Sample records for surface hopping method

  1. Surface hopping simulation of vibrational predissociation of methanol dimer

    NASA Astrophysics Data System (ADS)

    Jiang, Ruomu; Sibert, Edwin L.

    2012-06-01

    The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

  2. Generalized trajectory surface hopping method based on the Zhu-Nakamura theory

    NASA Astrophysics Data System (ADS)

    Oloyede, Ponmile; Mil'nikov, Gennady; Nakamura, Hiroki

    2006-04-01

    We present a generalized formulation of the trajectory surface hopping method applicable to a general multidimensional system. The method is based on the Zhu-Nakamura theory of a nonadiabatic transition and therefore includes the treatment of classically forbidden hops. The method uses a generalized recipe for the conservation of angular momentum after forbidden hops and an approximation for determining a nonadiabatic transition direction which is crucial when the coupling vector is unavailable. This method also eliminates the need for a rigorous location of the seam surface, thereby ensuring its applicability to a wide class of chemical systems. In a test calculation, we implement the method for the DH2+ system, and it shows a remarkable agreement with the previous results of C. Zhu, H. Kamisaka, and H. Nakamura, [J. Chem. Phys. 116, 3234 (2002)]. We then apply it to a diatomic-in-molecule model system with a conical intersection, and the results compare well with exact quantum calculations. The successful application to the conical intersection system confirms the possibility of directly extending the present method to an arbitrary potential of general topology.

  3. Generalized trajectory surface-hopping method for internal conversion and intersystem crossing

    NASA Astrophysics Data System (ADS)

    Cui, Ganglong; Thiel, Walter

    2014-09-01

    Trajectory-based fewest-switches surface-hopping (FSSH) dynamics simulations have become a popular and reliable theoretical tool to simulate nonadiabatic photophysical and photochemical processes. Most available FSSH methods model internal conversion. We present a generalized trajectory surface-hopping (GTSH) method for simulating both internal conversion and intersystem crossing processes on an equal footing. We consider hops between adiabatic eigenstates of the non-relativistic electronic Hamiltonian (pure spin states), which is appropriate for sufficiently small spin-orbit coupling. This choice allows us to make maximum use of existing electronic structure programs and to minimize the changes to available implementations of the traditional FSSH method. The GTSH method is formulated within the quantum mechanics (QM)/molecular mechanics framework, but can of course also be applied at the pure QM level. The algorithm implemented in the GTSH code is specified step by step. As an initial GTSH application, we report simulations of the nonadiabatic processes in the lowest four electronic states (S0, S1, T1, and T2) of acrolein both in vacuo and in acetonitrile solution, in which the acrolein molecule is treated at the ab initio complete-active-space self-consistent-field level. These dynamics simulations provide detailed mechanistic insight by identifying and characterizing two nonadiabatic routes to the lowest triplet state, namely, direct S1 → T1 hopping as major pathway and sequential S1 → T2 → T1 hopping as minor pathway, with the T2 state acting as a relay state. They illustrate the potential of the GTSH approach to explore photoinduced processes in complex systems, in which intersystem crossing plays an important role.

  4. Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

    A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully’s fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronicmore » wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.« less

  5. Multiple-hopping trajectories near a rotating asteroid

    NASA Astrophysics Data System (ADS)

    Shen, Hong-Xin; Zhang, Tian-Jiao; Li, Zhao; Li, Heng-Nian

    2017-03-01

    We present a study of the transfer orbits connecting landing points of irregular-shaped asteroids. The landing points do not touch the surface of the asteroids and are chosen several meters above the surface. The ant colony optimization technique is used to calculate the multiple-hopping trajectories near an arbitrary irregular asteroid. This new method has three steps which are as follows: (1) the search of the maximal clique of candidate target landing points; (2) leg optimization connecting all landing point pairs; and (3) the hopping sequence optimization. In particular this method is applied to asteroids 433 Eros and 216 Kleopatra. We impose a critical constraint on the target landing points to allow for extensive exploration of the asteroid: the relative distance between all the arrived target positions should be larger than a minimum allowed value. Ant colony optimization is applied to find the set and sequence of targets, and the differential evolution algorithm is used to solve for the hopping orbits. The minimum-velocity increment tours of hopping trajectories connecting all the landing positions are obtained by ant colony optimization. The results from different size asteroids indicate that the cost of the minimum velocity-increment tour depends on the size of the asteroids.

  6. A stable high-order perturbation of surfaces method for numerical simulation of diffraction problems in triply layered media

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hong, Youngjoon, E-mail: hongy@uic.edu; Nicholls, David P., E-mail: davidn@uic.edu

    The accurate numerical simulation of linear waves interacting with periodic layered media is a crucial capability in engineering applications. In this contribution we study the stable and high-order accurate numerical simulation of the interaction of linear, time-harmonic waves with a periodic, triply layered medium with irregular interfaces. In contrast with volumetric approaches, High-Order Perturbation of Surfaces (HOPS) algorithms are inexpensive interfacial methods which rapidly and recursively estimate scattering returns by perturbation of the interface shape. In comparison with Boundary Integral/Element Methods, the stable HOPS algorithm we describe here does not require specialized quadrature rules, periodization strategies, or the solution ofmore » dense non-symmetric positive definite linear systems. In addition, the algorithm is provably stable as opposed to other classical HOPS approaches. With numerical experiments we show the remarkable efficiency, fidelity, and accuracy one can achieve with an implementation of this algorithm.« less

  7. Communication: Standard surface hopping predicts incorrect scaling for Marcus' golden-rule rate: The decoherence problem cannot be ignored

    NASA Astrophysics Data System (ADS)

    Landry, Brian R.; Subotnik, Joseph E.

    2011-11-01

    We evaluate the accuracy of Tully's surface hopping algorithm for the spin-boson model for the case of a small diabatic coupling parameter (V). We calculate the transition rates between diabatic surfaces, and we compare our results to the expected Marcus rates. We show that standard surface hopping yields an incorrect scaling with diabatic coupling (linear in V), which we demonstrate is due to an incorrect treatment of decoherence. By modifying standard surface hopping to include decoherence events, we recover the correct scaling (˜V2).

  8. Nonadiabatic dynamics of photo-induced proton-coupled electron transfer reactions via ring-polymer surface hopping

    NASA Astrophysics Data System (ADS)

    Shakib, Farnaz; Huo, Pengfei

    Photo-induced proton-coupled electron transfer reactions (PCET) are at the heart of energy conversion reactions in photocatalysis. Here, we apply the recently developed ring-polymer surface-hopping (RPSH) approach to simulate the nonadiabatic dynamics of photo-induced PCET. The RPSH method incorporates ring-polymer (RP) quantization of the proton into the fewest-switches surface-hopping (FSSH) approach. Using two diabatic electronic states, corresponding to the electron donor and acceptor states, we model photo-induced PCET with the proton described by a classical isomorphism RP. From the RPSH method, we obtain numerical results that are comparable to those obtained when the proton is treated quantum mechanically. This accuracy stems from incorporating exact quantum statistics, such as proton tunnelling, into approximate quantum dynamics. Additionally, RPSH offers the numerical accuracy along with the computational efficiency. Namely, compared to the FSSH approach in vibronic representation, there is no need to calculate a massive number of vibronic states explicitly. This approach opens up the possibility to accurately and efficiently simulate photo-induced PCET with multiple transferring protons or electrons.

  9. A comparative study of different methods for calculating electronic transition rates

    NASA Astrophysics Data System (ADS)

    Kananenka, Alexei A.; Sun, Xiang; Schubert, Alexander; Dunietz, Barry D.; Geva, Eitan

    2018-03-01

    We present a comprehensive comparison of the following mixed quantum-classical methods for calculating electronic transition rates: (1) nonequilibrium Fermi's golden rule, (2) mixed quantum-classical Liouville method, (3) mean-field (Ehrenfest) mixed quantum-classical method, and (4) fewest switches surface-hopping method (in diabatic and adiabatic representations). The comparison is performed on the Garg-Onuchic-Ambegaokar benchmark charge-transfer model, over a broad range of temperatures and electronic coupling strengths, with different nonequilibrium initial states, in the normal and inverted regimes. Under weak to moderate electronic coupling, the nonequilibrium Fermi's golden rule rates are found to be in good agreement with the rates obtained via the mixed quantum-classical Liouville method that coincides with the fully quantum-mechanically exact results for the model system under study. Our results suggest that the nonequilibrium Fermi's golden rule can serve as an inexpensive yet accurate alternative to Ehrenfest and the fewest switches surface-hopping methods.

  10. Three-Dimensional Tracking of Interfacial Hopping Diffusion

    NASA Astrophysics Data System (ADS)

    Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

    2017-12-01

    Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

  11. A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination.

    PubMed

    Yu, Hua-Gen

    2008-05-21

    A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

  12. The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

    NASA Astrophysics Data System (ADS)

    Nguyen, Duc; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Girolami, Gregory S.; Lyding, Joseph; Gruebele, Martin

    2014-11-01

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB2 glass surface, two-state hopping of 1-2 nm diameter cooperatively rearranging regions or "clusters" occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunneling spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB2 has a very high bulk glass transition temperature Tg, and we observe no three-state hopping or sequential two-state hopping previously seen on lower Tg glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how "mixed" features can show up in surface dynamics of glasses.

  13. Human hopping on damped surfaces: strategies for adjusting leg mechanics.

    PubMed

    Moritz, Chet T; Farley, Claire T

    2003-08-22

    Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain.

  14. Human hopping on damped surfaces: strategies for adjusting leg mechanics.

    PubMed Central

    Moritz, Chet T; Farley, Claire T

    2003-01-01

    Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain. PMID:12965003

  15. Local control theory using trajectory surface hopping and linear-response time-dependent density functional theory.

    PubMed

    Curchod, Basile F E; Penfold, Thomas J; Rothlisberger, Ursula; Tavernelli, Ivano

    2013-01-01

    The implementation of local control theory using nonadiabatic molecular dynamics within the framework of linear-response time-dependent density functional theory is discussed. The method is applied to study the photoexcitation of lithium fluoride, for which we demonstrate that this approach can efficiently generate a pulse, on-the-fly, able to control the population transfer between two selected electronic states. Analysis of the computed control pulse yields insights into the photophysics of the process identifying the relevant frequencies associated to the curvature of the initial and final state potential energy curves and their energy differences. The limitations inherent to the use of the trajectory surface hopping approach are also discussed.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Duc; Girolami, Gregory S.; Beckman Institute, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB{sub 2} glass surface, two-state hopping of 1–2 nm diameter cooperatively rearranging regions or “clusters” occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunnelingmore » spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB{sub 2} has a very high bulk glass transition temperature T{sub g}, and we observe no three-state hopping or sequential two-state hopping previously seen on lower T{sub g} glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how “mixed” features can show up in surface dynamics of glasses.« less

  17. A new method of hybrid frequency hopping signals selection and blind parameter estimation

    NASA Astrophysics Data System (ADS)

    Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian

    2018-04-01

    Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

  18. An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping

    NASA Astrophysics Data System (ADS)

    Bai, Xin; Qiu, Jing; Wang, Linjun

    2018-03-01

    We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.

  19. Adsorbate hopping via vibrational-mode coupling induced by femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Ueba, H.; Hayashi, M.; Paulsson, M.; Persson, B. N. J.

    2008-09-01

    We study the heat transfer from femtosecond laser-heated hot electrons in a metal to adsorbates in the presence of vibrational-mode coupling. The theory is successfully applied to the experimental result of atomic oxygen hopping on a vicinal Pt(111) surface. The effective friction coupling between hot electrons and the vibrational mode relevant to the hopping motion depends on the transient temperature of the partner mode excited by hot electrons. The calculated two-pulse correlation and fluence dependence of the hopping probability reproduce the experimental results, which were previously analyzed using the hot-electron temperature (Te) -dependent friction ηa(Te) in a conventional heat transfer equation. A possible elementary process behind such a hypothetic modeling using ηa(Te) is discussed in terms of an indirect heating of the vibrational mode for hopping at the surface.

  20. Accelerated sampling by infinite swapping of path integral molecular dynamics with surface hopping

    NASA Astrophysics Data System (ADS)

    Lu, Jianfeng; Zhou, Zhennan

    2018-02-01

    To accelerate the thermal equilibrium sampling of multi-level quantum systems, the infinite swapping limit of a recently proposed multi-level ring polymer representation is investigated. In the infinite swapping limit, the ring polymer evolves according to an averaged Hamiltonian with respect to all possible surface index configurations of the ring polymer and thus connects the surface hopping approach to the mean-field path-integral molecular dynamics. A multiscale integrator for the infinite swapping limit is also proposed to enable efficient sampling based on the limiting dynamics. Numerical results demonstrate the huge improvement of sampling efficiency of the infinite swapping compared with the direct simulation of path-integral molecular dynamics with surface hopping.

  1. Detrending with Empirical Mode Decomposition (DEMD): Theory, Evaluation, and Application

    NASA Astrophysics Data System (ADS)

    Bolch, Michael Adam

    Land-surface heterogeneity (LSH) at different scales has significant influence on atmospheric boundary layer (ABL) buoyant and shear turbulence generation and transfers of water, carbon and heat. The extent of proliferation of this influence into larger-scale circulations and atmospheric structures is a topic continually investigated in experimental and numerical studies, in many cases with the hopes of improving land-atmosphere parameterizations for modeling purposes. The blending height is a potential metric for the vertical propagation of LSH effects into the ABL, and has been the subject of study for several decades. Proper assessment of the efficacy of blending height theory invites the combination of observations throughout ABLs above different LSH scales with model simulations of the observed ABL and LSH conditions. The central goal of this project is to develop an apt and thoroughly scrutinized method for procuring ABL observations that are accurately detrended and justifiably relevant for such a study, referred to here as Detrending with Empirical Mode Decomposition (DEMD). The Duke University helicopter observation platform (HOP) provides ABL data [wind (u, v, and w), temperature ( T), moisture (q), and carbon dioxide (CO 2)] at a wide range of altitudes, especially in the lower ABL, where LSH effects are most prominent, and where other aircraft-based platforms cannot fly. Also, lower airspeeds translate to higher resolution of the scalars and fluxes needed to evaluate blending height theory. To confirm noninterference of the main rotor downwash with the HOP sensors, and also to identify optimal airspeeds, analytical, numerical, and observational studies are presented. Analytical analysis clears the main rotor downwash from the HOP nose at airspeeds above 10 m s-1. Numerical models find an acceptable range from 20-40 m s-1, due to a growing compressed air preceding the HOP nose. The first observational study finds no impact of different HOP airspeeds on measurements from ˜18 m s -1 to ˜55 m s-1 over a stable marine boundary layer (MBL). Another set of observations studies HOP and tower data, using the Duke University Mobile Micrometeorological Station (MMS) over an MBL, and concludes that HOP sensible heat (SH), latent heat (LE), and carbon dioxide (F CO2) fluxes align well with MMS findings. The HOP sensors provide ABL data at 40 Hz, as well as a real-time display of theta for in-flight ABL height estimation. Sensor calibration and alignment procedures indicate usable ABL measurements. HOP data are especially susceptible to the spurious influence of platform motion on ABL data, largely due to the low-altitude and low-airspeed capabilities of the HOP. For example, HOP altitude motion in the presence of a lapse rate can cause spurious T fluctuations. Empirical mode decomposition (EMD) can separate HOP data into a set of adaptive and unique intrinsic mode functions (IMFs), often with physical meaning. DEMD aims to correct for spurious contributions to HOP data, while merging EMD with a correlation analysis to adjust data without eliminating relevant ABL dynamics. To evaluate DEMD efficacy, two-dimensional synthetic T fields with simulated turbulence over a prescribed lapse rate are sampled with altitude fluctuations similar to HOP flights, and with a wide range of T perturbation and sampling path parameter variations. DEMD recovers the prescribed lapse rate within 1% on average for the 552 test cases passing the filtering criteria. The method is further evaluated via application to vertical cross sections taken from the Ocean-Land-Atmosphere Model (OLAM) large-eddy simulation (LES) results, where DEMD shows improved accuracy of SH recovery. DEMD is applied to three low-altitude HOP flight legs flown on 19 June 2007 during the Cloud and Land Surface Interaction Campaign (CLASIC), both as an example of practical application and to compare DEMD to the initially proposed method (Holder et al. 2011, hereafter H11). H11 dictates the elimination of correlated IMFs, along with other subtle differences from DEMD, which also eliminates any ABL motions embedded in those IMFs. As suspected, the H11 method produces marked reductions of variances and turbulence kinetic energy (TKE) and substantial deviations in SH, LE, and FCO2 compared to DEMD. DEMD detrends without unnecessary elimination. DEMD is vital for ensuring accurate scalars and fluxes from HOP data, and a strategy for future research is presented that integrates properly detrended observations from the CLASIC HOP dataset with OLAM simulations to explore LSH effects on ABL processes and evaluate blending height theory.

  2. Surface hopping, transition state theory and decoherence. I. Scattering theory and time-reversibility

    NASA Astrophysics Data System (ADS)

    Jain, Amber; Herman, Michael F.; Ouyang, Wenjun; Subotnik, Joseph E.

    2015-10-01

    We provide an in-depth investigation of transmission coefficients as computed using the augmented-fewest switches surface hopping algorithm in the low energy regime. Empirically, microscopic reversibility is shown to hold approximately. Furthermore, we show that, in some circumstances, including decoherence on top of surface hopping calculations can help recover (as opposed to destroy) oscillations in the transmission coefficient as a function of energy; these oscillations can be studied analytically with semiclassical scattering theory. Finally, in the spirit of transition state theory, we also show that transmission coefficients can be calculated rather accurately starting from the curve crossing point and running trajectories forwards and backwards.

  3. Is scaffold hopping a reliable indicator for the ability of computational methods to identify structurally diverse active compounds?

    NASA Astrophysics Data System (ADS)

    Dimova, Dilyana; Bajorath, Jürgen

    2017-07-01

    Computational scaffold hopping aims to identify core structure replacements in active compounds. To evaluate scaffold hopping potential from a principal point of view, regardless of the computational methods that are applied, a global analysis of conventional scaffolds in analog series from compound activity classes was carried out. The majority of analog series was found to contain multiple scaffolds, thus enabling the detection of intra-series scaffold hops among closely related compounds. More than 1000 activity classes were found to contain increasing proportions of multi-scaffold analog series. Thus, using such activity classes for scaffold hopping analysis is likely to overestimate the scaffold hopping (core structure replacement) potential of computational methods, due to an abundance of artificial scaffold hops that are possible within analog series.

  4. Lateral hopping of CO molecules on Pt(111) surface by femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Hayashi, M.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.; Ueba, H.

    2009-12-01

    Theory of heat transfer between adsorbate vibrational degrees of freedom and ultrafast laser heated hot electrons including vibrational intermode coupling is applied to calculate two-pulse correlation, laser fluence dependence and time dependence of lateral hopping of CO molecules from a step to terrace site on a stepped Pt (111) surface. The intermode coupling is a key ingredient to describe vibrational heating of the frustrated translation mode responsible for the CO hopping. The calculated results are in good agreement with the experimental results, especially if we scale down the experimentally determined absorbed fluence. It is found that CO hopping is induced by indirect heating of the FT mode by the FR mode with a strong frictional coupling to hot electrons.

  5. Attractor hopping between polarization dynamical states in a vertical-cavity surface-emitting laser subject to parallel optical injection

    NASA Astrophysics Data System (ADS)

    Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc

    2018-03-01

    We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDaniel, Jesse G.; Yethiraj, Arun, E-mail: yethiraj@chem.wisc.edu

    The diffusion of protons in self-assembled systems is potentially important for the design of efficient proton exchange membranes. In this work, we study proton dynamics in a low-water content, lamellar phase of a sodium-carboxylate gemini surfactant/water system using computer simulations. The hopping of protons via the Grotthuss mechanism is explicitly allowed through the multi-state empirical valence bond method. We find that the hydronium ion is trapped on the hydrophobic side of the surfactant-water interface, and proton diffusion then proceeds by hopping between surface sites. The importance of hydrophobic traps is surprising because one would expect the hydronium ions to bemore » trapped at the charged headgroups. The physics illustrated in this system should be relevant to the proton dynamics in other amphiphilic membrane systems, whenever there exist exposed hydrophobic surface regions.« less

  7. Surface hopping with a manifold of electronic states. I. Incorporating surface-leaking to capture lifetimes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ouyang, Wenjun; Dou, Wenjie; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu

    2015-02-28

    We investigate the incorporation of the surface-leaking (SL) algorithm into Tully’s fewest-switches surface hopping (FSSH) algorithm to simulate some electronic relaxation induced by an electronic bath in conjunction with some electronic transitions between discrete states. The resulting SL-FSSH algorithm is benchmarked against exact quantum scattering calculations for three one-dimensional model problems. The results show excellent agreement between SL-FSSH and exact quantum dynamics in the wide band limit, suggesting the potential for a SL-FSSH algorithm. Discrepancies and failures are investigated in detail to understand the factors that will limit the reliability of SL-FSSH, especially the wide band approximation. Considering the easinessmore » of implementation and the low computational cost, we expect this method to be useful in studying processes involving both a continuum of electronic states (where electronic dynamics are probabilistic) and processes involving only a few electronic states (where non-adiabatic processes cannot ignore short-time coherence)« less

  8. Scaffold hopping in drug discovery using inductive logic programming.

    PubMed

    Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

    2008-05-01

    In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

  9. Quantifying exciton hopping in disordered media with quenching sites: Application to arrays of quantum dots

    NASA Astrophysics Data System (ADS)

    Miyazaki, Jun

    2013-10-01

    We present an analytical method for quantifying exciton hopping in an energetically disordered system with quenching sites. The method is subsequently used to provide a quantitative understanding of exciton hopping in a quantum dot (QD) array. Several statistical quantities that characterize the dynamics (survival probability, average number of distinct sites visited, average hopping distance, and average hopping rate in the initial stage) are obtained experimentally by measuring time-resolved fluorescence intensities at various temperatures. The time evolution of these quantities suggests in a quantitative way that at low temperature an exciton tends to be trapped at a local low-energy site, while at room temperature, exciton hopping occurs repeatedly, leading to a large hopping distance. This method will serve to facilitate highly efficient optoelectronic devices using QDs such as photovoltaic cells and light-emitting diodes, since exciton hopping is considered to strongly influence their operational parameters. The presence of a dark QD (quenching site) that exhibits fast decay is also quantified.

  10. Nonadiabatic Molecular Dynamics and Orthogonality Constrained Density Functional Theory

    NASA Astrophysics Data System (ADS)

    Shushkov, Philip Georgiev

    The exact quantum dynamics of realistic, multidimensional systems remains a formidable computational challenge. In many chemical processes, however, quantum effects such as tunneling, zero-point energy quantization, and nonadiabatic transitions play an important role. Therefore, approximate approaches that improve on the classical mechanical framework are of special practical interest. We propose a novel ring polymer surface hopping method for the calculation of chemical rate constants. The method blends two approaches, namely ring polymer molecular dynamics that accounts for tunneling and zero-point energy quantization, and surface hopping that incorporates nonadiabatic transitions. We test the method against exact quantum mechanical calculations for a one-dimensional, two-state model system. The method reproduces quite accurately the tunneling contribution to the rate and the distribution of reactants between the electronic states for this model system. Semiclassical instanton theory, an approach related to ring polymer molecular dynamics, accounts for tunneling by the use of periodic classical trajectories on the inverted potential energy surface. We study a model of electron transfer in solution, a chemical process where nonadiabatic events are prominent. By representing the tunneling electron with a ring polymer, we derive Marcus theory of electron transfer from semiclassical instanton theory after a careful analysis of the tunneling mode. We demonstrate that semiclassical instanton theory can recover the limit of Fermi's Golden Rule rate in a low-temperature, deep-tunneling regime. Mixed quantum-classical dynamics treats a few important degrees of freedom quantum mechanically, while classical mechanics describes affordably the rest of the system. But the interface of quantum and classical description is a challenging theoretical problem, especially for low-energy chemical processes. We therefore focus on the semiclassical limit of the coupled nuclear-electronic dynamics. We show that the time-dependent Schrodinger equation for the electrons employed in the widely used fewest switches surface hopping method is applicable only in the limit of nearly identical classical trajectories on the different potential energy surfaces. We propose a short-time decoupling algorithm that restricts the use of the Schrodinger equation only to the interaction regions. We test the short-time approximation on three model systems against exact quantum-mechanical calculations. The approximation improves the performance of the surface hopping approach. Nonadiabatic molecular dynamics simulations require the efficient and accurate computation of ground and excited state potential energy surfaces. Unlike the ground state calculations where standard methods exist, the computation of excited state properties is a challenging task. We employ time-independent density functional theory, in which the excited state energy is represented as a functional of the total density. We suggest an adiabatic-like approximation that simplifies the excited state exchange-correlation functional. We also derive a set of minimal conditions to impose exactly the orthogonality of the excited state Kohn-Sham determinant to the ground state determinant. This leads to an efficient, variational algorithm for the self-consistent optimization of the excited state energy. Finally, we assess the quality of the excitation energies obtained by the new method on a set of 28 organic molecules. The new approach provides results of similar accuracy to time-dependent density functional theory.

  11. Non-adiabatic molecular dynamics by accelerated semiclassical Monte Carlo

    DOE PAGES

    White, Alexander J.; Gorshkov, Vyacheslav N.; Tretiak, Sergei; ...

    2015-07-07

    Non-adiabatic dynamics, where systems non-radiatively transition between electronic states, plays a crucial role in many photo-physical processes, such as fluorescence, phosphorescence, and photoisomerization. Methods for the simulation of non-adiabatic dynamics are typically either numerically impractical, highly complex, or based on approximations which can result in failure for even simple systems. Recently, the Semiclassical Monte Carlo (SCMC) approach was developed in an attempt to combine the accuracy of rigorous semiclassical methods with the efficiency and simplicity of widely used surface hopping methods. However, while SCMC was found to be more efficient than other semiclassical methods, it is not yet as efficientmore » as is needed to be used for large molecular systems. Here, we have developed two new methods: the accelerated-SCMC and the accelerated-SCMC with re-Gaussianization, which reduce the cost of the SCMC algorithm up to two orders of magnitude for certain systems. In many cases shown here, the new procedures are nearly as efficient as the commonly used surface hopping schemes, with little to no loss of accuracy. This implies that these modified SCMC algorithms will be of practical numerical solutions for simulating non-adiabatic dynamics in realistic molecular systems.« less

  12. Toward rational nanoparticle synthesis: predicting surface intermixing in bimetallic alloy nanocatalysts

    DOE PAGES

    Roling, Luke T.; Mavrikakis, Manos

    2017-09-19

    In this paper, we present a database of first-principles calculated activation energy barriers for two competitive processes involving bimetallic adatom-surface permutations of ten transition metals: (i) adatom “hopping” diffusion and (ii) adatom substitution into the surface. We consider the surface structure sensitivity of these events as well as coverage effects. We find that surface hopping mechanisms are facile and always preferred to substitution events on close-packed fcc(111) and hcp(0001) surfaces. However, surface atom substitution is more facile on the more open fcc(100) surfaces and is competitive with adatom surface hopping, which is more difficult than on the close-packed surfaces. Finally,more » by comparing the absolute and relative magnitudes of the energetics of hopping and substitution, our calculations can offer qualitative predictions of intermixing and other phenomena relevant to nanocrystal growth, such as the tendency to form intermixed alloys or core–shell structures during layer-by-layer nanoparticle synthesis involving a given bimetallic pair, and thereby inform the rational design and synthesis of novel bimetallic nanomaterials.« less

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDaniel, Jesse G.; Yethiraj, Arun

    The diffusion of protons in self-assembled systems is potentially important for the design of efficient proton exchange membranes. In this work, we study proton dynamics in a low-water content, lamellar phase of an sodium-carboxylate gemini surfactant/water system using computer simulations. The hopping of protons via the Grotthuss mechanism is explicity allowed through the multi-state empirical valence bond (MS-EVB) method. We find that the hydronium ion is trapped on the hydrophobic side of the surfactant-water interface, and proton diffusion then proceeds by hopping between surface sites. The importance of hydrophobic traps is surprising, because one would expect the hydronium ions tomore » be trapped at the charged head-groups. Finally, the physics illustrated in this system should be relevant to the proton dynamics in other amphiphilic membrane systems, whenever there exists exposed hydrophobic surface regions.« less

  14. Molecular dynamics simulation of the cooperative adsorption of barley lipid transfer protein and cis-isocohumulone at the vacuum-water interface.

    PubMed

    Euston, S R; Hughes, P; Naser, Md A; Westacott, R E

    2008-11-01

    Molecular dynamic simulations have been carried out on systems containing a mixture of barley lipid transfer protein (LTP) and cis-isocohumulone (a hop derived iso-alpha-acid) in one of its enol forms, in bulk water and at the vacuum-water interface. In solution, the cis-isocohumulone molecules bind to the surface of the LTP molecule. The mechanism of binding appears to be purely hydrophobic in nature via desolvation of the protein surface. Binding of hop acids to the LTP leads to a small change in the 3-D conformation of the protein, but no change in the proportion of secondary structure present in helices, even though there is a significant degree of hop acid binding to the helical regions. At the vacuum-water interface, cis-isocohumulone shows a high surface activity and adsorbs rapidly at the interface. LTP then shows a preference to bind to the preadsorbed hop acid layer at the interface rather than to the bare water-vacuum interface. The free energy of adsorption of LTP at the hop-vacuum-water interface is more favorable than for adsorption at the vacuum-water interface. Our results support the view that hop iso-alpha-acids promote beer foam stability by forming bridges between separate adsorbed protein molecules, thus strengthening the adsorbed protein layer and reducing foam breakdown by lamellar phase drainage. The results also suggest a second mechanism may also occur, whereby the concentration of protein at the interface is increased via enhanced protein adsorption to adsorbed hop acid layers. This too would increase foam stability through its effect on the stabilizing protein layer around the foam bubbles.

  15. Hybrid spread spectrum radio system

    DOEpatents

    Smith, Stephen F.; Dress, William B.

    2010-02-02

    Systems and methods are described for hybrid spread spectrum radio systems. A method includes modulating a signal by utilizing a subset of bits from a pseudo-random code generator to control an amplification circuit that provides a gain to the signal. Another method includes: modulating a signal by utilizing a subset of bits from a pseudo-random code generator to control a fast hopping frequency synthesizer; and fast frequency hopping the signal with the fast hopping frequency synthesizer, wherein multiple frequency hops occur within a single data-bit time.

  16. An On-the-Fly Surface-Hopping Program JADE for Nonadiabatic Molecular Dynamics of Polyatomic Systems: Implementation and Applications.

    PubMed

    Du, Likai; Lan, Zhenggang

    2015-04-14

    Nonadiabatic dynamics simulations have rapidly become an indispensable tool for understanding ultrafast photochemical processes in complex systems. Here, we present our recently developed on-the-fly nonadiabatic dynamics package, JADE, which allows researchers to perform nonadiabatic excited-state dynamics simulations of polyatomic systems at an all-atomic level. The nonadiabatic dynamics is based on Tully's surface-hopping approach. Currently, several electronic structure methods (CIS, TDHF, TDDFT(RPA/TDA), and ADC(2)) are supported, especially TDDFT, aiming at performing nonadiabatic dynamics on medium- to large-sized molecules. The JADE package has been interfaced with several quantum chemistry codes, including Turbomole, Gaussian, and Gamess (US). To consider environmental effects, the Langevin dynamics was introduced as an easy-to-use scheme into the standard surface-hopping dynamics. The JADE package is mainly written in Fortran for greater numerical performance and Python for flexible interface construction, with the intent of providing open-source, easy-to-use, well-modularized, and intuitive software in the field of simulations of photochemical and photophysical processes. To illustrate the possible applications of the JADE package, we present a few applications of excited-state dynamics for various polyatomic systems, such as the methaniminium cation, fullerene (C20), p-dimethylaminobenzonitrile (DMABN) and its primary amino derivative aminobenzonitrile (ABN), and 10-hydroxybenzo[h]quinoline (10-HBQ).

  17. Nuclear magnetic resonance and high-performance liquid chromatography techniques for the characterization of bioactive compounds from Humulus lupulus L. (hop).

    PubMed

    Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica

    2018-06-01

    Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.

  18. Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations

    NASA Astrophysics Data System (ADS)

    Zhang, Wei; Gan, Jie; Li, Qian; Gao, Kun; Sun, Jian; Xu, Ning; Ying, Zhifeng; Wu, Jiada

    2011-06-01

    The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

  19. THE RELATIONSHIP BETWEEN VARIOUS MODES OF SINGLE LEG POSTURAL CONTROL ASSESSMENT

    PubMed Central

    Schmitz, Randy

    2012-01-01

    Purpose/Background: While various techniques have been developed to assess the postural control system, little is known about the relationship between single leg static and functional balance. The purpose of the current study was to determine the relationship between the performance measures of several single leg postural stability tests. Methods: Forty six recreationally active college students (17 males, 29 females, 21±3 yrs, 173±10 cm) performed six single leg tests in a counterbalanced order: 1) Firm Surface-Eyes Open, 2) Firm Surface-Eyes Closed, 3) Multiaxial Surface-Eyes Open, 4) Multiaxial Surface-Eyes Closed, 5) Star Excursion Balance Test (posterior medial reach), 6) Single leg Hop-Stabilization Test. Bivariate correlations were conducted between the six outcome variables. Results: Mild to moderate correlations existed between the static tests. No significant correlations existed involving either of the functional tests. Conclusions: The results indicate that while performance of static balance tasks are mildly to moderately related, they appear to be unrelated to functional reaching or hopping movements, supporting the utilization of a battery of tests to determine overall postural control performance. Level of Evidence: 3b PMID:22666640

  20. Importance of hydrophobic traps for proton diffusion in lyotropic liquid crystals

    DOE PAGES

    McDaniel, Jesse G.; Yethiraj, Arun

    2016-03-04

    The diffusion of protons in self-assembled systems is potentially important for the design of efficient proton exchange membranes. In this work, we study proton dynamics in a low-water content, lamellar phase of an sodium-carboxylate gemini surfactant/water system using computer simulations. The hopping of protons via the Grotthuss mechanism is explicity allowed through the multi-state empirical valence bond (MS-EVB) method. We find that the hydronium ion is trapped on the hydrophobic side of the surfactant-water interface, and proton diffusion then proceeds by hopping between surface sites. The importance of hydrophobic traps is surprising, because one would expect the hydronium ions tomore » be trapped at the charged head-groups. Finally, the physics illustrated in this system should be relevant to the proton dynamics in other amphiphilic membrane systems, whenever there exists exposed hydrophobic surface regions.« less

  1. Surface hopping investigation of the relaxation dynamics in radical cations

    DOE PAGES

    Assmann, Mariana; Weinacht, Thomas; Matsika, Spiridoula

    2016-01-19

    Ionization processes can lead to the formation of radical cations with population in several ionic states. In this study, we examine the dynamics of three radical cations starting from an excited ionic state using trajectory surface hopping dynamics in combination with multiconfigurational electronic structure methods. The efficiency of relaxation to the ground state is examined in an effort to understand better whether fragmentation of cations is likely to occur directly on excited states or after relaxation to the ground state. The results on cyclohexadiene, hexatriene, and uracil indicate that relaxation to the ground ionic state is very fast in thesemore » systems, while fragmentation before relaxation is rare. Ultrafast relaxation is facilitated by the close proximity of electronic states and the presence of two- and three-state conical intersections. Furthermore, examining the properties of the systems in the Franck-Condon region can give some insight into the subsequent dynamics.« less

  2. Sub-nanometer glass surface dynamics induced by illumination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Duc; Nienhaus, Lea; Beckman Institute, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

    2015-06-21

    Illumination is known to induce stress and morphology changes in opaque glasses. Amorphous silicon carbide (a-SiC) has a smaller bandgap than the crystal. Thus, we were able to excite with 532 nm light a 1 μm amorphous surface layer on a SiC crystal while recording time-lapse movies of glass surface dynamics by scanning tunneling microscopy (STM). Photoexcitation of the a-SiC surface layer through the transparent crystal avoids heating the STM tip. Up to 6 × 10{sup 4} s, long movies of surface dynamics with 40 s time resolution and sub-nanometer spatial resolution were obtained. Clusters of ca. 3-5 glass formingmore » units diameter are seen to cooperatively hop between two states at the surface. Photoexcitation with green laser light recruits immobile clusters to hop, rather than increasing the rate at which already mobile clusters hop. No significant laser heating was observed. Thus, we favor an athermal mechanism whereby electronic excitation of a-SiC directly controls glassy surface dynamics. This mechanism is supported by an exciton migration-relaxation-thermal diffusion model. Individual clusters take ∼1 h to populate states differently after the light intensity has changed. We believe the surrounding matrix rearranges slowly when it is stressed by a change in laser intensity, and clusters serve as a diagnostic. Such cluster hopping and matrix rearrangement could underlie the microscopic mechanism of photoinduced aging of opaque glasses.« less

  3. Semiclassical modelling of finite-pulse effects on non-adiabatic photodynamics via initial condition filtering: The predissociation of NaI as a test case

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martínez-Mesa, Aliezer; Institut für Chemie, Universität Potsdam, Karl-Liebknecht-Strasse 24-25, D-14476 Potsdam-Golm; Saalfrank, Peter

    2015-05-21

    Femtosecond-laser pulse driven non-adiabatic spectroscopy and dynamics in molecular and condensed phase systems continue to be a challenge for theoretical modelling. One of the main obstacles is the “curse of dimensionality” encountered in non-adiabatic, exact wavepacket propagation. A possible route towards treating complex molecular systems is via semiclassical surface-hopping schemes, in particular if they account not only for non-adiabatic post-excitation dynamics but also for the initial optical excitation. One such approach, based on initial condition filtering, will be put forward in what follows. As a simple test case which can be compared with exact wavepacket dynamics, we investigate the influencemore » of the different parameters determining the shape of a laser pulse (e.g., its finite width and a possible chirp) on the predissociation dynamics of a NaI molecule, upon photoexcitation of the A(0{sup +}) state. The finite-pulse effects are mapped into the initial conditions for semiclassical surface-hopping simulations. The simulated surface-hopping diabatic populations are in qualitative agreement with the quantum mechanical results, especially concerning the subpicosend photoinduced dynamics, the main deviations being the relative delay of the non-adiabatic transitions in the semiclassical picture. Likewise, these differences in the time-dependent electronic populations calculated via the semiclassical and the quantum methods are found to have a mild influence on the overall probability density distribution. As a result, the branching ratios between the bound and the dissociative reaction channels and the time-evolution of the molecular wavepacket predicted by the semiclassical method agree with those computed using quantum wavepacket propagation. Implications for more challenging molecular systems are given.« less

  4. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk

    2016-08-14

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on themore » adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.« less

  5. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    NASA Astrophysics Data System (ADS)

    Spencer, J.; Gajdos, F.; Blumberger, J.

    2016-08-01

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  6. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    PubMed

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. A Multicomponent UV Analysis of ["alpha"]- and ["beta"]-Acids in Hops

    ERIC Educational Resources Information Center

    Egts, Haley; Durben, Dan J.; Dixson, John A.; Zehfus, Micheal H.

    2012-01-01

    A method is presented for the determination of ["alpha"]- and ["beta"]-acids (humulones and lupulones) in a hops sample using a multicomponent UV spectroscopic analysis of a methanolic hop extract. When compared with standard methods, this lab can be considered "greener" because it uses smaller volumes of safer solvents (methanol instead of…

  8. Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

    PubMed

    Hartmann, Richard; Strunz, Walter T

    2017-12-12

    We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

  9. Varietal discrimination of hop pellets by near and mid infrared spectroscopy.

    PubMed

    Machado, Julio C; Faria, Miguel A; Ferreira, Isabel M P L V O; Páscoa, Ricardo N M J; Lopes, João A

    2018-04-01

    Hop is one of the most important ingredients of beer production and several varieties are commercialized. Therefore, it is important to find an eco-real-time-friendly-low-cost technique to distinguish and discriminate hop varieties. This paper describes the development of a method based on vibrational spectroscopy techniques, namely near- and mid-infrared spectroscopy, for the discrimination of 33 commercial hop varieties. A total of 165 samples (five for each hop variety) were analysed by both techniques. Principal component analysis, hierarchical cluster analysis and partial least squares discrimination analysis were the chemometric tools used to discriminate positively the hop varieties. After optimizing the spectral regions and pre-processing methods a total of 94.2% and 96.6% correct hop varieties discrimination were obtained for near- and mid-infrared spectroscopy, respectively. The results obtained demonstrate the suitability of these vibrational spectroscopy techniques to discriminate different hop varieties and consequently their potential to be used as an authenticity tool. Compared with the reference procedures normally used for hops variety discrimination these techniques are quicker, cost-effective, non-destructive and eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Low-coverage surface diffusion in complex periodic energy landscapes: Analytical solution for systems with symmetric hops and application to intercalation in topological insulators

    NASA Astrophysics Data System (ADS)

    Gosálvez, Miguel A.; Otrokov, Mikhail M.; Ferrando, Nestor; Ryabishchenkova, Anastasia G.; Ayuela, Andres; Echenique, Pedro M.; Chulkov, Evgueni V.

    2016-02-01

    This is the first of two papers that introduce a general expression for the tracer diffusivity in complex, periodic energy landscapes with M distinct hop rates in one-, two-, and three-dimensional diluted systems (low-coverage, single-tracer limit). The present report focuses on the analysis of diffusion in systems where the end sites of the hops are located symmetrically with respect to the hop origins (symmetric hops), as encountered in many ideal surfaces and bulk materials. For diffusion in two dimensions, a number of formulas are presented for complex combinations of the different hops in systems with triangular, rectangular, and square symmetry. The formulas provide values in excellent agreement with kinetic Monte Carlo simulations, concluding that the diffusion coefficient can be directly determined from the proposed expressions without performing the simulations. Based on the diffusion barriers obtained from first-principles calculations and a physically meaningful estimate of the attempt frequencies, the proposed formulas are used to analyze the diffusion of Cu, Ag, and Rb adatoms on the surface and within the van der Waals (vdW) gap of a model topological insulator, Bi2Se3 . Considering the possibility of adsorbate intercalation from the terraces to the vdW gaps at morphological steps, we infer that, at low coverage and room temperature, (i) a majority of the Rb atoms bounce back at the steps and remain on the terraces, (ii) Cu atoms mostly intercalate into the vdW gap, the remaining fraction staying at the steps, and (iii) Ag atoms essentially accumulate at the steps and gradually intercalate into the vdW gap. These conclusions are in good qualitative agreement with previous experiments. The companion report (M. A. Gosálvez et al., Phys. Rev. B, submitted] extends the present study to the description of systems that contain asymmetric hops.

  11. Beer spoilage bacteria and hop resistance.

    PubMed

    Sakamoto, Kanta; Konings, Wil N

    2003-12-31

    For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However, some potential hop-resistant strains cannot grow in beer unless they have first been exposed to subinhibitory concentration of hop compounds. The beer spoilage ability of Pectinatus spp. and M. cerevisiae has been poorly studied. Since all the strains have been reported to be capable of beer spoiling, species identification is sufficient for the breweries. However, with the current trend of beer flavor (lower alcohol and bitterness), there is the potential risk that not yet reported bacteria will contribute to beer spoilage. Investigation of the beer spoilage ability of especially Gram-negative bacteria may be useful to reduce this risk.

  12. The lunar hopping transporter

    NASA Technical Reports Server (NTRS)

    Degner, R.; Kaplan, M. H.; Manning, J.; Meetin, R.; Pasternack, S.; Peterson, S.; Seifert, H.

    1971-01-01

    Research on several aspects of lunar transport using the hopping mode is reported. Hopping exploits the weak lunar gravity, permits fuel economy because of partial recompression of propellant gas on landing, and does not require a continuous smooth surface for operation. Three questions critical to the design of a lunar hopping vehicle are addressed directly in this report: (1) the tolerance of a human pilot for repeated accelerations; (2) means for controlling vehicle attitude during ballistic flight; and (3) means of propulsion. In addition, a small scale terrestrial demonstrator built to confirm feasibility of the proposed operational mode is described, along with results of preliminary study of unmanned hoppers for moon exploration.

  13. Surface-hopping dynamics and decoherence with quantum equilibrium structure.

    PubMed

    Grunwald, Robbie; Kim, Hyojoon; Kapral, Raymond

    2008-04-28

    In open quantum systems, decoherence occurs through interaction of a quantum subsystem with its environment. The computation of expectation values requires a knowledge of the quantum dynamics of operators and sampling from initial states of the density matrix describing the subsystem and bath. We consider situations where the quantum evolution can be approximated by quantum-classical Liouville dynamics and examine the circumstances under which the evolution can be reduced to surface-hopping dynamics, where the evolution consists of trajectory segments exclusively evolving on single adiabatic surfaces, with probabilistic hops between these surfaces. The justification for the reduction depends on the validity of a Markovian approximation on a bath averaged memory kernel that accounts for quantum coherence in the system. We show that such a reduction is often possible when initial sampling is from either the quantum or classical bath initial distributions. If the average is taken only over the quantum dispersion that broadens the classical distribution, then such a reduction is not always possible.

  14. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dou, Wenjie; Subotnik, Joseph E.; Nitzan, Abraham

    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case ofmore » out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.« less

  15. Nanoscale live cell imaging using hopping probe ion conductance microscopy

    PubMed Central

    Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.

    2009-01-01

    We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505

  16. Signaling induced by hop/STI-1 depends on endocytosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

    The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP{sup C}), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP{sup C} and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling inducedmore » by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP{sup C} by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases.« less

  17. The frequency hopping pattern design for random hopping frequency signal based on stationary phase principle

    NASA Astrophysics Data System (ADS)

    Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun

    2018-04-01

    For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.

  18. Plasmodium falciparum Hop (PfHop) Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

    PubMed

    Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore

    2015-01-01

    Heat shock proteins (Hsps) play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70) is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90) facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop). We previously characterised the Hop protein from Plasmodium falciparum (PfHop). We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR) analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we observed that recombinant PfHop occasionally eluted as a protein species of twice its predicted size, suggesting that it may occur as a dimer. We conducted SPR analysis which suggested that PfHop is capable of self-association in presence or absence of ATP/ADP. Overall, our findings suggest that PfHop is a stress-inducible protein that directly associates with PfHsp70-1 and PfHsp90. In addition, the protein is capable of self-association. The findings suggest that PfHop serves as a module that brings these two prominent chaperones (PfHsp70-1 and PfHsp90) into a functional complex. Since PfHsp70-1 and PfHsp90 are essential for parasite growth, findings from this study are important towards the development of possible antimalarial inhibitors targeting the cooperation of these two chaperones.

  19. Kinetic barriers for Cd and Te adatoms on Cd and Te terminated CdTe (111) surface using ab initio simulations

    NASA Astrophysics Data System (ADS)

    Naderi, Ebadollah; Nanavati, Sachin P.; Majumder, Chiranjib; Ghaisas, S. V.

    2014-03-01

    In the present work we have calculated using density functional theory (DFT), diffusion barrier potentials on both the CdTe (111) surfaces, Cd terminated (A-type) & Te terminated (B-type). We employ nudge elastic band method (NEB) for obtaining the barrier potentials. The barrier is computed for Cd and for Te adatoms on both A-type and B-type surfaces. We report two energetically favourable positions along the normal to the surface, one above and other below the surface. The one above the surface has binding energy slightly more the one below. According to the results of this work, binding energy (in all cases) for adatoms are reasonable and close to experimental data. The barrier potential for hopping adatoms (Cd and Te) on both the surfaces is less than 0.35 eV. Apart from these most probable sites, there are other at least two sites on both the types of surfaces which are meta stable. We have also computed barriers for hopping to and from these meta stable positions. The present results can shade light on the defect formation mechanism in CdTe thin films during growth. The authors would like to thank C-DAC for the computing time on its PARAM series of supercomputers and DST Govt. of India, for partial funding.

  20. Path-integral isomorphic Hamiltonian for including nuclear quantum effects in non-adiabatic dynamics

    NASA Astrophysics Data System (ADS)

    Tao, Xuecheng; Shushkov, Philip; Miller, Thomas F.

    2018-03-01

    We describe a path-integral approach for including nuclear quantum effects in non-adiabatic chemical dynamics simulations. For a general physical system with multiple electronic energy levels, a corresponding isomorphic Hamiltonian is introduced such that Boltzmann sampling of the isomorphic Hamiltonian with classical nuclear degrees of freedom yields the exact quantum Boltzmann distribution for the original physical system. In the limit of a single electronic energy level, the isomorphic Hamiltonian reduces to the familiar cases of either ring polymer molecular dynamics (RPMD) or centroid molecular dynamics Hamiltonians, depending on the implementation. An advantage of the isomorphic Hamiltonian is that it can easily be combined with existing mixed quantum-classical dynamics methods, such as surface hopping or Ehrenfest dynamics, to enable the simulation of electronically non-adiabatic processes with nuclear quantum effects. We present numerical applications of the isomorphic Hamiltonian to model two- and three-level systems, with encouraging results that include improvement upon a previously reported combination of RPMD with surface hopping in the deep-tunneling regime.

