Sample records for surface receptor binding

  1. Endosomal receptor kinetics determine the stability of intracellular growth factor signalling complexes

    PubMed Central

    Tzafriri, A. Rami; Edelman, Elazer R.

    2006-01-01

    There is an emerging paradigm that growth factor signalling continues in the endosome and that cell response to a growth factor is defined by the integration of cell surface and endosomal events. As activated receptors in the endosome are exposed to a different set of binding partners, they probably elicit differential signals compared with when they are at the cell surface. As such, complete appreciation of growth factor signalling requires understanding of growth factor–receptor binding and trafficking kinetics both at the cell surface and in endosomes. Growth factor binding to surface receptors is well characterized, and endosomal binding is assumed to follow surface kinetics if one accounts for changes in pH. Yet, specific binding kinetics within the endosome has not been examined in detail. To parse the factors governing the binding state of endosomal receptors we analysed a whole-cell mathematical model of epidermal growth factor receptor trafficking and binding. We discovered that the stability of growth factor–receptor complexes within endosomes is governed by three primary independent factors: the endosomal dissociation constant, total endosomal volume and the number of endosomal receptors. These factors were combined into a single dimensionless parameter that determines the endosomal binding state of the growth factor–receptor complex and can distinguish different growth factors from each other and different cell states. Our findings indicate that growth factor binding within endosomal compartments cannot be appreciated solely on the basis of the pH-dependence of the dissociation constant and that the concentration of receptors in the endosomal compartment must also be considered. PMID:17117924

  2. Structure of colicin I receptor bound to the R-domain of colicin Ia: implications for protein import

    PubMed Central

    Buchanan, Susan K; Lukacik, Petra; Grizot, Sylvestre; Ghirlando, Rodolfo; Ali, Maruf M U; Barnard, Travis J; Jakes, Karen S; Kienker, Paul K; Esser, Lothar

    2007-01-01

    Colicin Ia is a 69 kDa protein that kills susceptible Escherichia coli cells by binding to a specific receptor in the outer membrane, colicin I receptor (70 kDa), and subsequently translocating its channel forming domain across the periplasmic space, where it inserts into the inner membrane and forms a voltage-dependent ion channel. We determined crystal structures of colicin I receptor alone and in complex with the receptor binding domain of colicin Ia. The receptor undergoes large and unusual conformational changes upon colicin binding, opening at the cell surface and positioning the receptor binding domain of colicin Ia directly above it. We modelled the interaction with full-length colicin Ia to show that the channel forming domain is initially positioned 150 Å above the cell surface. Functional data using full-length colicin Ia show that colicin I receptor is necessary for cell surface binding, and suggest that the receptor participates in translocation of colicin Ia across the outer membrane. PMID:17464289

  3. Ligand affinity of the 67-kD elastin/laminin binding protein is modulated by the protein's lectin domain: visualization of elastin/laminin-receptor complexes with gold-tagged ligands

    PubMed Central

    1991-01-01

    Video-enhanced microscopy was used to examine the interaction of elastin- or laminin-coated gold particles with elastin binding proteins on the surface of live cells. By visualizing the binding events in real time, it was possible to determine the specificity and avidity of ligand binding as well as to analyze the motion of the receptor-ligand complex in the plane of the plasma membrane. Although it was difficult to interpret the rates of binding and release rigorously because of the possibility for multiple interactions between particles and the cell surface, relative changes in binding have revealed important aspects of the regulation of affinity of ligand-receptor interaction in situ. Both elastin and laminin were found to compete for binding to the cell surface and lactose dramatically decreased the affinity of the receptor(s) for both elastin and laminin. These findings were supported by in vitro studies of the detergent-solubilized receptor. Further, immobilization of the ligand-receptor complexes through binding to the cytoskeleton dramatically decreased the ability of bound particles to leave the receptor. The changes in the kinetics of ligand-coated gold binding to living cells suggest that both laminin and elastin binding is inhibited by lactose and that attachment of receptor to the cytoskeleton increases its affinity for the ligand. PMID:1848864

  4. Distinctive receptor binding properties of the surface glycoprotein of a natural feline leukemia virus isolate with unusual disease spectrum.

    PubMed

    Bolin, Lisa L; Chandhasin, Chandtip; Lobelle-Rich, Patricia A; Albritton, Lorraine M; Levy, Laura S

    2011-05-13

    Feline leukemia virus (FeLV)-945, a member of the FeLV-A subgroup, was previously isolated from a cohort of naturally infected cats. An unusual multicentric lymphoma of non-T-cell origin was observed in natural and experimental infection with FeLV-945. Previous studies implicated the FeLV-945 surface glycoprotein (SU) as a determinant of disease outcome by an as yet unknown mechanism. The present studies demonstrate that FeLV-945 SU confers distinctive properties of binding to the cell surface receptor. Virions bearing the FeLV-945 Env protein were observed to bind the cell surface receptor with significantly increased efficiency, as was soluble FeLV-945 SU protein, as compared to the corresponding virions or soluble protein from a prototype FeLV-A isolate. SU proteins cloned from other cohort isolates exhibited increased binding efficiency comparable to or greater than FeLV-945 SU. Mutational analysis implicated a domain containing variable region B (VRB) to be the major determinant of increased receptor binding, and identified a single residue, valine 186, to be responsible for the effect. The FeLV-945 SU protein binds its cell surface receptor, feTHTR1, with significantly greater efficiency than does that of prototype FeLV-A (FeLV-A/61E) when present on the surface of virus particles or in soluble form, demonstrating a 2-fold difference in the relative dissociation constant. The results implicate a single residue, valine 186, as the major determinant of increased binding affinity. Computational modeling suggests a molecular mechanism by which residue 186 interacts with the receptor-binding domain through residue glutamine 110 to effect increased binding affinity. Through its increased receptor binding affinity, FeLV-945 SU might function in pathogenesis by increasing the rate of virus entry and spread in vivo, or by facilitating entry into a novel target cell with a low receptor density.

  5. Few residues within an extensive binding interface drive receptor interaction and determine the specificity of arrestin proteins.

    PubMed

    Vishnivetskiy, Sergey A; Gimenez, Luis E; Francis, Derek J; Hanson, Susan M; Hubbell, Wayne L; Klug, Candice S; Gurevich, Vsevolod V

    2011-07-08

    Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements.

  6. Few Residues within an Extensive Binding Interface Drive Receptor Interaction and Determine the Specificity of Arrestin Proteins*

    PubMed Central

    Vishnivetskiy, Sergey A.; Gimenez, Luis E.; Francis, Derek J.; Hanson, Susan M.; Hubbell, Wayne L.; Klug, Candice S.; Gurevich, Vsevolod V.

    2011-01-01

    Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements. PMID:21471193

  7. Combined sodium ion sensitivity in agonist binding and internalization of vasopressin V1b receptors.

    PubMed

    Koshimizu, Taka-Aki; Kashiwazaki, Aki; Taniguchi, Junichi

    2016-05-03

    Reducing Na(+) in the extracellular environment may lead to two beneficial effects for increasing agonist binding to cell surface G-protein coupled receptors (GPCRs): reduction of Na(+)-mediated binding block and reduce of receptor internalization. However, such combined effects have not been explored. We used Chinese Hamster Ovary cells expressing vasopressin V1b receptors as a model to explore Na(+) sensitivity in agonist binding and receptor internalization. Under basal conditions, a large fraction of V1b receptors is located intracellularly, and a small fraction is in the plasma membrane. Decreases in external Na(+) increased cell surface [(3)H]AVP binding and decreased receptor internalization. Substitution of Na(+) by Cs(+) or NH4(+) inhibited agonist binding. To suppress receptor internalization, the concentration of NaCl, but not of CsCl, had to be less than 50 mM, due to the high sensitivity of the internalization machinery to Na(+) over Cs(+). Iso-osmotic supplementation of glucose or NH4Cl maintained internalization of the V1b receptor, even in a low-NaCl environment. Moreover, iodide ions, which acted as a counter anion, inhibited V1b agonist binding. In summary, we found external ionic conditions that could increase the presence of high-affinity state receptors at the cell surface with minimum internalization during agonist stimulations.

