes on shock wave strength

    NASA Astrophysics Data System (ADS)

    Phan, K. C.; Stollery, J. L.

    Experimental simulations of a gun blast were performed in the course of an optimization study of shock-wave suppressor and muzzle-brake geometry. A single-spark schlieren system was used to photograph the shock waves emerging from a 32-mm shock tube. The suppressor systems tested with respect to the overpressure level included a perforated tube enclosed in an expansion chamber, a cup-and-box suppressor, and noise-absorbent materials inside a suppressor; high suppression efficiency was observed for the first two. Recoil simulation tests, performed with plain and pyramidal baffles, disk, and cylinder, show that the blast level is generally higher for a more efective muzzle brake. An optimum distance from the muzzle to the brake is suggested to be in the region of one caliber.

  14. Mutations in cadherin 23 affect tip links in zebrafish sensory hair cells.

    PubMed

    Söllner, Christian; Rauch, Gerd-Jörg; Siemens, Jan; Geisler, Robert; Schuster, Stephan C; Müller, Ulrich; Nicolson, Teresa

    2004-04-29

    Hair cells have highly organized bundles of apical projections, or stereocilia, that are deflected by sound and movement. Displacement of stereocilia stretches linkages at the tips of stereocilia that are thought to gate mechanosensory channels. To identify the molecular machinery that mediates mechanotransduction in hair cells, zebrafish mutants were identified with defects in balance and hearing. In sputnik mutants, stereociliary bundles are splayed to various degrees, with individuals displaying reduced or absent mechanotransduction. Here we show that the defects in sputnik mutants are caused by mutations in cadherin 23 (cdh23). Mutations in Cdh23 also cause deafness and vestibular defects in mice and humans, and the protein is present in hair bundles. We show that zebrafish Cdh23 protein is concentrated near the tips of hair bundles, and that tip links are absent in homozygous sputnik(tc317e) larvae. Moreover, tip links are absent in larvae carrying weak alleles of cdh23 that affect mechanotransduction but not hair bundle integrity. We conclude that Cdh23 is an essential tip link component required for hair-cell mechanotransduction.

  15. Unique pathway of expression of an opal suppressor phosphoserine tRNA.

    PubMed Central

    Lee, B J; de la Peña, P; Tobian, J A; Zasloff, M; Hatfield, D

    1987-01-01

    An opal suppressor phosphoserine tRNA gene is present in single copy in the genomes of higher vertebrates. We have shown that the product of this gene functions as a suppressor in an in vitro assay, and we have proposed that it may donate a modified amino acid directly to protein in response to specific UGA codons. In this report, we show through in vitro and in vivo studies that the human and Xenopus opal suppressor phosphoserine tRNAs are synthesized by a pathway that is, to the best of our knowledge, unlike that of any known eukaryotic tRNA. The primary transcript of this gene does not contain a 5'-leader sequence; and, therefore, transcription of this suppressor is initiated at the first nucleotide within the coding sequence. The 5'-terminal triphosphate, present on the primary transcript, remains intact through 3'-terminal maturation and through subsequent transport of the tRNA to the cytoplasm. The unique biosynthetic pathway of this opal suppressor may underlie its distinctive role in eukaryotic cells. Images PMID:3114749

  16. An integrated view of suppressor T cell subsets in immunoregulation

    PubMed Central

    Jiang, Hong; Chess, Leonard

    2004-01-01

    The immune system evolved to protect organisms from a virtually infinite variety of disease-causing agents but to avoid harmful responses to self. Because immune protective mechanisms include the elaboration of potent inflammatory molecules, antibodies, and killer cell activation — which together can not only destroy invading microorganisms, pathogenic autoreactive cells, and tumors, but also mortally injure normal cells — the immune system is inherently a “double-edged sword” and must be tightly regulated. Immune response regulation includes homeostatic mechanisms intrinsic to the activation and differentiation of antigen-triggered immunocompetent cells and extrinsic mechanisms mediated by suppressor cells. This review series will focus on recent advances indicating that distinct subsets of regulatory CD4+ and CD8+ T cells as well as NK T cells control the outgrowth of potentially pathogenic antigen-reactive T cells and will highlight the evidence that these suppressor T cells may play potentially important clinical roles in preventing and treating immune-mediated disease. Here we provide a historical overview of suppressor cells and the experimental basis for the existence of functionally and phenotypically distinct suppressor subsets. Finally, we will speculate on how the distinct suppressor cell subsets may function in concert to regulate immune responses. PMID:15520848

  17. Akt phosphorylation regulates the tumour-suppressor merlin through ubiquitination and degradation.

    PubMed

    Tang, Xiaoling; Jang, Sung-Wuk; Wang, Xuerong; Liu, Zhixue; Bahr, Scott M; Sun, Shi-Yong; Brat, Daniel; Gutmann, David H; Ye, Keqiang

    2007-10-01

    The neurofibromatosis-2 (NF2) tumour-suppressor gene encodes an intracellular membrane-associated protein, called merlin, whose growth-suppressive function is dependent on its ability to form interactions through its intramolecular amino-terminal domain (NTD) and carboxy-terminal domain (CTD). Merlin phosphorylation plays a critical part in dictating merlin NTD/CTD interactions as well as in controlling binding to its effector proteins. Merlin is partially regulated by phosphorylation of Ser 518, such that hyperphosphorylated merlin is inactive and fails to form productive intramolecular and intermolecular interactions. Here, we show that the protein kinase Akt directly binds to and phosphorylates merlin on residues Thr 230 and Ser 315, which abolishes merlin NTD/CTD interactions and binding to merlin's effector protein PIKE-L and other binding partners. Furthermore, Akt-mediated phosphorylation leads to merlin degradation by ubiquitination. These studies demonstrate that Akt-mediated merlin phosphorylation regulates the function of merlin in the absence of an inactivating mutation.

  18. Calmodulin point mutations affect Drosophila development and behavior.

    PubMed

    Nelson, H B; Heiman, R G; Bolduc, C; Kovalick, G E; Whitley, P; Stern, M; Beckingham, K

    1997-12-01

    Calmodulin (CAM) is recognized as a major intermediary in intracellular calcium signaling, but as yet little is known of its role in developmental and behavioral processes. We have generated and studied mutations to the endogenous Cam gene of Drosophila melanogaster that change single amino acids within the protein coding region. One of these mutations produces a striking pupal lethal phenotype involving failure of head eversion. Various mutant combinations produce specific patterns of ectopic wing vein formation or melanotic scabs on the cuticle. Anaphase chromosome bridging is also seen as a maternal effect during the early embryonic nuclear divisions. In addition, specific behavioral defects such as poor climbing and flightlessness are detected among these mutants. Comparisons with other Drosophila mutant phenotypes suggests potential CAM targets that may mediate these developmental and behavioral effects, and analysis of the CAM crystal structure suggests the structural consequences of the individual mutations.

  19. Calmodulin Point Mutations Affect Drosophila Development and Behavior

    PubMed Central

    Nelson, H. B.; Heiman, R. G.; Bolduc, C.; Kovalick, G. E.; Whitley, P.; Stern, M.; Beckingham, K.

    1997-01-01

    Calmodulin (CAM) is recognized as a major intermediary in intracellular calcium signaling, but as yet little is known of its role in developmental and behavioral processes. We have generated and studied mutations to the endogenous Cam gene of Drosophila melanogaster that change single amino acids within the protein coding region. One of these mutations produces a striking pupal lethal phenotype involving failure of head eversion. Various mutant combinations produce specific patterns of ectopic wing vein formation or melanotic scabs on the cuticle. Anaphase chromosome bridging is also seen as a maternal effect during the early embryonic nuclear divisions. In addition, specific behavioral defects such as poor climbing and flightlessness are detected among these mutants. Comparisons with other Drosophila mutant phenotypes suggests potential CAM targets that may mediate these developmental and behavioral effects, and analysis of the CAM crystal structure suggests the structural consequences of the individual mutations. PMID:9409836

  20. Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course‐based undergraduate research experience in molecular and cell biology

    PubMed Central

    Brownell, Sara E.; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F. Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S.; Stearns, Tim

    2016-01-01

    Abstract The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course‐based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students′ high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA‐binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161–178, 2017. PMID:27873457

  1. Negative Regulation of the Stability and Tumor Suppressor Function of Fbw7 by the Pin1 Prolyl Isomerase

    PubMed Central

    Min, Sang-Hyun; Lau, Alan W.; Lee, Tae Ho; Inuzuka, Hiroyuki; Wei, Shuo; Huang, Pengyu; Shaik, Shavali; Lee, Daniel Yenhong; Finn, Greg; Balastik, Martin; Chen, Chun-Hau; Luo, Manli; Tron, Adriana E.; DeCaprio, James A.; Zhou, Xiao Zhen; Wei, Wenyi; Lu, Kun Ping

    2012-01-01

    SUMMARY Fbw7 is the substrate recognition component of the SCF (Skp1-Cullin-F-box)-type E3 ligase complex and a well-characterized tumor suppressor that targets numerous oncoproteins for destruction. Genomic deletion or mutation of FBW7 has been frequently found in various types of human cancers, however, little is known about the upstream signaling pathway(s) governing Fbw7 stability and cellular functions. Here we report that Fbw7 protein destruction and tumor suppressor function are negatively regulated by the prolyl isomerase Pin1. Pin1 interacts with Fbw7 in a phoshorylation-dependent manner and promotes Fbw7 self-ubiquitination and protein degradation by disrupting Fbw7 dimerization. Consequently, over-expressing Pin1 reduces Fbw7 abundance and suppresses Fbw7’s ability to inhibit proliferation and transformation. By contrast, depletion of Pin1 in cancer cells leads to elevated Fbw7 expression, which subsequently reduces Mcl-1 abundance, sensitizing cancer cells to Taxol. Thus, Pin1-mediated inhibition of Fbw7 contributes to oncogenesis and Pin1 may be a promising drug target for anti-cancer therapy. PMID:22608923

  2. NEW TYPE OF STREPTOMYCIN RESISTANCE RESULTING FROM ACTION OF THE EPISOMELIKE MUTATOR FACTOR IN ESCHERICHIA COLI

    PubMed Central

    Gundersen, Wenche B.

    1963-01-01

    Gundersen, Wenche B. (Oslo University, Oslo, Norway). New type of streptomycin resistance resulting from action of the episomelike mutator factor in Escherichia coli. J. Bacteriol. 86:510–516. 1963.—Analyses have been performed to elucidate the genetic nature of the streptomycin resistance that results from the action of the previously described episomelike mutator factor in Escherichia coli. This streptomycin resistance has been found to differ from ordinary one-step streptomycin resistance. The new type of streptomycin resistance, “mutator resistance,” can be lost, either spontaneously or by treatment with ultraviolet light and acriflavine. It is more stable in a K-12 strain than in the original E. coli strain 635. Mutator resistance segregates like a chromosomal marker in genetic crosses, and is located near the ordinary streptomycin locus. The locus for mutator resistance is distinct from that of ordinary streptomycin resistance, apparently located further toward the threonine region. Mutator resistance, unlike ordinary one-step streptomycin resistance, appears as a dominant character. The possibilities of its being a suppressor or regulator mutation are discussed. PMID:14066430

  3. The tumor suppressor PTEN has a critical role in antiviral innate immunity.

    PubMed

    Li, Shun; Zhu, Mingzhu; Pan, Ruangang; Fang, Ting; Cao, Yuan-Yuan; Chen, Shuliang; Zhao, Xiaolu; Lei, Cao-Qi; Guo, Lin; Chen, Yu; Li, Chun-Mei; Jokitalo, Eija; Yin, Yuxin; Shu, Hong-Bing; Guo, Deyin

    2016-03-01

    The gene encoding PTEN is one of the most frequently mutated tumor suppressor-encoding genes in human cancer. While PTEN's function in tumor suppression is well established, its relationship to anti-microbial immunity remains unknown. Here we found a pivotal role for PTEN in the induction of type I interferon, the hallmark of antiviral innate immunity, that was independent of the pathway of the kinases PI(3)K and Akt. PTEN controlled the import of IRF3, a master transcription factor responsible for IFN-β production, into the nucleus. We further identified a PTEN-controlled negative phosphorylation site at Ser97 of IRF3 and found that release from this negative regulation via the phosphatase activity of PTEN was essential for the activation of IRF3 and its import into the nucleus. Our study identifies crosstalk between PTEN and IRF3 in tumor suppression and innate immunity.

  4. Aero-acoustic performance comparison of core engine noise suppressors on NASA quiet engine C

    NASA Technical Reports Server (NTRS)

    Bloomer, H. E.; Schaefer, J. W.

    1977-01-01

    The relative aero-acoustic effectiveness of two core engine suppressors, a contractor-designed suppressor delivered with the Quiet Engine, and a NASA-designed suppressor was evaluated. The NASA suppressor was tested with and without a splitter making a total of three configurations being reported in addition to the baseline hardwall case. The aerodynamic results are presented in terms of tailpipe pressure loss, corrected net thrust, and corrected specific fuel consumption as functions of engine power setting. The acoustic results are divided into duct and far-field acoustic data. The NASA-designed core suppressor did the better job of suppressing aft end noise, but the splitter associated with it caused a significant engine performance penality. The NASA core suppressor without the spltter suppressed most of the core noise without any engine performance penalty.

  5. Activating BRAF and PIK3CA mutations cooperate to promote anaplastic thyroid carcinogenesis.

    PubMed

    Charles, Roch-Philippe; Silva, Jillian; Iezza, Gioia; Phillips, Wayne A; McMahon, Martin

    2014-07-01

    Thyroid malignancies are the most common type of endocrine tumors. Of the various histologic subtypes, anaplastic thyroid carcinoma (ATC) represents a subset of all cases but is responsible for a significant proportion of thyroid cancer-related mortality. Indeed, ATC is regarded as one of the more aggressive and hard to treat forms of cancer. To date, there is a paucity of relevant model systems to critically evaluate how the signature genetic abnormalities detected in human ATC contribute to disease pathogenesis. Mutational activation of the BRAF protooncogene is detected in approximately 40% of papillary thyroid carcinoma (PTC) and in 25% of ATC. Moreover, in ATC, mutated BRAF is frequently found in combination with gain-of-function mutations in the p110 catalytic subunit of PI3'-Kinase (PIK3CA) or loss-of-function alterations in either the p53 (TP53) or PTEN tumor suppressors. Using mice with conditional, thyrocyte-specific expression of BRAF(V600E), we previously developed a model of PTC. However, as in humans, BRAF(V600E)-induced mouse PTC is indolent and does not lead to rapid development of end-stage disease. Here, we use mice carrying a conditional allele of PIK3CA to demonstrate that, although mutationally activated PIK3CA(H1047R) is unable to drive transformation on its own, when combined with BRAF(V600E) in thyrocytes, this leads to development of lethal ATC in mice. Combined, these data demonstrate that the BRAF(V600E) cooperates with either PIK3CA(H1074R) or with silencing of the tumor-suppressor PTEN, to promote development of anaplastic thyroid carcinoma. This genetically relevant mouse model of ATC will be an invaluable platform for preclinical testing of pathway-targeted therapies for the prevention and treatment of thyroid carcinoma. ©2014 American Association for Cancer Research.

  6. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    PubMed

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  7. Distinct Brca1 Mutations Differentially Reduce Hematopoietic Stem Cell Function.

    PubMed

    Mgbemena, Victoria E; Signer, Robert A J; Wijayatunge, Ranjula; Laxson, Travis; Morrison, Sean J; Ross, Theodora S

    2017-01-24

    BRCA1 is a well-known DNA repair pathway component and a tissue-specific tumor suppressor. However, its role in hematopoiesis is uncertain. Here, we report that a cohort of patients heterozygous for BRCA1 mutations experienced more hematopoietic toxicity from chemotherapy than those with BRCA2 mutations. To test whether this reflects a requirement for BRCA1 in hematopoiesis, we generated mice with Brca1 mutations in hematopoietic cells. Mice homozygous for a null Brca1 mutation in the embryonic hematopoietic system (Vav1-iCre;Brca1 F22-24/F22-24 ) developed hematopoietic defects in early adulthood that included reduced hematopoietic stem cells (HSCs). Although mice homozygous for a huBRCA1 knockin allele (Brca1 BRCA1/BRCA1 ) were normal, mice with a mutant huBRCA1/5382insC allele and a null allele (Mx1-Cre;Brca1 F22-24/5382insC ) had severe hematopoietic defects marked by a complete loss of hematopoietic stem and progenitor cells. Our data show that Brca1 is necessary for HSC maintenance and normal hematopoiesis and that distinct mutations lead to different degrees of hematopoietic dysfunction. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. An association study between CHEK2 gene mutations and susceptibility to breast cancer.

    PubMed

    Jalilvand, Manizheh; Oloomi, Mana; Najafipour, Reza; Alizadeh, Safar Ali; Saki, Najmaldin; Rad, Fatemeh Samiee; Shekari, Mohammad

    2017-01-01

    CHEK2 gene is known as a tumor suppressor gene in breast cancer (BC), which plays a role in DNA repair. The germ line mutations in CEHK2 have been associated with different types of cancer. The present study was aimed at studying the association between CHEK2 mutations and BC. Peripheral blood was collected from patients into a test tube containing EDTA, and DNA was extracted from blood samples. Then, we analyzed mutations including 1100delc, IVS2+1>A, del5395bp, and I157T within CHEK2 gene in patients with BC and 100 normal healthy controls according to PCR-RFLP, allelic specific PCR, and multiplex-PCR. Although IVS2+1G>A mutation within CHEK2 gene was found in two BC patients, other defined mutants were not detected. For the first time, we identified CHEK2 IVS2+1G>A mutation, one out of four different CHEK2 alterations in two Iranian BC patients (2%). Also, our results showed that CHEK2 1100elC, del5395bp, and I157T mutations are not associated with genetic susceptibility for BC among Iranian population.

  9. LATS2 tumour specific mutations and down-regulation of the gene in non-small cell carcinoma.

    PubMed

    Strazisar, Mojca; Mlakar, Vid; Glavac, Damjan

    2009-06-01

    LATS2 is a new member of the LATS tumour suppressor family. The human LATS2 gene is located at chromosome 13q11-12, a hot spot (67%) for loss of heterozygosity (LOH) in non-small cell lung cancer (NSCLC). We screened 129 non-small cell lung cancer samples and 13 lung cancer cell lines, initially for mutations in the LATS2 gene and subsequently for mutations in P53 and K-RAS genes. Either polymorphisms or mutations were identified in over 50 percent of analysed tumours. A novel missense mutation, S1073R, and a large deletion of 8 amino acids in the PAPA-repeat region were detected in 9 and 2 NSCLC tumours, respectively. Those mutations were not identified in the 13 lung cancer cell lines. Mutations were tumour specific and were absent from adjacent normal tissue and healthy controls. Down-regulation of the LATS2 gene was observed in most NSCLC tumours but was not related to any mutation or polymorphism. Tumours with a LATS2 mutation often also harbour a P53 but not K-RAS gene mutation and were mostly in an advanced stage of development, with regional lymph node involvement.

  10. Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

    PubMed

    Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

    2016-12-01

    Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

  11. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    PubMed

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  12. Cell culture-adaptive mutations of NS5A affect replication of hepatitis C virus differentially depending on the viral genotypes.

    PubMed

    Chung, Aeri; Jin, Bora; Han, Kwang-Hyub; Ahn, Sang Hoon; Kim, Seungtaek

    2017-01-01

    Most of HCV RNAs require cell culture-adaptive mutations for efficient replication in cell culture and a number of such mutations have been described including a well-known S2204I substitution mutation in NS5A protein. In contrast, the replication of genotype 2a JFH1 RNA in cell culture does not require any cell culture-adaptive mutation. Rather, the presence of S2204I mutation impaired the JFH1 RNA replication. In this study, we examined the effect of reversions and substitutions of NS5A cell culture-adaptive mutations on virus replication in different genotypic backgrounds after either placing genotype 1a NS5A in the genotype 2a JFH1 or vice versa. The results from this investigation suggest that the S2204I mutation affects HCV RNA replication differentially depending on the viral genotypes but that the effect was not simply explained by the genotypic background. Perhaps, the effect of the S2204I mutation on HCV replication reflects both intra- and intergenic interactions of NS5A protein. J. Med. Virol. 89:146-152, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Myeloid malignancies: mutations, models and management

    PubMed Central

    2012-01-01

    Myeloid malignant diseases comprise chronic (including myelodysplastic syndromes, myeloproliferative neoplasms and chronic myelomonocytic leukemia) and acute (acute myeloid leukemia) stages. They are clonal diseases arising in hematopoietic stem or progenitor cells. Mutations responsible for these diseases occur in several genes whose encoded proteins belong principally to five classes: signaling pathways proteins (e.g. CBL, FLT3, JAK2, RAS), transcription factors (e.g. CEBPA, ETV6, RUNX1), epigenetic regulators (e.g. ASXL1, DNMT3A, EZH2, IDH1, IDH2, SUZ12, TET2, UTX), tumor suppressors (e.g. TP53), and components of the spliceosome (e.g. SF3B1, SRSF2). Large-scale sequencing efforts will soon lead to the establishment of a comprehensive repertoire of these mutations, allowing for a better definition and classification of myeloid malignancies, the identification of new prognostic markers and therapeutic targets, and the development of novel therapies. Given the importance of epigenetic deregulation in myeloid diseases, the use of drugs targeting epigenetic regulators appears as a most promising therapeutic approach. PMID:22823977

  14. Germline mutations affecting the histone H4 core cause a developmental syndrome by altering DNA damage response and cell cycle control.

    PubMed

    Tessadori, Federico; Giltay, Jacques C; Hurst, Jane A; Massink, Maarten P; Duran, Karen; Vos, Harmjan R; van Es, Robert M; Scott, Richard H; van Gassen, Koen L I; Bakkers, Jeroen; van Haaften, Gijs

    2017-11-01

    Covalent modifications of histones have an established role as chromatin effectors, as they control processes such as DNA replication and transcription, and repair or regulate nucleosomal structure. Loss of modifications on histone N tails, whether due to mutations in genes belonging to histone-modifying complexes or mutations directly affecting the histone tails, causes developmental disorders or has a role in tumorigenesis. More recently, modifications affecting the globular histone core have been uncovered as being crucial for DNA repair, pluripotency and oncogenesis. Here we report monoallelic missense mutations affecting lysine 91 in the histone H4 core (H4K91) in three individuals with a syndrome of growth delay, microcephaly and intellectual disability. Expression of the histone H4 mutants in zebrafish embryos recapitulates the developmental anomalies seen in the patients. We show that the histone H4 alterations cause genomic instability, resulting in increased apoptosis and cell cycle progression anomalies during early development. Mechanistically, our findings indicate an important role for the ubiquitination of H4K91 in genomic stability during embryonic development.

  15. The Inherited p53 Mutation in the Brazilian Population.

    PubMed

    Achatz, Maria Isabel; Zambetti, Gerard P

    2016-12-01

    A common criticism of studying rare diseases is the often-limited relevance of the findings to human health. Here, we review ∼15 years of research into an unusual germline TP53 mutation (p.R337H) that began with its detection in children with adrenocortical carcinoma (ACC), a remarkably rare childhood cancer that is associated with poor prognosis. We have come to learn that the p.R337H mutation exists at a very high frequency in Southern and Southeastern Brazil, occurring in one of 375 individuals within a total population of ∼100 million. Moreover, it has been determined that carriers of this founder mutation display variable tumor susceptibility, ranging from isolated cases of pediatric ACC to Li-Fraumeni or Li-Fraumeni-like (LFL) syndromes, thus representing a significant medical issue for this country. Studying the biochemical and molecular consequences of this mutation on p53 tumor-suppressor activity, as well as the putative additional genetic alterations that cooperate with this mutation, is advancing our understanding of how p53 functions in tumor suppression in general. These studies, which originated with a rare childhood tumor, are providing important information for guiding genetic counselors and physicians in treating their patients and are already providing clinical benefit. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  16. Loss of heterozygosity on chromosome 11q13 in two families with acromegaly/gigantism is independent of mutations of the multiple endocrine neoplasia type I gene.

    PubMed

    Gadelha, M R; Prezant, T R; Une, K N; Glick, R P; Moskal, S F; Vaisman, M; Melmed, S; Kineman, R D; Frohman, L A

    1999-01-01

    Familial acromegaly/gigantism occurring in the absence of multiple endocrine neoplasia type I (MEN-1) or the Carney complex has been reported in 18 families since the biochemical diagnosis of GH excess became available, and the genetic defect is unknown. In the present study we examined 2 unrelated families with isolated acromegaly/gigantism. In family A, 3 of 4 siblings were affected, with ages at diagnosis of 19, 21, and 23 yr. In family B, 5 of 13 siblings exhibited the phenotype and were diagnosed at 13, 15, 17, 17, and 24 yr of age. All 8 affected patients had elevated basal GH levels associated with high insulin-like growth factor I levels and/or nonsuppressible serum GH levels during an oral glucose tolerance test. GHRH levels were normal in affected members of family A. An invasive macroadenoma was found in 6 subjects, and a microadenoma was found in 1 subject from family B. The sequence of the GHRH receptor complementary DNA in 1 tumor from family A was normal. There was no history of consanguinity in either family, and the past medical history and laboratory results excluded MEN-1 and the Carney complex in all affected and unaffected screened subjects. Five of 8 subjects have undergone pituitary surgery to date, and paraffin-embedded pituitary blocks were available for analysis. Loss of heterozygosity on chromosome 11q13 was studied by comparing microsatellite polymorphisms of leukocyte and tumor DNA using PYGM (centromeric) and D11S527 (telomeric), markers closely linked to the MEN-1 tumor suppressor gene. All tumors exhibited a loss of heterozygosity at both markers. Sequencing of the MEN-1 gene revealed no germline mutations in either family, nor was a somatic mutation found in tumor DNA from one subject in family A. The integrity of the MEN-1 gene in this subject was further supported by demonstration of the presence of MEN-1 messenger ribonucleic acid, as assessed by RT-PCR. These data indicate that loss of heterozygosity in these affected family

  17. Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

    PubMed

    Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

    2010-12-01

    Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

  18. Aero-acoustic performance comparison of core engine noise suppressors on NASA quiet engine 'C'

    NASA Technical Reports Server (NTRS)

    Bloomer, H. E.; Schaefer, J. W.

    1977-01-01

    The purpose of the experimental program reported herein was to evaluate and compare the relative aero-acoustic effectiveness of two core engine suppressors, a contractor-designed suppressor delivered with the Quiet Engine, and a NASA-designed suppressor, designed and built subsequently. The NASA suppressor was tested with and without a splitter making a total of three configurations being reported in addition to the baseline hardwall case. The aerodynamic results are presented in terms of tailpipe pressure loss, corrected net thrust, and corrected specific fuel consumption as functions of engine power setting. The acoustic results are divided into duct and far-field acoustic data. The NASA-designed core suppressor did the better job of suppressing aft end noise, but the splitter associated with it caused a significant engine performance penalty. The NASA core suppressor without the splitter suppressed most of the core noise without any engine performance penalty.

  19. Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

    PubMed Central

    Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

    2013-01-01

    BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

  20. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    PubMed

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  1. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome

    PubMed Central

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A.; Landau, Daniel

    2017-01-01

    Abstract A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9’s highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is

  2. Determination of Heritage SSME Pogo Suppressor Resistance and Inertance from Waterflow Pulse Testing

    NASA Technical Reports Server (NTRS)

    McDougal, Chris; Eberhart, Chad; Lee, Erik

    2016-01-01

    Waterflow tests of a heritage Space Shuttle Main Engine pogo suppressor were performed to experimentally quantify the resistance and inertance provided by the suppressor. Measurements of dynamic pressure and flow rate in response to pulsing flow were made throughout the test loop. A unique system identification methodology combined all sensor measurements with a one-dimensional perturbational flow model of the complete water flow loop to spatially translate physical measurements to the device under test. Multiple techniques were then employed to extract the effective resistance and inertance for the pogo suppressor. Parameters such as steady flow rate, perturbational flow rate magnitude, and pulse frequency were investigated to assess their influence on the behavior of the pogo suppressor dynamic response. These results support validation of the RS-25 pogo suppressor performance for use on the Space Launch System Core Stage.

  3. CSN1 Somatic Mutations in Penile Squamous Cell Carcinoma.

    PubMed

    Feber, Andrew; Worth, Daniel C; Chakravarthy, Ankur; de Winter, Patricia; Shah, Kunal; Arya, Manit; Saqib, Muhammad; Nigam, Raj; Malone, Peter R; Tan, Wei Shen; Rodney, Simon; Freeman, Alex; Jameson, Charles; Wilson, Gareth A; Powles, Tom; Beck, Stephan; Fenton, Tim; Sharp, Tyson V; Muneer, Asif; Kelly, John D

    2016-08-15

    Other than an association with HPV infection, little is known about the genetic alterations determining the development of penile cancer. Although penile cancer is rare in the developed world, it presents a significant burden in developing countries. Here, we report the findings of whole-exome sequencing (WES) to determine the somatic mutational landscape of penile cancer. WES was performed on penile cancer and matched germline DNA from 27 patients undergoing surgical resection. Targeted resequencing of candidate genes was performed in an independent 70 patient cohort. Mutation data were also integrated with DNA methylation and copy-number information from the same patients. We identified an HPV-associated APOBEC mutation signature and an NpCpG signature in HPV-negative disease. We also identified recurrent mutations in the novel penile cancer tumor suppressor genes CSN1(GPS1) and FAT1 Expression of CSN1 mutants in cells resulted in colocalization with AGO2 in cytoplasmic P-bodies, ultimately leading to the loss of miRNA-mediated gene silencing, which may contribute to disease etiology. Our findings represent the first comprehensive analysis of somatic alterations in penile cancer, highlighting the complex landscape of alterations in this malignancy. Cancer Res; 76(16); 4720-7. ©2016 AACR. ©2016 American Association for Cancer Research.

  4. Firearm suppressor having enhanced thermal management for rapid heat dissipation

    DOEpatents

    Moss, William C.; Anderson, Andrew T.

    2014-08-19

    A suppressor is disclosed for use with a weapon having a barrel through which a bullet is fired. The suppressor has an inner portion having a bore extending coaxially therethrough. The inner portion is adapted to be secured to a distal end of the barrel. A plurality of axial flow segments project radially from the inner portion and form axial flow paths through which expanding propellant gasses discharged from the barrel flow through. The axial flow segments have radially extending wall portions that define sections which may be filled with thermally conductive material, which in one example is a thermally conductive foam. The conductive foam helps to dissipate heat deposited within the suppressor during firing of the weapon.

  5. Patterns of Novel Alleles and Genotype/Phenotype Correlations Resulting from the Analysis of 108 Previously Undetected Mutations in Patients Affected by Neurofibromatosis Type I

    PubMed Central

    Bonatti, Francesco; Adorni, Alessia; Matichecchia, Annalisa; Mozzoni, Paola; Uliana, Vera; Pisani, Francesco; Garavelli, Livia; Graziano, Claudio; Gnoli, Maria; Bigoni, Stefania; Boschi, Elena; Martorana, Davide; Percesepe, Antonio

    2017-01-01

    Neurofibromatosis type I, a genetic disorder due to mutations in the NF1 gene, is characterized by a high mutation rate (about 50% of the cases are de novo) but, with the exception of whole gene deletions associated with a more severe phenotype, no specific hotspots and few solid genotype/phenotype correlations. After retrospectively re-evaluating all NF1 gene variants found in the diagnostic activity, we studied 108 patients affected by neurofibromatosis type I who harbored mutations that had not been previously reported in the international databases, with the aim of analyzing their type and distribution along the gene and of correlating them with the phenotypic features of the affected patients. Out of the 108 previously unreported variants, 14 were inherited by one of the affected parents and 94 were de novo. Twenty-nine (26.9%) mutations were of uncertain significance, whereas 79 (73.2%) were predicted as pathogenic or probably pathogenic. No differential distribution in the exons or in the protein domains was observed and no statistically significant genotype/phenotype correlation was found, confirming previous evidences. PMID:28961165

  6. SMARCB1 mutations in schwannomatosis and genotype correlations with rhabdoid tumors.

    PubMed

    Smith, Miriam J; Wallace, Andrew J; Bowers, Naomi L; Eaton, Helen; Evans, D Gareth R

    2014-09-01

    Mutations in the SMARCB1 gene are involved in several human tumor-predisposing syndromes. They were established as an underlying cause of the tumor suppressor syndrome schwannomatosis in 2008. There is a much higher rate of mutation detection in familial disease than in sporadic disease. We have performed extensive genetic testing on a cohort of familial and sporadic patients who fulfilled clinical diagnostic criteria for schwannomatosis. In our updated cohort, we identified novel mutations within the SMARCB1 gene as well as several recurrent mutations. Of the schwannomatosis screens reported to date, including those in our updated cohort, SMARCB1 mutations have been found in 45% of familial probands and 9% of sporadic patients. The exon 1 mutation, c.41C>A p.Pro14His (10% in our series), and the 3' untranslated region mutation, c.*82C>T (27%), are the most common changes reported in patients with schwannomatosis to date, indicating the presence of mutation hot spots at both 5' and 3' portions of the gene. Comparison with germline SMARCB1 mutations in patients with rhabdoid tumors showed that the schwannomatosis mutations were significantly more likely to occur at either end of the gene and be nontruncating mutations (P < 0.0001). SMARCB1 mutations are found in a significant proportion of schwannomatosis patients, and an even higher proportion of rhabdoid patients. Whereas SMARCB1 alone seems to account for rhabdoid disease, there is likely to be substantial heterogeneity in schwannomatosis even for familial disease. There is a clear genotype-phenotype correlation, with germline rhabdoid mutations being significantly more likely to be centrally placed, involve multiple exon deletions, and be truncating mutations. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Sleep quality and methylation status of selected tumor suppressor genes among nurses and midwives.