  1. Metastability in plyometric training on unstable surfaces: a pilot study

    PubMed Central

    2014-01-01

    Background In the past, plyometric training (PT) has been predominantly performed on stable surfaces. The purpose of this pilot study was to examine effects of a 7-week lower body PT on stable vs. unstable surfaces. This type of exercise condition may be denoted as metastable equilibrium. Methods Thirty-three physically active male sport science students (age: 24.1 ± 3.8 years) were randomly assigned to a PT group (n = 13) exercising on stable (STAB) and a PT group (n = 20) on unstable surfaces (INST). Both groups trained countermovement jumps, drop jumps, and practiced a hurdle jump course. In addition, high bar squats were performed. Physical fitness tests on stable surfaces (hexagonal obstacle test, countermovement jump, hurdle drop jump, left-right hop, dynamic and static balance tests, and leg extension strength) were used to examine the training effects. Results Significant main effects of time (ANOVA) were found for the countermovement jump, hurdle drop jump, hexagonal test, dynamic balance, and leg extension strength. A significant interaction of time and training mode was detected for the countermovement jump in favor of the INST group. No significant improvements were evident for either group in the left-right hop and in the static balance test. Conclusions These results show that lower body PT on unstable surfaces is a safe and efficient way to improve physical performance on stable surfaces. PMID:25089202

  2. High-throughput genotyping of hop (Humulus lupulus L.) utilising diversity arrays technology (DArT).

    PubMed

    Howard, E L; Whittock, S P; Jakše, J; Carling, J; Matthews, P D; Probasco, G; Henning, J A; Darby, P; Cerenak, A; Javornik, B; Kilian, A; Koutoulis, A

    2011-05-01

    Implementation of molecular methods in hop (Humulus lupulus L.) breeding is dependent on the availability of sizeable numbers of polymorphic markers and a comprehensive understanding of genetic variation. However, use of molecular marker technology is limited due to expense, time inefficiency, laborious methodology and dependence on DNA sequence information. Diversity arrays technology (DArT) is a high-throughput cost-effective method for the discovery of large numbers of quality polymorphic markers without reliance on DNA sequence information. This study is the first to utilise DArT for hop genotyping, identifying 730 polymorphic markers from 92 hop accessions. The marker quality was high and similar to the quality of DArT markers previously generated for other species; although percentage polymorphism and polymorphism information content (PIC) were lower than in previous studies deploying other marker systems in hop. Genetic relationships in hop illustrated by DArT in this study coincide with knowledge generated using alternate methods. Several statistical analyses separated the hop accessions into genetically differentiated North American and European groupings, with hybrids between the two groups clearly distinguishable. Levels of genetic diversity were similar in the North American and European groups, but higher in the hybrid group. The markers produced from this time and cost-efficient genotyping tool will be a valuable resource for numerous applications in hop breeding and genetics studies, such as mapping, marker-assisted selection, genetic identity testing, guidance in the maintenance of genetic diversity and the directed breeding of superior cultivars.

  3. A Comparison of Vertical Stiffness Values Calculated from Different Measures of Center of Mass Displacement in Single-Leg Hopping.

    PubMed

    Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J

    2017-02-01

    This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.

  4. Electronically nonadiabatic wave packet propagation using frozen Gaussian scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kondorskiy, Alexey D., E-mail: kondor@sci.lebedev.ru; Nanbu, Shinkoh, E-mail: shinkoh.nanbu@sophia.ac.jp

    2015-09-21

    We present an approach, which allows to employ the adiabatic wave packet propagation technique and semiclassical theory to treat the nonadiabatic processes by using trajectory hopping. The approach developed generates a bunch of hopping trajectories and gives all additional information to incorporate the effect of nonadiabatic coupling into the wave packet dynamics. This provides an interface between a general adiabatic frozen Gaussian wave packet propagation method and the trajectory surface hopping technique. The basic idea suggested in [A. D. Kondorskiy and H. Nakamura, J. Chem. Phys. 120, 8937 (2004)] is revisited and complemented in the present work by the elaborationmore » of efficient numerical algorithms. We combine our approach with the adiabatic Herman-Kluk frozen Gaussian approximation. The efficiency and accuracy of the resulting method is demonstrated by applying it to popular benchmark model systems including three Tully’s models and 24D model of pyrazine. It is shown that photoabsorption spectrum is successfully reproduced by using a few hundreds of trajectories. We employ the compact finite difference Hessian update scheme to consider feasibility of the ab initio “on-the-fly” simulations. It is found that this technique allows us to obtain the reliable final results using several Hessian matrix calculations per trajectory.« less

  5. Monte Carlo sampling of Wigner functions and surface hopping quantum dynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kube, Susanna; Lasser, Caroline; Weber, Marcus

    2009-04-01

    The article addresses the achievable accuracy for a Monte Carlo sampling of Wigner functions in combination with a surface hopping algorithm for non-adiabatic quantum dynamics. The approximation of Wigner functions is realized by an adaption of the Metropolis algorithm for real-valued functions with disconnected support. The integration, which is necessary for computing values of the Wigner function, uses importance sampling with a Gaussian weight function. The numerical experiments agree with theoretical considerations and show an error of 2-3%.

  6. Communication devices for network-hopping communications and methods of network-hopping communications

    DOEpatents

    Buttles, John W [Idaho Falls, ID

    2011-12-20

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The processing circuitry is configured to execute computer programming code. Storage media is coupled to the processing circuitry and includes computer programming code configured to cause the processing circuitry to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  7. Communication devices for network-hopping communications and methods of network-hopping communications

    DOEpatents

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  8. Coupled wave-packets for non-adiabatic molecular dynamics: a generalization of Gaussian wave-packet dynamics to multiple potential energy surfaces

    DOE PAGES

    White, Alexander James; Tretiak, Sergei; Mozyrsky, Dima V.

    2016-04-25

    Accurate simulation of the non-adiabatic dynamics of molecules in excited electronic states is key to understanding molecular photo-physical processes. Here we present a novel method, based on a semiclassical approximation, that is as efficient as the commonly used mean field Ehrenfest or ad hoc surface hopping methods and properly accounts for interference and decoherence effects. This novel method is an extension of Heller's thawed Gaussian wave-packet dynamics that includes coupling between potential energy surfaces. By studying several standard test problems we demonstrate that the accuracy of the method can be systematically improved while maintaining high efficiency. The method is suitablemore » for investigating the role of quantum coherence in the non-adiabatic dynamics of many-atom molecules.« less

  9. Non-adiabatic molecular dynamics with complex quantum trajectories. I. The diabatic representation.

    PubMed

    Zamstein, Noa; Tannor, David J

    2012-12-14

    We extend a recently developed quantum trajectory method [Y. Goldfarb, I. Degani, and D. J. Tannor, J. Chem. Phys. 125, 231103 (2006)] to treat non-adiabatic transitions. Each trajectory evolves on a single surface according to Newton's laws with complex positions and momenta. The transfer of amplitude between surfaces stems naturally from the equations of motion, without the need for surface hopping. In this paper we derive the equations of motion and show results in the diabatic representation, which is rarely used in trajectory methods for calculating non-adiabatic dynamics. We apply our method to the first two benchmark models introduced by Tully [J. Chem. Phys. 93, 1061 (1990)]. Besides giving the probability branching ratios between the surfaces, the method also allows the reconstruction of the time-dependent wavepacket. Our results are in quantitative agreement with converged quantum mechanical calculations.

  10. Classification of Scaffold Hopping Approaches

    PubMed Central

    Sun, Hongmao; Tawa, Gregory; Wallqvist, Anders

    2012-01-01

    The general goal of drug discovery is to identify novel compounds that are active against a preselected biological target with acceptable pharmacological properties defined by marketed drugs. Scaffold hopping has been widely applied by medicinal chemists to discover equipotent compounds with novel backbones that have improved properties. In this review, scaffold hopping is classified into four major categories, namely heterocycle replacements, ring opening or closure, peptidomimetics, and topology-based hopping. The structural diversity of original and final scaffolds with respect to each category will be reviewed. The advantages and limitations of small, medium, and large-step scaffold hopping will also be discussed. Software that is frequently used to facilitate different kinds of scaffold hopping methods will be summarized. PMID:22056715

  11. Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea

    PubMed Central

    Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun

    2016-01-01

    Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293

  12. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    PubMed Central

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  13. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kowalewski, Markus, E-mail: mkowalew@uci.edu; Mukamel, Shaul, E-mail: smukamel@uci.edu

    2015-07-28

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings.

  14. Flexible scheme to truncate the hierarchy of pure states.

    PubMed

    Zhang, P-P; Bentley, C D B; Eisfeld, A

    2018-04-07

    The hierarchy of pure states (HOPS) is a wavefunction-based method that can be used for numerically modeling open quantum systems. Formally, HOPS recovers the exact system dynamics for an infinite depth of the hierarchy. However, truncation of the hierarchy is required to numerically implement HOPS. We want to choose a "good" truncation method, where by "good" we mean that it is numerically feasible to check convergence of the results. For the truncation approximation used in previous applications of HOPS, convergence checks are numerically challenging. In this work, we demonstrate the application of the "n-particle approximation" to HOPS. We also introduce a new approximation, which we call the "n-mode approximation." We then explore the convergence of these truncation approximations with respect to the number of equations required in the hierarchy in two exemplary problems: absorption and energy transfer of molecular aggregates.

  15. Flexible scheme to truncate the hierarchy of pure states

    NASA Astrophysics Data System (ADS)

    Zhang, P.-P.; Bentley, C. D. B.; Eisfeld, A.

    2018-04-01

    The hierarchy of pure states (HOPS) is a wavefunction-based method that can be used for numerically modeling open quantum systems. Formally, HOPS recovers the exact system dynamics for an infinite depth of the hierarchy. However, truncation of the hierarchy is required to numerically implement HOPS. We want to choose a "good" truncation method, where by "good" we mean that it is numerically feasible to check convergence of the results. For the truncation approximation used in previous applications of HOPS, convergence checks are numerically challenging. In this work, we demonstrate the application of the "n-particle approximation" to HOPS. We also introduce a new approximation, which we call the "n-mode approximation." We then explore the convergence of these truncation approximations with respect to the number of equations required in the hierarchy in two exemplary problems: absorption and energy transfer of molecular aggregates.

  16. Mixed quantum/classical investigation of the photodissociation of NH3(Ã) and a practical method for maintaining zero-point energy in classical trajectories

    NASA Astrophysics Data System (ADS)

    Bonhommeau, David; Truhlar, Donald G.

    2008-07-01

    The photodissociation dynamics of ammonia upon excitation of the out-of-plane bending mode (mode ν2 with n2=0,…,6 quanta of vibration) in the à electronic state is investigated by means of several mixed quantum/classical methods, and the calculated final-state properties are compared to experiments. Five mixed quantum/classical methods are tested: one mean-field approach (the coherent switching with decay of mixing method), two surface-hopping methods [the fewest switches with time uncertainty (FSTU) and FSTU with stochastic decay (FSTU/SD) methods], and two surface-hopping methods with zero-point energy (ZPE) maintenance [the FSTU /SD+trajectory projection onto ZPE orbit (TRAPZ) and FSTU /SD+minimal TRAPZ (mTRAPZ) methods]. We found a qualitative difference between final NH2 internal energy distributions obtained for n2=0 and n2>1, as observed in experiments. Distributions obtained for n2=1 present an intermediate behavior between distributions obtained for smaller and larger n2 values. The dynamics is found to be highly electronically nonadiabatic with all these methods. NH2 internal energy distributions may have a negative energy tail when the ZPE is not maintained throughout the dynamics. The original TRAPZ method was designed to maintain ZPE in classical trajectories, but we find that it leads to unphysically high internal vibrational energies. The mTRAPZ method, which is new in this work and provides a general method for maintaining ZPE in either single-surface or multisurface trajectories, does not lead to unphysical results and is much less time consuming. The effect of maintaining ZPE in mixed quantum/classical dynamics is discussed in terms of agreement with experimental findings. The dynamics for n2=0 and n2=6 are also analyzed to reveal details not available from experiment, in particular, the time required for quenching of electronic excitation and the adiabatic energy gap and geometry at the time of quenching.

  17. Mixed quantum/classical investigation of the photodissociation of NH3(A) and a practical method for maintaining zero-point energy in classical trajectories.

    PubMed

    Bonhommeau, David; Truhlar, Donald G

    2008-07-07

    The photodissociation dynamics of ammonia upon excitation of the out-of-plane bending mode (mode nu(2) with n(2)=0,[ellipsis (horizontal)],6 quanta of vibration) in the A electronic state is investigated by means of several mixed quantum/classical methods, and the calculated final-state properties are compared to experiments. Five mixed quantum/classical methods are tested: one mean-field approach (the coherent switching with decay of mixing method), two surface-hopping methods [the fewest switches with time uncertainty (FSTU) and FSTU with stochastic decay (FSTU/SD) methods], and two surface-hopping methods with zero-point energy (ZPE) maintenance [the FSTUSD+trajectory projection onto ZPE orbit (TRAPZ) and FSTUSD+minimal TRAPZ (mTRAPZ) methods]. We found a qualitative difference between final NH(2) internal energy distributions obtained for n(2)=0 and n(2)>1, as observed in experiments. Distributions obtained for n(2)=1 present an intermediate behavior between distributions obtained for smaller and larger n(2) values. The dynamics is found to be highly electronically nonadiabatic with all these methods. NH(2) internal energy distributions may have a negative energy tail when the ZPE is not maintained throughout the dynamics. The original TRAPZ method was designed to maintain ZPE in classical trajectories, but we find that it leads to unphysically high internal vibrational energies. The mTRAPZ method, which is new in this work and provides a general method for maintaining ZPE in either single-surface or multisurface trajectories, does not lead to unphysical results and is much less time consuming. The effect of maintaining ZPE in mixed quantum/classical dynamics is discussed in terms of agreement with experimental findings. The dynamics for n(2)=0 and n(2)=6 are also analyzed to reveal details not available from experiment, in particular, the time required for quenching of electronic excitation and the adiabatic energy gap and geometry at the time of quenching.

  18. Dispersive Sachdev-Ye-Kitaev model: Band structure and quantum chaos

    NASA Astrophysics Data System (ADS)

    Zhang, Pengfei

    2017-11-01

    The Sachdev-Ye-Kitaev (SYK) model is a concrete model for a non-Fermi liquid with maximally chaotic behavior in (0 +1 ) dimensions. In order to gain some insights into real materials in higher dimensions where fermions could hop between different sites, here we consider coupling a SYK lattice by constant hopping. We call this the dispersive SYK model. Focusing on (1 +1 ) -dimensional homogeneous hopping, by either tuning the temperature or the relative strength of the random interaction (hopping) and constant hopping, we find a crossover between a dispersive metal to an incoherent metal, where the dynamic exponent z changes from 1 to ∞ . We study the crossover by calculating the spectral function, charge density correlator, and the Lyapunov exponent. We further find the Lyapunov exponent becomes larger when the chemical potential is tuned to approach a van Hove singularity because of the large density of states near the Fermi surface. The effect of the topological nontrivial bands is also discussed.

  19. Chemical desorption and diffusive dust chemistry

    NASA Astrophysics Data System (ADS)

    Dulieu, Francois; Pirronello, Valerio; Minissale, Marco; Congiu, Emanuele; Baouche, Saoud; Chaabouni, Henda; Moudens, Audrey; Accolla, Mario; Cazaux, Stephanie; Manicò, Giulio

    In molecular clouds, gaseous species can accrete efficiently on the cold surfaces of dust grains. As for radical-radical reactions, the surface of the grains acts as a third body, and changes dramatically the efficiency of the reactions (i.e., H2 formation), or lowers considerably the barrier to formation (i.e., H2O synthesis) in comparison with gas phase reaction processes. These properties make dust grains efficient catalytic templates. However, the chemical role of dust grains depends on the diffusive properties of the reactive partners. Over the last years, we have developed experimental tools and methods to explore the chemistry occurring on cold (6-50K) surfaces. We have obtained some hints about the diffusivity of H on amorphous ice, and studied in detail the diffusion of O atoms. The latter species appears to have a hopping rate in the range 0.01-100 hops/sec. The diffusion rate of O atoms is dependent on the surface morphology and on the surface temperature. The diffusion law is compatible with a diffusion dominated by quantum tunnelling rather than classical thermal hopping. Using H, O, N atoms and, indirectly, OH and HCO radicals, we have begun to explore many chemical reactive networks. In this presentation, I will focus on the formation of H2O and CO2, and will propose many possible formation routes to obtain these chemical traps. The molecules formed on surfaces have a certain probability of desorbing upon their formation. This non-thermal desorption mechanism, or chemical desorption, has been proposed to explain why some molecules can be detected in the gas phase of those region where they were believed to be part of the icy mantles covering dust grains. We have shown that this process can be very efficient, but is very sensitive to the substrate and the surroundings of the reaction site, is dependent on the kind of molecule formed and its chemical pathway. In my presentation I will present how the surface coverage and the type of reaction can play a major role in the chemical desorption process. I will discuss of possible key parameters that rule this process.

  20. Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

    ERIC Educational Resources Information Center

    Putnam, Michael

    2006-01-01

    This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

  1. Comparison of stochastic optimization methods for all-atom folding of the Trp-Cage protein.

    PubMed

    Schug, Alexander; Herges, Thomas; Verma, Abhinav; Lee, Kyu Hwan; Wenzel, Wolfgang

    2005-12-09

    The performances of three different stochastic optimization methods for all-atom protein structure prediction are investigated and compared. We use the recently developed all-atom free-energy force field (PFF01), which was demonstrated to correctly predict the native conformation of several proteins as the global optimum of the free energy surface. The trp-cage protein (PDB-code 1L2Y) is folded with the stochastic tunneling method, a modified parallel tempering method, and the basin-hopping technique. All the methods correctly identify the native conformation, and their relative efficiency is discussed.

  2. Generalization of fewest-switches surface hopping for coherences

    NASA Astrophysics Data System (ADS)

    Tempelaar, Roel; Reichman, David R.

    2018-03-01

    Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

  3. Rapid sampling of local minima in protein energy surface and effective reduction through a multi-objective filter

    PubMed Central

    2013-01-01

    Background Many problems in protein modeling require obtaining a discrete representation of the protein conformational space as an ensemble of conformations. In ab-initio structure prediction, in particular, where the goal is to predict the native structure of a protein chain given its amino-acid sequence, the ensemble needs to satisfy energetic constraints. Given the thermodynamic hypothesis, an effective ensemble contains low-energy conformations which are similar to the native structure. The high-dimensionality of the conformational space and the ruggedness of the underlying energy surface currently make it very difficult to obtain such an ensemble. Recent studies have proposed that Basin Hopping is a promising probabilistic search framework to obtain a discrete representation of the protein energy surface in terms of local minima. Basin Hopping performs a series of structural perturbations followed by energy minimizations with the goal of hopping between nearby energy minima. This approach has been shown to be effective in obtaining conformations near the native structure for small systems. Recent work by us has extended this framework to larger systems through employment of the molecular fragment replacement technique, resulting in rapid sampling of large ensembles. Methods This paper investigates the algorithmic components in Basin Hopping to both understand and control their effect on the sampling of near-native minima. Realizing that such an ensemble is reduced before further refinement in full ab-initio protocols, we take an additional step and analyze the quality of the ensemble retained by ensemble reduction techniques. We propose a novel multi-objective technique based on the Pareto front to filter the ensemble of sampled local minima. Results and conclusions We show that controlling the magnitude of the perturbation allows directly controlling the distance between consecutively-sampled local minima and, in turn, steering the exploration towards conformations near the native structure. For the minimization step, we show that the addition of Metropolis Monte Carlo-based minimization is no more effective than a simple greedy search. Finally, we show that the size of the ensemble of sampled local minima can be effectively and efficiently reduced by a multi-objective filter to obtain a simpler representation of the probed energy surface. PMID:24564970

  4. Hopping and trapping mechanisms in organic field-effect transistors

    NASA Astrophysics Data System (ADS)

    Konezny, S. J.; Bussac, M. N.; Zuppiroli, L.

    2010-01-01

    A charge carrier in the channel of an organic field-effect transistor (OFET) is coupled to the electric polarization of the gate in the form of a surface Fröhlich polaron [N. Kirova and M. N. Bussac, Phys. Rev. B 68, 235312 (2003)]. We study the effects of the dynamical field of polarization on both small-polaron hopping and trap-limited transport mechanisms. We present numerical calculations of polarization energies, band-narrowing effects due to polarization, hopping barriers, and interface trap depths in pentacene and rubrene transistors as functions of the dielectric constant of the gate insulator and demonstrate that a trap-and-release mechanism more appropriately describes transport in high-mobility OFETs. For mobilities on the order 0.1cm2/Vs and below, all states are highly localized and hopping becomes the predominant mechanism.

  5. Analytical methods for quantitation of prenylated flavonoids from hops.

    PubMed

    Nikolić, Dejan; van Breemen, Richard B

    2013-01-01

    The female flowers of hops ( Humulus lupulus L.) are used as a flavoring agent in the brewing industry. There is growing interest in possible health benefits of hops, particularly as estrogenic and chemopreventive agents. Among the possible active constituents, most of the attention has focused on prenylated flavonoids, which can chemically be classified as prenylated chalcones and prenylated flavanones. Among chalcones, xanthohumol (XN) and desmethylxanthohumol (DMX) have been the most studied, while among flavanones, 8-prenylnaringenin (8-PN) and 6-prenylnaringenin (6-PN) have received the most attention. Because of the interest in medicinal properties of prenylated flavonoids, there is demand for accurate, reproducible and sensitive analytical methods to quantify these compounds in various matrices. Such methods are needed, for example, for quality control and standardization of hop extracts, measurement of the content of prenylated flavonoids in beer, and to determine pharmacokinetic properties of prenylated flavonoids in animals and humans. This review summarizes currently available analytical methods for quantitative analysis of the major prenylated flavonoids, with an emphasis on the LC-MS and LC-MS-MS methods and their recent applications to biomedical research on hops. This review covers all methods in which prenylated flavonoids have been measured, either as the primary analytes or as a part of a larger group of analytes. The review also discusses methodological issues relating to the quantitative analysis of these compounds regardless of the chosen analytical approach.

  6. Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program

    PubMed Central

    Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

    2016-01-01

    Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968

  7. Design of Compressed Sensing Algorithm for Coal Mine IoT Moving Measurement Data Based on a Multi-Hop Network and Total Variation.

    PubMed

    Wang, Gang; Zhao, Zhikai; Ning, Yongjie

    2018-05-28

    As the application of a coal mine Internet of Things (IoT), mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH) is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.

  8. Quantitation of 4-Methyl-4-sulfanylpentan-2-one (4MSP) in Hops by a Stable Isotope Dilution Assay in Combination with GC×GC-TOFMS: Method Development and Application To Study the Influence of Variety, Provenance, Harvest Year, and Processing on 4MSP Concentrations.

    PubMed

    Reglitz, Klaas; Steinhaus, Martin

    2017-03-22

    A stable isotope dilution assay was developed for quantitation of 4-methyl-4-sulfanylpentan-2-one (4MSP) in hops. The approach included the use of 4-( 13 C)methyl-4-sulfanyl(1,3,5- 13 C 3 )pentan-2-one as internal standard, selective isolation of hop thiols by mercurated agarose, and GC×GC-TOFMS analysis. Application of the method to 53 different hop samples revealed 4MSP concentrations between <1 and 114 μg/kg. Notably high concentrations were associated with United States varieties such as Citra, Eureka, Simcoe, and Apollo, whereas 4MSP was absent from traditional German and English varieties. Further experiments showed that besides the variety, also harvest year and storage vitally influenced 4MSP concentrations, whereas the impact of provenance was less pronounced. Hop processing such as drying and pelletizing had only a minor impact on 4MSP concentrations. Like the majority of other hop volatiles, 4MSP is predominantly located in the lupulin glands.

  9. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    NASA Astrophysics Data System (ADS)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  10. Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems

    NASA Astrophysics Data System (ADS)

    Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen

    2002-09-01

    Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.

  11. Steerable Hopping Six-Legged Robot

    NASA Technical Reports Server (NTRS)

    Younse, Paulo; Aghazarian, Hrand

    2010-01-01

    The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that indicates the amount by which the spool has been turned. When the robot is ready to hop, the electromagnetic clutch disengages the motor from the spool, thus releasing the cable restraints on the springs and allowing the springs to extend all six legs simultaneously.

  12. Composition-dependent metallic glass alloys correlate atomic mobility with collective glass surface dynamics.

    PubMed

    Nguyen, Duc; Zhu, Zhi-Guang; Pringle, Brian; Lyding, Joseph; Wang, Wei-Hua; Gruebele, Martin

    2016-06-22

    Glassy metallic alloys are richly tunable model systems for surface glassy dynamics. Here we study the correlation between atomic mobility, and the hopping rate of surface regions (clusters) that rearrange collectively on a minute to hour time scale. Increasing the proportion of low-mobility copper atoms in La-Ni-Al-Cu alloys reduces the cluster hopping rate, thus establishing a microscopic connection between atomic mobility and dynamics of collective rearrangements at a glass surface made from freshly exposed bulk glass. One composition, La60Ni15Al15Cu10, has a surface resistant to re-crystallization after three heating cycles. When thermally cycled, surface clusters grow in size from about 5 glass-forming units to about 8 glass-forming units, evidence of surface aging without crystal formation, although its bulk clearly forms larger crystalline domains. Such kinetically stable glass surfaces may be of use in applications where glassy coatings stable against heating are needed.

  13. High-throughput genotyping of hop (Humulus lupulus L.) utilising diversity arrays technology (DArT)

    USDA-ARS?s Scientific Manuscript database

    Implementation of molecular methods in hop breeding is dependent on the availability of sizeable numbers of polymorphic markers and a comprehensive understanding of genetic variation. Diversity Arrays Technology (DArT) is a high-throughput cost-effective method for the discovery of large numbers of...

  14. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-α-Acids▿ † ¶

    PubMed Central

    Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc

    2010-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041

  15. Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network

    NASA Astrophysics Data System (ADS)

    Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji

    In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.

  16. Dynamically Stable Legged Locomotion.

    DTIC Science & Technology

    1983-01-27

    sweeps the leg during stance, and the third places the foot during flight and controls body attitude during stance. Each of the three methods elucidates...secondary strategy has been to examine systems with springy legs, so that the role of resonant oscillatory leg behavior might be better understood. ’ The ...body attitude : I lopping _leit: ’ The control system rcgulate:; hopping height by manlil)Lulating hopping energy. The leg is springy, so hopping is a

  17. Diffusion in quasi-one-dimensional channels: A small system n, p, T, transition state theory for hopping times.

    PubMed

    Ahmadi, Sheida; Bowles, Richard K

    2017-04-21

    Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.

  18. Hybrid spread spectrum radio system

    DOEpatents

    Smith, Stephen F [London, TN; Dress, William B [Camas, WA

    2010-02-09

    Systems and methods are described for hybrid spread spectrum radio systems. A method, includes receiving a hybrid spread spectrum signal including: fast frequency hopping demodulating and direct sequence demodulating a direct sequence spread spectrum signal, wherein multiple frequency hops occur within a single data-bit time and each bit is represented by chip transmissions at multiple frequencies.

  19. The initial stage of uranium oxidation: mechanism of UO(2) scale formation in the presence of a native lateral stress field.

    PubMed

    Chernia, Z; Ben-Eliyahu, Y; Kimmel, G; Braun, G; Sariel, J

    2006-11-23

    In this work, an oxidation model for alpha-uranium is presented. It describes the internally lateral stress field built in the oxide scale during the reaction. The thickness of the elastic, stress-preserving oxide (UO(2+x)) scale is less than 0.5 microm. A lateral, 6.5 GPa stress field has been calculated from strains derived from line shifts (delta(2theta)) as measured by the X-ray diffraction of UO(2). It is shown that in the elastic growth domain, (110) is the main UO(2) growth plane for gas-solid oxidation. The diffusion-limited oxidation mechanism discussed here is based on the known "2:2:2" cluster theory which describes the mechanism of fluorite-based hyperstoichiometric oxides. In this study, it is adapted to describe oxygen-anion hopping. Anion hopping toward the oxide-metal interface proceeds at high rates in the [110] direction, hence making this pipeline route the principal growth direction in UO(2) formation. It is further argued that growth in the pure elastic domain of the oxide scale should be attributed entirely to anion hopping in 110. Anions, diffusing isotropically via grain boundaries and cracks, are shown to have a significant impact on the overall oxidation rate in relatively thick (>0.35 microm) oxide scales if followed by an avalanche break off in the postelastic regime. Stress affects oxidation in the elastic domain by controlling the hopping rate directly. In the postelastic regime, stress weakens hopping, indirectly, by enhancing isotropic diffusion. Surface roughness presents an additional hindering factor for the anion hopping. In comparison to anisotropic hopping, diffusion of isotropic hopping has a lower activation energy barrier. Therefore, a relatively stronger impact at lower temperatures due to isotropic diffusion is displayed.

  20. Differential regulation of detoxification enzymes in hepatic and mammary tissue by hops (Humulus lupulus) in vitro and in vivo

    PubMed Central

    Dietz, Birgit M.; Hagos, Ghenet K.; Eskra, Jillian N.; Wijewickrama, Gihani T.; Anderson, Jeffrey R.; Nikolic, Dejan; Guo, Jian; Wright, Brian; Chen, Shao-Nong; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

    2013-01-01

    Scope Hops contain the phytoestrogen, 8-prenylnaringenin, and the cytoprotective compound, xanthohumol (XH). XH induces the detoxification enzyme, NAD(P)H-quinone oxidoreductase (NQO1) in vitro; however, the tissue distribution of XH and 8-prenylnaringenin and their tissue specific activity have not been analyzed. Methods and results A standardized hop extract (p.o.) and XH (s.c.) were administered to Sprague-Dawley rats over four days. LC-MS-MS analysis of plasma, liver and mammary gland revealed that XH accumulated in liver and mammary glands. Compared with the low level in the original extract, 8-prenylnaringenin was enriched in the tissues. Hops and XH induced NQO1 in the liver, while only hops reduced NQO1 activity in the mammary gland. Mechanistic studies revealed that hops modulated NQO1 through three mechanisms. In liver cells, 1) XH modified Keap1 leading to Nrf2 translocation and antioxidant response element (ARE) activation; 2) hop-mediated ARE induction was partially mediated through phosphorylation of Nrf2 by PKC; 3) in breast cells, 8-prenylnaringenin reduced NQO1 likely through binding to ERα, recruiting Nrf2, and downregulating ARE-regulated genes. Conclusions XH and 8-prenylnaringenin in dietary hops are bioavailable to the target tissues. While hops and XH might be cytoprotective in the liver, 8-prenylnaringenin seems responsible for hop-mediated NQO1 reduction in the mammary gland. PMID:23512484

  1. Ferrocene-decorated nanocrystalline cellulose with charge carrier mobility.

    PubMed

    Eyley, Samuel; Shariki, Sara; Dale, Sara E C; Bending, Simon; Marken, Frank; Thielemans, Wim

    2012-04-24

    Ferrocene-decorated cellulose nanowhiskers were prepared by the grafting of ethynylferrocene onto azide functionalized cotton-derived cellulose nanowhiskers using azide-alkyne cycloaddition. Successful surface modification and retention of the crystalline morphology of the nanocrystals was confirmed by elemental analysis, inductively coupled plasma-atomic emission spectroscopy, X-ray photoelectron spectroscopy, and X-ray diffraction. The coverage with ferrocenyl is high (approximately 1.14 × 10(-3) mol g(-1) or 4.6 × 10(13) mol cm(-2) corresponding to a specific area of 61 Å(2) per ferrocene). Cyclic voltammetry measurements of films formed by deposition of ferrocene-decorated nanowhiskers showed that this small spacing of redox centers along the nanowhisker surface allowed conduction hopping of electrons. The apparent diffusion coefficient for electron (or hole) hopping via Fe(III/II) surface sites is estimated as Dapp = 10(-19) m(2)s(-1) via impedance methods, a value significantly less than nonsolvated ferrocene polymers, which would be expected as the 1,2,3-triazole ring forms a rigid linker tethering the ferrocene to the nanowhisker surface. In part, this is believed to be also due to "bottleneck" diffusion of charges across contact points where individual cellulose nanowhiskers contact each other. However, the charge-communication across the nanocrystal surface opens up the potential for use of cellulose nanocrystals as a charge percolation template for the preparation of conducting films via covalent surface modification (with applications similar to those using adsorbed conducting polymers), for use in bioelectrochemical devices to gently transfer and remove electrons without the need for a solution-soluble redox mediator, or for the fabrication of three-dimensional self-assembled conducting networks.

  2. Landing Mechanics During Side Hopping and Crossover Hopping Maneuvers in Noninjured Women and Women With Anterior Cruciate Ligament Reconstruction

    PubMed Central

    Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.

    2011-01-01

    Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years after surgery, and women who have undergone a procedure such as ACL reconstruction may continue to exhibit knee-joint abduction moments that increase the risk of additional knee injury. PMID:21257128

  3. Effects of Holder pasteurization on the protein profile of human milk.

    PubMed

    Peila, Chiara; Coscia, Alessandra; Bertino, Enrico; Cavaletto, Maria; Spertino, Stefano; Icardi, Sara; Tortone, Claudia; Visser, Gerard H A; Gazzolo, Diego

    2016-04-07

    The most widespread method for the treatment of donor milk is the Holder pasteurization (HoP). The available literature data show that HoP may cause degradation of some bioactive components. The aim of this study was to determine the effect of HoP on the protein profile of human milk (HM) using a GeLC-MS method, a proteomic approach and a promising technique able to offer a qualitative HM protein profile. HM samples were collected by standardized methods from 20 mothers carrying both preterm and term newborns. A aliquot of each sample was immediately frozen at -80 °C, whilst another one was Holder pasteurized and then frozen. All samples were then analyzed by GeLC-MS. The protein bands of interest were excised from the gel, digested with trypsin and identified by nano-HPLC-MS/MS analysis. The protein profile before and after HoP showed qualitative differences only in 6 samples out of 20, while in the remaining 14 no detectable differences were found. The differences interested only colostrums and transitional milk samples and regarded the decrease of the electrophoretic bands corresponding to alpha and beta-casein, tenascin, lactoferrin and immunoglobulin. In the majority of samples, HoP did not cause any modification, thereby preserving the biological activity of HM proteins.

  4. Decoherence and surface hopping: When can averaging over initial conditions help capture the effects of wave packet separation?

    NASA Astrophysics Data System (ADS)

    Subotnik, Joseph E.; Shenvi, Neil

    2011-06-01

    Fewest-switches surface hopping (FSSH) is a popular nonadiabatic dynamics method which treats nuclei with classical mechanics and electrons with quantum mechanics. In order to simulate the motion of a wave packet as accurately as possible, standard FSSH requires a stochastic sampling of the trajectories over a distribution of initial conditions corresponding, e.g., to the Wigner distribution of the initial quantum wave packet. Although it is well-known that FSSH does not properly account for decoherence effects, there is some confusion in the literature about whether or not this averaging over a distribution of initial conditions can approximate some of the effects of decoherence. In this paper, we not only show that averaging over initial conditions does not generally account for decoherence, but also why it fails to do so. We also show how an apparent improvement in accuracy can be obtained for a fortuitous choice of model problems, even though this improvement is not possible, in general. For a basic set of one-dimensional and two-dimensional examples, we find significantly improved results using our recently introduced augmented FSSH algorithm.

  5. AC and DC conductivity due to hopping mechanism in double ion doped ceramics

    NASA Astrophysics Data System (ADS)

    Rizwana, Mahboob, Syed; Sarah, P.

    2018-04-01

    Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.

  6. Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

    PubMed

    Liu, Zechang; Wang, Liping; Liu, Yumei

    2018-01-18

    Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  7. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

    PubMed Central

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

    2007-01-01

    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

  8. Low temperature resistivity studies of SmB6: Observation of two-dimensional variable-range hopping conductivity

    NASA Astrophysics Data System (ADS)

    Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir

    2018-05-01

    We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.

  9. Implementation of a School Nurse-led Intervention for Children With Severe Obesity in New York City Schools.

    PubMed

    Schroeder, Krista; Jia, Haomiao; Wang, Y Claire; Smaldone, Arlene

    The Healthy Options and Physical Activity Program (HOP) is a school nurse-led intervention for children with severe obesity. HOP was developed by experts at the New York City Department of Health and Mental Hygiene and implemented in New York City schools beginning in 2012. The purpose of this study was to evaluate HOP implementation with the goal of informing HOP refinement and potential future HOP dissemination. This study entailed a retrospective analysis of secondary data. Analytic methods included descriptive statistics, Wilcoxon rank sum and Chi square tests, and multivariate logistic regression. During the 2012-2013 school year, 20,518 children were eligible for HOP. Of these, 1054 (5.1%) were enrolled in the program. On average, enrolled children attended one HOP session during the school year. Parent participation was low (3.2% of HOP sessions). Low nurse workload, low school poverty, higher grade level, higher BMI percentile, and chronic illness diagnosis were associated with student enrollment in HOP. As currently delivered, HOP is not likely to be efficacious. Lessons learned from this evaluation are applicable to future nurse-led obesity interventions. Prior to implementing a school nurse-led obesity intervention, nursing workload and available support must be carefully considered. Interventions should be designed to facilitate (and possibly require) parent involvement. Nurses who deliver obesity interventions may require additional training in obesity treatment. With attention to these lessons learned, evidence-based school nurse-led obesity interventions can be developed. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Augmented Ehrenfest dynamics yields a rate for surface hopping

    NASA Astrophysics Data System (ADS)

    Subotnik, Joseph E.

    2010-04-01

    We present a new algorithm for mixed quantum-classical dynamics that helps bridge the gap between mean-field (Ehrenfest) and surface-hopping dynamics by defining a natural rate of decoherence. In order to derive this decoherence result, we have expanded the number of independent variables in the usual Ehrenfest routine so that mixed quantum-classical derivatives are now propagated in time alongside the usual Ehrenfest variables. Having done so, we compute a unique rate of decoherence using two independent approaches: (i) by comparing the equations of motion for the joint nuclear-electronic probability density in phase space according to Ehrenfest dynamics versus partial Wigner transform dynamics and (ii) by introducing a frozen Gaussian interpretation of Ehrenfest dynamics which allows nuclear wave packets to separate. The first consequence of this work is a means to rigorously check the accuracy of standard Ehrenfest dynamics. Second, this paper suggests a nonadiabatic dynamics algorithm, whereby the nuclei are propagated on the mean-field (Ehrenfest) potential energy surface and undergo stochastic decoherence events. Our work resembles the surface-hopping algorithm of Schwartz and co-workers [J. Chem. Phys. 123, 234106 (2005)]—only now without any adjustable parameters. For the case of two electronic states, we present numerical results on the so-called "Tully problems" and emphasize that future numerical benchmarking is still needed. Future work will also treat the problem of three or more electronic states.

  11. The Number of Trials Required to Obtain a Representative Movement Pattern During a Hurdle Hop Exercise.

    PubMed

    Gore, Shane J; Marshall, Brendan M; Franklyn-Miller, Andrew D; Falvey, Eanna C; Moran, Kieran A

    2016-06-01

    When reporting a subject's mean movement pattern, it is important to ensure that reported values are representative of the subject's typical movement. While previous studies have used the mean of 3 trials, scientific justification of this number is lacking. One approach is to determine statistically how many trials are required to achieve a representative mean. This study compared 4 methods of calculating the number of trials required in a hopping movement to achieve a representative mean. Fifteen males completed 15 trials of a lateral hurdle hop. Range of motion at the trunk, pelvis, hip, knee, and ankle, in addition to peak moments for the latter 3 joints were examined. The number of trials required was computed using a peak intraclass correlation coefficient method, sequential analysis with a bandwidth of acceptable variance in the mean, and a novel method based on the standard error of measurement (SEMind). The number of trials required across all variables ranged from 2 to 12 depending on method, joint, and anatomical plane. The authors advocate the SEMind method as it demonstrated fewer limitations than the other methods. Using the SEMind, the required number of trials for a representative mean during the lateral hurdle hop is 6.

  12. Surface hopping trajectory simulations with spin-orbit and dynamical couplings

    NASA Astrophysics Data System (ADS)

    Granucci, Giovanni; Persico, Maurizio; Spighi, Gloria

    2012-12-01

    In this paper we consider the inclusion of the spin-orbit interaction in surface hopping molecular dynamics simulations to take into account spin forbidden transitions. Two alternative approaches are examined. The spin-diabatic one makes use of eigenstates of the spin-free electronic Hamiltonian and of hat{S}^2 and is commonly applied when the spin-orbit coupling is weak. We point out some inconsistencies of this approach, especially important when more than two spin multiplets are coupled. The spin-adiabatic approach is based on the eigenstates of the total electronic Hamiltonian including the spin-orbit coupling. Advantages and drawbacks of both strategies are discussed and illustrated with the help of two model systems.

  13. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

    PubMed Central

    2018-01-01

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation. PMID:29329248

  14. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    PubMed

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  15. Interaction of alcoholic extracts of hops with cocaine and paracetamol in mice.

    PubMed

    Horvat, Olga; Raskovic, Aleksandar; Jakovljevic, Vida; Sabo, Jan; Berenji, Janos

    2007-01-01

    This work describes a study of the interaction in the mouse model of alcoholic extracts of hops of Magnum, Aroma and wild genotypes with drugs that have excitatory effect on the cerebral cortex (cocaine) and analgesic action (paracetamol). Hop drying and preparation of the extracts were carried out according to standard pharmacological procedures for preparing total alcoholic extracts of dry herbs, consisting of one part of dry drug and two parts of 70% alcohol. The mice received four doses i.p. of 0.5% aqueous solutions of the above-mentioned extracts (10 ml/kg) 24, 16, 4 and 0.5 h prior to receiving cocaine (25 mg/kg) or paracetamol (80 mg/kg). The parameter investigated was the change in spontaneous motility of mice after combined treatment with the extracts and cocaine/paracetamol compared to control animals that received the same dose of the drug after treatment with physiological solution. Only the ethanolic extract of Magnum hops increased the spontaneous motility of mice, while none of the extracts showed analgesic action as measured by the hot-plate method. In the interaction with cocaine, the extract of Magnum hops suppressed almost completely the action of cocaine compared to controls. Extracts of the other hops also decreased the cocaine-induced locomotor activity of mice, but to a lesser extent. Hop extracts exhibited a significant pharmacological interaction with paracetamol, with the most pronounced increase in analgesic action being found for the ethanolic extract of Aroma hops and the tert-butanolic extract of wild hops.

  16. Adaptive time steps in trajectory surface hopping simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spörkel, Lasse, E-mail: spoerkel@kofo.mpg.de; Thiel, Walter, E-mail: thiel@kofo.mpg.de

    2016-05-21

    Trajectory surface hopping (TSH) simulations are often performed in combination with active-space multi-reference configuration interaction (MRCI) treatments. Technical problems may arise in such simulations if active and inactive orbitals strongly mix and switch in some particular regions. We propose to use adaptive time steps when such regions are encountered in TSH simulations. For this purpose, we present a computational protocol that is easy to implement and increases the computational effort only in the critical regions. We test this procedure through TSH simulations of a GFP chromophore model (OHBI) and a light-driven rotary molecular motor (F-NAIBP) on semiempirical MRCI potential energymore » surfaces, by comparing the results from simulations with adaptive time steps to analogous ones with constant time steps. For both test molecules, the number of successful trajectories without technical failures rises significantly, from 53% to 95% for OHBI and from 25% to 96% for F-NAIBP. The computed excited-state lifetime remains essentially the same for OHBI and increases somewhat for F-NAIBP, and there is almost no change in the computed quantum efficiency for internal rotation in F-NAIBP. We recommend the general use of adaptive time steps in TSH simulations with active-space CI methods because this will help to avoid technical problems, increase the overall efficiency and robustness of the simulations, and allow for a more complete sampling.« less

  17. Estimating the entropy and quantifying the impurity of a swarm of surface-hopping trajectories: A new perspective on decoherence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ouyang, Wenjun; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu

    2014-05-28

    In this article, we consider the intrinsic entropy of Tully's fewest switches surface hopping (FSSH) algorithm (as estimated by the impurity of the density matrix) [J. Chem. Phys. 93, 1061 (1990)]. We show that, even for a closed system, the total impurity of a FSSH calculation increases in time (rather than stays constant). This apparent failure of the FSSH algorithm can be traced back to an incorrect, approximate treatment of the electronic coherence between wavepackets moving along different potential energy surfaces. This incorrect treatment of electronic coherence also prevents the FSSH algorithm from correctly describing wavepacket recoherences (which is amore » well established limitation of the FSSH method). Nevertheless, despite these limitations, the FSSH algorithm often predicts accurate observables because the electronic coherence density is modulated by a phase factor which varies rapidly in phase space and which often integrates to almost zero. Adding “decoherence” events on top of a FSSH calculation completely destroys the incorrect FSSH electronic coherence and effectively sets the Poincaré recurrence time for wavepacket recoherence to infinity; this modification usually increases FSSH accuracy (assuming there are no recoherences) while also offering long-time stability for trajectories. In practice, we show that introducing “decoherence” events does not change the total FSSH impurity significantly, but does lead to more accurate evaluations of the impurity of the electronic subsystem.« less

  18. Adaptive time steps in trajectory surface hopping simulations

    NASA Astrophysics Data System (ADS)

    Spörkel, Lasse; Thiel, Walter

    2016-05-01

    Trajectory surface hopping (TSH) simulations are often performed in combination with active-space multi-reference configuration interaction (MRCI) treatments. Technical problems may arise in such simulations if active and inactive orbitals strongly mix and switch in some particular regions. We propose to use adaptive time steps when such regions are encountered in TSH simulations. For this purpose, we present a computational protocol that is easy to implement and increases the computational effort only in the critical regions. We test this procedure through TSH simulations of a GFP chromophore model (OHBI) and a light-driven rotary molecular motor (F-NAIBP) on semiempirical MRCI potential energy surfaces, by comparing the results from simulations with adaptive time steps to analogous ones with constant time steps. For both test molecules, the number of successful trajectories without technical failures rises significantly, from 53% to 95% for OHBI and from 25% to 96% for F-NAIBP. The computed excited-state lifetime remains essentially the same for OHBI and increases somewhat for F-NAIBP, and there is almost no change in the computed quantum efficiency for internal rotation in F-NAIBP. We recommend the general use of adaptive time steps in TSH simulations with active-space CI methods because this will help to avoid technical problems, increase the overall efficiency and robustness of the simulations, and allow for a more complete sampling.

  19. Surface Diffusion in Systems of Interacting Brownian Particles

    NASA Astrophysics Data System (ADS)

    Mazroui, M'hammed; Boughaleb, Yahia

    The paper reviews recent results on diffusive phenomena in two-dimensional periodic potential. Specifically, static and dynamic properties are investigated by calculating different correlation functions. Diffusion process is first studied for one-dimensional system by using the Fokker-Planck equation which is solved numerically by the matrix continued fraction method in the case of bistable potential. The transition from hopping to liquid-like diffusion induced by variation of some parameters is discussed. This study will therefore serve to demonstrate the influence of this form of potential. Further, an analytical approximation for the dc-conductivity is derived for a wide damping range in the framework of the Linear Response Theory. On the basis of this expression, calculations of the ac conductivity of two-dimensional system with Frenkel-Kontorova pair interaction in the intermediate friction regime is performed by using the continued fraction expansion method. The dc-conductivity expression is used to determine the rest of the development. By varying the density of mobile ions we discuss commensurability effects. To get information about the diffusion mechanism, the full width at half maximum λω(q), of the quasi-elastic line of the dynamical structure factor S(q,ω) is computed. The calculations are extended up to large values of q covering several Brillouin zones. The analysis of λω(q) with different parameters shows that the most probable diffusion process in good two-dimensional superionic conductors consists of a competition between a back correlated hopping in one direction and forward correlated hopping in addition to liquid-like motions in the other direction.

  20. Nerve Conduction Through Dendrites via Proton Hopping.

    PubMed

    Kier, Lemont B

    2017-01-01

    In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  1. Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

    PubMed

    Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

    2018-03-30

    Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

  2. Aspirin increases susceptibility of Helicobacter pylori to metronidazole by augmenting endocellular concentrations of antimicrobials

    PubMed Central

    Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang

    2009-01-01

    AIM: To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. METHODS: H pylori reference strain 26 695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-3H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26 695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. RESULTS: The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. CONCLUSION: Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression. PMID:19248190

  3. Deodorant effects of a supercritical hops extract: antibacterial activity against Corynebacterium xerosis and Staphylococcus epidermidis and efficacy testing of a hops/zinc ricinoleate stick in humans through the sensory evaluation of axillary deodorancy.