  8. Combined sodium ion sensitivity in agonist binding and internalization of vasopressin V1b receptors

    PubMed Central

    Koshimizu, Taka-aki; Kashiwazaki, Aki; Taniguchi, Junichi

    2016-01-01

    Reducing Na+ in the extracellular environment may lead to two beneficial effects for increasing agonist binding to cell surface G-protein coupled receptors (GPCRs): reduction of Na+-mediated binding block and reduce of receptor internalization. However, such combined effects have not been explored. We used Chinese Hamster Ovary cells expressing vasopressin V1b receptors as a model to explore Na+ sensitivity in agonist binding and receptor internalization. Under basal conditions, a large fraction of V1b receptors is located intracellularly, and a small fraction is in the plasma membrane. Decreases in external Na+ increased cell surface [3H]AVP binding and decreased receptor internalization. Substitution of Na+ by Cs+ or NH4+ inhibited agonist binding. To suppress receptor internalization, the concentration of NaCl, but not of CsCl, had to be less than 50 mM, due to the high sensitivity of the internalization machinery to Na+ over Cs+. Iso-osmotic supplementation of glucose or NH4Cl maintained internalization of the V1b receptor, even in a low-NaCl environment. Moreover, iodide ions, which acted as a counter anion, inhibited V1b agonist binding. In summary, we found external ionic conditions that could increase the presence of high-affinity state receptors at the cell surface with minimum internalization during agonist stimulations. PMID:27138239

  9. Contribution of the 37-kDa laminin receptor precursor in the anti-metastatic PSP94-derived peptide PCK3145 cell surface binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Annabi, Borhane; Currie, Jean-Christophe; Bouzeghrane, Mounia

    Purpose: PCK3145 is an anti-metastatic synthetic peptide with promising therapeutic efficacy against hormone-refractory prostate cancer. The characterization of the PCK3145 peptide cell surface binding/internalization mechanisms and of the receptors involved remained to be explored. Results: [{sup 14}C]PCK3145 cell surface binding assays showed rapid and transient kinetic profile, that was inhibited by RGD peptides, laminin, hyaluronan, and type-I collagen. RGD peptides were however unable to inhibit PCK3145 intracellular uptake. Far-Western ligand binding studies enabled the identification of the 37-kDa laminin receptor precursor (37LRP) as a potential ligand for PCK3145. Overexpression of the recombinant 37LRP indeed led to an increase in PCK3145more » binding but unexpectedly not to its uptake. Conclusions: Our data support the implication of laminin receptors in cell surface binding and in transducing PCK3145 anti-metastatic effects, and provide a rational for targeting cancers that express high levels of such laminin receptors.« less

  10. Nanomechanical mapping of first binding steps of a virus to animal cells

    NASA Astrophysics Data System (ADS)

    Alsteens, David; Newton, Richard; Schubert, Rajib; Martinez-Martin, David; Delguste, Martin; Roska, Botond; Müller, Daniel J.

    2017-02-01

    Viral infection is initiated when a virus binds to cell surface receptors. Because the cell membrane is dynamic and heterogeneous, imaging living cells and simultaneously quantifying the first viral binding events is difficult. Here, we show an atomic force and confocal microscopy set-up that allows the surface receptor landscape of cells to be imaged and the virus binding events within the first millisecond of contact with the cell to be mapped at high resolution (<50 nm). We present theoretical approaches to contour the free-energy landscape of early binding events between an engineered virus and cell surface receptors. We find that the first bond formed between the viral glycoprotein and its cognate cell surface receptor has relatively low lifetime and free energy, but this increases as additional bonds form rapidly (≤1 ms). The formation of additional bonds occurs with positive allosteric modulation and the three binding sites of the viral glycoprotein are quickly occupied. Our quantitative approach can be readily applied to study the binding of other viruses to animal cells.

  11. Novel Yeast-based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR*

    PubMed Central

    Li, Hao; Redinbo, Matthew R.; Venkatesh, Madhukumar; Ekins, Sean; Chaudhry, Anik; Bloch, Nicolin; Negassa, Abdissa; Mukherjee, Paromita; Kalpana, Ganjam; Mani, Sridhar

    2013-01-01

    The pregnane X receptor (PXR) is a master regulator of xenobiotic metabolism, and its activity is critical toward understanding the pathophysiology of several diseases, including inflammation, cancer, and steatosis. Previous studies have demonstrated that ketoconazole binds to ligand-activated PXR and antagonizes receptor control of gene expression. Structure-function as well as computational docking analysis suggested a putative binding region containing critical charge clamp residues Gln-272, and Phe-264 on the AF-2 surface of PXR. To define the antagonist binding surface(s) of PXR, we developed a novel assay to identify key amino acid residues on PXR based on a yeast two-hybrid screen that examined mutant forms of PXR. This screen identified multiple “gain-of-function” mutants that were “resistant” to the PXR antagonist effects of ketoconazole. We then compared our screen results identifying key PXR residues to those predicted by computational methods. Of 15 potential or putative binding residues based on docking, we identified three residues in the yeast screen that were then systematically verified to functionally interact with ketoconazole using mammalian assays. Among the residues confirmed by our study was Ser-208, which is on the opposite side of the protein from the AF-2 region critical for receptor regulation. The identification of new locations for antagonist binding on the surface or buried in PXR indicates novel aspects to the mechanism of receptor antagonism. These results significantly expand our understanding of antagonist binding sites on the surface of PXR and suggest new avenues to regulate this receptor for clinical applications. PMID:23525103

  12. Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

    NASA Astrophysics Data System (ADS)

    Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

    1990-10-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

  13. Co-Requirement of PICK1 Binding and PKC Phosphorylation for Stable Surface Expression of the Metabotropic Glutamate Receptor mGluR7

    PubMed Central

    Suh, Young Ho; Pelkey, Kenneth A.; Lavezzari, Gabriela; Roche, Paul A.; Huganir, Richard L.; McBain, Chris J.; Roche, Katherine W.

    2008-01-01

    SUMMARY The presynaptic metabotropic glutamate receptor (mGluR) mGluR7 modulates excitatory neurotransmission by regulating neurotransmitter release, and plays a critical role in certain forms of synaptic plasticity. Although the dynamic regulation of mGluR7 surface expression governs a novel form of metaplasticity in the hippocampus, little is known about the molecular mechanisms regulating mGluR7 trafficking. We now show that mGluR7 surface expression is stabilized by both PKC phosphorylation and by receptor binding to the PDZ domain-containing protein PICK1. Phosphorylation of mGluR7 on serine 862 (S862) inhibits CaM binding thereby increasing mGluR7 surface expression and receptor binding to PICK1. Furthermore, in mice lacking PICK1, PKC-dependent increases in mGluR7 phosphorylation and surface expression are diminished, and mGluR7-dependent plasticity at mossy fiber-interneuron hippocampal synapses is impaired. These data support a model in which PICK1 binding and PKC phosphorylation act together to stabilize mGluR7 on the cell surface in vivo. PMID:18549785

  14. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  15. Platelet dysfunction associated with the novel Trp29Cys thromboxane A₂ receptor variant.

    PubMed

    Mumford, A D; Nisar, S; Darnige, L; Jones, M L; Bachelot-Loza, C; Gandrille, S; Zinzindohoue, F; Fischer, A-M; Mundell, S J; Gaussem, P

    2013-03-01

    Genetic variations that affect the structure of the thromboxane A2 receptor (TP receptor) provide insights into the function of this key platelet and vascular receptor, but are very rare in unselected populations. To determine the functional consequences of the TP receptor Trp29Cys (W29C) substitution. We performed a detailed phenotypic analysis of an index case (P1) with reduced platelet aggregation and secretion responses to TP receptor pathway activators, and a heterozygous TP receptor W29C substitution. An analysis of the variant W29C TP receptor expressed in heterologous cells was performed. Total TP receptor expression in platelets from P1 was similar to that of controls, but there was reduced maximum binding and reduced affinity of binding to the TP receptor antagonist [(3) H]SQ29548. HEK293 cells transfected with W29C TP receptor cDNA showed similar total TP receptor expression to wild-type (WT) controls. However, the TP receptor agonist U46619 was less potent at inducing rises in cytosolic free Ca(2+) in HEK293 cells expressing the W29C TP receptor than in WT controls, indicating reduced receptor function. Immunofluorescence microscopy and cell surface ELISA showed intracellular retention and reduced cell surface expression of the W29C TP receptor in HEK293 cells. Consistent with the platelet phenotype, both maximum binding and the affinity of binding of [(3) H]SQ29548 to the W29C TP receptor were reduced compared to WT controls. These findings extend the phenotypic description of the very rare disorder TP receptor deficiency, and show that the W29C substitution reduces TP receptor function by reducing surface receptor expression and by disrupting ligand binding. © 2012 International Society on Thrombosis and Haemostasis.