    PubMed

    Bukowska-Damska, Agnieszka; Reszka, Edyta; Kaluzny, Pawel; Wieczorek, Edyta; Przybek, Monika; Zienolddiny, Shanbeh; Peplonska, Beata

    2018-01-01

    Chronic sleep restriction may affect metabolism, hormone secretion patterns and inflammatory responses. Limited reports suggest also epigenetic effects, such as changes in DNA methylation profiles. The study aims to assess the potential association between poor sleep quality or sleep duration and the levels of 5-methylcytosine in the promoter regions of selected tumor suppressor genes. A cross-sectional study was conducted on 710 nurses and midwives aged 40-60 years. Data from interviews regarding sleep habits and potential confounders were used. The methylation status of tumor suppressor genes was determined via qMSP reactions using DNA samples derived from leucocytes. No significant findings were observed in the total study population or in the two subgroups of women stratified by the current system of work. A borderline significance association was observed between a shorter duration of sleep and an increased methylation level in CDKN2A among day working nurses and midwives. Further studies are warranted to explore this under-investigated topic.

  8. TERT promoter mutations in bladder cancer affect patient survival and disease recurrence through modification by a common polymorphism.

    PubMed

    Rachakonda, P Sivaramakrishna; Hosen, Ismail; de Verdier, Petra J; Fallah, Mahdi; Heidenreich, Barbara; Ryk, Charlotta; Wiklund, N Peter; Steineck, Gunnar; Schadendorf, Dirk; Hemminki, Kari; Kumar, Rajiv

    2013-10-22

    The telomerase reverse transcriptase (TERT) promoter, an important element of telomerase expression, has emerged as a target of cancer-specific mutations. Originally described in melanoma, the mutations in TERT promoter have been shown to be common in certain other tumor types that include glioblastoma, hepatocellular carcinoma, and bladder cancer. To fully define the occurrence and effect of the TERT promoter mutations, we investigated tumors from a well-characterized series of 327 patients with urothelial cell carcinoma of bladder. The somatic mutations, mainly at positions -124 and -146 bp from ATG start site that create binding motifs for E-twenty six/ternary complex factors (Ets/TCF), affected 65.4% of the tumors, with even distribution across different stages and grades. Our data showed that a common polymorphism rs2853669, within a preexisting Ets2 binding site in the TERT promoter, acts as a modifier of the effect of the mutations on survival and tumor recurrence. The patients with the mutations showed poor survival in the absence [hazard ratio (HR) 2.19, 95% confidence interval (CI) 1.02-4.70] but not in the presence (HR 0.42, 95% CI 0.18-1.01) of the variant allele of the polymorphism. The mutations in the absence of the variant allele were highly associated with the disease recurrence in patients with Tis, Ta, and T1 tumors (HR 1.85, 95% CI 1.11-3.08). The TERT promoter mutations are the most common somatic lesions in bladder cancer with clinical implications. The association of the mutations with patient survival and disease recurrence, subject to modification by a common polymorphism, can be a unique putative marker with individualized prognostic potential.

  9. Expression of metastasis suppressor BRMS1 in breast cancer cells results in a marked delay in cellular adhesion to matrix

    USDA-ARS?s Scientific Manuscript database

    Metastatic dissemination is a multi-step process that depends on cancer cells’ ability to respond to microenvironmental cues by adapting adhesion abilities and undergoing cytoskeletal rearrangement. Breast Cancer Metastasis Suppressor 1 (BRMS1) affects several steps of the metastatic cascade: it dec...

  10. Molecular and clinical evidence for an ARMC5 tumor syndrome: concurrent inactivating germline and somatic mutations are associated with both primary macronodular adrenal hyperplasia and meningioma.

    PubMed

    Elbelt, Ulf; Trovato, Alessia; Kloth, Michael; Gentz, Enno; Finke, Reinhard; Spranger, Joachim; Galas, David; Weber, Susanne; Wolf, Cristina; König, Katharina; Arlt, Wiebke; Büttner, Reinhard; May, Patrick; Allolio, Bruno; Schneider, Jochen G

    2015-01-01

    Primary macronodular adrenal hyperplasia (PMAH) is a rare cause of Cushing's syndrome, which may present in the context of different familial multitumor syndromes. Heterozygous inactivating germline mutations of armadillo repeat containing 5 (ARMC5) have very recently been described as cause for sporadic PMAH. Whether this genetic condition also causes familial PMAH in association with other neoplasias is unclear. The aim of the present study was to delineate the molecular cause in a large family with PMAH and other neoplasias. Whole-genome sequencing and comprehensive clinical and biochemical phenotyping was performed in members of a PMAH affected family. Nodules derived from adrenal surgery and pancreatic and meningeal tumor tissue were analyzed for accompanying somatic mutations in the identified target genes. PMAH presenting either as overt or subclinical Cushing's syndrome was accompanied by a heterozygous germline mutation in ARMC5 (p.A110fs*9) located on chromosome 16. Analysis of tumor tissue showed different somatic ARMC5 mutations in adrenal nodules supporting a second hit hypothesis with inactivation of a tumor suppressor gene. A damaging somatic ARMC5 mutation was also found in a concomitant meningioma (p.R502fs) but not in a pancreatic tumor, suggesting biallelic inactivation of ARMC5 as causal also for the intracranial meningioma. Our analysis further confirms inherited inactivating ARMC5 mutations as a cause of familial PMAH and suggests an additional role for the development of concomitant intracranial meningiomas.

  11. Variation of p53 mutational spectra between carcinoma of the upper and lower respiratory tract.

    PubMed

    Law, J C; Whiteside, T L; Gollin, S M; Weissfeld, J; El-Ashmawy, L; Srivastava, S; Landreneau, R J; Johnson, J T; Ferrell, R E

    1995-07-01

    Mutations of the p53 tumor suppressor gene are the most common genetic alterations associated with human cancer. Tumor-associated p53 mutations often show characteristic tissue-specific profiles which may infer environmentally induced mutational mechanisms. The p53 mutational frequency and spectrum were determined for 95 carcinomas of the upper and lower respiratory tract (32 lung and 63 upper respiratory tract). Mutations were identified at a frequency of 30% in upper respiratory tract (URT) tumors and 31% in lung tumors. All 29 identified mutations were single-base substitutions. Comparison of the frequency of specific base substitutions between lung and URT showed a striking difference. Transitions occurred at a frequency of 68% in URT, but only 30% in lung. Mutations involving G:C-->A:T transitions, which are commonly reported in gastric and esophageal tumors, were the most frequently identified alteration in URT (11/19). Mutations involving G:C-->T:A transversions, which were relatively common in lung tumors (3/10) and are representative of tobacco smoke-induced mutations were rare in URT tumors (1/19). Interestingly, G:C-->A:T mutations at CpG sites, which are characteristic of endogenous processes, were observed frequently in URT tumors (9/19) but only rarely in lung tumors (1/10), suggesting that both endogenous and exogenous factors are responsible for the observed differences in mutational spectra between the upper and lower respiratory systems.

  12. Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course-based undergraduate research experience in molecular and cell biology.

    PubMed

    Hekmat-Scafe, Daria S; Brownell, Sara E; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S; Stearns, Tim

    2017-03-04

    The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course-based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students' high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA-binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161-178, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  13. High Incidence of Noonan Syndrome Features Including Short Stature and Pulmonic Stenosis in Patients carrying NF1 Missense Mutations Affecting p.Arg1809: Genotype-Phenotype Correlation.

    PubMed

    Rojnueangnit, Kitiwan; Xie, Jing; Gomes, Alicia; Sharp, Angela; Callens, Tom; Chen, Yunjia; Liu, Ying; Cochran, Meagan; Abbott, Mary-Alice; Atkin, Joan; Babovic-Vuksanovic, Dusica; Barnett, Christopher P; Crenshaw, Melissa; Bartholomew, Dennis W; Basel, Lina; Bellus, Gary; Ben-Shachar, Shay; Bialer, Martin G; Bick, David; Blumberg, Bruce; Cortes, Fanny; David, Karen L; Destree, Anne; Duat-Rodriguez, Anna; Earl, Dawn; Escobar, Luis; Eswara, Marthanda; Ezquieta, Begona; Frayling, Ian M; Frydman, Moshe; Gardner, Kathy; Gripp, Karen W; Hernández-Chico, Concepcion; Heyrman, Kurt; Ibrahim, Jennifer; Janssens, Sandra; Keena, Beth A; Llano-Rivas, Isabel; Leppig, Kathy; McDonald, Marie; Misra, Vinod K; Mulbury, Jennifer; Narayanan, Vinodh; Orenstein, Naama; Galvin-Parton, Patricia; Pedro, Helio; Pivnick, Eniko K; Powell, Cynthia M; Randolph, Linda; Raskin, Salmo; Rosell, Jordi; Rubin, Karol; Seashore, Margretta; Schaaf, Christian P; Scheuerle, Angela; Schultz, Meredith; Schorry, Elizabeth; Schnur, Rhonda; Siqveland, Elizabeth; Tkachuk, Amanda; Tonsgard, James; Upadhyaya, Meena; Verma, Ishwar C; Wallace, Stephanie; Williams, Charles; Zackai, Elaine; Zonana, Jonathan; Lazaro, Conxi; Claes, Kathleen; Korf, Bruce; Martin, Yolanda; Legius, Eric; Messiaen, Ludwine

    2015-11-01

    Neurofibromatosis type 1 (NF1) is one of the most frequent genetic disorders, affecting 1:3,000 worldwide. Identification of genotype-phenotype correlations is challenging because of the wide range clinical variability, the progressive nature of the disorder, and extreme diversity of the mutational spectrum. We report 136 individuals with a distinct phenotype carrying one of five different NF1 missense mutations affecting p.Arg1809. Patients presented with multiple café-au-lait macules (CALM) with or without freckling and Lisch nodules, but no externally visible plexiform neurofibromas or clear cutaneous neurofibromas were found. About 25% of the individuals had Noonan-like features. Pulmonic stenosis and short stature were significantly more prevalent compared with classic cohorts (P < 0.0001). Developmental delays and/or learning disabilities were reported in over 50% of patients. Melanocytes cultured from a CALM in a segmental NF1-patient showed two different somatic NF1 mutations, p.Arg1809Cys and a multi-exon deletion, providing genetic evidence that p.Arg1809Cys is a loss-of-function mutation in the melanocytes and causes a pigmentary phenotype. Constitutional missense mutations at p.Arg1809 affect 1.23% of unrelated NF1 probands in the UAB cohort, therefore this specific NF1 genotype-phenotype correlation will affect counseling and management of a significant number of patients. © 2015 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

  14. Genetic and Biochemical Evidence That Haploinsufficiency of the Nf1 Tumor Suppressor Gene Modulates Melanocyte and Mast Cell Fates in Vivo

    PubMed Central

    Ingram, David A.; Yang, Feng-Chun; Travers, Jeffrey B.; Wenning, Mary Jo; Hiatt, Kelly; New, Sheryl; Hood, Antoinette; Shannon, Kevin; Williams, David A.; Clapp, D. Wade

    2000-01-01

    Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's “two hit” model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1−/− murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W41 mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras–mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W41) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types. PMID:10620616

  15. Genetic and biochemical evidence that haploinsufficiency of the Nf1 tumor suppressor gene modulates melanocyte and mast cell fates in vivo.

    PubMed

    Ingram, D A; Yang, F C; Travers, J B; Wenning, M J; Hiatt, K; New, S; Hood, A; Shannon, K; Williams, D A; Clapp, D W

    2000-01-03

    Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's "two hit" model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1-/- murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W(41) mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras-mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W(41)) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types.

  16. HIV-1 protease inhibitor mutations affect the development of HIV-1 resistance to the maturation inhibitor bevirimat.

    PubMed

    Fun, Axel; van Maarseveen, Noortje M; Pokorná, Jana; Maas, Renée Em; Schipper, Pauline J; Konvalinka, Jan; Nijhuis, Monique

    2011-08-24

    Maturation inhibitors are an experimental class of antiretrovirals that inhibit Human Immunodeficiency Virus (HIV) particle maturation, the structural rearrangement required to form infectious virus particles. This rearrangement is triggered by the ordered cleavage of the precursor Gag polyproteins into their functional counterparts by the viral enzyme protease. In contrast to protease inhibitors, maturation inhibitors impede particle maturation by targeting the substrate of protease (Gag) instead of the protease enzyme itself. Direct cross-resistance between protease and maturation inhibitors may seem unlikely, but the co-evolution of protease and its substrate, Gag, during protease inhibitor therapy, could potentially affect future maturation inhibitor therapy. Previous studies showed that there might also be an effect of protease inhibitor resistance mutations on the development of maturation inhibitor resistance, but the exact mechanism remains unclear. We used wild-type and protease inhibitor resistant viruses to determine the impact of protease inhibitor resistance mutations on the development of maturation inhibitor resistance. Our resistance selection studies demonstrated that the resistance profiles for the maturation inhibitor bevirimat are more diverse for viruses with a mutated protease compared to viruses with a wild-type protease. Viral replication did not appear to be a major factor during emergence of bevirimat resistance. In all in vitro selections, one of four mutations was selected: Gag V362I, A364V, S368N or V370A. The impact of these mutations on maturation inhibitor resistance and viral replication was analyzed in different protease backgrounds. The data suggest that the protease background affects development of HIV-1 resistance to bevirimat and the replication profiles of bevirimat-selected HIV-1. The protease-dependent bevirimat resistance and replication levels can be explained by differences in CA/p2 cleavage processing by the different

  17. The risk of gastric cancer in carriers of CHEK2 mutations.

    PubMed

    Teodorczyk, Urszula; Cybulski, Cezary; Wokołorczyk, Dominika; Jakubowska, Anna; Starzyńska, Teresa; Lawniczak, Małgorzata; Domagała, Paweł; Ferenc, Katarzyna; Marlicz, Krzysztof; Banaszkiewicz, Zbigniew; Wiśniowski, Rafał; Narod, Steven A; Lubiński, Jan

    2013-09-01

    CHEK2 is a tumor suppressor gene whose functions are central to the induction of cell cycle arrest and apoptosis following DNA damage. Mutations in CHEK2 have been associated with cancers at many sites, including breast and prostate cancers, but the relationship between CHEK2 and gastric cancer has not been extensively studied. In Poland, there are four known founder alleles of CHEK2; three alleles are protein truncating (1100delC, IVS2G>A, del5395) and the other is a missense variant (I157T). We examined the frequencies of four Polish founder mutations in the CHEK2 gene in 658 unselected gastric cancer patients, in 154 familial gastric cancer patients and in 8,302 controls. A CHEK2 mutation was seen in 57 of 658 (8.7 %) unselected patients with gastric cancer compared to 480 of 8,302 (5.8 %) controls (OR 1.6, p = 0.004). A CHEK2 mutation was present in 19 of 154 (12.3 %) familial cases (OR = 2.3, p = 0.001). The odds ratio for early onset (<50 years) gastric cancer was higher (2.1, p = 0.01), than for cases diagnosed at age of 50 or above (OR 1.4, p = 0.05). Truncating mutations of CHEK2 were associated with higher risk (OR = 2.1, p = 0.02) than the missense mutation I157T (OR = 1.4, p = 0.04). CHEK2 mutations predispose to gastric cancer, in particular to young-onset cases.

  18. cld and lec23 are disparate mutations that affect maturation of lipoprotein lipase in the endoplasmic reticulum.

    PubMed

    Briquet-Laugier, V; Ben-Zeev, O; White, A; Doolittle, M H

    1999-11-01

    The mutations cld (combined lipase deficiency) and lec23 disrupt in a similar manner the expression of lipoprotein lipase (LPL). Whereas cld affects an unknown gene, lec23 abolishes the activity of alpha-glucosidase I, an enzyme essential for proper folding and assembly of nascent glycoproteins. The hypothesis that cld, like lec23, affects the folding/assembly of nascent LPL was confirmed by showing that in cell lines homozygous for these mutations (Cld and Lec23, respectively), the majority of LPL was inactive, displayed heterogeneous aggregation, and had a decreased affinity for heparin. While inactive LPL was retained in the ER, a small amount of LPL that had attained a native conformation was transported through the Golgi and secreted. Thus, Cld and Lec23 cells recognized and retained the majority of LPL as misfolded, maintaining the standard of quality control. Examination of candidate factors affecting protein maturation, such as glucose addition and trimming, proteins involved in lectin chaperone cycling, and other abundant ER chaperones, revealed that calnexin levels were dramatically reduced in livers from cld/cld mice; this finding was also confirmed in Cld cells. We conclude that cld may affect components in the ER, such as calnexin, that play a role in protein maturation. Whether the reduced calnexin levels per se contribute to the LPL deficiency awaits confirmation.

  19. Mutations That Affect the Efficiency of Translation of mRNA for the cII Gene of Coliphage Lambda

    PubMed Central

    Dul, Ed; Mahoney, Michael E.; Wulff, Daniel L.

    1987-01-01

    Starting with the λ pRE- strain λctr1 cy3008, which forms clear plaques, we have isolated two mutant strains, λdya2 ctr1 cy3008 and λ dya3 ctr1 cy3008, that form plaques with very slightly turbid centers. The dya2 and dya3 mutations lie in the region of overlap between the PRE promoter and the ribosome recognition region of the cII gene, and have nucleotide alterations at positions -1 and +5 of pRE, and alterations of cII mRNA at -16 and -21 nucleotides before the initial AUG codon of the gene. Both mutations destabilize a stem structure that may be formed by cII mRNA, and dya2 also changes the sequence on cII mRNA that is complementary to the 3'-end of 16 S rRNA from 5'-UAAGGA-3' to 5'-UGAGGA-3'.—The dya2 and dya3 mutations, along with the ctr1 mutation, which destabilizes either of two alternate stem structures which may be formed by cII mRNA (these being more stable stem structures than the one affected by dya2 and dya3), were tested for their ability to reverse two cII- mutations that are characterized by inefficient translation of cII mRNA. These are cII3088, an A → G mutation four bases before the initial AUG codon, and cII3059 , a GUU → GAU (Val2 → Asp) second codon mutation. It was found that ctr1 completely reverses the translation defects of these two mutations, while dya2 partially reverses these translation defects. The dya3 mutation has no effect on translation efficiency under any condition tested. However neither the ctr1 mutation nor the dya2 mutation has much effect on translation efficiency in an otherwise cII+ background, indicating that other factors must limit the rate of translation of cII mRNA under these conditions. PMID:2953647

  20. Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi

    PubMed Central

    van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.

    2014-01-01

    The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815

  1. CHEK2 mutations and the risk of papillary thyroid cancer.

    PubMed

    Siołek, Monika; Cybulski, Cezary; Gąsior-Perczak, Danuta; Kowalik, Artur; Kozak-Klonowska, Beata; Kowalska, Aldona; Chłopek, Małgorzata; Kluźniak, Wojciech; Wokołorczyk, Dominika; Pałyga, Iwona; Walczyk, Agnieszka; Lizis-Kolus, Katarzyna; Sun, Ping; Lubiński, Jan; Narod, Steven A; Góźdż, Stanisław

    2015-08-01

    Mutations in the cell cycle checkpoint kinase 2 (CHEK2) tumor suppressor gene are associated with multi-organ cancer susceptibility including cancers of the breast and prostate. A genetic association between thyroid and breast cancer has been suggested, however little is known about the determinants of this association. To characterize the association of CHEK2 mutations with thyroid cancer, we genotyped 468 unselected patients with papillary thyroid cancer and 468 (matched) cancer-free controls for four founder mutations of CHEK2 (1100delC, IVS2 + 1G>A, del5395 and I157T). We compared the family histories reported by patients with a CHEK2 mutation to those of non-carriers. A CHEK2 mutation was seen in 73 of 468 (15.6%) unselected patients with papillary thyroid cancer, compared to 28 of 460 (6.0%) age- and sex-matched controls (OR 3.3; p < 0.0001). A truncating mutation (IVS2 + 1G>A, 1100delC or del5395) was associated with a higher risk of thyroid cancer (OR = 5.7; p = 0.006), than was the missense mutation I157T (OR = 2.8; p = 0.0001). CHEK2 mutation carriers reported a family history of breast cancer 2.2 times more commonly than non-carriers (16.4% vs.8.1%; p = 0.05). A CHEK2 mutation was found in seven of 11 women (63%) with multiple primary cancers of the breast and thyroid (OR = 10; p = 0.0004). These results suggest that CHEK2 mutations predispose to thyroid cancer, familial aggregations of breast and thyroid cancer and to double primary cancers of the breast and thyroid. © 2015 UICC.

  2. Germline BRCA mutation in male carriers-ripe for precision oncology?

    PubMed

    Leão, Ricardo Romão Nazário; Price, Aryeh Joshua; James Hamilton, Robert

    2018-04-01

    Prostate cancer (PC) is one of the known heritable cancers with individual variations attributed to genetic factors. BRCA1 and BRCA2 are tumour suppressor genes with crucial roles in repairing DNA and thereby maintaining genomic integrity. Germline BRCA mutations predispose to multiple familial tumour types including PC. We performed a Pubmed database search along with review of reference lists from prominent articles to capture papers exploring the association between BRCA mtuations and prostate cancer risk and prognosis. Articles were retrieved until May 2017 and filtered for relevance, and publication type. We explored familial PC genetics; discussed the discovery and magnitude of the association between BRCA mutations and PC risk and outcome; examined implications of factoring BRCA mutations into PC screening; and discussed the rationale for chemoprevention in this high-risk population. We confirmed that BRCA1/2 mutations confer an up to 4.5-fold and 8.3-fold increased risk of PC, respectively. BRCA2 mutations are associated with an increased risk of high-grade disease, progression to metastatic castration-resistant disease, and 5-year cancer-specific survival rates of 50 to 60%. Despite the growing body of research on DNA repair genes, deeper analysis is needed to understand the aetiological role of germline BRCA mutations in the natural history of PC. There is a need for awareness to screen for this marker of PC risk. There is similarly an opportunity for structured PC screening programs for BRCA mutation carriers. Finally, further research is required to identify potential chemopreventive strategies for this high-risk subgroup.

  3. Metastasis Suppressor Genes: At the Interface Between the Environment and Tumor Cell Growth

    PubMed Central

    Hurst, Douglas R.; Welch, Danny R.

    2013-01-01

    The molecular mechanisms and genetic programs required for cancer metastasis are sometimes overlapping, but components are clearly distinct from those promoting growth of a primary tumor. Every sequential, rate-limiting step in the sequence of events leading to metastasis requires coordinated expression of multiple genes, necessary signaling events, and favorable environmental conditions or the ability to escape negative selection pressures. Metastasis suppressors are molecules that inhibit the process of metastasis without preventing growth of the primary tumor. The cellular processes regulated by metastasis suppressors are diverse and function at every step in the metastatic cascade. As we gain knowledge into the molecular mechanisms of metastasis suppressors and cofactors with which they interact, we learn more about the process, including appreciation that some are potential targets for therapy of metastasis, the most lethal aspect of cancer. Until now, metastasis suppressors have been described largely by their function. With greater appreciation of their biochemical mechanisms of action, the importance of context is increasingly recognized especially since tumor cells exist in myriad microenvironments. In this review, we assemble the evidence that selected molecules are indeed suppressors of metastasis, collate the data defining the biochemical mechanisms of action, and glean insights regarding how metastasis suppressors regulate tumor cell communication to–from microenvironments. PMID:21199781

  4. Characterization of the novel tumor-suppressor gene CCDC67 in papillary thyroid carcinoma.

    PubMed

    Yin, De Tao; Xu, Jianhui; Lei, Mengyuan; Li, Hongqiang; Wang, Yongfei; Liu, Zhen; Zhou, Yubing; Xing, Mingzhao

    2016-02-02

    Some studies showed an association of coiled-coil domain-containing (CCDC) genes with cancers. Our previous limited data specifically suggested a possible pathogenic role of CCDC67 in papillary thyroid cancer (PTC), but this has not been firmly established. The present study was to further investigate and establish this role of CCDC67 in PTC. The expression of CCDC67, both at mRNA and protein levels, was sharply down-regulated in PTC compared with normal thyroid tissues. Lower CCDC67 expression was significantly associated with aggressive tumor behaviors, such as advanced tumor stages and lymph node metastasis, as well as BRAF mutation. Introduced expression of CCDC67 in TPC-1 cells robustly inhibited cell proliferation, colony formation and migration, induced G1 phase cell cycle arrest, and increased cell apoptosis. Primary PTC tumors and matched normal thyroid tissues were obtained from 200 unselected patients at the initial surgery for detection of CCDC67 mRNA and protein by RT-PCR and Western blotting analyses, respectively. Genomic DNA sequencing was performed to detect BRAF mutation in PTC tumors. Clinicopathological data were retrospectively reviewed for correlation analyses. PTC cell line TPC-1 with stable transfection of CCDC67 was used to investigate the functions of CCDC67. This large study demonstrates down-regulation of CCDC67 in PTC, an inverse relationship between CCDC67 expression and PTC aggressiveness and BRAF mutation, and a robust inhibitory effect of CCDC67 on PTC cellular activities. These results are consistent with CCDC67 being a novel and impaired tumor suppressor gene in PTC, providing important prognostic and therapeutic implications for this cancer.

  5. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  6. NFκB1 is a suppressor of neutrophil-driven hepatocellular carcinoma

    NASA Astrophysics Data System (ADS)

    Wilson, C. L.; Jurk, D.; Fullard, N.; Banks, P.; Page, A.; Luli, S.; Elsharkawy, A. M.; Gieling, R. G.; Chakraborty, J. Bagchi; Fox, C.; Richardson, C.; Callaghan, K.; Blair, G. E.; Fox, N.; Lagnado, A.; Passos, J. F.; Moore, A. J.; Smith, G. R.; Tiniakos, D. G.; Mann, J.; Oakley, F.; Mann, D. A.

    2015-04-01

    Hepatocellular carcinoma (HCC) develops on the background of chronic hepatitis. Leukocytes found within the HCC microenvironment are implicated as regulators of tumour growth. We show that diethylnitrosamine (DEN)-induced murine HCC is attenuated by antibody-mediated depletion of hepatic neutrophils, the latter stimulating hepatocellular ROS and telomere DNA damage. We additionally report a previously unappreciated tumour suppressor function for hepatocellular nfkb1 operating via p50:p50 dimers and the co-repressor HDAC1. These anti-inflammatory proteins combine to transcriptionally repress hepatic expression of a S100A8/9, CXCL1 and CXCL2 neutrophil chemokine network. Loss of nfkb1 promotes ageing-associated chronic liver disease (CLD), characterized by steatosis, neutrophillia, fibrosis, hepatocyte telomere damage and HCC. Nfkb1S340A/S340Amice carrying a mutation designed to selectively disrupt p50:p50:HDAC1 complexes are more susceptible to HCC; by contrast, mice lacking S100A9 express reduced neutrophil chemokines and are protected from HCC. Inhibiting neutrophil accumulation in CLD or targeting their tumour-promoting activities may offer therapeutic opportunities in HCC.

  7. Genetic screens for mutations affecting development of Xenopus tropicalis.

    PubMed

    Goda, Tadahiro; Abu-Daya, Anita; Carruthers, Samantha; Clark, Matthew D; Stemple, Derek L; Zimmerman, Lyle B

    2006-06-01

    We present here the results of forward and reverse genetic screens for chemically-induced mutations in Xenopus tropicalis. In our forward genetic screen, we have uncovered 77 candidate phenotypes in diverse organogenesis and differentiation processes. Using a gynogenetic screen design, which minimizes time and husbandry space expenditures, we find that if a phenotype is detected in the gynogenetic F2 of a given F1 female twice, it is highly likely to be a heritable abnormality (29/29 cases). We have also demonstrated the feasibility of reverse genetic approaches for obtaining carriers of mutations in specific genes, and have directly determined an induced mutation rate by sequencing specific exons from a mutagenized population. The Xenopus system, with its well-understood embryology, fate map, and gain-of-function approaches, can now be coupled with efficient loss-of-function genetic strategies for vertebrate functional genomics and developmental genetics.

  8. Cavity filling mutations at the thyroxine-binding site dramatically increase transthyretin stability and prevent its aggregation.

    PubMed

    Sant'Anna, Ricardo; Almeida, Maria Rosário; Varejāo, Nathalia; Gallego, Pablo; Esperante, Sebastian; Ferreira, Priscila; Pereira-Henriques, Alda; Palhano, Fernando L; de Carvalho, Mamede; Foguel, Debora; Reverter, David; Saraiva, Maria João; Ventura, Salvador

    2017-03-24

    More than a hundred different Transthyretin (TTR) mutations are associated with fatal systemic amyloidoses. They destabilize the protein tetrameric structure and promote the extracellular deposition of TTR as pathological amyloid fibrils. So far, only mutations R104H and T119M have been shown to stabilize significantly TTR, acting as disease suppressors. We describe a novel A108V non-pathogenic mutation found in a Portuguese subject. This variant is more stable than wild type TTR both in vitro and in human plasma, a feature that prevents its aggregation. The crystal structure of A108V reveals that this stabilization comes from novel intra and inter subunit contacts involving the thyroxine (T 4 ) binding site. Exploiting this observation, we engineered a A108I mutation that fills the T 4 binding cavity, as evidenced in the crystal structure. This synthetic protein becomes one of the most stable TTR variants described so far, with potential application in gene and protein replacement therapies.

  9. CRISPR/Cas9-mediated ASXL1 mutations in U937 cells disrupt myeloid differentiation

    PubMed Central

    Wu, Zhi-Jie; Zhao, Xin; Banaszak, Lauren G.; Gutierrez-Rodrigues, Fernanda; Keyvanfar, Keyvan; Gao, Shou-Guo; Raffo, Diego Quinones; Kajigaya, Sachiko; Young, Neal S.

    2018-01-01

    Additional sex combs-like 1 (ASXL1) is a well-known tumor suppressor gene and epigenetic modifier. ASXL1 mutations are frequent in myeloid malignances; these mutations are risk factors for the development of myelodysplasia and also appear as small clones during normal aging. ASXL1 appears to act as an epigenetic regulator of cell survival and myeloid differentiation; however, the molecular mechanisms underlying the malignant transformation of cells with ASXL1 mutations are not well defined. Using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein-9 nuclease (Cas9) genome editing, heterozygous and homozygous ASXL1 mutations were introduced into human U937 leukemic cells. Comparable cell growth and cell cycle progression were observed between wild-type (WT) and ASXL1-mutated U937 cells. Drug-induced cytotoxicity, as measured by growth inhibition and apoptosis in the presence of the cell-cycle active agent 5-fluorouracil, was variable among the mutated clones but was not significantly different from WT cells. In addition, ASXL1-mutated cells exhibited defects in monocyte/macrophage differentiation. Transcriptome analysis revealed that ASXL1 mutations altered differentiation of U937 cells by disturbing genes involved in myeloid differentiation, including cytochrome B-245 β chain and C-type lectin domain family 5, member A. Dysregulation of numerous gene sets associated with cell death and survival were also observed in ASXL1-mutated cells. These data provide evidence regarding the underlying molecular mechanisms induced by mutated ASXL1 in leukemogenesis. PMID:29532865

  10. Notch signaling: switching an oncogene to a tumor suppressor

    PubMed Central

    Lobry, Camille; Oh, Philmo; Mansour, Marc R.; Look, A. Thomas

    2014-01-01

    The Notch signaling pathway is a regulator of self-renewal and differentiation in several tissues and cell types. Notch is a binary cell-fate determinant, and its hyperactivation has been implicated as oncogenic in several cancers including breast cancer and T-cell acute lymphoblastic leukemia (T-ALL). Recently, several studies also unraveled tumor-suppressor roles for Notch signaling in different tissues, including tissues where it was before recognized as an oncogene in specific lineages. Whereas involvement of Notch as an oncogene in several lymphoid malignancies (T-ALL, B-chronic lymphocytic leukemia, splenic marginal zone lymphoma) is well characterized, there is growing evidence involving Notch signaling as a tumor suppressor in myeloid malignancies. It therefore appears that Notch signaling pathway’s oncogenic or tumor-suppressor abilities are highly context dependent. In this review, we summarize and discuss latest advances in the understanding of this dual role in hematopoiesis and the possible consequences for the treatment of hematologic malignancies. PMID:24608975

  11. Neonatal diabetes caused by a homozygous KCNJ11 mutation demonstrates that tiny changes in ATP sensitivity markedly affect diabetes risk.