    PubMed

    Dumas, Elizabeth R; Michaud, Amy E; Bergeron, Chantal; Lafrance, Jennifer L; Mortillo, Susan; Gafner, Stefan

    2009-09-01

    There is little scientific evidence to support the efficacy of natural deodorants and therefore, such products may be perceived as inefficacious. The evaluation of the in vitro antibacterial activity of a hop extract and the evaluation of the odor-reducing capacity of a hops/zinc ricinoleate-containing product by a sensory evaluation panel is employed to verify deodorant performance. The goal of this study was to evaluate the in vitro antibacterial activity of a hop extract against Corynebacterium xerosis and Staphylococcus epidermidis and to verify in vivo deodorant performance of a hops/zinc ricinoleate-containing product. The hops extract was evaluated on a culture of an armpit swab from six volunteers. Furthermore, the extract was submitted to a zone of inhibition test and an agar-dilution assay against two major odor-causing bacteria. The clinical evaluation of the finished product was carried out according to a standard method for substantiating deodorant efficacy using trained odor judges for the assessment of axillary malodor (ASTM method E 1207-87 Standard Practice for the Sensory Evaluation of Axillary Deodorancy). The supercritical hops extract showed good antibacterial activities in all three tests. Minimum inhibitory concentration values of 6.25 and 25 mug/mL against C. xerosis and S. aureus, respectively, were obtained in the agar-dilution assay. In the clinical underarm odor-reduction evaluation, the mean malodor score dropped from 6.28 (+/-0.70) to 1.80 (+/-0.71) after 8 h of application. There was still a noticeable effect at both 12 and 24 h after the application, with a score of 1.82 (+/-0.74) and 2.24 (+/-0.77), respectively. The hops extract has good in vitro antibacterial properties and, in combination with zinc ricinoleate in an appropriate base, delivers in vivo odor reduction. The clinical efficacy is likely due to a combination of the base ingredients and the antibacterial actives.

  4. Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy

    PubMed Central

    Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.

    2016-01-01

    Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD0-200ms, and the knee extension moment was positively associated with RTD0-200ms. At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD0-200ms, and RTD0–peak torque. Conclusion: Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Clinical Relevance: Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance. PMID:28210647

  5. Clinician-Friendly Physical Performance Tests for the Hip, Ankle, and Foot.

    PubMed

    Vogler, Joseph H; Csiernik, Alexander J; Yorgey, Marissa K; Harrison, Jerrod J; Games, Kenneth E

    2017-09-01

    Reference:  Hegedus EJ, McDonough SM, Bleakley C, Baxter D, Cook CE. Clinician-friendly lower extremity physical performance tests in athletes: a systematic review of measurement properties and correlation with injury. Part 2: the tests for the hip, thigh, foot, and ankle including the Star Excursion Balance Test. Br J Sports Med. 2015;49(10):649-656.   Do individual physical performance tests (PPTs) for the lower extremity have any relation to injury in athletes 12 years of age and older?   The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were followed to locate articles. Three databases were searched from inception to January 13, 2014: PubMed, CINAHL, and SPORTDiscus. Search phrases were sport, athletics, athletes, and injuries combined with strength, power, endurance, agility, and function. Reference lists of all remaining articles and personal collections of the authors were then reviewed for any missing articles.   Studies were included according to the following criteria: (1) published in English, (2) presented as complete articles (ie, no abstracts or posters), and (3) involved human participants. Studies were excluded on the following criteria: (1) a combination of PPTs was examined, (2) the results were measured using equipment that was expensive or not readily available to the average clinician, (3) the PPTs examined impairment-level data, (4) the PPTs examined tasks not relevant to the lower extremity, or (5) the participants scored 4 or less on the Tegner Activity Scale. The final analysis involved 31 studies.   The name of the PPT and methods were extracted. Each PPT was then critiqued using the Consensus-Based Standards for the Selection of Health Measurement Instruments, a 4-point Likert scale. Data were also summarized using a score of unknown, strong, moderate, limited, or conflicting for the best evidence synthesis.   A total of 14 PPTs were examined; however, names and methods of the PPTs were inconsistent throughout the literature. In descending order, based on frequency of appearance in the literature, the PPTs were (1) 1-legged hop for distance, (2) vertical jump, (3) Star Excursion Balance Test, (4) shuttle run, (5) 6-m timed hop, (6) triple hop, (7) 40-yd sprint, (8) triple crossover hop for distance, (9) 6-m timed crossover hop, (10) T-agility, (11) hexagon hop, (12) medial hop, (13) lateral hop, and (14) multi-stage fitness (beep test). The Star Excursion Balance Test in the anterior, posteromedial, and posterolateral directions was the only test that could help identify injury risk. The 1-legged hop for distance and hexagon hop showed a moderate ability to differentiate between normal and unstable ankles. In dancers, the medial hop in dancers differentiated between painful and normal hips with moderate evidence.   Very little evidence supports the use of PPTs for athletes with lower extremity injuries. A panel of experts needs to standardize the names and methods of widely accepted tests.

  6. Condom Use and Hip Hop Culture: The Case of Urban Young Men in New York City

    PubMed Central

    Muñoz-Laboy, Miguel A.; Castellanos, Daniel H.; Haliburton, Chanel S.; del Aguila, Ernesto Vasquez; Weinstein, Hannah J.; Parker, Richard G.

    2008-01-01

    Objectives. We explored how young men’s perceptions of and participation in hip hop culture—urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music—and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. Methods. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Results. Differences in young men’s perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Conclusions. Popular discourses on young men’s health risks often blame youths’ cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men’s lives and what aspects of youths’ culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk. PMID:18445799

  7. A comparison of optimisation methods and knee joint degrees of freedom on muscle force predictions during single-leg hop landings.

    PubMed

    Mokhtarzadeh, Hossein; Perraton, Luke; Fok, Laurence; Muñoz, Mario A; Clark, Ross; Pivonka, Peter; Bryant, Adam L

    2014-09-22

    The aim of this paper was to compare the effect of different optimisation methods and different knee joint degrees of freedom (DOF) on muscle force predictions during a single legged hop. Nineteen subjects performed single-legged hopping manoeuvres and subject-specific musculoskeletal models were developed to predict muscle forces during the movement. Muscle forces were predicted using static optimisation (SO) and computed muscle control (CMC) methods using either 1 or 3 DOF knee joint models. All sagittal and transverse plane joint angles calculated using inverse kinematics or CMC in a 1 DOF or 3 DOF knee were well-matched (RMS error<3°). Biarticular muscles (hamstrings, rectus femoris and gastrocnemius) showed more differences in muscle force profiles when comparing between the different muscle prediction approaches where these muscles showed larger time delays for many of the comparisons. The muscle force magnitudes of vasti, gluteus maximus and gluteus medius were not greatly influenced by the choice of muscle force prediction method with low normalised root mean squared errors (<48%) observed in most comparisons. We conclude that SO and CMC can be used to predict lower-limb muscle co-contraction during hopping movements. However, care must be taken in interpreting the magnitude of force predicted in the biarticular muscles and the soleus, especially when using a 1 DOF knee. Despite this limitation, given that SO is a more robust and computationally efficient method for predicting muscle forces than CMC, we suggest that SO can be used in conjunction with musculoskeletal models that have a 1 or 3 DOF knee joint to study the relative differences and the role of muscles during hopping activities in future studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Non-adiabatic dynamics close to conical intersections and the surface hopping perspective

    PubMed Central

    Malhado, João Pedro; Bearpark, Michael J.; Hynes, James T.

    2014-01-01

    Conical intersections play a major role in the current understanding of electronic de-excitation in polyatomic molecules, and thus in the description of photochemistry and photophysics of molecular systems. This article reviews aspects of the basic theory underlying the description of non-adiabatic transitions at conical intersections, with particular emphasis on the important case when the dynamics of the nuclei are treated classically. Within this classical nuclear motion framework, the main aspects of the surface hopping methodology in the conical intersection context are presented. The emerging picture from this treatment is that of electronic transitions around conical intersections dominated by the interplay of the nuclear velocity and the derivative non-adiabatic coupling vector field. PMID:25485263

  9. PARALLEL HOP: A SCALABLE HALO FINDER FOR MASSIVE COSMOLOGICAL DATA SETS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Skory, Stephen; Turk, Matthew J.; Norman, Michael L.

    2010-11-15

    Modern N-body cosmological simulations contain billions (10{sup 9}) of dark matter particles. These simulations require hundreds to thousands of gigabytes of memory and employ hundreds to tens of thousands of processing cores on many compute nodes. In order to study the distribution of dark matter in a cosmological simulation, the dark matter halos must be identified using a halo finder, which establishes the halo membership of every particle in the simulation. The resources required for halo finding are similar to the requirements for the simulation itself. In particular, simulations have become too extensive to use commonly employed halo finders, suchmore » that the computational requirements to identify halos must now be spread across multiple nodes and cores. Here, we present a scalable-parallel halo finding method called Parallel HOP for large-scale cosmological simulation data. Based on the halo finder HOP, it utilizes message passing interface and domain decomposition to distribute the halo finding workload across multiple compute nodes, enabling analysis of much larger data sets than is possible with the strictly serial or previous parallel implementations of HOP. We provide a reference implementation of this method as a part of the toolkit {sup yt}, an analysis toolkit for adaptive mesh refinement data that include complementary analysis modules. Additionally, we discuss a suite of benchmarks that demonstrate that this method scales well up to several hundred tasks and data sets in excess of 2000{sup 3} particles. The Parallel HOP method and our implementation can be readily applied to any kind of N-body simulation data and is therefore widely applicable.« less

  10. Harvesting electricity from human hair.

    PubMed

    Tulachan, Brindan; Singh, Sushil K; Philip, Deepu; Das, Mainak

    2016-01-01

    Electrical conductivity of human hair is a debatable issue among hair experts and scientists. There are unsubstantiated claims that hair conducts electricity. However, hair experts provided ample evidence that hair is an insulator. Although wet hair exhibited drastic reduction in resistivity; scientists regarded hair as a proton semiconductor at the best. Here, we demonstrate that hair filaments generate electricity on absorbing water vapor between 50 degrees and 80 degrees C. This electricity can operate low power electronic systems. Essentially, we are exposing the hydrated hair polymer to a high temperature (50 degrees-80 degrees C). It has long been speculated that when certain biopolymers are simultaneously hydrated and exposed to high temperature, they exhibit significant proton hopping at a specific temperature regime. This happens due to rapid movement of water molecules on the polymer surface. This lead us to speculate that the observed flow of current is partly ionic and partly due to "proton hopping" in the hydrated nano spaces of hair filament. Such proton hopping is exceptionally high when the hydrated hair polymer is exposed to a temperature between 50 degrees and 80 degrees C. Differential scanning calorimetry data further corroborated the results and indicated that indeed at this temperature range, there is an enormous movement of water molecules on the hair polymer surface. This enormously rapid movement of water molecules lead to the "making and breaking" of innumerable hydrogen bonds and thus resulting in hopping of the protons. What is challenging is "how to tap these hopping protons to obtain useful electricity?" We achieved this by placing a bundle of hair between two different electrodes having different electro negativities, and exposing it to water vapor (water + heat). The two different electrodes offered directionality to the hopping protons and the existing ions and thus resulting in the generation of useful current. Further, by continuously hydrating the polymer with water vapor, we prolonged the process. If this interesting aspect of polymer is exploited further and fine tuned, then it will open new avenues for development of sophisticated polymer-based systems, which could be used to harvest electricity from waste heat.

  11. Nonlinear absorption dynamics using field-induced surface hopping: zinc porphyrin in water.

    PubMed

    Röhr, Merle I S; Petersen, Jens; Wohlgemuth, Matthias; Bonačić-Koutecký, Vlasta; Mitrić, Roland

    2013-05-10

    We wish to present the application of our field-induced surface-hopping (FISH) method to simulate nonlinear absorption dynamics induced by strong nonresonant laser fields. We provide a systematic comparison of the FISH approach with exact quantum dynamics simulations on a multistate model system and demonstrate that FISH allows for accurate simulations of nonlinear excitation processes including multiphoton electronic transitions. In particular, two different approaches for simulating two-photon transitions are compared. The first approach is essentially exact and involves the solution of the time-dependent Schrödinger equation in an extended manifold of excited states, while in the second one only transiently populated nonessential states are replaced by an effective quadratic coupling term, and dynamics is performed in a considerably smaller manifold of states. We illustrate the applicability of our method to complex molecular systems by simulating the linear and nonlinear laser-driven dynamics in zinc (Zn) porphyrin in the gas phase and in water. For this purpose, the FISH approach is connected with the quantum mechanical-molecular mechanical approach (QM/MM) which is generally applicable to large classes of complex systems. Our findings that multiphoton absorption and dynamics increase the population of higher excited states of Zn porphyrin in the nonlinear regime, in particular in solution, provides a means for manipulating excited-state properties, such as transient absorption dynamics and electronic relaxation. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Observation of Landau levels on nitrogen-doped flat graphite surfaces without external magnetic fields

    PubMed Central

    Kondo, Takahiro; Guo, Donghui; Shikano, Taishi; Suzuki, Tetsuya; Sakurai, Masataka; Okada, Susumu; Nakamura, Junji

    2015-01-01

    Under perpendicular external magnetic fields, two-dimensional carriers exhibit Landau levels (LLs). However, it has recently been reported that LLs have been observed on graphene and graphite surfaces without external magnetic fields being applied. These anomalous LLs have been ascribed primarily to a strain of graphene sheets, leading to in-plane hopping modulation of electrons. Here, we report the observation of the LLs of massive Dirac fermions on atomically flat areas of a nitrogen-doped graphite surface in the absence of external magnetic fields. The corresponding magnetic fields were estimated to be as much as approximately 100 T. The generation of the LLs at the area with negligible strain can be explained by inequivalent hopping of π electrons that takes place at the perimeter of high-potential domains surrounded by positively charged substituted graphitic-nitrogen atoms. PMID:26549618

  13. EON: software for long time simulations of atomic scale systems

    NASA Astrophysics Data System (ADS)

    Chill, Samuel T.; Welborn, Matthew; Terrell, Rye; Zhang, Liang; Berthet, Jean-Claude; Pedersen, Andreas; Jónsson, Hannes; Henkelman, Graeme

    2014-07-01

    The EON software is designed for simulations of the state-to-state evolution of atomic scale systems over timescales greatly exceeding that of direct classical dynamics. States are defined as collections of atomic configurations from which a minimization of the potential energy gives the same inherent structure. The time evolution is assumed to be governed by rare events, where transitions between states are uncorrelated and infrequent compared with the timescale of atomic vibrations. Several methods for calculating the state-to-state evolution have been implemented in EON, including parallel replica dynamics, hyperdynamics and adaptive kinetic Monte Carlo. Global optimization methods, including simulated annealing, basin hopping and minima hopping are also implemented. The software has a client/server architecture where the computationally intensive evaluations of the interatomic interactions are calculated on the client-side and the state-to-state evolution is managed by the server. The client supports optimization for different computer architectures to maximize computational efficiency. The server is written in Python so that developers have access to the high-level functionality without delving into the computationally intensive components. Communication between the server and clients is abstracted so that calculations can be deployed on a single machine, clusters using a queuing system, large parallel computers using a message passing interface, or within a distributed computing environment. A generic interface to the evaluation of the interatomic interactions is defined so that empirical potentials, such as in LAMMPS, and density functional theory as implemented in VASP and GPAW can be used interchangeably. Examples are given to demonstrate the range of systems that can be modeled, including surface diffusion and island ripening of adsorbed atoms on metal surfaces, molecular diffusion on the surface of ice and global structural optimization of nanoparticles.

  14. A basin-hopping Monte Carlo investigation of the structural and energetic properties of 55- and 561-atom bimetallic nanoclusters: the examples of the ZrCu, ZrAl, and CuAl systems.

    PubMed

    De Souza, Douglas G; Cezar, Henrique M; Rondina, Gustavo G; de Oliveira, Marcelo F; Da Silva, Juarez L F

    2016-05-05

    We report a basin-hopping Monte Carlo investigation within the embedded-atom method of the structural and energetic properties of bimetallic ZrCu, ZrAl, and CuAl nanoclusters with 55 and 561 atoms. We found that unary Zr55, Zr561, Cu55, Cu561, Al55, and Al561 systems adopt the well known compact icosahedron (ICO) structure. The excess energy is negative for all systems and compositions, which indicates an energetic preference for the mixing of both chemical species. The ICO structure is preserved if a few atoms of the host system are replaced by different species, however, the composition limit in which the ICO structure is preserved depends on both the host and new chemical species. Using several structural analyses, three classes of structures, namely ideal ICO, nearly ICO, and distorted ICO structures, were identified. As the amounts of both chemical species change towards a more balanced composition, configurations far from the ICO structure arise and the dominant structures are nearly spherical, which indicates a strong minimization of the surface energy by decreasing the number of atoms with lower coordination on the surface. The average bond lengths follow Vegard's law almost exactly for ZrCu and ZrAl, however, this is not the case for CuAl. Furthermore, the radial distribution allowed us to identify the presence of an onion-like behavior in the surface of the 561-atom CuAl nanocluster with the Al atoms located in the outermost surface shell, which can be explained by the lower surface energies of the Al surfaces compared with the Cu surfaces. In ZrCu and ZrAl the radial distribution indicates a nearly homogeneous distribution for the chemical species, however, with a slightly higher concentration of Al atoms on the ZrAl surface, which can also be explained by the lower surface energy.

  15. Critical Hip Hop Pedagogy as a Form of Liberatory Praxis

    ERIC Educational Resources Information Center

    Akom, A. A.

    2009-01-01

    This article uses Paulo Freire's problem-posing method, youth participatory action research, and case study methodology to introduce an alternative instructional strategy called Critical Hip Hop Pedagogy (CHHP). This approach attempts to address deep-rooted ideologies to social inequities by creating a space in teacher education courses for…

  16. Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.

    PubMed

    Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J

    2006-04-01

    A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and knee flexion and generated powers for the knee and ankle joints during take-off, and less hip joint moments during landing under fatigued conditions. The large negative power values observed at the knee joint during the landing phase of the single-leg hop, during which the quadriceps muscle activates eccentrically, indicate that not only hop distance but also the ability to perform successful landings should be investigated when assessing dynamic knee function.

  17. Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes

    PubMed Central

    Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

    2017-01-01

    Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types. Conclusion: The single-leg hop tests and isokinetic strength measurements were both useful for a bilateral comparison of knee functional performance and strength. Knee flexion strength deficits and flexion-to-extension ratios seemed to be correlated with single-leg hop test performance. There was no difference in postoperative hop test performance or knee strength according to graft type. PMID:29164167

  18. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

    PubMed

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

    2015-03-01

    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation. Antimicrobial hop extracts could be used as natural preservatives in food applications to extend the shelf life and to increase the safety of fresh products. © 2014 The Society for Applied Microbiology.

  19. Multiple Signal Classification for Determining Direction of Arrival of Frequency Hopping Spread Spectrum Signals

    DTIC Science & Technology

    2014-03-27

    42 4.2.3 Number of Hops Hs . . . . . . . . . . . . . . . . . . . . . . . . . 45 4.2.4 Number of Sensors M... 45 4.5 Standard deviation vs. Ns. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46 4.6 Bias...laboratory MTM multiple taper method MUSIC multiple signal classification MVDR minimum variance distortionless reposnse PSK phase shift keying QAM

  20. Ultrasonic Multiple-Access Ranging System Using Spread Spectrum and MEMS Technology for Indoor Localization

    PubMed Central

    Segers, Laurent; Tiete, Jelmer; Braeken, An; Touhafi, Abdellah

    2014-01-01

    Indoor localization of persons and objects poses a great engineering challenge. Previously developed localization systems demonstrate the use of wideband techniques in ultrasound ranging systems. Direct sequence and frequency hopping spread spectrum ultrasound signals have been proven to achieve a high level of accuracy. A novel ranging method using the frequency hopping spread spectrum with finite impulse response filtering will be investigated and compared against the direct sequence spread spectrum. In the first setup, distances are estimated in a single-access environment, while in the second setup, two senders and one receiver are used. During the experiments, the micro-electromechanical systems are used as ultrasonic sensors, while the senders were implemented using field programmable gate arrays. Results show that in a single-access environment, the direct sequence spread spectrum method offers slightly better accuracy and precision performance compared to the frequency hopping spread spectrum. When two senders are used, measurements point out that the frequency hopping spread spectrum is more robust to near-far effects than the direct sequence spread spectrum. PMID:24553084

  1. Photo-induced changes of the surface band bending in GaN: Influence of growth technique, doping and polarity

    NASA Astrophysics Data System (ADS)

    Winnerl, Andrea; Pereira, Rui N.; Stutzmann, Martin

    2017-05-01

    In this work, we use conductance and contact potential difference photo-transient data to study the influence of the growth technique, doping, and crystal polarity on the kinetics of photo-generated charges in GaN. We found that the processes, and corresponding time scales, involved in the decay of charge carriers generated at and close to the GaN surface via photo-excitation are notably independent of the growth technique, doping (n- and p-types), and also crystal polarity. Hence, the transfer of photo-generated charges from band states back to surface states proceeds always by hopping via shallow defect states in the space-charge region (SCR) close to the surface. Concerning the charge carrier photo-generation kinetics, we observe considerable differences between samples grown with different techniques. While for GaN grown by metal-organic chemical vapor deposition, the accumulation of photo-conduction electrons results mainly from a combined trapping-hopping process (slow), where photo-generated electrons hop via shallow defect states to the conduction band (CB), in hydride vapor phase epitaxy and molecular beam epitaxy materials, a faster direct process involving electron transfer via CB states is also present. The time scales of both processes are quite insensitive to the doping level and crystal polarity. However, these processes become irrelevant for very high doping levels (both n- and p-types), where the width of the SCR is much smaller than the photon penetration depth, and therefore, most charge carriers are generated outside the SCR.

  2. Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network

    NASA Astrophysics Data System (ADS)

    Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen

    2018-06-01

    We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.

  3. Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network

    NASA Astrophysics Data System (ADS)

    Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen

    2018-02-01

    We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.

  4. Mars Surface Mobility Leading to Sustainable Exploration

    NASA Technical Reports Server (NTRS)

    Linne, Diane L.; Barsi, Stephen J.; Sjauw En Wa, Waldy K.; Landis, Geoffrey A.

    2012-01-01

    A Mars rocket-propelled hopper concept was evaluated for feasibility through analysis and experiments. The approach set forth in this paper is to combine the use of in-situ resources in a new Mars mobility concept that will greatly enhance the science return while providing the first opportunity towards reducing the risk of incorporating ISRU into the critical path for the highly coveted, but currently unaffordable, sample return mission. Experimental tests were performed on a high-pressure, self-throttling gaseous oxygen/methane propulsion system to simulate a two-burn-with-coast hop profile. Analysis of the trajectory, production plant requirements, and vehicle mass indicates that a small hopper vehicle could hop 2 km every 30 days with an initial mass of less than 60 kg. A larger vehicle can hop 15 km every 30 to 60 days with an initial mass of 300 to 430 kg.

  5. A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications

    PubMed Central

    Fernández de Gorostiza, Erlantz; Mabe, Jon

    2018-01-01

    Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method. PMID:29473910

  6. A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications.

    PubMed

    Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto

    2018-02-23

    Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.

  7. DC electrical conductivity of Ag2O-TeO2-V2O5 glassy systems

    NASA Astrophysics Data System (ADS)

    Souri, D.; Tahan, Z. Esmaeili; Salehizadeh, S. A.

    2016-04-01

    In the present article, samples of xAg2O-40TeO2-(60 - x)V2O5 ternary tellurite glasses with 0 ≤ x ≤ 50 (in mol%) have been prepared using the melt-quenching technique. XRD analysis, density measurement by Archimedes' law, determination of reduced vanadium ions by titration method, and electrical conductivity measurement by using four-probe methods have been done for these glasses. The mixed electronic-ionic conduction of these glasses has been investigated over a wide temperature range of 150-380 K. The experimental results have been analyzed with different theoretical models of hopping conduction. The analysis shows that at high temperatures the conductivity data are consistent with Mott's model of phonon-assisted polaronic hopping, while Mott's variable-range hopping model and Greaves' hopping model are valid at low temperatures. The temperature dependence of the conductivity has been also interpreted in the framework of the percolation model proposed by Triberis and Friedman. The analysis of the conductivity data also indicates that the hopping in these tellurite glasses occurs in the non-adiabatic regime. In each sample, based upon the justified transport mechanism, carrier density and mobility have been determined at different temperatures. The values of oxygen molar volume indicate the effect of Ag2O concentration on the thermal stability or fragility of understudied samples.

  8. Effects of CO2 adsorption on proton migration on a hydrated ZrO2 surface: an ab initio molecular dynamics study.

    PubMed

    Sato, Ryuhei; Shibuta, Yasushi; Shimojo, Fuyuki; Yamaguchi, Shu

    2017-08-02

    Hydration reactions on a carbonate-terminated cubic ZrO 2 (110) surface were analyzed using ab initio molecular dynamics (AIMD) simulations. After hydration reactions, carbonates were still present on the surface at 500 K. However, these carbonates are very weak conjugate bases and only act as steric hindrance in proton hopping processes between acidic chemisorbed H 2 O molecules (Zr-OH 2 ) and monodentate hydroxyl groups (Zr-OH - ). Similar to a carbonate-free hydrated surface, Zr-OH 2 , Zr-OH - , and polydentate hydroxyl groups ([double bond splayed left]OH + ) were observed, while the ratio of acidic Zr-OH 2 was significantly larger than that on the carbonate-free hydrated surface. A thermodynamic discussion and bond property analysis reveal that CO 2 adsorption significantly decreases the basicity of surface oxide ions ([double bond splayed left]O), whereas the acidity of Zr-OH 2 is not affected. As a result, protons released from [double bond splayed left]OH + react with Zr-OH - to form Zr-OH 2 , leading to a deficiency of proton acceptor sites, which decreases the proton conductivity by the hopping mechanism.

  9. A new bioenergetic and thermodynamic approach to batch photoautotrophic growth of Arthrospira (Spirulina) platensis in different photobioreactors and under different light conditions.

    PubMed

    da Silva, Milena Fernandes; Casazza, Alessandro Alberto; Ferrari, Pier Francesco; Perego, Patrizia; Bezerra, Raquel Pedrosa; Converti, Attilio; Porto, Ana Lucia Figueiredo

    2016-05-01

    Photobioreactor configuration, mode of operation and light intensity are known to strongly impact on cyanobacteria growth. To shed light on these issues, kinetic, bioenergetic and thermodynamic parameters of batch Arthrospira platensis cultures were estimated along the time at photosynthetic photon flux density (PPFD) of 70μmolm(-2)s(-1) in different photobioreactors with different surface/volume ratio (S/V), namely open pond (0.25cm(-1)), shaken flask (0.48cm(-1)), horizontal photobioreactor (HoP) (1.94cm(-1)) and helicoidal photobioreactor (HeP) (3.88cm(-1)). Maximum biomass concentration and productivity remarkably increased with S/V up to 1.94cm(-1). HoP was shown to be the best-performing system throughout the whole runs, while HeP behaved better only at the start. Runs carried out in HoP increasing PPFD from 40 to 100μmolm(-2)s(-1) revealed a progressive enhancement of bioenergetics and thermodynamics likely because of favorable light distribution. HoP appeared to be a promising configuration to perform high-yield indoor cyanobacterial cultures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Study of Exciton Hopping Transport in PbS Colloidal Quantum Dot Thin Films Using Frequency- and Temperature-Scanned Photocarrier Radiometry

    NASA Astrophysics Data System (ADS)

    Hu, Lilei; Mandelis, Andreas; Melnikov, Alexander; Lan, Xinzheng; Hoogland, Sjoerd; Sargent, Edward H.

    2017-01-01

    Solution-processed colloidal quantum dots (CQDs) are promising materials for realizing low-cost, large-area, and flexible photovoltaic devices. The study of charge carrier transport in quantum dot solids is essential for understanding energy conversion mechanisms. Recently, solution-processed two-layer oleic-acid-capped PbS CQD solar cells with one layer treated with tetrabutylammonium iodide (TBAI) serving as the main light-absorbing layer and the other treated with 1,2-ethanedithiol (EDT) acting as an electron-blocking/hole-extraction layer were reported. These solar cells demonstrated a significant improvement in power conversion efficiency of 8.55% and long-term air stability. Coupled with photocarrier radiometry measurements, this work used a new trap-state mediated exciton hopping transport model, specifically for CQD thin films, to unveil and quantify exciton transport mechanisms through the extraction of hopping transport parameters including exciton lifetimes, hopping diffusivity, exciton detrapping time, and trap-state density. It is shown that PbS-TBAI has higher trap-state density than PbS-EDT that results in higher PbS-EDT exciton lifetimes. Hopping diffusivities of both CQD thin film types show similar temperature dependence, particularly higher temperatures yield higher hopping diffusivity. The higher diffusivity of PbS-TBAI compared with PbS-EDT indicates that PbS-TBAI is a much better photovoltaic material than PbS-EDT. Furthermore, PCR temperature spectra and deep-level photothermal spectroscopy provided additional insights to CQD surface trap states: PbS-TBAI thin films exhibit a single dominant trap level, while PbS-EDT films with lower trap-state densities show multiple trap levels.

  11. Rapid differentiation of citrus Hop stunt viroid variants by use of real-time RT-PCR and high resolution melting analysis

    USDA-ARS?s Scientific Manuscript database

    The RNA genome of Hop stunt viroid (HSVd) contains five to six nucleotides in a variable (V) domain, called the cachexia expression motif, which is associated with pathogenic and non-pathogenic variants in citrus. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological i...

  12. An efficient implementation of semiempirical quantum-chemical orthogonalization-corrected methods for excited-state dynamics

    NASA Astrophysics Data System (ADS)

    Liu, Jie; Thiel, Walter

    2018-04-01

    We present an efficient implementation of configuration interaction with single excitations (CIS) for semiempirical orthogonalization-corrected OMx methods and standard modified neglect of diatomic overlap (MNDO)-type methods for the computation of vertical excitation energies as well as analytical gradients and nonadiabatic couplings. This CIS implementation is combined with Tully's fewest switches algorithm to enable surface hopping simulations of excited-state nonadiabatic dynamics. We introduce an accurate and efficient expression for the semiempirical evaluation of nonadiabatic couplings, which offers a significant speedup for medium-size molecules and is suitable for use in long nonadiabatic dynamics runs. As a pilot application, the semiempirical CIS implementation is employed to investigate ultrafast energy transfer processes in a phenylene ethynylene dendrimer model.

  13. An efficient implementation of semiempirical quantum-chemical orthogonalization-corrected methods for excited-state dynamics.

    PubMed

    Liu, Jie; Thiel, Walter

    2018-04-21

    We present an efficient implementation of configuration interaction with single excitations (CIS) for semiempirical orthogonalization-corrected OMx methods and standard modified neglect of diatomic overlap (MNDO)-type methods for the computation of vertical excitation energies as well as analytical gradients and nonadiabatic couplings. This CIS implementation is combined with Tully's fewest switches algorithm to enable surface hopping simulations of excited-state nonadiabatic dynamics. We introduce an accurate and efficient expression for the semiempirical evaluation of nonadiabatic couplings, which offers a significant speedup for medium-size molecules and is suitable for use in long nonadiabatic dynamics runs. As a pilot application, the semiempirical CIS implementation is employed to investigate ultrafast energy transfer processes in a phenylene ethynylene dendrimer model.

  14. Efficient algorithms for the simulation of non-adiabatic electron transfer in complex molecular systems: application to DNA.

    PubMed

    Kubař, Tomáš; Elstner, Marcus

    2013-04-28

    In this work, a fragment-orbital density functional theory-based method is combined with two different non-adiabatic schemes for the propagation of the electronic degrees of freedom. This allows us to perform unbiased simulations of electron transfer processes in complex media, and the computational scheme is applied to the transfer of a hole in solvated DNA. It turns out that the mean-field approach, where the wave function of the hole is driven into a superposition of adiabatic states, leads to over-delocalization of the hole charge. This problem is avoided using a surface hopping scheme, resulting in a smaller rate of hole transfer. The method is highly efficient due to the on-the-fly computation of the coarse-grained DFT Hamiltonian for the nucleobases, which is coupled to the environment using a QM/MM approach. The computational efficiency and partial parallel character of the methodology make it possible to simulate electron transfer in systems of relevant biochemical size on a nanosecond time scale. Since standard non-polarizable force fields are applied in the molecular-mechanics part of the calculation, a simple scaling scheme was introduced into the electrostatic potential in order to simulate the effect of electronic polarization. It is shown that electronic polarization has an important effect on the features of charge transfer. The methodology is applied to two kinds of DNA sequences, illustrating the features of transfer along a flat energy landscape as well as over an energy barrier. The performance and relative merit of the mean-field scheme and the surface hopping for this application are discussed.

  15. 45 MPH 6,000-Pound and 10,000-Pound Rough Terrain Fork Lift Truck Feasibility Study.

    DTIC Science & Technology

    1986-06-24

    Airport Post Office Box 66911 Chicago, IL 60666 NPN Security Classification of This Page REPORT DOCUMENTATION PAGE la . Report Security Classification...HOP Unausended Duadin., 20 - I: - 1 1.8 Inch RMS Road 14 la -3 * Clam C (0.93 Inch RMS) Rod w 12 10 10 Per~cent 9 P 7 U. 3 Percent 3 2 0 20 40 SPM...elm 10 67- * * 3 o *" - .2 0 20 40 W (mph) 4/2/ SOJA Figure 75. Rear Wheel Hop on Four Road Surfaces (10K RTFLT Unsuspended Baseline) " Page 93 Adding

  16. The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers

    NASA Astrophysics Data System (ADS)

    Di, Bing; Wang, Ya-Dong; Zhang, Ya-Lin; An, Zhong

    2013-06-01

    The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons.

  17. Mechanism of photocatalytic water oxidation on small TiO 2 nanoparticles

    DOE PAGES

    Muuronen, Mikko; Parker, Shane M.; Berardo, Enrico; ...

    2016-12-07

    Here, we present the first unconstrained nonadiabatic molecular dynamics (NAMD) simulations of photocatalytic water oxidation by small hydrated TiO 2 nanoparticles using Tully surface hopping and time-dependent density functional theory. The results indicate that ultrafast electron–proton transfer from physisorbed water to the photohole initiates the photo-oxidation on the S 1 potential energy surface. The new mechanism readily explains the observation of mobile hydroxyl radicals in recent experiments. Two key driving forces for the photo-oxidation reaction are identified: localization of the electron–hole pair and stabilization of the photohole by hydrogen bonding interaction. Our findings illustrate the scope of recent advances inmore » NAMD methods and emphasize the importance of explicit simulation of electronic excitations.« less

  18. Surface hopping with a manifold of electronic states. III. Transients, broadening, and the Marcus picture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dou, Wenjie; Subotnik, Joseph E.; Nitzan, Abraham

    2015-06-21

    In a previous paper [Dou et al., J. Chem. Phys. 142, 084110 (2015)], we have introduced a surface hopping (SH) approach to deal with the Anderson-Holstein model. Here, we address some interesting aspects that have not been discussed previously, including transient phenomena and extensions to arbitrary impurity-bath couplings. In particular, in this paper we show that the SH approach captures phonon coherence beyond the secular approximation, and that SH rates agree with Marcus theory at steady state. Finally, we show that, in cases where the electronic tunneling rate depends on nuclear position, a straightforward use of Marcus theory rates yieldsmore » a useful starting point for capturing level broadening. For a simple such model, we find I-V curves that exhibit negative differential resistance.« less

  19. Frequency hopping due to acousto-electric interaction in ZnO based surface acoustic wave oscillator

    NASA Astrophysics Data System (ADS)

    Dasgupta, Daipayan; Sreenivas, K.

    2011-08-01

    A 36 MHz surface acoustic wave delay line based oscillator has been used to study the effect of acousto-electric interaction due to photo generated charge carriers in rf sputtered ZnO film under UV illumination (λ = 365 nm, 20-100 μW/cm2). Design aspects for developing a delay line based SAW oscillator are specified. The observed linear downshift in frequency (2.2 to 19.0 kHz) with varying UV intensity (20-100 μW/cm2) is related to the fractional velocity change due to acousto-electric interaction. UV illumination level of 100 μW/cm2 leads to a characteristic frequency hopping behavior arising due to a change in the oscillation criteria, and is attributed to the complex interplay between the increased attenuation and velocity shift.

  20. Associations Among Quadriceps Strength and Rate of Torque Development 6 Weeks Post Anterior Cruciate Ligament Reconstruction and Future Hop and Vertical Jump Performance: A Prospective Cohort Study.

    PubMed

    Pua, Yong-Hao; Mentiplay, Benjamin F; Clark, Ross A; Ho, Jia-Ying

    2017-11-01

    Study Design Prospective cohort. Background Quadriceps strength is associated with hop distance and jump height in persons who have undergone anterior cruciate ligament (ACL) reconstruction. However, it is unknown whether the ability to rapidly generate quadriceps torque in the early phase of recovery is associated with future hopping and jumping performance in this population. Objective To evaluate the prospective associations among quadriceps strength and rate of torque development (RTD) and single-leg hop for distance, vertical jump height, vertical ground reaction force (vGRF), and vertical force loading rate during a landing task in persons who have undergone ACL reconstruction. Methods Seventy patients with unilateral ACL reconstruction participated. At 6 weeks post ACL reconstruction, isometric quadriceps strength and RTD were measured using a dynamometer. At 6 months following ACL reconstruction, patients performed the single-leg hop for distance test. Patients also performed the single-leg vertical jump test on a force plate that measured maximum jump height, vGRF, and average loading rate during landing. Results Both quadriceps strength and RTD at 6 weeks post ACL reconstruction were associated with all hopping and jumping measures at 6 months post ACL reconstruction (P≤.04). Single-leg hop distance was associated more closely with quadriceps strength than with quadriceps RTD (P = .05), and vertical jump height and vGRF measures were associated more closely with quadriceps RTD than with quadriceps strength (P = .05 and P<.01, respectively). Both quadriceps measures were associated with loading rate. Conclusion Quadriceps strength and RTD are complementary but distinct predictors of future hopping and jumping performance in persons who have undergone ACL reconstruction. These findings may contribute to improved rehabilitation of patients who are at risk for poor jumping/hopping performance and abnormal knee loading. J Orthop Sports Phys Ther 2017;47(11):845-852. Epub 13 Oct 2017. doi:10.2519/jospt.2017.7133.

  1. Single-legged Hop Tests as Predictors of Self-reported Knee Function After Anterior Cruciate Ligament Reconstruction

    PubMed Central

    Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn

    2012-01-01

    Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times more likely to have a crossover hop LSI greater than the 95% cutoff than those with knee function below normal ranges. No preoperative single-legged hop test predicted self-reported knee function within normal ranges 1 year after ACL reconstruction (all P > .353). Conclusion Single-legged hop tests conducted 6 months after ACL reconstruction can predict the likelihood of successful and unsuccessful outcome 1 year after ACL reconstruction. Patients demonstrating less than the 88% cutoff score on the 6-m timed hop test at 6 months may benefit from targeted training to improve limb symmetry in an attempt to normalize function. Patients with minimal side-to-side differences on the crossover hop test at 6 months possibly will have good knee function at 1 year if they continue with their current training regimen. Preoperative single-legged hop tests are not able to predict postoperative outcomes. PMID:22926749

  2. Scanning ion conductance microscopy for visualizing the three-dimensional surface topography of cells and tissues.

    PubMed

    Nakajima, Masato; Mizutani, Yusuke; Iwata, Futoshi; Ushiki, Tatsuo

    2018-01-01

    Scanning ion conductance microscopy (SICM), which belongs to the family of scanning probe microscopy, regulates the tip-sample distance by monitoring the ion current through the use of an electrolyte-filled nanopipette as the probing tip. Thus, SICM enables "contact-free" imaging of cell surface topography in liquid conditions. In this paper, we applied hopping mode SICM for obtaining topographical images of convoluted tissue samples such as trachea and kidney in phosphate buffered saline. Some of the SICM images were compared with the images obtained by scanning electron microscopy (SEM) after drying the same samples. We showed that the imaging quality of hopping mode SICM was excellent enough for investigating the three-dimensional surface structure of the soft tissue samples. Thus, SICM is expected to be used for imaging a wide variety of cells and tissues - either fixed or alive- at high resolution under physiologically relevant liquid conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. HUNTING FOR YOUNG DISPERSING STAR CLUSTERS IN IC 2574

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pellerin, Anne; Meyer, Martin M.; Calzetti, Daniella

    2012-12-01

    Dissolving stellar groups are very difficult to detect using traditional surface photometry techniques. We have developed a method to find and characterize non-compact stellar systems in galaxies where the young stellar population can be spatially resolved. By carrying out photometry on individual stars, we are able to separate the luminous blue stellar population from the star field background. The locations of these stars are used to identify groups by applying the HOP algorithm, which are then characterized using color-magnitude and stellar density radial profiles to estimate age, size, density, and shape. We test the method on Hubble Space Telescope Advancedmore » Camera for Surveys archival images of IC 2574 and find 75 dispersed stellar groups. Of these, 20 highly dispersed groups are good candidates for dissolving systems. We find few compact systems with evidence of dissolution, potentially indicating that star formation in this galaxy occurs mostly in unbound clusters or groups. These systems indicate that the dispersion rate of groups and clusters in IC 2574 is at most 0.45 pc Myr{sup -1}. The location of the groups found with HOP correlate well with H I contour map features. However, they do not coincide with H I holes, suggesting that those holes were not created by star-forming regions.« less

  4. The Effect of the Spin-Forbidden Co((sup 1) Sigma plus) plus O((sup 3) P) Yields CO2 (1 Sigma (sub G) plus) Recombination Reaction on Afterbody Heating of Mars Entry Vehicles

    NASA Technical Reports Server (NTRS)

    Xu, Lu T.; Jaffe, Richard L.; Schwenke, David W.; Panesi, Marco

    2017-01-01

    Vibrationally excited CO2, formed by two-body recombination from CO((sup 1) sigma plus) and O((sup 3) P) in the wake behind spacecraft entering the Martian atmosphere reaction, is potentially responsible for the higher than anticipated radiative heating of the backshell, compared to pre-flight predictions. This process involves a spin-forbidden transition of the transient triplet CO2 molecule to the longer-lived singlet. To accurately predict the singlet-triplet transition probability and estimate the thermal rate coefficient of the recombination reaction, ab initio methods were used to compute the first singlet and three lowest triplet CO2 potential energy surfaces and the spin-orbit coupling matrix elements between these states. Analytical fits to these four potential energy surfaces were generated for surface hopping trajectory calculations, using Tully's fewest switches surface hopping algorithm. Preliminary results for the trajectory calculations are presented. The calculated probability of a CO((sup 1) sigma plus) and O((sup 3) P) collision leading to singlet CO2 formation is on the order of 10 (sup -4). The predicted flowfield conditions for various Mars entry scenarios predict temperatures in the range of 1000 degrees Kelvin - 4000 degrees Kelvin and pressures in the range of 300-2500 pascals at the shoulder and in the wake, which is consistent with a heavy-particle collision frequency of 10 (sup 6) to 10 (sup 7) per second. Owing to this low collision frequency, it is likely that CO((sup 1) sigma plus) molecules formed by this mechanism will mostly be frozen in a highly nonequilibrium rovibrational energy state until they relax by photoemission.

  5. Non-adiabatic excited state molecular dynamics of phenylene ethynylene dendrimer using a multiconfigurational Ehrenfest approach

    DOE PAGES

    Fernandez-Alberti, Sebastian; Makhov, Dmitry V.; Tretiak, Sergei; ...

    2016-03-10

    Photoinduced dynamics of electronic and vibrational unidirectional energy transfer between meta-linked building blocks in a phenylene ethynylene dendrimer is simulated using a multiconfigurational Ehrenfest in time-dependent diabatic basis (MCE-TDDB) method, a new variant of the MCE approach developed by us for dynamics involving multiple electronic states with numerous abrupt crossings. Excited-state energies, gradients and non-adiabatic coupling terms needed for dynamics simulation are calculated on-the-fly using the Collective Electron Oscillator (CEO) approach. In conclusion, a comparative analysis of our results obtained using MCE-TDDB, the conventional Ehrenfest method and the surface-hopping approach with and without decoherence corrections is presented.

  6. Ice particle morphology and microphysical properties of cirrus clouds inferred from combined CALIOP-IIR measurements

    NASA Astrophysics Data System (ADS)

    Saito, Masanori; Iwabuchi, Hironobu; Yang, Ping; Tang, Guanglin; King, Michael D.; Sekiguchi, Miho

    2017-04-01

    Ice particle morphology and microphysical properties of cirrus clouds are essential for assessing radiative forcing associated with these clouds. We develop an optimal estimation-based algorithm to infer cirrus cloud optical thickness (COT), cloud effective radius (CER), plate fraction including quasi-horizontally oriented plates (HOPs), and the degree of surface roughness from the Cloud Aerosol Lidar with Orthogonal Polarization (CALIOP) and the Infrared Imaging Radiometer (IIR) on the Cloud Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) platform. A simple but realistic ice particle model is used, and the relevant bulk optical properties are computed using state-of-the-art light-scattering computational capabilities. Rigorous estimation of uncertainties related to surface properties, atmospheric gases, and cloud heterogeneity is performed. The results based on the present method show that COTs are quite consistent with other satellite products and CERs essentially agree with the other counterparts. A 1 month global analysis for April 2007, in which CALIPSO off-nadir angle is 0.3°, shows that the HOP has significant temperature-dependence and is critical to the lidar ratio when cloud temperature is warmer than -40°C. The lidar ratio is calculated from the bulk optical properties based on the inferred parameters, showing robust temperature dependence. The median lidar ratio of cirrus clouds is 27-31 sr over the globe.

  7. Effective dynamics of a random walker on a heterogeneous ring: Exact results

    NASA Astrophysics Data System (ADS)

    Masharian, S. R.

    2018-07-01

    In this paper, by considering a biased random walker hopping on a one-dimensional lattice with a ring geometry, we investigate the fluctuations of the speed of the random walker. We assume that the lattice is heterogeneous i.e. the hopping rate of the random walker between the first and the last lattice sites is different from the hopping rate of the random walker between the other links of the lattice. Assuming that the average speed of the random walker in the steady-state is v∗, we have been able to find the unconditional effective dynamics of the random walker where the absolute value of the average speed of the random walker is -v∗. Using a perturbative method in the large system-size limit, we have also been able to show that the effective hopping rates of the random walker near the defective link are highly site-dependent.

  8. The crossover between tunnel and hopping conductivity in granulated films of noble metals

    NASA Astrophysics Data System (ADS)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

    2017-11-01

    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  9. An Open-Label Randomized Control Trial of Hopping and Jumping Training versus Sensorimotor Rehabilitation Programme on Postural Capacities in Individuals with Intellectual Disabilities

    ERIC Educational Resources Information Center

    Borji, Rihab; Sahli, Sonia; Baccouch, Rym; Laatar, Rabeb; Kachouri, Hiba; Rebai, Haithem

    2018-01-01

    Background: This study aimed to compare the effectiveness of a hopping and jumping training programme (HJP) versus a sensorimotor rehabilitation programme (SRP) on postural performances in children with intellectual disability. Methods: Three groups of children with intellectual disability participated in the study: the HJP group, the SRP group…

  10. Guiding the Influence of Hip-Hop Music on Middle-School Students' Feelings, Thinking, and Behaving

    ERIC Educational Resources Information Center

    Brown, Veda

    2006-01-01

    Although the nature of the relationship of music on students' emotional development remains an issue for continued research, my overall purpose is to provide adults with research-based methods to help children become better consumers of hip-hop music. First, I identify research-based recommendations to prepare adults as facilitators of children's…

  11. What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

    ERIC Educational Resources Information Center

    Love, Bettina L.

    2015-01-01

    Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

  12. Pedagogical Ideas on Sonic, Mediated, and Virtual Musical Landscapes: Teaching Hip Hop in a University Classroom

    ERIC Educational Resources Information Center

    Dhokai, Niyati

    2012-01-01

    Based on the experience of teaching the history of American hip hop music to a classroom of Canadian university students, the author considers the disjuncture between the cultural orientations of herself and her students. The author considers teaching methods to solve the place-based disjuncture that often occurs when teaching genres such as hip…

  13. Optimisation of active suspension control inputs for improved vehicle ride performance

    NASA Astrophysics Data System (ADS)

    Čorić, Mirko; Deur, Joško; Xu, Li; Tseng, H. Eric; Hrovat, Davor

    2016-07-01

    A collocation-type control variable optimisation method is used in the paper to analyse to which extent the fully active suspension (FAS) can improve the vehicle ride comfort while preserving the wheel holding ability. The method is first applied for a cosine-shaped bump road disturbance of different heights, and for both quarter-car and full 10 degree-of-freedom vehicle models. A nonlinear anti-wheel hop constraint is considered, and the influence of bump preview time period is analysed. The analysis is then extended to the case of square- or cosine-shaped pothole with different lengths, and the quarter-car model. In this case, the cost function is extended with FAS energy consumption and wheel damage resilience costs. The FAS action is found to be such to provide a wheel hop over the pothole, in order to avoid or minimise the damage at the pothole trailing edge. In the case of long pothole, when the FAS cannot provide the wheel hop, the wheel is travelling over the pothole bottom and then hops over the pothole trailing edge. The numerical optimisation results are accompanied by a simplified algebraic analysis.