  16. Functional characterization of c-Mpl ectodomain mutations that underlie congenital amegakaryocytic thrombocytopenia.

    PubMed

    Varghese, Leila N; Zhang, Jian-Guo; Young, Samuel N; Willson, Tracy A; Alexander, Warren S; Nicola, Nicos A; Babon, Jeffrey J; Murphy, James M

    2014-02-01

    Activation of the cell surface receptor, c-Mpl, by the cytokine, thrombopoietin (TPO), underpins megakaryocyte and platelet production in mammals. In humans, mutations in c-Mpl have been identified as the molecular basis of Congenital Amegakaryocytic Thrombocytopenia (CAMT). Here, we show that CAMT-associated mutations in c-Mpl principally lead to defective receptor presentation on the cell surface. In contrast, one CAMT mutant c-Mpl, F104S, was expressed on the cell surface, but showed defective TPO binding and receptor activation. Using mutational analyses, we examined which residues adjacent to F104 within the membrane-distal cytokine receptor homology module (CRM) of c-Mpl comprise the TPO-binding epitope, revealing residues within the predicted Domain 1 E-F and A-B loops and Domain 2 F'-G' loop as key TPO-binding determinants. These studies underscore the importance of the c-Mpl membrane-distal CRM to TPO-binding and suggest that mutations within this CRM that perturb TPO binding could give rise to CAMT.

  17. Quartz crystal microbalance (QCM) with immobilized protein receptors: comparison of response to ligand binding for direct protein immobilization and protein attachment via disulfide linker.

    PubMed

    Baltus, Ruth E; Carmon, Kendra S; Luck, Linda A

    2007-03-27

    Results from an investigation of the frequency response resulting from ligand binding for a genetically engineered hormone-binding domain of the alpha-estrogen receptor immobilized to a piezoelectric quartz crystal are reported. Two different approaches were used to attach a genetically altered receptor to the gold electrode on the quartz surface: (1) the mutant receptor containing a single solvent-exposed cysteine was directly attached to the crystal via a sulfur to gold covalent bond, forming a self-assembled protein monolayer, and (2) the N-terminal histidine-tagged end was utilized to attach the receptor via a 3,3-dithiobis[N-(5-amino-5-carboxypentyl)propionamide-N',N'-diacetic acid] linker complexed with nickel. Previous studies have shown that these engineered constructs bind 17beta-estradiol and are fully functional. Exposure of the receptor directly attached to the piezoelectric crystal to the known ligand 17beta-estradiol resulted in a measurable frequency response, consistent with a change in conformation of the receptor with ligand binding. However, no response was observed when the receptor immobilized via the linker was exposed to the same ligand. The presence of the linker between the quartz surface and the protein receptor does not allow the crystal to sense the conformational change in the receptor that occurs with ligand binding. These results illustrate that the immobilization strategy used to bind the receptor to the sensor platform is key to eliciting an appropriate response from this biosensor. This study has important implications for the development of QCM-based sensors using protein receptors.

  18. Microscopic visualization of metabotropic glutamate receptors on the surface of living cells using bifunctional magnetic resonance imaging probes.

    PubMed

    Mishra, Anurag; Mishra, Ritu; Gottschalk, Sven; Pal, Robert; Sim, Neil; Engelmann, Joern; Goldberg, Martin; Parker, David

    2014-02-19

    A series of bimodal metabotropic glutamate-receptor targeted MRI contrast agents has been developed and evaluated, based on established competitive metabotropic Glu receptor subtype 5 (mGluR5) antagonists. In order to directly visualize mGluR5 binding of these agents on the surface of live astrocytes, variations in the core structure were made. A set of gadolinium conjugates containing either a cyanine dye or a fluorescein moiety was accordingly prepared, to allow visualization by optical microscopy in cellulo. In each case, surface receptor binding was compromised and cell internalization observed. Another approach, examining the location of a terbium analogue via sensitized emission, also exhibited nonspecific cell uptake in neuronal cell line models. Finally, biotin derivatives of two lead compounds were prepared, and the specificity of binding to the mGluR5 cell surface receptors was demonstrated with the aid of their fluorescently labeled avidin conjugates, using both total internal reflection fluorescence (TIRF) and confocal microscopy.

  19. Cargo binding promotes KDEL receptor clustering at the mammalian cell surface

    PubMed Central

    Becker, Björn; Shaebani, M. Reza; Rammo, Domenik; Bubel, Tobias; Santen, Ludger; Schmitt, Manfred J.

    2016-01-01

    Transmembrane receptor clustering is a ubiquitous phenomenon in pro- and eukaryotic cells to physically sense receptor/ligand interactions and subsequently translate an exogenous signal into a cellular response. Despite that receptor cluster formation has been described for a wide variety of receptors, ranging from chemotactic receptors in bacteria to growth factor and neurotransmitter receptors in mammalian cells, a mechanistic understanding of the underlying molecular processes is still puzzling. In an attempt to fill this gap we followed a combined experimental and theoretical approach by dissecting and modulating cargo binding, internalization and cellular response mediated by KDEL receptors (KDELRs) at the mammalian cell surface after interaction with a model cargo/ligand. Using a fluorescent variant of ricin toxin A chain as KDELR-ligand (eGFP-RTAH/KDEL), we demonstrate that cargo binding induces dose-dependent receptor cluster formation at and subsequent internalization from the membrane which is associated and counteracted by anterograde and microtubule-assisted receptor transport to preferred docking sites at the plasma membrane. By means of analytical arguments and extensive numerical simulations we show that cargo-synchronized receptor transport from and to the membrane is causative for KDELR/cargo cluster formation at the mammalian cell surface. PMID:27353000

  20. Cargo binding promotes KDEL receptor clustering at the mammalian cell surface

    NASA Astrophysics Data System (ADS)

    Becker, Björn; Shaebani, M. Reza; Rammo, Domenik; Bubel, Tobias; Santen, Ludger; Schmitt, Manfred J.

    2016-06-01

    Transmembrane receptor clustering is a ubiquitous phenomenon in pro- and eukaryotic cells to physically sense receptor/ligand interactions and subsequently translate an exogenous signal into a cellular response. Despite that receptor cluster formation has been described for a wide variety of receptors, ranging from chemotactic receptors in bacteria to growth factor and neurotransmitter receptors in mammalian cells, a mechanistic understanding of the underlying molecular processes is still puzzling. In an attempt to fill this gap we followed a combined experimental and theoretical approach by dissecting and modulating cargo binding, internalization and cellular response mediated by KDEL receptors (KDELRs) at the mammalian cell surface after interaction with a model cargo/ligand. Using a fluorescent variant of ricin toxin A chain as KDELR-ligand (eGFP-RTAH/KDEL), we demonstrate that cargo binding induces dose-dependent receptor cluster formation at and subsequent internalization from the membrane which is associated and counteracted by anterograde and microtubule-assisted receptor transport to preferred docking sites at the plasma membrane. By means of analytical arguments and extensive numerical simulations we show that cargo-synchronized receptor transport from and to the membrane is causative for KDELR/cargo cluster formation at the mammalian cell surface.

  1. Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

    PubMed

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

    2012-12-04

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

  2. Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

    PubMed Central

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

    2014-01-01

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

  3. Structure-activity relationships of seco-prezizaane and picrotoxane/picrodendrane terpenoids by Quasar receptor-surface modeling.

    PubMed

    Schmidt, Thomas J; Gurrath, Marion; Ozoe, Yoshihisa

    2004-08-01

    The seco-prezizaane-type sesquiterpenes pseudoanisatin and parviflorolide from Illicium are noncompetitive antagonists at housefly (Musca domestica) gamma-aminobutyric acid (GABA) receptors. They show selectivity toward the insect receptor and thus represent new leads toward selective insecticides. Based on the binding data for 13 seco-prezizaane terpenoids and 17 picrotoxane and picrodendrane-type terpenoids to housefly and rat GABA receptors, a QSAR study was conducted by quasi-atomistic receptor-surface modeling (Quasar). The resulting models provide insight into the structural basis of selectivity and properties of the binding sites at GABA receptor-coupled chloride channels of insects and mammals.

  4. A fractal analysis of protein to DNA binding kinetics using biosensors.

    PubMed

    Sadana, Ajit

    2003-08-01

    A fractal analysis of a confirmative nature only is presented for the binding of estrogen receptor (ER) in solution to its corresponding DNA (estrogen response element, ERE) immobilized on a sensor chip surface [J. Biol. Chem. 272 (1997) 11384], and for the cooperative binding of human 1,25-dihydroxyvitamin D(3) receptor (VDR) to DNA with the 9-cis-retinoic acid receptor (RXR) [Biochemistry 35 (1996) 3309]. Ligands were also used to modulate the first reaction. Data taken from the literature may be modeled by using a single- or a dual-fractal analysis. Relationships are presented for the binding rate coefficient as a function of either the analyte concentration in solution or the fractal dimension that exists on the biosensor surface. The binding rate expressions developed exhibit a wide range of dependence on the degree of heterogeneity that exists on the surface, ranging from sensitive (order of dependence equal to 1.202) to very sensitive (order of dependence equal to 12.239). In general, the binding rate coefficient increases as the degree of heterogeneity or the fractal dimension of the surface increases. The predictive relationships presented provide further physical insights into the reactions occurring on the biosensor surface. Even though these reactions are occurring on the biosensor surface, the relationships presented should assist in understanding and in possibly manipulating the reactions occurring on cellular surfaces.