    PubMed

    Vedovato, Natascia; Cliff, Edward; Proks, Peter; Poovazhagi, Varadarajan; Flanagan, Sarah E; Ellard, Sian; Hattersley, Andrew T; Ashcroft, Frances M

    2016-07-01

    The pancreatic ATP-sensitive potassium (KATP) channel plays a pivotal role in linking beta cell metabolism to insulin secretion. Mutations in KATP channel genes can result in hypo- or hypersecretion of insulin, as in neonatal diabetes mellitus and congenital hyperinsulinism, respectively. To date, all patients affected by neonatal diabetes due to a mutation in the pore-forming subunit of the channel (Kir6.2, KCNJ11) are heterozygous for the mutation. Here, we report the first clinical case of neonatal diabetes caused by a homozygous KCNJ11 mutation. A male patient was diagnosed with diabetes shortly after birth. At 5 months of age, genetic testing revealed he carried a homozygous KCNJ11 mutation, G324R, (Kir6.2-G324R) and he was successfully transferred to sulfonylurea therapy (0.2 mg kg(-1) day(-1)). Neither heterozygous parent was affected. Functional properties of wild-type, heterozygous and homozygous mutant KATP channels were examined after heterologous expression in Xenopus oocytes. Functional studies indicated that the Kir6.2-G324R mutation reduces the channel ATP sensitivity but that the difference in ATP inhibition between homozygous and heterozygous channels is remarkably small. Nevertheless, the homozygous patient developed neonatal diabetes, whereas the heterozygous parents were, and remain, unaffected. Kir6.2-G324R channels were fully shut by the sulfonylurea tolbutamide, which explains why the patient's diabetes was well controlled by sulfonylurea therapy. The data demonstrate that tiny changes in KATP channel activity can alter beta cell electrical activity and insulin secretion sufficiently to cause diabetes. They also aid our understanding of how the Kir6.2-E23K variant predisposes to type 2 diabetes.

  12. CDKN1C mutation affecting the PCNA-binding domain as a cause of familial Russell Silver syndrome.

    PubMed

    Brioude, F; Oliver-Petit, I; Blaise, A; Praz, F; Rossignol, S; Le Jule, M; Thibaud, N; Faussat, A-M; Tauber, M; Le Bouc, Y; Netchine, I

    2013-12-01

    Russell Silver syndrome (RSS) leads to prenatal and postnatal growth retardation. About 55% of RSS patients present a loss-of-methylation of the paternal ICR1 domain on chromosome 11p15. CDKN1C is a cell proliferation inhibitor encoded by an imprinted gene in the 11p15 ICR2 domain. CDKN1C mutations lead to Beckwith Wiedemann syndrome (BWS, overgrowth syndrome) and in IMAGe syndrome which associates growth retardation and adrenal insufficiency. We searched for CDKN1C mutations in a cohort of clinically diagnosed RSS patients with no molecular anomaly. The coding sequence and intron-exon boundaries of CDKN1C were analysed in 97 RSS patients. The impact of CDKN1C variants on the cell cycle in vitro were determined by flow cytometry. Stability of CDKN1C was studied by western immunoblotting after inhibition of translation with cycloheximide. We identified the novel c.836G>[G;T] (p.Arg279Leu) mutation in a familial case of intrauterine growth retardation (IUGR) with RSS phenotype and no evidence of IMAGe. All the RSS patients inherited this mutation from their mothers (consistent with monoallelic expression from the maternal allele of the gene). A mutation of this amino acid (p.Arg279Pro) has been reported in cases of IMAGe. Functional analysis showed that Arg279Leu (RSS) did not affect the cell cycle, whereas the Arg279Pro mutation (IMAGe) led to a gain of function. Arg279Leu (RSS) led to an increased stability which could explain an increased activity of CDKN1C. CDKN1C mutations cause dominant maternally transmitted RSS, completing the molecular mirror with BWS. CDKN1C should be investigated in cases with family history of RSS.

  13. Extragenic Suppression of a Mutation in Herpes Simplex Virus 1 UL34 That Affects Lamina Disruption and Nuclear Egress

    PubMed Central

    Vu, Amber; Poyzer, Chelsea

    2016-01-01

    ABSTRACT Nuclear egress of herpesviruses is accompanied by changes in the architecture of the nuclear membrane and nuclear lamina that are thought to facilitate capsid access to the inner nuclear membrane (INM) and curvature of patches of the INM around the capsid during budding. Here we report the properties of a point mutant of pUL34 (Q163A) that fails to induce gross changes in nuclear architecture or redistribution of lamin A/C. The UL34(Q163A) mutant shows a roughly 100-fold defect in single-step growth, and it forms small plaques. This mutant has a defect in nuclear egress, and furthermore, it fails to disrupt nuclear shape or cause observable displacement of lamin A/C despite retaining the ability to recruit the pUS3 and PKC protein kinases and to mediate phosphorylation of emerin. Extragenic suppressors of the UL34(Q163A) phenotype were isolated, and all of them carry a single mutation of arginine 229 to leucine in UL31. Surprisingly, although this UL31 mutation largely restores virus replication, it does not correct the lamina disruption defect, suggesting that, in Vero cells, changes in nuclear shape and gross displacements of lamin A/C may facilitate but are unnecessary for nuclear egress. IMPORTANCE Herpesvirus nuclear egress is an essential and conserved process that requires close association of the viral capsid with the inner nuclear membrane and budding of the capsid into that membrane. Access to the nuclear membrane and tight curvature of that membrane are thought to require disruption of the nuclear lamina that underlies the inner nuclear membrane, and consistent with this idea, herpesvirus infection induces biochemical and architectural changes at the nuclear membrane. The significance of the nuclear membrane architectural changes is poorly characterized. The results presented here address that deficiency in our understanding and show that a combination of mutations in two of the viral nuclear egress factors results in a failure to accomplish at

  14. Extragenic Suppression of a Mutation in Herpes Simplex Virus 1 UL34 That Affects Lamina Disruption and Nuclear Egress.

    PubMed

    Vu, Amber; Poyzer, Chelsea; Roller, Richard

    2016-12-01

    Nuclear egress of herpesviruses is accompanied by changes in the architecture of the nuclear membrane and nuclear lamina that are thought to facilitate capsid access to the inner nuclear membrane (INM) and curvature of patches of the INM around the capsid during budding. Here we report the properties of a point mutant of pUL34 (Q163A) that fails to induce gross changes in nuclear architecture or redistribution of lamin A/C. The UL34(Q163A) mutant shows a roughly 100-fold defect in single-step growth, and it forms small plaques. This mutant has a defect in nuclear egress, and furthermore, it fails to disrupt nuclear shape or cause observable displacement of lamin A/C despite retaining the ability to recruit the pUS3 and PKC protein kinases and to mediate phosphorylation of emerin. Extragenic suppressors of the UL34(Q163A) phenotype were isolated, and all of them carry a single mutation of arginine 229 to leucine in UL31. Surprisingly, although this UL31 mutation largely restores virus replication, it does not correct the lamina disruption defect, suggesting that, in Vero cells, changes in nuclear shape and gross displacements of lamin A/C may facilitate but are unnecessary for nuclear egress. Herpesvirus nuclear egress is an essential and conserved process that requires close association of the viral capsid with the inner nuclear membrane and budding of the capsid into that membrane. Access to the nuclear membrane and tight curvature of that membrane are thought to require disruption of the nuclear lamina that underlies the inner nuclear membrane, and consistent with this idea, herpesvirus infection induces biochemical and architectural changes at the nuclear membrane. The significance of the nuclear membrane architectural changes is poorly characterized. The results presented here address that deficiency in our understanding and show that a combination of mutations in two of the viral nuclear egress factors results in a failure to accomplish at least two components

  15. The Genetics of a Small Autosomal Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. III. Hypomorphic and Hypermorphic Mutations Affecting the Expression of Hairless

    PubMed Central

    Ashburner, Michael

    1982-01-01

    A lethal locus (l(2)br7;35B6-10), near Adh on chromosome arm 2L of D. melanogaster, is identified with Plunkett's dominant suppressor of Hairless (H). Of eight new alleles, seven act as dominant suppressors of H, the eighth is a dominant enhancer of H. One of the suppressor alleles is both a leaky lethal and a weak suppressor of H. Confirming Nash (1970), deletions of l(2)br7 are dominant suppressors, and duplications are dominant enhancers of H. A simple model is proposed to account for the interaction of l(2)br7 and H, assuming that amorphic (or hypomorphic) alleles of l(2)br7 suppress H and that hypermorphic alleles enhance H. PMID:6816670

  16. Mutations that alter a repeated ACCA element located at the 5' end of the Potato virus X genome affect RNA accumulation.

    PubMed

    Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung

    2008-08-15

    The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.

  17. The Retinoblastoma Tumor Suppressor Regulates a Xenobiotic Detoxification Pathway

    PubMed Central

    Sáenz Robles, Maria Teresa; Case, Ashley; Chong, Jean-Leon; Leone, Gustavo; Pipas, James M.

    2011-01-01

    The retinoblastoma tumor suppressor (pRb) regulates cell cycle entry, progression and exit by controlling the activity of the E2F-family of transcription factors. During cell cycle exit pRb acts as a transcriptional repressor by associating with E2F proteins and thereby inhibiting their ability to stimulate the expression of genes required for S phase. Indeed, many tumors harbor mutations in the RB gene and the pRb-E2F pathway is compromised in nearly all types of cancers. In this report we show that both pRb and its interacting partners, the transcriptional factors E2F1-2-3, act as positive modulators of detoxification pathways important for metabolizing and clearing xenobiotics—such as toxins and drugs—from the body. Using a combination of conventional molecular biology techniques and microarray analysis of specific cell populations, we have analyzed the detoxification pathway in murine samples in the presence or absence of pRb and/or E2F1-2-3. In this report, we show that both pRb and E2F1-2-3 act as positive modulators of detoxification pathways in mice, challenging the conventional view of E2F1-2-3 as transcriptional repressors negatively regulated by pRb. These results suggest that mutations altering the pRb-E2F axis may have consequences beyond loss of cell cycle control by altering the ability of tissues to remove toxins and to properly metabolize anticancer drugs, and might help to understand the formation and progression rates of different types of cancer, as well as to better design appropriate therapies based on the particular genetic composition of the tumors. PMID:22022495

  18. Condensin II mutation causes T-cell lymphoma through tissue-specific genome instability

    PubMed Central

    Woodward, Jessica; Taylor, Gillian C.; Soares, Dinesh C.; Boyle, Shelagh; Sie, Daoud; Read, David; Chathoth, Keerthi; Vukovic, Milica; Tarrats, Nuria; Jamieson, David; Campbell, Kirsteen J.; Blyth, Karen; Acosta, Juan Carlos; Ylstra, Bauke; Arends, Mark J.; Kranc, Kamil R.; Jackson, Andrew P.; Bickmore, Wendy A.

    2016-01-01

    Chromosomal instability is a hallmark of cancer, but mitotic regulators are rarely mutated in tumors. Mutations in the condensin complexes, which restructure chromosomes to facilitate segregation during mitosis, are significantly enriched in cancer genomes, but experimental evidence implicating condensin dysfunction in tumorigenesis is lacking. We report that mice inheriting missense mutations in a condensin II subunit (Caph2nes) develop T-cell lymphoma. Before tumors develop, we found that the same Caph2 mutation impairs ploidy maintenance to a different extent in different hematopoietic cell types, with ploidy most severely perturbed at the CD4+CD8+ T-cell stage from which tumors initiate. Premalignant CD4+CD8+ T cells show persistent catenations during chromosome segregation, triggering DNA damage in diploid daughter cells and elevated ploidy. Genome sequencing revealed that Caph2 single-mutant tumors are near diploid but carry deletions spanning tumor suppressor genes, whereas P53 inactivation allowed Caph2 mutant cells with whole-chromosome gains and structural rearrangements to form highly aggressive disease. Together, our data challenge the view that mitotic chromosome formation is an invariant process during development and provide evidence that defective mitotic chromosome structure can promote tumorigenesis. PMID:27737961

  19. Uveal melanoma hepatic metastases mutation spectrum analysis using targeted next-generation sequencing of 400 cancer genes.

    PubMed

    Luscan, A; Just, P A; Briand, A; Burin des Roziers, C; Goussard, P; Nitschké, P; Vidaud, M; Avril, M F; Terris, B; Pasmant, E

    2015-04-01

    Uveal melanoma (UM) is the most common malignant tumour of the eye. Diagnosis often occurs late in the course of disease, and prognosis is generally poor. Recently, recurrent somatic mutations were described, unravelling additional specific altered pathways in UM. Targeted next-generation sequencing (NGS) can now be applied to an accurate and fast identification of somatic mutations in cancer. The aim of the present study was to characterise the mutation pattern of five UM hepatic metastases with well-defined clinical and pathological features. We analysed the UM mutation spectrum using targeted NGS on 409 cancer genes. Four previous reported genes were found to be recurrently mutated. All tumours presented mutually exclusive GNA11 or GNAQ missense mutations. BAP1 loss-of-function mutations were found in three UMs. SF3B1 missense mutations were found in the two UMs with no BAP1 mutations. We then searched for additional mutation targets. We identified the Arg505Cys mutation in the tumour suppressor FBXW7. The same mutation was previously described in different cancer types, and FBXW7 was recently reported to be mutated in UM exomes. Further studies are required to confirm FBXW7 implication in UM tumorigenesis. Elucidating the molecular mechanisms underlying UM tumorigenesis holds the promise for novel and effective targeted UM therapies. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  20. High frequency of coexistent mutations of PIK3CA and PTEN genes in endometrial carcinoma.

    PubMed

    Oda, Katsutoshi; Stokoe, David; Taketani, Yuji; McCormick, Frank

    2005-12-01

    The phosphatidylinositol 3'-kinase (PI3K) pathway is activated in many human cancers. In addition to inactivation of the PTEN tumor suppressor gene, mutations or amplifications of the catalytic subunit alpha of PI3K (PIK3CA) have been reported. However, the coexistence of mutations in these two genes seems exceedingly rare. As PTEN mutations occur at high frequency in endometrial carcinoma, we screened 66 primary endometrial carcinomas for mutations in the helical and catalytic domains of PIK3CA. We identified a total of 24 (36%) mutations in this gene and coexistence of PIK3CA/PTEN mutations at high frequency (26%). PIK3CA mutations were more common in tumors with PTEN mutations (17 of 37, 46%) compared with those without PTEN mutations (7 of 29, 24%). Array comparative genomic hybridization detected 3q24-qter amplification, which covers the PIK3CA gene (3q26.3), in one of nine tumors. Knocking down PTEN expression in the HEC-1B cell line, which possesses both K-Ras and PIK3CA mutations, further enhances phosphorylation of Akt (Ser473), indicating that double mutation of PIK3CA and PTEN has an additive effect on PI3K activation. Our data suggest that the PI3K pathway is extensively activated in endometrial carcinomas, and that combination of PIK3CA/PTEN alterations might play an important role in development of these tumors.

  1. A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors.

    PubMed

    Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena

    2015-03-21

    Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

  2. Structure and Mechanism of Action of the BRCA2 Breast Cancer Tumor Suppressor

    PubMed Central

    Malivert, Laurent; McIlwraith, Michael J.; Pape, Tillman; West, Stephen C.; Zhang, Xiaodong

    2014-01-01

    Mutations in BRCA2 increase susceptibility to breast, ovarian and prostate cancers. The product of human BRCA2, BRCA2 protein, plays a key role in the repair of DNA double strand breaks and interstrand crosslinks by RAD51-mediated homologous recombination. Here, we present a biochemical and structural characterization of full length (3,418 amino acid) BRCA2, alone and in complex with RAD51. We show that BRCA2 facilitates nucleation of RAD51 filaments at multiple sites on single-stranded DNA. Three-dimensional electron microscopy reconstructions revealed that BRCA2 exists as a dimer and that two oppositely-oriented sets of RAD51 molecules bind the dimer. Single stranded DNA binds along the long axis of BRCA2, such that only one set of RAD51 monomers can form a productive complex with DNA and establish filament formation. Our data define the molecular mechanism by which this tumor suppressor facilitates RAD51-mediated homologous recombinational repair. PMID:25282148

  3. Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

    PubMed

    Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

    1999-07-19

    Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

  4. Mutations in Nonconserved Domains of Ty3 Integrase Affect Multiple Stages of the Ty3 Life Cycle

    PubMed Central

    Nymark-McMahon, M. Henrietta; Sandmeyer, Suzanne B.

    1999-01-01

    Ty3, a retroviruslike element of Saccharomyces cerevisiae, transposes into positions immediately upstream of RNA polymerase III-transcribed genes. The Ty3 integrase (IN) protein is required for integration of the replicated, extrachromosomal Ty3 DNA. In retroviral IN, a conserved core region is sufficient for strand transfer activity. In this study, charged-to-alanine scanning mutagenesis was used to investigate the roles of the nonconserved amino- and carboxyl-terminal regions of Ty3 IN. Each of the 20 IN mutants was defective for transposition, but no mutant was grossly defective for capsid maturation. All mutations affecting steady-state levels of mature IN protein resulted in reduced levels of replicated DNA, even when polymerase activity was not grossly defective as measured by exogenous reverse transcriptase activity assay. Thus, IN could contribute to nonpolymerase functions required for DNA production in vivo or to the stability of the DNA product. Several mutations in the carboxyl-terminal domain resulted in relatively low levels of processed 3′ ends of the replicated DNA, suggesting that this domain may be important for binding of IN to the long terminal repeat. Another class of mutants produced wild-type amounts of DNA with correctly processed 3′ ends. This class could include mutants affected in nuclear entry and target association. Collectively, these mutations demonstrate that in vivo, within the preintegration complex, IN performs a central role in coordinating multiple late stages of the retrotransposition life cycle. PMID:9847351

  5. PU.1 is a major transcriptional activator of the tumour suppressor gene LIMD1

    PubMed Central

    Foxler, Daniel E.; James, Victoria; Shelton, Samuel J.; Vallim, Thomas Q. de A.; Shaw, Peter E.; Sharp, Tyson V.

    2011-01-01

    LIMD1 is a tumour suppressor gene (TSG) down regulated in ∼80% of lung cancers with loss also demonstrated in breast and head and neck squamous cell carcinomas. LIMD1 is also a candidate TSG in childhood acute lymphoblastic leukaemia. Mechanistically, LIMD1 interacts with pRB, repressing E2F-driven transcription as well as being a critical component of microRNA-mediated gene silencing. In this study we show a CpG island within the LIMD1 promoter contains a conserved binding motif for the transcription factor PU.1. Mutation of the PU.1 consensus reduced promoter driven transcription by 90%. ChIP and EMSA analysis demonstrated that PU.1 specifically binds to the LIMD1 promoter. siRNA depletion of PU.1 significantly reduced endogenous LIMD1 expression, demonstrating that PU.1 is a major transcriptional activator of LIMD1. PMID:21402070

  6. p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zonesmore » in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.« less

  7. [Contact shot from infantry weapons with a flash-suppressor].

    PubMed

    Perdekamp, Markus Grosse; Braunwarth, Roland; Schmidt, Ulrike; Schmidt, Wolfgang; Pollak, Stefan

    2003-01-01

    The number of reports on contact shots from firearms with a flash suppressor attached to the muzzle is small. On the basis of a case report (suicidal shot to the forehead with a Kalschnikow AKMS 47 assault rifle) the morphological peculiarities (characteristics soot pattern, relatively small powder cavity and only minor skin tears in the presence of a bony support) are presented and the conclusions to be drawn from the findings regarding the flash-suppressor, the shot distance, the angle of the shot and the way of holding the weapon are discussed.

  8. Conservative mutation Met8 --> Leu affects the folding process and structural stability of squash trypsin inhibitor CMTI-I.

    PubMed Central

    Zhukov, I.; Jaroszewski, L.; Bierzyński, A.

    2000-01-01

    Protein molecules can accommodate a large number of mutations without noticeable effects on their stability and folding kinetics. On the other hand, some mutations can have quite strong effects on protein conformational properties. Such mutations either destabilize secondary structures, e.g., alpha-helices, are incompatible with close packing of protein hydrophobic cores, or lead to disruption of some specific interactions such as disulfide cross links, salt bridges, hydrogen bonds, or aromatic-aromatic contacts. The Met8 --> Leu mutation in CMTI-I results in significant destabilization of the protein structure. This effect could hardly be expected since the mutation is highly conservative, and the side chain of residue 8 is situated on the protein surface. We show that the protein destabilization is caused by rearrangement of a hydrophobic cluster formed by side chains of residues 8, Ile6, and Leu17 that leads to partial breaking of a hydrogen bond formed by the amide group of Leu17 with water and to a reduction of a hydrophobic surface buried within the cluster. The mutation perturbs also the protein folding. In aerobic conditions the reduced wild-type protein folds effectively into its native structure, whereas more then 75% of the mutant molecules are trapped in various misfolded species. The main conclusion of this work is that conservative mutations of hydrophobic residues can destabilize a protein structure even if these residues are situated on the protein surface and partially accessible to water. Structural rearrangement of small hydrophobic clusters formed by such residues can lead to local changes in protein hydration, and consequently, can affect considerably protein stability and folding process. PMID:10716179

  9. Rpl27a mutation in the sooty foot ataxia mouse phenocopies high p53 mouse models

    PubMed Central

    Terzian, Tamara; Dumble, Melissa; Arbab, Farinaz; Thaller, Christina; Donehower, Lawrence A; Lozano, Guillermina; Justice, Monica J; Roop, Dennis R; Box, Neil F

    2013-01-01

    Ribosomal stress is an important, yet poorly understood, mechanism that results in activation of the p53 tumour suppressor. We present a mutation in the ribosomal protein Rpl27a gene (sooty foot ataxia mice), isolated through a sensitized N-ethyl-N-nitrosourea (ENU) mutagenesis screen for p53 pathway defects, that shares striking phenotypic similarities with high p53 mouse models, including cerebellar ataxia, pancytopenia and epidermal hyperpigmentation. This phenocopy is rescued in a haploinsufficient p53 background. A detailed examination of the bone marrow in these mice identified reduced numbers of haematopoietic stem cells and a p53-dependent c-Kit down-regulation. These studies suggest that reduced Rpl27a increases p53 activity in vivo, further evident with a delay in tumorigenesis in mutant mice. Taken together, these data demonstrate that Rpl27a plays a crucial role in multiple tissues and that disruption of this ribosomal protein affects both development and transformation. PMID:21674502

  10. PML tumor suppressor protein is required for HCV production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuroki, Misao; Research Fellow of the Japan Society for the Promotion of Science; Center for AIDS Research, Kumamoto University, Kumamoto 860-0811

    2013-01-11

    Highlights: Black-Right-Pointing-Pointer PML tumor suppressor protein is required for HCV production. Black-Right-Pointing-Pointer PML is dispensable for HCV RNA replication. Black-Right-Pointing-Pointer HCV could not alter formation of PML-NBs. Black-Right-Pointing-Pointer INI1 and DDX5, PML-related proteins, are involved in HCV life cycle. -- Abstract: PML tumor suppressor protein, which forms discrete nuclear structures termed PML-nuclear bodies, has been associated with several cellular functions, including cell proliferation, apoptosis and antiviral defense. Recently, it was reported that the HCV core protein colocalizes with PML in PML-NBs and abrogates the PML function through interaction with PML. However, role(s) of PML in HCV life cycle is unknown.more » To test whether or not PML affects HCV life cycle, we examined the level of secreted HCV core and the infectivity of HCV in the culture supernatants as well as the level of HCV RNA in HuH-7-derived RSc cells, in which HCV-JFH1 can infect and efficiently replicate, stably expressing short hairpin RNA targeted to PML. In this context, the level of secreted HCV core and the infectivity in the supernatants from PML knockdown cells was remarkably reduced, whereas the level of HCV RNA in the PML knockdown cells was not significantly affected in spite of very effective knockdown of PML. In fact, we showed that PML is unrelated to HCV RNA replication using the subgenomic HCV-JFH1 replicon RNA, JRN/3-5B. Furthermore, the infectivity of HCV-like particle in the culture supernatants was significantly reduced in PML knockdown JRN/3-5B cells expressing core to NS2 coding region of HCV-JFH1 genome using the trans-packaging system. Finally, we also demonstrated that INI1 and DDX5, the PML-related proteins, are involved in HCV production. Taken together, these findings suggest that PML is required for HCV production.« less

  11. Random mtDNA mutations modulate proliferation capacity in mouse embryonic fibroblasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kukat, Alexandra; Cologne Excellence Cluster on Cellular Stress Responses in Ageing-Associated Diseases; Edgar, Daniel

    2011-06-10

    Highlights: {yields} Increased mtDNA mutations in MEFs lead to high level of spontaneous immortalization. {yields} This process is independent of endogenous ROS production. {yields} Aerobic glycolysis significantly contributes to spontaneous immortalization of MEFs. -- Abstract: An increase in mtDNA mutation load leads to a loss of critical cells in different tissues thereby contributing to the physiological process of organismal ageing. Additionally, the accumulation of senescent cells that display changes in metabolic function might act in an active way to further disrupt the normal tissue function. We believe that this could be the important link missing in our understanding of themore » molecular mechanisms of premature ageing in the mtDNA mutator mice. We tested proliferation capacity of mtDNA mutator cells in vitro. When cultured in physiological levels of oxygen (3%) their proliferation capacity is somewhat lower than wild-type cells. Surprisingly, in conditions of increased oxidative stress (20% O{sub 2}) mtDNA mutator mouse embryonic fibroblasts exhibit continuous proliferation due to spontaneous immortalization, whereas the same conditions promote senescence in wild-type cells. We believe that an increase in aerobic glycolysis observed in mtDNA mutator mice is a major mechanism behind this process. We propose that glycolysis promotes proliferation and allows a fast turnover of metabolites, but also leads to energy crisis due to lower ATP production rate. This could lead to compromised replication and/or repair and therefore, in rare cases, might lead to mutations in tumor suppressor genes and spontaneous immortalization.« less

  12. Enhanced Transgene Expression in Sugarcane by Co-Expression of Virus-Encoded RNA Silencing Suppressors

    PubMed Central

    Park, Jong-Won; Beyene, Getu; Buenrostro-Nava, Marco T.; Molina, Joe; Wang, Xiaofeng; Ciomperlik, Jessica J.; Manabayeva, Shuga A.; Alvarado, Veria Y.; Rathore, Keerti S.; Scholthof, Herman B.; Mirkov, T. Erik

    2013-01-01

    Post-transcriptional gene silencing is commonly observed in polyploid species and often poses a major limitation to plant improvement via biotechnology. Five plant viral suppressors of RNA silencing were evaluated for their ability to counteract gene silencing and enhance the expression of the Enhanced Yellow Fluorescent Protein (EYFP) or the β-glucuronidase (GUS) reporter gene in sugarcane, a major sugar and biomass producing polyploid. Functionality of these suppressors was first verified in Nicotiana benthamiana and onion epidermal cells, and later tested by transient expression in sugarcane young leaf segments and protoplasts. In young leaf segments co-expressing a suppressor, EYFP reached its maximum expression at 48–96 h post-DNA introduction and maintained its peak expression for a longer time compared with that in the absence of a suppressor. Among the five suppressors, Tomato bushy stunt virus-encoded P19 and Barley stripe mosaic virus-encoded γb were the most efficient. Co-expression with P19 and γb enhanced EYFP expression 4.6-fold and 3.6-fold in young leaf segments, and GUS activity 2.3-fold and 2.4-fold in protoplasts compared with those in the absence of a suppressor, respectively. In transgenic sugarcane, co-expression of GUS and P19 suppressor showed the highest accumulation of GUS levels with an average of 2.7-fold more than when GUS was expressed alone, with no detrimental phenotypic effects. The two established transient expression assays, based on young leaf segments and protoplasts, and confirmed by stable transgene expression, offer a rapid versatile system to verify the efficiency of RNA silencing suppressors that proved to be valuable in enhancing and stabilizing transgene expression in sugarcane. PMID:23799071

  13. P53 Mutation Profiles in Premenopausal Versus Postmenopausal Breast Cancer in a Stationary Population

    DTIC Science & Technology

    1997-08-01

    Gryka , M ., Bischoff, F Z., Tainsky, M . A., Friend. S. H., 1990: Germ line p53 mutation in a familial syndrome of breast cancer, sarcomas, and...of relapse and survival with amplification of the HER-2/neu oncogene. Science 235:177-182 2. Prosser, J., Thompson, A. M ., Cranston, G and Evans, HJ...1990: Evidence that p53 behaves as a tumor suppressor gene in sporadic breast tumours. Oncogene 5:1573-1579. 3. Davidoff, A. M ., Kerns, B.J. M

  14. A Novel WT1 Gene Mutation in a Three-Generation Family with Progressive Isolated Focal Segmental Glomerulosclerosis

    PubMed Central

    Caridi, Gianluca; Malaventura, Cristina; Dagnino, Monica; Leonardi, Emanuela; Artifoni, Lina; Ghiggeri, Gian Marco; Tosatto, Silvio C.E.; Murer, Luisa

    2010-01-01

    Background and objectives: Wilms tumor-suppressor gene-1 (WT1) plays a key role in kidney development and function. WT1 mutations usually occur in exons 8 and 9 and are associated with Denys-Drash, or in intron 9 and are associated with Frasier syndrome. However, overlapping clinical and molecular features have been reported. Few familial cases have been described, with intrafamilial variability. Sporadic cases of WT1 mutations in isolated diffuse mesangial sclerosis or focal segmental glomerulosclerosis have also been reported. Design, setting, participants, & measurements: Molecular analysis of WT1 exons 8 and 9 was carried out in five members on three generations of a family with late-onset isolated proteinuria. The effect of the detected amino acid substitution on WT1 protein's structure was studied by bioinformatics tools. Results: Three family members reached end-stage renal disease in full adulthood. None had genital abnormalities or Wilms tumor. Histologic analysis in two subjects revealed focal segmental glomerulosclerosis. The novel sequence variant c.1208G>A in WT1 exon 9 was identified in all of the affected members of the family. Conclusions: The lack of Wilms tumor or other related phenotypes suggests the expansion of WT1 gene analysis in patients with focal segmental glomerulosclerosis, regardless of age or presence of typical Denys-Drash or Frasier syndrome clinical features. Structural analysis of the mutated protein revealed that the mutation hampers zinc finger-DNA interactions, impairing target gene transcription. This finding opens up new issues about WT1 function in the maintenance of the complex gene network that regulates normal podocyte function. PMID:20150449

  15. Just like the rest of evolution in Mother Nature, the evolution of cancers may be driven by natural selection, and not by haphazard mutations

    PubMed Central

    Zhang, Ju; Lou, Xiaomin; Zellmer, Lucas; Liu, Siqi; Xu, Ningzhi; Liao, D. Joshua

    2014-01-01

    Sporadic carcinogenesis starts from immortalization of a differentiated somatic cell or an organ-specific stem cell. The immortalized cell incepts a new or quasinew organism that lives like a parasite in the patient and usually proceeds to progressive simplification, constantly engendering intermediate organisms that are simpler than normal cells. Like organismal evolution in Mother Nature, this cellular simplification is a process of Darwinian selection of those mutations with growth- or survival-advantages, from numerous ones that occur randomly and stochastically. Therefore, functional gain of growth- or survival-sustaining oncogenes and functional loss of differentiation-sustaining tumor suppressor genes, which are hallmarks of cancer cells and contribute to phenotypes of greater malignancy, are not drivers of carcinogenesis but are results from natural selection of advantageous mutations. Besides this mutation-load dependent survival mechanism that is evolutionarily low and of an asexual nature, cancer cells may also use cell fusion for survival, which is an evolutionarily-higher mechanism and is of a sexual nature. Assigning oncogenes or tumor suppressor genes or their mutants as drivers to induce cancer in animals may somewhat coerce them to create man-made oncogenic pathways that may not really be a course of sporadic cancer formations in the human. PMID:25594068

  16. Identification of a single ancestral CYP1B1 mutation in Slovak Gypsies (Roms) affected with primary congenital glaucoma.