  14. Multiple coupled landscapes and non-adiabatic dynamics with applications to self-activating genes.

    PubMed

    Chen, Cong; Zhang, Kun; Feng, Haidong; Sasai, Masaki; Wang, Jin

    2015-11-21

    Many physical, chemical and biochemical systems (e.g. electronic dynamics and gene regulatory networks) are governed by continuous stochastic processes (e.g. electron dynamics on a particular electronic energy surface and protein (gene product) synthesis) coupled with discrete processes (e.g. hopping among different electronic energy surfaces and on and off switching of genes). One can also think of the underlying dynamics as the continuous motion on a particular landscape and discrete hoppings among different landscapes. The main difference of such systems from the intra-landscape dynamics alone is the emergence of the timescale involved in transitions among different landscapes in addition to the timescale involved in a particular landscape. The adiabatic limit when inter-landscape hoppings are fast compared to continuous intra-landscape dynamics has been studied both analytically and numerically, but the analytical treatment of the non-adiabatic regime where the inter-landscape hoppings are slow or comparable to continuous intra-landscape dynamics remains challenging. In this study, we show that there exists mathematical mapping of the dynamics on 2(N) discretely coupled N continuous dimensional landscapes onto one single landscape in 2N dimensional extended continuous space. On this 2N dimensional landscape, eddy current emerges as a sign of non-equilibrium non-adiabatic dynamics and plays an important role in system evolution. Many interesting physical effects such as the enhancement of fluctuations, irreversibility, dissipation and optimal kinetics emerge due to non-adiabaticity manifested by the eddy current illustrated for an N = 1 self-activator. We further generalize our theory to the N-gene network with multiple binding sites and multiple synthesis rates for discretely coupled non-equilibrium stochastic physical and biological systems.

  15. Adsorption and dynamics of Si atoms at the monolayer Pb/Si(111) surface

    NASA Astrophysics Data System (ADS)

    Kumar, Rakesh; Fang, Chuang-Kai; Lee, Chih-Hao; Hwang, Ing-Shouh

    2017-06-01

    In this work, we studied the adsorption behavior of deposited Si atoms along with their diffusion and other dynamic processes on a Pb monolayer-covered Si(111) surface from 125 to 230 K using a variable-temperature scanning tunneling microscope. The Pb-covered Si(111) surface forms a low-symmetry rowlike (√{7 }×√{3 } ) structure in this temperature range and the Si atoms bind favorably to two specific on-top sites (T1 A and T1 B) on the trimer row after deposition at the sample temperature of ˜125 K . The Si atoms were immobile at low temperatures and started to switch between the two neighboring T1 A and T1 B sites within the same trimer when the temperature was raised to ˜150 K . When the temperature was raised above ˜160 K , the adsorbed Si atoms could hop to other trimers along the same trimer row. Below ˜170 K , short hops to adjacent trimers dominated, but long hops dominated at temperatures above ˜170 K . The activation energy and prefactor for the Si atoms diffusion were derived through analysis of continuous-time imaging at temperatures from 160 to 174 K. In addition, irreversible aggregation of single Si atoms into Si clusters started to occur at the phase boundaries or defective sites at temperatures above ˜170 K . At temperature above ˜180 K , nearly all Si atoms aggregated into clusters, which may have important implications for the atomic mechanism of epitaxial growth of Si on the Pb-covered Si(111) surface. In addition, our study provides strong evidence for breaking in the mirror symmetry in the (√{7 }×√{3 } )-Pb structure, which has implications for the atomic model of this controversial structure.

  16. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    PubMed

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  17. Network-assisted target identification for haploinsufficiency and homozygous profiling screens

    PubMed Central

    Wang, Sheng

    2017-01-01

    Chemical genomic screens have recently emerged as a systematic approach to drug discovery on a genome-wide scale. Drug target identification and elucidation of the mechanism of action (MoA) of hits from these noisy high-throughput screens remain difficult. Here, we present GIT (Genetic Interaction Network-Assisted Target Identification), a network analysis method for drug target identification in haploinsufficiency profiling (HIP) and homozygous profiling (HOP) screens. With the drug-induced phenotypic fitness defect of the deletion of a gene, GIT also incorporates the fitness defects of the gene’s neighbors in the genetic interaction network. On three genome-scale yeast chemical genomic screens, GIT substantially outperforms previous scoring methods on target identification on HIP and HOP assays, respectively. Finally, we showed that by combining HIP and HOP assays, GIT further boosts target identification and reveals potential drug’s mechanism of action. PMID:28574983

  18. Genetic and epigenetic stability of cryopreserved and cold-stored hops (Humulus lupulus L.).

    PubMed

    Peredo, Elena L; Arroyo-García, Rosa; Reed, Barbara M; Revilla, M Angeles

    2008-12-01

    Conventional cold storage and cryopreservation methods for hops (Humulus lupulus L.) are available but, to our knowledge, the genetic and epigenetic stability of the recovered plants have not been tested. This study analyzed 51 accessions of hop using the molecular techniques, Random Amplified DNA Polymorphism (RAPD) and Amplified Fragment Length Polymorphism (AFLP), revealing no genetic variation among greenhouse-grown controls and cold stored or cryopreserved plants. Epigenetic stability was evaluated using Methylation Sensitive Amplified Polymorphism (MSAP). Over 36% of the loci were polymorphic when the cold and cryo-treated plants were compared to greenhouse plants. The main changes were demethylation events and they were common to the cryopreserved and cold stored plants indicating the possible effect of the in vitro establishment process, an essential step in both protocols. Protocol-specific methylation patterns were also detected indicating that both methods produced epigenetic changes in plants following cold storage and cryopreservation.

  19. Robust passive dynamics of the musculoskeletal system compensate for unexpected surface changes during human hopping

    PubMed Central

    van der Krogt, Marjolein M.; de Graaf, Wendy W.; Farley, Claire T.; Moritz, Chet T.; Richard Casius, L. J.; Bobbert, Maarten F.

    2009-01-01

    When human hoppers are surprised by a change in surface stiffness, they adapt almost instantly by changing leg stiffness, implying that neural feedback is not necessary. The goal of this simulation study was first to investigate whether leg stiffness can change without neural control adjustment when landing on an unexpected hard or unexpected compliant (soft) surface, and second to determine what underlying mechanisms are responsible for this change in leg stiffness. The muscle stimulation pattern of a forward dynamic musculoskeletal model was optimized to make the model match experimental hopping kinematics on hard and soft surfaces. Next, only surface stiffness was changed to determine how the mechanical interaction of the musculoskeletal model with the unexpected surface affected leg stiffness. It was found that leg stiffness adapted passively to both unexpected surfaces. On the unexpected hard surface, leg stiffness was lower than on the soft surface, resulting in close-to-normal center of mass displacement. This reduction in leg stiffness was a result of reduced joint stiffness caused by lower effective muscle stiffness. Faster flexion of the joints due to the interaction with the hard surface led to larger changes in muscle length, while the prescribed increase in active state and resulting muscle force remained nearly constant in time. Opposite effects were found on the unexpected soft surface, demonstrating the bidirectional stabilizing properties of passive dynamics. These passive adaptations to unexpected surfaces may be critical when negotiating disturbances during locomotion across variable terrain. PMID:19589956

  20. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    NASA Astrophysics Data System (ADS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  1. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com; Ghaisas, S. V.

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked outmore » from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.« less

  2. Single-Step Electrophoretic Deposition of Non-noble Metal Catalyst Layer with Low Onset Voltage for Ethanol Electro-oxidation.

    PubMed

    Ahmadi Daryakenari, Ahmad; Hosseini, Davood; Ho, Ya-Lun; Saito, Takumi; Apostoluk, Aleksandra; Müller, Christoph R; Delaunay, Jean-Jacques

    2016-06-29

    A single-step electrophoretic deposition (EPD) process is used to fabricate catalyst layers which consist of nickel oxide nanoparticles attached on the surface of nanographitic flakes. Magnesium ions present in the colloid charge positively the flake's surface as they attach on it and are also used to bind nanographitic flakes together. The fabricated catalyst layers showed a very low onset voltage (-0.2 V vs Ag/AgCl) in the electro-oxidation of ethanol. To clarify the occurring catalytic mechanism, we performed annealing treatment to produce samples having a different electrochemical behavior with a large onset voltage. Temperature dependence measurements of the layer conductivity pointed toward a charge transport mechanism based on hopping for the nonannealed layers, while the drift transport is observed in the annealed layers. The hopping charge transport is responsible for the appearance of the low onset voltage in ethanol electro-oxidation.

  3. Computationally efficient characterization of potential energy surfaces based on fingerprint distances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schaefer, Bastian; Goedecker, Stefan, E-mail: stefan.goedecker@unibas.ch

    2016-07-21

    An analysis of the network defined by the potential energy minima of multi-atomic systems and their connectivity via reaction pathways that go through transition states allows us to understand important characteristics like thermodynamic, dynamic, and structural properties. Unfortunately computing the transition states and reaction pathways in addition to the significant energetically low-lying local minima is a computationally demanding task. We here introduce a computationally efficient method that is based on a combination of the minima hopping global optimization method and the insight that uphill barriers tend to increase with increasing structural distances of the educt and product states. This methodmore » allows us to replace the exact connectivity information and transition state energies with alternative and approximate concepts. Without adding any significant additional cost to the minima hopping global optimization approach, this method allows us to generate an approximate network of the minima, their connectivity, and a rough measure for the energy needed for their interconversion. This can be used to obtain a first qualitative idea on important physical and chemical properties by means of a disconnectivity graph analysis. Besides the physical insight obtained by such an analysis, the gained knowledge can be used to make a decision if it is worthwhile or not to invest computational resources for an exact computation of the transition states and the reaction pathways. Furthermore it is demonstrated that the here presented method can be used for finding physically reasonable interconversion pathways that are promising input pathways for methods like transition path sampling or discrete path sampling.« less

  4. Adaptive Transmission and Channel Modeling for Frequency Hopping Communications

    DTIC Science & Technology

    2009-09-21

    proposed adaptive transmission method has much greater system capacity than conventional non-adaptive MC direct- sequence ( DS )- CDMA system. • We...several mobile radio systems. First, a new improved allocation algorithm was proposed for multicarrier code-division multiple access (MC- CDMA ) system...Multicarrier code-division multiple access (MC- CDMA ) system with adaptive frequency hopping (AFH) has attracted attention of researchers due to its

  5. Confined diffusion of transmembrane proteins and lipids induced by the same actin meshwork lining the plasma membrane

    PubMed Central

    Fujiwara, Takahiro K.; Iwasawa, Kokoro; Kalay, Ziya; Tsunoyama, Taka A.; Watanabe, Yusuke; Umemura, Yasuhiro M.; Murakoshi, Hideji; Suzuki, Kenichi G. N.; Nemoto, Yuri L.; Morone, Nobuhiro; Kusumi, Akihiro

    2016-01-01

    The mechanisms by which the diffusion rate in the plasma membrane (PM) is regulated remain unresolved, despite their importance in spatially regulating the reaction rates in the PM. Proposed models include entrapment in nanoscale noncontiguous domains found in PtK2 cells, slow diffusion due to crowding, and actin-induced compartmentalization. Here, by applying single-particle tracking at high time resolutions, mainly to the PtK2-cell PM, we found confined diffusion plus hop movements (termed “hop diffusion”) for both a nonraft phospholipid and a transmembrane protein, transferrin receptor, and equal compartment sizes for these two molecules in all five of the cell lines used here (actual sizes were cell dependent), even after treatment with actin-modulating drugs. The cross-section size and the cytoplasmic domain size both affected the hop frequency. Electron tomography identified the actin-based membrane skeleton (MSK) located within 8.8 nm from the PM cytoplasmic surface of PtK2 cells and demonstrated that the MSK mesh size was the same as the compartment size for PM molecular diffusion. The extracellular matrix and extracellular domains of membrane proteins were not involved in hop diffusion. These results support a model of anchored TM-protein pickets lining actin-based MSK as a major mechanism for regulating diffusion. PMID:26864625

  6. HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.

    PubMed

    Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar

    2018-05-08

    HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.

  7. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

    PubMed

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-09-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

  8. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping

    PubMed Central

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-01-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results. PMID:27799670

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. Multi-Hop Teleportation of an Unknown Qubit State Based on W States

    NASA Astrophysics Data System (ADS)

    Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen

    2018-04-01

    Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.

  11. Partially entangled states bridge in quantum teleportation

    NASA Astrophysics Data System (ADS)

    Cai, Xiao-Fei; Yu, Xu-Tao; Shi, Li-Hui; Zhang, Zai-Chen

    2014-10-01

    The traditional method for information transfer in a quantum communication system using partially entangled state resource is quantum distillation or direct teleportation. In order to reduce the waiting time cost in hop-by-hop transmission and execute independently in each node, we propose a quantum bridging method with partially entangled states to teleport quantum states from source node to destination node. We also prove that the designed specific quantum bridging circuit is feasible for partially entangled states teleportation across multiple intermediate nodes. Compared to two traditional ways, our partially entanglement quantum bridging method uses simpler logic gates, has better security, and can be used in less quantum resource situation.

  12. DETERMINATION OF CLINICALLY RELEVANT DIFFERENCES IN FRONTAL PLANE HOP TESTS IN WOMEN'S COLLEGIATE BASKETBALL AND SOCCER PLAYERS

    PubMed Central

    Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung

    2017-01-01

    Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p < 0.05). Significant side differences (p = 0.02) were identified in the entire population for the medial triple hop test, such that participants jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally, the medial triple hop for distance test may be effective at identifying side‐to‐side asymmetries Level of Evidence 3 PMID:28515972

  13. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    NASA Astrophysics Data System (ADS)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of engagement for STEAM educators. It concluded with suggestions for future research that further explicates hip hop epistemology and Hip Hop STEAM Pedagogy.

  14. RELIABILITY AND VALIDITY OF FUNCTIONAL PERFORMANCE TESTS IN DANCERS WITH HIP DYSFUNCTION

    PubMed Central

    Carcia, Christopher R.; Clemente, F. Richard; Phelps, Amy L.; Martin, RobRoy L.

    2013-01-01

    Study Design: Quasi-experimental, repeated measures. Purpose/Background: Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. Methods: Nineteen female dancers (age: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Results: Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = −4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = −0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = −0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = −1.84, p=0.08) were not statistically different between sides. Conclusion: The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. Level of Evidence: 3b. Non-consecutive cohort study PMID:24175123

  15. Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment.

    PubMed

    Traore, Boubacar; Pedesseau, Laurent; Assam, Linda; Che, Xiaoyang; Blancon, Jean-Christophe; Tsai, Hsinhan; Nie, Wanyi; Stoumpos, Constantinos C; Kanatzidis, Mercouri G; Tretiak, Sergei; Mohite, Aditya D; Even, Jacky; Kepenekian, Mikaël; Katan, Claudine

    2018-04-24

    Layered hybrid organic-inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers' confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignments becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Thus, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.

  16. Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment

    DOE PAGES

    Traore, Boubacar; Pedesseau, Laurent; Assam, Linda; ...

    2018-02-26

    Layered hybrid organic–inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers’ confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignmentsmore » becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Furthermore, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.« less

  17. Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Traore, Boubacar; Pedesseau, Laurent; Assam, Linda

    Layered hybrid organic–inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers’ confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignmentsmore » becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Furthermore, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.« less

  18. Army ants algorithm for rare event sampling of delocalized nonadiabatic transitions by trajectory surface hopping and the estimation of sampling errors by the bootstrap method.

    PubMed

    Nangia, Shikha; Jasper, Ahren W; Miller, Thomas F; Truhlar, Donald G

    2004-02-22

    The most widely used algorithm for Monte Carlo sampling of electronic transitions in trajectory surface hopping (TSH) calculations is the so-called anteater algorithm, which is inefficient for sampling low-probability nonadiabatic events. We present a new sampling scheme (called the army ants algorithm) for carrying out TSH calculations that is applicable to systems with any strength of coupling. The army ants algorithm is a form of rare event sampling whose efficiency is controlled by an input parameter. By choosing a suitable value of the input parameter the army ants algorithm can be reduced to the anteater algorithm (which is efficient for strongly coupled cases), and by optimizing the parameter the army ants algorithm may be efficiently applied to systems with low-probability events. To demonstrate the efficiency of the army ants algorithm, we performed atom-diatom scattering calculations on a model system involving weakly coupled electronic states. Fully converged quantum mechanical calculations were performed, and the probabilities for nonadiabatic reaction and nonreactive deexcitation (quenching) were found to be on the order of 10(-8). For such low-probability events the anteater sampling scheme requires a large number of trajectories ( approximately 10(10)) to obtain good statistics and converged semiclassical results. In contrast by using the new army ants algorithm converged results were obtained by running 10(5) trajectories. Furthermore, the results were found to be in excellent agreement with the quantum mechanical results. Sampling errors were estimated using the bootstrap method, which is validated for use with the army ants algorithm. (c) 2004 American Institute of Physics.

  19. A 10-Year Prospective Trial of a Patient Management Algorithm and Screening Examination for Highly Active Individuals with ACL Injury. Part II: Determinants of Dynamic Knee Stability

    PubMed Central

    Hurd, Wendy J.; Axe, Michael J.; Snyder-Mackler, Lynn

    2010-01-01

    Objectives To clarify the determinants of dynamic knee stability early after anterior cruciate ligament (ACL) injury. Materials and Methods 345 consecutive patients who were regular participants in IKDC level I/II sports before injury and had an acute isolated ACL injury from the practice of a single orthopaedic surgeon underwent a screening examination including clinical measures, knee laxity, quadriceps strength, hop testing, and patient self-reported knee function an average of 6 weeks after injury when impairments were resolved. Independent t-tests were performed to evaluate differences in quadriceps strength and anterior knee laxity between potential copers and noncopers. Hierarchical regression was performed to determine the influence of quadriceps strength, pre-injury activity level, and anterior knee laxity on hop test performance, as well as the influence of timed hop, cross-over hop, quadriceps strength, pre-injury activity level, and anterior knee laxity on self-assessed global function. Results Neither anterior knee laxity nor quadriceps strength differed between potential copers and non-copers. Quadriceps strength influenced hop test performance more significantly than pre-injury activity level or anterior knee laxity, but the variance accounted for by quadriceps strength was low (Range: 4-8%). Timed hop performance was the only variable that impacted self-assessed global function. Conclusions Traditional surgical decision making based on passive anterior knee laxity and pre-injury activity level is not supported by the results, as neither are good predictors of dynamic knee stability. Clinical tests that capture neuromuscular adaptations, including the timed hop test, may be useful in predicting function and guiding individualized patient management after ACL injury. PMID:17932399

  20. Study of hopping type conduction from AC conductivity in multiferroic composite

    NASA Astrophysics Data System (ADS)

    Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan

    2018-05-01

    0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).

  1. A Large-Scale Multi-Hop Localization Algorithm Based on Regularized Extreme Learning for Wireless Networks.

    PubMed

    Zheng, Wei; Yan, Xiaoyong; Zhao, Wei; Qian, Chengshan

    2017-12-20

    A novel large-scale multi-hop localization algorithm based on regularized extreme learning is proposed in this paper. The large-scale multi-hop localization problem is formulated as a learning problem. Unlike other similar localization algorithms, the proposed algorithm overcomes the shortcoming of the traditional algorithms which are only applicable to an isotropic network, therefore has a strong adaptability to the complex deployment environment. The proposed algorithm is composed of three stages: data acquisition, modeling and location estimation. In data acquisition stage, the training information between nodes of the given network is collected. In modeling stage, the model among the hop-counts and the physical distances between nodes is constructed using regularized extreme learning. In location estimation stage, each node finds its specific location in a distributed manner. Theoretical analysis and several experiments show that the proposed algorithm can adapt to the different topological environments with low computational cost. Furthermore, high accuracy can be achieved by this method without setting complex parameters.

  2. Development of a new high-performance liquid chromatography method with diode array and electrospray ionization-mass spectrometry detection for the metabolite fingerprinting of bioactive compounds in Humulus lupulus L.

    PubMed

    Prencipe, Francesco Pio; Brighenti, Virginia; Rodolfi, Margherita; Mongelli, Andrea; dall'Asta, Chiara; Ganino, Tommaso; Bruni, Renato; Pellati, Federica

    2014-07-04

    The study was aimed at developing a new analytical method for the metabolite fingerprinting of bioactive compounds in Humulus lupulus L. (hop), together with a simple extraction procedure. Different extraction techniques, including maceration, heat reflux extraction (HRE), ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE), were compared in order to obtain a high yield of the target analytes. Dynamic maceration for 30min with MeOH-HCOOH (99:1, v/v) as the extraction solvent provided the best result in terms of recovery of secondary metabolites. The analysis of hop constituents, including prenylflavonoids and prenylphloroglucinols (bitter acids), was carried out by means of HPLC-UV/DAD, HPLC-ESI-MS and MS(2), using an ion trap mass analyzer. An Ascentis Express C18 column (150mm×3.0mm I.D., 2.7μm) was used for the HPLC analysis, with a mobile phase composed of 0.25% formic acid in both water and acetonitrile, under gradient elution. The method validation was performed to show compliance with ICH guidelines. The validated technique was successfully applied to the phytochemical analysis of ten commercial cultivars and twenty-three wild Italian hop genotypes, thus demonstrating to be a reliable and useful tool for the comprehensive multi-component analysis of hop secondary metabolites. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. The diffusion of a Ga atom on GaAs(001)β2(2 × 4): Local superbasin kinetic Monte Carlo

    NASA Astrophysics Data System (ADS)

    Lin, Yangzheng; Fichthorn, Kristen A.

    2017-10-01

    We use first-principles density-functional theory to characterize the binding sites and diffusion mechanisms for a Ga adatom on the GaAs(001)β 2(2 × 4) surface. Diffusion in this system is a complex process involving eleven unique binding sites and sixteen different hops between neighboring binding sites. Among the binding sites, we can identify four different superbasins such that the motion between binding sites within a superbasin is much faster than hops exiting the superbasin. To describe diffusion, we use a recently developed local superbasin kinetic Monte Carlo (LSKMC) method, which accelerates a conventional kinetic Monte Carlo (KMC) simulation by describing the superbasins as absorbing Markov chains. We find that LSKMC is up to 4300 times faster than KMC for the conditions probed in this study. We characterize the distribution of exit times from the superbasins and find that these are sometimes, but not always, exponential and we characterize the conditions under which the superbasin exit-time distribution should be exponential. We demonstrate that LSKMC simulations assuming an exponential superbasin exit-time distribution yield the same diffusion coefficients as conventional KMC.

  4. Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.

    PubMed

    Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F

    2006-10-01

    Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.

  5. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    PubMed

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  6. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  7. Method to suppress DDFS spurious signals in a frequency-hopping synthesizer with DDFS-driven PLL architecture.

    PubMed

    Kwon, Kun-Sup; Yoon, Won-Sang

    2010-01-01

    In this paper we propose a method of removing from synthesizer output spurious signals due to quasi-amplitude modulation and superposition effect in a frequency-hopping synthesizer with direct digital frequency synthesizer (DDFS)-driven phase-locked loop (PLL) architecture, which has the advantages of high frequency resolution, fast transition time, and small size. There are spurious signals that depend on normalized frequency of DDFS. They can be dominant if they occur within the PLL loop bandwidth. We suggest that such signals can be eliminated by purposefully creating frequency errors in the developed synthesizer.

  8. FUNCTIONAL PERFORMANCE AND KNEE LAXITY IN NORMAL INDIVIDUALS AND IN INDIVIDUALS SUBMITTED TO ANTERIOR CRUCIATE LIGAMENT RECONSTRUCTION

    PubMed Central

    de Vasconcelos, Rodrigo Antunes; Bevilaqua-Grossi, Débora; Shimano, Antonio Carlos; Jansen Paccola, Cleber Antonio; Salvini, Tânia Fátima; Prado, Christiane Lanatovits; Mello Junior, Wilson A.

    2015-01-01

    The aim of this study was to analyze the correlation between deficits in the isokinetic peak torque of the knee extensors and flexors with hop tests, postoperative knee laxity and functional scores in normal and ACL- reconstructed subjects with patellar tendon and hamstring tendon autografts. Methods: Sixty male subjects were enrolled and subdivided into three groups: Twenty subjects without knee injuries (GC group) and two groups of 20 subjects submitted to ACL reconstruction with patellar tendon (GTP group) and hamstrings autograft (GTF group). Results: The results showed significant correlation between knee extensors peak torque and performance in the hop tests for GTF and GC groups. There are no significantly correlations between post op knee laxity and Lysholm score compared with the hop tests and peak torque deficits. Concerning the differences between groups, the GTP group showed greater peak torque deficits in knee extensors, worst Lysholm scores and higher percentage of individuals with lower limb symmetry index (ISM) < 90% in both hop tests when compared to the other two groups. Conclusion: It is not recommendable to use only one measurement instrument for the functional evaluation of ACL-reconstructed patients, because significant correlation between peak torque, subject's functional score, knee laxity and hop tests were not observed in all groups. PMID:26998464

  9. Towards an Efficient Flooding Scheme Exploiting 2-Hop Backward Information in MANETs

    NASA Astrophysics Data System (ADS)

    Le, Trong Duc; Choo, Hyunseung

    Flooding is an indispensable operation for providing control or routing functionalities to mobile ad hoc networks (MANETs). Previously, many flooding schemes have been studied with the intention of curtailing the problems of severe redundancies, contention, and collisions in traditional implementations. A recent approach with relatively high efficiency is 1HI by Liu et al., which uses only 1-hop neighbor information. The scheme achieves local optimality in terms of the number of retransmission nodes with time complexity &Theta(n log n), where n is the number of neighbors of a node; however, this method tends to make many redundant transmissions. In this paper, we present a novel flooding algorithm, 2HBI (2-hop backward information), that efficiently reduces the number of retransmission nodes and solves the broadcast storm problem in ad hoc networks using our proposed concept, “2-hop backward information.” The most significant feature of the proposed algorithm is that it does not require any extra communication overhead other than the exchange of 1-hop HELLO messages but maintains high deliverability. Comprehensive computer simulations show that the proposed scheme significantly reduces redundant transmissions in 1HI and in pure flooding, up to 38% and 91%, respectively; accordingly it alleviates contention and collisions in networks.

  10. Hopping and the Stokes–Einstein relation breakdown in simple glass formers

    PubMed Central

    Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco

    2014-01-01

    One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition—like that of other statistical systems—is exact when the spatial dimension d→∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions, d=2,3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes–Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses. PMID:25288722

  11. Hopping and the Stokes-Einstein relation breakdown in simple glass formers.

    PubMed

    Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco

    2014-10-21

    One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition--like that of other statistical systems--is exact when the spatial dimension d → ∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions,d = 2, 3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes-Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses.

  12. Holder pasteurization affects S100B concentrations in human milk.

    PubMed

    Peila, Chiara; Coscia, Alessandra; Bertino, Enrico; Li Volti, Giovanni; Galvano, Fabio; Visser, Gerard H A; Gazzolo, Diego

    2018-02-01

    Donor milk (DM) represents an important nutrition source for high-risk newborns. Holder pasteurization (HoP) is the most recommended procedure for DM treatment, providing a good compromise between microbiological safety and biological quality. HoP was previously shown to affect DM cytokines, growth factors and hormones levels, whilst no data concerning the possible effects of HoP on neurobiomarkers (NB) are available. Therefore, our study investigated whether the concentration in DM of a well-known NB involved in brain development/damage, namely S100B, changes due to HoP. We conducted a pretest-test study in 11 mothers, whose DM samples were sub-divided into two parts: the first was immediately frozen (-80 °C); the second was pasteurized with Holder method before freezing. S100B DM levels were measured using a commercially available immunoluminometric assay. S100B protein was detected in all milk samples. Results showed significant differences between groups (p < 0.05) in S100B levels after HoP. Our data provide evidence that S100B is present in preterm milk as well as in term milk during maturation degree. Moreover, the results confirm the susceptibility of this neurotrophic factor to pasteurization stresses and the need to develop new storage techniques to preserve the biological quality of human milk.

  13. Model-driven harmonic parameterization of the cortical surface: HIP-HOP.

    PubMed

    Auzias, G; Lefèvre, J; Le Troter, A; Fischer, C; Perrot, M; Régis, J; Coulon, O

    2013-05-01

    In the context of inter subject brain surface matching, we present a parameterization of the cortical surface constrained by a model of cortical organization. The parameterization is defined via an harmonic mapping of each hemisphere surface to a rectangular planar domain that integrates a representation of the model. As opposed to previous landmark-based registration methods we do not match folds between individuals but instead optimize the fit between cortical sulci and specific iso-coordinate axis in the model. This strategy overcomes some limitation to sulcus-based registration techniques such as topological variability in sulcal landmarks across subjects. Experiments on 62 subjects with manually traced sulci are presented and compared with the result of the Freesurfer software. The evaluation involves a measure of dispersion of sulci with both angular and area distortions. We show that the model-based strategy can lead to a natural, efficient and very fast (less than 5 min per hemisphere) method for defining inter subjects correspondences. We discuss how this approach also reduces the problems inherent to anatomically defined landmarks and open the way to the investigation of cortical organization through the notion of orientation and alignment of structures across the cortex.

  14. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    ERIC Educational Resources Information Center

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  15. Analysis of hop-derived terpenoids in beer and evaluation of their behavior using the stir bar-sorptive extraction method with GC-MS.

    PubMed

    Kishimoto, Toru; Wanikawa, Akira; Kagami, Noboru; Kawatsura, Katsuyuki

    2005-06-15

    Hop aroma components, which mainly comprise terpenoids, contribute to the character of beers. However, pretreatments are necessary before analyzing these components because of their trace levels and complicated matrixes. Here, the stir bar-sorptive extraction (SBSE) method was used to detect and quantify many terpenoids simultaneously from small samples. This simple technique showed low coefficients of variation, high accuracy, and low detection limits. An investigation of the behavior of terpenoids identified two distinct patterns of decreasing concentration during wort boiling. The first, which was seen in myrcene and linalool, involved a rapid decrease that was best fitted by a quadratic curve. The second, which was observed in beta-eudesmol, humulene, humulene epoxide I, beta-farnesene, caryophyllene, and geraniol, involved a gentle linear decrease. Conversely, the concentration of beta-damascenone increased after boiling. As the aroma composition depended on the hop variety, we also examined the relationship between terpenoid content and sensory analysis in beer.

  16. Efficient kinetic Monte Carlo method for reaction-diffusion problems with spatially varying annihilation rates

    NASA Astrophysics Data System (ADS)

    Schwarz, Karsten; Rieger, Heiko

    2013-03-01

    We present an efficient Monte Carlo method to simulate reaction-diffusion processes with spatially varying particle annihilation or transformation rates as it occurs for instance in the context of motor-driven intracellular transport. Like Green's function reaction dynamics and first-passage time methods, our algorithm avoids small diffusive hops by propagating sufficiently distant particles in large hops to the boundaries of protective domains. Since for spatially varying annihilation or transformation rates the single particle diffusion propagator is not known analytically, we present an algorithm that generates efficiently either particle displacements or annihilations with the correct statistics, as we prove rigorously. The numerical efficiency of the algorithm is demonstrated with an illustrative example.

  17. Structural, optical and morphological studies of Cd2+ doping in CH3NH3PbI3 perovskite semiconductor at Pb2+ site for photovoltaic applications

    NASA Astrophysics Data System (ADS)

    Parrey, Khursheed; Warish, Mohd.; Devi, Nisha; Niazi, A.; Aziz, A.; Ansari, S. G.

    2018-05-01

    Doping of semiconductors in a controlled mannner have paramount technological importance as far as the optical and electronic properties of the devices are concerned. Hybrid organic-inorganic perovskites (HOPs) as intrinsic semiconductors have sensational properties required for both the solar photovoltaics and perovskite light emitting diodes. However, undoped and complexity in the dpoing process of HOPs have limited their exploitation in the field of elcronics. In this papper we present the synthesis of HOP semiconductor (CH3NH3PbI3) doped in Pb2+ position by Cd2+. We studied the effect of the incorporation of Cd2+ into the crystalline structure and analysed the changes in the properties like crystal structure, optical absorption and the surface morphology. The structure of HOPs confirmed by X-ray diffraction analysis is tetragonal perovskite type. It can be found that the crystallinity of the samples was enhanced with the doping concentration as the intensity of diffraction peaks were observed to increase with doping. The absorption spectra as obtained from UV-Visible spectrophotometry and Tauc plot analysis indicated that the band gap observed (1.73 eV) is direct type and gets reduced to 1.67 eV with the doping concentration. The red shift may be due to the increase in the size of nanocrystalline material with doping.

  18. Evidence of a Cell Surface Role for Hsp90 Complex Proteins Mediating Neuroblast Migration in the Subventricular Zone.

    PubMed

    Miyakoshi, Leo M; Marques-Coelho, Diego; De Souza, Luiz E R; Lima, Flavia R S; Martins, Vilma R; Zanata, Silvio M; Hedin-Pereira, Cecilia

    2017-01-01

    In most mammalian brains, the subventricular zone (SVZ) is a germinative layer that maintains neurogenic activity throughout adulthood. Neuronal precursors arising from this region migrate through the rostral migratory stream (RMS) and reach the olfactory bulbs where they differentiate and integrate into the local circuitry. Recently, studies have shown that heat shock proteins have an important role in cancer cell migration and blocking Hsp90 function was shown to hinder cell migration in the developing cerebellum. In this work, we hypothesize that chaperone complexes may have an important function regulating migration of neuronal precursors from the subventricular zone. Proteins from the Hsp90 complex are present in the postnatal SVZ as well as in the RMS. Using an in vitro SVZ explant model, we have demonstrated the expression of Hsp90 and Hop/STI1 by migrating neuroblasts. Treatment with antibodies against Hsp90 and co-chaperone Hop/STI1, as well as Hsp90 and Hsp70 inhibitors hinder neuroblast chain migration. Time-lapse videomicroscopy analysis revealed that cell motility and average migratory speed was decreased after exposure to both antibodies and inhibitors. Antibodies recognizing Hsp90, Hsp70, and Hop/STI1 were found bound to the membranes of cells from primary SVZ cultures and biotinylation assays demonstrated that Hsp70 and Hop/STI1 could be found on the external leaflet of neuroblast membranes. The latter could also be detected in conditioned medium samples obtained from cultivated SVZ cells. Our results suggest that chaperones Hsp90, Hsp70, and co-chaperone Hop/STI1, components of the Hsp90 complex, regulate SVZ neuroblast migration in a concerted manner through an extracellular mechanism.

  19. Treatment of homozygous familial hypercholesterolaemia in paediatric patients: A monocentric experience.

    PubMed

    Buonuomo, Paola S; Macchiaiolo, Marina; Leone, Giovanna; Valente, Paola; Mastrogiorgio, Gerarda; Gnazzo, Maria; Rana, Ippolita; Gonfiantini, Michaela V; Gagliardi, Maria G; Romano, Francesca; Bartuli, Andrea

    2018-01-01

    Background Homozygous familial hypercholesterolaemia is a rare life-threatening disease characterized by markedly elevated low-density lipoprotein cholesterol (LDL-C) concentrations and accelerated atherosclerosis. The presence of double gene defects in the LDL-Receptor, either the same defect (homozygous) or two different LDL-raising mutations (compound heterozygotes) or other variants, identify the homozygous phenotype (HopFH). Apheresis is a procedure in which plasma is separated from red blood cells before the physical removal of LDL-C or the LDL-C is directly removed from whole blood. It is currently the treatment of choice for patients with HopFH whose LDL-C levels are not able to be reduced to target levels with conventional lipid-lowering drug therapy. Design The aim of this study is to report a cohort of six paediatric patients and to evaluate the long term efficacy of combined medical therapy and LDL-apheresis on LDL-C reduction. Methods We collected data from six children with confirmed diagnosis of HopFH (two females and four males; age range at diagnosis 3-8 years, mean 6 ± 1 years) from a single clinical hospital in Italy from 2007 to 2017. Results Clinical manifestations and outcomes may greatly vary in children with HopFH. Medical therapy and LDL-apheresis for the severe form should be started promptly in order to prevent cardiovascular disease. Conclusions Lipoprotein apheresis is a very important tool in managing patients with HopFH at high risk of cardiovascular disease. Based on our experience and the literature data, the method is feasible in very young children, efficient regarding biological results and cardiac events, and safe with minor side-effects and technical problems. We advise treating homozygous and compound heterozygous children as soon as possible.

  20. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    PubMed Central

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  1. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    PubMed

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  2. Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

    NASA Astrophysics Data System (ADS)

    Beyer, Eric W.

    The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions is shown to validate the dynamic model. Using the validated dynamic model, simulations were performed to better understand the dynamics of the device. In addition, key parameters such as system weight, rotor speed, internal mass weight and location, as well as battery capacity are varied to explore and optimize flight performance characteristics such as single hop height and range, number of hops, and total achievable range. The sensitivity of the Hopping Rotochute to atmospheric winds is also investigated as is the ability of the device to perform trajectory shaping.

  3. Theoretical study of the structures and chemical ordering of CoPd nanoalloys supported on MgO(001)

    NASA Astrophysics Data System (ADS)

    Taran, Songul; Garip, Ali Kemal; Arslan, Haydar

    2016-06-01

    Metal nanoalloys on oxide surface are a widely studied topic in surface science and technology. In this study, the structures of CoPd nanoalloys adsorbed on MgO(001) have been searched by basin-hopping global optimization method within an atomistic model. Two different sizes (34 and 38 atom) have been considered for all compositions of CoPd/MgO(001) nanoalloys. Co and Pd atoms, for all the compositions, have cube-on-cube (001) epitaxy with substrate at interface. For both sizes, we have found that Pd rich composition nanoalloys have three layers, Co rich composition nanoalloys have four layers in morphology. Excess energy and second difference in energy analyzes have been performed to investigate the relative stability of nanoalloys with respect to their size and composition.

  4. Quasiparticle energy bands and Fermi surfaces of monolayer NbSe2

    NASA Astrophysics Data System (ADS)

    Kim, Sejoong; Son, Young-Woo

    2017-10-01

    A quasiparticle band structure of a single layer 2 H -NbSe2 is reported by using first-principles G W calculation. We show that a self-energy correction increases the width of a partially occupied band and alters its Fermi surface shape when comparing those using conventional mean-field calculation methods. Owing to a broken inversion symmetry in the trigonal prismatic single layer structure, the spin-orbit interaction is included and its impact on the Fermi surface and quasiparticle energy bands are discussed. We also calculate the doping dependent static susceptibilities from the band structures obtained by the mean-field calculation as well as G W calculation with and without spin-orbit interactions. A complete tight-binding model is constructed within the three-band third nearest neighbor hoppings and is shown to reproduce our G W quasiparticle energy bands and Fermi surface very well. Considering variations of the Fermi surface shapes depending on self-energy corrections and spin-orbit interactions, we discuss the formations of charge density wave (CDW) with different dielectric environments and their implications on recent controversial experimental results on CDW transition temperatures.

  5. HapHop-Physio: a computer game to support cognitive therapies in children

    PubMed Central

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

    2017-01-01

    Background Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. PMID:28740440

  6. Recent Advances and Perspectives on Nonadiabatic Mixed Quantum-Classical Dynamics.

    PubMed

    Crespo-Otero, Rachel; Barbatti, Mario

    2018-05-16

    Nonadiabatic mixed quantum-classical (NA-MQC) dynamics methods form a class of computational theoretical approaches in quantum chemistry tailored to investigate the time evolution of nonadiabatic phenomena in molecules and supramolecular assemblies. NA-MQC is characterized by a partition of the molecular system into two subsystems: one to be treated quantum mechanically (usually but not restricted to electrons) and another to be dealt with classically (nuclei). The two subsystems are connected through nonadiabatic couplings terms to enforce self-consistency. A local approximation underlies the classical subsystem, implying that direct dynamics can be simulated, without needing precomputed potential energy surfaces. The NA-MQC split allows reducing computational costs, enabling the treatment of realistic molecular systems in diverse fields. Starting from the three most well-established methods-mean-field Ehrenfest, trajectory surface hopping, and multiple spawning-this review focuses on the NA-MQC dynamics methods and programs developed in the last 10 years. It stresses the relations between approaches and their domains of application. The electronic structure methods most commonly used together with NA-MQC dynamics are reviewed as well. The accuracy and precision of NA-MQC simulations are critically discussed, and general guidelines to choose an adequate method for each application are delivered.

  7. Effects of interdot hopping and Coulomb blockade on the thermoelectric properties of serially coupled quantum dots

    PubMed Central

    2012-01-01

    We have theoretically studied the thermoelectric properties of serially coupled quantum dots (SCQDs) embedded in an insulator connected to metallic electrodes. In the framework of Keldysh Green’s function technique, the Landauer formula of transmission factor is obtained using the equation of motion method. Based on such analytical expressions of charge and heat currents, we calculate the electrical conductance, Seebeck coefficient, electron thermal conductance, and figure of merit (ZT) of SCQDs in the linear response regime. The effects of interdot hopping and electron Coulomb interactions on ZT are analyzed. We demonstrate that ZT is not a monotonic increasing function of interdot electron hopping strength (tc). We also show that in the absence of phonon thermal conductance, SCQD can reach the Carnot efficiency as tcapproaches zero. PMID:22591807

  8. Parallel Monotonic Basin Hopping for Low Thrust Trajectory Optimization

    NASA Technical Reports Server (NTRS)

    McCarty, Steven L.; McGuire, Melissa L.

    2018-01-01

    Monotonic Basin Hopping has been shown to be an effective method of solving low thrust trajectory optimization problems. This paper outlines an extension to the common serial implementation by parallelizing it over any number of available compute cores. The Parallel Monotonic Basin Hopping algorithm described herein is shown to be an effective way to more quickly locate feasible solutions, and improve locally optimal solutions in an automated way without requiring a feasible initial guess. The increased speed achieved through parallelization enables the algorithm to be applied to more complex problems that would otherwise be impractical for a serial implementation. Low thrust cislunar transfers and a hybrid Mars example case demonstrate the effectiveness of the algorithm. Finally, a preliminary scaling study quantifies the expected decrease in solve time compared to a serial implementation.,

  9. A first principles kinetic Monte Carlo investigation of the adsorption and mobility of gadolinium on the (100) surface of tungsten

    NASA Astrophysics Data System (ADS)

    Samin, Adib J.; Zhang, Jinsuo

    2017-05-01

    An accurate characterization of lanthanide adsorption and mobility on tungsten surfaces is important for pyroprocessing. In the present study, the adsorption and diffusion of gadolinium on the (100) surface of tungsten was investigated. It was found that the hollow sites were the most energetically favorable for the adsorption. It was further observed that a magnetic moment was induced following the adsorption of gadolinium on the tungsten surface and that the system with adsorbed hollow sites had the largest magnetization. A pathway for the surface diffusion of gadolinium was determined to occur by hopping between the nearest neighbor hollow sites via the bridge site and the activation energy for the hop was calculated to be 0.75 eV. The surface diffusion process was further assessed using two distinct kinetic Monte Carlo models; one that accounted for lateral adsorbate interactions up to the second nearest neighbor and one that did not account for such interatomic interactions in the adlayer. When the lateral interactions were included in the simulations, the diffusivity was observed to have a strong dependence on coverage (for the coverage values being studied). The effects of lateral interactions were further observed in a one-dimensional simulation of the diffusion equation where the asymmetry in the surface coverage profile upon its approach to a steady state distribution was clear in comparison with the simulations which did not account for those interactions.

  10. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  11. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

    PubMed Central

    Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

    2017-01-01

    As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs. PMID:28098818

  12. A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

    PubMed

    Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

    2018-05-08

    With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

  13. Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.

    PubMed

    Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

    2016-09-12

    In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).

  14. HopBase: a unified resource for Humulus genomics

    PubMed Central

    Hill, Steven T.; Sudarsanam, Ramcharan

    2017-01-01

    Abstract Hop (Humulus lupulus L. var lupulus) is a dioecious plant of worldwide significance, used primarily for bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop have led to additional interest from pharmacy and healthcare industries as well as livestock production as a natural antibiotic. Genomic research in hop has resulted a published draft genome and transcriptome assemblies. As research into the genomics of hop has gained interest, there is a critical need for centralized online genomic resources. To support the growing research community, we report the development of an online resource "HopBase.org." In addition to providing a gene annotation to the existing Shinsuwase draft genome, HopBase makes available genome assemblies and annotations for both the cultivar “Teamaker” and male hop accession number USDA 21422M. These genome assemblies, gene annotations, along with other common data, coupled with a genome browser and BLAST database enable the hop community to enter the genomic age. The HopBase genomic resource is accessible at http://hopbase.org and http://hopbase.cgrb.oregonstate.edu. PMID:28415075

  15. Nonadiabatic nuclear dynamics of the ammonia cation studied by surface hopping classical trajectory calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belyaev, Andrey K., E-mail: belyaev@herzen.spb.ru; Domcke, Wolfgang, E-mail: wolfgang.domcke@ch.tum.de; Lasser, Caroline, E-mail: classer@ma.tum.de

    The Landau–Zener (LZ) type classical-trajectory surface-hopping algorithm is applied to the nonadiabatic nuclear dynamics of the ammonia cation after photoionization of the ground-state neutral molecule to the excited states of the cation. The algorithm employs a recently proposed formula for nonadiabatic LZ transition probabilities derived from the adiabatic potential energy surfaces. The evolution of the populations of the ground state and the two lowest excited adiabatic states is calculated up to 200 fs. The results agree well with quantum simulations available for the first 100 fs based on the same potential energy surfaces. Three different time scales are detected formore » the nuclear dynamics: Ultrafast Jahn–Teller dynamics between the excited states on a 5 fs time scale; fast transitions between the excited state and the ground state within a time scale of 20 fs; and relatively slow partial conversion of a first-excited-state population to the ground state within a time scale of 100 fs. Beyond 100 fs, the adiabatic electronic populations are nearly constant due to a dynamic equilibrium between the three states. The ultrafast nonradiative decay of the excited-state populations provides a qualitative explanation of the experimental evidence that the ammonia cation is nonfluorescent.« less

  16. Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).

    PubMed

    Stannard, Hayley J; Tulk, Melissa L; Old, Julie M

    2017-03-01

    Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine procedures, close montoring and quick action in response to signs of illness will ensure Tyzzer's disease outbreaks do not occur. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Long-Term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice

    PubMed Central

    Sasaoka, Norio; Sakamoto, Megumi; Kanemori, Shoko; Kan, Michiru; Tsukano, Chihiro; Takemoto, Yoshiji; Kakizuka, Akira

    2014-01-01

    Coincident with the expanding population of aged people, the incidence of Alzheimer disease (AD) is rapidly increasing in most advanced countries. At present, no effective prophylactics are available. Among several pathological mechanisms proposed for AD, the “amyloid hypothesis” has been most widely accepted, in which accumulation or deposition of Aβ is considered to be the initial event. Thus, prevention of Aβ production would be an ideal strategy for the treatment or prevention of AD. Aβ is produced via the proteolytic cleavage of its precursor protein, APP (amyloid precursor protein), by two different enzymes, β and γ-secretases. Indeed, inhibitors against either or both enzymes have been developed and tested for clinical efficacy. Based on the “amyloid hypothesis”, we developed a luciferase-based screening method to monitor γ-secretase activity, screened more than 1,600 plant extracts, most of which have long been used in Chinese medicine, and observed that Hop extracts significantly inhibit Aβ production in cultured cells. A major component of the inhibitory activity was purified, and its chemical identity was determined by NMR to be Garcinielliptone HC. In vivo, oral administration of Hop extracts to AD model mice decreased Aβ depositions in the cerebral cortex of the parietal lobe, hippocampus, and artery walls (amyloid angiopathy) in the brains. In a Morris water maze test, AD model mice that had daily consumed Hop extracts in their drinking water showed significant mitigation of memory impairment at ages of 9 and 12 months. Moreover, in the open field test oral administration of Hop extracts also prevented an emotional disturbance that appeared in the AD mice at 18 months. Despite lifelong consumption of Hop extracts, no deleterious side effects were observed at any age. These results support the “amyloid hypothesis”, and indicate that Hop extract is a promising candidate for an effective prophylactic for AD. PMID:24489866

  18. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage.