  5. Concepts in receptor optimization: targeting the RGD peptide.

    PubMed

    Chen, Wei; Chang, Chia-en; Gilson, Michael K

    2006-04-12

    Synthetic receptors have a wide range of potential applications, but it has been difficult to design low molecular weight receptors that bind ligands with high, "proteinlike" affinities. This study uses novel computational methods to understand why it is hard to design a high-affinity receptor and to explore the limits of affinity, with the bioactive peptide RGD as a model ligand. The M2 modeling method is found to yield excellent agreement with experiment for a known RGD receptor and then is used to analyze a series of receptors generated in silico with a de novo design algorithm. Forces driving binding are found to be systematically opposed by proportionate repulsions due to desolvation and entropy. In particular, strong correlations are found between Coulombic attractions and the electrostatic desolvation penalty and between the mean energy change on binding and the cost in configurational entropy. These correlations help explain why it is hard to achieve high affinity. The change in surface area upon binding is found to correlate poorly with affinity within this series. Measures of receptor efficiency are formulated that summarize how effectively a receptor uses surface area, total energy, and Coulombic energy to achieve affinity. Analysis of the computed efficiencies suggests that a low molecular weight receptor can achieve proteinlike affinity. It is also found that macrocyclization of a receptor can, unexpectedly, increase the entropy cost of binding because the macrocyclic structure further restricts ligand motion.

  6. Inhibition Of Call-Cell Binding By Kipid Assemblies

    DOEpatents

    Nagy, Jon O. , Bargatze, Robert F.

    2003-12-16

    This invention relates generally to the field of therapeutic compounds designed to interfere between the binding of ligands and their receptors on cell surface. More specifically, it provides products and methods for inhibiting cell migration and activation using lipid assemblies with surface recognition elements that are specific for the receptors involved in cell migration and activation.

  7. Inhibition of cell-cell binding by lipid assemblies

    DOEpatents

    Nagy, Jon O.; Bargatze, Robert F.

    2001-05-22

    This invention relates generally to the field of therapeutic compounds designed to interfere between the binding of ligands and their receptors on cell surface. More specifically, it provides products and methods for inhibiting cell migration and activation using lipid assemblies with surface recognition elements that are specific for the receptors involved in cell migration and activation.

  8. Detection of angiotensin II binding to single adrenal zona glomerulosa cells by confocal Raman microspectroscopy

    NASA Astrophysics Data System (ADS)

    McCoy, Michael J.; Habermann, Timothy J.; Hanke, Craig J.; Adar, Fran; Campbell, William B.; Nithipatikom, Kasem

    1999-04-01

    We developed a confocal Raman microspectroscopic technique to study ligand-receptor bindings in single cells using Raman-labeled ligands and surface-enhanced Raman scattering (SERS). The adrenal zona glomerulosa (ZG) cells were used as a model in this study. ZG cells have a high density of angiotensin II (AII) receptors on the cellular membrane. There are two identified subtypes of AII receptors,namely AT1 and AT2 receptors. AII is a peptidic hormone, which upon binding to its receptors, stimulates the release of aldosterone from ZG cells. The cellular localization of these receptors subtypes was detected in single ZG cells by using immunocomplexation of receptors with specific antibodies and confocal Raman microspectroscopy. In the binding study, we used biotin-labeled AII to bind to its receptors in ZG cells. Then, avidin and Raman-labeled AII. The binding was measure directly on the single ZG cells. The results showed that the binding was displaced with unlabeled AII and specific AII antagonists. This is a rapid and sensitive technique for detection of cellular ligand bindings as well as antagonists screening in drug discovery.

  9. Interaction of tachykinins with phospholipid membranes: A neutron diffraction study

    NASA Astrophysics Data System (ADS)

    Darkes, Malcolm J. M.; Davies, Sarah M. A.; Bradshaw, Jeremy P.

    Tachykinins are a group of peptides which bind to G-protein-coupled receptors. Receptor affinity appears to depend on different secondary structures of tachykinin which share the same hydrophobic carboxy-terminal sequence, FXGLM. Receptor activation is thought to be due to the carboxy-terminal submerging into the bilayer and the amino-terminal binding on the surface. Binding of tachykinins to phospholipid bilayers may take place both on the aqueous membrane surface and in the hydrophobic region. The two-state equilibrium appears to depend on the surface charge of the membrane. Deuterating substance P and neurokinin A at their carboxy-terminals, our results show two populations of label for each peptide. One is very close to the water-hydrocarbon interface, the other some 13 Å deeper. We report that the bilayer location of the two tachykinins is remarkably similar, thereby inferring that receptor specifity must be controlled by finer levels of structure.

  10. Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.

    PubMed

    Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik

    2018-06-01

    Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.

  11. Structure of unliganded HSV gD reveals a mechanism for receptor-mediated activation of virus entry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krummenacher, Claude; Supekar, Vinit M.; Whitbeck, J. Charles

    2010-07-19

    Herpes simplex virus (HSV) entry into cells requires binding of the envelope glycoprotein D (gD) to one of several cell surface receptors. The 50 C-terminal residues of the gD ectodomain are essential for virus entry, but not for receptor binding. We have determined the structure of an unliganded gD molecule that includes these C-terminal residues. The structure reveals that the C-terminus is anchored near the N-terminal region and masks receptor-binding sites. Locking the C-terminus in the position observed in the crystals by an intramolecular disulfide bond abolished receptor binding and virus entry, demonstrating that this region of gD moves uponmore » receptor binding. Similarly, a point mutant that would destabilize the C-terminus structure was nonfunctional for entry, despite increased affinity for receptors. We propose that a controlled displacement of the gD C-terminus upon receptor binding is an essential feature of HSV entry, ensuring the timely activation of membrane fusion.« less

  12. GRB2 Interaction with the Ecotropic Murine Leukemia Virus Receptor, mCAT-1, Controls Virus Entry and Is Stimulated by Virus Binding

    PubMed Central

    Chen, Zeming; Kolokoltsov, Andrey A.; Wang, Jia; Adhikary, Shramika; Lorinczi, Marta; Elferink, Lisa A.

    2012-01-01

    For retroviruses such as HIV-1 and murine leukemia virus (MLV), active receptor recruitment and trafficking occur during viral entry. However, the underlying mechanisms and cellular factors involved in the process are largely uncharacterized. The viral receptor for ecotropic MLV (eMLV), a classical model for retrovirus infection mechanisms and pathogenesis, is mouse cationic amino acid transporter 1 (mCAT-1). Growth factor receptor-bound protein 2 (GRB2) is an adaptor protein that has been shown to couple cell surface receptors, such as epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor, to intracellular signaling events. Here we examined if GRB2 could also play a role in controlling infection by retroviruses by affecting receptor function. The GRB2 RNA interference (RNAi)-mediated suppression of endogenous GRB2 resulted in a consistent and significant reduction of virus binding and membrane fusion. The binding between eMLV and cells promoted increased GRB2–mCAT-1 interactions, as detected by immunoprecipitation. Consistently, the increased colocalization of GRB2 and mCAT-1 signals was detected by confocal microscopy. This association was time dependent and paralleled the kinetics of cell-virus membrane fusion. Interestingly, unlike the canonical binding pattern seen for GRB2 and growth factor receptors, GRB2–mCAT-1 binding does not depend on the GRB2-SH2 domain-mediated recognition of tyrosine phosphorylation on the receptor. The inhibition of endogenous GRB2 led to a reduction in surface levels of mCAT-1, which was detected by immunoprecipitation and by a direct binding assay using a recombinant MLV envelope protein receptor binding domain (RBD). Consistent with this observation, the expression of a dominant negative GRB2 mutant (R86K) resulted in the sequestration of mCAT-1 from the cell surface into intracellular vesicles. Taken together, these findings suggest a novel role for GRB2 in ecotropic MLV entry and infection by facilitating mCAT-1 trafficking. PMID:22090132

  13. GRB2 interaction with the ecotropic murine leukemia virus receptor, mCAT-1, controls virus entry and is stimulated by virus binding.