    PubMed

    Plásilová, M; Stoilov, I; Sarfarazi, M; Kádasi, L; Feráková, E; Ferák, V

    1999-04-01

    Primary congenital glaucoma (PCG) is an autosomal recessive eye disease that occurs at an unusually high frequency in the ethnic isolate of Roms (Gypsies) in Slovakia. Recently, we linked the disease in this population to the GLC3A locus on 2p21. At this locus, mutations in the cytochrome P4501B1 (CYP1B1) gene have been identified as a molecular basis for this condition. Here, we report the results of CYP1B1 mutation screening of 43 PCG patients from 26 Slovak Rom families. A homozygous G-->A transition at nucleotide 1505 in the highly conserved region of exon 3 was detected in all families. This mutation results in the E387K substitution, which affects the conserved K helix region of the cytochrome P450 molecule. Determination of the CYP1B1 polymorphic background showed a common DNA haplotype in all patients, thus indicating that the E387K mutation in Roms has originated from a single ancestral mutational event. The Slovak Roms represent the first population in which PCG is found to result from a single mutation in the CYP1B1 gene, so that a founder effect is the most plausible explanation of its increased incidence. An ARMS-PCR assay has been developed for fast detection of this mutation, thus allowing direct DNA based prenatal diagnosis as well as gene carrier detection in this particular population. Screening of 158 healthy Roms identified 17 (10.8%) mutation carriers, indicating that the frequency of PCG in this population may be even higher than originally estimated.

  17. Anaerobically Grown Escherichia coli Has an Enhanced Mutation Rate and Distinct Mutational Spectra

    PubMed Central

    Shewaramani, Sonal; Finn, Thomas J.; Kassen, Rees; Rainey, Paul B.

    2017-01-01

    Oxidative stress is a major cause of mutation but little is known about how growth in the absence of oxygen impacts the rate and spectrum of mutations. We employed long-term mutation accumulation experiments to directly measure the rates and spectra of spontaneous mutation events in Escherichia coli populations propagated under aerobic and anaerobic conditions. To detect mutations, whole genome sequencing was coupled with methods of analysis sufficient to identify a broad range of mutational classes, including structural variants (SVs) generated by movement of repetitive elements. The anaerobically grown populations displayed a mutation rate nearly twice that of the aerobic populations, showed distinct asymmetric mutational strand biases, and greater insertion element activity. Consistent with mutation rate and spectra observations, genes for transposition and recombination repair associated with SVs were up-regulated during anaerobic growth. Together, these results define differences in mutational spectra affecting the evolution of facultative anaerobes. PMID:28103245

  18. TRNA mutations that affect decoding fidelity deregulate development and the proteostasis network in zebrafish

    PubMed Central

    Reverendo, Marisa; Soares, Ana R; Pereira, Patrícia M; Carreto, Laura; Ferreira, Violeta; Gatti, Evelina; Pierre, Philippe; Moura, Gabriela R; Santos, Manuel A

    2014-01-01

    Mutations in genes that encode tRNAs, aminoacyl-tRNA syntheases, tRNA modifying enzymes and other tRNA interacting partners are associated with neuropathies, cancer, type-II diabetes and hearing loss, but how these mutations cause disease is unclear. We have hypothesized that levels of tRNA decoding error (mistranslation) that do not fully impair embryonic development can accelerate cell degeneration through proteome instability and saturation of the proteostasis network. To test this hypothesis we have induced mistranslation in zebrafish embryos using mutant tRNAs that misincorporate Serine (Ser) at various non-cognate codon sites. Embryo viability was affected and malformations were observed, but a significant proportion of embryos survived by activating the unfolded protein response (UPR), the ubiquitin proteasome pathway (UPP) and downregulating protein biosynthesis. Accumulation of reactive oxygen species (ROS), mitochondrial and nuclear DNA damage and disruption of the mitochondrial network, were also observed, suggesting that mistranslation had a strong negative impact on protein synthesis rate, ER and mitochondrial homeostasis. We postulate that mistranslation promotes gradual cellular degeneration and disease through protein aggregation, mitochondrial dysfunction and genome instability. PMID:25483040

  19. Strain of Escherichia coli with a temperature-sensitive mutation affecting ribosomal ribonucleic acid accumulation.

    PubMed Central

    Frey, T; Newlin, L L; Atherly, A G

    1975-01-01

    A mutant of Escherichia coli has been isolated that has a temperature-sensitive mutation that results in specific loss of ribosomal ribonucleic acid (RNA) synthesis and some reduction in messenger RNA synthesis. When the strain was grown in glucose medium at a restrictive temperature, RNA accumulation ceased, but both messenger RNA and protein synthesis continued for an extended time. Because carbon metabolism was slowed drastically when strain AA-157 was placed at the restrictive temperature, this phenotype can be compared with carbon depletion conditions present during diauxic lag. However, the phenotype of mutant AA-157 differs from shift-down conditions in that guanosine-3',5'-tetraphosphate levels are unaffected; therefore, a different site is affected. This mutant strain (AA-157) thus shows many characteristics similar to an aldolase mutant previously reported (Böck and Neidhardt, 1966). However, the mutation occurred in a different position on the E. coli genetic map, and furthermore, aldolase was not temperature sensitive in strain AA-157. In this paper we present a study of macromolecular biosynthesis in this mutant. PMID:1090609

  20. Analysis of APC mutation in human ameloblastoma and clinical significance.

    PubMed

    Li, Ning; Liu, Bing; Sui, Chengguang; Jiang, Youhong

    2016-01-01

    As a highly conserved signaling pathway, Wnt/β-catenin signal transduction pathway plays an important role in many processes. Either in the occurrence or development of tumor, activation of this pathway takes an important place. APC inhibits Wnt/β-catenin pathway to regulate cell proliferation and differentiation. This study aimed to investigate the function of cancer suppressor gene. PCR amplification and sequencing method was used to analyze APC mutations of human clinical specimens. The pathological specimens were collected for PCR and clear electrophoretic bands were obtained after electrophoresis. The gene sequence obtained after purification and sequencing analysis was compared with the known APC gene sequence (NM_000038.5). Base mutations at APC 1543 (T → C), APC-4564 (G → A), APC-5353 (T → G), APC-5550 (T → A) and APC-5969 (G → A) locus existed in 22 (27.5 %), 12 (15 %), 5 (6.25 %), 13 (16.25 %) and 12 patients (15 %), respectively. Gene mutations existed in ameloblastoma, and the mutation loci were 1543 locus (T → C), 4564 locus (G → A), 5353 locus (T → G), 5550 locus (T → A) and 5969 locus (G → A) 15 %, respectively. APC mutation plays a certain role in monitoring the tumor malignant degree as it may indicate the transition process of ameloblastoma malignant phenotype.

  1. RSRC1 mutation affects intellect and behaviour through aberrant splicing and transcription, downregulating IGFBP3.

    PubMed

    Perez, Yonatan; Menascu, Shay; Cohen, Idan; Kadir, Rotem; Basha, Omer; Shorer, Zamir; Romi, Hila; Meiri, Gal; Rabinski, Tatiana; Ofir, Rivka; Yeger-Lotem, Esti; Birk, Ohad S

    2018-04-01

    RSRC1, whose polymorphism is associated with altered brain function in schizophrenia, is a member of the serine and arginine rich-related protein family. Through homozygosity mapping and whole exome sequencing we show that RSRC1 mutation causes an autosomal recessive syndrome of intellectual disability, aberrant behaviour, hypotonia and mild facial dysmorphism with normal brain MRI. Further, we show that RSRC1 is ubiquitously expressed, and that the RSRC1 mutation triggers nonsense-mediated mRNA decay of the RSRC1 transcript in patients' fibroblasts. Short hairpin RNA (shRNA)-mediated lentiviral silencing and overexpression of RSRC1 in SH-SY5Y cells demonstrated that RSRC1 has a role in alternative splicing and transcription regulation. Transcriptome profiling of RSRC1-silenced cells unravelled specific differentially expressed genes previously associated with intellectual disability, hypotonia and schizophrenia, relevant to the disease phenotype. Protein-protein interaction network modelling suggested possible intermediate interactions by which RSRC1 affects gene-specific differential expression. Patient-derived induced pluripotent stem cells, differentiated into neural progenitor cells, showed expression dynamics similar to the RSRC1-silenced SH-SY5Y model. Notably, patient neural progenitor cells had 9.6-fold downregulated expression of IGFBP3, whose brain expression is affected by MECP2, aberrant in Rett syndrome. Interestingly, Igfbp3-null mice have behavioural impairment, abnormal synaptic function and monoaminergic neurotransmission, likely correlating with the disease phenotype.

  2. Promoter Hypermethylation of Tumour Suppressor Genes as Potential Biomarkers in Colorectal Cancer

    PubMed Central

    Ng, Jennifer Mun-Kar; Yu, Jun

    2015-01-01

    Colorectal cancer (CRC) is a common malignancy and the fourth leading cause of cancer deaths worldwide. It results from the accumulation of multiple genetic and epigenetic changes leading to the transformation of colon epithelial cells into invasive adenocarcinomas. In CRC, epigenetic changes, in particular promoter CpG island methylation, occur more frequently than genetic mutations. Hypermethylation contributes to carcinogenesis by inducing transcriptional silencing or downregulation of tumour suppressor genes and currently, over 600 candidate hypermethylated genes have been identified. Over the past decade, a deeper understanding of epigenetics coupled with technological advances have hinted at the potential of translating benchtop research into biomarkers for clinical use. DNA methylation represents one of the largest bodies of literature in epigenetics, and hence has the highest potential for minimally invasive biomarker development. Most progress has been made in the development of diagnostic markers and there are currently two, one stool-based and one blood-based, biomarkers that are commercially available for diagnostics. Prognostic and predictive methylation markers are still at their infantile stages. PMID:25622259

  3. Neurofibromatosis 2 tumor suppressor, the gene induced by valproic acid, mediates neurite outgrowth through interaction with paxillin.

    PubMed

    Yamauchi, Junji; Miyamoto, Yuki; Kusakawa, Shinji; Torii, Tomohiro; Mizutani, Reiko; Sanbe, Atsushi; Nakajima, Hideki; Kiyokawa, Nobutaka; Tanoue, Akito

    2008-07-01

    Valproic acid (VPA), the drug for bipolar disorder and epilepsy, has a potent ability to induce neuronal differentiation, yet comparatively little is presently known about the underlying mechanism. We previously demonstrated that c-Jun N-terminal kinase (JNK) phosphorylation of the focal adhesion protein paxillin mediates differentiation in N1E-115 neuroblastoma cells. Here, we show that VPA up-regulates the neurofibromatosis type 2 (NF2) tumor suppressor, merlin, to regulate neurite outgrowth through the interaction with paxillin. The inhibition of merlin function by its knockdown or expression of merlin harboring the Gln-538-to-Pro mutation, a naturally occurring NF2 missense mutation deficient in linking merlin to the actin cytoskeleton, decreases VPA-induced neurite outgrowth. Importantly, the expression of merlin by itself is not sufficient to induce neurite outgrowth, which requires co-expression with paxillin, the binding partner of merlin. In fact, the missense mutation Trp-60-to-Cys or Phe-62-to-Ser, that is deficient in binding to paxillin, reduces neurite outgrowth induced by VPA. In addition, co-expression of a paxillin construct harboring the mutation at the JNK phosphorylation site with merlin results in blunted induction of the outgrowth. We also find that the first LIM domain of paxillin is a major binding region with merlin and that expression of the isolated first LIM domain blocks the effects of VPA. Furthermore, similar findings that merlin regulates neurite outgrowth through the interaction with paxillin have been observed in several kinds of neuronal cells. These results suggest that merlin is an as yet unknown regulator of neurite outgrowth through the interaction with paxillin, providing a possibly common mechanism regulating neurite formation.

  4. High dietary intake of sodium selenite does not affect gene mutation frequency in rat colon and liver.

    PubMed

    Zeng, Huawei; Uthus, Eric O; Ross, Sharon A; Davis, Cindy D

    2009-10-01

    Our previous studies have shown that selenium (Se) is protective against dimethylhydrazine (DMH)-induced preneoplastic colon cancer lesions, and protection against DNA damage has been hypothesized to be one mechanism for the anticancer effect of Se. The present study was designed to determine whether dietary selenite affects somatic mutation frequency in vivo. We used the Big Blue transgenic model to evaluate the in vivo mutation frequency of the cII gene in rats fed either a Se-deficient (0 microg Se/g diet) or Se-supplemented diet (0.2 or 2 microg Se/g diet; n = 3 rats/diet in experiment 1 and n = 5 rats/group in experiment 2) and injected with DMH (25 mg/kg body weight, i.p.). There were no significant differences in body weight between the Se-deficient and Se-supplemented (0.2 or 2 microg Se/g diet) rats, but the activities of liver glutathione peroxidase and thioredoxin reductase and concentration of liver Se were significantly lower (p < 0.0001) in Se-deficient rats compared to rats supplemented with Se. We found no effect of dietary Se on liver 8-hydroxy-2'-deoxyguanosine. Gene mutation frequency was significantly lower in liver (p < 0.001) than that of colon regardless of dietary Se. However, there were no differences in gene mutation frequency in DNA from colon mucosa or liver from rats fed the Se-deficient diet compared to those fed the Se-supplemented (0.2 or 2 microg Se/g diet) diet. Although gene mutations have been implicated in the etiology of cancer, our data suggest that decreasing gene mutation is not likely a key mechanism through which dietary selenite exerts its anticancer action against DMH-induced preneoplastic colon cancer lesions in a Big Blue transgenic rat model.

  5. Characterization of a mutation commonly associated with persistent stuttering: evidence for a founder mutation

    PubMed Central

    Fedyna, Alison; Drayna, Dennis; Kang, Changsoo

    2010-01-01

    Stuttering is a disorder which affects the fluency of speech. It has been shown to have high heritability, and has recently been linked to mutations in the GNPTAB gene. One such mutation, Glu1200Lys, has been repeatedly observed in unrelated families and individual cases. Eight unrelated individuals carrying this mutation were analyzed in an effort to distinguish whether these arise from repeated mutation at the same site, or whether they represent a founder mutation with a single origin. Results show that all 12 chromosomes carrying this mutation share a common haplotype in this region, indicating it is a founder mutation. Further analysis estimated the age of this allele to be ~572 generations. Construction of a cladogram tracing the mutation through our study sample also supports the founder mutation hypothesis. PMID:20944643

  6. Classification of TP53 mutations and HPV predict survival in advanced larynx cancer.

    PubMed

    Scheel, Adam; Bellile, Emily; McHugh, Jonathan B; Walline, Heather M; Prince, Mark E; Urba, Susan; Wolf, Gregory T; Eisbruch, Avraham; Worden, Francis; Carey, Thomas E; Bradford, Carol

    2016-09-01

    Assess tumor suppressor p53 (TP53) functional mutations in the context of other biomarkers in advanced larynx cancer. Prospective analysis of pretreatment tumor TP53, human papillomavirus (HPV), Bcl-xL, and cyclin D1 status in stage III and IV larynx cancer patients in a clinical trial. TP53 exons 4 through 9 from 58 tumors were sequenced. Mutations were grouped using three classifications based on their expected function. Each functional group was analyzed for response to induction chemotherapy, time to surgery, survival, HPV status, p16INK4a, Bcl-xl, and cyclin D1 expression. TP53 mutations were found in 22 of 58 (37.9%) patients with advanced larynx cancer, including missense mutations in 13 of 58 (22.4%) patients, nonsense mutations in four of 58 (6.9%), and deletions in five of 58 (8.6%). High-risk HPV was found in 20 of 52 (38.5%) tumors. A classification based on Evolutionary Action score of p53 (EAp53) distinguished missense mutations with high risk for decreased survival from low-risk mutations (P = 0.0315). A model including this TP53 classification, HPV status, cyclin D1, and Bcl-xL staining significantly predicts survival (P = 0.0017). EAp53 functional classification of TP53 mutants and biomarkers predict survival in advanced larynx cancer. NA. Laryngoscope, 126:E292-E299, 2016. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  7. USP7 Is a Tumor-Specific WNT Activator for APC-Mutated Colorectal Cancer by Mediating β-Catenin Deubiquitination.

    PubMed

    Novellasdemunt, Laura; Foglizzo, Valentina; Cuadrado, Laura; Antas, Pedro; Kucharska, Anna; Encheva, Vesela; Snijders, Ambrosius P; Li, Vivian S W

    2017-10-17

    The tumor suppressor gene adenomatous polyposis coli (APC) is mutated in most colorectal cancers (CRCs), resulting in constitutive Wnt activation. To understand the Wnt-activating mechanism of the APC mutation, we applied CRISPR/Cas9 technology to engineer various APC-truncated isogenic lines. We find that the β-catenin inhibitory domain (CID) in APC represents the threshold for pathological levels of Wnt activation and tumor transformation. Mechanistically, CID-deleted APC truncation promotes β-catenin deubiquitination through reverse binding of β-TrCP and USP7 to the destruction complex. USP7 depletion in APC-mutated CRC inhibits Wnt activation by restoring β-catenin ubiquitination, drives differentiation, and suppresses xenograft tumor growth. Finally, the Wnt-activating role of USP7 is specific to APC mutations; thus, it can be used as a tumor-specific therapeutic target for most CRCs. Copyright © 2017 The Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

  8. [Analysis of genotype and phenotype correlation of MYH7-V878A mutation among ethnic Han Chinese pedigrees affected with hypertrophic cardiomyopathy].

    PubMed

    Wang, Bo; Guo, Ruiqi; Zuo, Lei; Shao, Hong; Liu, Ying; Wang, Yu; Ju, Yan; Sun, Chao; Wang, Lifeng; Zhang, Yanmin; Liu, Liwen

    2017-08-10

    To analyze the phenotype-genotype correlation of MYH7-V878A mutation. Exonic amplification and high-throughput sequencing of 96-cardiovascular disease-related genes were carried out on probands from 210 pedigrees affected with hypertrophic cardiomyopathy (HCM). For the probands, their family members, and 300 healthy volunteers, the identified MYH7-V878A mutation was verified by Sanger sequencing. Information of the HCM patients and their family members, including clinical data, physical examination, echocardiography (UCG), electrocardiography (ECG), and conserved sequence of the mutation among various species were analyzed. A MYH7-V878A mutation was detected in five HCM pedigrees containing 31 family members. Fourteen members have carried the mutation, among whom 11 were diagnosed with HCM, while 3 did not meet the diagnostic criteria. Some of the fourteen members also carried other mutations. Family members not carrying the mutation had normal UCG and ECG. No MYH7-V878A mutation was found among the 300 healthy volunteers. Analysis of sequence conservation showed that the amino acid is located in highly conserved regions among various species. MYH7-V878A is a hot spot among ethnic Han Chinese with a high penetrance. Functional analysis of the conserved sequences suggested that the mutation may cause significant alteration of the function. MYH7-V878A has a significant value for the early diagnosis of HCM.

  9. The UMD-p53 database: new mutations and analysis tools.

    PubMed

    Béroud, Christophe; Soussi, Thierry

    2003-03-01

    The tumor suppressor gene TP53 (p53) is the most extensively studied gene involved in human cancers. More than 1,400 publications have reported mutations of this gene in 150 cancer types for a total of 14,971 mutations. To exploit this huge bulk of data, specific analytic tools were highly warranted. We therefore developed a locus-specific database software called UMD-p53. This database compiles all somatic and germline mutations as well as polymorphisms of the TP53 gene which have been reported in the published literature since 1989, or unpublished data submitted to the database curators. The database is available at www.umd.necker.fr or at http://p53.curie.fr/. In this paper, we describe recent developments of the UMD-p53 database. These developments include new fields and routines. For example, the analysis of putative acceptor or donor splice sites is now automated and gives new insight for the causal role of "silent mutations." Other routines have also been created such as the prescreening module, the UV module, and the cancer distribution module. These new improvements will help users not only for molecular epidemiology and pharmacogenetic studies but also for patient-based studies. To achieve theses purposes we have designed a procedure to check and validate data in order to reach the highest quality data. Copyright 2003 Wiley-Liss, Inc.

  10. Point Mutations in the Stem Region and the Fourth AAA Domain of Cytoplasmic Dynein Heavy Chain Partially Suppress the Phenotype of NUDF/LIS1 Loss in Aspergillus nidulans

    PubMed Central

    Zhuang, Lei; Zhang, Jun; Xiang, Xin

    2007-01-01

    Cytoplasmic dynein performs multiple cellular tasks but its regulation remains unclear. The dynein heavy chain has a N-terminal stem that binds to other subunits and a C-terminal motor unit that contains six AAA (ATPase associated with cellular activities) domains and a microtubule-binding site located between AAA4 and AAA5. In Aspergillus nidulans, NUDF (a LIS1 homolog) functions in the dynein pathway, and two nudF6 partial suppressors were mapped to the nudA dynein heavy chain locus. Here we identified these two mutations. The nudAL1098F mutation resides in the stem region, and nudAR3086C is in the end of AAA4. These mutations partially suppress the phenotype of nudF deletion but do not suppress the phenotype exhibited by mutants of dynein intermediate chain and Arp1. Surprisingly, the stronger ΔnudF suppressor, nudAR3086C, causes an obvious decrease in the basal level of dynein's ATPase activity and an increase in dynein's distribution along microtubules. Thus, suppression of the ΔnudF phenotype may result from mechanisms other than simply the enhancement of dynein's ATPase activity. The fact that a mutation in the end of AAA4 negatively regulates dynein's ATPase activity but partially compensates for NUDF loss indicates the importance of the AAA4 domain in dynein regulation in vivo. PMID:17237507

  11. Bacterial mutation affecting plasmid maintenance in Pseudomonas aeruginosa.

    PubMed Central

    Chang, B J; Holloway, B W

    1977-01-01

    A bacterial mutation, risA, in Pseudomonas aeruginosa caused growth inhibition at 43 degrees C of risA strains containing P2 plasmids. Incubation at 43 degrees C resulted in selection for clones that had lost P2 plasmids. PMID:122513

  12. A tumor suppressor role of the Bub3 spindle checkpoint protein after apoptosis inhibition

    PubMed Central

    Moutinho-Santos, Tatiana

    2013-01-01

    Most solid tumors contain aneuploid cells, indicating that the mitotic checkpoint is permissive to the proliferation of chromosomally aberrant cells. However, mutated or altered expression of mitotic checkpoint genes accounts for a minor proportion of human tumors. We describe a Drosophila melanogaster tumorigenesis model derived from knocking down spindle assembly checkpoint (SAC) genes and preventing apoptosis in wing imaginal discs. Bub3-deficient tumors that were also deficient in apoptosis displayed neoplastic growth, chromosomal aneuploidy, and high proliferative potential after transplantation into adult flies. Inducing aneuploidy by knocking down CENP-E and preventing apoptosis does not induce tumorigenesis, indicating that aneuploidy is not sufficient for hyperplasia. In this system, the aneuploidy caused by a deficient SAC is not driving tumorigenesis because preventing Bub3 from binding to the kinetochore does not cause hyperproliferation. Our data suggest that Bub3 has a nonkinetochore-dependent function that is consistent with its role as a tumor suppressor. PMID:23609535

  13. Characterization of an RNA silencing suppressor encoded by maize yellow dwarf virus-RMV2.

    PubMed

    Wang, Fang; Zhao, Xia; Dong, Qing; Zhou, Benguo; Gao, Zhengliang

    2018-05-11

    Maize yellow dwarf virus-RMV2 (MYDV-RMV2) causes dwarfing and yellowing symptoms on leaves in field-grown maize plants in Anhui province in China. Herein, we evaluated the RNA silencing suppressor (RSS) activity of the P0 protein from MYDV-RMV2 by co-infiltration assays using wild-type and GFP-transgenic Nicotiana benthamiana (line 16C). The P0 of MYDV-RMV2 exhibited RSS activity and inhibited RNA silencing both locally and systemically. MYDV-RMV2 P0 acts as an F-box-like motif, and mutations to Ala at positions 67, 68, and 81 in the F-box-like motif (67LPxx81P) abolished the RSS activity of P0. However, MYDV-RMV2 P0 failed to interact with AGO1 from Arabidopsis thaliana. Expressing P0 induced developmental defects. P0 was targeted to both the nuclei and cytoplasm of plant cells. These findings expand our knowledge of the role of polerovirus P0 proteins in RNA silencing.

  14. Tumor suppressors Sav/Scrib and oncogene Ras regulate stem cell transformation in adult Drosophila Malpighian Tubules

    PubMed Central

    Zeng, Xiankun; Singh, Shree Ram; Hou, David; Hou, Steven X.

    2012-01-01

    An increasing body of evidence suggests that tumors might originate from a few transformed cells that share many properties with normal stem cells. However, it remains unclear how normal stem cells are transformed into cancer stem cells. Here, we demonstrated that mutations causing the loss of tumor suppressor Sav or Scrib or activation of the oncogene Ras transform normal stem cells into cancer stem cells through a multistep process in the adult Drosophila Malpighian Tubules (MTs). In wild-type MTs, each stem cell generates one self-renewing and one differentiating daughter cell. However, in flies with loss-of-function sav or scrib or gain-of-function Ras mutations, both daughter cells grew and behaved like stem cells, leading to the formation of tumors in MTs. Ras functioned downstream of Sav and Scrib in regulating the stem cell transformation. The Ras-transformed stem cells exhibited many of the hallmarks of cancer, such as increased proliferation, reduced cell death, and failure to differentiate. We further demonstrated that several signal transduction pathways (including MEK/MAPK, RhoA, PKA, and TOR) mediate Rasṕ function in the stem cell transformation. Therefore, we have identified a molecular mechanism that regulates stem cell transformation, and this finding may lead to strategies for preventing tumor formation in certain organs. PMID:20432470

  15. Activating ESR1 Mutations Differentially Affect the Efficacy of ER Antagonists.

    PubMed

    Toy, Weiyi; Weir, Hazel; Razavi, Pedram; Lawson, Mandy; Goeppert, Anne U; Mazzola, Anne Marie; Smith, Aaron; Wilson, Joanne; Morrow, Christopher; Wong, Wai Lin; De Stanchina, Elisa; Carlson, Kathryn E; Martin, Teresa S; Uddin, Sharmeen; Li, Zhiqiang; Fanning, Sean; Katzenellenbogen, John A; Greene, Geoffrey; Baselga, José; Chandarlapaty, Sarat

    2017-03-01

    Recent studies have identified somatic ESR1 mutations in patients with metastatic breast cancer and found some of them to promote estrogen-independent activation of the receptor. The degree to which all recurrent mutants can drive estrogen-independent activities and reduced sensitivity to ER antagonists like fulvestrant is not established. In this report, we characterize the spectrum of ESR1 mutations from more than 900 patients. ESR1 mutations were detected in 10%, with D538G being the most frequent (36%), followed by Y537S (14%). Several novel, activating mutations were also detected (e.g., L469V, V422del, and Y537D). Although many mutations lead to constitutive activity and reduced sensitivity to ER antagonists, only select mutants such as Y537S caused a magnitude of change associated with fulvestrant resistance in vivo Correspondingly, tumors driven by Y537S, but not D5358G, E380Q, or S463P, were less effectively inhibited by fulvestrant than more potent and bioavailable antagonists, including AZD9496. These data point to a need for antagonists with optimal pharmacokinetic properties to realize clinical efficacy against certain ESR1 mutants. Significance: A diversity of activating ESR1 mutations exist, only some of which confer resistance to existing ER antagonists that might be overcome by next-generation inhibitors such as AZD9496. Cancer Discov; 7(3); 277-87. ©2016 AACR. This article is highlighted in the In This Issue feature, p. 235 . ©2016 American Association for Cancer Research.

  16. Tumor suppressor identified as inhibitor of inflammation

    Cancer.gov

    Scientists at NCI have found that a protein, FBXW7, which acts as a tumor suppressor, is also important for the reduction in strength of inflammatory pathways. It has long been recognized that a complex interaction exists between cancer causing mechanisms

  17. Immune suppression with supraoptimal doses of antigen in contact sensitivity. I. Demonstration of suppressor cells and their sensitivity to cyclophosphamide.

    PubMed

    Sy, M S; Miller, S D; Claman, H N

    1977-07-01

    Immunologic suppression was induced in a mouse model of contact sensitization to DNFB by using supraoptimal doses of antigen. In these studies, in vivo measurement of ear swelling as an indication of immunologic responsiveness correlated well with measurement of in vitro antigen-induced cell proliferation. This unresponsiveness was specific, since supraoptimal doses of DNFB did not interfere with the development of contact sensitivity to another contactant, oxazolone. The decrease in responsiveness is a form of active suppression, as lymphoid cells from supraoptimally sensitized donors transferred suppression to normal recipients. Furthermore, pretreatment with cyclophosphamide (Cy) reversed the suppression seen in supraoptimally sensitized animals but had no effect on the optimal sensitization regimen. These results indicate that supraoptimal doses of contactants can activate suppressor cells and that precursors of these cells are sensitive to Cy. Such suppressors regenerate within 7 to 14 days after Cy treatment. The ability of Cy pretreatment to affect supraoptimal sensitization without affecting optimal sensitization confirms other reports indicating that the observed results of Cy treatment depend critically upon the dose of antigen used.

  18. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Dehua; Fan, Wufang; Liu, Guohong

    2006-04-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showedmore » that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties.« less

  19. Switching on RNA Silencing Suppressor Activity by Restoring Argonaute Binding to a Viral Protein

    PubMed Central

    Szabó, Edit Z.; Manczinger, Máté; Göblös, Anikó; Kemény, Lajos

    2012-01-01

    We found that Sweet potato feathery mottle virus (SPFMV) P1, a close homologue of Sweet potato mild mottle virus P1, did not have any silencing suppressor activity. Remodeling the Argonaute (AGO) binding domain of SPFMV P1 by the introduction of two additional WG/GW motifs converted it to a silencing suppressor with AGO binding capacity. To our knowledge, this is the first instance of the transformation of a viral protein of unknown function to a functional silencing suppressor. PMID:22623784

  20. Social defeat interacts with Disc1 mutations in the mouse to affect behavior.

    PubMed

    Haque, F Nipa; Lipina, Tatiana V; Roder, John C; Wong, Albert H C

    2012-08-01

    DISC1 (Disrupted-in-schizophrenia 1) is a strong candidate susceptibility gene for psychiatric disease that was originally discovered in a family with a chromosomal translocation severing this gene. Although the family members with the translocation had an identical genetic mutation, their clinical diagnosis and presentation varied significantly. Gene-environment interactions have been proposed as a mechanism underlying the complex heritability and variable phenotype of psychiatric disorders such as major depressive disorder and schizophrenia. We hypothesized that gene-environment interactions would affect behavior in a mutant Disc1 mouse model. We examined the effect of chronic social defeat (CSD) as an environmental stressor in two lines of mice carrying different Disc1 point mutations, on behaviors relevant to psychiatric illness: locomotion in a novel open field (OF), pre-pulse inhibition (PPI) of the acoustic startle response, latent inhibition (LI), elevated plus maze (EPM), forced swim test (FST), sucrose consumption (SC), and the social interaction task for sociability and social novelty (SSN). We found that Disc1-L100P +/- and wild-type mice have similar anxiety responses to CSD, while Q31L +/- mice had a very different response. We also found evidence of significant gene-environment interactions in the OF, EPM and SSN. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. The functional consequences of mis-sense mutations affecting an intra-molecular salt bridge in arylsulphatase A.

    PubMed Central

    Schestag, Frank; Yaghootfam, Afshin; Habetha, Matthias; Poeppel, Peter; Dietz, Frank; Klein, Roger A; Zlotogora, Joel; Gieselmann, Volkmar

    2002-01-01

    Metachromatic leukodystrophy is a lysosomal storage disorder caused by the deficiency of arylsulphatase A. We describe the functional consequences of three mis-sense mutations in the arylsulphatase A gene (Asp-335-Val, Arg-370-Trp and Arg-370-Gln), affecting an apparent intramolecular Asp-335 to Arg-370 salt bridge, and interpret the effects and clinical consequences on the basis of the three-dimensional structure of arylsulphatase A. Asp-335-Val and Arg-370-Trp substitutions each cause a complete loss of enzyme activity and are associated with the most severe form of the human disease, whereas the Arg-370-Gln-substituted enzyme retains some residual activity, being found in a patient suffering from the milder juvenile form of the disease. Detailed analysis reveals that formation of the apparent salt bridge depends critically on the presence of aspartic acid and arginine residues at positions 335 and 370, respectively. Substitution by various other amino acids, including glutamic acid and lysine, affects enzyme function severely. Biosynthesis and immunoprecipitation studies indicate that the Asp-335-Val substitution affects folding of arylsulphatase A more severely than either the Arg-370-Trp or Arg-370-Gln substitutions. In vitro mutagenesis data show that clinical severity correlates with the space occupied by residue 370. The combination with structural data suggests that the bulky tryptophan residue broadens the cleft held together by the apparent salt bridge, whereas the smaller glutamine residue still allows the cleft to close, yielding a less severely affected enzyme. The position of residue 370 in the three-dimensional structure of the enzyme provides a plausible explanation for the differing severities in loss of enzyme function caused by the mutations and thus the clinical phenotype. PMID:12086582

  2. Nonoverlapping Clinical and Mutational Patterns in Melanomas from the Female Genital Tract and Atypical Genital Nevi.

    PubMed

    Yélamos, Oriol; Merkel, Emily A; Sholl, Lauren Meldi; Zhang, Bin; Amin, Sapna M; Lee, Christina Y; Guitart, Gerta E; Yang, Jingyi; Wenzel, Alexander T; Bunick, Christopher G; Yazdan, Pedram; Choi, Jaehyuk; Gerami, Pedram

    2016-09-01

    Genital melanomas (GM) are the second most common cancer of the female external genitalia and may be confused with atypical genital nevi (AGN), which exhibit atypical histological features but have benign behavior. In this study, we compared the clinical, histological, and molecular features of 19 GM and 25 AGN. We described chromosomal copy number aberrations and the mutational status of 50 oncogenes and tumor suppressor genes in both groups. Our study showed that a pigmented lesion occurring in mucosal tissue, particularly in postmenopausal women, was more likely to be a melanoma than a nevus. GM had high levels of chromosomal instability, with many copy number aberrations. Furthermore, we found a completely nonoverlapping pattern of oncogenic mutations when comparing GM and AGN. In GM, we report somatic mutations in KIT and TP53. Conversely, AGN had frequent BRAF V600E mutations, which were not seen in any of the GM. Our results show that GM and AGN have distinct clinical and molecular changes and that GM have a different mutational pattern compared with AGN. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Prognostic role and implications of mutation status of tumor suppressor gene ARID1A in cancer: a systematic review and meta-analysis

    PubMed Central

    Luchini, Claudio; Veronese, Nicola; Solmi, Marco; Cho, Hanbyoul; Kim, Jae-Hoon; Chou, Angela; Gill, Anthony J.; Faraj, Sheila F.; Chaux, Alcides; Netto, George J.; Nakayama, Kentaro; Kyo, Satoru; Lee, Soo Young; Kim, Duck-Woo; Yousef, George M.; Scorilas, Andreas; Nelson, Gregg S.; Köbel, Martin; Kalloger, Steve E.; Schaeffer, David F.; Yan, Hai-Bo; Liu, Feng; Yokoyama, Yoshihito; Zhang, Xianyu; Pang, Da; Lichner, Zsuzsanna; Sergi, Giuseppe; Manzato, Enzo; Capelli, Paola; Wood, Laura D.; Scarpa, Aldo; Correll, Christoph U.