    PubMed

    Haakensen, Monique; Vickers, David M; Ziola, Barry

    2009-09-07

    Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol). Use of antimicrobial compounds (e.g., hop-compounds, Penicillin) by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Lactic acid bacteria susceptibility test broth medium (LSM) used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  19. Data mining of molecular dynamics data reveals Li diffusion characteristics in garnet Li7La3Zr2O12

    PubMed Central

    Chen, Chi; Lu, Ziheng; Ciucci, Francesco

    2017-01-01

    Understanding Li diffusion in solid conductors is essential for the next generation Li batteries. Here we show that density-based clustering of the trajectories computed using molecular dynamics simulations helps elucidate the Li diffusion mechanism within the Li7La3Zr2O12 (LLZO) crystal lattice. This unsupervised learning method recognizes lattice sites, is able to give the site type, and can identify Li hopping events. Results show that, while the cubic LLZO has a much higher hopping rate compared to its tetragonal counterpart, most of the Li hops in the cubic LLZO do not contribute to the diffusivity due to the dominance of back-and-forth type jumps. The hopping analysis and local Li configuration statistics give evidence that Li diffusivity in cubic LLZO is limited by the low vacancy concentration. The hopping statistics also shows uncorrelated Poisson-like diffusion for Li in the cubic LLZO, and correlated diffusion for Li in the tetragonal LLZO in the temporal scale. Further analysis of the spatio-temporal correlation using site-to-site mutual information confirms the weak site dependence of Li diffusion in the cubic LLZO as the origin for the uncorrelated diffusion. This work puts forward a perspective on combining machine learning and information theory to interpret results of molecular dynamics simulations. PMID:28094317

  20. Data mining of molecular dynamics data reveals Li diffusion characteristics in garnet Li7La3Zr2O12

    NASA Astrophysics Data System (ADS)

    Chen, Chi; Lu, Ziheng; Ciucci, Francesco

    2017-01-01

    Understanding Li diffusion in solid conductors is essential for the next generation Li batteries. Here we show that density-based clustering of the trajectories computed using molecular dynamics simulations helps elucidate the Li diffusion mechanism within the Li7La3Zr2O12 (LLZO) crystal lattice. This unsupervised learning method recognizes lattice sites, is able to give the site type, and can identify Li hopping events. Results show that, while the cubic LLZO has a much higher hopping rate compared to its tetragonal counterpart, most of the Li hops in the cubic LLZO do not contribute to the diffusivity due to the dominance of back-and-forth type jumps. The hopping analysis and local Li configuration statistics give evidence that Li diffusivity in cubic LLZO is limited by the low vacancy concentration. The hopping statistics also shows uncorrelated Poisson-like diffusion for Li in the cubic LLZO, and correlated diffusion for Li in the tetragonal LLZO in the temporal scale. Further analysis of the spatio-temporal correlation using site-to-site mutual information confirms the weak site dependence of Li diffusion in the cubic LLZO as the origin for the uncorrelated diffusion. This work puts forward a perspective on combining machine learning and information theory to interpret results of molecular dynamics simulations.

  1. Experimental verification of hopping mechanism using permanent magnets for an asteroid rover at drop tower

    NASA Astrophysics Data System (ADS)

    Kurisu, Masamitsu; Yano, Hajime; Yoshimitsu, Tetsuo; Kubota, Takashi; Adachi, Tadashi; Kuroda, Yoji

    Verification of the hopping mechanism using permanent magnets by microgravity experiments at ZARM drop tower will be presented in this report. The mechanism, which is called HMPM (Hopping Mechanism with Permanent Magnets) was developed for a small asteroid exploration rover to replace with conventional locomotion mechanism such as wheels and crawlers. The main part of HMPM consists of three permanent magnets which are two stationary magnets and one movable magnet aligned between them. HMPM itself hops by utilizing the impact force generated when the movable magnet sticks to one of the stationary magnets. The features of HMPM are that the large impact force can be generated in spite of low-power consumption, and that it can be easily miniaturized and modularized. On the other hand, the weak point of HMPM is that the performance of the mechanism cannot be controlled directly, since the performance is decided by its design. Therefore, it is significant to evaluate the performance of HMPM before it is mounted on a flight model of rover. On the microgravity experiments at the drop tower, an imitation rover with 0.8kg weight is tested to hop with the operation of a prototype HMPM mounted on the rover. The prototype module weighs only 0.03kg with dimension 0.033 m in width, 0.046 m in height, and 0.012 m in depth, except the drive circuit and power source. Experimental results show the availability of HMPM. Also, the hopping performance of HMPM which is evaluated from the motion of rover recorded by cameras equipped inside the dropping capsule is compared with the estimated performance derived from the theoretical model. From the investigation, validity of the evaluation method based on the theoretical model is discussed. In order that the potential ability of HMPM is fully derived, optimal design of HMPM will require the evaluation method. The experiments at ZARM drop tower were accomplished based on the agreement on the Hayabusa-2 project by DLR-JAXA. And we received technical and operation supports from ZARM. We express our gratitude to ZARM, DLR and JAXA.

  2. Surface adsorption and hopping cause probe-size-dependent microrheology of actin networks

    NASA Astrophysics Data System (ADS)

    He, Jun; Tang, Jay X.

    2011-04-01

    A network of filaments formed primarily by the abundant cytoskeletal protein actin gives animal cells their shape and elasticity. The rheological properties of reconstituted actin networks have been studied by tracking micron-sized probe beads embedded within the networks. We investigate how microrheology depends on surface properties of probe particles by varying the stickiness of their surface. For this purpose, we chose carboxylate polystyrene (PS) beads, silica beads, bovine serum albumin (BSA) -coated PS beads, and polyethylene glycol (PEG) -grafted PS beads, which show descending stickiness to actin filaments, characterized by confocal imaging and microrheology. Probe size dependence of microrheology is observed for all four types of beads. For the slippery PEG beads, particle-tracking microrheology detects weaker networks using smaller beads, which tend to diffuse through the network by hopping from one confinement “cage” to another. This trend is reversed for the other three types of beads, for which microrheology measures stiffer networks for smaller beads due to physisorption of nearby filaments to the bead surface. We explain the probe size dependence with two simple models. We also evaluate depletion effect near nonadsorption bead surface using quantitative image analysis and discuss the possible impact of depletion on microrheology. Analysis of these effects is necessary in order to accurately define the actin network rheology both in vitro and in vivo.

  3. Field Trip 5: HYDROGEOLOGY OF BEER AND WINE IN THE YAKIMA VALLEY

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Last, George V.; Bachmann, Matthew P.; Bjornstad, Bruce N.

    The climate and geology of eastern Washington are ideally suited to the production of hops and wine grapes. Nearly all of Washington’s hop and wine-grape production is located in the lower Yakima River Basin , which is one of the most intensively irrigated areas in the United States. Most of this irrigation water has been supplied by surface water reservoirs and canal systems drawing from the Yakima River. However, increasing demands for water has spurred the increased use of groundwater resources. This field trip guide explores many aspects of the geology and hydrogeology in the lower Yakima River Basin, particularlymore » as they relate to water resources that support the local beer and wine industries.« less

  4. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    ERIC Educational Resources Information Center

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  5. Variable range hopping in ZnO films

    NASA Astrophysics Data System (ADS)

    Ali, Nasir; Ghosh, Subhasis

    2018-04-01

    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  6. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    ERIC Educational Resources Information Center

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  7. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    ERIC Educational Resources Information Center

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  8. Hip-hop as a resource for understanding the urban context

    NASA Astrophysics Data System (ADS)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  9. Allez Hop, a nationwide programme for the promotion of physical activity in Switzerland: what is the evidence for a population impact after one decade of implementation?

    PubMed Central

    Wanner, Miriam; Martin-Diener, Eva; Bauer, Georg F; Stamm, Hanspeter; Martin, Brian W

    2011-01-01

    Objectives To present evidence for a population impact of a national physical activity promotion programme after a decade of implementation. Methods The programme Allez Hop offered local physical activity courses (mainly walking and Nordic walking) once a week over 12 weeks. Data from a pretest posttest survey in 2005 course participants (N=2157 at baseline (of 4130, 52.2%), 1587 at first follow-up (73.6%); smaller subsample with second follow-up) and from repeated cross-sectional national surveys have been analysed regarding changes in physical activity behaviour. Results The total number of Allez Hop courses was 18 684 between 1997 and 2008. 89.2% of participants were women, the mean age was 48.5 years. The proportion meeting the physical activity recommendations was 31.7% at baseline, in participants with first follow-up data it increased from 33.1% to 42.3% (p<0.001). On the population level in the main user group of Allez Hop (middle-aged women) the proportion not engaging in any sport decreased from 50.1% (1997) to 47.2% (2002) and to 43.1% (2007) (p<0.01). Walking/hiking was the second most frequently performed sport (33.7%) in 2007, with the most remarkable increase since 2000 (+11.1%). Conclusions Allez Hop was successfully implemented for more than a decade, reached middle-aged women and a high proportion of insufficiently active individuals. Changes in participants' physical activity behaviour must be interpreted cautiously because of low response rates and short follow-up. However, indications for behavioural changes were observed at the population level, even though these data do not allow a causal link to Allez Hop. PMID:20542973

  10. Functional performance testing in participants with functional ankle instability and in a healthy control group.

    PubMed

    Buchanan, Amanda S; Docherty, Carrie L; Schrader, John

    2008-01-01

    Functional ankle instability (FAI) affects a large part of the population. Inconsistent findings have been reported regarding the existence of functional performance deficits in individuals with FAI. To examine functional performance in participants with FAI compared with participants in a control group during 2 hopping tests. Case-control study. Athletic training research laboratory. There were 40 college-aged individuals who participated in our study: 20 with FAI and 20 without FAI. We defined FAI as history of an ankle sprain and residual episodes of "giving way." Participants completed 2 functional performance tests (FPTs): the single-limb hopping and the single-limb hurdle tests. Time to complete each test was recorded. Following each FPT, participants were asked if their ankles felt unstable during the test. We found no difference between participants in the FAI and control groups for the hopping or hurdle tests (P > .05). When asked if their ankles felt unstable during the FPTs, approximately half of the participants in the FAI group and none of the participants in the control group reported a feeling of instability. Subsequently, a secondary analysis of variance was calculated with participants grouped into 3 categories: control participants, FAI participants reporting instability symptoms during FPT (FAI-S), and FAI participants not reporting instability symptoms during FPT (FAI-NS). Results revealed a difference among the 3 groups for the single-limb hopping test (P < .01). Post hoc analysis revealed a difference between the FAI-S participants and both the control and the FAI-NS participants. No difference was identified for the single-limb hurdle test (P = .41). The FAI-S participants had performance deficits during the single-limb hopping test. Therefore, clinicians could use this simple hopping test as an additional method to determine the presence of FAI.

  11. Grain size effect on the electrical and magneto-transport properties of nanosized Pr0.67Sr0.33MnO3

    NASA Astrophysics Data System (ADS)

    Ng, S. W.; Lim, K. P.; Halim, S. A.; Jumiah, H.

    2018-06-01

    In this study, nanosized of Pr0.67Sr0.33MnO3 prepared via sol-gel method followed by heat treatment at 600-1000 °C in intervals of 100 °C were synthesized. The structure, surface morphology, electrical, magneto-transport and magnetic properties of the samples were investigated. Rietveld refinements of X-ray diffraction patterns confirm that single phase orthorhombic crystal structure with the space group of Pnma (62) is formed at 600 °C. A strong dependence of surface morphology, electrical and magneto-transport properties on grain size have been observed in this manganites system. Both grain size and crystallite size are increases with the sintering temperature due to the congregation effect. Upon increasing grain size, the paramagnetic-ferromagnetic transition temperature increases from 278 K to 295 K. The resistivity drops and the metal-insulator transition temperature shifted from 184 K to 248 K with increases of grain size due to the grain growth and reduction of grain boundary. Below metal-insulator transition temperature, the samples fit well to the combination of resistivity due to grain or domain boundaries, electron-electron scattering process and electron-phonon interaction. The resistivity data above the metal-insulator transition temperature is well described using small polaron hopping and variable range hopping models. It is found that the negative magnetoresistance also increases with larger grain size where the highest %MR of - 26% can be observed for sample sintered at 1000 °C (245 nm).

  12. Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿

    PubMed Central

    Behr, Jürgen; Vogel, Rudi F.

    2010-01-01

    In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of hop inhibition, these investigations provide general insight on the role of electrophysiology and ion homeostasis in bacterial stress responses to membrane-active drugs. PMID:19880646

  13. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    ERIC Educational Resources Information Center

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  14. High-Speed On-Board Data Processing for Science Instruments: HOPS

    NASA Technical Reports Server (NTRS)

    Beyon, Jeffrey

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  15. Sufficient Amounts of Functional HOP2/MND1 Complex Promote Interhomolog DNA Repair but Are Dispensable for Intersister DNA Repair during Meiosis in Arabidopsis[W

    PubMed Central

    Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde

    2013-01-01

    During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313

  16. Triton Hopper: Exploring Neptune's Captured Kuiper Belt Object

    NASA Technical Reports Server (NTRS)

    Oleson, Steve; Landis, Geoffrey

    2018-01-01

    Neptune's moon Triton is a fascinating object, a dynamic moon with an atmosphere, and geysers. Triton is unique in the outer solar system in that it is most likely a captured Kuiper belt object (KBO), a leftover building block of the solar system. When Voyager flew by it was the coldest body yet found in our solar system (33 degrees Kelvin) and had volcanic activity, geysers, and a thin atmosphere. It is covered in ices made from nitrogen, water, and carbon-dioxide, and shows surface deposits of tholins, organic compounds that may be precursor chemicals to the origin of life. Exploring Triton will be a challenge well beyond anything done in previous missions; but the unique environment of Triton also allows some new possibilities for mobility. We developed a conceptual design of a Triton Hopping probe that both analyzes the surface and collects it for use to propel its hops. The Hopper would land near the South Pole in 2040 where geysers have been detected. Depending the details of propulsion chosen the Hopper should be able to jump over 300 kilometers in 60 hops or less, exploring the surface and thin atmosphere on its way. This craft will autonomously carry out detailed scientific investigations on the surface, below the surface (drilling) and in the upper atmosphere to provide unprecedented knowledge of a KBO-turned moon and expanding NASA's existing capabilities in deep space planetary exploration to include Hoppers using different ices for propellant. Triton is roughly 2700 kilometers in diameter with a surface of mostly frozen nitrogen, mostly water ice crust and core of metal and rock. Its gravity is half that of Earth's Moon and its atmosphere is 170,000th of Earth's or 0.3 of Mars.The mission concept studied investigated the full surface and atmospheric phenomenon: chemical composition of surface and near subsurface materials, the thin atmosphere, volcanic and geyser activity. Measurements of all these aspects of Triton's unique environment can only be made through focused in-situ exploration with a well-instrumented craft. And this craft will be provided revolutionary mobility, nearly global, using in-situ ices as propellants. While other concepts have looked at gathering gases at Mars to propel a hopper, long periods of time are needed to gather the thin CO2 atmosphere. Several gases, mainly nitrogen are on the surface in a readily dense ice form and just need to be picked up, vaporized and used for propellant.

  17. Measurements of the Activation Energies for Atomic Hydrogen Diffusion on Pure Solid CO

    NASA Astrophysics Data System (ADS)

    Kimura, Y.; Tsuge, M.; Pirronello, V.; Kouchi, A.; Watanabe, N.

    2018-05-01

    The diffusion of hydrogen atoms on dust grains is a key process in the formation of interstellar H2 and some hydrogenated molecules such as formaldehyde and methanol. We investigate the adsorption and diffusion of H atoms on pure solid CO as an analog of dust surfaces observed toward some cold interstellar regions. Using a combination of photostimulated desorption and resonance-enhanced multiphoton ionization methods to detect H atoms directly, the relative adsorption probabilities and diffusion coefficients of the H atoms are measured on pure solid CO at 8, 12, and 15 K. There is little difference between the diffusion coefficients of the hydrogen and deuterium atoms, indicating that the diffusion is limited by thermal hopping. The activation energies controlling the H-atom diffusion depend on the surface temperature, and values of 22, 30, and ∼37 meV were obtained for 8, 12, and 15 K, respectively.

  18. Non-adiabatic dynamics of isolated green fluorescent protein chromophore anion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Li, E-mail: zhaoli282@dicp.ac.cn, E-mail: pwzhou@dicp.ac.cn, E-mail: libinsnet@dicp.ac.cn, E-mail: aihuagao@dicp.ac.cn; Gao, Ai-Hua, E-mail: zhaoli282@dicp.ac.cn, E-mail: pwzhou@dicp.ac.cn, E-mail: libinsnet@dicp.ac.cn, E-mail: aihuagao@dicp.ac.cn; University of the Chinese Academy of Sciences, Beijing 100049

    2014-12-21

    On-the-fly ab initio molecular dynamics calculations have been performed to investigate the relaxation mechanism of green fluorescent protein chromophore anion under vacuum. The CASSCF surface hopping simulation method based on Zhu-Nakamura theory is applied to present the real-time conformational changes of the target molecule. The static calculations and dynamics simulation results suggest that not only the twisting motion around bridging bonds between imidazolinone and phenoxy groups but the strength mode of C=O and pyramidalization character of bridging atom are major factors on the ultrafast fluorescence quenching process of the isolated chromophore anion. The abovementioned factors bring the molecule to themore » vicinity of conical intersections on its potential energy surface and to finish the internal conversion process. A Hula-like twisting pattern is displayed during the relaxation process and the entire decay process disfavors a photoswitching pattern which corresponds to cis-trans photoisomerization.« less

  19. Hopping Robot with Wheels

    NASA Technical Reports Server (NTRS)

    Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

    2003-01-01

    A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

  20. Systematic network coding for two-hop lossy transmissions

    NASA Astrophysics Data System (ADS)

    Li, Ye; Blostein, Steven; Chan, Wai-Yip

    2015-12-01

    In this paper, we consider network transmissions over a single or multiple parallel two-hop lossy paths. These scenarios occur in applications such as sensor networks or WiFi offloading. Random linear network coding (RLNC), where previously received packets are re-encoded at intermediate nodes and forwarded, is known to be a capacity-achieving approach for these networks. However, a major drawback of RLNC is its high encoding and decoding complexity. In this work, a systematic network coding method is proposed. We show through both analysis and simulation that the proposed method achieves higher end-to-end rate as well as lower computational cost than RLNC for finite field sizes and finite-sized packet transmissions.

  1. Disruption of prion protein-HOP engagement impairs glioblastoma growth and cognitive decline and improves overall survival.

    PubMed

    Lopes, M H; Santos, T G; Rodrigues, B R; Queiroz-Hazarbassanov, N; Cunha, I W; Wasilewska-Sampaio, A P; Costa-Silva, B; Marchi, F A; Bleggi-Torres, L F; Sanematsu, P I; Suzuki, S H; Oba-Shinjo, S M; Marie, S K N; Toulmin, E; Hill, A F; Martins, V R

    2015-06-01

    Glioblastomas (GBMs) are resistant to current therapy protocols and identification of molecules that target these tumors is crucial. Interaction of secreted heat-shock protein 70 (Hsp70)-Hsp90-organizing protein (HOP) with cellular prion protein (PrP(C)) triggers a large number of trophic effects in the nervous system. We found that both PrP(C) and HOP are highly expressed in human GBM samples relative to non-tumoral tissue or astrocytoma grades I-III. High levels of PrP(C) and HOP were associated with greater GBM proliferation and lower patient survival. HOP-PrP(C) binding increased GBM proliferation in vitro via phosphatidylinositide 3-kinase and extracellular-signal-regulated kinase pathways, and a HOP peptide mimicking the PrP(C) binding site (HOP230-245) abrogates this effect. PrP(C) knockdown impaired tumor growth and increased survival of mice with tumors. In mice, intratumor delivery of HOP230-245 peptide impaired proliferation and promoted apoptosis of GBM cells. In addition, treatment with HOP230-245 peptide inhibited tumor growth, maintained cognitive performance and improved survival. Thus, together, the present results indicate that interfering with PrP(C)-HOP engagement is a promising approach for GBM therapy.

  2. Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy.

    PubMed

    Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L

    2016-12-01

    Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD 0-200ms , and the knee extension moment was positively associated with RTD 0-200ms . At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD 0-200ms , and RTD 0-peak torque . Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance.

  3. Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network

    NASA Astrophysics Data System (ADS)

    Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue

    2006-09-01

    In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.

  4. Model for using hip-hop music for small group HIV/AIDS prevention counseling with African American adolescents and young adults.

    PubMed

    Stephens, T; Braithwaite, R L; Taylor, S E

    1998-10-01

    Currently little attention has been directed, with the exception of peer education efforts, to constructively develop new and innovative ways to promote HIV/AIDS primary prevention among African American (AA) adolescents and young adults. With this in mind, the aim of this conceptual effort is to present a HIV/AIDS preventive counseling protocol developed for use with AA young adults that makes use of hip-hop music, a form of music popularized by young AAs. The author contend that an increased understanding of the relationships that many AA young adults have with hip-hop music may be used by disease prevention personnel to educate these populations about protective factors for HIV. Making use of hip-hop music is one strategy for integrating counseling in prevention and health maintenance. The overall implications of using hip-hop music in health promotion are unlimited. First, this method makes use of cultural relevant materials to address the educational and health needs of the target community. Second, it is grounded in an approach that serves to stimulate cooperative learning based on peer developed content. Moreover, the use of this medium can be applied to other health promotion activities such as violence/harm reduction and substance abuse prevention, upon reviews of songs for appropriate content. The authors contend that such an approach holds heuristic value in dealing with HIV/AIDS prevention among AA young adults. Additional testing of the intervention is warranted in the refinement of this innovative intervention.

  5. Different surface sensing of the cell body and nucleus in healthy primary cells and in a cancerous cell line on nanogrooves.

    PubMed

    Davidson, Patricia M; Bigerelle, Maxence; Reiter, Günter; Anselme, Karine

    2015-10-01

    Cancer cells are known to have alterations compared to healthy cells, but can these differences extend to the way cells interact with their environment? Here, the authors focused on the alignment on an array of grooves of nanometer depth using two cell types: healthy osteoprogenitor primary cells (HOP) and a cancerous osteosarcoma (SaOs-2) cell line. Another concern was how this alignment affects the cell's interior, namely, the nucleus. Based on the results, it is proposed that these two cell types respond to different size regimes: SaOs-2 cells are more sensitive to shallow grooves while HOP cells are strongly aligned with deep grooves. As a measure of the impact of cell alignment on the nucleus the orientation and elongation of the nucleus were determined. Compared to HOP cells, the cell nucleus of SaOs-2 cells is more aligned and elongated in response to grooves, suggesting a softer nucleus and/or increased force transmission. These results support the hypothesis that cancer cells have reduced nucleus rigidity compared to healthy ones and further indicate differences in sensing, which may be important during metastasis.

  6. Hop crop wild relatives

    USDA-ARS?s Scientific Manuscript database

    The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...

  7. The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.

    PubMed

    Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David

    2016-08-15

    Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. DOW-PR DOlphin and Whale Pods Routing Protocol for Underwater Wireless Sensor Networks (UWSNs).

    PubMed

    Wadud, Zahid; Ullah, Khadem; Hussain, Sajjad; Yang, Xiaodong; Qazi, Abdul Baseer

    2018-05-12

    Underwater Wireless Sensor Networks (UWSNs) have intrinsic challenges that include long propagation delays, high mobility of sensor nodes due to water currents, Doppler spread, delay variance, multipath, attenuation and geometric spreading. The existing Weighting Depth and Forwarding Area Division Depth Based Routing (WDFAD-DBR) protocol considers the weighting depth of the two hops in order to select the next Potential Forwarding Node (PFN). To improve the performance of WDFAD-DBR, we propose DOlphin and Whale Pod Routing protocol (DOW-PR). In this scheme, we divide the transmission range into a number of transmission power levels and at the same time select the next PFNs from forwarding and suppressed zones. In contrast to WDFAD-DBR, our scheme not only considers the packet upward advancement, but also takes into account the number of suppressed nodes and number of PFNs at the first and second hops. Consequently, reasonable energy reduction is observed while receiving and transmitting packets. Moreover, our scheme also considers the hops count of the PFNs from the sink. In the absence of PFNs, the proposed scheme will select the node from the suppressed region for broadcasting and thus ensures minimum loss of data. Besides this, we also propose another routing scheme (whale pod) in which multiple sinks are placed at water surface, but one sink is embedded inside the water and is physically connected with the surface sink through high bandwidth connection. Simulation results show that the proposed scheme has high Packet Delivery Ratio (PDR), low energy tax, reduced Accumulated Propagation Distance (APD) and increased the network lifetime.

  9. DOW-PR DOlphin and Whale Pods Routing Protocol for Underwater Wireless Sensor Networks (UWSNs)

    PubMed Central

    Wadud, Zahid; Ullah, Khadem; Hussain, Sajjad; Yang, Xiaodong; Qazi, Abdul Baseer

    2018-01-01

    Underwater Wireless Sensor Networks (UWSNs) have intrinsic challenges that include long propagation delays, high mobility of sensor nodes due to water currents, Doppler spread, delay variance, multipath, attenuation and geometric spreading. The existing Weighting Depth and Forwarding Area Division Depth Based Routing (WDFAD-DBR) protocol considers the weighting depth of the two hops in order to select the next Potential Forwarding Node (PFN). To improve the performance of WDFAD-DBR, we propose DOlphin and Whale Pod Routing protocol (DOW-PR). In this scheme, we divide the transmission range into a number of transmission power levels and at the same time select the next PFNs from forwarding and suppressed zones. In contrast to WDFAD-DBR, our scheme not only considers the packet upward advancement, but also takes into account the number of suppressed nodes and number of PFNs at the first and second hops. Consequently, reasonable energy reduction is observed while receiving and transmitting packets. Moreover, our scheme also considers the hops count of the PFNs from the sink. In the absence of PFNs, the proposed scheme will select the node from the suppressed region for broadcasting and thus ensures minimum loss of data. Besides this, we also propose another routing scheme (whale pod) in which multiple sinks are placed at water surface, but one sink is embedded inside the water and is physically connected with the surface sink through high bandwidth connection. Simulation results show that the proposed scheme has high Packet Delivery Ratio (PDR), low energy tax, reduced Accumulated Propagation Distance (APD) and increased the network lifetime. PMID:29757208

  10. DIFFERENTIAL DIAGNOSTIC PROCESS AND CLINICAL DECISION MAKING IN A YOUNG ADULT FEMALE WITH LATERAL HIP PAIN: A CASE REPORT.

    PubMed

    Livingston, Jennifer I; Deprey, Sara M; Hensley, Craig P

    2015-10-01

    differential diagnosis and clinical decision making. Young adults with lateral hip pain are often referred to physical therapy (PT). A thorough examination is required to obtain a diagnosis and guide management. The purpose of this case report is to describe the physical therapist's differential diagnostic process and clinical decision making for a subject with the referring diagnosis of trochanteric bursitis. A 29-year-old female presented to PT with limited sitting and running tolerance secondary to right lateral hip pain. Her symptoms began three months prior when she abruptly changed her running intensity and frequency of weight bearing activities, including running and low impact plyometrics for the lower extremity. Physical examination revealed a positive Trendelenburg sign, manual muscle test that was weak and painless of the right hip abductors, and pain elicited when performing a vertical hop on a concrete surface (+single leg hop test), but pain-free when performing the same single leg hop on a foam surface. Examination findings warranted discussion with the referring physician for further diagnostic imaging. Magnetic resonance imaging revealed a focus of edema in the posterior acetabulum, suspicious for an acetabular stress fracture. The subject was subsequently diagnosed with an acetabular stress fracture and restricted from running and plyometrics for four weeks. Thorough examination and appropriate clinical decision making by the physical therapist at the initial examination led to the diagnosis of an acetabular stress fracture in this subject. Clinicians must be aware of symptoms and signs which place the subject at risk for stress fracture for timely referral and management. 4.

  11. Time synchronization of a frequency-hopped MFSK communication system

    NASA Technical Reports Server (NTRS)

    Simon, M. K.; Polydoros, A.; Huth, G. K.

    1981-01-01

    In a frequency-hopped (FH) multiple-frequency-shift-keyed (MFSK) communication system, frequency hopping causes the necessary frequency transitions for time synchronization estimation rather than the data sequence as in the conventional (nonfrequency-hopped) system. Making use of this observation, this paper presents a fine synchronization (i.e., time errors of less than a hop duration) technique for estimation of FH timing. The performance degradation due to imperfect FH time synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of hops used in the FH timing estimate.

  12. Hop/STI1 modulates retinal proliferation and cell death independent of PrP{sup C}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.

    Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP{sup C}). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP{sup C} dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 ({alpha}-STI1) blocked both ganglion cell and NBL cell deathmore » independent of PrP{sup C}. cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while {alpha}-STI1 increased proliferation in the developing retina, both independent of PrP{sup C}. We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP{sup C}.« less

  13. Inhomogeneous atomic Bose-Fermi mixtures in cubic lattices.

    PubMed

    Cramer, M; Eisert, J; Illuminati, F

    2004-11-05

    We determine the ground state properties of inhomogeneous mixtures of bosons and fermions in cubic lattices and parabolic confining potentials. For finite hopping we determine the domain boundaries between Mott-insulator plateaux and hopping-dominated regions for lattices of arbitrary dimension within mean-field and perturbation theory. The results are compared with a new numerical method that is based on a Gutzwiller variational approach for the bosons and an exact treatment for the fermions. The findings can be applied as a guideline for future experiments with trapped atomic Bose-Fermi mixtures in optical lattices.

  14. Research on the frequency hopping bistatic sonar system

    NASA Astrophysics Data System (ADS)

    Liang, Guo-long; Zhang, Yao; Zhang, Guang-pu; Liu, Kai

    2011-10-01

    A new model for bistatic sonar system is established, in which frequency hopping (FH) signals are used for targets detection according to some rules. This model can decrease the time between adjacent signals and obtain more information in a unit time. The receiving system will receive and process the signals of different frequency respectively, according the FH pattern, for detecting and locating targets. This method can helps yield more stable and accurate outputs, using the characteristic of the FH signals, increase the ability of anti-detection and anti partial-band jamming.

  15. Generalized Kondo lattice model and its spin-polaron realization by the projection method for cuprates

    NASA Astrophysics Data System (ADS)

    Valkov, V. V.; Dzebisashvili, D. M.; Barabanov, A. F.

    2017-05-01

    The spin-fermion model, which is an effective low-energy realization of the three-band Emery model after passing to the Wannier representation for the px and py orbitals of the subsystem of oxygen ions, reduces to the generalized Kondo lattice model. A specific feature of this model is the existence of spin-correlated hoppings of the current carriers between distant cells. Numerical calculations of the spectrum of spin-electron excitations highlight the important role of the long-range spin-correlated hoppings.

  16. The 1963 Hip-Hop Machine: Hip-Hop Pedagogy as Composition.

    ERIC Educational Resources Information Center

    Rice, Jeff

    2003-01-01

    Proposes an alternative invention strategy for research-based argumentative writing. Investigates the coincidental usage of the term "whatever" in hip-hop, theory, and composition studies. Presents a "whatever-pedagogy" identified as "hip-hop pedagogy," a writing practice that models itself after digital sampling's…

  17. Research on synchronization technology of frequency hopping communication system

    NASA Astrophysics Data System (ADS)

    Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

    2018-05-01

    Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

  18. Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

    ERIC Educational Resources Information Center

    Brown, Bryan

    2010-01-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

  19. Formation and electrical transport properties of pentacene nanorod crystal.

    PubMed

    Akai-Kasaya, M; Ohmori, C; Kawanishi, T; Nashiki, M; Saito, A; Aono, M; Kuwahara, Y

    2010-09-10

    The monophasic formation of an uncharted pentacene crystal, the pentacene nanorod, has been investigated. The restricted formation of the pentacene nanorod on a bare mica surface reveals a peculiar surface catalytic crystal growth mode of the pentacene. We demonstrated the charge transport measurements through a single pentacene nanorod and analyzed the data using a periodic hopping conduction model. The results revealed that the pentacene nanorod has a periodic conductive node within their one-dimensional crystal.

  20. Chemical transformations of characteristic hop secondary metabolites in relation to beer properties and the brewing process: a review.

    PubMed

    Steenackers, Bart; De Cooman, Luc; De Vos, Dirk

    2015-04-01

    The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. High-Speed On-Board Data Processing Platform for LIDAR Projects at NASA Langley Research Center

    NASA Astrophysics Data System (ADS)

    Beyon, J.; Ng, T. K.; Davis, M. J.; Adams, J. K.; Lin, B.

    2015-12-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 - April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  2. Hip-Hopping across China: Intercultural Formulations of Local Identities

    ERIC Educational Resources Information Center

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  3. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    ERIC Educational Resources Information Center

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Dong; Heidelberger, Philip; Sugawara, Yutaka

    An apparatus and method for extending the scalability and improving the partitionability of networks that contain all-to-all links for transporting packet traffic from a source endpoint to a destination endpoint with low per-endpoint (per-server) cost and a small number of hops. An all-to-all wiring in the baseline topology is decomposed into smaller all-to-all components in which each smaller all-to-all connection is replaced with star topology by using global switches. Stacking multiple copies of the star topology baseline network creates a multi-planed switching topology for transporting packet traffic. Point-to-point unified stacking method using global switch wiring methods connects multiple planes ofmore » a baseline topology by using the global switches to create a large network size with a low number of hops, i.e., low network latency. Grouped unified stacking method increases the scalability (network size) of a stacked topology.« less

  5. Leucine-rich-repeat-containing variable lymphocyte receptors as modules to target plant-expressed proteins

    DOE PAGES

    Velásquez, André C.; Nomura, Kinya; Cooper, Max D.; ...

    2017-04-19

    The ability to target and manipulate protein-based cellular processes would accelerate plant research; yet, the technology to specifically and selectively target plant-expressed proteins is still in its infancy. Leucine-rich repeats (LRRs) are ubiquitously present protein domains involved in mediating protein–protein interactions. LRRs confer the binding specificity to the highly diverse variable lymphocyte receptor (VLR) antibodies (including VLRA, VLRB and VLRC types) that jawless vertebrates make as the functional equivalents of jawed vertebrate immunoglobulin-based antibodies. Here, VLRBs targeting an effector protein from a plant pathogen, HopM1, were developed by immunizing lampreys and using yeast surface display to select for high-affinity VLRBs.more » HopM1-specific VLRBs (VLRM1) were expressed in planta in the cytosol, the trans-Golgi network, and the apoplast. Expression of VLRM1 was higher when the protein localized to an oxidizing environment that would favor disulfide bridge formation (when VLRM1 was not localized to the cytoplasm), as disulfide bonds are necessary for proper VLR folding. VLRM1 specifically interacted in planta with HopM1 but not with an unrelated bacterial effector protein while HopM1 failed to interact with a non-specific VLRB. Later, VLRs may be used as flexible modules to bind proteins or carbohydrates of interest in planta, with broad possibilities for their use by binding directly to their targets and inhibiting their action, or by creating chimeric proteins with new specificities in which endogenous LRR domains are replaced by those present in VLRs.« less

  6. Leucine-rich-repeat-containing variable lymphocyte receptors as modules to target plant-expressed proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Velásquez, André C.; Nomura, Kinya; Cooper, Max D.

    The ability to target and manipulate protein-based cellular processes would accelerate plant research; yet, the technology to specifically and selectively target plant-expressed proteins is still in its infancy. Leucine-rich repeats (LRRs) are ubiquitously present protein domains involved in mediating protein–protein interactions. LRRs confer the binding specificity to the highly diverse variable lymphocyte receptor (VLR) antibodies (including VLRA, VLRB and VLRC types) that jawless vertebrates make as the functional equivalents of jawed vertebrate immunoglobulin-based antibodies. Here, VLRBs targeting an effector protein from a plant pathogen, HopM1, were developed by immunizing lampreys and using yeast surface display to select for high-affinity VLRBs.more » HopM1-specific VLRBs (VLRM1) were expressed in planta in the cytosol, the trans-Golgi network, and the apoplast. Expression of VLRM1 was higher when the protein localized to an oxidizing environment that would favor disulfide bridge formation (when VLRM1 was not localized to the cytoplasm), as disulfide bonds are necessary for proper VLR folding. VLRM1 specifically interacted in planta with HopM1 but not with an unrelated bacterial effector protein while HopM1 failed to interact with a non-specific VLRB. Later, VLRs may be used as flexible modules to bind proteins or carbohydrates of interest in planta, with broad possibilities for their use by binding directly to their targets and inhibiting their action, or by creating chimeric proteins with new specificities in which endogenous LRR domains are replaced by those present in VLRs.« less

  7. A dynamical mean-field study of orbital-selective Mott phase enhanced by next-nearest neighbor hopping

    NASA Astrophysics Data System (ADS)

    Niu, Yuekun; Sun, Jian; Ni, Yu; Song, Yun

    2018-06-01

    The dynamical mean-field theory is employed to study the orbital-selective Mott transition (OSMT) of the two-orbital Hubbard model with nearest neighbor hopping and next-nearest neighbor (NNN) hopping. The NNN hopping breaks the particle-hole symmetry at half filling and gives rise to an asymmetric density of states (DOS). Our calculations show that the broken symmetry of DOS benefits the OSMT, where the region of the orbital-selective Mott phase significantly extends with the increasing NNN hopping integral. We also find that Hund's rule coupling promotes OSMT by blocking the orbital fluctuations, but the influence of NNN hopping is more remarkable.

  8. The Helicopter Observation Platform for Marine and Continental Boundary Layer Studies

    NASA Astrophysics Data System (ADS)

    Avissar, R.; Broad, K.; Walko, R. L.; Drennan, W. M.; Williams, N. J.

    2016-02-01

    The University of Miami has acquired a commercial helicopter (Airbus H125) that was transformed into a one-of-a-kind Helicopter Observation Platform (HOP) that fills critical gaps in physical, chemical and biological observations of the environment. This new research facility is designed to carry sensors and instrument inlets in the undisturbed air in front of the helicopter nose at low airspeed and at various altitudes, from a few feet above the Earth's surface (where much of the climate and weather "action" takes place, and where we live) and up through the atmospheric boundary layer and the mid troposphere. The HOP, with its hovering capability, is also ideal for conducting various types of remote-sensing observations. It provides a unique and essential component of airborne measurement whose purpose, among others, is to quantify the exchanges of gases and energy at the Earth surface, as well as aerosol properties that affect the environment, the climate system, and human health. For its first scientific mission, an eddy-correlation system is being mounted in front of its nose to conduct high-frequency measurements of turbulence variables relevant to atmospheric boundary layer studies.Fully fueled and with both pilot and co-pilot on board, the HOP can carry a scientific payload of up to about 1,000 lbs internally (about 3,000 lbs externally) and fly for nearly 4 hours without refueling at an airspeed of 65 knots ( 30 m/s) that is ideal for in-situ observations. Its fast cruising speed is about 140 knots andits range, at that speed, is about 350 nautical miles. This specific helicopter was chosen because of its flat floor design, which is particularly convenient for installing scientific payload and also because of its high-altitude capability (it is the only commercial helicopter that ever landed at the top of Mt Everest).The HOP is available to the entire scientific community for any project that is feasible from a flight safety point of view and that fulfills the flight regulations of the country that it is flown in. It can be easily transported anywhere in the world and can also be operated from a properly equipped ship at sea foroceanographic research.

  9. Effects of 2 ankle destabilization devices on electromyography measures during functional exercises in individuals with chronic ankle instability.

    PubMed

    Donovan, Luke; Hart, Joseph M; Hertel, Jay

    2015-03-01

    Randomized crossover laboratory study. To determine the effects of ankle destabilization devices on surface electromyography (sEMG) measures of selected lower extremity muscles during functional exercises in participants with chronic ankle instability. Ankle destabilization devices are rehabilitation tools that can be worn as a boot or sandal to increase lower extremity muscle activation during walking in healthy individuals. However, they have not been tested in a population with pathology. Fifteen adults with chronic ankle instability participated. Surface electromyography electrodes were located over the anterior tibialis, fibularis longus, lateral gastrocnemius, rectus femoris, biceps femoris, and gluteus medius. The activity level of these muscles was recorded in a single testing session during unipedal stance with eyes closed, the Star Excursion Balance Test, lateral hops, and treadmill walking. Each task was performed under 3 conditions: shod, ankle destabilization boot, and ankle destabilization sandal. Surface electromyography signal amplitudes were measured for each muscle during each exercise for all 3 conditions. Participants demonstrated a significant increase, with moderate to large effect sizes, in sEMG signal amplitude of the fibularis longus in the ankle destabilization boot and ankle destabilization sandal conditions during the unipedal eyes-closed balance test, the Star Excursion Balance Test in the anterior and posteromedial directions, lateral hops, and walking, when compared to the shod condition. Both devices also resulted in an increase in sEMG signal amplitudes, with large effect sizes of the lateral gastrocnemius, rectus femoris, biceps femoris, and gluteus medius during the unipedal-stance-with-eyes-closed test, compared to the shod condition. Wearing ankle destabilization devices caused greater muscle activation during functional exercises in individuals with chronic ankle instability. Based on the magnitude of the effect, there were consistent increases in fibularis longus sEMG amplitudes during the unipedal eyes-closed balance test, the Star Excursion Balance Test in the anterior and posteromedial directions, and pre-initial contact and post-initial contact during lateral hops and walking.

  10. A Mobile Asteroid Surface Scout (MASCOT) for the Hayabusa 2 Mission to 1999 JU3: The Scientific Approach

    NASA Astrophysics Data System (ADS)

    Jaumann, Ralf; Bibring, Jean-Pierre; Glassmeier, Karl-Heinz; Grott, Matthias; Ho, Tra-Mi; Ulamec, Stepahn; Schmitz, Nicole; Auster, Ulrich; Biele, Jens; Kuninaka, Hitoshi; Okada, Tatsuaki; Yoshikawa, Makoto; Watanabe, Sei-ichhiro; Fujimoto, Masaki; Spohn, Tilman; Koncz, Alexander; Michaelis, Harald

    2014-05-01

    MASCOT, a Mobile Asteroid Surface Scout, will support JAXA's Hayabusa 2 mission to investigate the C-type asteroid 1999 JU3 (1). The German Aer-ospace Center (DLR) develops MASCOT with contributions from CNES (France) (2,3). Main objective is to in-situ map the asteroid's geomorpholo-gy, the intimate structure, texture and composition of the regolith (dust, soil and rocks), and the thermal, mechanical, and magnetic properties of the sur-face in order to provide ground truth for the orbiter remote measurements, support the selection of sampling sites, and provide context information for the returned samples. MASCOT comprises a payload of four scientific in-struments: camera, radiometer, magnetometer and hyperspectral microscope. C- and D-type asteroids hold clues to the origin of the solar system, the for-mation of planets, the origins of water and life on Earth, the protection of Earth from impacts, and resources for future human exploration. C- and D-types are dark and difficult to study from Earth, and have only been glimpsed by spacecraft. While results from recent missions (e.g., Hayabusa, NEAR (4, 5, 6)) have dramatically increased our understanding of asteroids, important questions remain. For example, characterizing the properties of asteroid regolith in-situ would deliver important ground truth for further understanding telescopic and orbital observations and samples of such aster-oids. MASCOT will descend and land on the asteroid and will change its position two times by hopping. This enables measurements during descent, at the landing and hopping positions #1-3, and during hopping. References: (1) Vilas, F., Astronomical J. 1101-1105, 2008; (2) Ulamec, S., et al., Acta Astronautica, Vol. 93, pp. 460-466; (3) Jaumann et al., 45th LPSC, Houston; (4) Special Issue, Science, Vol. 312 no. 5778, 2006; (5) Special Issue Science, Vol. 333 no. 6046, 2011. (6) Bell, L., Mitton, J-., Cambridge Univ. Press, 2002.

  11. A Mobile Asteroid Surface Scout (MASCOT) for the Hayabusa 2 Mission to 1999 JU3: The Scientific Approach

    NASA Astrophysics Data System (ADS)

    Jaumann, Ralf; Bibring, Jean-Pierre; Glassmeier, Karl-Heinz; Grott, Matthias; Ho, Tra-Mie; Ulamec, Stephan; Schmitz, Nicole; Auster, Hans-Ulrich; Biele, Jens; Kuninaka, Hitoshi; Okada, Tatsuaki; Yoshikawa, Makoto; Watanabe, Sei-ichhiro; Fujimoto, Masaki; Spohn, Tilman

    2013-04-01

    Mascot, a Mobile Asteroid Surface Scout, will support JAXA's Hayabusa 2 mission to investigate the C-type asteroid 1999 JU3 (1). The German Aero-space Center (DLR) develops Mascot with contributions from CNES (France) (2). Main objective is to in-situ map the asteroid's geomorphology, the intimate structure, texture and composition of the regolith (dust, soil and rocks), and the thermal, mechanical, and magnetic properties of the surface in order to provide ground truth for the orbiter remote measurements, sup-port the selection of sampling sites, and provide context information for the returned samples. Mascot comprises a payload of four scientific instruments: camera, radiometer, magnetometer and hyperspectral microscope. C- and D-type asteroids hold clues to the origin of the solar system, the formation of planets, the origins of water and life on Earth, the protection of Earth from impacts, and resources for future human exploration. C- and D-types are dark and difficult to study from Earth, and have only been glimpsed by spacecraft. While results from recent missions (e.g., Hayabusa, NEAR (3, 4, 5)) have dramatically increased our understanding of asteroids, important questions remain. For example, characterizing the properties of asteroid reg-olith in-situ would deliver important ground truth for further understanding telescopic and orbital observations and samples of such asteroids. Mascot will descend and land on the asteroid and will change its position two times by hopping. This enables measurements during descent, at the landing and hopping positions #1-3, and during hopping. References: (1) Vilas, F., Astronomical J. 1101-1105, 2008; (2) Ulamec, S., et al., COSPAR, General Assembly, Mysore/India, 2012; (3) Special Issue, Science, Vol. 312 no. 5778, 2006; (4) Special Issue Science, Vol. 333 no. 6046, 2011; (5) Bell, L., Mitton, J-., Cambridge Univ. Press, 2002.

  12. Hydrogen bond strengthening induces fluorescence quenching of PRODAN derivative by turning on twisted intramolecular charge transfer

    NASA Astrophysics Data System (ADS)

    Yang, Yonggang; Li, Donglin; Li, Chaozheng; Liu, YuFang; Jiang, Kai

    2017-12-01

    Researchers have proposed different effective mechanisms of hydrogen bonding (HB) on the fluorescence of 6-propionyl-2-dimethylaminonaphthalene (PRODAN) and its derivatives. Herein, excited state transition and dynamics analysis confirm that the fluorescence of PD (a derivative of PRODAN with ethyl replaced by 3-hydroxy-2,2-dimethylpropan) emits from the planar intramolecular charge transfer (PICT) state rather than twist ICT (TICT) state, because the fluorescence emission and surface hopping from the TICT state to the twist ground (T-S0) state is energy forbidden. Nevertheless, the strengthening of intramolecular-HB (intra-HB) and intermolecular-HB (inter-HB) of PD-(methanol)2 smooth the pathway of surface hopping from TICT to T-S0 state and the external conversion going to planar ground state by decreasing the energy difference of the two states. This smoothing changes the fluorescence state of PD-(methanol)2 to the TICT state in which fluorescence emission does not occur but surface hopping, leading to the partial fluorescence quenching of PD in methanol solvent. This conclusion is different from previous related reports. Moreover, the inter-HB strengthening of PD-methanol in PICT state induces the cleavage of intra-HB and a fluorescence red-shift of 54 nm compared to PD. This red-shift increases to 66 nm for PD-(methanol)2 for the strengthening of the one intra-HB and two inter-HBs. The dipole moments of PD-methanol and PD-(methanol)2 respectively increase about 10.3D and 8.1D in PICT state compared to PD. The synergistic effect of intra-HB and inter-HB induces partial quenching of PD in methanol solvent by turning on the TICT state and fluorescence red-shift. This work gives a reasonable description on the fluorescence red-shift and partial quenching of PD in methanol solvent, which will bring insight into the study of spectroscopic properties of molecules owning better spectral characteristics.

  13. Hydrogen bond strengthening induces fluorescence quenching of PRODAN derivative by turning on twisted intramolecular charge transfer.

    PubMed

    Yang, Yonggang; Li, Donglin; Li, Chaozheng; Liu, YuFang; Jiang, Kai

    2017-12-05

    Researchers have proposed different effective mechanisms of hydrogen bonding (HB) on the fluorescence of 6-propionyl-2-dimethylaminonaphthalene (PRODAN) and its derivatives. Herein, excited state transition and dynamics analysis confirm that the fluorescence of PD (a derivative of PRODAN with ethyl replaced by 3-hydroxy-2,2-dimethylpropan) emits from the planar intramolecular charge transfer (PICT) state rather than twist ICT (TICT) state, because the fluorescence emission and surface hopping from the TICT state to the twist ground (T-S 0 ) state is energy forbidden. Nevertheless, the strengthening of intramolecular-HB (intra-HB) and intermolecular-HB (inter-HB) of PD-(methanol) 2 smooth the pathway of surface hopping from TICT to T-S 0 state and the external conversion going to planar ground state by decreasing the energy difference of the two states. This smoothing changes the fluorescence state of PD-(methanol) 2 to the TICT state in which fluorescence emission does not occur but surface hopping, leading to the partial fluorescence quenching of PD in methanol solvent. This conclusion is different from previous related reports. Moreover, the inter-HB strengthening of PD-methanol in PICT state induces the cleavage of intra-HB and a fluorescence red-shift of 54nm compared to PD. This red-shift increases to 66nm for PD-(methanol) 2 for the strengthening of the one intra-HB and two inter-HBs. The dipole moments of PD-methanol and PD-(methanol) 2 respectively increase about 10.3D and 8.1D in PICT state compared to PD. The synergistic effect of intra-HB and inter-HB induces partial quenching of PD in methanol solvent by turning on the TICT state and fluorescence red-shift. This work gives a reasonable description on the fluorescence red-shift and partial quenching of PD in methanol solvent, which will bring insight into the study of spectroscopic properties of molecules owning better spectral characteristics. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State

    NASA Astrophysics Data System (ADS)

    Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen

    2017-10-01

    Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.