    PubMed

    Chen, Zeming; Kolokoltsov, Andrey A; Wang, Jia; Adhikary, Shramika; Lorinczi, Marta; Elferink, Lisa A; Davey, Robert A

    2012-02-01

    For retroviruses such as HIV-1 and murine leukemia virus (MLV), active receptor recruitment and trafficking occur during viral entry. However, the underlying mechanisms and cellular factors involved in the process are largely uncharacterized. The viral receptor for ecotropic MLV (eMLV), a classical model for retrovirus infection mechanisms and pathogenesis, is mouse cationic amino acid transporter 1 (mCAT-1). Growth factor receptor-bound protein 2 (GRB2) is an adaptor protein that has been shown to couple cell surface receptors, such as epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor, to intracellular signaling events. Here we examined if GRB2 could also play a role in controlling infection by retroviruses by affecting receptor function. The GRB2 RNA interference (RNAi)-mediated suppression of endogenous GRB2 resulted in a consistent and significant reduction of virus binding and membrane fusion. The binding between eMLV and cells promoted increased GRB2-mCAT-1 interactions, as detected by immunoprecipitation. Consistently, the increased colocalization of GRB2 and mCAT-1 signals was detected by confocal microscopy. This association was time dependent and paralleled the kinetics of cell-virus membrane fusion. Interestingly, unlike the canonical binding pattern seen for GRB2 and growth factor receptors, GRB2-mCAT-1 binding does not depend on the GRB2-SH2 domain-mediated recognition of tyrosine phosphorylation on the receptor. The inhibition of endogenous GRB2 led to a reduction in surface levels of mCAT-1, which was detected by immunoprecipitation and by a direct binding assay using a recombinant MLV envelope protein receptor binding domain (RBD). Consistent with this observation, the expression of a dominant negative GRB2 mutant (R86K) resulted in the sequestration of mCAT-1 from the cell surface into intracellular vesicles. Taken together, these findings suggest a novel role for GRB2 in ecotropic MLV entry and infection by facilitating mCAT-1 trafficking.

  14. A2A adenosine receptor ligand binding and signalling is allosterically modulated by adenosine deaminase.

    PubMed

    Gracia, Eduard; Pérez-Capote, Kamil; Moreno, Estefanía; Barkešová, Jana; Mallol, Josefa; Lluís, Carme; Franco, Rafael; Cortés, Antoni; Casadó, Vicent; Canela, Enric I

    2011-05-01

    A2ARs (adenosine A2A receptors) are highly enriched in the striatum, which is the main motor control CNS (central nervous system) area. BRET (bioluminescence resonance energy transfer) assays showed that A2AR homomers may act as cell-surface ADA (adenosine deaminase; EC 3.5.4.4)-binding proteins. ADA binding affected the quaternary structure of A2ARs present on the cell surface. ADA binding to adenosine A2ARs increased both agonist and antagonist affinity on ligand binding to striatal membranes where these proteins are co-expressed. ADA also increased receptor-mediated ERK1/2 (extracellular-signal-regulated kinase 1/2) phosphorylation. Collectively, the results of the present study show that ADA, apart from regulating the concentration of extracellular adenosine, may behave as an allosteric modulator that markedly enhances ligand affinity and receptor function. This powerful regulation may have implications for the physiology and pharmacology of neuronal A2ARs.

  15. Crystal Structure of the Botulinum Neurotoxin Type G Binding Domain: Insight into Cell Surface Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stenmark, Pål; Dong, Min; Dupuy, Jérôme

    2011-11-02

    Botulinum neurotoxins (BoNTs) typically bind the neuronal cell surface via dual interactions with both protein receptors and gangliosides. We present here the 1.9-{angstrom} X-ray structure of the BoNT serotype G (BoNT/G) receptor binding domain (residues 868-1297) and a detailed view of protein receptor and ganglioside binding regions. The ganglioside binding motif (SxWY) has a conserved structure compared to the corresponding regions in BoNT serotype A and BoNT serotype B (BoNT/B), but several features of interactions with the hydrophilic face of the ganglioside are absent at the opposite side of the motif in the BoNT/G ganglioside binding cleft. This may significantlymore » reduce the affinity between BoNT/G and gangliosides. BoNT/G and BoNT/B share the protein receptor synaptotagmin (Syt) I/II. The Syt binding site has a conserved hydrophobic plateau located centrally in the proposed protein receptor binding interface (Tyr1189, Phe1202, Ala1204, Pro1205, and Phe1212). Interestingly, only 5 of 14 residues that are important for binding between Syt-II and BoNT/B are conserved in BoNT/G, suggesting that the means by which BoNT/G and BoNT/B bind Syt diverges more than previously appreciated. Indeed, substitution of Syt-II Phe47 and Phe55 with alanine residues had little effect on the binding of BoNT/G, but strongly reduced the binding of BoNT/B. Furthermore, an extended solvent-exposed hydrophobic loop, located between the Syt binding site and the ganglioside binding cleft, may serve as a third membrane association and binding element to contribute to high-affinity binding to the neuronal membrane. While BoNT/G and BoNT/B are homologous to each other and both utilize Syt-I/Syt-II as their protein receptor, the precise means by which these two toxin serotypes bind to Syt appears surprisingly divergent.« less

  16. Crystal structure of the botulinum neurotoxin type G binding domain: insight into cell surface binding.

    PubMed

    Stenmark, Pål; Dong, Min; Dupuy, Jérôme; Chapman, Edwin R; Stevens, Raymond C

    2010-04-16

    Botulinum neurotoxins (BoNTs) typically bind the neuronal cell surface via dual interactions with both protein receptors and gangliosides. We present here the 1.9-A X-ray structure of the BoNT serotype G (BoNT/G) receptor binding domain (residues 868-1297) and a detailed view of protein receptor and ganglioside binding regions. The ganglioside binding motif (SxWY) has a conserved structure compared to the corresponding regions in BoNT serotype A and BoNT serotype B (BoNT/B), but several features of interactions with the hydrophilic face of the ganglioside are absent at the opposite side of the motif in the BoNT/G ganglioside binding cleft. This may significantly reduce the affinity between BoNT/G and gangliosides. BoNT/G and BoNT/B share the protein receptor synaptotagmin (Syt) I/II. The Syt binding site has a conserved hydrophobic plateau located centrally in the proposed protein receptor binding interface (Tyr1189, Phe1202, Ala1204, Pro1205, and Phe1212). Interestingly, only 5 of 14 residues that are important for binding between Syt-II and BoNT/B are conserved in BoNT/G, suggesting that the means by which BoNT/G and BoNT/B bind Syt diverges more than previously appreciated. Indeed, substitution of Syt-II Phe47 and Phe55 with alanine residues had little effect on the binding of BoNT/G, but strongly reduced the binding of BoNT/B. Furthermore, an extended solvent-exposed hydrophobic loop, located between the Syt binding site and the ganglioside binding cleft, may serve as a third membrane association and binding element to contribute to high-affinity binding to the neuronal membrane. While BoNT/G and BoNT/B are homologous to each other and both utilize Syt-I/Syt-II as their protein receptor, the precise means by which these two toxin serotypes bind to Syt appears surprisingly divergent. Copyright (c) 2010. Published by Elsevier Ltd.

  17. Fucosylation and protein glycosylation create functional receptors for cholera toxin

    PubMed Central

    Wands, Amberlyn M; Fujita, Akiko; McCombs, Janet E; Cervin, Jakob; Dedic, Benjamin; Rodriguez, Andrea C; Nischan, Nicole; Bond, Michelle R; Mettlen, Marcel; Trudgian, David C; Lemoff, Andrew; Quiding-Järbrink, Marianne; Gustavsson, Bengt; Steentoft, Catharina; Clausen, Henrik; Mirzaei, Hamid; Teneberg, Susann; Yrlid, Ulf; Kohler, Jennifer J

    2015-01-01

    Cholera toxin (CT) enters and intoxicates host cells after binding cell surface receptors using its B subunit (CTB). The ganglioside (glycolipid) GM1 is thought to be the sole CT receptor; however, the mechanism by which CTB binding to GM1 mediates internalization of CT remains enigmatic. Here we report that CTB binds cell surface glycoproteins. Relative contributions of gangliosides and glycoproteins to CTB binding depend on cell type, and CTB binds primarily to glycoproteins in colonic epithelial cell lines. Using a metabolically incorporated photocrosslinking sugar, we identified one CTB-binding glycoprotein and demonstrated that the glycan portion of the molecule, not the protein, provides the CTB interaction motif. We further show that fucosylated structures promote CTB entry into a colonic epithelial cell line and subsequent host cell intoxication. CTB-binding fucosylated glycoproteins are present in normal human intestinal epithelia and could play a role in cholera. DOI: http://dx.doi.org/10.7554/eLife.09545.001 PMID:26512888