    2015-01-01

    Loss of the tumor suppressor gene AT-rich interactive domain-containing protein 1A (ARID1A) has been demonstrated in several cancers, but its prognostic role is unknown. We aimed to investigate the risk associated with loss of ARID1A (ARID1A−) for all-cause mortality, cancer-specific mortality and recurrence of disease in subjects with cancer. PubMed and SCOPUS search from database inception until 01/31/2015 without language restriction was conducted, contacting authors for unpublished data. Eligible were prospective studies reporting data on prognostic parameters in subjects with cancer, comparing participants with presence of ARID1A (ARID1A+) vs. ARID1A−, assessed either via immunohistochemistry (loss of expression) or with genetic testing (presence of mutation). Data were summarized using risk ratios (RR) for number of deaths/recurrences and hazard ratios (HR) for time-dependent risk related to ARID1A− adjusted for potential confounders. Of 136 hits, 25 studies with 5,651 participants (28 cohorts; ARID1A−: n = 1,701; ARID1A+: n = 3,950), with a mean follow-up period of 4.7 ± 1.8 years, were meta-analyzed. Compared to ARID1A+, ARID1A− significantly increased cancer-specific mortality (studies = 3; RR = 1.55, 95% confidence interval (CI) = 1.19–2.00, I2 = 31%). Using HRs adjusted for potential confounders, ARID1A− was associated with a greater risk of cancer-specific mortality (studies = 2; HR = 2.55, 95%CI = 1.19–5.45, I2 = 19%) and cancer recurrence (studies = 10; HR = 1.93, 95%CI = 1.22–3.05, I2 = 76%). On the basis of these results, we have demonstrated that loss of ARID1A shortened time to cancer-specific mortality, and to recurrence of cancer when adjusting for potential confounders. For its role, this gene should be considered as an important potential target for personalized medicine in cancer treatment. PMID:26384299

  4. Induction of Myeloid-Derived Suppressor Cells in Cryopyrin-Associated Periodic Syndromes.

    PubMed

    Ballbach, Marlene; Hall, Tobias; Brand, Alina; Neri, Davide; Singh, Anurag; Schaefer, Iris; Herrmann, Eva; Hansmann, Sandra; Handgretinger, Rupert; Kuemmerle-Deschner, Jasmin; Hartl, Dominik; Rieber, Nikolaus

    2016-01-01

    Cryopyrin-associated periodic syndromes (CAPS) are caused by mutations in the NLRP3 gene leading to overproduction of IL-1β and other NLRP3 inflammasome products. Myeloid-derived suppressor cells (MDSCs) represent a novel innate immune cell subset capable of suppressing T-cell responses. As inflammasome products were previously found to induce MDSCs, we hypothesized that NLRP3 inflammasome-dependent factors induce the generation of MDSCs in CAPS. We studied neutrophilic MDSCs, their clinical relevance, and MDSC-inducing factors in a unique cohort of CAPS patients under anti-IL-1 therapy. Despite anti-IL-1 therapy and low clinical disease activity, CAPS patients showed significantly elevated MDSCs compared to healthy controls. MDSCs were functionally competent, as they suppressed polyclonal T-cell proliferation, as well as Th1 and Th17 responses. In addition, MDSCs decreased monocytic IL-1β secretion. Multiplex assays revealed a distinct pattern of MDSC-inducing cytokines, chemokines, and growth factors. Experimental analyses demonstrated that IL-1 cytokine family members and autoinflammation-associated alarmins differentially induced human MDSCs. Increased MDSCs might represent a novel autologous anti-inflammatory mechanism in autoinflammatory conditions and may serve as a future therapeutic target. © 2016 S. Karger AG, Basel.

  5. Mutational Biases and GC-Biased Gene Conversion Affect GC Content in the Plastomes of Dendrobium Genus

    PubMed Central

    Niu, Zhitao; Xue, Qingyun; Wang, Hui; Xie, Xuezhu; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu

    2017-01-01

    The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC)—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1) consistent GC content evolution trends and mutational biases in single-copy (SC) and inverted repeats (IRs) regions; and (2) that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus. PMID:29099062

  6. Novel mutations in GALNT3 causing hyperphosphatemic familial tumoral calcinosis.

    PubMed

    Yancovitch, Alan; Hershkovitz, Dov; Indelman, Margareta; Galloway, Peter; Whiteford, Margo; Sprecher, Eli; Kılıç, Esra

    2011-09-01

    Hyperphosphatemic familial tumoral calcinosis (HFTC) is known to be caused by mutations in at least three genes: FGF23, GALNT3 and KL. Two families with two affected members suffering from HFTC were scrutinized for mutations in these candidate genes. We identified in both families homozygous missense mutations affecting highly conserved amino acids in GALNT3. One of the mutations is a novel mutation, whereas the second mutation was reported before in a compound heterozygous state. Our data expand the spectrum of known mutations in GALNT3 and contribute to a better understanding of the phenotypic manifestations of mutations in this gene.

  7. What affects the predictability of evolutionary constraints using a G-matrix? The relative effects of modular pleiotropy and mutational correlation.

    PubMed

    Chebib, Jobran; Guillaume, Frédéric

    2017-10-01

    Phenotypic traits do not always respond to selection independently from each other and often show correlated responses to selection. The structure of a genotype-phenotype map (GP map) determines trait covariation, which involves variation in the degree and strength of the pleiotropic effects of the underlying genes. It is still unclear, and debated, how much of that structure can be deduced from variational properties of quantitative traits that are inferred from their genetic (co) variance matrix (G-matrix). Here we aim to clarify how the extent of pleiotropy and the correlation among the pleiotropic effects of mutations differentially affect the structure of a G-matrix and our ability to detect genetic constraints from its eigen decomposition. We show that the eigenvectors of a G-matrix can be predictive of evolutionary constraints when they map to underlying pleiotropic modules with correlated mutational effects. Without mutational correlation, evolutionary constraints caused by the fitness costs associated with increased pleiotropy are harder to infer from evolutionary metrics based on a G-matrix's geometric properties because uncorrelated pleiotropic effects do not affect traits' genetic correlations. Correlational selection induces much weaker modular partitioning of traits' genetic correlations in absence then in presence of underlying modular pleiotropy. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  8. ERF is a Potential ERK Modulated Tumor Suppressor in Prostate Cancer

    DTIC Science & Technology

    2016-10-01

    6/27/2016 - 6/27/2019 1.20 calendar Prostate Cancer Foundation (formerly CaP CURE) $ 75,000 Epigenetic ...AWARD NUMBER: W81XWH-15-1-0277 TITLE: ERF is a Potential ERK-Modulated Tumor Suppressor in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Rohit...4. TITLE AND SUBTITLE ERF is a Potential ERK-Modulated Tumor Suppressor in Prostate Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-15-1-0277

  9. Tumor suppressor NDRG2 inhibits glycolysis and glutaminolysis in colorectal cancer cells by repressing c-Myc expression

    PubMed Central

    Chu, Dake; Wei, Li; Li, Xia; Yang, Guodong; Liu, Xinping; Yao, Libo; Zhang, Jian; Shen, Lan

    2015-01-01

    Cancer cells use glucose and glutamine as the major sources of energy and precursor intermediates, and enhanced glycolysis and glutamimolysis are the major hallmarks of metabolic reprogramming in cancer. Oncogene activation and tumor suppressor gene inactivation alter multiple intracellular signaling pathways that affect glycolysis and glutaminolysis. N-Myc downstream regulated gene 2 (NDRG2) is a tumor suppressor gene inhibiting cancer growth, metastasis and invasion. However, the role and molecular mechanism of NDRG2 in cancer metabolism remains unclear. In this study, we discovered the role of the tumor suppressor gene NDRG2 in aerobic glycolysis and glutaminolysis of cancer cells. NDRG2 inhibited glucose consumption and lactate production, glutamine consumption and glutamate production in colorectal cancer cells. Analysis of glucose transporters and the catalytic enzymes involved in glycolysis revealed that glucose transporter 1 (GLUT1), hexokinase 2 (HK2), pyruvate kinase M2 isoform (PKM2) and lactate dehydrogenase A (LDHA) was significantly suppressed by NDRG2. Analysis of glutamine transporter and the catalytic enzymes involved in glutaminolysis revealed that glutamine transporter ASC amino-acid transporter 2 (ASCT2) and glutaminase 1 (GLS1) was also significantly suppressed by NDRG2. Transcription factor c-Myc mediated inhibition of glycolysis and glutaminolysis by NDRG2. More importantly, NDRG2 inhibited the expression of c-Myc by suppressing the expression of β-catenin, which can transcriptionally activate C-MYC gene in nucleus. In addition, the growth and proliferation of colorectal cancer cells were suppressed significantly by NDRG2 through inhibition of glycolysis and glutaminolysis. Taken together, these findings indicate that NDRG2 functions as an essential regulator in glycolysis and glutaminolysis via repression of c-Myc, and acts as a suppressor of carcinogenesis through coordinately targeting glucose and glutamine transporter, multiple catalytic

  10. Mutations in CypA Binding Region of HIV-1 Capsid Affect Capsid Stability and Viral Replication in Primary Macrophages.

    PubMed

    Setiawan, Laurentia C; van Dort, Karel A; Rits, Maarten A N; Kootstra, Neeltje A

    2016-04-01

    Mutations in the cyclophilin A (CypA) binding region in the HIV-1 capsid affect their dependency on the known HIV-1 cofactor CypA and allow escape from the HIV-1 restriction factor Trim5α in human and simian cells. Here we study the effect of these mutations in the CypA binding region of capsid on cofactor binding, capsid destabilization, and viral replication in primary cells. We showed that the viral capsid with mutations in the CypA binding region (CypA-BR) interacted efficiently with CypA, but had an increased stability upon infection as compared to the wild-type capsid. Interestingly, the wild-type virus was able to infect monocyte-derived macrophages (MDM) more efficiently as compared to the CypA-BR mutant variant. The lower infectivity of the CypA-BR mutant virus in MDM was associated with lower levels of reverse transcription products. Similar to the wild-type virus, the CypA-BR mutant variant was unable to induce a strong innate response in primary macrophages. These data demonstrate that mutations in the CypA binding site of the capsid resulted in higher capsid stability and hampered infectivity in macrophages.

  11. Mutations close to a hub residue affect the distant active site of a GH1 β-glucosidase.

    PubMed

    Souza, Valquiria P; Ikegami, Cecília M; Arantes, Guilherme M; Marana, Sandro R

    2018-01-01

    The tertiary structure of proteins has been represented as a network, in which residues are nodes and their contacts are edges. Protein structure networks contain residues, called hubs or central, which are essential to form short connection pathways between any pair of nodes. Hence hub residues may effectively spread structural perturbations through the protein. To test whether modifications nearby to hub residues could affect the enzyme active site, mutations were introduced in the β-glycosidase Sfβgly (PDB-ID: 5CG0) directed to residues that form an α-helix (260-265) and a β-strand (335-337) close to one of its main hub residues, F251, which is approximately 14 Å from the Sfβgly active site. Replacement of residues A263 and A264, which side-chains project from the α-helix towards F251, decreased the rate of substrate hydrolysis. Mutation A263F was shown to weaken noncovalent interactions involved in transition state stabilization within the Sfβgly active site. Mutations placed on the opposite side of the same α-helix did not show these effects. Consistently, replacement of V336, which side-chain protrudes from a β-strand face towards F251, inactivated Sfβgly. Next to V336, mutation S337F also caused a decrease in noncovalent interactions involved in transition state stabilization. Therefore, we suggest that mutations A263F, A264F, V336F and S337F may directly perturb the position of the hub F251, which could propagate these perturbations into the Sfβgly active site through short connection pathways along the protein network.

  12. The Role of Suppressors of Cytokine Signalling in Human Neoplasms

    PubMed Central

    Sharma, Anup K.; Mokbel, Kefah

    2014-01-01

    Suppressors of cytokine signalling 1–7 (SOCS1–7) and cytokine-inducible SH2-containing protein (CIS) are a group of intracellular proteins that are well known as JAK-STAT and several other signalling pathways negative feedback regulators. More recently several members have been identified as tumour suppressors and dysregulation of their biological roles in controlling cytokine and growth factor signalling may contribute to the development of many solid organ and haematological malignancies. This review explores their biological functions and their possible tumour suppressing role in human neoplasms. PMID:24757565

  13. Identifying Breast Tumor Suppressors Using in Vitro and in Vivo RNAi Screens

    DTIC Science & Technology

    2011-10-01

    vivo RNA interference screen, breast cancer , tumor suppressor, leukemia inhibitory factor receptor (LIFR) 16. SECURITY CLASSIFICATION OF: 17...The identification of these genes will improve the understanding of the causes of breast cancer , which may lead to therapeutic advancements for... breast cancer prevention and treatment. BODY Objective 1: Identification of breast tumor suppressors using in vitro and in vivo RNAi screens

  14. Potential role of TRIM3 as a novel tumour suppressor in colorectal cancer (CRC) development.

    PubMed

    Piao, Mei-Yu; Cao, Hai-Long; He, Na-Na; Xu, Meng-Que; Dong, Wen-Xiao; Wang, Wei-Qiang; Wang, Bang-Mao; Zhou, Bing

    2016-01-01

    Colorectal cancer (CRC) is the third leading cause of cancer-related mortality in the United States. Recent cancer genome-sequencing efforts and complementary functional studies have led to the identification of a collection of candidate 'driver' genes involved in CRC tumorigenesis. Tripartite motif (TRIM3) is recently identified as a tumour suppressor in glioblastoma but this tumour-suppressive function has not been investigated in CRC. In this study, we investigated the potential role of TRIM3 as a tumour suppressor in CRC development by manipulating the expression of TRIM3 in two authentic CRC cell lines, HCT116 and DLD1, followed by various functional assays, including cell proliferation, colony formation, scratch wound healing, soft agar, and invasion assays. Xenograft experiment was performed to examine in vivo tumour-suppressive properties of TRIM3. Small-interfering RNA (siRNA) mediated knockdown of TRIM3 conferred growth advantage in CRC cells. In contrast, overexpression of TRIM3 affected cell survival, cell migration, anchorage independent growth and invasive potential in CRC cells. In addition, TRIM3 was found to be down-regulated in human colon cancer tissues compared with matched normal colon tissues. Overexpression of TRIM3 significantly inhibited tumour growth in vivo using xenograft mouse models. Mechanistic investigation revealed that TRIM3 can regulate p53 protein level through its stabilisation. TRIM3 functions as a tumour suppressor in CRC progression. This tumour-suppressive function is exerted partially through regulation of p53 protein. Therefore, this protein may represent a novel therapeutic target for prevention or intervention of CRC.

  15. Detection of inherited mutations for breast and ovarian cancer using genomic capture and massively parallel sequencing

    PubMed Central

    Walsh, Tom; Lee, Ming K.; Casadei, Silvia; Thornton, Anne M.; Stray, Sunday M.; Pennil, Christopher; Nord, Alex S.; Mandell, Jessica B.; Swisher, Elizabeth M.; King, Mary-Claire

    2010-01-01

    Inherited loss-of-function mutations in the tumor suppressor genes BRCA1, BRCA2, and multiple other genes predispose to high risks of breast and/or ovarian cancer. Cancer-associated inherited mutations in these genes are collectively quite common, but individually rare or even private. Genetic testing for BRCA1 and BRCA2 mutations has become an integral part of clinical practice, but testing is generally limited to these two genes and to women with severe family histories of breast or ovarian cancer. To determine whether massively parallel, “next-generation” sequencing would enable accurate, thorough, and cost-effective identification of inherited mutations for breast and ovarian cancer, we developed a genomic assay to capture, sequence, and detect all mutations in 21 genes, including BRCA1 and BRCA2, with inherited mutations that predispose to breast or ovarian cancer. Constitutional genomic DNA from subjects with known inherited mutations, ranging in size from 1 to >100,000 bp, was hybridized to custom oligonucleotides and then sequenced using a genome analyzer. Analysis was carried out blind to the mutation in each sample. Average coverage was >1200 reads per base pair. After filtering sequences for quality and number of reads, all single-nucleotide substitutions, small insertion and deletion mutations, and large genomic duplications and deletions were detected. There were zero false-positive calls of nonsense mutations, frameshift mutations, or genomic rearrangements for any gene in any of the test samples. This approach enables widespread genetic testing and personalized risk assessment for breast and ovarian cancer. PMID:20616022

  16. Cardiomyopathy mutations in the tail of β-cardiac myosin modify the coiled-coil structure and affect integration into thick filaments in muscle sarcomeres in adult cardiomyocytes.

    PubMed

    Wolny, Marcin; Colegrave, Melanie; Colman, Lucy; White, Ed; Knight, Peter J; Peckham, Michelle

    2013-11-01

    It is unclear why mutations in the filament-forming tail of myosin heavy chain (MHC) cause hypertrophic or dilated cardiomyopathy as these mutations should not directly affect contraction. To investigate this, we first investigated the impact of five hypertrophic cardiomyopathy-causing (N1327K, E1356K, R1382W, E1555K, and R1768K) and one dilated cardiomyopathy-causing (R1500W) tail mutations on their ability to incorporate into muscle sarcomeres in vivo. We used adenoviral delivery to express full-length wild type or mutant enhanced GFP-MHC in isolated adult cardiomyocytes. Three mutations (N1327K, E1356K, and E1555K) reduced enhanced GFP-MHC incorporation into muscle sarcomeres, whereas the remainder had no effect. No mutations significantly affected contraction. Fluorescence recovery after photobleaching showed that fluorescence recovery for the mutation that incorporated least well (N1327K) was significantly faster than that of WT with half-times of 25.1 ± 1.8 and 32.2 ± 2.5 min (mean ± S.E.), respectively. Next, we determined the effects of each mutation on the helical properties of wild type and seven mutant peptides (7, 11, or 15 heptads long) from the myosin tail by circular dichroism. R1382W and E1768K slightly increased the α-helical nature of peptides. The remaining mutations reduced α-helical content, with N1327K showing the greatest reduction. Only peptides containing residues 1301-1329 were highly α-helical suggesting that this region helps in initiation of coiled coil. These results suggest that small effects of mutations on helicity translate into a reduced ability to incorporate into sarcomeres, which may elicit compensatory hypertrophy.

  17. A novel genome-wide in vivo screen for metastatic suppressors in human colon cancer identifies the positive WNT-TCF pathway modulators TMED3 and SOX12

    PubMed Central

    Duquet, Arnaud; Melotti, Alice; Mishra, Sonakshi; Malerba, Monica; Seth, Chandan; Conod, Arwen; Ruiz i Altaba, Ariel

    2014-01-01

    The progression of tumors to the metastatic state involves the loss of metastatic suppressor functions. Finding these, however, is difficult as in vitro assays do not fully predict metastatic behavior, and the majority of studies have used cloned cell lines, which do not reflect primary tumor heterogeneity. Here, we have designed a novel genome-wide screen to identify metastatic suppressors using primary human tumor cells in mice, which allows saturation screens. Using this unbiased approach, we have tested the hypothesis that endogenous colon cancer metastatic suppressors affect WNT-TCF signaling. Our screen has identified two novel metastatic suppressors: TMED3 and SOX12, the knockdown of which increases metastatic growth after direct seeding. Moreover, both modify the type of self-renewing spheroids, but only knockdown of TMED3 also induces spheroid cell spreading and lung metastases from a subcutaneous xenograft. Importantly, whereas TMED3 and SOX12 belong to different families involved in protein secretion and transcriptional regulation, both promote endogenous WNT-TCF activity. Treatments for advanced or metastatic colon cancer may thus not benefit from WNT blockers, and these may promote a worse outcome. PMID:24920608

  18. Enhancement of the RAD51 Recombinase Activity by the Tumor Suppressor PALB2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dray, Eloise; Etchin, Julia; Wiese, Claudia

    2010-08-24

    Homologous recombination mediated by the RAD51 recombinase helps eliminate chromosomal lesions, such as DNA double-stranded breaks induced by radiation or arising from injured DNA replication forks. The tumor suppressors BRCA2 and PALB2 act together to deliver RAD51 to chromosomal lesions to initiate repair. Here we document a new function of PALB2 in the enhancement of RAD51's ability to form the D-loop. We show that PALB2 binds DNA and physically interacts with RAD51. Importantly, while PALB2 alone stimulates D-loop formation, a cooperative effect is seen with RAD51AP1, an enhancer of RAD51. This stimulation stems from PALB2's ability to function with RAD51more » and RAD51AP1 to assemble the synaptic complex. Our results help unveil a multi-faceted role of PALB2 in chromosome damage repair. Since PALB2 mutations can cause breast and other tumors or lead to Fanconi anemia, our findings are important for understanding the mechanism of tumor suppression in humans.« less

  19. Mutations in GNA11 in Uveal Melanoma

    PubMed Central

    Van Raamsdonk, Catherine D.; Griewank, Klaus G.; Crosby, Michelle B.; Garrido, Maria C.; Vemula, Swapna; Wiesner, Thomas; Obenauf, Anna C.; Wackernagel, Werner; Green, Gary; Bouvier, Nancy; Sozen, M. Mert; Baimukanova, Gail; Roy, Ritu; Heguy, Adriana; Dolgalev, Igor; Khanin, Raya; Busam, Klaus; Speicher, Michael R.; O’Brien, Joan; Bastian, Boris C.

    2011-01-01

    BACKGROUND Uveal melanoma is the most common intraocular cancer. There are no effective therapies for metastatic disease. Mutations in GNAQ, the gene encoding an alpha subunit of heterotrimeric G proteins, are found in 40% of uveal melanomas. METHODS We sequenced exon 5 of GNAQ and GNA11, a paralogue of GNAQ, in 713 melanocytic neoplasms of different types (186 uveal melanomas, 139 blue nevi, 106 other nevi, and 282 other melanomas). We sequenced exon 4 of GNAQ and GNA11 in 453 of these samples and in all coding exons of GNAQ and GNA11 in 97 uveal melanomas and 45 blue nevi. RESULTS We found somatic mutations in exon 5 (affecting Q209) and in exon 4 (affecting R183) in both GNA11 and GNAQ, in a mutually exclusive pattern. Mutations affecting Q209 in GNA11 were present in 7% of blue nevi, 32% of primary uveal melanomas, and 57% of uveal melanoma metastases. In contrast, we observed Q209 mutations in GNAQ in 55% of blue nevi, 45% of uveal melanomas, and 22% of uveal melanoma metastases. Mutations affecting R183 in either GNAQ or GNA11 were less prevalent (2% of blue nevi and 6% of uveal melanomas) than the Q209 mutations. Mutations in GNA11 induced spontaneously metastasizing tumors in a mouse model and activated the mitogen-activated protein kinase pathway. CONCLUSIONS Of the uveal melanomas we analyzed, 83% had somatic mutations in GNAQ or GNA11. Constitutive activation of the pathway involving these two genes appears to be a major contributor to the development of uveal melanoma. (Funded by the National Institutes of Health and others.) PMID:21083380

  20. Missense mutation in GRN gene affecting RNA splicing and plasma progranulin level in a family affected by frontotemporal lobar degeneration.

    PubMed

    Luzzi, Simona; Colleoni, Lara; Corbetta, Paola; Baldinelli, Sara; Fiori, Chiara; Girelli, Francesca; Silvestrini, Mauro; Caroppo, Paola; Giaccone, Giorgio; Tagliavini, Fabrizio; Rossi, Giacomina

    2017-06-01

    Gene coding for progranulin, GRN, is a major gene linked to frontotemporal lobar degeneration. While most of pathogenic GRN mutations are null mutations leading to haploinsufficiency, GRN missense mutations do not have an obvious pathogenicity, and only a few have been revealed to act through different pathogenetic mechanisms, such as cytoplasmic missorting, protein degradation, and abnormal cleavage by elastase. The aim of this study was to disclose the pathogenetic mechanisms of the GRN A199V missense mutation, which was previously reported not to alter physiological progranulin features but was associated with a reduced plasma progranulin level. After investigating the family pedigree, we performed genetic and biochemical analysis on its members and performed RNA expression studies. We found that the mutation segregates with the disease and discovered that its pathogenic feature is the alteration of GRN mRNA splicing, actually leading to haploinsufficiency. Thus, when facing with a missense GRN mutation, its pathogenetic effects should be investigated, especially if associated with low plasma progranulin levels, to determine its nature of either benign polymorphism or pathogenic mutation. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Multielement suppressor nozzles for thrust augmentation systems.

    NASA Technical Reports Server (NTRS)

    Lawrence, R. L.; O'Keefe, J. V.; Tate, R. B.

    1972-01-01

    The noise reduction and nozzle performance characteristics of large-scale, high-aspect-ratio multielement nozzle arrays operated at low velocities were determined by test. The nozzles are selected for application to high-aspect-ratio augmentor suppressors to be used for augmentor wing airplanes. Significant improvements in noise characteristics for multielement nozzles over those of round or high-aspect-ratio slot nozzles are obtained. Elliptical noise patterns typical of slot nozzles are presented for high-aspect-ratio multielement nozzle arrays. Additional advantages are available in OASPL noise reduction from the element size and spacing. Augmentor-suppressor systems can be designed for maximum beam pattern directivity and frequency spectrum shaping advantages. Measurements of the nozzle wakes show a correlation with noise level data and frequency spectrum peaks. The noise and jet wake results are compared with existing prediction procedures based on empirical jet flow equations, Lighthill relationships, Strouhal number, and empirical shock-induced screech noise effects.

  2. PTT analysis of polyps from FAP patients reveals a great majority of APC truncating mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luijt, R.B. van der; Khan, P.M.; Tops, C.M.J.

    The adenomatous polyposis coli (APC) gene plays an important role in colorectal carcinogenesis. Germline APC mutations are associated with familial adenomatous polyposis (FAP), an autosomal dominantly inherited predisposition to colorectal cancer, characterized by the development of numerous adenomatous polyps in the large intestine. In order to investigate whether somatic inactivation of the remaining APC allele is necessary for adenoma formation, we collected multiple adenomatous polyps from individual FAP patients and investigated the presence of somatic mutations in the APC gene. The analysis of somatic APC mutations in these tumor samples was performed using a rapid and sensitive assay, called themore » protein truncation test (PTT). Chain-terminating somatic APC mutations were detected in the great majority of the tumor samples investigated. As expected, these mutations were mainly located in the mutation cluster region (MCR) in exon 15. Our results confirm that somatic mutation of the second APC allele is required for adenoma formation in FAP. Interestingly, in the polyps investigated in our study, the second APC allele is somatically inactivated through point mutation leading to a stop codon rather than by loss of heterozygosity. The observation that somatic second hits in APC are required for tumor development in FAP is in apparent accordance with the Knudson hypothesis for classical tumor suppressor genes. However, it is yet unknown whether chain-terminating APC mutations lead to a truncated protein exerting a dominant-negative effect or whether these mutations result in a null allele. Further investigation of this important issue will hopefully provide a better understanding of the mechanism of action of the mutated APC alleles in colorectal carcinogenesis.« less

  3. Recognition Mechanism of siRNA by Viral p19 Suppressor of RNA Silencing: A Molecular Dynamics Study

    PubMed Central

    Xia, Zhen; Zhu, Zhihong; Zhu, Jun; Zhou, Ruhong

    2009-01-01

    The p19 protein (p19) encoded from Tombusvirus is involved in various activities such as pathogenicity and virus transport. Recent studies have found that p19 is a plant suppressor of RNA silencing, which binds to short interfering RNAs (siRNAs) with high affinity. We use molecular dynamics (MD) simulations of the wild-type and mutant p19 protein (W39 and W42G) binding with a 21-nt siRNA duplex to study the p19-siRNA recognition mechanism and mutation effects. Our simulations with standard MD and steered molecular dynamics have shown that the double mutant structure is indeed much less stable than the wild-type, consistent with the recent experimental findings. Comprehensive structural analysis also shows that the W39/42G mutations first induce the loss of stacking interactions between p19 and siRNA, Trp42-Cyt1 (Cyt1 from the 5′ to 3′ strand) and Trp39-Gua′19 (Gua19 from the 3′ to 5′ strand), and then breaks the hydrophobic core formed by W39-W42 with nucleotide basepairs in the wild-type. The steered molecular dynamics simulations also show that the mutant p19 complex is “decompounded” very fast under a constant separation force, whereas the wild-type remains largely intact under the same steering force. Moreover, we have used the free energy perturbation to predict a binding affinity loss of 6.98 ± 0.95 kcal/mol for the single mutation W39G, and 12.8 ± 1.0 kcal/mol loss for the double mutation W39/42G, with the van der Waals interactions dominating the contribution (∼90%). These results indicate that the W39/42G mutations essentially destroy the important p19-siRNA recognition by breaking the strong stacking interaction between Cyt1 and Gua′19 with end-capping tryptophans. These large scale simulations might provide new insights to the interactions and co-evolution relationship between RNA virus proteins and their hosts. PMID:19254536

  4. Frequent epigenetic inactivation of chromosome 3p candidate tumor suppressor genes in gallbladder carcinoma.

    PubMed

    Riquelme, Erick; Tang, Moying; Baez, Sergio; Diaz, Alfonso; Pruyas, Martha; Wistuba, Ignacio I; Corvalan, Alejandro

    2007-05-18

    Gallbladder carcinoma (GBC) is a highly malignant neoplasm that represents the leading cause of death for cancer in Chilean females. There is limited information about the molecular abnormalities involved in its pathogenesis. We have identified a number of molecular changes in GBC, including frequent allelic losses at chromosome 3p regions. Four distinct 3p sites (3p12, 3p14.2, 3p21.3 and 3p22-24) with frequent and early allelic losses in the sequential pathogenesis of this neoplasm have been detected. We investigated epigenetic and genetic abnormalities in GBC affecting 6 candidate tumor suppressor genes (TSG) located in chromosome 3p, including DUTT1 (3p12), FHIT (3p14.2), BLU, RASSF1A, SEMA3B and hMLH1 (3p21.3). DNA extracted from frozen tissue obtained from 50 surgical resected GBCs was examined for gene promoter methylation using MSP (methylation-specific PCR) technique after bisulfite treatment in all 6 genes. In addition, we performed PCR-based mutation examination using SSCP in FHIT and RASSF1A genes and loss of heterozygosity (LOH) analysis using microdissected tissue in a subset of tumors for the 3p21.3 region with 8 microsatellite markers. A very high frequency of GBC methylation was detected in SEMA3B (46/50, 92%) and FHIT (33/50, 66%), intermediate incidences in BLU (13/50, 26%) and DUTT1 (11/50, 22%) and very low frequencies in RASSF1A (4/50, 8%) and hMLH1 (2/50, 4%). Allelic loss at 3p21.3 was found in nearly half of the GBCs examined. We conclude that epigenetic inactivation by abnormal promoter methylation is a frequent event in chromosome 3p candidate TSGs in GBC pathogenesis, especially affecting genes SEMA3B (3p21.3) and FHIT (3p14.2).

  5. The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

    PubMed

    Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

    2017-11-24

    To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

  6. Next generation sequencing of carcinoma of unknown primary reveals novel combinatorial strategies in a heterogeneous mutational landscape

    PubMed Central

    Subbiah, Ishwaria M.; Tsimberidou, Apostolia; Subbiah, Vivek; Janku, Filip; Roy-Chowdhuri, Sinchita; Hong, David S.