  15. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    ERIC Educational Resources Information Center

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  16. Precision QTL mapping of downy mildew resistance in Hop (Humulus lupulus L.)

    USDA-ARS?s Scientific Manuscript database

    Hop Downy mildew (DM) is an obligate parasite causing severe losses in hop if not controlled. Resistance to this pathogen is a primary goal for hop breeding programs. The objective of this study was to identify QTLs linked to DM resistance. Next-generation-sequencing was performed on a mapping po...

  17. Genomics of the hop psuedo-autosomal regions

    USDA-ARS?s Scientific Manuscript database

    Hop is one of the few crop species with female and male plants with sex being determined by either XX or XY chromosomes. Hop cones are only produced in female hops with or without fertilization. This has lead to most genomic research being directed toward female plants. Very little work has been don...

  18. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    ERIC Educational Resources Information Center

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  19. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    ERIC Educational Resources Information Center

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  20. Simulation of clustering and anisotropy due to Co step-edge segregation in vapor-deposited CoPt3

    NASA Astrophysics Data System (ADS)

    Maranville, B. B.; Schuerman, M.; Hellman, F.

    2006-03-01

    An atomistic mechanism is proposed for the creation of structural anisotropy and consequent large perpendicular magnetic anisotropy in vapor-deposited films of CoPt3 . Energetic considerations of bonding in Co-Pt suggest that Co segregates to step edges due to their low coordination, for all film orientations, while Pt segregates to the two low index surfaces. Coalescence of islands during growth cause these Co-rich step edges to become flat thin Co platelets in a Pt rich matrix, giving rise to the experimentally observed magnetic anisotropy. This proposed model is tested with kinetic Monte Carlo simulation of the vapor deposition growth. A tight-binding, second-moment approximation to the interatomic potential is used to calculate the probability of an atom hopping from one surface site to another, assuming an Arrhenius-like activation model of surface motion. Growth is simulated by allowing many hopping events per adatom. The simulated as-grown films show an asymmetry in Co-Co bonding between the in-plane and out-of-plane directions, in good agreement with experimental data. The growth temperature dependence found in the simulations is strong and similar to that seen in experiments, and an increase in Co edge segregation with increasing temperature is also observed.

  1. 3-Sulfanyl-4-methylpentan-1-ol in Dry-Hopped Beers: First Evidence of Glutathione S-Conjugates in Hop (Humulus lupulus L.).

    PubMed

    Kankolongo Cibaka, Marie-Lucie; Decourrière, Laura; Lorenzo-Alonso, Celso-José; Bodart, Etienne; Robiette, Raphaël; Collin, Sonia

    2016-11-16

    Monovarietal dry-hopped beers were produced with the dual-purpose hop cultivars Amarillo, Hallertau Blanc, and Mosaic. The grapefruit-like 3-sulfanyl-4-methylpentan-1-ol was found in all three beers at concentrations much higher than expected on the basis of the free thiol content in hop. Even cysteinylated precursors proved unable to explain our results. As observed in wine, the occurrence of S-glutathione precursors was therefore suspected in hop. The analytical standards of S-3-(4-methyl-1-hydroxypentyl)glutathione, never described before, and of S-3-(1-hydroxyhexyl)glutathione, previously evidenced in grapes, were chemically synthesized. An optimized extraction of glutathionylated precursors was then applied to Amarillo, Hallertau Blanc, and Mosaic hop samples. HPLC-ESI(+)MS/MS revealed, for the first time, the occurrence of S-3-(1-hydroxyhexyl)glutathione and S-3-(4-methyl-1-hydroxypentyl)glutathione in hop, at levels well above those reported for their cysteinylated counterparts. S-3-(1-Hydroxyhexyl)glutathione emerged in all cases as the major adduct in hop. Yet, although 3-sulfanylhexan-1-ol seems relatively ubiquitous in free, cysteinylated, and glutathionylated forms, the glutathione adduct of 3-sulfanyl-4-methylpentan-1-ol, never evidenced in other plants up to now, was found only in the Hallertau Blanc variety.

  2. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    PubMed

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2018-06-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  3. The Pseudomonas syringae type III effector HopG1 targets mitochondria, alters plant development, and suppresses plant innate immunity

    PubMed Central

    Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.

    2009-01-01

    Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557

  4. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    PubMed

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  5. Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

    PubMed

    Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

    2018-04-01

    Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p < 0.01), triple hop (417 ± 106 vs 519 ± 102% limb length, p < 0.01), timed hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p < 0.01), and crossover hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the operative limb compared to the control and non-operative limbs, even after starting sport-specific drills. Importantly, HER strength independently predicted hop performance. Based on these findings, to resolve between-limb deficits in strength and hop performance clinicians should include HER strengthening exercises in post-operative rehabilitation. Prognostic Study, Level II.

  6. COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT

    PubMed Central

    Carcia, Christopher R.; Christoforetti, John J.; Martin, RobRoy L.

    2016-01-01

    ABSTRACT Background Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. Purpose The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Study Design Quasi-experimental, cohort comparison. Methods Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. Results No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Conclusion Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. Level of Evidence 3B, non-consectutive cohort study PMID:27525177

  7. Variation in band gap energy and electrical analysis of double doped cobalt ferrite

    NASA Astrophysics Data System (ADS)

    Parveen, Azra; Agrawal, Shraddha; Azam, Ameer

    2018-05-01

    The Ca and Cr doped cobalt ferrite nanoparticles (Co0.9Ca0.1) (Fe0.8 Cr0.2)2O4 were synthesized by microwave gel combustion method. Microstructural studies were carried out by XRD and SEM. Structural studies suggest that the crystal system remains spinal even with the doping of calcium and chromium. The SEM image shows the spherical morphology of surface of the sample. Optical properties of Ca and Cr doped cobalt ferrite were studied by UV-visible technique in the range of 400-600 nm. The electrical conductivity of pure and doped cobalt ferrite were studied as a function of frequency and were explained on the basis of electron hopping.

  8. Excited state dynamics of thiophene and bithiophene: new insights into theoretically challenging systems.

    PubMed

    Prlj, Antonio; Curchod, Basile F E; Corminboeuf, Clémence

    2015-06-14

    The computational elucidation and proper description of the ultrafast deactivation mechanisms of simple organic electronic units, such as thiophene and its oligomers, is as challenging as it is contentious. A comprehensive excited state dynamics analysis of these systems utilizing reliable electronic structure approaches is currently lacking, with earlier pictures of the photochemistry of these systems being conceived based upon high-level static computations or lower level dynamic trajectories. Here a detailed surface hopping molecular dynamics of thiophene and bithiophene using the algebraic diagrammatic construction to second order (ADC(2)) method is presented. Our findings illustrate that ring puckering plays an important role in thiophene photochemistry and that the photostability increases when going upon dimerization into bithiophene.

  9. QTL examination of a bi-parental mapping population segregating for “short-stature” in hop (Humulus lupulus L.)

    USDA-ARS?s Scientific Manuscript database

    Increasing labor costs and reduced labor pools for hop production have resulted in the necessity to develop strategies to improve efficiency and automate hop production and harvest. One solution for reducing labor inputs is the use and production of “low-trellis” hop varieties optimized for mechani...

  10. First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China

    USDA-ARS?s Scientific Manuscript database

    Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...

  11. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    ERIC Educational Resources Information Center

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  12. Hip-Hop and the Academic Canon

    ERIC Educational Resources Information Center

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  13. 21 CFR 173.270 - Hexane.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...

  14. 21 CFR 173.270 - Hexane.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...

  15. Human Exploration of Mars

    NASA Astrophysics Data System (ADS)

    Gwynne, Owen; McKay, Chris; Zubrin, Robert

    1991-06-01

    Novel approaches to the human exploration of Mars are considered with emphasis on a space suit design, extraterrestrial surface mobility, and water supply. A possible way of transporting personnel on the surface of Mars uses a suborbital rocket that will hop from one site to the next, refuelling each time it lands and giving the Martian explorers effective global mobility. Telepresence could be used to avoid limiting the people on Mars to a small exploration area as a result of a lack of transportation infrastructure. Drawings and photographs are included.

  16. Effects of europium substitution for In on structure and photoelectric properties of CuIn{sub 1−x}Eu{sub x}Te{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nie, Xiaomeng; Guo, Yongquan

    2016-01-15

    The structures and optical and electric properties of europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2} have been studied systematically using powder X-ray diffraction (XRD), scanning electron microscopy (SEM) with energy dispersive spectrum (EDS), ultraviolet and visible spectrophotometer (UV–vis), and standard four-probe method. The studies reveal that the minor europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} could still stabilize the chalcopyrite structure in a solid solution of x=0.1. The lattice parameters are going up with increasing the content of europium in CuIn{sub 1−x}Eu{sub x}Te{sub 2} due to the size effect at In site. The structural refinement confirms that Eu partly substitutes formore » In and occupies the 4b crystal position. SEM morphologies show that the europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} can fine the grains from the largely agglomerated state to the uniformly separated state. The electrical resistivities of single phase CuIn{sub 1−x}Eu{sub x}Te{sub 2} follow a mixture model of hopping conductivity and variable range hopping conductivity. The absorption band-gaps of CuIn{sub 1−x}Eu{sub x}Te{sub 2} at room temperature tend to increase with increasing Eu content. CuIn{sub 1−x}Eu{sub x}Te{sub 2} might be a good candidate for photovoltaic cell. - Graphical abstract: CuIn{sub 0.9}Eu{sub 0.1}Te{sub 2} follows a mixture of hopping conductivity and variable range hopping conductivity mechanism. - Highlights: • Novel europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2}. • Potential application for devices and solar cells. • A mixture of hopping and variable range hopping conductivity mechanism.« less

  17. HapHop-Physio: a computer game to support cognitive therapies in children.

    PubMed

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

    2017-01-01

    Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch ® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

  18. Organogenic nodule formation in hop: a tool to study morphogenesis in plants with biotechnological and medicinal applications.

    PubMed

    Fortes, Ana M; Santos, Filipa; Pais, Maria S

    2010-01-01

    The usage of Humulus lupulus for brewing increased the demand for high-quality plant material. Simultaneously, hop has been used in traditional medicine and recently recognized with anticancer and anti-infective properties. Tissue culture techniques have been reported for a wide range of species, and open the prospect for propagation of disease-free, genetically uniform and massive amounts of plants in vitro. Moreover, the development of large-scale culture methods using bioreactors enables the industrial production of secondary metabolites. Reliable and efficient tissue culture protocol for shoot regeneration through organogenic nodule formation was established for hop. The present review describes the histological, and biochemical changes occurring during this morphogenic process, together with an analysis of transcriptional and metabolic profiles. We also discuss the existence of common molecular factors among three different morphogenic processes: organogenic nodules and somatic embryogenesis, which strictly speaking depend exclusively on intrinsic developmental reprogramming, and legume nitrogen-fixing root nodules, which arises in response to symbiosis. The review of the key factors that participate in hop nodule organogenesis and the comparison with other morphogenic processes may have merit as a study presenting recent advances in complex molecular networks occurring during morphogenesis and together, these provide a rich framework for biotechnology applications.

  19. Aspirin increases susceptibility of Helicobacter pylori to metronidazole by augmenting endocellular concentrations of antimicrobials.

    PubMed

    Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang

    2009-02-28

    To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. H pylori reference strain 26695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-(3)H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression.

  20. Genetic interactions between the chromosome axis-associated protein Hop1 and homologous recombination determinants in Schizosaccharomyces pombe.

    PubMed

    Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander

    2018-03-17

    Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.

  1. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs

    PubMed Central

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-01-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014

  2. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    PubMed

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  3. The Habc Domain of the SNARE Vam3 Interacts with the HOPS Tethering Complex to Facilitate Vacuole Fusion*

    PubMed Central

    Lürick, Anna; Kuhlee, Anne; Bröcker, Cornelia; Kümmel, Daniel; Raunser, Stefan; Ungermann, Christian

    2015-01-01

    Membrane fusion at vacuoles requires a consecutive action of the HOPS tethering complex, which is recruited by the Rab GTPase Ypt7, and vacuolar SNAREs to drive membrane fusion. It is assumed that the Sec1/Munc18-like Vps33 within the HOPS complex is largely responsible for SNARE chaperoning. Here, we present direct evidence for HOPS binding to SNAREs and the Habc domain of the Vam3 SNARE protein, which may explain its function during fusion. We show that HOPS interacts strongly with the Vam3 Habc domain, assembled Q-SNAREs, and the R-SNARE Ykt6, but not the Q-SNARE Vti1 or the Vam3 SNARE domain. Electron microscopy combined with Nanogold labeling reveals that the binding sites for vacuolar SNAREs and the Habc domain are located in the large head of the HOPS complex, where Vps16 and Vps33 have been identified before. Competition experiments suggest that HOPS bound to the Habc domain can still interact with assembled Q-SNAREs, whereas Q-SNARE binding prevents recognition of the Habc domain. In agreement, membranes carrying Vam3ΔHabc fuse poorly unless an excess of HOPS is provided. These data suggest that the Habc domain of Vam3 facilitates the assembly of the HOPS/SNARE machinery at fusion sites and thus supports efficient membrane fusion. PMID:25564619

  4. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    ERIC Educational Resources Information Center

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  5. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    ERIC Educational Resources Information Center

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  6. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    ERIC Educational Resources Information Center

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  7. Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

    ERIC Educational Resources Information Center

    Love, Bettina L.

    2016-01-01

    Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

  8. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    ERIC Educational Resources Information Center

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  9. Advances and Promises of Layered Halide Hybrid Perovskite Semiconductors.

    PubMed

    Pedesseau, Laurent; Sapori, Daniel; Traore, Boubacar; Robles, Roberto; Fang, Hong-Hua; Loi, Maria Antonietta; Tsai, Hsinhan; Nie, Wanyi; Blancon, Jean-Christophe; Neukirch, Amanda; Tretiak, Sergei; Mohite, Aditya D; Katan, Claudine; Even, Jacky; Kepenekian, Mikaël

    2016-11-22

    Layered halide hybrid organic-inorganic perovskites (HOP) have been the subject of intense investigation before the rise of three-dimensional (3D) HOP and their impressive performance in solar cells. Recently, layered HOP have also been proposed as attractive alternatives for photostable solar cells and revisited for light-emitting devices. In this review, we combine classical solid-state physics concepts with simulation tools based on density functional theory to overview the main features of the optoelectronic properties of layered HOP. A detailed comparison between layered and 3D HOP is performed to highlight differences and similarities. In the same way as the cubic phase was established for 3D HOP, here we introduce the tetragonal phase with D 4h symmetry as the reference phase for 2D monolayered HOP. It allows for detailed analysis of the spin-orbit coupling effects and structural transitions with corresponding electronic band folding. We further investigate the effects of octahedral tilting on the band gap, loss of inversion symmetry and possible Rashba effect, quantum confinement, and dielectric confinement related to the organic barrier, up to excitonic properties. Altogether, this paper aims to provide an interpretive and predictive framework for 3D and 2D layered HOP optoelectronic properties.

  10. A Hop-Count Analysis Scheme for Avoiding Wormhole Attacks in MANET

    PubMed Central

    Jen, Shang-Ming; Laih, Chi-Sung; Kuo, Wen-Chung

    2009-01-01

    MANET, due to the nature of wireless transmission, has more security issues compared to wired environments. A specific type of attack, the Wormhole attack does not require exploiting any nodes in the network and can interfere with the route establishment process. Instead of detecting wormholes from the role of administrators as in previous methods, we implement a new protocol, MHA, using a hop-count analysis from the viewpoint of users without any special environment assumptions. We also discuss previous works which require the role of administrator and their reliance on impractical assumptions, thus showing the advantages of MHA. PMID:22408566

  11. HOPM1 mediated disease resistance to Pseudomonas syringae in Arabidopsis

    DOEpatents

    He, Sheng Yang [Okemos, MI; Nomura, Kinya [East Lansing, MI

    2011-11-15

    The present invention relates to compositions and methods for enhancing plant defenses against pathogens. More particularly, the invention relates to enhancing plant immunity against bacterial pathogens, wherein HopM1.sub.1-300 mediated protection is enhanced, such as increased protection to Pseudomonas syringae pv. tomato DC3000 HopM1 and/or there is an increase in activity of an ATMIN associated plant protection protein, such as ATMIN7. Reagents of the present invention further provide a means of studying cellular trafficking while formulations of the present inventions provide increased pathogen resistance in plants.

  12. A rapid isothermal assay for the detection of Hop stunt viroid in hop plants (Humulus lupulus), and its application in disease surveys.

    PubMed

    Kappagantu, Madhu; Villamor, Dan Edward V; Bullock, Jeff M; Eastwell, Kenneth C

    2017-07-01

    Hop stunt disease caused by Hop stunt viroid (HSVd) is a growing threat to hop cultivation globally. HSVd spreads mainly by use of contaminated planting material and by mechanical means. Thorough testing of hop yards and removal of infected bines are critical components of efforts to control the spread of the disease. Reverse transcription-polymerase chain reaction (RT-PCR) has become the primary technique used for HSVd detection; however, sample handling and analysis are technically challenging. In this study, a robust reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed to facilitate analysis of multiple samples. The assay was optimized with all major variants of HSVd from other host species in addition to hop variants. Used in conjunction with sample collection cards, RT-RPA accommodates large sample numbers. Greenhouse and farm samples tested with RT-RPA were also tested with RT-PCR and a 100% correlation between the two techniques was found. Copyright © 2017. Published by Elsevier B.V.

  13. Incorporating Decoherence in the Dynamic Disorder Model of Organic Semiconductors

    NASA Astrophysics Data System (ADS)

    Si, Wei; Yao, Yao; Wu, Chang-Qin

    2014-03-01

    The transport phenomena in crystalline organic semiconductors, such as pentacene, have drawn much attention recently, where the electron-phonon interaction plays a crucial role. An important advance is the dynamic disorder model proposed by Troisi et. al., which is successful in determining the carrier mobility and explaining the optical conductivity measurements. In this work, we aim to incorporate the decoherence effects in the dynamic disorder model, which is essential for the self-consistent description of the carrier dynamics. The method is based on the energy-based decoherence correction widely used in the surface hopping algorithm. The resulting dynamics shows a diffusion process of wave packets with finite localization length, which scales with the decoherence time. In addition, the calculated mobility decreases with increasing temperature. Thus the method could describe a band-like transport based on localized states, which is the type of transport anticipated in these materials.

  14. Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

    PubMed

    Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

    2015-08-01

    Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

  15. Optimization of Benzoisothiazole dioxide inhibitory activity of the NS5B polymerase of HCV genotype 4 using ligand-steered homological modeling, reaction-driven scaffold-hopping and Enovo workflow.

    PubMed

    Mahmoud, Amr Hamed; Mohamed Abouzid, Khaled Abouzid; El Ella, Dalal Abd El Rahman Abou; Hamid Ismail, Mohamed Abdel

    2011-01-01

    Infection caused by hepatitis C virus (HCV) is a significant world health problem for which novel therapies are in urgent demand. The virus is highly prevalent in the Middle East and Africa particularly Egypt with more than 90% of infections due to genotype 4. Nonstructural (NS5B) viral proteins have emerged as an attractive target for HCV antivirals discovery. A potent class of inhibitors having benzisothiazole dioxide scaffold has been identified on this target, however they were mainly active on genotype 1 while exhibiting much lowered activity on other genotypes due to the high degree of mutation of its binding site. Based on this fact, we employed a novel strategy to optimize this class on genotype 4. This strategy depends on using a refined ligand-steered homological model of this genotype to study the mutation binding energies of the binding site amino acid residues, the essential features for interaction and provide a structure-based pharmacophore model that can aid optimization. This model was applied on a focused library which was generated using a reaction-driven scaffold-hopping strategy. The hits retrieved were subjected to Enovo pipeline pilot optimization workflow that employs R-group enumeration, core-constrained protein docking using modified CDOCKER and finally ranking of poses using an accurate molecular mechanics generalized Born with surface area method.

  16. Single molecule translocation in smectics illustrates the challenge for time-mapping in simulations on multiple scales

    NASA Astrophysics Data System (ADS)

    Mukherjee, Biswaroop; Peter, Christine; Kremer, Kurt

    2017-09-01

    Understanding the connections between the characteristic dynamical time scales associated with a coarse-grained (CG) and a detailed representation is central to the applicability of the coarse-graining methods to understand molecular processes. The process of coarse graining leads to an accelerated dynamics, owing to the smoothening of the underlying free-energy landscapes. Often a single time-mapping factor is used to relate the time scales associated with the two representations. We critically examine this idea using a model system ideally suited for this purpose. Single molecular transport properties are studied via molecular dynamics simulations of the CG and atomistic representations of a liquid crystalline, azobenzene containing mesogen, simulated in the smectic and the isotropic phases. The out-of-plane dynamics in the smectic phase occurs via molecular hops from one smectic layer to the next. Hopping can occur via two mechanisms, with and without significant reorientation. The out-of-plane transport can be understood as a superposition of two (one associated with each mode of transport) independent continuous time random walks for which a single time-mapping factor would be rather inadequate. A comparison of the free-energy surfaces, relevant to the out-of-plane transport, qualitatively supports the above observations. Thus, this work underlines the need for building CG models that exhibit both structural and dynamical consistency to the underlying atomistic model.

  17. Fermiology and Superconductivity of Topological Surface States in PdTe2

    NASA Astrophysics Data System (ADS)

    Clark, O. J.; Neat, M. J.; Okawa, K.; Bawden, L.; Marković, I.; Mazzola, F.; Feng, J.; Sunko, V.; Riley, J. M.; Meevasana, W.; Fujii, J.; Vobornik, I.; Kim, T. K.; Hoesch, M.; Sasagawa, T.; Wahl, P.; Bahramy, M. S.; King, P. D. C.

    2018-04-01

    We study the low-energy surface electronic structure of the transition-metal dichalcogenide superconductor PdTe2 by spin- and angle-resolved photoemission, scanning tunneling microscopy, and density-functional theory-based supercell calculations. Comparing PdTe2 with its sister compound PtSe2 , we demonstrate how enhanced interlayer hopping in the Te-based material drives a band inversion within the antibonding p -orbital manifold well above the Fermi level. We show how this mediates spin-polarized topological surface states which form rich multivalley Fermi surfaces with complex spin textures. Scanning tunneling spectroscopy reveals type-II superconductivity at the surface, and moreover shows no evidence for an unconventional component of its superconducting order parameter, despite the presence of topological surface states.

  18. Balancing the competing requirements of saltatorial and fossorial specialisation: burrowing costs in the spinifex hopping mouse, Notomys alexis.

    PubMed

    White, Craig R; Matthews, Philip G D; Seymour, Roger S

    2006-06-01

    Semi-fossorial animals (burrowing surface foragers) need to balance the competing morphological requirements of terrestrial and burrowing locomotion. These species rarely show the same degree of claw, forelimb and pectoral girdle structural development that fully fossorial forms (burrowing subterranean foragers) do, but nevertheless invest considerable amounts of energy in burrow systems. The compromise between terrestrial and burrowing locomotion was investigated by measuring net costs of burrowing and pedestrian transport in the spinifex hopping mouse, Notomys alexis, a species that forages in open areas in arid environments and is adapted for saltatorial locomotion. The net cost of transport by burrowing of hopping mice was found to be more expensive than for specialised fossorial species, and burrows were estimated to represent an energy investment equivalent to the terrestrial locomotion expected to be incurred in 17-100 days. A phylogenetically independent-contrasts approach revealed that morphological specialisation for burrowing was associated with low maximum running speeds in fossorial mammals and, for non-fossorial rodents and marsupials, maximum running speed was positively correlated with an index of habitat structure that ranged from arboreal to open desert. The high terrestrial speeds attainable by this semi-fossorial species by saltatory locomotion apparently outweigh the energetic savings that would be associated with burrowing specialisation.

  19. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    ERIC Educational Resources Information Center

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  20. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    ERIC Educational Resources Information Center

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  1. Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

    ERIC Educational Resources Information Center

    Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

    2013-01-01

    Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

  2. Bringing Back Sweet (and Not so Sweet) Memories: The Cultural Politics of Memory, Hip-Hop, and Generational Identities

    ERIC Educational Resources Information Center

    Hill, Marc Lamont

    2009-01-01

    This article examines the salience of collective "memory" and "remembering" among a group of students in Hip-Hop Lit, a hip-hop centered English literature course that I co-taught at "Howard High School," an urban high school in the Northeastern United States. Specifically, this article examines the memory work that occurred within Hip-Hop Lit in…

  3. Precision improvement of frequency-modulated continuous-wave laser ranging system with two auxiliary interferometers

    NASA Astrophysics Data System (ADS)

    Shi, Guang; Wang, Wen; Zhang, Fumin

    2018-03-01

    The measurement precision of frequency-modulated continuous-wave (FMCW) laser distance measurement should be proportional to the scanning range of the tunable laser. However, the commercial external cavity diode laser (ECDL) is not an ideal tunable laser source in practical applications. Due to the unavoidable mode hopping and scanning nonlinearity of the ECDL, the measurement precision of FMCW laser distance measurements can be substantially affected. Therefore, an FMCW laser ranging system with two auxiliary interferometers is proposed in this paper. Moreover, to eliminate the effects of ECDL, the frequency-sampling method and mode hopping influence suppression method are employed. Compared with a fringe counting interferometer, this FMCW laser ranging system has a measuring error of ± 20 μm at the distance of 5.8 m.

  4. Hop/Sti1 – A Two-Faced Cochaperone Involved in Pattern Recognition Receptor Maturation and Viral Infection

    PubMed Central

    Lamm, Christian E.; Kraner, Max. E.; Hofmann, Jörg; Börnke, Frederik; Mock, Hans-Peter; Sonnewald, Uwe

    2017-01-01

    Perception of pathogens by host pattern recognition receptors (PRRs) or R proteins is a prerequisite to promote successful immune responses. The Hsp70/Hsp90 organizing protein Hop/Sti1, a multifunctional cochaperone, has been implicated in the maturation of a receptor-like kinase (RLK) necessary for chitin sensing. However, it remains unknown whether Hop/Sti1 is generally participating in PRR genesis. Using RNA-interference (RNAi), we silenced Hop/Sti1 expression in Nicotiana tabacum to gain further insight into the role of the cochaperone in plant defense responses. As expected, transgenic plants do not respond to chitin treatment anymore. In contrast to this, trafficking and functionality of the flagellin PRR FLS2 were unaltered, suggesting a selective involvement of Hop/Sti1 during PRR maturation. Furthermore, Hop/Sti1 was identified as a cellular determinant of Potato virus Y (PVY) symptom development in tobacco, since PVY was able to accumulate to near wild-type level without provoking the usual veinal necrosis phenotype. In addition, typical antiviral host defense responses were suppressed in the transgenic plants. These data suggest that perception of PVY is dependent on Hop/Sti1-mediated receptor maturation, while viral symptoms represent a failing attempt to restrict PVY spread. In addition, Hop/Sti1 colocalized with virus-induced membrane aggregates in wild-type plants. The retention of Hop/Sti1 in potential viral replication complexes suggests a role during viral translation/replication, explaining why RNAi-lines do not exhibit increased susceptibility to PVY. This study provides evidence for a dual role of Hop/Sti1 in PRR maturation and pathogen perception as well as in promoting viral proliferation. PMID:29075278

  5. Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip

    PubMed Central

    Nelson, Gregory M.; Huffman, Holly; Smith, David F.

    2003-01-01

    Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function. PMID:14627198

  6. Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

    PubMed

    Nelson, Gregory M; Huffman, Holly; Smith, David F

    2003-01-01

    Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

  7. Characterization of host-dependent mutations of apple fruit crinkle viroid replicating in newly identified experimental hosts suggests maintenance of stem-loop structures in the left-hand half of the molecule is important for replication.

    PubMed

    Suzuki, Takahiro; Fujibayashi, Misato; Hataya, Tatsuji; Taneda, Akito; He, Ying-Hong; Tsushima, Taro; Duraisamy, Ganesh Selvaraj; Siglová, Kristyna; Matoušek, Jaroslav; Sano, Teruo

    2017-03-01

    Apple fruit crinkle viroid (AFCVd) is a tentative member of the genus Apscaviroid, family Pospiviroidae. AFCVd has a narrow host range and is known to infect apple, hop and persimmon as natural hosts. In this study, tomato, cucumber and wild hop have been identified as new experimental herbaceous hosts. Foliar symptoms were very mild or virtually undetectable, but fruits of infected tomato were small, cracked and distorted. These symptoms resemble those observed on some AFCVd-sensitive apple cultivars. After transfer to tomato, cucumber and wild hop, sequence changes were detected in a natural AFCVd isolate from hop, and major variants in tomato, cucumber and wild hop differed in 10, 8 or 2 nucleotides, respectively, from the predominant one in the inoculum. The major variants in tomato and cucumber were almost identical, and the one in wild hop was very similar to the one in cultivated hop. Detailed analyses of the host-dependent sequence changes that appear in a naturally occurring AFCVd isolate from hop after transfer to tomato using small RNA deep sequence data and infectivity studies with dimeric RNA transcripts followed by progeny analysis indicate that the major AFCVd variant in tomato emerged by selection of a minor variant present in the inoculum (i.e. hop) followed by one to two host-dependent de novo mutations. Comparison of the secondary structures of major variants in hop, tomato and persimmon after transfer to tomato suggested that maintenance of stem-loop structures in the left-hand half of the molecule is critical for infection.

  8. Random walk numerical simulation for hopping transport at finite carrier concentrations: diffusion coefficient and transport energy concept.

    PubMed

    Gonzalez-Vazquez, J P; Anta, Juan A; Bisquert, Juan

    2009-11-28

    The random walk numerical simulation (RWNS) method is used to compute diffusion coefficients for hopping transport in a fully disordered medium at finite carrier concentrations. We use Miller-Abrahams jumping rates and an exponential distribution of energies to compute the hopping times in the random walk simulation. The computed diffusion coefficient shows an exponential dependence with respect to Fermi-level and Arrhenius behavior with respect to temperature. This result indicates that there is a well-defined transport level implicit to the system dynamics. To establish the origin of this transport level we construct histograms to monitor the energies of the most visited sites. In addition, we construct "corrected" histograms where backward moves are removed. Since these moves do not contribute to transport, these histograms provide a better estimation of the effective transport level energy. The analysis of this concept in connection with the Fermi-level dependence of the diffusion coefficient and the regime of interest for the functioning of dye-sensitised solar cells is thoroughly discussed.

  9. Confined diffusion of transmembrane proteins and lipids induced by the same actin meshwork lining the plasma membrane.

    PubMed

    Fujiwara, Takahiro K; Iwasawa, Kokoro; Kalay, Ziya; Tsunoyama, Taka A; Watanabe, Yusuke; Umemura, Yasuhiro M; Murakoshi, Hideji; Suzuki, Kenichi G N; Nemoto, Yuri L; Morone, Nobuhiro; Kusumi, Akihiro

    2016-04-01

    The mechanisms by which the diffusion rate in the plasma membrane (PM) is regulated remain unresolved, despite their importance in spatially regulating the reaction rates in the PM. Proposed models include entrapment in nanoscale noncontiguous domains found in PtK2 cells, slow diffusion due to crowding, and actin-induced compartmentalization. Here, by applying single-particle tracking at high time resolutions, mainly to the PtK2-cell PM, we found confined diffusion plus hop movements (termed "hop diffusion") for both a nonraft phospholipid and a transmembrane protein, transferrin receptor, and equal compartment sizes for these two molecules in all five of the cell lines used here (actual sizes were cell dependent), even after treatment with actin-modulating drugs. The cross-section size and the cytoplasmic domain size both affected the hop frequency. Electron tomography identified the actin-based membrane skeleton (MSK) located within 8.8 nm from the PM cytoplasmic surface of PtK2 cells and demonstrated that the MSK mesh size was the same as the compartment size for PM molecular diffusion. The extracellular matrix and extracellular domains of membrane proteins were not involved in hop diffusion. These results support a model of anchored TM-protein pickets lining actin-based MSK as a major mechanism for regulating diffusion. © 2016 Fujiwara et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  10. Hopper on wheels: evolving the hopping robot concept

    NASA Technical Reports Server (NTRS)

    Schell, S.; Tretten, A.; Burdick, J.; Fuller, S. B.; Fiorini, P.

    2001-01-01

    This paper describes the evolution of our concept of hopping robot for planetary exploration, that combines coarse long range mobility achieved by hopping, with short range wheeled mobility for precision target acquisition.

  11. Characterization of the Mammalian CORVET and HOPS Complexes and Their Modular Restructuring for Endosome Specificity*

    PubMed Central

    van der Kant, Rik; Jonker, Caspar T. H.; Wijdeven, Ruud H.; Bakker, Jeroen; Janssen, Lennert; Klumperman, Judith; Neefjes, Jacques

    2015-01-01

    Trafficking of cargo through the endosomal system depends on endosomal fusion events mediated by SNARE proteins, Rab-GTPases, and multisubunit tethering complexes. The CORVET and HOPS tethering complexes, respectively, regulate early and late endosomal tethering and have been characterized in detail in yeast where their sequential membrane targeting and assembly is well understood. Mammalian CORVET and HOPS subunits significantly differ from their yeast homologues, and novel proteins with high homology to CORVET/HOPS subunits have evolved. However, an analysis of the molecular interactions between these subunits in mammals is lacking. Here, we provide a detailed analysis of interactions within the mammalian CORVET and HOPS as well as an additional endosomal-targeting complex (VIPAS39-VPS33B) that does not exist in yeast. We show that core interactions within CORVET and HOPS are largely conserved but that the membrane-targeting module in HOPS has significantly changed to accommodate binding to mammalian-specific RAB7 interacting lysosomal protein (RILP). Arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome-associated mutations in VPS33B selectively disrupt recruitment to late endosomes by RILP or binding to its partner VIPAS39. Within the shared core of CORVET/HOPS, we find that VPS11 acts as a molecular switch that binds either CORVET-specific TGFBRAP1 or HOPS-specific VPS39/RILP thereby allowing selective targeting of these tethering complexes to early or late endosomes to time fusion events in the endo/lysosomal pathway. PMID:26463206

  12. An Initiative to Facilitate Park Usage, Discovery, and Physical Activity Among Children and Adolescents in Greenville County, South Carolina, 2014

    PubMed Central

    Kaczynski, Andrew T.; Hughey, S. Morgan; Besenyi, Gina M.; Powers, Alicia R.

    2017-01-01

    Introduction Parks are important settings for increasing population-level physical activity (PA). The objective of this study was to evaluate Park Hop, an incentivized scavenger-hunt–style intervention designed to influence park usage, discovery, park-based PA, and perceptions of parks among children and adolescents in Greenville County, South Carolina. Methods We used 2 data collection methods: matched preintervention and postintervention parent-completed surveys and in-park observations during 4 days near the midpoint of the intervention. We used paired-samples t tests and logistic regression to analyze changes in park visitation, perceptions, and PA. Results Children and adolescents visited an average of 12.1 (of 19) Park Hop parks, and discovered an average of 4.6 venues. In a subset of participants, from preintervention to postintervention, the mean number of park visits increased from 5.0 visits to 6.1 visits, the proportion of time engaged in PA during the most recent park visit increased from 77% to 87%, and parents reported more positive perceptions of the quality of park amenities. We observed more children and adolescents (n = 586) in the 2 intervention parks than in the 2 matched control parks (n = 305). However, the likelihood of children and adolescents engaging in moderate-to-vigorous PA was significantly greater in the control parks (74.3%) than in Park Hop parks (64.2%). Conclusion Park Hop facilitated community-collaboration between park agencies and positively influenced park usage, park discovery, time engaged in PA during park visits, and perceptions of parks. This low-cost, replicable, and scalable model can be implemented across communities to facilitate youth and family-focused PA through parks. PMID:28182864

  13. Hip-Hop--What's in It for the Academy? Self-Understanding, Pedagogy and Aesthetical Learning Processes in Everyday Cultural Praxis

    ERIC Educational Resources Information Center

    Söderman, Johan; Sernhede, Ove

    2016-01-01

    Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…

  14. Wheeled hopping robot

    DOEpatents

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  15. Real-Time On-Board Airborne Demonstration of High-Speed On-Board Data Processing for Science Instruments (HOPS)

    NASA Technical Reports Server (NTRS)

    Beyon, Jeffrey Y.; Ng, Tak-Kwong; Davis, Mitchell J.; Adams, James K.; Bowen, Stephen C.; Fay, James J.; Hutchinson, Mark A.

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program since April, 2012. The HOPS team recently completed two flight campaigns during the summer of 2014 on two different aircrafts with two different science instruments. The first flight campaign was in July, 2014 based at NASA Langley Research Center (LaRC) in Hampton, VA on the NASA's HU-25 aircraft. The science instrument that flew with HOPS was Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) CarbonHawk Experiment Simulator (ACES) funded by NASA's Instrument Incubator Program (IIP). The second campaign was in August, 2014 based at NASA Armstrong Flight Research Center (AFRC) in Palmdale, CA on the NASA's DC-8 aircraft. HOPS flew with the Multifunctional Fiber Laser Lidar (MFLL) instrument developed by Excelis Inc. The goal of the campaigns was to perform an end-to-end demonstration of the capabilities of the HOPS prototype system (HOPS COTS) while running the most computationally intensive part of the ASCENDS algorithm real-time on-board. The comparison of the two flight campaigns and the results of the functionality tests of the HOPS COTS are presented in this paper.

  16. Co-chaperone Hsp70/Hsp90-organizing protein (Hop) is required for transposon silencing and Piwi-interacting RNA (piRNA) biogenesis.

    PubMed

    Karam, Joseph A; Parikh, Rasesh Y; Nayak, Dhananjaya; Rosenkranz, David; Gangaraju, Vamsi K

    2017-04-14

    Piwi-interacting RNAs (piRNAs) are 26-30-nucleotide germ line-specific small non-coding RNAs that have evolutionarily conserved function in mobile genetic element (transposons) silencing and maintenance of genome integrity. Drosophila Hsp70/90-organizing protein homolog (Hop), a co-chaperone, interacts with piRNA-binding protein Piwi and mediates silencing of phenotypic variations. However, it is not known whether Hop has a direct role in piRNA biogenesis and transposon silencing. Here, we show that knockdown of Hop in the germ line nurse cells (GLKD) of Drosophila ovaries leads to activation of transposons. Hop GLKD females can lay eggs at the same rate as wild-type counterparts, but the eggs do not hatch into larvae. Hop GLKD leads to the accumulation of γ-H2Av foci in the germ line, indicating increased DNA damage in the ovary. We also show that Hop GLKD-induced transposon up-regulation is due to inefficient piRNA biogenesis. Based on these results, we conclude that Hop is a critical component of the piRNA pathway and that it maintains genome integrity by silencing transposons. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Selective binding of meiosis-specific yeast Hop1 protein to the holliday junctions distorts the DNA structure and its implications for junction migration and resolution.

    PubMed

    Tripathi, Pankaj; Anuradha, S; Ghosal, Gargi; Muniyappa, K

    2006-12-08

    Saccharomyces cerevisiae HOP1, which encodes a component of synaptonemal complex (SC), plays an important role in both gene conversion and crossing over between homologs, as well as enforces meiotic recombination checkpoint control over the progression of recombination intermediates. In hop1Delta mutants, meiosis-specific double-strand breaks (DSBs) are reduced to 10% of the wild-type level, and at aberrantly late times, these DSBs are processed into inter-sister recombination intermediates. However, the underlying mechanism by which Hop1 protein regulates these nuclear events remains obscure. Here we show that Hop1 protein interacts selectively with the Holliday junction, changes its global conformation and blocks the dissolution of the junction by a RecQ helicase. The Holliday junction-Hop1 protein complexes are significantly more stable at higher ionic strengths and molar excess of unlabeled competitor DNA than complexes containing other recombination intermediates. Structural analysis of the Holliday junction using 2-aminopurine fluorescence emission, DNase I footprinting and KMnO4 probing provide compelling evidence that Hop1 protein binding induces significant distortion at the center of the Holliday junction. We propose that Hop1 protein might coordinate the physical monitoring of meiotic recombination intermediates with the process of branch migration of Holliday junction.

  18. Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)*

    PubMed Central

    He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny

    2005-01-01

    Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

  19. Urban hopper.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xavier, Patrick Gordon; Feddema, John Todd; Little, Charles Quentin

    2010-03-01

    Hopping robots provide the possibility of breaking the link between the size of a ground vehicle and the largest obstacle that it can overcome. For more than a decade, DARPA and Sandia National Laboratories have been developing small-scale hopping robot technology, first as part of purely hopping platforms and, more recently, as part of platforms that are capable of both wheeled and hopping locomotion. In this paper we introduce the Urban Hopper robot and summarize its capabilities. The advantages of hopping for overcoming certain obstacles are discussed. Several configurations of the Urban Hopper are described, as are intelligent capabilities ofmore » the system. Key challenges are discussed.« less

  20. The Sedative Effect of Non-Alcoholic Beer in Healthy Female Nurses

    PubMed Central

    Franco, Lourdes; Sánchez, Cristina; Bravo, Rafael; Rodríguez, Ana B.; Barriga, Carmen; Romero, Eulalia; Cubero, Javier

    2012-01-01

    Introduction The hop (Humulus lupulus L.), a component of beer, is a sedative plant whose pharmacological activity is principally due to its bitter resins, in particular to the α-acid degradation product 2-methyl-3-buten-2-ol. The mechanism of action of hop resin consists of raising the levels of the neurotransmitter γ-aminobutyric acid (GABA), an inhibitory neurotransmitter acting in the central nervous system (CNS). Objectives To analyze the sedative effect of hops as a component of non-alcoholic beer on the sleep/wake rhythm in a work-stressed population. Methods The experiment was conducted with healthy female nurses (n = 17) working rotating and/or night shifts. Overnight sleep and chronobiological parameters were assessed by actigraphy (Actiwatch®) after moderate ingestion of non-alcoholic beer containing hops (333 ml with 0,0% alcohol) with supper for 14 days (treatment). Data were obtained in comparison with her own control group without consumption of beer during supper. Results Actigraphy results demonstrated improvement of night sleep quality as regards the most important parameters: Sleep Latency diminished (p≤0.05) in the Treatment group (12.01±1.19 min) when compared to the Control group (20.50±4.21 min), as also did Total Activity (p≤0.05; Treatment group = 5284.78±836.99 activity pulses vs Control = 7258.78±898.89 activity pulses). In addition, anxiety as indexed by the State-Trait Anxiety Inventory (STAI) decreased in the Treatment group (State Anxiety 18.09±3.8 vs Control 20.69±2.14). Conclusion The moderate consumption of non-alcoholic beer will favour night-time rest, due in particular to its hop components, in addition to its other confirmed benefits for the organism. PMID:22815680

  1. An Efficient Next Hop Selection Algorithm for Multi-Hop Body Area Networks

    PubMed Central

    Ayatollahitafti, Vahid; Ngadi, Md Asri; Mohamad Sharif, Johan bin; Abdullahi, Mohammed

    2016-01-01

    Body Area Networks (BANs) consist of various sensors which gather patient’s vital signs and deliver them to doctors. One of the most significant challenges faced, is the design of an energy-efficient next hop selection algorithm to satisfy Quality of Service (QoS) requirements for different healthcare applications. In this paper, a novel efficient next hop selection algorithm is proposed in multi-hop BANs. This algorithm uses the minimum hop count and a link cost function jointly in each node to choose the best next hop node. The link cost function includes the residual energy, free buffer size, and the link reliability of the neighboring nodes, which is used to balance the energy consumption and to satisfy QoS requirements in terms of end to end delay and reliability. Extensive simulation experiments were performed to evaluate the efficiency of the proposed algorithm using the NS-2 simulator. Simulation results show that our proposed algorithm provides significant improvement in terms of energy consumption, number of packets forwarded, end to end delay and packet delivery ratio compared to the existing routing protocol. PMID:26771586

  2. Azobenzene as a photoregulator covalently attached to RNA: a quantum mechanics/molecular mechanics-surface hopping dynamics study.

    PubMed

    Mondal, Padmabati; Granucci, Giovanni; Rastädter, Dominique; Persico, Maurizio; Burghardt, Irene

    2018-05-28

    The photoregulation of nucleic acids by azobenzene photoswitches has recently attracted considerable interest in the context of emerging biotechnological applications. To understand the mechanism of photoinduced isomerisation and conformational control in these complex biological environments, we employ a Quantum Mechanics/Molecular Mechanics (QM/MM) approach in conjunction with nonadiabatic Surface Hopping (SH) dynamics. Two representative RNA-azobenzene complexes are investigated, both of which contain the azobenzene chromophore covalently attached to an RNA double strand via a β-deoxyribose linker. Due to the pronounced constraints of the local RNA environment, it is found that trans -to- cis isomerization is slowed down to a time scale of ∼10-15 picoseconds, in contrast to 500 femtoseconds in vacuo , with a quantum yield reduced by a factor of two. By contrast, cis -to- trans isomerization remains in a sub-picosecond regime. A volume-conserving isomerization mechanism is found, similarly to the pedal-like mechanism previously identified for azobenzene in solution phase. Strikingly, the chiral RNA environment induces opposite right-handed and left-handed helicities of the ground-state cis -azobenzene chromophore in the two RNA-azobenzene complexes, along with an almost completely chirality conserving photochemical pathway for these helical enantiomers.

  3. Systematic characterization of a 1550 nm microelectromechanical (MEMS)-tunable vertical-cavity surface-emitting laser (VCSEL) with 7.92 THz tuning range for terahertz photomixing systems

    NASA Astrophysics Data System (ADS)

    Haidar, M. T.; Preu, S.; Cesar, J.; Paul, S.; Hajo, A. S.; Neumeyr, C.; Maune, H.; Küppers, F.

    2018-01-01

    Continuous-wave (CW) terahertz (THz) photomixing requires compact, widely tunable, mode-hop-free driving lasers. We present a single-mode microelectromechanical system (MEMS)-tunable vertical-cavity surface-emitting laser (VCSEL) featuring an electrothermal tuning range of 64 nm (7.92 THz) that exceeds the tuning range of commercially available distributed-feedback laser (DFB) diodes (˜4.8 nm) by a factor of about 13. We first review the underlying theory and perform a systematic characterization of the MEMS-VCSEL, with particular focus on the parameters relevant for THz photomixing. These parameters include mode-hop-free CW tuning with a side-mode-suppression-ratio >50 dB, a linewidth as narrow as 46.1 MHz, and wavelength and polarization stability. We conclude with a demonstration of a CW THz photomixing setup by subjecting the MEMS-VCSEL to optical beating with a DFB diode driving commercial photomixers. The achievable THz bandwidth is limited only by the employed photomixers. Once improved photomixers become available, electrothermally actuated MEMS-VCSELs should allow for a tuning range covering almost the whole THz domain with a single system.

  4. Full-dimensional quantum calculations of the vibrational states of H5(+).

    PubMed

    Song, Hongwei; Lee, Soo-Ying; Yang, Minghui; Lu, Yunpeng

    2013-03-28

    Full-dimensional quantum calculations of the vibrational states of H5(+) have been performed on the accurate potential energy surface developed by Xie et al. [J. Chem. Phys. 122, 224307 (2005)]. The zero point energies of H5(+), H4D(+), D4H(+), and D5(+) and their ground-state geometries are presented and compared with earlier theoretical results. The first 10 low-lying excited states of H5(+) are assigned to the fundamental, overtone, and combination of the H2-H3(+) stretch, the shared proton hopping and the out-of-plane torsion. The ground-state torsional tunneling splitting, the fundamental of the photon hopping mode and the first overtone of the torsion mode are 87.3 cm(-1), 354.4 cm(-1), and 444.0 cm(-1), respectively. All of these values agree well with the diffusion Monte Carlo and multi-configuration time-dependent Hartree results where available.

  5. Homothallism in Pseudoperonospora humuli

    USDA-ARS?s Scientific Manuscript database

    The hop downy mildew pathogen, Pseudoperonospora humuli, forms oospores abundantly in diseased hop tissue. Diverse monosporangial isolates of P. humuli collected from Japan, Germany, and five states in the USA readily formed oospores within hop leaves when inoculated singly, suggesting homothallism....

  6. "Makin' Somethin' Outta Little-to-Nufin'': Racism, Revision and Rotating Records--The Hip-Hop DJ in Composition Praxis

    ERIC Educational Resources Information Center

    Craig, Todd

    2015-01-01

    Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…

  7. "Words of Wisdom": An Expectancy-Value Examination of Relationships among Hip-Hop Racial Socialization and Racial Identity of African-American College Students

    ERIC Educational Resources Information Center

    Gangloff-Bailey, Felicia

    2017-01-01

    The influence of hip hop culture and music on African-American youth is profound and can be used as a tool to shape positive outcomes in education. Hip hop has been used effectively in the classroom to engage students and enhance their critical thinking (Gangloff-Bailey & Freeman, 2014). In addition, hip hop has been described as a socializer…

  8. Evaluation of 1-hydroxypyrene as a biological marker of industrial exposure to polycyclic aromatic hydrocarbons

    NASA Astrophysics Data System (ADS)

    Calderon, Francisco M.