  18. Fractal binding and dissociation kinetics of lecithin cholesterol acyl transferase (LCAT), a heart-related compound, on biosensor surfaces

    NASA Astrophysics Data System (ADS)

    Doke, Atul M.; Sadana, Ajit

    2006-05-01

    A fractal analysis is presented for the binding and dissociation of different heart-related compounds in solution to receptors immobilized on biosensor surfaces. The data analyzed include LCAT (lecithin cholesterol acyl transferase) concentrations in solution to egg-white apoA-I rHDL immobilized on a biosensor chip surface.1 Single- and dual- fractal models were employed to fit the data. Values of the binding and the dissociation rate coefficient(s), affinity values, and the fractal dimensions were obtained from the regression analysis provided by Corel Quattro Pro 8.0 (Corel Corporation Limited).2 The binding rate coefficients are quite sensitive to the degree of heterogeneity on the sensor chip surface. Predictive equations are developed for the binding rate coefficient as a function of the degree of heterogeneity present on the sensor chip surface and on the LCAT concentration in solution, and for the affinity as a function of the ratio of fractal dimensions present in the binding and the dissociation phases. The analysis presented provided physical insights into these analyte-receptor reactions occurring on different biosensor surfaces.

  19. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  20. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  1. Different mechanisms are involved in the antibody mediated inhibition of ligand binding to the urokinase receptor: a study based on biosensor technology.

    PubMed

    List, K; Høyer-Hansen, G; Rønne, E; Danø, K; Behrendt, N

    1999-01-01

    Certain monoclonal antibodies are capable of inhibiting the biological binding reactions of their target proteins. At the molecular level, this type of effect may be brought about by completely different mechanisms, such as competition for common binding determinants, steric hindrance or interference with conformational properties of the receptor critical for ligand binding. This distinction is central when employing the antibodies as tools in the elucidation of the structure-function relationship of the protein in question. We have studied the effect of monoclonal antibodies against the urokinase plasminogen activator receptor (uPAR), a protein located on the surface of various types of malignant and normal cells which is involved in the direction of proteolytic degradation reactions in the extracellular matrix. We show that surface plasmon resonance/biomolecular interaction analysis (BIA) can be employed as a highly useful tool to characterize the inhibitory mechanism of specific antagonist antibodies. Two inhibitory antibodies against uPAR, mAb R3 and mAb R5, were shown to exhibit competitive and non-competitive inhibition, respectively, of ligand binding to the receptor. The former antibody efficiently blocked the receptor against subsequent ligand binding but was unable to promote the dissociation of a preformed receptor-ligand complex. The latter antibody was capable of binding the preformed complex, forming a transient trimolecular assembly, and promoting the dissociation of the uPA/uPAR complex. The continuous recording of binding and dissociation, obtained in BIA, is central in characterizing these phenomena. The identification of a non-competitive inhibitory mechanism against this receptor reveals the presence of a determinant which influences the binding properties of a remote site in the molecular structure and which could be an important target for a putative synthetic antagonist.

  2. Binding specificity of Bacillus thuringiensis Cry1Aa for purified, native Bombyx mori aminopeptidase N and cadherin-like receptors

    PubMed Central

    Jenkins, Jeremy L; Dean, Donald H

    2001-01-01

    Background To better understand the molecular interactions of Bt toxins with non-target insects, we have examined the real-time binding specificity and affinity of Cry1 toxins to native silkworm (Bombyx mori) midgut receptors. Previous studies on B. mori receptors utilized brush border membrane vesicles or purifed receptors in blot-type assays. Results The Bombyx mori (silkworm) aminopeptidase N (APN) and cadherin-like receptors for Bacillus thuringiensis insecticidal Cry1Aa toxin were purified and their real-time binding affinities for Cry toxins were examined by surface plasmon resonance. Cry1Ab and Cry1Ac toxins did not bind to the immobilized native receptors, correlating with their low toxicities. Cry1Aa displayed moderate affinity for B. mori APN (75 nM), and unusually tight binding to the cadherin-like receptor (2.6 nM), which results from slow dissociation rates. The binding of a hybrid toxin (Aa/Aa/Ac) was identical to Cry1Aa. Conclusions These results indicate domain II of Cry1Aa is essential for binding to native B. mori receptors and for toxicity. Moreover, the high-affinity binding of Cry1Aa to native cadherin-like receptor emphasizes the importance of this receptor class for Bt toxin research. PMID:11722800

  3. Characterization of the ligand-binding site of the transferrin receptor in Trypanosoma brucei demonstrates a structural relationship with the N-terminal domain of the variant surface glycoprotein.

    PubMed

    Salmon, D; Hanocq-Quertier, J; Paturiaux-Hanocq, F; Pays, A; Tebabi, P; Nolan, D P; Michel, A; Pays, E

    1997-12-15

    The Trypanosoma brucei transferrin (Tf) receptor is a heterodimer encoded by ESAG7 and ESAG6, two genes contained in the different polycistronic transcription units of the variant surface glycoprotein (VSG) gene. The sequence of ESAG7/6 differs slightly between different units, so that receptors with different affinities for Tf are expressed alternatively following transcriptional switching of VSG expression sites during antigenic variation of the parasite. Based on the sequence homology between pESAG7/6 and the N-terminal domain of VSGs, it can be predicted that the four blocks containing the major sequence differences between pESAG7 and pESAG6 form surface-exposed loops and generate the ligand-binding site. The exchange of a few amino acids in this region between pESAG6s encoded by different VSG units greatly increased the affinity for bovine Tf. Similar changes in other regions were ineffective, while mutations predicted to alter the VSG-like structure abolished the binding. Chimeric proteins containing the N-terminal dimerization domain of VSG and the C-terminal half of either pESAG7 or pESAG6, which contains the ligand-binding domain, can form heterodimers that bind Tf. Taken together, these data provided evidence that the T.brucei Tf receptor is structurally related to the N-terminal domain of the VSG and that the ligand-binding site corresponds to the exposed surface loops of the protein.

  4. Poliovirus Mutants Resistant to Neutralization with Soluble Cell Receptors

    NASA Astrophysics Data System (ADS)

    Kaplan, Gerardo; Peters, David; Racaniello, Vincent R.

    1990-12-01

    Poliovirus mutants resistant to neutralization with soluble cellular receptor were isolated. Replication of soluble receptor-resistant (srr) mutants was blocked by a monoclonal antibody directed against the HeLa cell receptor for poliovirus, indicating that the mutants use this receptor to enter cells. The srr mutants showed reduced binding to HeLa cells and cell membranes. However, the reduced binding phenotype did not have a major impact on viral replication, as judged by plaque size and one-step growth curves. These results suggest that the use of soluble receptors as antiviral agents could lead to the selection of neutralization-resistant mutants that are able to bind cell surface receptors, replicate, and cause disease.

  5. Absolute binding free energies between T4 lysozyme and 141 small molecules: calculations based on multiple rigid receptor configurations

    PubMed Central

    Xie, Bing; Nguyen, Trung Hai; Minh, David D. L.

    2017-01-01

    We demonstrate the feasibility of estimating protein-ligand binding free energies using multiple rigid receptor configurations. Based on T4 lysozyme snapshots extracted from six alchemical binding free energy calculations with a flexible receptor, binding free energies were estimated for a total of 141 ligands. For 24 ligands, the calculations reproduced flexible-receptor estimates with a correlation coefficient of 0.90 and a root mean square error of 1.59 kcal/mol. The accuracy of calculations based on Poisson-Boltzmann/Surface Area implicit solvent was comparable to previously reported free energy calculations. PMID:28430432

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yue; Sheng, Ju; Baggen, Jim

    Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon’ on the virus surface. The sialic acid receptor induces a cascade of conformational changes inmore » the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Furthermore, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry.« less

  7. The Macrophage Galactose-Type Lectin Can Function as an Attachment and Entry Receptor for Influenza Virus

    PubMed Central

    Ng, Wy Ching; Liong, Stella; Tate, Michelle D.; Irimura, Tatsuro; Denda-Nagai, Kaori; Brooks, Andrew G.; Londrigan, Sarah L.