    2017-01-01

    Background Advanced carcinoma of unknown primary (CUP) has limited effective therapeutic options given the phenotypic and genotypic diversity. To identify future novel therapeutic strategies we conducted an exploratory analysis of next-generation sequencing (NGS) of relapsed, refractory CUP. Methods We identified patients in our phase I clinic where archival tissue was available for a targeted NGS CLIA-certified assay. Results Of 17 patients tested, 15 (88%) demonstrated genomic alterations (median 2 aberrations; range 0–8, total 59 alterations). Nine (53%) patients had altered cell signaling including the PI3K/AKT/MTOR (n=5, 29%) and MAPK pathways (n=3,18%); 7 (41%) patients demonstrated ≥1 alterations in tumor suppressor genes (TP53 in 5 patients), 8 (47%) had impaired epigenetic regulation and DNA methylation, 8 (47%) had aberrant cell cycle regulation, commonly in the cyclin dependent kinases. Ten (59%) patients had alterations in transcriptional regulators. Concurrent mutations affecting cell cycle regulation were noted to occur with aberrant epigenetic regulation (n=6, 35%) and MAPK/PI3K pathway (n=5, 29%). Conclusion Every patient had a unique molecular profile with no two patients demonstrating an identical panel of mutations. We identify two emerging novel combinatorial strategies targeting impaired cell cycle arrest, first with epigenetic modifiers and, second, with MAPK/PI3K pathway inhibition. PMID:28781987

  7. Myeloid-derived suppressor cells

    PubMed Central

    Chandra, Dinesh; Gravekamp, Claudia

    2013-01-01

    While conventional anticancer therapies, including surgical resection, radiotherapy, and/or chemotherapy, are relatively efficient at eliminating primary tumors, these treatment modalities are largely ineffective against metastases. At least in part, this reflects the rather inefficient delivery of conventional anticancer agents to metastatic lesions. We have recently demonstrated that myeloid-derived suppressor cells (MDSCs) can be used as cellular missiles to selectively deliver a radioisotope-coupled attenuated variant of Listeria monocytogenes to both primary and metastatic neoplastic lesions in mice with pancreatic cancer. This novel immunotherapeutic intervention robustly inhibited tumor growth while promoting a dramatic decrease in the number of metastases. PMID:24427545

  8. Mutations in MexB that affect the efflux of antibiotics with cytoplasmic targets.

    PubMed

    Ohene-Agyei, Thelma; Lea, Jon D; Venter, Henrietta

    2012-08-01

    Drug efflux pumps such as MexAB-OprM from Pseudomonas aeruginosa confer resistance to a wide range of chemically different compounds. Within the tripartite assembly, the inner membrane protein MexB is mainly responsible for substrate recognition. Recently, considerable advances have been made in elucidating the drug efflux pathway through the large periplasmic domains of resistance-nodulation-division (RND) transporters. However, little is known about the role of amino acids in other parts of the protein. We have investigated the role of two conserved phenylalanine residues that are aligned around the cytoplasmic side of the central cavity of MexB. The two conserved phenylalanine residues have been mutated to alanine residues (FAFA MexB). The interaction of the wild-type and mutant proteins with a variety of drugs from different classes was investigated by assays of cytotoxicity and drug transport. The FAFA mutation affected the efflux of compounds that have targets inside the cell, but antibiotics that act on cell wall synthesis and membrane probes were unaffected. Combined, our results indicate the presence of a hitherto unidentified cytoplasmic-binding site in RND drug transporters and enhance our understanding of the molecular mechanisms that govern drug resistance in Gram-negative pathogens. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  9. Chemosensitivity of BRCA1-Mutated Ovarian Cancer Cells and Established Cytotoxic Agents.

    PubMed

    van Haaften, Caroline; van Eendenburg, Jaap; Boot, Arnoud; Corver, Willem E; Haans, Lucien; van Wezel, Tom; Trimbos, J Baptist

    2017-10-01

    Serous adenocarcinomas that arise in patients with inherited mutations in the tumor suppressor genes BRCA1 and BRCA2 are initially well treatable with platinum/paclitaxel. For recurrent disease in patients with BRCA1 or BRCA2 mutations, olaparib treatment is available. To study additional therapeutic regimens, a better understanding of the cellular and molecular mechanisms of the tumors in in vitro models is important. From a high-grade serous ovarian tumor of a BRCA1 mutation carrier, we established 3 distinct cell line subclones, OVCA-TR3.1, -2, and -3. Immunohistochemical characterization, flow cytometric analyses, chemosensitivity, and somatic mutation profiling were performed. The cell lines expressed AE1/AE3, Pax8, WT-1, OC125, estrogen receptor (ER), and p53, comparable to the primary tumor. Synergism could be shown in the combination treatment eremophila-1-(10)-11(13)-dien-12,8β-olide (EPD), with cisplatin, whereas combination with olaparib did not show synergism. Eremophila-1-(10)-11(13)-dien-12,8β-olide, a sesquiterpene lactone, is a novel chemotherapeutic agent. The inherited BRCA1 c.2989_2990dupAA mutation was confirmed in the cell lines. Loss of heterozygosity of BRCA1 was detected in each cell line, as well as a homozygous TP53 c.722C>A mutation. Flow cytometry showed that all cell lines had a distinct DNA index. Three new isogenic ovarian cancer cell lines were developed from a patient with a germ line BRCA1 mutation. Chemosensitivity profiling of the cell lines showed high tolerance for olaparib. Treatment with EPD proved synergistic with cisplatin. The effects of EPD will be further investigated for future clinical efficacy.

  10. A novel natural mutation AαPhe98Ile in the fibrinogen coiled-coil affects fibrinogen function.

    PubMed

    Riedelová-Reicheltová, Zuzana; Kotlín, Roman; Suttnar, Jiří; Geierová, Véra; Riedel, Tomáš; Májek, Pavel; Dyr, Jan Evangelista

    2014-01-01

    The aim of this study was to investigate the structure and function of fibrinogen obtained from a patient with normal coagulation times and idiopathic thrombophilia. This was done by SDS-PAGE and DNA sequence analyses, scanning electron microscopy, fibrinopeptide release, fibrin polymerisation initiated by thrombin and reptilase, fibrinolysis, and platelet aggregometry. A novel heterozygous point mutation in the fibrinogen Aα chain, Phe98 to Ile, was found and designated as fibrinogen Vizovice. The mutation, which is located in the RGDF sequence (Aα 95-98) of the fibrinogen coiled-coil region, significantly affected fibrin clot morphology. Namely, the clot formed by fibrinogen Vizovice contained thinner and curled fibrin fibers with reduced length. Lysis of the clots prepared from Vizovice plasma and isolated fibrinogen were found to be impaired. The lysis rate of Vizovice clots was almost four times slower than the lysis rate of control clots. In the presence of platelets agonists the mutant fibrinogen caused increased platelet aggregation. The data obtained show that natural mutation of Phe98 to Ile in the fibrinogen Aα chain influences lateral aggregation of fibrin protofibrils, fibrinolysis, and platelet aggregation. They also suggest that delayed fibrinolysis, together with the abnormal fibrin network morphology and increased platelet aggregation, may be the direct cause of thrombotic complications in the patient associated with pregnancy loss.

  11. Spectrum and prevalence of FP/TMEM127 gene mutations in pheochromocytomas and paragangliomas.

    PubMed

    Yao, Li; Schiavi, Francesca; Cascon, Alberto; Qin, Yuejuan; Inglada-Pérez, Lucia; King, Elizabeth E; Toledo, Rodrigo A; Ercolino, Tonino; Rapizzi, Elena; Ricketts, Christopher J; Mori, Luigi; Giacchè, Mara; Mendola, Antonella; Taschin, Elisa; Boaretto, Francesca; Loli, Paola; Iacobone, Maurizio; Rossi, Gian-Paolo; Biondi, Bernadette; Lima-Junior, José Viana; Kater, Claudio E; Bex, Marie; Vikkula, Miikka; Grossman, Ashley B; Gruber, Stephen B; Barontini, Marta; Persu, Alexandre; Castellano, Maurizio; Toledo, Sergio P A; Maher, Eamonn R; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Dahia, Patricia L M

    2010-12-15

    Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P = 2.7 × 10(-4)) and/or with familial disease (5 of 20 samples; P = .005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P = .54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Germline mutations of FP/TMEM127 were associated with pheochromocytoma but

  12. Suppressor Effects of Positive and Negative Religious Coping on Academic Burnout Among Korean Middle School Students.

    PubMed

    Noh, Hyunkyung; Chang, Eunbi; Jang, Yoojin; Lee, Ji Hae; Lee, Sang Min

    2016-02-01

    Statistical suppressor effects in prediction models can provide evidence of the interdependent relationship of independent variables. In this study, the suppressor effects of positive and negative religious coping on academic burnout were examined using longitudinal data. First, 388 middle school students reported their type of religion and use of positive and negative religious coping strategies. Four months later, they also reported their level of academic burnout. From structural equation modeling, significant suppressor effects were found among religious students. That is, the coefficients became larger when both positive and negative religious coping predicted academic burnout simultaneously, compared to when each religious coping predicted academic burnout alone. However, suppressor effects were not found among non-religious students.

  13. Granular Media-Based Tunable Passive Vibration Suppressor

    NASA Technical Reports Server (NTRS)

    Dillon, Robert P.; Davis, Gregory L.; Shapiro, Andrew A.; Borgonia, John Paul C.; Kahn, Daniel L.; Boechler, Nicholas; Boechler,, Chiara

    2013-01-01

    isolation (Figure 1). This configuration is referred to as a single-axis vibration suppressor. This invention also includes further designs for the integration of the single-axis vibration suppressor into a six-degree-of-freedom hexapod "Stewart"mounting configuration (Figure 2). By integrating each singleaxis vibration suppressor into a hexapod formation, a payload will be protected in all six degrees of freedom from shock and/or vibration. Additionally, to further enable the application of this device to multiple operational scenarios, particularly in the case of high loads, the vibration suppressor devices can be used in parallel in any array configuration.

  14. Factors affecting the loss of MED12-mutated leiomyoma cells during in vitro growth.

    PubMed

    Bloch, Jeannine; Holzmann, Carsten; Koczan, Dirk; Helmke, Burkhard Maria; Bullerdiek, Jörn

    2017-05-23

    Uterine leiomyomas (UL) are the most prevalent symptomatic human tumors at all and somatic mutations of the gene encoding mediator subcomplex 12 (MED12) constitute the most frequent driver mutations in UL. Recently, a rapid loss of mutated cells during in vitro growth of UL-derived cell cultures was reported, resulting in doubts about the benefits of UL-derived cell cultures. To evaluate if the rapid loss of MED12-mutated cells in UL cell cultures depends on in vitro passaging, we set up cell cultures from nine UL from 40-50 year old Caucasian patients with at least one UL. Cultured UL cells were investigated for loss of MED12-mutated cells. Genetic characterization of native tumor samples and adjacent myometrium was done by array analysis. "Aged" primary cultures without passaging were compared to cells of three subsequent passages. Comparative analyses of the mutated/non-mutated ratios between native tissue, primary cells, and cultured tumor cells revealed a clear decrease of MED12-mutated cells. None of the tumors showed gross alterations of the array profiles, excluding the presence of gross genomic imbalances besides the MED12 mutations as a reason for the intertumoral variation in the loss of MED12-mutated cells. Albeit at a lesser rate, loss of MED12-mutated cells from cell cultures of UL occurs even without passaging thus indicating the requirement of soluble factors or matrix components lacking in vitro. Identification of these factors can help to understand the mechanisms of the growth of the most frequent type of uterine leiomyomas and to decipher novel drug targets.

  15. Breast carcinoma metastasis suppressor gene 1 (BRMS1): update on its role as the suppressor of cancer metastases.

    PubMed

    Kodura, Magdalena Anna; Souchelnytskyi, Serhiy

    2015-12-01

    BRMS1 was discovered over a decade ago as a potential tumor suppressor gene. In this review, we summarize the recent findings about the structure of BRMS1, mechanisms of its action and a role of BRMS1 in the cancer progression. As a suppressor of metastasis, BRMS1 has demonstrated a variety of ways to act on the cell functions, such as cell migration, invasiveness, angiogenesis, cell survival, cytoskeleton rearrangements, cell adhesion, and immune recognition. This variety of effects is a likely reason behind the robustness of anti-metastatic influence of BRMS1. Intracellular signaling mechanisms employed by BRMS1 include regulation of transcription, EGF/HER2 signaling, and expression of NF-kB, fascin, osteopontin, and IL-6. Recently reported clinical studies confirm that BRMS1 can indeed be used as a prognostic marker. Approaches to employ BRMS1 in a development of anti-cancer treatment have also been made. The studies reviewed here with respect to BRMS1 structure, cellular effects, intracellular signaling, and clinical value consolidate the importance of BRMS1 in the development of metastasis.

  16. Kinetics of mutation induction by ultraviolet light in excision-deficient yeast.

    PubMed

    Eckardt, F; Haynes, R H

    1977-02-01

    We have measured the frequency of UV-induced reversions (locus plus suppressor) for the ochre alleles ade2-1 and lys2-1 and forward mutations (ade2 adex double auxotrophs) in an excision-deficient strain of Saccharomyces cerevisiae (rad2-20). For very low UV doses, both mutational systems exhibit linear induction kinetics. However, as the dose increases, a strikingly different response is observed: in the selective reversion system a transition to higher order induction kinetics occurs near 9 ergs/mm2 (25% survival), whereas in the nonselective forward system the mutation frequency passes through a maximum near 14 ergs/mm2 (4.4% survival) and then declines. This contrast in kinetics cannot be explained in any straightforward way by current models of induced mutagenesis, which have been developed primarily on the basis of bacterial data. The bacterial models are designed to accommodate the quadratic induction kinetics that are frequently observed in these systems. We have derived a mathematical expression for mutation frequency that enables us to fit both the forward and reversion data on the assumptions that mutagenesis is basically a "single event" Poisson process, and that mutation and killing are not necessarily independent of one another. In particular, the dose-response relations are consistent with the idea that the sensitivity of the revertants is about 25% less than that of the original cell population, whereas the sensitivity of the forward mutants is about 29% greater than the population average. We argue that this relatively small differential sensitivity of mutant and nonmutant cells is associated with events that take place during mutation expression and clonal growth.

  17. Continuation of surge life of transient voltage suppressor

    NASA Technical Reports Server (NTRS)

    Clark, O. M.

    1977-01-01

    Efforts expended in testing, analyzing and the development of a meaningful definition of the mean number of peak pulses before failure (mp2bf) levels of a family of transient voltage suppressor devices were documented. Tests were done to determine the ability of the transient suppressor to effectively and reliably protect against severe short term, millisecond range, and transient voltages of the types resulting from inductive load switching and induced lightning. Existing pulse testing instrumentation was utilized, interfaced to an automatic sequencing test rack accommodating up to 50 devices. Tests were performed in step stress increments of 25% beginning at 25% and extending thru 100% rated I(pp) for each voltage category. The four voltage types test were the 6.8V, 33V, 91V, and 190V. Engineering efforts addressed the problem of improving the reliability of the 190V types.

  18. T cell chronic lymphocytic leukaemia with suppressor phenotype.

    PubMed Central

    Hofman, F M; Smith, D; Hocking, W

    1982-01-01

    The peripheral blood cells from a patient with T cell chronic lymphocytic leukaemia were examined for surface marker and functional characteristics. Eighty-91% of the peripheral blood cells formed SRBC rosettes and 22-49% possessed Fc receptors; 73% of the peripheral blood cells were reactive with the OKT8 antiserum and 61% expressed DR antigens. Response to PHA stimulation was markedly reduced, whereas allogeneic responsiveness in mixed leucocyte culture was intact. The ability of Con A-stimulated peripheral blood cells to generate suppressor activity in a mixed leucocyte reaction was deficient, whereas suppression of in vitro immunoglobulin synthesis was greater than normal. The leukaemic peripheral blood cell population expressed a T suppressor phenotype. Functional studies suggest that these cells were derived from the subset of T lymphocytes with regulatory activity for immunoglobulin synthesis as opposed to mitogenic responsiveness. PMID:6215199

  19. The interaction between cytosine methylation and processes of DNA replication and repair shape the mutational landscape of cancer genomes.

    PubMed

    Poulos, Rebecca C; Olivier, Jake; Wong, Jason W H

    2017-07-27

    Methylated cytosines (5mCs) are frequently mutated in the genome. However, no studies have yet comprehensively analysed mutation-methylation associations across cancer types. Here we analyse 916 cancer genomes, together with tissue type-specific methylation and replication timing data. We describe a strong mutation-methylation association across colorectal cancer subtypes, most interestingly in samples with microsatellite instability (MSI) or Polymerase epsilon (POLE) exonuclease domain mutations. By analysing genomic regions with differential mismatch repair (MMR) efficiency, we suggest a possible role for MMR in the correction of 5mC deamination events, potentially accounting for the high rate of 5mC mutation accumulation in MSI tumours. Additionally, we propose that mutant POLE asserts a mutator phenotype specifically at 5mCs, and we find coding mutation hotspots in POLE-mutant cancers at highly-methylated CpGs in the tumour-suppressor genes APC and TP53. Finally, using multivariable regression models, we demonstrate that different cancers exhibit distinct mutation-methylation associations, with DNA repair influencing such associations in certain cancer genomes. Taken together, we find differential associations with methylation that are vital for accurately predicting expected mutation loads across cancer types. Our findings reveal links between methylation and common mutation and repair processes, with these mechanisms defining a key part of the mutational landscape of cancer genomes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. SST Technology Follow-On Program - Phase 2. Noise Suppressor/Nozzle Development. Volume 9. Performance Technology - Analysis of the Low Speed Performance of Multitube Suppressor/Ejector Nozzles (0-167 kn)

    DTIC Science & Technology

    1975-03-01

    Layer Suction 18 Temperature and Pressure Profile at Charging Station |9 Roiind-Corivergent Reference Nozzle 20 Elliptical Ramps 21 37-Tube...between plumes of the jets in the outer row of a suppressor Homulary layer Discharge coelticient, accounting for temperature induced no/./Ie area...tunnel floor. The suppressor air tlow rate was measured with an A.S.M.H. long-radius flow nozzle. The boundary layer ihickness at the ejector inlet

  1. Flavonols Accumulate Asymmetrically and Affect Auxin Transport in Arabidopsis1[C][W][OA

    PubMed Central

    Kuhn, Benjamin M.; Geisler, Markus; Bigler, Laurent; Ringli, Christoph

    2011-01-01

    Flavonoids represent a class of secondary metabolites with diverse functions in plants including ultraviolet protection, pathogen defense, and interspecies communication. They are also known as modulators of signaling processes in plant and animal systems and therefore are considered to have beneficial effects as nutraceuticals. The rol1-2 (for repressor of lrx1) mutation of Arabidopsis (Arabidopsis thaliana) induces aberrant accumulation of flavonols and a cell-growth phenotype in the shoot. The hyponastic cotyledons, aberrant shape of pavement cells, and deformed trichomes in rol1-2 mutants are suppressed by blocking flavonoid biosynthesis, suggesting that the altered flavonol accumulation in these plants induces the shoot phenotype. Indeed, the identification of several transparent testa, myb, and fls1 (for flavonol synthase1) alleles in a rol1-2 suppressor screen provides genetic evidence that flavonols interfere with shoot development in rol1-2 seedlings. The increased accumulation of auxin in rol1-2 seedlings appears to be caused by a flavonol-induced modification of auxin transport. Quantification of auxin export from mesophyll protoplasts revealed that naphthalene-1-acetic acid but not indole-3-acetic acid transport is affected by the rol1-2 mutation. Inhibition of flavonol biosynthesis in rol1-2 fls1-3 restores naphthalene-1-acetic acid transport to wild-type levels, indicating a very specific mode of action of flavonols on the auxin transport machinery. PMID:21502189

  2. Human pluripotent stem cells recurrently acquire and expand dominant negative P53 mutations

    PubMed Central

    Kamitaki, Nolan; Mitchell, Jana; Avior, Yishai; Mello, Curtis; Kashin, Seva; Mekhoubad, Shila; Ilic, Dusko; Charlton, Maura; Saphier, Genevieve; Handsaker, Robert E.; Genovese, Giulio; Bar, Shiran; Benvenisty, Nissim; McCarroll, Steven A.; Eggan, Kevin

    2017-01-01

    Human pluripotent stem cells (hPSCs) can self-renew indefinitely, making them an attractive source for regenerative therapies. This expansion potential has been linked with acquisition of large copy number variants (CNVs) that provide mutant cells with a growth advantage in culture1–3. However, the nature, extent, and functional impact of other acquired genome sequence mutations in cultured hPSCs is not known. Here, we sequenced the protein-coding genes (exomes) of 140 independent human embryonic stem cell (hESC) lines, including 26 lines prepared for potential clinical use4. We then applied computational strategies for identifying mutations present in a subset of cells5. Though such mosaic mutations were generally rare, we identified five unrelated hESC lines that carried six mutations in the TP53 gene that encodes the tumor suppressor P53. Notably, the TP53 mutations we observed are dominant negative and are the mutations most commonly seen in human cancers. We used droplet digital PCR to demonstrate that the TP53 mutant allelic fraction increased with passage number under standard culture conditions, suggesting that P53 mutation confers selective advantage. When we then mined published RNA sequencing data from 117 hPSC lines, we observed another nine TP53 mutations, all resulting in coding changes in the DNA binding domain of P53. Strikingly, in three lines, the allelic fraction exceeded 50%, suggesting additional selective advantage resulting from loss of heterozygosity at the TP53 locus. As the acquisition and favored expansion of cancer-associated mutations in hPSCs may go unnoticed during most applications, we suggest that careful genetic characterization of hPSCs and their differentiated derivatives should be carried out prior to clinical use. PMID:28445466

  3. Evidence for constitutional mutations in patients with multiple BCCs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bonifas, J.M.; Leyden, W.A.; Epstein, E.H. Jr.

    Basal cell nevus syndrome (BCNS) is an autosomal dominant disease, one of whose prominent phenotypic features is a large number of cutaneous basal cell carcinomas. The gene whose mutation underlies this disease has been mapped to chromosome 9q22.3-q31, and basal cell carcinomas frequently have allelic losses at this area. We have reported recently that the chromosome 9q22.3-q31 alleles lost in 57% (24/42) of basal cell carcinomas from BCNS patients were those alleles predicted by linkage to contain the wild type gene, as is expected for a tumor suppressor gene. We have extended this work to patients with multiple basal cellmore » carcinomas with no other phenotypic manifestations of BCNS. We found in two individuals that 88% (30 out of 34) had loss of heterozygosity (LOH) in this region. Surprisingly, in both patients the allele lost in tumors was not random; it was the same in 29/30 tumors (19 form one patient and 10 from the other). This suggests that constitutional mutations in the BCNS gene region may underlie skin carcinomas in patients without BCNS. The mutations may have been somatic, because neither of one patient`s two adult sons have BCCs even though they have inherited different copies of his 9q.« less

  4. Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.

    PubMed

    Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G

    2015-07-01

    Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96

  5. Mutation analysis of the APC gene in Taiwanese FAP families: low incidence of APC germline mutation in a distinct subgroup of FAP families.

    PubMed

    Chiang, J M; Chen, H W; Tang, R P; Chen, J S; Changchien, C R; Hsieh, P S; Wang, J Y

    2010-06-01

    Familial adenomatous polyposis (FAP) is an autosomal-dominant disease caused by germline mutations in the adenomatous polyposis coli (APC) gene. The affected individuals develop colorectal polyposis and show various extra-colonic manifestations. In this study, we aimed to investigate the genetic and clinical characteristics of FAP in Taiwanese families and analyze the genotype-phenotype correlations. Blood samples were obtained from 66 FAP patients registered in the hereditary colorectal cancer database. Then, germline mutations in the APC genes of these 66 polyposis patients from 47 unrelated FAP families were analyzed. The germline-mutation-negative cases were analyzed by performing multiplex ligation-dependent probe amplification (MLPA) and single-strand conformation polymorphism (SSCP) analysis of the MUTYH gene. Among the analyzed families, 79% (37/47) of the families showed 28 APC mutations, including 19 frameshift mutations, 4 nonsense mutations, 3 genomic deletion mutations, 1 missense mutation, and 1 splice-site mutation. In addition, we identified 15 novel mutations in 32% (15/47) of the families. The cases in which APC mutations were not identified showed significantly lower incidence of profuse polyposis (P = 0.034) and gastroduodenal polyps (P = 0.027). Furthermore, FAP families in which some affected individuals had less than 100 polyps showed significant association with low incidence of APC germline mutations (P = 0.002). We have added the APC germline-mutation data for Taiwanese FAP patients and indicated the presence of an FAP subgroup comprising affected individuals with nonadenomatous polyps or less than 100 adenomatous polyps; this form of FAP is less frequently caused by germline mutations of the APC gene.

  6. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    PubMed

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. SPRED1, a RAS MAPK pathway inhibitor that causes Legius syndrome, is a tumour suppressor downregulated in paediatric acute myeloblastic leukaemia.

    PubMed

    Pasmant, E; Gilbert-Dussardier, B; Petit, A; de Laval, B; Luscan, A; Gruber, A; Lapillonne, H; Deswarte, C; Goussard, P; Laurendeau, I; Uzan, B; Pflumio, F; Brizard, F; Vabres, P; Naguibvena, I; Fasola, S; Millot, F; Porteu, F; Vidaud, D; Landman-Parker, J; Ballerini, P

    2015-01-29

    Constitutional dominant loss-of-function mutations in the SPRED1 gene cause a rare phenotype referred as neurofibromatosis type 1 (NF1)-like syndrome or Legius syndrome, consisted of multiple café-au-lait macules, axillary freckling, learning disabilities and macrocephaly. SPRED1 is a negative regulator of the RAS MAPK pathway and can interact with neurofibromin, the NF1 gene product. Individuals with NF1 have a higher risk of haematological malignancies. SPRED1 is highly expressed in haematopoietic cells and negatively regulates haematopoiesis. SPRED1 seemed to be a good candidate for leukaemia predisposition or transformation. We performed SPRED1 mutation screening and expression status in 230 paediatric lymphoblastic and acute myeloblastic leukaemias (AMLs). We found a loss-of-function frameshift SPRED1 mutation in a patient with Legius syndrome. In this patient, the leukaemia blasts karyotype showed a SPRED1 loss of heterozygosity, confirming SPRED1 as a tumour suppressor. Our observation confirmed that acute leukaemias are rare complications of the Legius syndrome. Moreover, SPRED1 was significantly decreased at RNA and protein levels in the majority of AMLs at diagnosis compared with normal or paired complete remission bone marrows. SPRED1 decreased expression correlated with genetic features of AML. Our study reveals a new mechanism which contributes to deregulate RAS MAPK pathway in the vast majority of paediatric AMLs.

  8. Screening for germline phosphatase and tensin homolog-mutations in suspected Cowden syndrome and Cowden syndrome-like families among uterine cancer patients

    PubMed Central

    TZORTZATOS, GERASIMOS; ARAVIDIS, CHRISTOS; LINDBLOM, ANNIKA; MINTS, MIRIAM; THAM, EMMA

    2015-01-01

    Cowden syndrome (CS) is an autosomal dominant disorder characterized by multiple hamartomas in the breast, thyroid and endometrium, with a prevalence of 1 per 250,000. Females with CS have a 21–28% lifetime risk of developing uterine cancer. Germline mutations in the phosphatase and tensin homolog (PTEN) gene, a tumor suppressor gene, are responsible for 30–80% of CS cases. PTEN is a nine-exon gene, located on chromosome 10q23.3, which encodes the 403 amino acid PTEN protein. It negatively regulates the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin pathway, affecting various cellular processes and signaling pathways. The present study examined whether PTEN mutations are present in CS-like families with uterine cancer (UC). UC patients underwent surgery at Karolinska University Hospital, Stockholm, Sweden (2008–2012). Pedigrees were analyzed and 54 unrelated CS-like families were identified. CS-like families were defined as having at least one occurrence of uterine cancer and one of breast cancer, as well as at least one additional Cowden-associated tumor (uterine, breast, thyroid, colon or kidney cancer) in the same individual or in first-degree relatives. Genomic DNA was amplified using polymerase chain reaction, and DNA sequencing analysis of all nine exons of the PTEN gene was conducted. No germline PTEN mutations or polymorphisms were identified. Germline PTEN mutations are rare in CS-like families with uterine cancer, therefore, genetic screening must be restricted to patients that meet the strict National Comprehensive Cancer Network criteria. Gynecologists must be aware of the CS criteria and identify potential cases of CS in females where uterine cancer is the sentinel cancer. PMID:25789042

  9. Screening for germline mutations in the neurofibromatosis type 2 (NF2) gene in NF2 patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andermann, A.A.; Ruttledge, M.H.; Rangaratnam, A.

    Neurofibromatosis type 2 (NF2) is an autosomal dominant disease with over 95% penetrance which predisposes gene carriers to develop multiple tumors of the central nervous system. The NF2 gene is a putative tumor suppressor gene which was previously mapped to the long arm of chromosome 22, and has recently been identified, using positional cloning techniques. The gene encodes a protein, schwannomin (SCH), which is highly homologous to the band 4.1 protein family. In an attempt to identify and characterize mutations which lead to the manifestation of the disease, we have used single strand conformation analysis (SSCA) to screen for germlinemore » mutations in all 17 exons of the NF2 gene in 59 unrelated NF2 patients, representing both familial and new mutations. A total of 27 migration abnormalities was found in 26 patients. Using direct sequencing analysis, the majority of these variants were found to result in nonsense, splice-site or frameshift mutations. Mutations identified in familial NF2 patients segregate in the family, and may prove to be useful tools for a simple and direct SSCA-based technique of presymptomatic or prenatal diagnosis in relatives of patients with NF2. This may be of particular importance in children of patients who have new mutations in the NF2 gene, where linkage analysis may not be feasible.« less

  10. Distinct mutations in yeast TAF(II)25 differentially affect the composition of TFIID and SAGA complexes as well as global gene expression patterns.

    PubMed

    Kirschner, Doris B; vom Baur, Elmar; Thibault, Christelle; Sanders, Steven L; Gangloff, Yann-Gaël; Davidson, Irwin; Weil, P Anthony; Tora, Làszlò

    2002-05-01

    The RNA polymerase II transcription factor TFIID, composed of the TATA-binding protein (TBP) and TBP-associated factors (TAF(II)s), nucleates preinitiation complex formation at protein-coding gene promoters. SAGA, a second TAF(II)-containing multiprotein complex, is involved in transcription regulation in Saccharomyces cerevisiae. One of the essential protein components common to SAGA and TFIID is yTAF(II)25. We define a minimal evolutionarily conserved 91-amino-acid region of TAF(II)25 containing a histone fold domain that is necessary and sufficient for growth in vivo. Different temperature-sensitive mutations of yTAF(II)25 or chimeras with the human homologue TAF(II)30 arrested cell growth at either the G(1) or G(2)/M cell cycle phase and displayed distinct phenotypic changes and gene expression patterns. Immunoprecipitation studies revealed that TAF(II)25 mutation-dependent gene expression and phenotypic changes correlated at least partially with the integrity of SAGA and TFIID. Genome-wide expression analysis revealed that the five TAF(II)25 temperature-sensitive mutant alleles individually affect the expression of between 18 and 33% of genes, whereas taken together they affect 64% of all class II genes. Thus, different yTAF(II)25 mutations induce distinct phenotypes and affect the regulation of different subsets of genes, demonstrating that no individual TAF(II) mutant allele reflects the full range of its normal functions.

  11. A new visualization approach for identifying mutations that affect differentiation and organization of the Drosophila ommatidia.

    PubMed

    Pichaud, F; Desplan, C

    2001-03-01

    The Drosophila eye is widely used as a model system to study neuronal differentiation, survival and axon projection. Photoreceptor differentiation starts with the specification of a founder cell R8, which sequentially recruits other photoreceptor neurons to the ommatidium. The eight photoreceptors that compose each ommatidium exist in two chiral forms organized along two axes of symmetry and this pattern represents a paradigm to study tissue polarity. We have developed a method of fluoroscopy to visualize the different types of photoreceptors and the organization of the ommatidia in living animals. This allowed us to perform an F(1) genetic screen to isolate mutants affecting photoreceptor differentiation, survival or planar polarity. We illustrate the power of this detection system using known genetic backgrounds and new mutations that affect ommatidial differentiation, morphology or chirality.

  12. Prenatal diagnosis for a novel splice mutation of PHEX gene in a large Han Chinese family affected with X-linked hypophosphatemic rickets.