    1993-03-01

    One hundred twenty-two workers (sixteen from a coke production plant and 106 from a graphite electrode manufacturing plant) agreed to participate in this study evaluating the relationship between exposure to polycyclic aromatic hydrocarbons (PAHs) and urinary excretion of 1-hydroxypyrene (1-HOP), the main metabolite of pyrene. The results show that the concentration of pyrene in air is highly correlated with total PAHs (r equals 0.83, P < 0.0001). The correlation coefficient between pyrene in air and 1-HOP is (r equals 0.69, P < 0.0001) and between 1-HOP and total PAHs is (r equals 0.77, P < 0.0001). The biological half life of the 1-HOP was determined (18 hrs) and the noninterference of smoking habits in relation to 1-HOP urinary excretion was established, concluding that 1-HOP is a suitable bioindicator of the occupational exposure to PAHs.

  9. Vortex variable range hopping in a conventional superconducting film

    NASA Astrophysics Data System (ADS)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  10. Structural studies on the co-chaperone Hop and its complexes with Hsp90.

    PubMed

    Onuoha, S C; Coulstock, E T; Grossmann, J G; Jackson, S E

    2008-06-13

    The tetratricopeptide repeat domain (TPR)-containing co-chaperone Hsp-organising protein (Hop) plays a critical role in mediating interactions between Heat Shock Protein (Hsp)70 and Hsp90 as part of the cellular assembly machine. It also modulates the ATPase activity of both Hsp70 and Hsp90, thus facilitating client protein transfer between the two. Despite structural work on the individual domains of Hop, no structure for the full-length protein exists, nor is it clear exactly how Hop interacts with Hsp90, although it is known that its primary binding site is the C-terminal MEEVD motif. Here, we have undertaken a biophysical analysis of the structure and binding of Hop to Hsp90 using a variety of truncation mutants of both Hop and Hsp90, in addition to mutants of Hsp90 that are thought to modulate the conformation, in particular the N-terminal dimerisation of the chaperone. The results establish that whilst the primary binding site of Hop is the C-terminal MEEVD peptide of Hsp90, binding also occurs at additional sites in the C-terminal and middle domain. In contrast, we show that another TPR-containing co-chaperone, CyP40, binds solely to the C-terminus of Hsp90. Truncation mutants of Hop were generated and used to investigate the dimerisation interface of the protein. In good agreement with recently published data, we find that the TPR2a domain that contains the Hsp90-binding site is also the primary site for dimerisation. However, our results suggest that residues within the TPR2b may play a role. Together, these data along with shape reconstruction analysis from small-angle X-ray scattering measurements are used to generate a solution structure for full-length Hop, which we show has an overall butterfly-like quaternary structure. Studies on the nucleotide dependence of Hop binding to Hsp90 establish that Hop binds to the nucleotide-free, 'open' state of Hsp90. However, the Hsp90-Hop complex is weakened by the conformational changes that occur in Hsp90 upon ATP binding. Together, the data are used to propose a detailed model of how Hop may help present the client protein to Hsp90 by aligning the bound client on Hsp70 with the middle domain of Hsp90. It is likely that Hop binds to both monomers of Hsp90 in the form of a clamp, interacting with residues in the middle domain of Hsp90, thus preventing ATP hydrolysis, possibly by the prevention of association of N-terminal and middle domains in individual Hsp90 monomers.

  11. The HOPS/Class C Vps Complex Tethers High-Curvature Membranes via a Direct Protein-Membrane Interaction.

    PubMed

    Ho, Ruoya; Stroupe, Christopher

    2016-10-01

    Membrane tethering is a physical association of two membranes before their fusion. Many membrane tethering factors have been identified, but the interactions that mediate inter-membrane associations remain largely a matter of conjecture. Previously, we reported that the homotypic fusion and protein sorting/Class C vacuolar protein sorting (HOPS/Class C Vps) complex, which has two binding sites for the yeast vacuolar Rab GTPase Ypt7p, can tether two low-curvature liposomes when both membranes bear Ypt7p. Here, we show that HOPS tethers highly curved liposomes to Ypt7p-bearing low-curvature liposomes even when the high-curvature liposomes are protein-free. Phosphorylation of the curvature-sensing amphipathic lipid-packing sensor (ALPS) motif from the Vps41p HOPS subunit abrogates tethering of high-curvature liposomes. A HOPS complex without its Vps39p subunit, which contains one of the Ypt7p binding sites in HOPS, lacks tethering activity, though it binds high-curvature liposomes and Ypt7p-bearing low-curvature liposomes. Thus, HOPS tethers highly curved membranes via a direct protein-membrane interaction. Such high-curvature membranes are found at the sites of vacuole tethering and fusion. There, vacuole membranes bend sharply, generating large areas of vacuole-vacuole contact. We propose that HOPS localizes via the Vps41p ALPS motif to these high-curvature regions. There, HOPS binds via Vps39p to Ypt7p in an apposed vacuole membrane. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Leg exoskeleton reduces the metabolic cost of human hopping.

    PubMed

    Grabowski, Alena M; Herr, Hugh M

    2009-09-01

    During bouncing gaits such as hopping and running, leg muscles generate force to enable elastic energy storage and return primarily from tendons and, thus, demand metabolic energy. In an effort to reduce metabolic demand, we designed two elastic leg exoskeletons that act in parallel with the wearer's legs; one exoskeleton consisted of a multiple leaf (MLE) and the other of a single leaf (SLE) set of fiberglass springs. We hypothesized that hoppers, hopping on both legs, would adjust their leg stiffness while wearing an exoskeleton so that the combination of the hopper and exoskeleton would behave as a linear spring-mass system with the same total stiffness as during normal hopping. We also hypothesized that decreased leg force generation while wearing an exoskeleton would reduce the metabolic power required for hopping. Nine subjects hopped in place at 2.0, 2.2, 2.4, and 2.6 Hz with and without an exoskeleton while we measured ground reaction forces, exoskeletal compression, and metabolic rates. While wearing an exoskeleton, hoppers adjusted their leg stiffness to maintain linear spring-mass mechanics and a total stiffness similar to normal hopping. Without accounting for the added weight of each exoskeleton, wearing the MLE reduced net metabolic power by an average of 6% and wearing the SLE reduced net metabolic power by an average of 24% compared with hopping normally at frequencies between 2.0 and 2.6 Hz. Thus, when hoppers used external parallel springs, they likely decreased the mechanical work performed by the legs and substantially reduced metabolic demand compared with hopping without wearing an exoskeleton.

  13. Knee Joint Loading during Single-Leg Forward Hopping.

    PubMed

    Krupenevich, Rebecca L; Pruziner, Alison L; Miller, Ross H

    2017-02-01

    Increased or abnormal loading on the intact limb is thought to contribute to the relatively high risk of knee osteoarthritis in this limb for individuals with unilateral lower limb loss. This theory has been assessed previously by studying walking, but knee joint loading during walking is often similar between individuals with and without limb loss, prompting assessment of other movements that may place unusual loads on the knee. One such movement, hopping, is a form of locomotion that individuals with unilateral lower limb loss may situationally use instead of walking, but the mechanical effects of hopping on the intact limb are unknown. Compare knee joint kinetics of healthy adults during single-leg forward hopping compared to walking, a more traditional form of locomotion. Twenty-four healthy adults walked and hopped at self-selected speeds of 1.5 and 2.3 m·s, respectively. Joint moments were calculated using inverse dynamics. A paired Student's t-test was utilized to compare peak, impulse, and loading rate (LR) of knee adduction moment (KAM), and peak knee flexion moment (KFM) between walking and hopping. Peak KFM and KAM LR were greater during hopping compared to walking (peak KFM: 20.73% vs 5.51% body weight (BW) × height (Ht), P < 0.001; KAM LR: 0.47 vs. 0.33 BW·Ht·s, P = 0.01). Kinetic measures affecting knee joint loading are greater in hopping compared to walking. It may be advisable to limit single-leg forward hopping in the limb loss population until it is known if these loads increase knee osteoarthritis risk.

  14. Localization in one-dimensional lattices with non-nearest-neighbor hopping: Generalized Anderson and Aubry-Andre models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biddle, J.; Priour, D. J. Jr.; Wang, B.

    We study the quantum localization phenomena of noninteracting particles in one-dimensional lattices based on tight-binding models with various forms of hopping terms beyond the nearest neighbor, which are generalizations of the famous Aubry-Andre and noninteracting Anderson models. For the case with deterministic disordered potential induced by a secondary incommensurate lattice (i.e., the Aubry-Andre model), we identify a class of self-dual models, for which the boundary between localized and extended eigenstates are determined analytically by employing a generalized Aubry-Andre transformation. We also numerically investigate the localization properties of nondual models with next-nearest-neighbor hopping, Gaussian, and power-law decay hopping terms. We findmore » that even for these nondual models, the numerically obtained mobility edges can be well approximated by the analytically obtained condition for localization transition in the self-dual models, as long as the decay of the hopping rate with respect to distance is sufficiently fast. For the disordered potential with genuinely random character, we examine scenarios with next-nearest-neighbor hopping, exponential, Gaussian, and power-law decay hopping terms numerically. We find that the higher-order hopping terms can remove the symmetry in the localization length about the energy band center compared to the Anderson model. Furthermore, our results demonstrate that for the power-law decay case, there exists a critical exponent below which mobility edges can be found. Our theoretical results could, in principle, be directly tested in shallow atomic optical lattice systems enabling non-nearest-neighbor hopping.« less

  15. A Multi-Hop Energy Neutral Clustering Algorithm for Maximizing Network Information Gathering in Energy Harvesting Wireless Sensor Networks.

    PubMed

    Yang, Liu; Lu, Yinzhi; Zhong, Yuanchang; Wu, Xuegang; Yang, Simon X

    2015-12-26

    Energy resource limitation is a severe problem in traditional wireless sensor networks (WSNs) because it restricts the lifetime of network. Recently, the emergence of energy harvesting techniques has brought with them the expectation to overcome this problem. In particular, it is possible for a sensor node with energy harvesting abilities to work perpetually in an Energy Neutral state. In this paper, a Multi-hop Energy Neutral Clustering (MENC) algorithm is proposed to construct the optimal multi-hop clustering architecture in energy harvesting WSNs, with the goal of achieving perpetual network operation. All cluster heads (CHs) in the network act as routers to transmit data to base station (BS) cooperatively by a multi-hop communication method. In addition, by analyzing the energy consumption of intra- and inter-cluster data transmission, we give the energy neutrality constraints. Under these constraints, every sensor node can work in an energy neutral state, which in turn provides perpetual network operation. Furthermore, the minimum network data transmission cycle is mathematically derived using convex optimization techniques while the network information gathering is maximal. Simulation results show that our protocol can achieve perpetual network operation, so that the consistent data delivery is guaranteed. In addition, substantial improvements on the performance of network throughput are also achieved as compared to the famous traditional clustering protocol LEACH and recent energy harvesting aware clustering protocols.

  16. A Multi-Hop Energy Neutral Clustering Algorithm for Maximizing Network Information Gathering in Energy Harvesting Wireless Sensor Networks

    PubMed Central

    Yang, Liu; Lu, Yinzhi; Zhong, Yuanchang; Wu, Xuegang; Yang, Simon X.

    2015-01-01

    Energy resource limitation is a severe problem in traditional wireless sensor networks (WSNs) because it restricts the lifetime of network. Recently, the emergence of energy harvesting techniques has brought with them the expectation to overcome this problem. In particular, it is possible for a sensor node with energy harvesting abilities to work perpetually in an Energy Neutral state. In this paper, a Multi-hop Energy Neutral Clustering (MENC) algorithm is proposed to construct the optimal multi-hop clustering architecture in energy harvesting WSNs, with the goal of achieving perpetual network operation. All cluster heads (CHs) in the network act as routers to transmit data to base station (BS) cooperatively by a multi-hop communication method. In addition, by analyzing the energy consumption of intra- and inter-cluster data transmission, we give the energy neutrality constraints. Under these constraints, every sensor node can work in an energy neutral state, which in turn provides perpetual network operation. Furthermore, the minimum network data transmission cycle is mathematically derived using convex optimization techniques while the network information gathering is maximal. Simulation results show that our protocol can achieve perpetual network operation, so that the consistent data delivery is guaranteed. In addition, substantial improvements on the performance of network throughput are also achieved as compared to the famous traditional clustering protocol LEACH and recent energy harvesting aware clustering protocols. PMID:26712764

  17. Comparative studies of the structure, morphology and electrical conductivity of polyaniline weakly doped with chlorocarboxylic acids

    NASA Astrophysics Data System (ADS)

    Gmati, Fethi; Fattoum, Arbi; Bohli, Nadra; Dhaoui, Wadia; Belhadj Mohamed, Abdellatif

    2007-08-01

    We report the results of studies on two series of polyaniline (PANI), doped with dichloroacetic (DCA) and trichloroacetic (TCA) acids, respectively, at various doping rates and obtained by the in situ polymerization method. Samples were characterized by x-ray diffraction, scanning electron microscopy and conductivity measurements. The direct current (dc) and alternating current (ac) electrical conductivities of PANI salts have been investigated in the temperature range 100-310 K and frequency range 7-106 Hz. The results of this study indicate better chain ordering and higher conductivity for PANI doped with TCA. The dc conductivity of all samples is suitably fitted to Mott's three-dimensional variable-range hopping (VRH) model. Different Mott parameters such as characteristic temperature T0, density of states at the Fermi level (N(EF)), average hopping energy (W) and the average hopping distance (R) have been evaluated. The dependence of such values on the dopant acid used is discussed. At high frequencies, the ac conductivity follows the power law σac(ω,T) = A(T)ωs(T,ω), which is characteristic for charge transport in disordered materials by hopping or tunnelling processes. The observed increase in the frequency exponent s with temperature suggests that the small-polaron tunnelling model best describes the dominant ac conduction mechanism. A direct correlation between conductivity, structure and morphology was obtained in our systems.

  18. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    NASA Astrophysics Data System (ADS)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-07-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

  19. A surface hopping algorithm for nonadiabatic minimum energy path calculations.

    PubMed

    Schapiro, Igor; Roca-Sanjuán, Daniel; Lindh, Roland; Olivucci, Massimo

    2015-02-15

    The article introduces a robust algorithm for the computation of minimum energy paths transiting along regions of near-to or degeneracy of adiabatic states. The method facilitates studies of excited state reactivity involving weakly avoided crossings and conical intersections. Based on the analysis of the change in the multiconfigurational wave function the algorithm takes the decision whether the optimization should continue following the same electronic state or switch to a different state. This algorithm helps to overcome convergence difficulties near degeneracies. The implementation in the MOLCAS quantum chemistry package is discussed. To demonstrate the utility of the proposed procedure four examples of application are provided: thymine, asulam, 1,2-dioxetane, and a three-double-bond model of the 11-cis-retinal protonated Schiff base. © 2015 Wiley Periodicals, Inc.

  20. Energy landscapes and properties of biomolecules.

    PubMed

    Wales, David J

    2005-11-09

    Thermodynamic and dynamic properties of biomolecules can be calculated using a coarse-grained approach based upon sampling stationary points of the underlying potential energy surface. The superposition approximation provides an overall partition function as a sum of contributions from the local minima, and hence functions such as internal energy, entropy, free energy and the heat capacity. To obtain rates we must also sample transition states that link the local minima, and the discrete path sampling method provides a systematic means to achieve this goal. A coarse-grained picture is also helpful in locating the global minimum using the basin-hopping approach. Here we can exploit a fictitious dynamics between the basins of attraction of local minima, since the objective is to find the lowest minimum, rather than to reproduce the thermodynamics or dynamics.

  1. Decoding Hip-Hop's Cultural Impact: Scholars Are Poised to Take a Close Look at the Influence of Hip-Hop on the Social Identity, Values of Today's Youth

    ERIC Educational Resources Information Center

    Roach, Ronald

    2004-01-01

    As a cultural movement, hip-hop manages to get billed as both a positive and negative influence on young people, especially on Black and Latino youth. On one hand, there are African American activists, artists and entrepreneurs, such as Russell Simmons, who seek to build a progressive political movement among young hip-hop fans and who have had…

  2. Using high-order polynomial basis in 3-D EM forward modeling based on volume integral equation method

    NASA Astrophysics Data System (ADS)

    Kruglyakov, Mikhail; Kuvshinov, Alexey

    2018-05-01

    3-D interpretation of electromagnetic (EM) data of different origin and scale becomes a common practice worldwide. However, 3-D EM numerical simulations (modeling)—a key part of any 3-D EM data analysis—with realistic levels of complexity, accuracy and spatial detail still remains challenging from the computational point of view. We present a novel, efficient 3-D numerical solver based on a volume integral equation (IE) method. The efficiency is achieved by using a high-order polynomial (HOP) basis instead of the zero-order (piecewise constant) basis that is invoked in all routinely used IE-based solvers. We demonstrate that usage of the HOP basis allows us to decrease substantially the number of unknowns (preserving the same accuracy), with corresponding speed increase and memory saving.

  3. Type III Effector Diversification via Both Pathoadaptation and Horizontal Transfer in Response to a Coevolutionary Arms Race

    PubMed Central

    Ma, Wenbo; Dong, Frederick F. T; Stavrinides, John; Guttman, David S

    2006-01-01

    The concept of the coevolutionary arms race holds a central position in our understanding of pathogen–host interactions. Here we identify the molecular mechanisms and follow the stepwise progression of an arms race in a natural system. We show how the evolution and function of the HopZ family of type III secreted effector proteins carried by the plant pathogen Pseudomonas syringae are influenced by a coevolutionary arms race between pathogen and host. We surveyed 96 isolates of P. syringae and identified three homologs (HopZ1, HopZ2, and HopZ3) distributed among ∼45% of the strains. All alleles were sequenced and their expression was confirmed. Evolutionary analyses determined that the diverse HopZ1 homologs are ancestral to P. syringae, and have diverged via pathoadaptive mutational changes into three functional and two degenerate forms, while HopZ2 and HopZ3 have been brought into P. syringae via horizontal transfer from other ecologically similar bacteria. A PAML selection analysis revealed that the C terminus of HopZ1 is under strong positive selection. Despite the extensive genetic variation observed in this family, all three homologs have cysteine–protease activity, although their substrate specificity may vary. The introduction of the ancestral hopZ1 allele into strains harboring alternate alleles results in a resistance protein-mediated defense response in their respective hosts, which is not observed with the endogenous allele. These data indicate that the P. syringae HopZ family has undergone allelic diversification via both pathoadaptive mutational changes and horizontal transfer in response to selection imposed by the host defense system. This genetic diversity permits the pathogen to avoid host defenses while still maintaining a virulence-associated protease, thereby allowing it to thrive on its current host, while simultaneously impacting its host range. PMID:17194219

  4. Energetics and biomechanics of locomotion by red kangaroos (Macropus rufus).

    PubMed

    Kram, R; Dawson, T J

    1998-05-01

    As red kangaroos hop faster over level ground, their rate of oxygen consumption (indicating metabolic energy consumption) remains nearly the same. This phenomenon has been attributed to exceptional elastic energy storage and recovery via long compliant tendons in the legs. Alternatively, red kangaroos may have exceptionally efficient muscles. To estimate efficiency, we measured the metabolic cost of uphill hopping, where muscle fibers must perform mechanical work against gravity. We found that uphill hopping was much more expensive than level hopping. The maximal rate of oxygen consumption measured (3 ml O2 kg-1 s-1) exceeds all but a few vertebrate species. However, efficiency values were normal, approximately 30%. At faster level hopping speeds the effective mechanical advantage of the extensor muscles of the ankle joint remained the same. Thus, kangaroos generate the same muscular force at all speeds but do so more rapidly at faster hopping speeds. This contradicts a recent hypothesis for what sets the cost of locomotion. The cost of transport (J kg-1 m-1) decreases at faster hopping speeds, yet red kangaroos prefer to use relatively slow speeds that avoid high levels of tendon stress.

  5. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    PubMed

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  6. Low Power Multi-Hop Networking Analysis in Intelligent Environments

    PubMed Central

    Etxaniz, Josu; Aranguren, Gerardo

    2017-01-01

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide. PMID:28534847

  7. Gold Binding by Native and Chemically Modified Hops Biomasses

    PubMed Central

    López, M. Laura; Peralta-Videa, J. R.; de la Rosa, G.; Armendáriz, V.; Herrera, I.; Troiani, H.; Henning, J.

    2005-01-01

    Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass (Humulus lupulus) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively. PMID:18365087

  8. Rice Protein Matrix Enhances Circulating Levels of Xanthohumol Following Acute Oral Intake of Spent Hops in Humans.

    PubMed

    O'Connor, Annalouise; Konda, Veera; Reed, Ralph L; Christensen, J Mark; Stevens, Jan F; Contractor, Nikhat

    2018-03-01

    Xanthohumol (XN), a prenylated flavonoid found in hops, exhibits anti-inflammatory and antioxidant properties. However, poor bioavailability may limit therapeutic applications. As food components are known to modulate polyphenol absorption, the objective is to determine whether a protein matrix could enhance the bioavailability of XN post oral consumption in humans. This is a randomized, double-blind, crossover study in healthy participants (n = 6) evaluating XN and its major metabolites (isoxanthohumol [IX], 6- and 8-prenylnaringenin [6-PN, 8-PN]) for 6 h following consumption of 12.4 mg of XN delivered via a spent hops-rice protein matrix preparation or a control spent hops preparation. Plasma XN and metabolites are measured by LC-MS/MS. C max , T max , and area-under-the-curve (AUC) values were determined. Circulating XN and metabolite response to each treatment was not bioequivalent. Plasma concentrations of XN and XN + metabolites (AUC) are greater with consumption of the spent hops-rice protein matrix preparation. Compared to a standard spent hops powder, a protein-rich spent hops matrix demonstrates enhanced plasma levels of XN and metabolites following acute oral intake. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

    PubMed

    Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

    2009-05-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

  10. Condom use and hip hop culture: the case of urban young men in New York City.

    PubMed

    Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

    2008-06-01

    We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

  11. Energy landscape in frustrated systems: Cation hopping in pyrochlores

    NASA Astrophysics Data System (ADS)

    Brooks Hinojosa, Beverly; Asthagiri, Aravind; Nino, Juan C.

    2013-07-01

    We investigate the dynamics of the local environment and electronic structure in inherently dipolar frustrated pyrochlore compounds to help identify the fundamental nature of dipolar disorder in pyrochlore systems and determine the necessary and sufficient conditions for dielectric relaxation. We map out the energy landscape associated with cation hopping events in three compounds and correlate the hopping pathway with experimental dielectric response. Comprehensive analysis of the calculations allows us to postulate rules to predict the occurrence of relaxation and cation hopping pathways.

  12. Hopping robot

    DOEpatents

    Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.

    2001-01-01

    The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.

  13. Electron Transfer Pathways Facilitating U(VI) Reduction by Fe(II) on Al- vs Fe-Oxides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taylor, S. D.; Becker, U.; Rosso, K. M.

    This study continues mechanistic development of heterogeneous electron transfer (ET) pathways at mineral surfaces in aquatic environments that enable the reduction U(VI) by surface-associated Fe(II). Using computational molecular simulation within the framework of Marcus Theory, our findings highlight the importance of the configurations and interaction of the electron donor and acceptor species with the substrate, with respect to influencing its electronic structure and thereby the ability of semiconducting minerals to facilitate ET. U(VI) reduction by surface-associated Fe(II) (adsorbed or structurally incorporated into the lattice) on an insulating, corundum (001) surface (α-Al2O3) occurs when proximal inner-sphere (IS) surface complexes are formed,more » such that ET occurs through a combination of direct exchange (i.e., Fe d- and U f-orbitals overlap through space) and superexchange via intervening surface oxygen atoms. U(VI) reduction by coadsorbed Fe(II) on the isostructural semiconducting hematite (α-Fe2O3) basal surface requires either their direct electronic interaction (e.g., IS complexation) or mediation of this interaction indirectly through the surface via an intrasurface pathway. Conceptually possible longer-range ET by charge-hopping through surface Fe atoms was investigated to determine whether this indirect pathway is competitive with direct ET. The calculations show that energy barriers are large for this conduction-based pathway; interfacial ET into the hematite surface is endothermic (+80.1 kJ/mol) and comprises the rate-limiting step (10–6 s–1). The presence of the IS adsorbates appears to weaken the electronic coupling between underlying Fe ions within the surface, resulting in slower intra-surface ET (10–5 s–1) than expected in the bulk basal plane. Our findings lay out first insights into donor-acceptor communication via a charge-hopping pathway through the surface for heterogeneous reduction of U(VI) by Fe(II) and help provide a basis for experimental interrogation of this important process at mineral-water interfaces.« less

  14. [Abnormal growth of spine in patients with adolescent idiopathic thoracic scoliosis].

    PubMed

    Bao, Hongda; Liu, Zhen; Qiu, Yong; Zhu, Feng; Zhu, Zezhang; Zhang, Wen

    2014-05-01

    To investigate if the growth patterns of the spine and pelvis are consistent in adolescent idiopathic scoliosis (AIS) patients with single thoracic curves. Forty-eight thoracic adolescent idiopathic scoliosis (T-AIS) female patients and 48 healthy age-matched adolescents were recruited consecutively between December 2011 and October 2012. Radiographic parameters including height of spine (HOS), length of spine (LOS), height of thoracic spine (HOT), length of thoracic spine (LOT), height of pelvis (HOP), width of pelvis (WOP) and width of thorax (WOT) were measured on the long-cassette posteroanterior standing radiographs. In addition, ratios including HOS/HOP, LOS/HOP, HOT/HOP, LOT/HOP, LOS/LOT, WOT/WOP were also calculated. Independent t-test was performed to compare the radiographic parameters and ratios between the two groups. Compared to the age-matched healthy adolescents, T-AIS patients had a significantly higher LOS and LOT (t = -2.364 and -1.495, P = 0.020 and 0.043) and smaller HOS and HOT (t = 2.060 and 3.359, P = 0.042 and 0.001). Yet, all of HOP, WOP and WOT showed no significant difference between T-AIS patients and healthy adolescents. Similarly, LOS/HOP and LOT/HOP were significantly higher in T-AIS patients as may be expected with an average LOS/HOP of 2.26 ± 0.14 in normal controls.In addition, LOS/LOT in normal controls had a trend of increase with age which was different from the stable LOS/LOT in T-AIS patients, indicating an increased growth of thoracic vertebra compared to lumbar vertebra. Compared to the age-matched healthy adolescents, T-AIS patients have an abnormal growth characteristics with longer spine. The growth of pelvis and thorax show no significant differences between T-AIS patients and healthy adolescents.

  15. Gender differences in active musculoskeletal stiffness. Part II. Quantification of leg stiffness during functional hopping tasks.

    PubMed

    Granata, K P; Padua, D A; Wilson, S E

    2002-04-01

    Leg stiffness was compared between age-matched males and females during hopping at preferred and controlled frequencies. Stiffness was defined as the linear regression slope between the vertical center of mass (COM) displacement and ground-reaction forces recorded from a force plate during the stance phase of the hopping task. Results demonstrate that subjects modulated the vertical displacement of the COM during ground contact in relation to the square of hopping frequency. This supports the accuracy of the spring-mass oscillator as a representative model of hopping. It also maintained peak vertical ground-reaction load at approximately three times body weight. Leg stiffness values in males (33.9+/-8.7 kN/m) were significantly (p<0.01) greater than in females (26.3+/-6.5 kN/m) at each of three hopping frequencies, 3.0, 2.5 Hz, and a preferred hopping rate. In the spring-mass oscillator model leg stiffness and body mass are related to the frequency of motion. Thus male subjects necessarily recruited greater leg stiffness to drive their heavier body mass at the same frequency as the lighter female subjects during the controlled frequency trials. However, in the preferred hopping condition the stiffness was not constrained by the task because frequency was self-selected. Nonetheless, both male and female subjects hopped at statistically similar preferred frequencies (2.34+/-0.22 Hz), therefore, the females continued to demonstrate less leg stiffness. Recognizing the active muscle stiffness contributes to biomechanical stability as well as leg stiffness, these results may provide insight into the gender bias in risk of musculoskeletal knee injury.

  16. Performance on the Functional Movement Screen™ is related to hop performance, but not to hip and knee strength in collegiate football players

    PubMed Central

    Willigenburg, Nienke; Hewett, Timothy E.

    2016-01-01

    Objective To define the relationship between FMS™ scores and hop performance, hip strength, and knee strength in collegiate football players. Design Cross-sectional cohort. Participants Freshmen of a division I collegiate American football team (n=59). Main Outcome Measures The athletes performed the FMS™, as well as a variety of hop tests, isokinetic knee strength and isometric hip strength tasks. We recorded total FMS™ score, peak strength and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman’s correlation coefficients quantified the relationships these measures, and chi-square analyses compared the number of athletes with asymmetries on the different tasks. Results We observed significant correlations (r=0.38–0.56, p≤0.02) between FMS™ scores and hop distance, but not between FMS™ scores and hip or knee strength (all p≥0.21). The amount of asymmetry on the FMS™ test was significantly correlated to the amount of asymmetry on the timed 6m hop (r=0.44, p<0.01), but not to hip or knee strength asymmetries between limbs (all p≥0.34). Conclusions FMS™ score was positively correlated to hop distance, and limb asymmetry in FMS™ tasks was correlated to limb asymmetry in 6m hop time in football players. No significant correlations were observed between FMS™ score and hip and knee strength, or between FMS™ asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time and cost efficient alternative to FMS™ testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries. PMID:26886801

  17. Performance on the Functional Movement Screen Is Related to Hop Performance But Not to Hip and Knee Strength in Collegiate Football Players.

    PubMed

    Willigenburg, Nienke; Hewett, Timothy E

    2017-03-01

    To define the relationship between Functional Movement Screen (FMS) scores and hop performance, hip strength, and knee strength in collegiate football players. Cross-sectional cohort. Freshmen of a Division I collegiate American football team (n = 59). The athletes performed the FMS, and also a variety of hop tests, isokinetic knee strength, and isometric hip strength tasks. We recorded total FMS score, peak strength, and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman correlation coefficients quantified the relationships between these measures, and χ analyses compared the number of athletes with asymmetries on the different tasks. We observed significant correlations (r = 0.38-0.56, P ≤ 0.02) between FMS scores and hop distance but not between FMS scores and hip or knee strength (all P ≥ 0.21). The amount of asymmetry on the FMS test was significantly correlated to the amount of asymmetry on the timed 6-m hop (r = 0.44, P < 0.01) but not to hip or knee strength asymmetries between limbs (all P ≥ 0.34). Functional Movement Screen score was positively correlated to hop distance, and limb asymmetry in FMS tasks was correlated to limb asymmetry in 6-m hop time in football players. No significant correlations were observed between FMS score and hip and knee strength or between FMS asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time-efficient and cost-efficient alternative to FMS testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries.

  18. No difference between mechanical perturbation training with compliant surface and manual perturbation training on knee functional performance after ACL rupture.

    PubMed

    Nawasreh, Zakariya; Logerstedt, David; Failla, Mathew; Snyder-Mackler, Lynn

    2017-10-27

    Manual perturbation training improves dynamic knee stability and functional performance after anterior cruciate ligament rupture (ACL-rupture). However, it is limited to static standing position and does not allow time-specific perturbations at different phase of functional activities. The purpose of this study was to investigate whether administering mechanical perturbation training including compliant surface provides effects similar to manual perturbation training on knee functional measures after an acute ACL-rupture. Sixteen level I/II athletes with ACL-ruptures participated in this preliminary study. Eight patients received mechanical (Mechanical) and eight subjects received manual perturbation training (Manual). All patients completed a functional testing (isometric quadriceps strength, single-legged hop tests) and patient-reported measures (Knee Outcome Survey-Activities of Daily Living Scale (KOS-ADLS), Global Rating Score (GRS), International Knee Documentation Committee 2000 (IKDC 2000) at pre- and post-training. 2 × 2 ANOVA was used for data analysis. No significant group-by-time interactions were found for all measures (p > 0.18). Main effects of time were found for single hop (Pre-testing: 85.14% ± 21.07; Post-testing: 92.49% ± 17.55), triple hop (Pre-testing: 84.64% ± 14.17; Post-testing: 96.64% ± 11.14), KOS-ADLS (Pre-testing: 81.13% ± 11.12; Post-testing: 88.63% ± 12.63), GRS (Pre-testing: 68.63% ± 15.73; Post-testing: 78.81% ± 13.85), and IKDC 2000 (Pre-testing: 66.66% ± 9.85; Post-testing: 76.05% ± 14.62) (p < 0.032). Administering mechanical perturbation training using compliant surfaces induce effects similar to manual perturbation training on knee functional performance after acute ACL-rupture. The clinical significance is both modes of training improve patients' functional-performance and limb-to-limb movement symmetry, and enhancing the patients' self-reported of knee functional measures after ACL rupture. Mechanical perturbation that provides a compliant surface might be utilized as part of the ACL rehabilitation training. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  19. Mode Hopping in Semiconductor Lasers

    NASA Astrophysics Data System (ADS)

    Heumier, Timothy Alan

    Semiconductor lasers have found widespread use in fiberoptic communications, merchandising (bar-code scanners), entertainment (videodisc and compact disc players), and in scientific inquiry (spectroscopy, laser cooling). Some uses require a minimum degree of stability of wavelength which is not met by these lasers: Under some conditions, semiconductor lasers can discontinuously switch wavelengths in a back-and-forth manner. This is called mode hopping. We show that mode hopping is directly correlated to noise in the total intensity, and that this noise is easily detected by a photodiode. We also show that there are combinations of laser case temperature and injection current which lead to mode hopping. Conversely, there are other combinations for which the laser is stable. These results are shown to have implications for controlling mode hopping.

  20. Statistical Field Estimation for Complex Coastal Regions and Archipelagos (PREPRINT)

    DTIC Science & Technology

    2011-04-09

    and study the computational properties of these schemes. Specifically, we extend a multiscale Objective Analysis (OA) approach to complex coastal...computational properties of these schemes. Specifically, we extend a multiscale Objective Analysis (OA) approach to complex coastal regions and... multiscale free-surface code builds on the primitive-equation model of the Harvard Ocean Predic- tion System (HOPS, Haley et al. (2009)). Additionally

  1. A Mobile Asteroid Surface Scout (MASCOT) for the Hayabusa 2 Mission to 1999 JU3: The Scientific Approach

    NASA Astrophysics Data System (ADS)

    Jaumann, Ralf; Bibring, Jean-Piere; Glassmeier, Karl-Heiz; Grott, Mathias; Ho, Tra-Mi; Ulamec, Stefan; Schmitz, Nicole; Auster, Ulrich; Biele, Jens; Kuninaka, Hitoshi; Okada, Tatsuaki; Yoshikawa, Makoto; Watanabe, Sei-ichiro; Fujimoto, Masaki; Spohn, Tilman; Koncz, Aalexander; Hercik, Davis; Michaelis, Harald

    2015-04-01

    MASCOT, a Mobile Asteroid Surface Scout, will support JAXA's Hayabusa 2 mission to investigate the C-type asteroid 1999 JU3 (1). The German Aer-ospace Center (DLR) develops MASCOT with contributions from CNES (France) (2,3,4). Main objective is to in-situ map the asteroid's geomorphol-ogy, the intimate mixture, texture and composition of the regolith (dust, soil and rocks), and the thermal, mechanical, and magnetic properties of the sur-face in order to provide ground truth for the orbiter remote measurements, support the selection of sampling sites, and provide context information for the returned samples. MASCOT comprises a payload of four scientific in-struments: camera, radiometer, magnetometer and hyperspectral microscope. C- and D-type asteroids hold clues to the origin of the solar system, the for-mation of planets, the origins of water and life on Earth, the protection of Earth from impacts, and resources for future human exploration. C- and D-types are dark and difficult to study from Earth, and have only been glimpsed by spacecraft. While results from recent missions (e.g., Hayabusa, NEAR (5, 6, 7)) have dramatically increased our understanding of asteroids, important questions remain open. For example, characterizing the properties of asteroid regolith in-situ would deliver important ground truth for further understanding telescopic and orbital observations and samples of such asteroids. MASCOT will descend and land on the asteroid and will change its own position up to two times by hopping. This enables measurements during descent, at the landing and hopping positions #1-3, and during hopping. Hayabusa 2 together with MASCOT launched December 3rd 2014, will arrive at 1999JU3 in 2018 and return samples back to Earth in 2020. References: (1) Vilas, F., Astronomical J. 1101-1105, 2008; (2) Ulamec, S., et al., Acta Astronautica, Vol. 93, pp. 460-466; (3) Jaumann et al., 45th LPSC, #1812, Houston; (4) Ho et al., 45th LPSC, #2535, Houston; (5) Spe-cial Issue, Science, Vol. 312 no. 5778, 2006; (6) Special Issue Science, Vol. 333 no. 6046, 2011. (7) Bell, L., Mitton, J-., Cambridge Univ. Press, 2002.

  2. Hop powdery mildew control through alteration of spring pruning practices

    USDA-ARS?s Scientific Manuscript database

    Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

  3. Pseudomonas HopU1 modulates plant immune receptor levels by blocking the interaction of their mRNAs with GRP7.

    PubMed

    Nicaise, Valerie; Joe, Anna; Jeong, Byeong-ryool; Korneli, Christin; Boutrot, Freddy; Westedt, Isa; Staiger, Dorothee; Alfano, James R; Zipfel, Cyril

    2013-03-06

    Pathogens target important components of host immunity to cause disease. The Pseudomonas syringae type III-secreted effector HopU1 is a mono-ADP-ribosyltransferase required for full virulence on Arabidopsis thaliana. HopU1 targets several RNA-binding proteins including GRP7, whose role in immunity is still unclear. Here, we show that GRP7 associates with translational components, as well as with the pattern recognition receptors FLS2 and EFR. Moreover, GRP7 binds specifically FLS2 and EFR transcripts in vivo through its RNA recognition motif. HopU1 does not affect the protein-protein associations between GRP7, FLS2 and translational components. Instead, HopU1 blocks the interaction between GRP7 and FLS2 and EFR transcripts in vivo. This inhibition correlates with reduced FLS2 protein levels upon Pseudomonas infection in a HopU1-dependent manner. Our results reveal a novel virulence strategy used by a microbial effector to interfere with host immunity.

  4. HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis.

    PubMed

    Kang, Yongsung; Jelenska, Joanna; Cecchini, Nicolas M; Li, Yujie; Lee, Min Woo; Kovar, David R; Greenberg, Jean T

    2014-06-01

    A central mechanism of virulence of extracellular bacterial pathogens is the injection into host cells of effector proteins that modify host cellular functions. HopW1 is an effector injected by the type III secretion system that increases the growth of the plant pathogen Pseudomonas syringae on the Columbia accession of Arabidopsis. When delivered by P. syringae into plant cells, HopW1 causes a reduction in the filamentous actin (F-actin) network and the inhibition of endocytosis, a known actin-dependent process. When directly produced in plants, HopW1 forms complexes with actin, disrupts the actin cytoskeleton and inhibits endocytosis as well as the trafficking of certain proteins to vacuoles. The C-terminal region of HopW1 can reduce the length of actin filaments and therefore solubilize F-actin in vitro. Thus, HopW1 acts by disrupting the actin cytoskeleton and the cell biological processes that depend on actin, which in turn are needed for restricting P. syringae growth in Arabidopsis.

  5. Hop Optimization and Relay Node Selection in Multi-hop Wireless Ad-Hoc Networks

    NASA Astrophysics Data System (ADS)

    Li, Xiaohua(Edward)

    In this paper we propose an efficient approach to determine the optimal hops for multi-hop ad hoc wireless networks. Based on the assumption that nodes use successive interference cancellation (SIC) and maximal ratio combining (MRC) to deal with mutual interference and to utilize all the received signal energy, we show that the signal-to-interference-plus-noise ratio (SINR) of a node is determined only by the nodes before it, not the nodes after it, along a packet forwarding path. Based on this observation, we propose an iterative procedure to select the relay nodes and to calculate the path SINR as well as capacity of an arbitrary multi-hop packet forwarding path. The complexity of the algorithm is extremely low, and scaling well with network size. The algorithm is applicable in arbitrarily large networks. Its performance is demonstrated as desirable by simulations. The algorithm can be helpful in analyzing the performance of multi-hop wireless networks.

  6. Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

    PubMed

    Neiens, Silva D; Steinhaus, Martin

    2018-02-14

    The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

  7. Female PFP patients present alterations in eccentric muscle activity but not the temporal order of activation of the vastus lateralis muscle during the single leg triple hop test.

    PubMed

    Kalytczak, Marcelo Martins; Lucareli, Paulo Roberto Garcia; Dos Reis, Amir Curcio; Bley, André Serra; Biasotto-Gonzalez, Daniela Aparecida; Correa, João Carlos Ferrari; Politti, Fabiano

    2018-04-07

    This study aimed to compare the concentric and eccentric activity and the temporal order of peak activity of the hip and knee muscles between women with patellofemoral pain (PFP) and healthy women during the single leg triple hop test (SLTHT). Electromyographic (EMG) and Kinematic data were collected from 14 healthy women (CG) and 14 women diagnosed with PFP (PFG) during a single session of the single leg triple hop test. Integral surface electromyography (iEMG) data of the hip and knee muscles in eccentric and concentric phases and the length of time that each muscle needed to reach the maximal peak of muscle activity were calculated. The iEMG in the eccentric phase was significantly higher (p < 0.05) than the concentric phase, for the gluteus maximus and gluteus medius muscles (CG and PFG) and for the vastus lateralis muscle (PFG). The vastus lateralis muscle was the first muscle to reach the highest peak of activity in the PFG, and the third to reach this peak in the CG. In the present study, the activity of the vastus lateralis muscle during the eccentric phase of the jump was greater than concentric phase, as a temporal anticipation of its peak in activity among women with PFP. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Systematic assessment of scaffold hopping versus activity cliff formation across bioactive compound classes following a molecular hierarchy.

    PubMed

    Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

    2015-07-01

    Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth

    USDA-ARS?s Scientific Manuscript database

    Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...

  10. HopBase: A unified resource for Humulus genomics

    USDA-ARS?s Scientific Manuscript database

    Hop (Humulus lupulus L. var lupulus) is a plant of worldwide significance, used primarily for its’ bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop has led to additional interest from pharmacy and healthcare industries as well a...

  11. Determinant quantum Monte Carlo study of d -wave pairing in the plaquette Hubbard hamiltonian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ying, T.; Mondaini, R.; Sun, X. D.

    2014-08-13

    We used the determinant Quantum Monte Carlo (DQMC) to determine the pairing and magnetic response for a Hubbard model built up from four-site clusters - a two-dimensional square lattice consisting of elemental 2x2 plaquettes with hopping t and on-site repulsion U coupled by an interplaquette hopping t' ≤ t. Superconductivity in this geometry has previously been studied by a variety of analytic and numeric methods, with differing conclusions concerning whether the pairing correlations and transition temperature are raised near half-filling by the inhomogeneous hopping or not. For U/t = 4, DQMC indicates an optimal t'/t ≈ 0.4 at which themore » pairing vertex is most attractive. We also found that optimal t'/t increases with U/t. We then contrast our results for this plaquette model with a Hamiltonian which instead involves a regular pattern of site energies whose large site energy limit is the three band CuO 2 model; we show that there the inhomogeneity rapidly, and monotonically, suppresses pairing.« less

  12. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    ERIC Educational Resources Information Center

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  13. Optimum Detection Of Slow-Frequency-Hopping Signals

    NASA Technical Reports Server (NTRS)

    Levitt, Barry K.; Cheng, Unjeng

    1994-01-01

    Two papers present theoretical analyses of various schemes for coherent and noncoherent detection of M-ary-frequency-shift-keyed (MFSK) signals with slow frequency hopping. Special attention focused on continuous-phase-modulation (CPM) subset of SFH/MFSK signals, for which frequency modulation such carrier phase remains continuous (albeit unknown) during each hop.

  14. Toward Hip-Hop Pedagogies for Music Education

    ERIC Educational Resources Information Center

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  15. 21 CFR 172.560 - Modified hop extract.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...

  16. 21 CFR 172.560 - Modified hop extract.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...

  17. 21 CFR 172.560 - Modified hop extract.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...

  18. 21 CFR 172.560 - Modified hop extract.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...

  19. Framing and Reviewing Hip-Hop Educational Research

    ERIC Educational Resources Information Center

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  20. Hip-Hop Education Resources

    ERIC Educational Resources Information Center

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  1. Gold Binding by Native and Chemically Modified Hops Biomasses

    DOE PAGES

    López, M. Laura; Gardea-Torresdey, J. L.; Peralta-Videa, J. R.; ...

    2005-01-01

    Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass ( Humulus lupulus ) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding atmore » pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively.« less

  2. Sequence analyses reveal that a TPR–DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR–DP domains and prokaryotic GerD proteins

    PubMed Central

    Papandreou, Nikolaos; Chomilier, Jacques

    2008-01-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR–DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR–DP domains. Electronic supplementary material The online version of this article (doi:10.1007/s12192-008-0083-8) contains supplementary material, which is available to authorized users. PMID:18987995

  3. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    PubMed

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  4. Technical strategy of triple jump: differences of inverted pendulum model between hop-dominated and balance techniques.

    PubMed

    Fujibayashi, Nobuaki; Otsuka, Mitsuo; Yoshioka, Shinsuke; Isaka, Tadao

    2017-10-24

    The present study aims to cross-sectionally clarify the characteristics of the motions of an inverted pendulum model, a stance leg, a swing leg and arms in different triple-jumping techniques to understand whether or not hop displacement is relatively longer rather than step and jump displacements. Eighteen male athletes performed the triple jump with a full run-up. Based on the technique of the jumpers, they were classified as hop-dominated (n = 10) or balance (n = 8) jumpers. The kinematic data were calculated using motion capture and compared between the two techniques using the inverted pendulum model. The hop-dominated jumpers had a significantly longer hop displacement and faster vertical centre-of-mass (COM) velocity of their whole body at hop take-off, which was generated by faster rotation behaviours of inverted pendulum model and faster swinging behaviours of arms. Conversely, balance jumpers had a significantly longer jump displacement and faster horizontal COM velocity of their whole body at take-off, which was generated by a stiffer inverted pendulum model and stance leg. The results demonstrate that hop-dominated and balance jumpers enhanced each dominated-jump displacement using different swing- and stance-leg motions. This information may help to enhance the actual displacement of triple jumpers using different jumping techniques.

  5. Effects of dietary hop (Humulus lupulus L.) β-acids on quality attributes, composition and oxidative stability of pork meat.

    PubMed

    Sbardella, Maicon; Racanicci, Aline Mc; Gois, Franz D; de Lima, Cristiane B; Migotto, Dannielle L; Costa, Leandro B; Miyada, Valdomiro S

    2018-04-01

    The effects of dietary levels of hop β-acids on physical attributes, lipid oxidation and chemical composition of pork meat were evaluated. Thirty-two castrated male pigs obtained from a complete block design feeding experiment (6.23 ± 0.42 kg initial body weight (BW) to 20.45 ± 0.95 kg final BW) and fed diets supplemented with 0, 120, 240 or 360 mg kg -1 hop β-acids during 35 days were slaughtered to sample longissimus dorsi muscle for meat analysis. No effects (P > 0.05) of dietary hop β-acids were observed on meat physical attributes. Quadratic effects (P < 0.05) of hop β-acids were observed on lipid and protein contents and on thiobarbituric acid-reactive substance (TBARS) values of meatballs, whose equations allowed the estimation of dietary hop β-acid levels of 176, 169 and 181 mg kg -1 to provide up to 16.20% lipid reduction, 1.95% protein accretion and 23.31% TBARS reduction respectively. Dietary hop β-acids fed to pigs might reduce lipid, increase protein and reduce lipid oxidation without affecting physical attributes of the pork meat. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. The Hip-Hop club scene: Gender, grinding and sex.

    PubMed

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  7. Layer Anti-Ferromagnetism on Bilayer Honeycomb Lattice

    PubMed Central

    Tao, Hong-Shuai; Chen, Yao-Hua; Lin, Heng-Fu; Liu, Hai-Di; Liu, Wu-Ming

    2014-01-01

    Bilayer honeycomb lattice, with inter-layer tunneling energy, has a parabolic dispersion relation, and the inter-layer hopping can cause the charge imbalance between two sublattices. Here, we investigate the metal-insulator and magnetic phase transitions on the strongly correlated bilayer honeycomb lattice by cellular dynamical mean-field theory combined with continuous time quantum Monte Carlo method. The procedures of magnetic spontaneous symmetry breaking on dimer and non-dimer sites are different, causing a novel phase transition between normal anti-ferromagnet and layer anti-ferromagnet. The whole phase diagrams about the magnetism, temperature, interaction and inter-layer hopping are obtained. Finally, we propose an experimental protocol to observe these phenomena in future optical lattice experiments. PMID:24947369

  8. Composite operators in the hopping parameter expansion in the free quark model

    NASA Astrophysics Data System (ADS)

    Kunszt, Z.