    2014-01-01

    Specific protein receptors that mediate internalization and entry of influenza A virus (IAV) have not been identified for any cell type. Sialic acid (SIA), the primary attachment factor for IAV hemagglutinin, is expressed by numerous cell surface glycoproteins and glycolipids, confounding efforts to identify specific receptors involved in virus infection. Lec1 Chinese hamster ovary (CHO) epithelial cells express cell surface SIA and bind IAV yet are largely resistant to infection. Here, we demonstrate that expression of the murine macrophage galactose-type lectin 1 (MGL1) by Lec1 cells enhanced Ca2+-dependent IAV binding and restored permissivity to infection. Lec1 cells expressing MGL1 were infected in the presence or absence of cell surface SIA, indicating that MGL1 can act as a primary receptor or as a coreceptor with SIA. Lec1 cells expressing endocytosis-deficient MGL1 mediated Ca2+-dependent IAV binding but were less sensitive to IAV infection, indicating that direct internalization via MGL1 can result in cellular infection. Together, these studies identify MGL1 as a cell surface glycoprotein that can act as an authentic receptor for both attachment and infectious entry of IAV. PMID:24257596

  8. Insulin Mimetic Peptide Disrupts the Primary Binding Site of the Insulin Receptor*

    PubMed Central

    Lawrence, Callum F.; Margetts, Mai B.; Menting, John G.; Smith, Nicholas A.; Smith, Brian J.; Ward, Colin W.; Lawrence, Michael C.

    2016-01-01

    Sets of synthetic peptides that interact with the insulin receptor ectodomain have been discovered by phage display and reported in the literature. These peptides were grouped into three classes termed Site 1, Site 2, and Site 3 based on their mutual competition of binding to the receptor. Further refinement has yielded, in particular, a 36-residue Site 2-Site 1 fusion peptide, S519, that binds the insulin receptor with subnanomolar affinity and exhibits agonist activity in both lipogenesis and glucose uptake assays. Here, we report three-dimensional crystallographic detail of the interaction of the C-terminal, 16-residue Site 1 component (S519C16) of S519 with the first leucine-rich repeat domain (L1) of the insulin receptor. Our structure shows that S519C16 binds to the same site on the L1 surface as that occupied by a critical component of the primary binding site, namely the helical C-terminal segment of the insulin receptor α-chain (termed αCT). In particular, the two phenylalanine residues within the FYXWF motif of S519C16 are seen to engage the insulin receptor L1 domain surface in a fashion almost identical to the respective αCT residues Phe701 and Phe705. The structure provides a platform for the further development of peptidic and/or small molecule agents directed toward the insulin receptor and/or the type 1 insulin-like growth factor receptor. PMID:27281820

  9. Surveying GPCR solubilisation conditions using surface plasmon resonance.

    PubMed

    Navratilova, Iva Hopkins; Aristotelous, Tonia; Bird, Louise E; Hopkins, Andrew L

    2018-06-15

    Biophysical screening techniques, such as surface plasmon resonance, enable detailed kinetic analysis of ligands binding to solubilised G-protein coupled receptors. The activity of a receptor solubilised out of the membrane is crucially dependent on the environment in which it is suspended. Finding the right conditions is challenging due to the number of variables to investigate in order to determine the optimum solubilisation buffer for any given receptor. In this study we used surface plasmon resonance technology to screen a variety of solubilisation conditions including buffers and detergents for two model receptors: CXCR4 and CCR5. We tested 950 different combinations of solubilisation conditions for both receptors. The activity of both receptors was monitored by using conformation dependent monoclonal antibodies and the binding of small molecule ligands. Despite both receptors belonging to the chemokine receptor family they show some differences in their preference for solubilisation conditions that provide the highest level of binding for both the conformation dependent antibodies and small molecules. The study described here is focused not only on finding the best solubilisation conditions for each receptor, but also on factors that determine the sensitivity of the assay for each receptor. We also suggest how these data about different buffers and detergents can be used as a guide for selecting solubilisation conditions for other membrane proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

    PubMed

    Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

    2007-02-27

    Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

  11. B cell recognition of the conserved HIV-1 co-receptor binding site is altered by endogenous primate CD4.

    PubMed

    Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T

    2008-10-03

    The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.

  12. Prediction of consensus binding mode geometries for related chemical series of positive allosteric modulators of adenosine and muscarinic acetylcholine receptors.

    PubMed

    Sakkal, Leon A; Rajkowski, Kyle Z; Armen, Roger S

    2017-06-05

    Following insights from recent crystal structures of the muscarinic acetylcholine receptor, binding modes of Positive Allosteric Modulators (PAMs) were predicted under the assumption that PAMs should bind to the extracellular surface of the active state. A series of well-characterized PAMs for adenosine (A 1 R, A 2A R, A 3 R) and muscarinic acetylcholine (M 1 R, M 5 R) receptors were modeled using both rigid and flexible receptor CHARMM-based molecular docking. Studies of adenosine receptors investigated the molecular basis of the probe-dependence of PAM activity by modeling in complex with specific agonist radioligands. Consensus binding modes map common pharmacophore features of several chemical series to specific binding interactions. These models provide a rationalization of how PAM binding slows agonist radioligand dissociation kinetics. M 1 R PAMs were predicted to bind in the analogous M 2 R PAM LY2119620 binding site. The M 5 R NAM (ML-375) was predicted to bind in the PAM (ML-380) binding site with a unique induced-fit receptor conformation. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Crystal structure of botulinum neurotoxin type A in complex with the cell surface co-receptor GT1b-insight into the toxin-neuron interaction.

    PubMed

    Stenmark, Pål; Dupuy, Jérôme; Imamura, Akihiro; Kiso, Makoto; Stevens, Raymond C

    2008-08-15

    Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in the toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.

  14. Activation of m1 muscarinic acetylcholine receptor induces surface transport of KCNQ channels through a CRMP-2-mediated pathway.

    PubMed

    Jiang, Ling; Kosenko, Anastasia; Yu, Clinton; Huang, Lan; Li, Xuejun; Hoshi, Naoto

    2015-11-15

    Neuronal excitability is strictly regulated by various mechanisms, including modulation of ion channel activity and trafficking. Stimulation of m1 muscarinic acetylcholine receptor (also known as CHRM1) increases neuronal excitability by suppressing the M-current generated by the Kv7/KCNQ channel family. We found that m1 muscarinic acetylcholine receptor stimulation also triggers surface transport of KCNQ subunits. This receptor-induced surface transport was observed with KCNQ2 as well as KCNQ3 homomeric channels, but not with Kv3.1 channels. Deletion analyses identified that a conserved domain in a proximal region of the N-terminal tail of KCNQ protein is crucial for this surface transport--the translocation domain. Proteins that bind to this domain were identified as α- and β-tubulin and collapsin response mediator protein 2 (CRMP-2; also known as DPYSL2). An inhibitor of casein kinase 2 (CK2) reduced tubulin binding to the translocation domain, whereas an inhibitor of glycogen synthase kinase 3 (GSK3) facilitated CRMP-2 binding to the translocation domain. Consistently, treatment with the GSK3 inhibitor enhanced receptor-induced KCNQ2 surface transport. M-current recordings from neurons showed that treatment with a GSK3 inhibitor shortened the duration of muscarinic suppression and led to over-recovery of the M-current. These results suggest that m1 muscarinic acetylcholine receptor stimulates surface transport of KCNQ channels through a CRMP-2-mediated pathway. © 2015. Published by The Company of Biologists Ltd.

  15. Factor VIII Interacts with the Endocytic Receptor Low-density Lipoprotein Receptor-related Protein 1 via an Extended Surface Comprising "Hot-Spot" Lysine Residues.

    PubMed

    van den Biggelaar, Maartje; Madsen, Jesper J; Faber, Johan H; Zuurveld, Marleen G; van der Zwaan, Carmen; Olsen, Ole H; Stennicke, Henning R; Mertens, Koen; Meijer, Alexander B

    2015-07-03

    Lysine residues are implicated in driving the ligand binding to the LDL receptor family. However, it has remained unclear how specificity is regulated. Using coagulation factor VIII as a model ligand, we now study the contribution of individual lysine residues in the interaction with the largest member of the LDL receptor family, low-density lipoprotein receptor-related protein (LRP1). Using hydrogen-deuterium exchange mass spectrometry (HDX-MS) and SPR interaction analysis on a library of lysine replacement variants as two independent approaches, we demonstrate that the interaction between factor VIII (FVIII) and LRP1 occurs over an extended surface containing multiple lysine residues. None of the individual lysine residues account completely for LRP1 binding, suggesting an additive binding model. Together with structural docking studies, our data suggest that FVIII interacts with LRP1 via an extended surface of multiple lysine residues that starts at the bottom of the C1 domain and winds around the FVIII molecule. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. The role of receptor binding specificity in interspecies transmission of influenza viruses

    PubMed Central

    Imai, Masaki; Kawaoka, Yoshihiro

    2017-01-01

    Influenza A virus infection begins with the binding of the hemagglutinin (HA) glycoprotein to sialic acid-containing receptors on the surface of the target cell. Avian influenza viruses, including avian H5N1, H7, and H9N2 viruses, can occasionally cross the species barrier and infect humans; however, these viruses do not spread efficiently from person to person, perhaps, in part, due to differences in the receptor-binding specificities of human and avian influenza viruses. The HAs of avian influenza viruses must adapt to receptors in humans to acquire efficient human-to-human transmissibility. In this review, we discuss the receptor binding specificity of influenza A viruses and its role in interspecies transmission. PMID:22445963

  17. Cryo-electron microscopy structures of the SARS-CoV spike glycoprotein reveal a prerequisite conformational state for receptor binding.