    PubMed

    Qiu, Guangrong; Liu, Caixia; Zhou, Jingyi; Liu, Peiyan; Wang, Jun; Jiang, Hongkun; Hou, Zhiyan; Zhao, Yanyan; Sun, Kailai; Li-Ling, Jesse

    2010-06-01

    X-linked hypophosphatemia (XLH) is the most common form of heritable rickets characterized by X-linked dominant inheritance, renal phosphate wasting, hypophosphatemia, and defective bone mineralization. Inactivating mutations of the PHEX gene located at Xp22.1 have been linked with this disease. Ethnic distribution of such mutations seems widespread but only a few mutations in the Chinese population have been reported to date. We report on a large Han Chinese family affected with XLH rickets, which included 13 patients from four generations. Polymerase chain reaction and direct sequencing were performed for all exons and intron-exon boundaries of the PHEX gene. The effect of nucleotide changes was analyzed using bioinformatic software. Prenatal diagnosis was performed on umbilical cord blood at the 20th gestational week. A novel G-->A splice mutation in intron 7 (c.849+1G>A) was identified in all patients from the family. As confirmed by reverse-transcription (RT)-polymerase chain reaction (PCR), the mutation has rendered loss of a normal splice donor site (c.849+1G) while activating a cryptic one at c.849+519G, which resulted in addition of 518 nucleotides to the mature RNA. Prenatal diagnosis had excluded the fetus for carrying the same mutation. A healthy boy was born later. A novel splice mutation c.849+1G>A in the PHEX gene is responsible for XLH in the studied family. Further studies may enhance our understanding of the role of this mutation in the pathogenesis of XLH.

  13. Mutation-induced protein interaction kinetics changes affect apoptotic network dynamic properties and facilitate oncogenesis

    PubMed Central

    Zhao, Linjie; Sun, Tanlin; Pei, Jianfeng; Ouyang, Qi

    2015-01-01

    It has been a consensus in cancer research that cancer is a disease caused primarily by genomic alterations, especially somatic mutations. However, the mechanism of mutation-induced oncogenesis is not fully understood. Here, we used the mitochondrial apoptotic pathway as a case study and performed a systematic analysis of integrating pathway dynamics with protein interaction kinetics to quantitatively investigate the causal molecular mechanism of mutation-induced oncogenesis. A mathematical model of the regulatory network was constructed to establish the functional role of dynamic bifurcation in the apoptotic process. The oncogenic mutation enrichment of each of the protein functional domains involved was found strongly correlated with the parameter sensitivity of the bifurcation point. We further dissected the causal mechanism underlying this correlation by evaluating the mutational influence on protein interaction kinetics using molecular dynamics simulation. We analyzed 29 matched mutant–wild-type and 16 matched SNP—wild-type protein systems. We found that the binding kinetics changes reflected by the changes of free energy changes induced by protein interaction mutations, which induce variations in the sensitive parameters of the bifurcation point, were a major cause of apoptosis pathway dysfunction, and mutations involved in sensitive interaction domains show high oncogenic potential. Our analysis provided a molecular basis for connecting protein mutations, protein interaction kinetics, network dynamics properties, and physiological function of a regulatory network. These insights provide a framework for coupling mutation genotype to tumorigenesis phenotype and help elucidate the logic of cancer initiation. PMID:26170328

  14. The interaction between cytosine methylation and processes of DNA replication and repair shape the mutational landscape of cancer genomes

    PubMed Central

    Poulos, Rebecca C.

    2017-01-01

    Abstract Methylated cytosines (5mCs) are frequently mutated in the genome. However, no studies have yet comprehensively analysed mutation–methylation associations across cancer types. Here we analyse 916 cancer genomes, together with tissue type-specific methylation and replication timing data. We describe a strong mutation–methylation association across colorectal cancer subtypes, most interestingly in samples with microsatellite instability (MSI) or Polymerase epsilon (POLE) exonuclease domain mutations. By analysing genomic regions with differential mismatch repair (MMR) efficiency, we suggest a possible role for MMR in the correction of 5mC deamination events, potentially accounting for the high rate of 5mC mutation accumulation in MSI tumours. Additionally, we propose that mutant POLE asserts a mutator phenotype specifically at 5mCs, and we find coding mutation hotspots in POLE-mutant cancers at highly-methylated CpGs in the tumour-suppressor genes APC and TP53. Finally, using multivariable regression models, we demonstrate that different cancers exhibit distinct mutation–methylation associations, with DNA repair influencing such associations in certain cancer genomes. Taken together, we find differential associations with methylation that are vital for accurately predicting expected mutation loads across cancer types. Our findings reveal links between methylation and common mutation and repair processes, with these mechanisms defining a key part of the mutational landscape of cancer genomes. PMID:28531315

  15. ASXL1 mutation correction by CRISPR/Cas9 restores gene function in leukemia cells and increases survival in mouse xenografts

    PubMed Central

    Valletta, Simona; Dolatshad, Hamid; Bartenstein, Matthias; Yip, Bon Ham; Bello, Erica; Gordon, Shanisha; Yu, Yiting; Shaw, Jacqueline; Roy, Swagata; Scifo, Laura; Schuh, Anna; Pellagatti, Andrea; Fulga, Tudor A.; Verma, Amit; Boultwood, Jacqueline

    2015-01-01

    Recurrent somatic mutations of the epigenetic modifier and tumor suppressor ASXL1 are common in myeloid malignancies, including chronic myeloid leukemia (CML), and are associated with poor clinical outcome. CRISPR/Cas9 has recently emerged as a powerful and versatile genome editing tool for genome engineering in various species. We have used the CRISPR/Cas9 system to correct the ASXL1 homozygous nonsense mutation present in the CML cell line KBM5, which lacks ASXL1 protein expression. CRISPR/Cas9-mediated ASXL1 homozygous correction resulted in protein re-expression with restored normal function, including down-regulation of Polycomb repressive complex 2 target genes. Significantly reduced cell growth and increased myeloid differentiation were observed in ASXL1 mutation-corrected cells, providing new insights into the role of ASXL1 in human myeloid cell differentiation. Mice xenografted with mutation-corrected KBM5 cells showed significantly longer survival than uncorrected xenografts. These results show that the sole correction of a driver mutation in leukemia cells increases survival in vivo in mice. This study provides proof-of-concept for driver gene mutation correction via CRISPR/Cas9 technology in human leukemia cells and presents a strategy to illuminate the impact of oncogenic mutations on cellular function and survival. PMID:26623729

  16. ASXL1 mutation correction by CRISPR/Cas9 restores gene function in leukemia cells and increases survival in mouse xenografts.

    PubMed

    Valletta, Simona; Dolatshad, Hamid; Bartenstein, Matthias; Yip, Bon Ham; Bello, Erica; Gordon, Shanisha; Yu, Yiting; Shaw, Jacqueline; Roy, Swagata; Scifo, Laura; Schuh, Anna; Pellagatti, Andrea; Fulga, Tudor A; Verma, Amit; Boultwood, Jacqueline

    2015-12-29

    Recurrent somatic mutations of the epigenetic modifier and tumor suppressor ASXL1 are common in myeloid malignancies, including chronic myeloid leukemia (CML), and are associated with poor clinical outcome. CRISPR/Cas9 has recently emerged as a powerful and versatile genome editing tool for genome engineering in various species. We have used the CRISPR/Cas9 system to correct the ASXL1 homozygous nonsense mutation present in the CML cell line KBM5, which lacks ASXL1 protein expression. CRISPR/Cas9-mediated ASXL1 homozygous correction resulted in protein re-expression with restored normal function, including down-regulation of Polycomb repressive complex 2 target genes. Significantly reduced cell growth and increased myeloid differentiation were observed in ASXL1 mutation-corrected cells, providing new insights into the role of ASXL1 in human myeloid cell differentiation. Mice xenografted with mutation-corrected KBM5 cells showed significantly longer survival than uncorrected xenografts. These results show that the sole correction of a driver mutation in leukemia cells increases survival in vivo in mice. This study provides proof-of-concept for driver gene mutation correction via CRISPR/Cas9 technology in human leukemia cells and presents a strategy to illuminate the impact of oncogenic mutations on cellular function and survival.

  17. Novel CLCNKB mutations causing Bartter syndrome affect channel surface expression.

    PubMed

    Keck, Mathilde; Andrini, Olga; Lahuna, Olivier; Burgos, Johanna; Cid, L Pablo; Sepúlveda, Francisco V; L'hoste, Sébastien; Blanchard, Anne; Vargas-Poussou, Rosa; Lourdel, Stéphane; Teulon, Jacques

    2013-09-01

    Mutations in the CLCNKB gene encoding the ClC-Kb Cl(-) channel cause Bartter syndrome, which is a salt-losing renal tubulopathy. Here, we investigate the functional consequences of seven mutations. When expressed in Xenopus laevis oocytes, four mutants carried no current (c.736G>C, p.Gly246Arg; c.1271G>A, p.Gly424Glu; c.1313G>A, p.Arg438His; c.1316T>C, p.Leu439Pro), whereas others displayed a 30%-60% reduction in conductance as compared with wild-type ClC-Kb (c.242T>C, p.Leu81Pro; c.274C>T, p.Arg92Trp; c.1052G>C, p.Arg351Pro). Anion selectivity and sensitivity to external Ca(2+) and H(+), typical of the ClC-Kb channel, were not modified in the partially active mutants. In oocytes, we found that all the mutations reduced surface expression with a profile similar to that observed for currents. In HEK293 cells, the currents in the mutants had similar profiles to those obtained in oocytes, except for p.Leu81Pro, which produced no current. Furthermore, p.Arg92Trp and p.Arg351Pro mutations did not modify the unit-conductance of closely related ClC-K1. Western blot analysis in HEK293 cells showed that ClC-Kb protein abundance was lower for the nonconducting mutants but similar to wild-type for other mutants. Overall, two classes of mutants can be distinguished: nonconducting mutants associated with low total protein expression, and partially conducting mutants with unaltered channel properties and ClC-Kb protein abundance. © 2013 WILEY PERIODICALS, INC.

  18. Driver gene classification reveals a substantial overrepresentation of tumor suppressors among very large chromatin-regulating proteins.

    PubMed

    Waks, Zeev; Weissbrod, Omer; Carmeli, Boaz; Norel, Raquel; Utro, Filippo; Goldschmidt, Yaara

    2016-12-23

    Compiling a comprehensive list of cancer driver genes is imperative for oncology diagnostics and drug development. While driver genes are typically discovered by analysis of tumor genomes, infrequently mutated driver genes often evade detection due to limited sample sizes. Here, we address sample size limitations by integrating tumor genomics data with a wide spectrum of gene-specific properties to search for rare drivers, functionally classify them, and detect features characteristic of driver genes. We show that our approach, CAnceR geNe similarity-based Annotator and Finder (CARNAF), enables detection of potentially novel drivers that eluded over a dozen pan-cancer/multi-tumor type studies. In particular, feature analysis reveals a highly concentrated pool of known and putative tumor suppressors among the <1% of genes that encode very large, chromatin-regulating proteins. Thus, our study highlights the need for deeper characterization of very large, epigenetic regulators in the context of cancer causality.

  19. Loss of heterozygosity at 7q22 and mutation analysis of the CDP gene in human epithelial ovarian tumors.

    PubMed

    Neville, P J; Thomas, N; Campbell, I G

    2001-02-01

    Many tumor types including that of the ovary show loss of heterozygosity (LOH) on chromosome arm 7q, which suggests the existence of at least one tumor suppressor gene (TSG) on this chromosome arm. We have studied the region surrounding the putative tumor suppressor gene CUTL1 at 7q22 in 127 epithelial ovarian tumors. LOH was found across 7q22 in 31% of malignant and 14% of benign ovarian tumors. In 16% of the tumors the LOH appeared to be centered on the CUTL1 gene. This gene has been implicated previously as a TSG in both uterine leiomyomas and breast carcinoma. However, mutation analysis of the CUTL1 gene in 47 tumors with 7q22 LOH failed to identify any somatic alterations in the coding regions. This finding suggests that CUTL1 may not be the target of the 7q22 LOH in ovarian cancers.

  20. Mutation testing in Treacher Collins Syndrome.

    PubMed

    Ellis, P E; Dawson, M; Dixon, M J

    2002-12-01

    To report on a study where 97 subjects were screened for mutations in the Treacher Collins syndrome (TCS) gene TCOF1. Ninety-seven subjects with a clinical diagnosis of TCS were screened for potential mutations in TCOF1, by means of single strand conformation polymorphism (SSCP) analysis. In those subjects where potential mutations were detected, sequence analysis was performed to determine the site and type of mutation present. Thirty-six TCS-specific mutations are reported including 27 deletions, six point mutations, two splice junction mutations, and one insertion/deletion. This brings the total number of mutations reported to date to 105. The importance of detection of these mutations is mainly in postnatal diagnosis and genetic counselling. Knowledge of the family specific mutation may also be used in prenatal diagnosis to confirm whether the foetus is affected or not, and give the parents the choice of whether to continue with the pregnancy.

  1. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    PubMed

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  2. First report of an unusual novel double mutation affecting the transcription repression domain of MeCP2 and causing a severe phenotype of Rett syndrome: Molecular analyses and computational investigation.

    PubMed

    Ghorbel, Rania; Ghorbel, Raouia; Rouissi, Aida; Fendri-Kriaa, Nourhene; Ben Salah, Ghada; Belguith, Neila; Ammar-Keskes, Leila; Gouider-Khouja, Neziha; Fakhfakh, Faiza

    2018-02-26

    Rett syndrome is an X-linked neurodevelopmental disorder that develops a profound intellectual and motor disability and affects 1 from 10 000 to 15 000 live female births. This disease is characterized by a period of apparently normal development until 6-18 months of age when motor and communication abilities regress which is caused by mutations occurred in the X-linked MECP2 gene, encoding the methyl-CpG binding protein 2. This research study reports a molecular analysis via an exhaustive gene sequencing which reveals an unusual novel double mutation (c.695 G > T; c.880C > T) located in a highly conserved region in MECP2 gene affecting the transcription repression domain (TRD) of MeCP2 protein and leading for the first time to a severe phenotype of Rett syndrome. Moreover, a computational investigation of MECP2 mutations demonstrates that the novel mutation c.695 G > T is highly deleterious which affects the MeCP2 protein showing also an adverse impact on MECP2 gene expression and resulting in an affected folding and decreased stability of MECP2 structures. Thus, the altered TRD domain engenders a disrupted process of MECP2 functions. Therefore, this is the first study which highlights a novel double mutation among the transcription repression domain (TRD) of MeCP2 protein in Rett patient with a severe clinical phenotype in North Africa region. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Binding of Amphipathic Cell Penetrating Peptide p28 to Wild Type and Mutated p53 as studied by Raman, Atomic Force and Surface Plasmon Resonance spectroscopies.

    PubMed

    Signorelli, Sara; Santini, Simona; Yamada, Tohru; Bizzarri, Anna Rita; Beattie, Craig W; Cannistraro, Salvatore

    2017-04-01

    Mutations within the DNA binding domain (DBD) of the tumor suppressor p53 are found in >50% of human cancers and may significantly modify p53 secondary structure impairing its function. p28, an amphipathic cell-penetrating peptide, binds to the DBD through hydrophobic interaction and induces a posttranslational increase in wildtype and mutant p53 restoring functionality. We use mutation analyses to explore which elements of secondary structure may be critical to p28 binding. Molecular modeling, Raman spectroscopy, Atomic Force Spectroscopy (AFS) and Surface Plasmon Resonance (SPR) were used to identify which secondary structure of site-directed and naturally occurring mutant DBDs are potentially altered by discrete changes in hydrophobicity and the molecular interaction with p28. We show that specific point mutations that alter hydrophobicity within non-mutable and mutable regions of the p53 DBD alter specific secondary structures. The affinity of p28 was positively correlated with the β-sheet content of a mutant DBD, and reduced by an increase in unstructured or random coil that resulted from a loss in hydrophobicity and redistribution of surface charge. These results help refine our knowledge of how mutations within p53-DBD alter secondary structure and provide insight on how potential structural alterations in p28 or similar molecules improve their ability to restore p53 function. Raman spectroscopy, AFS, SPR and computational modeling are useful approaches to characterize how mutations within the p53DBD potentially affect secondary structure and identify those structural elements prone to influence the binding affinity of agents designed to increase the functionality of p53. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Mutation in cyclophilin B that causes hyperelastosis cutis in American Quarter Horse does not affect peptidylprolyl cis-trans isomerase activity but shows altered cyclophilin B-protein interactions and affects collagen folding.

    PubMed

    Ishikawa, Yoshihiro; Vranka, Janice A; Boudko, Sergei P; Pokidysheva, Elena; Mizuno, Kazunori; Zientek, Keith; Keene, Douglas R; Rashmir-Raven, Ann M; Nagata, Kazuhiro; Winand, Nena J; Bächinger, Hans Peter

    2012-06-22

    The rate-limiting step of folding of the collagen triple helix is catalyzed by cyclophilin B (CypB). The G6R mutation in cyclophilin B found in the American Quarter Horse leads to autosomal recessive hyperelastosis cutis, also known as hereditary equine regional dermal asthenia. The mutant protein shows small structural changes in the region of the mutation at the side opposite the catalytic domain of CypB. The peptidylprolyl cis-trans isomerase activity of the mutant CypB is normal when analyzed in vitro. However, the biosynthesis of type I collagen in affected horse fibroblasts shows a delay in folding and secretion and a decrease in hydroxylysine and glucosyl-galactosyl hydroxylysine. This leads to changes in the structure of collagen fibrils in tendon, similar to those observed in P3H1 null mice. In contrast to cyclophilin B null mice, where little 3-hydroxylation was found in type I collagen, 3-hydroxylation of type I collagen in affected horses is normal. The mutation disrupts the interaction of cyclophilin B with the P-domain of calreticulin, with lysyl hydroxylase 1, and probably other proteins, such as the formation of the P3H1·CypB·cartilage-associated protein complex, resulting in less effective catalysis of the rate-limiting step in collagen folding in the rough endoplasmic reticulum.

  5. Mutation in Cyclophilin B That Causes Hyperelastosis Cutis in American Quarter Horse Does Not Affect Peptidylprolyl cis-trans Isomerase Activity but Shows Altered Cyclophilin B-Protein Interactions and Affects Collagen Folding*

    PubMed Central

    Ishikawa, Yoshihiro; Vranka, Janice A.; Boudko, Sergei P.; Pokidysheva, Elena; Mizuno, Kazunori; Zientek, Keith; Keene, Douglas R.; Rashmir-Raven, Ann M.; Nagata, Kazuhiro; Winand, Nena J.; Bächinger, Hans Peter

    2012-01-01

    The rate-limiting step of folding of the collagen triple helix is catalyzed by cyclophilin B (CypB). The G6R mutation in cyclophilin B found in the American Quarter Horse leads to autosomal recessive hyperelastosis cutis, also known as hereditary equine regional dermal asthenia. The mutant protein shows small structural changes in the region of the mutation at the side opposite the catalytic domain of CypB. The peptidylprolyl cis-trans isomerase activity of the mutant CypB is normal when analyzed in vitro. However, the biosynthesis of type I collagen in affected horse fibroblasts shows a delay in folding and secretion and a decrease in hydroxylysine and glucosyl-galactosyl hydroxylysine. This leads to changes in the structure of collagen fibrils in tendon, similar to those observed in P3H1 null mice. In contrast to cyclophilin B null mice, where little 3-hydroxylation was found in type I collagen, 3-hydroxylation of type I collagen in affected horses is normal. The mutation disrupts the interaction of cyclophilin B with the P-domain of calreticulin, with lysyl hydroxylase 1, and probably other proteins, such as the formation of the P3H1·CypB·cartilage-associated protein complex, resulting in less effective catalysis of the rate-limiting step in collagen folding in the rough endoplasmic reticulum. PMID:22556420

  6. Mutations affecting transport of the hexitols D-mannitol, D-glucitol, and galactitol in Escherichia coli K-12: isolation and mapping.

    PubMed Central

    Lengeler, J

    1975-01-01

    Mutants of Escherichia coli K-12 unable to grow on any of the three naturally occurring hexitols D-manitol, D-glucitol, and galactitol and, among these specifically, mutants with altered transport and phosphorylating activity have been isolated. Different isolation procedures have been utilized, including suicide by D-[3H]mannitol, chemotaxis, and resistance to the toxic hexitol analogue 2-deoxy-arabino-hexitol. Mutations thus obtained have been mapped in four distinct operons. (i) Mutations affecting an enzyme II-complexmt1 activity of the phosphoenolpyruvate-dependent phosphotransferase system all map in gene mtlA. This gene has previously been shown (Solomon and Lin, 1972) to be part of an operon, mtl, located at 71 min on the E. coli linkage map containing, in addition to mtlA, the cis-dominant regulatory gene mtlC and mtlD, the structural gene for the enzyme D-mannitol-1-phosphate dehydrogenase. The gene order in this operon, induced by D-mannitol, is mtlC A D. (ii) Mutations in gene gutA affecting a second enzyme II-complexgut of the phosphotransferase system map at 51 min, clustered in operon gutC A D together with the cis-dominant regulatory gene gutC and the structural gene gutD for the enzyme D-glucitol-6-phosphate dehydrogenase. The gut operon, previously called sbl or srl, is induced by D-glucitol. (iii) Mutations affecting the transport and catabolism of galactitol are clustered in a third operon, gatC A D, located at 40.5 min. This operon again contains a cis-dominant regulatory gene, gatC, the structural gene gatD for galactitol-1-phosphate dehydrogenase, and gene gatA coding for a thrid hexitol-specific enzyme II-complexgat. Other genes coding for two additional enzymes involved in galactitol catabolism apparently are not linked to gatC A D. (iv) A fourth class of mutants pleiotropically negative for hexitol growth and transport maps in the pts operon. Triple-negative mutants (mtlA gutA gatA) do not have further transport or phosphorylating activity

  7. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation.

    PubMed

    Harms, Paul W; Collie, Angela M B; Hovelson, Daniel H; Cani, Andi K; Verhaegen, Monique E; Patel, Rajiv M; Fullen, Douglas R; Omata, Kei; Dlugosz, Andrzej A; Tomlins, Scott A; Billings, Steven D

    2016-03-01

    Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin 20 (CK20) is expressed in ~95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small-cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (10 Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high-confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes

  8. Next Generation Sequencing of Cytokeratin 20-Negative Merkel Cell Carcinoma Reveals Ultraviolet Signature Mutations and Recurrent TP53 and RB1 Inactivation

    PubMed Central

    Harms, Paul W.; Collie, Angela M. B.; Hovelson, Daniel H.; Cani, Andi K.; Verhaegen, Monique E.; Patel, Rajiv M.; Fullen, Douglas R.; Omata, Kei; Dlugosz, Andrzej A.; Tomlins, Scott A.; Billings, Steven D.

    2016-01-01

    Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin-20 (CK20) is expressed in approximately 95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (ten Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%)) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping

  9. Structural insights into translational recoding by frameshift suppressor tRNASufJ

    PubMed Central

    Fagan, Crystal E.; Maehigashi, Tatsuya; Dunkle, Jack A.; Miles, Stacey J.

    2014-01-01

    The three-nucleotide mRNA reading frame is tightly regulated during translation to ensure accurate protein expression. Translation errors that lead to aberrant protein production can result from the uncoupled movement of the tRNA in either the 5′ or 3′ direction on mRNA. Here, we report the biochemical and structural characterization of +1 frameshift suppressor tRNASufJ, a tRNA known to decode four, instead of three, nucleotides. Frameshift suppressor tRNASufJ contains an insertion 5′ to its anticodon, expanding the anticodon loop from seven to eight nucleotides. Our results indicate that the expansion of the anticodon loop of either ASLSufJ or tRNASufJ does not affect its affinity for the A site of the ribosome. Structural analyses of both ASLSufJ and ASLThr bound to the Thermus thermophilus 70S ribosome demonstrate both ASLs decode in the zero frame. Although the anticodon loop residues 34–37 are superimposable with canonical seven-nucleotide ASLs, the single C31.5 insertion between nucleotides 31 and 32 in ASLSufJ imposes a conformational change of the anticodon stem, that repositions and tilts the ASL toward the back of the A site. Further modeling analyses reveal that this tilting would cause a distortion in full-length A-site tRNASufJ during tRNA selection and possibly impede gripping of the anticodon stem by 16S rRNA nucleotides in the P site. Together, these data implicate tRNA distortion as a major driver of noncanonical translation events such as frameshifting. PMID:25352689

  10. High frequency electromagnetic fields (GSM signals) affect gene expression levels in tumor suppressor p53-deficient embryonic stem cells.

    PubMed

    Czyz, Jaroslaw; Guan, Kaomei; Zeng, Qinghua; Nikolova, Teodora; Meister, Armin; Schönborn, Frank; Schuderer, Jürgen; Kuster, Niels; Wobus, Anna M

    2004-05-01

    Effects of electromagnetic fields (EMF) simulating exposure to the Global System for Mobile Communications (GSM) signals were studied using pluripotent embryonic stem (ES) cells in vitro. Wild-type ES cells and ES cells deficient for the tumor suppressor p53 were exposed to pulse modulated EMF at 1.71 GHz, lower end of the uplink band of GSM 1800, under standardized and controlled conditions, and transcripts of regulatory genes were analyzed during in vitro differentiation. Two dominant GSM modulation schemes (GSM-217 and GSM-Talk), which generate temporal changes between GSM-Basic (active during talking phases) and GSM-DTX (active during listening phases thus simulating a typical conversation), were applied to the cells at and below the basic safety limits for local exposures as defined for the general public by the International Commission on Nonionizing Radiation Protection (ICNIRP). GSM-217 EMF induced a significant upregulation of mRNA levels of the heat shock protein, hsp70 of p53-deficient ES cells differentiating in vitro, paralleled by a low and transient increase of c-jun, c-myc, and p21 levels in p53-deficient, but not in wild-type cells. No responses were observed in either cell type after EMF exposure to GSM-Talk applied at similar slot-averaged specific absorption rates (SAR), but at lower time-averaged SAR values. Cardiac differentiation and cell cycle characteristics were not affected in embryonic stem and embryonic carcinoma cells after exposure to GSM-217 EMF signals. Our data indicate that the genetic background determines cellular responses to GSM modulated EMF. Bioelectromagnetics 25:296-307, 2004. Copyright 2004 Wiley-Liss, Inc.

  11. Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs.

    PubMed

    Hopper, A K; Schultz, L D; Shapiro, R A

    1980-03-01

    By using conditional loss of suppression an an assay, we have been successful in screening for a yeast mutant which is defective in tRNA processing. The los1-1 mutation causes an accumulation of a subset of precursor tRNAs at the nonpermissive temperature. These pre-tRNAs are like those which accumulate in the yeast mutant ts 136 (rna1) in that they have transcribed intervening sequences. The mutations at los1-1 and rna1 complement and segregate independently of each other. The los1-1 mutation affects the expression of all 8 tyrosine-inserting suppressor loci, but does not seem to affect rRNA or mRNA synthesis.

  12. piRNA-mediated transposon regulation and the germ-line mutation rate in Drosophila melanogaster males.

    PubMed

    Simmons, Michael J; Peterson, Mark P; Thorp, Michael W; Buschette, Jared T; DiPrima, Stephanie N; Harter, Christine L; Skolnick, Matthew J

    2015-03-01

    Transposons, especially retrotransposons, are abundant in the genome of Drosophila melanogaster. These mobile elements are regulated by small RNAs that interact with the Piwi family of proteins-the piwi-interacting or piRNAs. The Piwi proteins are encoded by the genes argonaute3 (ago3), aubergine (aub), and piwi. Heterochromatin Protein 1 (HP1), a chromatin-organizing protein encoded by the Suppressor of variegation 205 [Su(var)205] gene, also plays a role in this regulation. To assess the mutational impact of weakening the system for transposon regulation, we measured the frequency of recessive X-linked lethal mutations occurring in the germ lines of males from stocks that were heterozygous for mutant alleles of the ago3, aub, piwi, or Su(var)205 genes. These mutant alleles are expected to deplete the wild-type proteins encoded by these genes by as much as 50%. The mutant alleles of piwi and Su(var)205 significantly increased the X-linked lethal mutation frequency, whereas the mutant alleles of ago3 did not. An increased mutation frequency was also observed in males from one of two mutant aub stocks, but this increase may not have been due to the aub mutant. The increased mutation frequency caused by depleting Piwi or HP1suggests that chromatin-organizing proteins play important roles in minimizing the germ-line mutation rate, possibly by stabilizing the structure of the heterochromatin in which many transposons are situated. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. [Analysis of MAT1A gene mutations in a child affected with simple hypermethioninemia].

    PubMed

    Sun, Yun; Ma, Dingyuan; Wang, Yanyun; Yang, Bin; Jiang, Tao

    2017-02-10

    To detect potential mutations of MAT1A gene in a child suspected with simple hypermethioninemia by MS/MS neonatal screening. Clinical data of the child was collected. Genomic DNA was extracted by a standard method and subjected to targeted sequencing using an Ion Ampliseq TM Inherited Disease Panel. Detected mutations were verified by Sanger sequencing. The child showed no clinical features except evaluated methionine. A novel compound mutation of the MAT1A gene, i.e., c.345delA and c.529C>T, was identified in the child. His father and mother were found to be heterozygous for the c.345delA mutation and c.529C>T mutation, respectively. The compound mutation c.345delA and c.529C>T of the MAT1A gene probably underlie the disease in the child. The semi-conductor sequencing has provided an important means for the diagnosis of hereditary diseases.

  14. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  15. Interallelic Complementation at the Suppressor of Forked Locus of Drosophila Reveals Complementation between Suppressor of Forked Proteins Mutated in Different Regions

    PubMed Central

    Simonelig, M.; Elliott, K.; Mitchelson, A.; O'Hare, K.

    1996-01-01

    The Su(f) protein of Drosophila melanogaster shares extensive homologies with proteins from yeast (RNA14) and man (77 kD subunit of cleavage stimulation factor) that are required for 3' end processing of mRNA. These homologies suggest that su(f) is involved in mRNA 3' end formation and that some aspects of this process are conserved throughout eukaryotes. We have investigated the genetic and molecular complexity of the su(f) locus. The su(f) gene is transcribed to produce three RNAs and could encode two proteins. Using constructs that contain different parts of the locus, we show that only the larger predicted gene product of 84 kD is required for the wild-type function of su(f). Some lethal alleles of su(f) complement to produce viable combinations. The structures of complementing and noncomplementing su(f) alleles indicate that 84-kD Su(f) proteins mutated in different domains can act in combination for partial su(f) function. Our results suggest protein-protein interaction between or within wild-type Su(f) molecules. PMID:8846900

  16. Separation of concanavalin A-induced human suppressor and helper T cells by the autologous erythrocyte rosette technique.

    PubMed

    Sakane, T; Honda, M; Taniguchi, Y; Kotani, H

    1981-08-01

    Very few normal human peripheral blood T cells are capable of binding autologous erythrocytes to form rosettes, whereas in the T cell population activated by concanavalin A (Con A) the autorosette levels are markedly enhanced. Fractionation of the Con A-activated T cells with autologous erythrocytes into autorosetting and nonrosetting cells demonstrates that suppressor, but not helper, activity resides in the autorosetting population, whereas the reverse is true of the nonrosetting population. Both these activities are found to be Con A dependent. The Con A-induced human suppressor cells can be identified and separated from the Con A-induced human helper cells by the autorosette technique. Studies on the surface properties of autorosetting and nonrosetting T cells indicate that there is little correlation between the activated suppressor and helper T cell subsets defined by autorosette technique and either those defined by monoclonal antibodies (which are able to distinguish these subsets in the resting but not activated T cells) or those defined by Fc receptors. Since the autorosetting T cell population (which acts as suppressor cells) bears receptors for peanut agglutinin, the nature of Con A-induced human suppressor cells appears to be analogous to that of Con A-induced murine suppressor cells.

  17. EZH2 mutations and promoter hypermethylation in childhood acute lymphoblastic leukemia.

    PubMed

    Schäfer, Vivien; Ernst, Jana; Rinke, Jenny; Winkelmann, Nils; Beck, James F; Hochhaus, Andreas; Gruhn, Bernd; Ernst, Thomas

    2016-07-01

    Acute lymphoblastic leukemia (ALL) is the most common malignancy in children and young adults. The polycomb repressive complex 2 (PRC2) has been identified as one of the most frequently mutated epigenetic protein complexes in hematologic cancers. PRC2 acts as an epigenetic repressor through histone H3 lysine 27 trimethylation (H3K27me3), catalyzed by the histone methyltransferase enhancer of zeste homolog 2 protein (EZH2). To study the prevalence and clinical impact of PRC2 aberrations in an unselected childhood ALL cohort (n = 152), we performed PRC2 mutational screenings by Sanger sequencing and promoter methylation analyses by quantitative pyrosequencing for the three PRC2 core component genes EZH2, suppressor of zeste 12 (SUZ12), and embryonic ectoderm development (EED). Targeted deep next-generation sequencing of 30 frequently mutated genes in leukemia was performed to search for cooperating mutations in patients harboring PRC2 aberrations. Finally, the functional consequence of EZH2 promoter hypermethylation on H3K27me3 was studied by Western blot analyses of primary cells. Loss-of-function EZH2 mutations were detected in 2/152 (1.3 %) patients with common-ALL and early T-cell precursor (ETP)-ALL, respectively. In one patient, targeted deep sequencing identified cooperating mutations in ASXL1 and TET2. EZH2 promoter hypermethylation was found in one patient with ETP-ALL which led to reduced H3K27me3. In comparison with healthy children, the EZH2 promoter was significantly higher methylated in T-ALL patients. No mutations or promoter methylation changes were identified for SUZ12 or EED genes, respectively. Although PRC2 aberrations seem to be rare in childhood ALL, our findings indicate that EZH2 aberrations might contribute to the disease in specific cases. Hereby, EZH2 promoter hypermethylation might have functionally similar consequences as loss-of-function mutations.