    1983-11-01

    I have calculated hopping parameter series of meson and baryon propagators up to O(K32) in the Wilson formulation of the free quark model. The position of branch point singularities has been found with the help of Padé approximants. The values of the position of the singularities in K agreed with the exact values within 1-2% in case of mesons and 4-5% in case of baryons. It is argued that in QCD at the cross-over region the systematic errors of the method must be even smaller. Part of this work has been done while the author was visiting the Rutherford and Appleton Laboratories, UK.

  9. Electron Flow through Proteins

    PubMed Central

    Gray, Harry B.; Winkler, Jay R.

    2009-01-01

    Electron transfers in photosynthesis and respiration commonly occur between metal-containing cofactors that are separated by large molecular distances. Employing laser flash-quench triggering methods, we have shown that 20-Å, coupling-limited FeII to RuIII and CuI to RuIII electron tunneling in Ru-modified cytochromes and blue copper proteins can occur on the microsecond timescale both in solutions and crystals. Redox equivalents can be transferred even longer distances by multistep tunneling, often called hopping, through intervening amino acid side chains. Our work has established that 20-Å hole hopping through an intervening tryptophan is two orders of magnitude faster than single-step electron tunneling in a Re-modified blue copper protein. PMID:20161522

  10. Random hopping fermions on bipartite lattices: density of states, inverse participation ratios, and their correlations in a strong disorder regime

    NASA Astrophysics Data System (ADS)

    Yamada, Hiroki; Fukui, Takahiro

    2004-02-01

    We study Anderson localization of non-interacting random hopping fermions on bipartite lattices in two dimensions, focusing our attention to strong disorder features of the model. We concentrate ourselves on specific models with a linear dispersion in the vicinity of the band center, which can be described by a Dirac fermion in the continuum limit. Based on the recent renormalization group method developed by Carpentier and Le Doussal for the XY gauge glass model, we calculate the density of states, inverse participation ratios, and their spatial correlations. It turns out that their behavior is quite different from those expected within naive weak disorder approaches.

  11. Distributed Wavelet Transform for Irregular Sensor Network Grids

    DTIC Science & Technology

    2005-01-01

    implement it in a multi-hop, wireless sensor network ; and illustrate with several simulations. The new transform performs on par with conventional wavelet methods in a head-to-head comparison on a regular grid of sensor nodes.

  12. Microscopic Simulations of Charge Transport in Disordered Organic Semiconductors

    PubMed Central

    2011-01-01

    Charge carrier dynamics in an organic semiconductor can often be described in terms of charge hopping between localized states. The hopping rates depend on electronic coupling elements, reorganization energies, and driving forces, which vary as a function of position and orientation of the molecules. The exact evaluation of these contributions in a molecular assembly is computationally prohibitive. Various, often semiempirical, approximations are employed instead. In this work, we review some of these approaches and introduce a software toolkit which implements them. The purpose of the toolkit is to simplify the workflow for charge transport simulations, provide a uniform error control for the methods and a flexible platform for their development, and eventually allow in silico prescreening of organic semiconductors for specific applications. All implemented methods are illustrated by studying charge transport in amorphous films of tris-(8-hydroxyquinoline)aluminum, a common organic semiconductor. PMID:22076120

  13. Non-Adiabatic Molecular Dynamics Methods for Materials Discovery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Furche, Filipp; Parker, Shane M.; Muuronen, Mikko J.

    2017-04-04

    The flow of radiative energy in light-driven materials such as photosensitizer dyes or photocatalysts is governed by non-adiabatic transitions between electronic states and cannot be described within the Born-Oppenheimer approximation commonly used in electronic structure theory. The non-adiabatic molecular dynamics (NAMD) methods based on Tully surface hopping and time-dependent density functional theory developed in this project have greatly extended the range of molecular materials that can be tackled by NAMD simulations. New algorithms to compute molecular excited state and response properties efficiently were developed. Fundamental limitations of common non-linear response methods were discovered and characterized. Methods for accurate computations ofmore » vibronic spectra of materials such as black absorbers were developed and applied. It was shown that open-shell TDDFT methods capture bond breaking in NAMD simulations, a longstanding challenge for single-reference molecular dynamics simulations. The methods developed in this project were applied to study the photodissociation of acetaldehyde and revealed that non-adiabatic effects are experimentally observable in fragment kinetic energy distributions. Finally, the project enabled the first detailed NAMD simulations of photocatalytic water oxidation by titania nanoclusters, uncovering the mechanism of this fundamentally important reaction for fuel generation and storage.« less

  14. Simulations of optically switchable molecular machines for particle transport.

    PubMed

    Raeker, Tim; Jansen, Björn; Behrens, Dominik; Hartke, Bernd

    2018-03-24

    A promising application for design and deployment of molecular machines is nanoscale transport, driven by artificial cilia. In this contribution, we present several further steps toward this goal, beyond our first-generation artificial cilium (Raeker et al., J. Phys. Chem. A 2012, 116, 11241). Promising new azobenzene-derivatives were tested for use as cilium motors. Using a QM/MM partitioning in on-the-fly photodynamics, excited-state surface-hopping trajectories were calculated for each isomerization direction and each motor version. The methods used were reparametrized semiempirical quantum chemistry together with floating-occupation configuration interaction as the QM part and the OPLSAA-L forcefield as MM part. In addition, we simulated actual particle transport by a single cilium attached to a model surface, with varying attachment strengths and modes, and with transport targets ranging from single atoms to multi-molecule arrangements. Our results provide valuable design guidelines for cilia-driven nanoscale transport and emphasize the need to carefully select the whole setup (not just the cilium itself, but also its surface attachment and the dynamic cilium-target interaction) to achieve true transport. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  15. Development of biological control of Tetranychus urticae (Acari:Tetranychidae) and Phorodon humuli (Hemiptera: Aphididae) in Oregon Hop yards

    USDA-ARS?s Scientific Manuscript database

    The temporal development of biological control of arthropod pests in perennial cropping systems is largely unreported. In this study, the development of biological control of twospotted spider mite, Tetranychus urticae Koch and hop aphid, Phorodon humuli (Schrank) in a new planting of hop in Oregon...

  16. Hip-Hop and a Hybrid Text in a Postsecondary English Class

    ERIC Educational Resources Information Center

    Sanchez, Deborah M.

    2010-01-01

    This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

  17. QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)

    USDA-ARS?s Scientific Manuscript database

    Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...

  18. Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy

    ERIC Educational Resources Information Center

    Cermak, Michael J.

    2012-01-01

    This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…

  19. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    ERIC Educational Resources Information Center

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  20. 75 FR 59260 - HOP Energy, LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes Request for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-27

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. ER10-2658-000] HOP Energy, LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes Request for Blanket Section... of HOP Energy, LLC's application for market-based rate authority, with an accompanying rate tariff...

  1. Framing Hip Hop: New Methodologies for New Times

    ERIC Educational Resources Information Center

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  2. Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

    ERIC Educational Resources Information Center

    Wessel, Roger D.; Wallaert, Kerry A.

    2011-01-01

    This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

  3. Hip Hop Is Now: An Evolving Youth Culture

    ERIC Educational Resources Information Center

    Taylor, Carl; Taylor, Virgil

    2007-01-01

    Emerging from Rap music, Hip Hop has become a lifestyle to many modern youth around the world. Embodying both creativity and controversy, Hip Hop mirrors the values, violence, and hypocrisy of modern culture. The authors dispel some of the simplistic views that surround this evolving youth movement embraced by millions of young people who are…

  4. Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

    ERIC Educational Resources Information Center

    Emdin, Christopher

    2010-01-01

    The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

  5. Factors of Intensification in the Hops Cluster of Chuvashia

    ERIC Educational Resources Information Center

    Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.

    2016-01-01

    The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…

  6. A study on a wheel-based stair-climbing robot with a hopping mechanism

    NASA Astrophysics Data System (ADS)

    Kikuchi, Koki; Sakaguchi, Keisuke; Sudo, Takayuki; Bushida, Naoki; Chiba, Yasuhiro; Asai, Yuji

    2008-08-01

    In this study, we propose a simple hopping mechanism using the vibration of a two-degree-of-freedom system for a wheel-based stair-climbing robot. The robot, consisting of two bodies connected by springs and a wire, hops by releasing energy stored in the springs and quickly travels using wheels mounted in its lower body. The trajectories of the bodies during hopping change in accordance with the design parameters, such as the reduced mass of the two bodies, the mass ratio between the upper and lower bodies, the spring constant, the control parameters such as the initial contraction of the spring and the wire tension. This property allows the robot to quickly and economically climb up and down stairs, leap over obstacles, and landing softly without complex control. In this paper, the characteristics of hopping motion for the design and control parameters are clarified by both numerical simulations and experiments. Furthermore, using the robot design based on the results the abilities to hop up and down a step, leap over a cable, and land softly are demonstrated.

  7. Results of Computing Amplitude and Phase of the VLF Wave Using Wave Hop Theory

    NASA Astrophysics Data System (ADS)

    Pal, Sujay; Basak, Tamal; Chakrabarti, Sandip K.

    2011-07-01

    We present the basics of the wave hop theory to compute the amplitude and phase of the VLF signals. We use the Indian Navy VTX transmitter at 18.2 kHz as an example of the source and compute the VLF propagation characteristics for several propagation paths using the wave-hop theory. We find the signal amplitudes as a function of distance from the transmitter using wave hop theory in different bearing angles and compare with the same obtained from the Long Wave Propagation Capability (LWPC) code which uses the mode theory. We repeat a similar exercise for the diurnal and seasonal behavior. We note that the signal variation by wave hop theory gives more detailed information in the day time. We further present the spatial variation of the signal amplitude over whole of India at a given time including the effect of sunrise and sunset terminator and also compare the same with that from the mode theory. We point out that the terminator effect is clearly understood in wave hop results than that from the mode theory.

  8. Not letting the left leg know what the right leg is doing: limb-specific locomotor adaptation to sensory-cue conflict.

    PubMed

    Durgin, Frank H; Fox, Laura F; Hoon Kim, Dong

    2003-11-01

    We investigated the phenomenon of limb-specific locomotor adaptation in order to adjudicate between sensory-cue-conflict theory and motor-adaptation theory. The results were consistent with cue-conflict theory in demonstrating that two different leg-specific hopping aftereffects are modulated by the presence of conflicting estimates of self-motion from visual and nonvisual sources. Experiment 1 shows that leg-specific increases in forward drift during attempts to hop in place on one leg while blindfolded vary according to the relationship between visual information and motor activity during an adaptation to outdoor forward hopping. Experiment 2 shows that leg-specific changes in performance on a blindfolded hopping-to-target task are similarly modulated by the presence of cue conflict during adaptation to hopping on a treadmill. Experiment 3 shows that leg-specific aftereffects from hopping additionally produce inadvertent turning during running in place while blindfolded. The results of these experiments suggest that these leg-specific locomotor aftereffects are produced by sensory-cue conflict rather than simple motor adaptation.

  9. Why do mammals hop? Understanding the ecology, biomechanics and evolution of bipedal hopping.

    PubMed

    McGowan, Craig P; Collins, Clint E

    2018-06-15

    Bipedal hopping is a specialized mode of locomotion that has arisen independently in at least five groups of mammals. We review the evolutionary origins of these groups, examine three of the most prominent hypotheses for why bipedal hopping may have arisen, and discuss how this unique mode of locomotion influences the behavior and ecology of modern species. While all bipedal hoppers share generally similar body plans, differences in underlying musculoskeletal anatomy influence what performance benefits each group may derive from this mode of locomotion. Based on a review of the literature, we conclude that the most likely reason that bipedal hopping evolved is associated with predator avoidance by relatively small species in forested environments. Yet, the morphological specializations associated with this mode of locomotion have facilitated the secondary acquisition of performance characteristics that enable these species to be highly successful in ecologically demanding environments such as deserts. We refute many long-held misunderstandings about the origins of bipedal hopping and identify potential areas of research that would advance the understanding of this mode of locomotion. © 2018. Published by The Company of Biologists Ltd.

  10. Landing mechanics during single hop for distance in females following anterior cruciate ligament reconstruction compared to healthy controls.

    PubMed

    Trigsted, Stephanie M; Post, Eric G; Bell, David R

    2017-05-01

    To determine possible differences in single-hop kinematics and kinetics in females with anterior cruciate ligament reconstruction compared to healthy controls. A second purpose was to make comparisons between the healthy and reconstructed limbs. Subjects were grouped based on surgical status (33 ACLR patients and 31 healthy controls). 3D motion capture synchronized with force plates was used to capture the landing phase of three successful trials of single hop for distance during a single data collection session. Peak values during the loading phase were analysed. Subjects additionally completed three successful trials of the triple hop for distance Tegner activity scale and International Knee Document Committee 2000 (IKDC). Controls demonstrated greater peak knee flexion and greater internal knee extension moment and hip extension moment than ACLR subjects. Within the ACLR group, the healthy limb exhibited greater peak knee flexion, hip flexion, hip extension moment, single hop and triple hops for distance and normalized quadriceps strength. Patients who undergo anterior cruciate ligament reconstruction land in a more extended posture when compared to healthy controls and compared to their healthy limb. III.

  11. Comprehensive analysis of orthologous protein domains using the HOPS database.

    PubMed

    Storm, Christian E V; Sonnhammer, Erik L L

    2003-10-01

    One of the most reliable methods for protein function annotation is to transfer experimentally known functions from orthologous proteins in other organisms. Most methods for identifying orthologs operate on a subset of organisms with a completely sequenced genome, and treat proteins as single-domain units. However, it is well known that proteins are often made up of several independent domains, and there is a wealth of protein sequences from genomes that are not completely sequenced. A comprehensive set of protein domain families is found in the Pfam database. We wanted to apply orthology detection to Pfam families, but first some issues needed to be addressed. First, orthology detection becomes impractical and unreliable when too many species are included. Second, shorter domains contain less information. It is therefore important to assess the quality of the orthology assignment and avoid very short domains altogether. We present a database of orthologous protein domains in Pfam called HOPS: Hierarchical grouping of Orthologous and Paralogous Sequences. Orthology is inferred in a hierarchic system of phylogenetic subgroups using ortholog bootstrapping. To avoid the frequent errors stemming from horizontally transferred genes in bacteria, the analysis is presently limited to eukaryotic genes. The results are accessible in the graphical browser NIFAS, a Java tool originally developed for analyzing phylogenetic relations within Pfam families. The method was tested on a set of curated orthologs with experimentally verified function. In comparison to tree reconciliation with a complete species tree, our approach finds significantly more orthologs in the test set. Examples for investigating gene fusions and domain recombination using HOPS are given.

  12. Nonadiabatic ab initio molecular dynamics with PME-ONIOM scheme of photoisomerization reaction between 1,3-cyclohexadiene and 1,3,5-cis-hexatriene in solution phase

    NASA Astrophysics Data System (ADS)

    Ohta, Ayumi; Kobayashi, Osamu; Danielache, Sebastian O.; Nanbu, Shinkoh

    2017-03-01

    The ultra-fast photoisomerization reactions between 1,3-cyclohexadiene (CHD) and 1,3,5-cis-hexatriene (HT) in both hexane and ethanol solvents were revealed by nonadiabatic ab initio molecular dynamics (AI-MD) with a particle-mesh Ewald summation method and our Own N-layered Integrated molecular Orbital and molecular Mechanics model (PME-ONIOM) scheme. Zhu-Nakamura version trajectory surface hopping method (ZN-TSH) was employed to treat the ultra-fast nonadiabatic decaying process. The results for hexane and ethanol simulations reasonably agree with experimental data. The high nonpolar-nonpolar affinity between CHD and the solvent was observed in hexane solvent, which definitely affected the excited state lifetimes, the product branching ratio of CHD:HT, and solute (CHD) dynamics. In ethanol solvent, however, the CHD solute was isomerized in the solvent cage caused by the first solvation shell. The photochemical dynamics in ethanol solvent results in the similar property to the process appeared in vacuo (isolated CHD dynamics).

  13. Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

    PubMed

    Kea, J; Kramer, J; Forwell, L; Birmingham, T

    2001-08-01

    Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

  14. Transport mechanism of reverse surface leakage current in AlGaN/GaN high-electron mobility transistor with SiN passivation

    NASA Astrophysics Data System (ADS)

    Zheng, Xue-Feng; Fan, Shuang; Chen, Yong-He; Kang, Di; Zhang, Jian-Kun; Wang, Chong; Mo, Jiang-Hui; Li, Liang; Ma, Xiao-Hua; Zhang, Jin-Cheng; Hao, Yue

    2015-02-01

    The transport mechanism of reverse surface leakage current in the AlGaN/GaN high-electron mobility transistor (HEMT) becomes one of the most important reliability issues with the downscaling of feature size. In this paper, the research results show that the reverse surface leakage current in AlGaN/GaN HEMT with SiN passivation increases with the enhancement of temperature in the range from 298 K to 423 K. Three possible transport mechanisms are proposed and examined to explain the generation of reverse surface leakage current. By comparing the experimental data with the numerical transport models, it is found that neither Fowler-Nordheim tunneling nor Frenkel-Poole emission can describe the transport of reverse surface leakage current. However, good agreement is found between the experimental data and the two-dimensional variable range hopping (2D-VRH) model. Therefore, it is concluded that the reverse surface leakage current is dominated by the electron hopping through the surface states at the barrier layer. Moreover, the activation energy of surface leakage current is extracted, which is around 0.083 eV. Finally, the SiN passivated HEMT with a high Al composition and a thin AlGaN barrier layer is also studied. It is observed that 2D-VRH still dominates the reverse surface leakage current and the activation energy is around 0.10 eV, which demonstrates that the alteration of the AlGaN barrier layer does not affect the transport mechanism of reverse surface leakage current in this paper. Project supported by the National Natural Science Foundation of China (Grant Nos. 61334002, 61106106, and 61474091), the Opening Project of Science and Technology on Reliability Physics and Application Technology of Electronic Component Laboratory, China (Grant No. ZHD201206), the New Experiment Development Funds for Xidian University, China (Grant No. SY1213), the 111 Project, China (Grant No. B12026), the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry, China, and the Fundamental Research Funds for the Central Universities, China (Grant No. K5051325002).

  15. Spectral properties near the Mott transition in the two-dimensional t-J model with next-nearest-neighbor hopping

    NASA Astrophysics Data System (ADS)

    Kohno, Masanori

    2018-05-01

    The single-particle spectral properties of the two-dimensional t-J model with next-nearest-neighbor hopping are investigated near the Mott transition by using cluster perturbation theory. The spectral features are interpreted by considering the effects of the next-nearest-neighbor hopping on the shift of the spectral-weight distribution of the two-dimensional t-J model. Various anomalous features observed in hole-doped and electron-doped high-temperature cuprate superconductors are collectively explained in the two-dimensional t-J model with next-nearest-neighbor hopping near the Mott transition.

  16. Ultrafast hopping dynamics of 5f electrons in the Mott insulator UO₂ studied by femtosecond pump-probe spectroscopy.

    PubMed

    An, Yong Q; Taylor, Antoinette J; Conradson, Steven D; Trugman, Stuart A; Durakiewicz, Tomasz; Rodriguez, George

    2011-05-20

    We describe a femtosecond pump-probe study of ultrafast hopping dynamics of 5f electrons in the Mott insulator UO₂ following Mott-gap excitation at temperatures of 5-300 K. Hopping-induced response of the lattice and electrons is probed by transient reflectivity at mid- and above-gap photon energies, respectively. These measurements show an instantaneous hop, subsequent picosecond lattice deformation, followed by acoustic phonon emission and microsecond relaxation. Temperature-dependent studies indicate that the slow relaxation results from Hubbard excitons formed by U³⁺-U⁵⁺ pairs.

  17. INTRA-RATER RELIABILITY OF THE MULTIPLE SINGLE-LEG HOP-STABILIZATION TEST AND RELATIONSHIPS WITH AGE, LEG DOMINANCE AND TRAINING.

    PubMed

    Sawle, Leanne; Freeman, Jennifer; Marsden, Jonathan

    2017-04-01

    Balance is a complex construct, affected by multiple components such as strength and co-ordination. However, whilst assessing an athlete's dynamic balance is an important part of clinical examination, there is no gold standard measure. The multiple single-leg hop-stabilization test is a functional test which may offer a method of evaluating the dynamic attributes of balance, but it needs to show adequate intra-tester reliability. The purpose of this study was to assess the intra-rater reliability of a dynamic balance test, the multiple single-leg hop-stabilization test on the dominant and non-dominant legs. Intra-rater reliability study. Fifteen active participants were tested twice with a 10-minute break between tests. The outcome measure was the multiple single-leg hop-stabilization test score, based on a clinically assessed numerical scoring system. Results were analysed using an Intraclass Correlations Coefficient (ICC 2,1 ) and Bland-Altman plots. Regression analyses explored relationships between test scores, leg dominance, age and training (an alpha level of p = 0.05 was selected). ICCs for intra-rater reliability were 0.85 for the dominant and non-dominant legs (confidence intervals = 0.62-0.95 and 0.61-0.95 respectively). Bland-Altman plots showed scores within two standard deviations. A significant correlation was observed between the dominant and non-dominant leg on balance scores (R 2 =0.49, p<0.05), and better balance was associated with younger participants in their non-dominant leg (R 2 =0.28, p<0.05) and their dominant leg (R 2 =0.39, p<0.05), and a higher number of hours spent training for the non-dominant leg R 2 =0.37, p<0.05). The multiple single-leg hop-stabilisation test demonstrated strong intra-tester reliability with active participants. Younger participants who trained more, have better balance scores. This test may be a useful measure for evaluating the dynamic attributes of balance. 3.

  18. ACL deficient potential copers and non-copers reveal different isokinetic quadriceps strength profiles in the early stage after injury

    PubMed Central

    Eitzen, I; Eitzen, TJ; Holm, I; Snyder-Mackler, L; Risberg, MA

    2011-01-01

    Background Isokinetic muscle strength tests using the peak torque value is the most frequently included quadriceps muscle strength measurement for anterior cruciate ligament (ACL) injured subjects. Aims The purpose of this study was to investigate quadriceps muscle performance during the whole isokinetic curve in ACL deficient subjects classified as potential copers or non-copers, and investigate whether these curve profiles were associated with single-leg hop performance. We hypothesized that quadriceps muscle torque at other knee flexion angles than peak torque would give more information about quadriceps muscle strength deficits. Furthermore, we hypothesized that there would be significant torque differences between potential copers and non-copers, and a significant relationship between angle specific torque values and single-leg hop performance. Study Design Cross-sectional study; Level of evidence, 2 Methods Seventy-six individuals with a complete unilateral ACL rupture within the last 3 months were included. The subjects were classified into potential copers and non-copers according to the criteria from Fitzgerald et al12. Isokinetic quadriceps muscle tests were performed at 60°/sec (Biodex 6000). Mean torque values were calculated for peak torque as well as for specific knee flexion angles. The one-leg hop and the 6 meter timed hop tests were included and symmetry indices were used. Results The peak torque value did not identify the largest quadriceps muscle strength deficit. Rather, these were established at knee flexion angles of less than 40°. There were significant differences in angle specific torque values between potential copers and non-copers (p<0.05). Moderate to strong associations were disclosed between angle specific torque values and single-leg hop performance, but only for non-copers (r≥0.32– 0.58). Conclusions Angle specific quadriceps muscle torque values of less than 40° of knee flexion provide more information on the quadriceps strength deficits after ACL injury compared to the commonly used peak torque values. PMID:20110458

  19. An Evaluation of a Numerical Prediction Method for Electric Field Strength of Low Frequency Radio Waves based on Wave-Hop Ionospheric Propagation

    NASA Astrophysics Data System (ADS)

    Kitauchi, H.; Nozaki, K.; Ito, H.; Kondo, T.; Tsuchiya, S.; Imamura, K.; Nagatsuma, T.; Ishii, M.

    2014-12-01

    We present our recent efforts on an evaluation of the numerical prediction method of electric field strength for ionospheric propagation of low frequency (LF) radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012), "Prediction of field strength at frequencies below about 150 kHz," made by International Telecommunication Union Radiocommunication Sector (ITU-R). As part of the Japanese Antarctic Research Expedition (JARE), we conduct on-board measurements of the electric field strengths and phases of LF 40 kHz and 60 kHz of radio signals (call sign JJY) continuously along both the ways between Tokyo, Japan and Syowa Station, the Japanese Antarctic station, at 69° 00' S, 39° 35' E on East Ongul Island, Lützow-Holm Bay, East Antarctica. The measurements are made by a newly developed, highly sensitive receiving system installed on board the Japanese Antarctic research vessel (RV) Shirase. We obtained new data sets of the electric field strength up to approximately 13,000-14,000 km propagation of LF JJY 40 kHz and 60 kHz radio waves by utilizing a newly developed, highly sensitive receiving system, comprised of an orthogonally crossed double-loop antenna and digital-signal-processing lock-in amplifiers, on board RV Shirase during the 55th JARE from November 2013 to April 2014. We have made comparisons between those on-board measurements and the numerical predictions of field strength for long-range propagation of low frequency radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012) to show that our results qualitatively support the recommended wave-hop theory for the great-circle paths approximately 7,000-8,000 km and 13,000-14,000 km propagations.

  20. No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.

    PubMed

    Gibson, W; Campbell, A; Allison, G

    2013-09-01

    Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Musculoskeletal modelling deconstructs the paradoxical effects of elastic ankle exoskeletons on plantar-flexor mechanics and energetics during hopping

    PubMed Central

    Farris, Dominic James; Hicks, Jennifer L.; Delp, Scott L.; Sawicki, Gregory S.

    2014-01-01

    Experiments have shown that elastic ankle exoskeletons can be used to reduce ankle joint and plantar-flexor muscle loading when hopping in place and, in turn, reduce metabolic energy consumption. However, recent experimental work has shown that such exoskeletons cause less favourable soleus (SO) muscle–tendon mechanics than is observed during normal hopping, which might limit the capacity of the exoskeleton to reduce energy consumption. To directly link plantar-flexor mechanics and energy consumption when hopping in exoskeletons, we used a musculoskeletal model of the human leg and a model of muscle energetics in simulations of muscle–tendon dynamics during hopping with and without elastic ankle exoskeletons. Simulations were driven by experimental electromyograms, joint kinematics and exoskeleton torque taken from previously published data. The data were from seven males who hopped at 2.5 Hz with and without elastic ankle exoskeletons. The energetics model showed that the total rate of metabolic energy consumption by ankle muscles was not significantly reduced by an ankle exoskeleton. This was despite large reductions in plantar-flexor force production (40–50%). The lack of larger metabolic reductions with exoskeletons was attributed to increases in plantar-flexor muscle fibre velocities and a shift to less favourable muscle fibre lengths during active force production. This limited the capacity for plantar-flexors to reduce activation and energy consumption when hopping with exoskeleton assistance. PMID:25278469

  2. How Does a Hopping Kangaroo Breathe?

    ERIC Educational Resources Information Center

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  3. Christian Hip Hop as Pedagogy: A South African Case Study

    ERIC Educational Resources Information Center

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  4. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    ERIC Educational Resources Information Center

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  5. Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

    ERIC Educational Resources Information Center

    Price, Robert J., Jr.

    2005-01-01

    Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

  6. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    ERIC Educational Resources Information Center

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  7. We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education

    ERIC Educational Resources Information Center

    Dando, Michael

    2017-01-01

    Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…

  8. Don't Believe the Hype: Hip-Hop Literacies and English Education

    ERIC Educational Resources Information Center

    Belle, Crystal

    2016-01-01

    Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

  9. Polish Hip Hop as a Form of Multiliteracies and Situated Learning

    ERIC Educational Resources Information Center

    Torrence, Michael L.

    2009-01-01

    The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

  10. 78 FR 13346 - Medicare Program; Changes to the Semi-Annual Meeting of the Advisory Panel on Hospital Outpatient...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-27

    ... (HOP Panel)--March 11 and March 12, 2013 AGENCY: Centers for Medicare & Medicaid Services (CMS), HHS... Program; Semi-Annual Meeting of the Advisory Panel on Hospital Outpatient Payment (HOP Panel)--March 11...-annual meeting of the Advisory Panel on Hospital Outpatient Payment (HOP, the Panel) for 2013. We note...

  11. 78 FR 7434 - Medicare Program: Notice of Two Membership Appointments to the Advisory Panel on Hospital...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-01

    ... Panel on Hospital Outpatient Payment (HOP, the Panel). The two new appointments to the Panel will each... Classification groups and weights. The Advisory Panel on Hospital Outpatient Payment (HOP, the Panel) is governed... members to the Advisory Panel on Hospital Outpatient Payment (HOP, the Panel) to fill two vacancies on the...

  12. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    ERIC Educational Resources Information Center

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  13. Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment

    ERIC Educational Resources Information Center

    Petchauer, Emery

    2011-01-01

    College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…

  14. Trends in German Hip Hop Music and Its Usefulness for the Classroom

    ERIC Educational Resources Information Center

    Schmidt, Johannes

    2008-01-01

    German hip hop music has proved productive, especially since 2000 when rap in Germany experienced something like a first crisis. As a response, German hip hop artists and record labels have ventured off in several different directions including other musical genres, different topics, and new approaches to German rap. This article discusses the…

  15. Representin': Drawing from Hip-Hop and Urban Youth Culture to Inform Teacher Education

    ERIC Educational Resources Information Center

    Irizarry, Jason G.

    2009-01-01

    The potential of drawing from urban youth culture, and hip-hop more specifically, to serve as a bridge to the standard curriculum has been well documented. However, the richness and potential benefits of hip-hop are more far-reaching and present significant implications for teacher education and professional development efforts as well. This…

  16. Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice

    ERIC Educational Resources Information Center

    Travis, Raphael, Jr.; Deepak, Anne

    2011-01-01

    Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…

  17. Analysis of muscle activity and ankle joint movement during the side-hop test.

    PubMed

    Yoshida, Masahiro; Taniguchi, Keigo; Katayose, Masaki

    2011-08-01

    Functional performance tests (FPTs) that consist of movements, such as hopping, landing, and cutting, provide useful measurements. Although some tests have been established for kinematic studies of the knee joint, very few tests have been established for the ankle joint. To use the FPT as a test battery for patients with an ankle sprain, it is necessary to document typical patterns of muscle activation and range of motion (ROM) of the ankle joint during FPTs. Therefore, the purpose of this study was to investigate the pattern of the ROM of the ankle inversion/eversion and the muscle activity of the peroneus longus muscle (PL) and the tibial anterior muscle (TA) in normal subjects during the side-hop test. To emphasize the characteristics of ROM and electromyography (EMG) at each phase, the side-hop tests were divided into 4 phases: lateral-hop contact phase (LC), lateral-hop flight phase (LF), medial hop contact phase (MC), and medial hop flight phase (MF), and the ROM of ankle inversion/eversion, a peak angle of ankle inversion, and Integral EMG (IEMG) of PL and TA compared among 4 phases. Fifteen male subjects with no symptoms of ankle joint problems participated in this research. The ROM of ankle inversion/eversion during the side-hop test was 27 ± 3.8° (mean ± SD), and there was a significant difference in the ROM of ankle inversion/eversion among 4 phases (p < 0.05). The phase in which the widest ROM was presented was the MF. A peak angle of the ankle inversion at MC was significantly greater than at LC and MF (p <0.05). A peak angle of the ankle inversion at LF was significantly greater than at LC and MF. The PL remained contracting with 50-160% of maximal voluntary contraction (MVC). The IEMGs of PL in both the contact phases were significantly greater than in both the flight phases (p < 0.05). In addition, the PL activity at LC was significantly greater than at MC. The TA remained contracting at 50-80% of MVC through the side-hop test. The IEMG of TA at both the contact phases was significantly greater than at 2 flight phases. However, there was no significant difference between LC and MF. Results of this study could be useful as basic data when evaluating the validity of the side-hop test for patients with ankle sprain.

  18. Reliability and validity of functional performance tests in dancers with hip dysfunction.

    PubMed

    Kivlan, Benjamin R; Carcia, Christopher R; Clemente, F Richard; Phelps, Amy L; Martin, Robroy L

    2013-08-01

    Quasi-experimental, repeated measures. Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. NINETEEN FEMALE DANCERS (AGE: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = -4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = -0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = -0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = -1.84, p=0.08) were not statistically different between sides. The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. 3b. Non-consecutive cohort study.

  19. Postactivation potentiation can counteract declines in force and power that occur after stretching.

    PubMed

    Kümmel, J; Kramer, A; Cronin, N J; Gruber, M

    2017-12-01

    Stretching can decrease a muscle's maximal force, whereas short but intense muscle contractions can increase it. We hypothesized that when combined, postactivation potentiation induced by reactive jumps would counteract stretch-induced decrements in drop jump (DJ) performance. Moreover, we measured changes in muscle twitch forces and ankle joint stiffness (K A nkle ) to examine underlying mechanisms. Twenty subjects completed three DJs and 10 electrically evoked muscle twitches of the triceps surae subsequent to four different conditioning activities and control. The conditioning activities were 10 hops, 20s of static stretching of the triceps surae muscle, 20s of stretching followed by 10 hops, and vice versa. After 10 hops, twitch peak torque (TPT) was 20% and jump height 5% higher compared with control with no differences in K A nkle . After stretching, TPT and jump height were both 9% and K A nkle 6% lower. When hops and stretching were combined as conditioning activities, jump height was not different compared with control but significantly higher (11% and 8%) compared with stretching. TPTs were 16% higher compared with control when the hops were performed after stretching and 9% higher compared with the reverse order. K A nkle was significantly lower when stretching was performed after the hops (6%) compared with control, but no significant difference was observed when hops were performed after stretching. These results demonstrate that conditioning hops can counteract stretch-related declines in DJ performance. Furthermore, the differences in TPTs and K A nkle between combined conditioning protocols indicate that the order of conditioning tasks might play an important role at the muscle-tendon level. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Star Formation Under the Outflow: The Discovery of a Non-thermal Jet from OMC-2 FIR 3 and Its Relationship to the Deeply Embedded FIR 4 Protostar

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osorio, Mayra; Díaz-Rodríguez, Ana K.; Anglada, Guillem

    We carried out multiwavelength (0.7–5 cm), multi-epoch (1994–2015) Very Large Array (VLA) observations toward the region enclosing the bright far-IR sources FIR 3 (HOPS 370) and FIR 4 (HOPS 108) in OMC-2. We report the detection of 10 radio sources, 7 of them identified as young stellar objects. We image a well-collimated radio jet with a thermal free–free core (VLA 11) associated with the Class I intermediate-mass protostar HOPS 370. The jet features several knots (VLA 12N, 12C, 12S) of non-thermal radio emission (likely synchrotron from shock-accelerated relativistic electrons) at distances of ∼7500–12,500 au from the protostar, in a regionmore » where other shock tracers have been previously identified. These knots are moving away from the HOPS 370 protostar at ∼100 km s{sup −1}. The Class 0 protostar HOPS 108, which itself is detected as an independent, kinematically decoupled radio source, falls in the path of these non-thermal radio knots. These results favor the previously proposed scenario in which the formation of HOPS 108 is triggered by the impact of the HOPS 370 outflow with a dense clump. However, HOPS 108 has a large proper motion velocity of ∼30 km s{sup −1}, similar to that of other runaway stars in Orion, whose origin would be puzzling within this scenario. Alternatively, an apparent proper motion could result because of changes in the position of the centroid of the source due to blending with nearby extended emission, variations in the source shape, and/or opacity effects.« less

  1. Treating primary insomnia - the efficacy of valerian and hops.

    PubMed

    Salter, Shanah; Brownie, Sonya

    2010-06-01

    To evaluate the efficacy of valerian and hops in the treatment of primary insomnia. The AMED and MEDLINE databases were searched for primary sources of literature published between 1950 and 2009, using keywords: herbal medicine, medicinal plants, herbal, Valeriana officinalis, valerian, Humulus lupulus, hops, sleep, insomnia. Studies were included if they evaluated the efficacy of valerian or hops in improving primary insomnia in adults: sixteen studies met the inclusion criteria. Twelve of these found that the use of valerian, on its own, or in combination with hops, is associated with improvements in some sleep parameters (eg. sleep latency and quality of sleep). However, these results need to be interpreted cautiously as there were significant differences in design between the studies. Further randomised, double blind, placebo controlled trials are needed before such herbal treatments can be confidently recommended for the treatment of primary insomnia.

  2. A Routing Path Construction Method for Key Dissemination Messages in Sensor Networks

    PubMed Central

    Moon, Soo Young; Cho, Tae Ho

    2014-01-01

    Authentication is an important security mechanism for detecting forged messages in a sensor network. Each cluster head (CH) in dynamic key distribution schemes forwards a key dissemination message that contains encrypted authentication keys within its cluster to next-hop nodes for the purpose of authentication. The forwarding path of the key dissemination message strongly affects the number of nodes to which the authentication keys in the message are actually distributed. We propose a routing method for the key dissemination messages to increase the number of nodes that obtain the authentication keys. In the proposed method, each node selects next-hop nodes to which the key dissemination message will be forwarded based on secret key indexes, the distance to the sink node, and the energy consumption of its neighbor nodes. The experimental results show that the proposed method can increase by 50–70% the number of nodes to which authentication keys in each cluster are distributed compared to geographic and energy-aware routing (GEAR). In addition, the proposed method can detect false reports earlier by using the distributed authentication keys, and it consumes less energy than GEAR when the false traffic ratio (FTR) is ≥10%. PMID:25136649

  3. Two-dimensional description of surface-bounded exospheres with application to the migration of water molecules on the Moon

    NASA Astrophysics Data System (ADS)

    Schorghofer, Norbert

    2015-05-01

    On the Moon, water molecules and other volatiles are thought to migrate along ballistic trajectories. Here, this migration process is described in terms of a two-dimensional partial differential equation for the surface concentration, based on the probability distribution of thermal ballistic hops. A random-walk model, a corresponding diffusion coefficient, and a continuum description are provided. In other words, a surface-bounded exosphere is described purely in terms of quantities on the surface, which can provide computational and conceptual advantages. The derived continuum equation can be used to calculate the steady-state distribution of the surface concentration of volatile water molecules. An analytic steady-state solution is obtained for an equatorial ring; it reveals the width and mass of the pileup of molecules at the morning terminator.

  4. WOBBLE: A Proposed Mission to Characterize Past and Present Water on Mars

    NASA Technical Reports Server (NTRS)

    Udrea, Bogdan; Delory, Greg; Landis, Geoffrey; Duvet, Ludovic; Choudhuri, Ahsan; Prina, Mauro; Moreels, Pierre; Bedard, Donald; Furano, Gianluca

    2002-01-01

    WOBBLE ("Water Observations from a Balloon Borne Light Explorer") is a mission concept study for a small robotic probe to explore Mars and to accomplish a scientific mission compatible with the goals of the NASA Code S enterprise. The detection of past or present water is a crucial goal for Mars exploration, representing a cross-cutting science theme relevant to past or extant life, climate history, sample return missions and eventual human exploration. The WOBBLE mission concept was developed to study evidence of water using in-situ detection methods. The features on Mars most suited to this investigation are the gullies identified by Malin and Edgett as evidence for recent, near-surface runoff of liquid water. These features are typically located on the inside face of crater rims, where the local slope angle is at or near the angle of repose. This makes the terrain difficult or impossible to access with conventional wheeled rover technology. Combined with the small size of the gullies in relation to a standard landing error ellipse, scientific investigation of these features requires a new approach to surface mobility. WOBBLE uses a low-altitude balloon-borne platform to traverse the surface from the landing site, to the investigation site, and then rise up the slope to investigate the regions of interest at close range. Of the mobility technologies available for near-term Mars exploration, only a balloon platform is capable of a well targeted, detailed sampling of the gully regions over periods of days or more. The science approach embodied in WOBBLE is two-pronged, designed to investigate both the historical evidence of liquid water utilizing high-resolution geomorphology and the characterization of mineral deposits, and present subsurface liquid water using radar sounding techniques. The WOBBLE balloon is a high-pressure hydrogen gas design, 24 meters in diameter and lifting a total payload of 130 kg, including a high-resolution camera/IR imager, Raman spectrometer, and a ground penetrating radar (GPR) sounder. The stowed balloon and payload are designed to fit within the current airbag delivery system being built for the Mars Exploration Rovers. Characterization of local meteorological conditions and wind is made over the initial sols following landing and before balloon inflation. Following balloon inflation and launch, a controlled, targeted approach toward the identified regions of interest is made in a series of several low-altitude "hops," with the balloon tethered to the ground between the hop intervals. A "snake" system is used to control the altitude to a few tens of meters above the local ground level. Enroute to the target gully, GPR soundings and Raman spectroscopy measurements study past or present water, while continued camera bearings and meteorological measurements refine the next "hop" trajectory. Once at the gully/outflow region, GPR and Raman soundings continue while the camera obtains detailed, approx. 0.5 cm images for geomorphology studies. The WOBBLE concept is applicable to Mars Scout, Mars Surveyor, or Discovery class missions.

  5. Predicting muscle forces during the propulsion phase of single leg triple hop test.

    PubMed

    Alvim, Felipe Costa; Lucareli, Paulo Roberto Garcia; Menegaldo, Luciano Luporini

    2018-01-01

    Functional biomechanical tests allow the assessment of musculoskeletal system impairments in a simple way. Muscle force synergies associated with movement can provide additional information for diagnosis. However, such forces cannot be directly measured noninvasively. This study aims to estimate muscle activations and forces exerted during the preparation phase of the single leg triple hop test. Two different approaches were tested: static optimization (SO) and computed muscle control (CMC). As an indirect validation, model-estimated muscle activations were compared with surface electromyography (EMG) of selected hip and thigh muscles. Ten physically healthy active women performed a series of jumps, and ground reaction forces, kinematics and EMG data were recorded. An existing OpenSim model with 92 musculotendon actuators was used to estimate muscle forces. Reflective markers data were processed using the OpenSim Inverse Kinematics tool. Residual Reduction Algorithm (RRA) was applied recursively before running the SO and CMC. For both, the same adjusted kinematics were used as inputs. Both approaches presented similar residuals amplitudes. SO showed a closer agreement between the estimated activations and the EMGs of some muscles. Due to inherent EMG methodological limitations, the superiority of SO in relation to CMC can be only hypothesized. It should be confirmed by conducting further studies comparing joint contact forces. The workflow presented in this study can be used to estimate muscle forces during the preparation phase of the single leg triple hop test and allows investigating muscle activation and coordination. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Redirected charge transport arising from diazonium grafting of carbon coated LiFePO4.

    PubMed

    Madec, L; Seid, K A; Badot, J-C; Humbert, B; Moreau, P; Dubrunfaut, O; Lestriez, B; Guyomard, D; Gaubicher, J

    2014-11-07

    The morphological and the electrical properties of carbon coated LiFePO4 (LFPC) active material functionalized by 4-ethynylbenzene tetrafluoroboratediazonium salt were investigated. For this purpose, FTIR, Raman, XPS, High Resolution Transmission Electron Microscopy (HRTEM) and Broadband Dielectric Spectroscopy (BDS) were considered. Electronic conductivities of LFPC samples at room temperature were found to decrease in a large frequency range upon simple immersion in polar solvents and to decrease further upon functionalization. Due to their high dipole moment, strongly physisorbed molecules detected by XPS likely add barriers to electron hopping. Significant alteration of the carbon coating conductivity was only observed, however, upon functionalization. This effect is most presumably associated with an increase in the sp(3) content determined by Raman spectroscopy, which is a strong indication of the formation of a covalent bond between the organic layer and the carbon coating. In this case, the electron flux appears to be redirected and relayed by short-range (intra chain) and long-range (inter chain) electron transport through molecular oligomers anchored at the LFPC surface. The latter are controlled by tunnelling and slightly activated hopping, which enable higher conductivity at low temperature (T < 250 K). Alteration of the electron transport within the carbon coating also allows detection of a relaxation phenomenon that corresponds to small polaron hopping in bulk LiFePO4. XPS and HRTEM images allow a clear correlation of these findings with the island type oligomeric structure of grafted molecules.

  7. Sista Girl Rock: Women of Colour and Hip-Hop Deejaying as Raced/Gendered Knowledge and Language

    ERIC Educational Resources Information Center

    Craig, Todd; Kynard, Carmen

    2017-01-01

    This article seeks to introduce and situate a seldom-explored subject: the role and contribution of women hip-hop deejays in the testosterone-filled genre called hip-hop. Grounding the analysis in the interviews of six women deejays--Spinderella, Kuttin Kandi, Pam the Funkstress, Reborn, Shorty Wop and Natasha Diggs--"Sista Girl Rock"…

  8. Hip-Hop Feminism: A Standpoint to Enhance the Positive Self-Identity of Black College Women

    ERIC Educational Resources Information Center

    Henry, Wilma J.

    2010-01-01

    The popularity of hip-hop among young Black college women, coupled with the deluge of negative and positive messages in this culture regarding these women's identity, signals an opportunity for the arrival of a contemporary, culturally relevant epistemology--hip-hop feminism. Through the lens of Black feminist theory, this article explores hip-hop…

  9. I Feel What He Was Doin': Responding to Justice-Oriented Teaching through Hip-Hop Aesthetics

    ERIC Educational Resources Information Center

    Petchauer, Emery

    2011-01-01

    This study illustrates a set of learning activities designed from two hip-hop aesthetics and explores their use among a classroom of African American preservice teachers who graduated from urban school districts. Based on the two hip-hop aesthetics of kinetic consumption and autonomy/distance, the specific goal of these learning activities is to…

  10. 75 FR 70236 - Hop Beta Acids; Receipt of Application for Emergency Exemption, Solicitation of Public Comment

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-17

    ... of Agriculture to use hop beta acids (CAS Reg. No. none specified) to treat up to 181,000 honey bee... exemption regional request for use of hop beta acids in honey bee hives to control varroa mites. Information... effect on honey bee populations. The parasitic mite is considered the primary pest of honeybees and its...

  11. "They Wasn't Makin' My Kinda Music": A Hip-Hop Musician's Perspective on School, Schooling, and School Music

    ERIC Educational Resources Information Center

    Kruse, Adam J.

    2016-01-01

    This article focuses on a hip-hop perspective of school, schooling, and school music. The study involves applications of ethnographic (including autoethnographic) techniques within the framework of a holistic multiple case study. One case is an adult amateur hip-hop musician named Terrence (pseudonym), and the other is myself (a traditionally…

  12. Hip-Hop, the "Obama Effect," and Urban Science Education

    ERIC Educational Resources Information Center

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  13. Supporting Communication and Argumentation in Urban Science Education: Hip-Hop, the Battle, and the Cypher

    ERIC Educational Resources Information Center

    Emdin, Christopher

    2011-01-01

    This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…

  14. Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education

    ERIC Educational Resources Information Center

    Petchauer, Emery

    2010-01-01

    Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…

  15. Hip-Hop's Influence on the Identity Development of Black Female College Students: A Literature Review

    ERIC Educational Resources Information Center

    Henry, Wilma J.; West, Nicole M.; Jackson, Andrea

    2010-01-01

    This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…

  16. Being Hip-Hop: Beyond Skills and Songs

    ERIC Educational Resources Information Center

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  17. Fresh Faces, New Places: Moving beyond Teacher-Researcher Perspectives in Hip-Hop-Based Education Research

    ERIC Educational Resources Information Center

    Irby, Decoteau J.; Hall, H. Bernard

    2011-01-01

    Grounded in critical and culturally relevant theory, hip-hop-based education (HHBE) research documents the use of hip-hop in educational settings. Despite the richness of the emerging field, overreliance on teacher-researcher perspectives leaves much to be desired. Little is known of the extent and ways HHBE is used by nonresearching K-12…

  18. "You Don't Have to Claim Her": Reconstructing Black Femininity through Critical Hip-Hop Literacy

    ERIC Educational Resources Information Center

    Kelly, Lauren Leigh

    2016-01-01

    This article explores the ways in which females who identify with hip-hop often develop and construct their identities in relation to media representations of blackness and femininity in hip-hop music and culture. In order for educators to support female students in constructing identities of empowerment and agency, they should be willing and able…

  19. Culturally Relevant Teaching: Hip-Hop Pedagogy in Urban Schools. Counterpoints: Studies in the Postmodern Theory of Education. Volume 396

    ERIC Educational Resources Information Center

    Prier, Darius D.

    2012-01-01

    "Culturally Relevant Teaching" centers hip-hop culture as a culturally relevant form of critical pedagogy in urban pre-service teacher education programs. In this important book, Darius D. Prier explores how hip-hop artists construct a sense of democratic education and pedagogy with transformative possibilities in their schools and communities. In…

  20. White Privilege? The Intersection of Hip-Hop and Whiteness as a Catalyst for Cross-Racial Interaction among White Males

    ERIC Educational Resources Information Center

    Sulé, Venice Thandi

    2015-01-01

    Given the prevalence of racial segregation in the U.S., college is an opportunity to prepare students for diversity through cross-racial interaction. Hip-hop, a culture steeped in black and Latino experiences, has significant white supporters. Through diversity and critical whiteness frameworks, this research considers how white hip-hop collegians…

Top