  18. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

    PubMed Central

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

  19. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

    PubMed

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

  20. Mutations, mutation rates, and evolution at the hypervariable VNTR loci of Yersinia pestis.

    PubMed

    Vogler, Amy J; Keys, Christine E; Allender, Christopher; Bailey, Ira; Girard, Jessica; Pearson, Talima; Smith, Kimothy L; Wagner, David M; Keim, Paul

    2007-03-01

    VNTRs are able to discriminate among closely related isolates of recently emerged clonal pathogens, including Yersinia pestis the etiologic agent of plague, because of their great diversity. Diversity is driven largely by mutation but little is known about VNTR mutation rates, factors affecting mutation rates, or the mutational mechanisms. The molecular epidemiological utility of VNTRs will be greatly enhanced when this foundational knowledge is available. Here, we measure mutation rates for 43 VNTR loci in Y. pestis using an in vitro generated population encompassing approximately 96,000 generations. We estimate the combined 43-locus rate and individual rates for 14 loci. A comparison of Y. pestis and Escherichia coli O157:H7 VNTR mutation rates and products revealed a similar relationship between diversity and mutation rate in these two species. Likewise, the relationship between repeat copy number and mutation rate is nearly identical between these species, suggesting a generalized relationship that may be applicable to other species. The single- versus multiple-repeat mutation ratios and the insertion versus deletion mutation ratios were also similar, providing support for a general model for the mutations associated with VNTRs. Finally, we use two small sets of Y. pestis isolates to show how this general model and our estimated mutation rates can be used to compare alternate phylogenies, and to evaluate the significance of genotype matches, near-matches, and mismatches found in empirical comparisons with a reference database.

  1. Frequent NF2 gene transcript mutations in sporadic meningiomas and vestibular schwannomas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Deprez, R.H.L.; Groen, N.A.; Zwarthoff, E.C.

    1994-06-01

    The gene for the hereditary disorder neurofibromatosis type 2 (NF2), which predisposes for benign CNS tumors such as vestibular schwannomas and meningiomas, has been assigned to chromosome 22 and recently has been isolated. Mutations in the NF2 gene were found in both sporadic meningiomas and vestibular schwannomas. However, so far only 6 of the 16 exons of the gene have been analyzed. In order to extend the analysis of an involvement of the NF2 gene in the sporadic counterparts of these NF2-related tumors, the authors have used reverse transcriptase-PCR amplification followed by SSCP and DNA sequence analysis to screen formore » mutations in the coding region of the NF2 gene. Analysis of the NF2 gene transcript in 53 unrelated patients with meningiomas and vestibular schwannomas revealed mutations in 32% of the sporadic meningiomas (n = 44), in 50% of the sporadic vestibular schwannomas (n = 4), in 100% of the tumors found in NF2 patients (n = 2), and in one of three tumors from multiple-meningioma patients. Of the 18 tumors in which a mutation in the NF2 gene transcript was observed and the copy number of chromosome 22 could be established, 14 also showed loss of (parts of) chromosome 22. This suggests that in sporadic meningiomas and NF2-associated tumors the NF2 gene functions as a recessive tumor-suppressor gene. The mutations detected resulted mostly in frameshifts, predicting truncations starting within the N-terminal half of the putative protein. 23 refs., 2 figs. 3 tabs.« less

  2. Genomic mutation consequence calculator.

    PubMed

    Major, John E

    2007-11-15

    The genomic mutation consequence calculator (GMCC) is a tool that will reliably and quickly calculate the consequence of arbitrary genomic mutations. GMCC also reports supporting annotations for the specified genomic region. The particular strength of the GMCC is it works in genomic space, not simply in spliced transcript space as some similar tools do. Within gene features, GMCC can report on the effects on splice site, UTR and coding regions in all isoforms affected by the mutation. A considerable number of genomic annotations are also reported, including: genomic conservation score, known SNPs, COSMIC mutations, disease associations and others. The manual interface also offers link outs to various external databases and resources. In batch mode, GMCC returns a csv file which can easily be parsed by the end user. GMCC is intended to support the many tumor resequencing efforts, but can be useful to any study investigating genomic mutations.

  3. A Novel Plasmid-Based Microarray Screen Identifies Suppressors of rrp6Δ in Saccharomyces cerevisiae▿†

    PubMed Central

    Abruzzi, Katharine; Denome, Sylvia; Olsen, Jens Raabjerg; Assenholt, Jannie; Haaning, Line Lindegaard; Jensen, Torben Heick; Rosbash, Michael

    2007-01-01

    Genetic screens in Saccharomyces cerevisiae provide novel information about interacting genes and pathways. We screened for high-copy-number suppressors of a strain with the gene encoding the nuclear exosome component Rrp6p deleted, with either a traditional plate screen for suppressors of rrp6Δ temperature sensitivity or a novel microarray enhancer/suppressor screening (MES) strategy. MES combines DNA microarray technology with high-copy-number plasmid expression in liquid media. The plate screen and MES identified overlapping, but also different, suppressor genes. Only MES identified the novel mRNP protein Nab6p and the tRNA transporter Los1p, which could not have been identified in a traditional plate screen; both genes are toxic when overexpressed in rrp6Δ strains at 37°C. Nab6p binds poly(A)+ RNA, and the functions of Nab6p and Los1p suggest that mRNA metabolism and/or protein synthesis are growth rate limiting in rrp6Δ strains. Microarray analyses of gene expression in rrp6Δ strains and a number of suppressor strains support this hypothesis. PMID:17101774

  4. TET2 mutations in B cells of patients affected by angioimmunoblastic T-cell lymphoma.

    PubMed

    Schwartz, Friederike H; Cai, Qian; Fellmann, Eva; Hartmann, Sylvia; Mäyränpää, Mikko I; Karjalainen-Lindsberg, Marja-Liisa; Sundström, Christer; Scholtysik, René; Hansmann, Martin-Leo; Küppers, Ralf

    2017-06-01

    Angioimmunoblastic T-cell lymphomas (AITLs) frequently carry mutations in the TET2 and IDH2 genes. TET2 mutations represent early genetic lesions as they had already been detected in haematopoietic precursor cells of AITL patients. We show by analysis of whole-tissue sections and microdissected PD1 + cells that the frequency of TET2-mutated AITL is presumably even higher than reported (12/13 cases in our collection; 92%). In two-thirds of informative AITLs (6/9), a fraction of B cells was also TET2-mutated. Investigation of four AITLs by TET2 and IGHV gene sequencing of single microdissected B cells showed that between 10% and 60% of polyclonal B cells in AITL lymph nodes harboured the identical TET2 mutations of the respective T-cell lymphoma clone. Thus, TET2-mutated haematopoietic precursor cells in AITL patients not only give rise to the T-cell lymphoma but also generate a large population of mutated mature B cells. Future studies will show whether this is a reason why AITL patients frequently also develop B-cell lymphomas. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  5. The efficiency of dentin sialoprotein-phosphophoryn processing is affected by mutations both flanking and distant from the cleavage site.

    PubMed

    Yang, Robert T; Lim, Glendale L; Dong, Zhihong; Lee, Arthur M; Yee, Colin T; Fuller, Robert S; Ritchie, Helena H

    2013-02-22

    Normal dentin mineralization requires two highly acidic proteins, dentin sialoprotein (DSP) and phosphophoryn (PP). DSP and PP are synthesized as part of a single secreted precursor, DSP-PP, which is conserved in marsupial and placental mammals. Using a baculovirus expression system, we previously found that DSP-PP is accurately cleaved into DSP and PP after secretion into medium by an endogenous, secreted, zinc-dependent Sf9 cell activity. Here we report that mutation of conserved residues near and distant from the G(447)↓D(448) cleavage site in DSP-PP(240) had dramatic effects on cleavage efficiency by the endogenous Sf9 cell processing enzyme. We found that: 1) mutation of residues flanking the cleavage site from P(4) to P(4)' blocked, impaired, or enhanced DSP-PP(240) cleavage; 2) certain conserved amino acids distant from the cleavage site were important for precursor cleavage; 3) modification of the C terminus by appending a C-terminal tag altered the pattern of processing; and 4) mutations in DSP-PP(240) had similar effects on cleavage by recombinant human BMP1, a candidate physiological processing enzyme, as was seen with the endogenous Sf9 cell activity. An analysis of a partial TLR1 cDNA from Sf9 cells indicates that residues that line the substrate-binding cleft of Sf9 TLR1 and human BMP1 are nearly perfectly conserved, offering an explanation of why Sf9 cells so accurately process mammalian DSP-PP. The fact that several mutations in DSP-PP(240) significantly modified the amount of PP(240) product generated from DSP-PP(240) precursor protein cleavage suggests that such mutation may affect the mineralization process.

  6. The prevalence of ABCB1:c.227_230delATAG mutation in affected dog breeds from European countries.

    PubMed

    Firdova, Zuzana; Turnova, Evelina; Bielikova, Marcela; Turna, Jan; Dudas, Andrej

    2016-06-01

    Deletion of 4-base pairs in the canine ABCB1 (MDR1) gene, responsible for encoding P-glycoprotein, leads to nonsense frame-shift mutation, which causes hypersensitivity to macrocyclic lactones drugs (e.g. ivermectin). To date, at least 12 purebred dog breeds have been found to be affected by this mutation. The aim of this study was to update information about the prevalence of ABCB1 mutation (c.227_230delATAG) in predisposed breeds in multiple European countries. This large scale survey also includes countries which were not involved in previous studies. The samples were collected in the period from 2012 to 2014. The overview is based on genotyping data of 4729 individuals. The observed mutant allele frequencies were 58.5% (Smooth Collie), 48.3% (Rough Collie), 35% (Australian Shepherd), 30.3% (Shetland Sheepdog), 28.1% (Silken Windhound), 26.1% (Miniature Australian Shepherd), 24.3% (Longhaired Whippet), 16.2% (White Swiss Shepherd) and 0% (Border Collie). The possible presence of an ABCB1 mutant allele in Akita-Inu breed has been investigated with negative results. This information could be helpful for breeders in optimization of their breeding strategy and for veterinarians when prescribing drug therapy for dogs of predisposed breeds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Mutation screening of X-chromosomal neuroligin genes: no mutations in 196 autism probands.

    PubMed

    Vincent, John B; Kolozsvari, Debbie; Roberts, Wendy S; Bolton, Patrick F; Gurling, Hugh M D; Scherer, Stephen W

    2004-08-15

    Autism, a childhood neuropsychiatric disorder with a strong genetic component, is currently the focus of considerable attention within the field of human genetics as well many other medical-related disciplines. A recent study has implicated two X-chromosomal neuroligin genes, NLGN3 and NLGN4, as having an etiological role in autism, having identified a frameshift mutation in one gene and a substitution mutation in the other, segregating in multiplex autism spectrum families (Jamain et al. [2003: Nat Genet 34:27-29]). The function of neuroligin as a trigger for synapse formation would suggest that such mutations would likely result in some form of pathological manifestation. Our own study, screening a larger sample of 196 autism probands, failed to identify any mutations that would affect the coding regions of these genes. Our findings suggest that mutations in these two genes are infrequent in autism. Copyright 2004 Wiley-Liss, Inc.

  8. Potential hot spot for de novo mutations in PTCH1 gene in Gorlin syndrome patients: a case report of twins from Croatia.

    PubMed

    Musani, Vesna; Ozretić, Petar; Trnski, Diana; Sabol, Maja; Poduje, Sanja; Tošić, Mateja; Šitum, Mirna; Levanat, Sonja

    2018-02-28

    We describe a case of twins with sporadic Gorlin syndrome. Both twins had common Gorlin syndrome features including calcification of the falx cerebri, multiple jaw keratocysts, and multiple basal cell carcinomas, but with different expressivity. One brother also had benign testicular mesothelioma. We propose this tumor type as a possible new feature of Gorlin syndrome. Gorlin syndrome is a rare autosomal dominant disorder characterized by both developmental abnormalities and cancer predisposition, with variable expression of various developmental abnormalities and different types of tumors. The syndrome is primarily caused by mutations in the Patched 1 (PTCH1) gene, although rare mutations of Patched 2 (PTCH2) or Suppressor of Fused (SUFU) genes have also been found. Neither founder mutations nor hot spot locations have been described for PTCH1 in Gorlin syndrome patients. Although de novo mutations of the PTCH1 gene occur in almost 50% of Gorlin syndrome cases, there are a few recurrent mutations. Our twin patients were carriers of a de novo mutation in the PTCH1 gene, c.3364_3365delAT (p.Met1122ValfsX22). This is, to our knowledge, the first Gorlin syndrome-causing mutation that has been reported four independent times in distant geographical locations. Therefore, we propose the location of the described mutation as a potential hot spot for mutations in PTCH1.

  9. The contribution of de novo coding mutations to autism spectrum disorder

    PubMed Central

    Iossifov, Ivan; O’Roak, Brian J.; Sanders, Stephan J.; Ronemus, Michael; Krumm, Niklas; Levy, Dan; Stessman, Holly A.; Witherspoon, Kali; Vives, Laura; Patterson, Karynne E.; Smith, Joshua D.; Paeper, Bryan; Nickerson, Deborah A.; Dea, Jeanselle; Dong, Shan; Gonzalez, Luis E.; Mandell, Jefferey D.; Mane, Shrikant M.; Murtha, Michael T.; Sullivan, Catherine A.; Walker, Michael F.; Waqar, Zainulabedin; Wei, Liping; Willsey, A. Jeremy; Yamrom, Boris; Lee, Yoon-ha; Grabowska, Ewa; Dalkic, Ertugrul; Wang, Zihua; Marks, Steven; Andrews, Peter; Leotta, Anthony; Kendall, Jude; Hakker, Inessa; Rosenbaum, Julie; Ma, Beicong; Rodgers, Linda; Troge, Jennifer; Narzisi, Giuseppe; Yoon, Seungtai; Schatz, Michael C.; Ye, Kenny; McCombie, W. Richard; Shendure, Jay; Eichler, Evan E.; State, Matthew W.; Wigler, Michael

    2015-01-01

    We sequenced exomes from more than 2,500 simplex families each having a child with an autistic spectrum disorder (ASD). By comparing affected to unaffected siblings, we estimate that 13% of de novo (DN) missense mutations and 42% of DN likely gene-disrupting (LGD) mutations contribute to 12% and 9% of diagnoses, respectively. Including copy number variants, coding DN mutations contribute to about 30% of all simplex and 45% of female diagnoses. Virtually all LGD mutations occur opposite wild-type alleles. LGD targets in affected females significantly overlap the targets in males of lower IQ, but neither overlaps significantly with targets in males of higher IQ. We estimate that LGD mutation in about 400 genes can contribute to the joint class of affected females and males of lower IQ, with an overlapping and similar number of genes vulnerable to causative missense mutation. LGD targets in the joint class overlap with published targets for intellectual disability and schizophrenia, and are enriched for chromatin modifiers, FMRP-associated genes and embryonically expressed genes. Virtually all significance for the latter comes from affected females. PMID:25363768

  10. NS1 Protein Mutation I64T Affects Interferon Responses and Virulence of Circulating H3N2 Human Influenza A Viruses

    PubMed Central

    DeDiego, Marta L.; Nogales, Aitor; Lambert-Emo, Kris; Martinez-Sobrido, Luis

    2016-01-01

    ABSTRACT Influenza NS1 protein is the main viral protein counteracting host innate immune responses, allowing the virus to efficiently replicate in interferon (IFN)-competent systems. In this study, we analyzed NS1 protein variability within influenza A (IAV) H3N2 viruses infecting humans during the 2012-2013 season. We also evaluated the impact of the mutations on the ability of NS1 proteins to inhibit host innate immune responses and general gene expression. Surprisingly, a previously unidentified mutation in the double-stranded RNA (dsRNA)-binding domain (I64T) decreased NS1-mediated general inhibition of host protein synthesis by decreasing its interaction with cleavage and polyadenylation specificity factor 30 (CPSF30), leading to increased innate immune responses after viral infection. Notably, a recombinant A/Puerto Rico/8/34 H1N1 virus encoding the H3N2 NS1-T64 protein was highly attenuated in mice, most likely because of its ability to induce higher antiviral IFN responses at early times after infection and because this virus is highly sensitive to the IFN-induced antiviral state. Interestingly, using peripheral blood mononuclear cells (PBMCs) collected at the acute visit (2 to 3 days after infection), we show that the subject infected with the NS1-T64 attenuated virus has diminished responses to interferon and to interferon induction, suggesting why this subject could be infected with this highly IFN-sensitive virus. These data demonstrate the importance of influenza virus surveillance in identifying new mutations in the NS1 protein, affecting its ability to inhibit innate immune responses and, as a consequence, the pathogenicity of the virus. IMPORTANCE Influenza A and B viruses are one of the most common causes of respiratory infections in humans, causing 1 billion infections and between 300,000 and 500,000 deaths annually. Influenza virus surveillance to identify new mutations in the NS1 protein affecting innate immune responses and, as a consequence

  11. Positive selection of deleterious alleles through interaction with a sex-ratio suppressor gene in African Buffalo: a plausible new mechanism for a high frequency anomaly.

    PubMed

    van Hooft, Pim; Greyling, Ben J; Getz, Wayne M; van Helden, Paul D; Zwaan, Bas J; Bastos, Armanda D S

    2014-01-01

    Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer) population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations), we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has important

  12. Mitochondria, calcium, and tumor suppressor Fus1: At the crossroad of cancer, inflammation, and autoimmunity

    PubMed Central

    Uzhachenko, Roman; Shanker, Anil; Yarbrough, Wendell G.; Ivanova, Alla V.

    2015-01-01

    Mitochondria present a unique set of key intracellular functions such as ATP synthesis, production of reactive oxygen species (ROS) and Ca2+ buffering. Mitochondria both encode and decode Ca2+ signals and these interrelated functions have a direct impact on cell signaling and metabolism. High proliferative potential is a key energy-demanding feature shared by cancer cells and activated T lymphocytes. Switch of a metabolic state mediated by alterations in mitochondrial homeostasis plays a fundamental role in maintenance of the proliferative state. Recent studies show that tumor suppressors have the ability to affect mitochondrial homeostasis controlling both cancer and autoimmunity. Herein, we discuss established and putative mechanisms of calcium–dependent regulation of both T cell and tumor cell activities. We use the mitochondrial protein Fus1 as a case of tumor suppressor that controls immune response and tumor growth via maintenance of mitochondrial homeostasis. We focus on the regulation of mitochondrial Ca2+ handling as a key function of Fus1 and highlight the mechanisms of a crosstalk between Ca2+ accumulation and mitochondrial homeostasis. Given the important role of Ca2+ signaling, mitochondrial Ca2+ transport and ROS production in the activation of NFAT and NF-κB transcription factors, we outline the importance of Fus1 activities in this context. PMID:26246474

  13. Mutations in the Neuroblastoma Amplified Sequence gene in a family affected by Acrofrontofacionasal Dysostosis type 1.

    PubMed

    Palagano, Eleonora; Zuccarini, Giulia; Prontera, Paolo; Borgatti, Renato; Stangoni, Gabriela; Elisei, Sandro; Mantero, Stefano; Menale, Ciro; Forlino, Antonella; Uva, Paolo; Oppo, Manuela; Vezzoni, Paolo; Villa, Anna; Merlo, Giorgio R; Sobacchi, Cristina

    2018-06-19

    Acrofrontofacionasal Dysostosis type 1 (AFFND1) is an extremely rare, autosomal recessive syndrome, comprising facial and skeletal abnormalities, short stature and intellectual disability. We analyzed an Indian family with two affected siblings by exome sequencing and identified a novel homozygous truncating mutation in the Neuroblastoma-Amplified Sequence (NBAS) gene in the patients' genome. Mutations in the NBAS gene have recently been associated with different phenotypes mainly involving skeletal formation, liver and cognitive development. The NBAS protein has been implicated in two key cellular processes, namely the non-sense mediated decay and the Golgi-to-Endoplasmic Reticulum retrograde traffic. Both functions were impaired in HEK293T cells overexpressing the truncated NBAS protein, as assessed by Real-Time PCR, Western blot analysis, co-immunoprecipitation, and immunofluorescence analysis. We examined the expression of NBAS protein in mouse embryos at various developmental stages by immunohistochemistry, and detected expression in developing chondrogenic and osteogenic structures of the skeleton as well as in the cortex, hippocampus and cerebellum, which is compatible with a role in bone and brain development. Functional genetics in the zebrafish model showed that depletion of endogenous z-nbas in fish embryos results in defective morphogenesis of chondrogenic cranial skeletal elements. Overall, our data point to a conserved function of NBAS in skeletal morphogenesis during development, support the hypothesis of a causative role of the mutated NBAS gene in the pathogenesis of AFFND1 and extend the spectrum of phenotypes associated with defects in this gene. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. A critical functional missense mutation (H173R) in the bovine PROP1 gene significantly affects growth traits in cattle.

    PubMed

    Pan, Chuanying; Wu, Chongyang; Jia, Wenchao; Xu, Yao; Lei, Chuzhao; Hu, Shenrong; Lan, Xianyong; Chen, Hong

    2013-12-01

    The PROP1 protein, encoded by the prophet of Pit-1 (PROP1) gene, exhibits both DNA-binding and transcriptional activation abilities. Its expression leads to the ontogenesis of growth hormone (GH), prolactin (PRL), thyroid-stimulating hormone (TSH), and pituitary hormone. The missense mutation H173R in PROP1 may result in deficiencies of GH, PRL, TSH, and Pit-1, thereby affecting growth traits. The objective of this study was to characterize the H173R mutation within the PROP1 gene and examine its associations with growth traits in cattle. Accordingly, the H173R mutation was genotyped in 1207 cows belonging to five Chinese native breeds. Three genotypes were identified among the specimens, with genotype AA being the major one. Consequently, the "G" allele was the minor allele. Association testing revealed that the H173R mutation was significantly associated with body weight, average daily weight gain and physical parameters in the analyzed breeds. Interestingly, the cows with genotype AG and/or AA had superior growth traits compared with those expressing the GG genotype, in all tested breeds. These findings revealed that the "A" allele had positive effects on growth traits, which was consistent with the increasing binding ability and enhanced activation capacity associated with the bovine isoform PROP1-173H, representing the "A" allele. Therefore, the H173R mutation can be considered as a DNA marker for selecting individuals with superior growth traits, thereby contributing to research on breeding and genetics in the beef industry. © 2013.

  15. Pan-cancer transcriptomic analysis associates long non-coding RNAs with key mutational driver events

    PubMed Central

    Ashouri, Arghavan; Sayin, Volkan I.; Van den Eynden, Jimmy; Singh, Simranjit X.; Papagiannakopoulos, Thales; Larsson, Erik

    2016-01-01

    Thousands of long non-coding RNAs (lncRNAs) lie interspersed with coding genes across the genome, and a small subset has been implicated as downstream effectors in oncogenic pathways. Here we make use of transcriptome and exome sequencing data from thousands of tumours across 19 cancer types, to identify lncRNAs that are induced or repressed in relation to somatic mutations in key oncogenic driver genes. Our screen confirms known coding and non-coding effectors and also associates many new lncRNAs to relevant pathways. The associations are often highly reproducible across cancer types, and while many lncRNAs are co-expressed with their protein-coding hosts or neighbours, some are intergenic and independent. We highlight lncRNAs with possible functions downstream of the tumour suppressor TP53 and the master antioxidant transcription factor NFE2L2. Our study provides a comprehensive overview of lncRNA transcriptional alterations in relation to key driver mutational events in human cancers. PMID:28959951

  16. X-linked retinoschisis: RS1 mutation severity and age affect the ERG phenotype in a cohort of 68 affected male subjects.

    PubMed

    Bowles, Kristen; Cukras, Catherine; Turriff, Amy; Sergeev, Yuri; Vitale, Susan; Bush, Ronald A; Sieving, Paul A

    2011-11-29

    To assess the effect of age and RS1 mutation on the phenotype of X-linked retinoschisis (XLRS) subjects using the clinical electroretinogram (ERG) in a cross-sectional analysis. Sixty-eight XLRS males 4.5 to 55 years of age underwent genotyping, and the retinoschisis (RS1) mutations were classified as less severe (27 subjects) or more severe (41 subjects) based on the putative impact on the protein. ERG parameters of retinal function were analyzed by putative mutation severity with age as a continuous variable. The a-wave amplitude remained greater than the lower limit of normal (mean, -2 SD) for 72% of XLRS males and correlated with neither age nor mutation class. However, b-wave and b/a-ratio amplitudes were significantly lower in the more severe than in the less severe mutation groups and in older than in younger subjects. Subjects up to 10 years of age with more severe RS1 mutations had significantly greater b-wave amplitudes and faster a-wave trough implicit times than older subjects in this group. RS1 mutation putative severity and age both had significant effects on retinal function in XLRS only in the severe mutation group, as judged by ERG analysis of the b-wave amplitude and the b/a-ratio, whereas the a-wave amplitude remained normal in most. A new observation was that increasing age (limited to those aged 55 and younger) caused a significant delay in XLRS b-wave onset (i.e., a-wave implicit time), even for those who retained considerable b-wave amplitudes. The delayed b-wave onset suggested that dysfunction of the photoreceptor synapse or of bipolar cells increases with age of XLRS subjects.

  17. Construction and properties of a temperature-sensitive mutation in the gene for the bacteriophage SPO1 DNA-binding protein TF1.

    PubMed

    Sayre, M H; Geiduschek, E P

    1990-08-01

    The Bacillus subtilis bacteriophage SPO1 encodes the DNA-binding protein TF1, a homolog of the ubiquitous type II DNA-binding proteins that are components of bacterial chromatin. The known three-dimensional structure of a related protein was used in devising a scheme of site-directed mutagenesis that led to the creation of a temperature-sensitive mutation in the TF1 gene. At the nonpermissive temperature, this mutation disrupted the temporal regulation of viral protein synthesis and processing, altered the kinetics of accumulation of at least one viral transcript, and prohibited the production of infective progeny phage. We suggest that TF1 function is required to shut off the expression of several early-middle and middle viral genes and that TF1 plays a role in phage head morphogenesis. Spontaneous second-site mutations of the temperature-sensitive mutant TF1 allele that suppressed its associated phenotypes were analyzed. These suppressor mutations conferred greater amino acid sequence homology with the type II DNA-binding protein from the thermophile Bacillus stearothermophilus.

  18. HPV-negative penile squamous cell carcinoma: disruptive mutations in the TP53 gene are common.

    PubMed

    Kashofer, Karl; Winter, Elke; Halbwedl, Iris; Thueringer, Andrea; Kreiner, Marisa; Sauer, Stefan; Regauer, Sigrid

    2017-07-01

    The majority of penile squamous cell carcinomas is caused by transforming human papilloma virus (HPV) infection. The etiology of HPV-negative cancers is unclear, but TP53 mutations have been implicated. Archival tissues of 108 invasive squamous cell carcinoma from a single pathology institution in a low-incidence area were analyzed for HPV-DNA and p16 ink4a overexpression and for TP53 mutations by ion torrent next-generation sequencing. Library preparation failed in 32/108 squamous cell carcinomas. Institutional review board approval was obtained. Thirty of 76 squamous cell carcinomas (43%; average 63 years) were HPV-negative with 8/33 squamous cell carcinomas being TP53 wild-type (24%; average 63 years). Twenty-five of 33 squamous cell carcinomas (76%; average 65 years) showed 32 different somatic TP53 mutations (23 missense mutations in exons 5-8, 6 nonsense, 1 frameshift and 2 splice-site mutations). Several hotspot mutations were detected multiple times (R175H, R248, R282, and R273). Eighteen of 19 squamous cell carcinomas with TP53 expression in immunohistochemistry had TP53 mutations. Fifty percent of TP53-negative squamous cell carcinomas showed mostly truncating loss-of-function TP53 mutations. Patients without mutations had longer survival (5 years: 86% vs 61%; 10 years: 60% vs 22%), but valid clinically relevant conclusions cannot be drawn due to different tumor stages and heterogeneous treatment of the cases presented in this study. Somatic TP53 mutations are a common feature in HPV-negative penile squamous cell carcinomas and offer an explanation for HPV-independent penile carcinogenesis. About half of HPV-negative penile cancers are driven by oncogenic activation of TP53, while a quarter is induced by loss of TP53 tumor suppressor function. Detection of TP53 mutations should be carried out by sequencing, as immunohistochemical TP53 staining could not identify all squamous cell carcinomas with TP53 mutations.

  19. Functional significance of co-occurring mutations in PIK3CA and MAP3K1 in breast cancer.

    PubMed

    Avivar-Valderas, Alvaro; McEwen, Robert; Taheri-Ghahfarokhi, Amir; Carnevalli, Larissa S; Hardaker, Elizabeth L; Maresca, Marcello; Hudson, Kevin; Harrington, Elizabeth A; Cruzalegui, Francisco

    2018-04-20

    The PI3Kα signaling pathway is frequently hyper-activated in breast cancer (BrCa), as a result of mutations/amplifications in oncogenes (e.g. HER2 ), decreased function in tumor suppressors (e.g. PTEN ) or activating mutations in key components of the pathway. In particular, activating mutations of PIK3CA (~45%) are frequently found in luminal A BrCa samples. Genomic studies have uncovered inactivating mutations in MAP3K1 (13-20%) and MAP2K4 (~8%), two upstream kinases of the JNK apoptotic pathway in luminal A BrCa samples. Further, simultaneous mutation of PIK3CA and MAP3K1 are found in ~11% of mutant PIK3CA tumors. How these two alterations may cooperate to elicit tumorigenesis and impact the sensitivity to PI3K and AKT inhibitors is currently unknown. Using CRISPR gene editing we have genetically disrupted MAP3K1 expression in mutant PIK3CA cell lines to specifically create in vitro models reflecting the mutational status of PIK3CA and MAP3K1 in BrCa patients. MAP3K1 deficient cell lines exhibited ~2.4-fold increased proliferation rate and decreased sensitivity to PI3Kα/δ(AZD8835) and AKT (AZD5363) inhibitors (~2.61 and ~5.23-fold IC 50 increases, respectively) compared with parental control cell lines. In addition, mechanistic analysis revealed that MAP3K1 disruption enhances AKT phosphorylation and downstream signaling and reduces sensitivity to AZD5363-mediated pathway inhibition. This appears to be a consequence of deficient MAP3K1-JNK signaling increasing IRS1 stability and therefore promoting IRS1 binding to p85, resulting in enhanced PI3Kα activity. Using 3D-MCF10A-PI3Kα H1047R models, we found that MAP3K1 depletion increased overall acinar volume and counteracted AZD5363-mediated reduction of acinar growth due to enhanced proliferation and reduced apoptosis. Furthermore, in vivo efficacy studies revealed that MAP3K1-deficient MCF7 tumors were less sensitive to AKT inhibitor treatment, compared with parental MCF7 tumors. Our study provides

  20. The reduction of gunshot noise and auditory risk through the use of firearm suppressors and low-velocity ammunition.

    PubMed

    Murphy, William J; Flamme, Gregory A; Campbell, Adam R; Zechmann, Edward L; Tasko, Stephen M; Lankford, James E; Meinke, Deanna K; Finan, Donald S; Stewart, Michael

    2018-02-01

    This research assessed the reduction of peak levels, equivalent energy and sound power of firearm suppressors. The first study evaluated the effect of three suppressors at four microphone positions around four firearms. The second study assessed the suppressor-related reduction of sound power with a 3 m hemispherical microphone array for two firearms. The suppressors reduced exposures at the ear between 17 and 24 dB peak sound pressure level and reduced the 8 h equivalent A-weighted energy between 9 and 21 dB depending upon the firearm and ammunition. Noise reductions observed for the instructor's position about a metre behind the shooter were between 20 and 28 dB peak sound pressure level and between 11 and 26 dB L Aeq,8h . Firearm suppressors reduced the measured sound power levels between 2 and 23 dB. Sound power reductions were greater for the low-velocity ammunition than for the same firearms fired with high-velocity ammunition due to the effect of N-waves produced by a supersonic bullet. Firearm suppressors may reduce noise exposure, and the cumulative exposures of suppressed firearms can still present a significant hearing risk. Therefore, firearm users should always wear hearing protection whenever target shooting or hunting.