    PubMed

    Gui, Miao; Song, Wenfei; Zhou, Haixia; Xu, Jingwei; Chen, Silian; Xiang, Ye; Wang, Xinquan

    2017-01-01

    The global outbreak of SARS in 2002-2003 was caused by the infection of a new human coronavirus SARS-CoV. The infection of SARS-CoV is mediated mainly through the viral surface glycoproteins, which consist of S1 and S2 subunits and form trimer spikes on the envelope of the virions. Here we report the ectodomain structures of the SARS-CoV surface spike trimer in different conformational states determined by single-particle cryo-electron microscopy. The conformation 1 determined at 4.3 Å resolution is three-fold symmetric and has all the three receptor-binding C-terminal domain 1 (CTD1s) of the S1 subunits in "down" positions. The binding of the "down" CTD1s to the SARS-CoV receptor ACE2 is not possible due to steric clashes, suggesting that the conformation 1 represents a receptor-binding inactive state. Conformations 2-4 determined at 7.3, 5.7 and 6.8 Å resolutions are all asymmetric, in which one RBD rotates away from the "down" position by different angles to an "up" position. The "up" CTD1 exposes the receptor-binding site for ACE2 engagement, suggesting that the conformations 2-4 represent a receptor-binding active state. This conformational change is also required for the binding of SARS-CoV neutralizing antibodies targeting the CTD1. This phenomenon could be extended to other betacoronaviruses utilizing CTD1 of the S1 subunit for receptor binding, which provides new insights into the intermediate states of coronavirus pre-fusion spike trimer during infection.

  18. Gonadotropin-Releasing Hormone (GnRH) Receptor Structure and GnRH Binding

    PubMed Central

    Flanagan, Colleen A.; Manilall, Ashmeetha

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) regulates reproduction. The human GnRH receptor lacks a cytoplasmic carboxy-terminal tail but has amino acid sequence motifs characteristic of rhodopsin-like, class A, G protein-coupled receptors (GPCRs). This review will consider how recent descriptions of X-ray crystallographic structures of GPCRs in inactive and active conformations may contribute to understanding GnRH receptor structure, mechanism of activation and ligand binding. The structures confirmed that ligands bind to variable extracellular surfaces, whereas the seven membrane-spanning α-helices convey the activation signal to the cytoplasmic receptor surface, which binds and activates heterotrimeric G proteins. Forty non-covalent interactions that bridge topologically equivalent residues in different transmembrane (TM) helices are conserved in class A GPCR structures, regardless of activation state. Conformation-independent interhelical contacts account for a conserved receptor protein structure and their importance in the GnRH receptor structure is supported by decreased expression of receptors with mutations of residues in the network. Many of the GnRH receptor mutations associated with congenital hypogonadotropic hypogonadism, including the Glu2.53(90) Lys mutation, involve amino acids that constitute the conserved network. Half of the ~250 intramolecular interactions in GPCRs differ between inactive and active structures. Conformation-specific interhelical contacts depend on amino acids changing partners during activation. Conserved inactive conformation-specific contacts prevent receptor activation by stabilizing proximity of TM helices 3 and 6 and a closed G protein-binding site. Mutations of GnRH receptor residues involved in these interactions, such as Arg3.50(139) of the DRY/S motif or Tyr7.53(323) of the N/DPxxY motif, increase or decrease receptor expression and efficiency of receptor coupling to G protein signaling, consistent with the native residues stabilizing the inactive GnRH receptor structure. Active conformation-specific interhelical contacts stabilize an open G protein-binding site. Progress in defining the GnRH-binding site has recently slowed, with evidence that Tyr6.58(290) contacts Tyr5 of GnRH, whereas other residues affect recognition of Trp3 and Gly10NH2. The surprisingly consistent observations that GnRH receptor mutations that disrupt GnRH binding have less effect on “conformationally constrained” GnRH peptides may now be explained by crystal structures of agonist-bound peptide receptors. Analysis of GPCR structures provides insight into GnRH receptor function. PMID:29123501

  19. Modeling Multivalent Ligand-Receptor Interactions with Steric Constraints on Configurations of Cell-Surface Receptor Aggregates

    PubMed Central

    Monine, Michael I.; Posner, Richard G.; Savage, Paul B.; Faeder, James R.; Hlavacek, William S.

    2010-01-01

    Abstract We use flow cytometry to characterize equilibrium binding of a fluorophore-labeled trivalent model antigen to bivalent IgE-FcεRI complexes on RBL cells. We find that flow cytometric measurements are consistent with an equilibrium model for ligand-receptor binding in which binding sites are assumed to be equivalent and ligand-induced receptor aggregates are assumed to be acyclic. However, this model predicts extensive receptor aggregation at antigen concentrations that yield strong cellular secretory responses, which is inconsistent with the expectation that large receptor aggregates should inhibit such responses. To investigate possible explanations for this discrepancy, we evaluate four rule-based models for interaction of a trivalent ligand with a bivalent cell-surface receptor that relax simplifying assumptions of the equilibrium model. These models are simulated using a rule-based kinetic Monte Carlo approach to investigate the kinetics of ligand-induced receptor aggregation and to study how the kinetics and equilibria of ligand-receptor interaction are affected by steric constraints on receptor aggregate configurations and by the formation of cyclic receptor aggregates. The results suggest that formation of linear chains of cyclic receptor dimers may be important for generating secretory signals. Steric effects that limit receptor aggregation and transient formation of small receptor aggregates may also be important. PMID:20085718

  20. Molecular characterization of the receptor binding structure-activity relationships of influenza B virus hemagglutinin.

    PubMed

    Carbone, V; Kim, H; Huang, J X; Baker, M A; Ong, C; Cooper, M A; Li, J; Rockman, S; Velkov, T

    2013-01-01

    Selectivity of α2,6-linked human-like receptors by B hemagglutinin (HA) is yet to be fully understood. This study integrates binding data with structure-recognition models to examine the impact of regional-specific sequence variations within the receptor-binding pocket on selectivity and structure activity relationships (SAR). The receptor-binding selectivity of influenza B HAs corresponding to either B/Victoria/2/1987 or the B/Yamagata/16/88 lineages was examined using surface plasmon resonance, solid-phase ELISA and gel-capture assays. Our SAR data showed that the presence of asialyl sugar units is the main determinant of receptor preference of α2,6 versus α2,3 receptor binding. Changes to the type of sialyl-glycan linkage present on receptors exhibit only a minor effect upon binding affinity. Homology-based structural models revealed that structural properties within the HA pocket, such as a glyco-conjugate at Asn194 on the 190-helix, sterically interfere with binding to avian receptor analogs by blocking the exit path of the asialyl sugars. Similarly, naturally occurring substitutions in the C-terminal region of the 190-helix and near the N-terminal end of the 140-loop narrows the horizontal borders of the binding pocket, which restricts access of the avian receptor analog LSTa. This study helps bridge the gap between ligand structure and receptor recognition for influenza B HA; and provides a consensus SAR model for the binding of human and avian receptor analogs to influenza B HA.

  1. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform

    PubMed Central

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-01-01

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329

  2. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform.

    PubMed

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-07-16

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.

  3. Distinct Conformations of Ly49 Natural Killer Cell Receptors Mediate MHC Class I Recognition in Trans and Cis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Back, J.; Malchiodi, E; Cho, S

    2009-01-01

    Certain cell-surface receptors engage ligands expressed on juxtaposed cells and ligands on the same cell. The structural basis for trans versus cis binding is not known. Here, we showed that Ly49 natural killer (NK) cell receptors bound two MHC class I (MHC-I) molecules in trans when the two ligand-binding domains were backfolded onto the long stalk region. In contrast, dissociation of the ligand-binding domains from the stalk and their reorientation relative to the NK cell membrane allowed monovalent binding of MHC-I in cis. The distinct conformations (backfolded and extended) define the structural basis for cis-trans binding by Ly49 receptors andmore » explain the divergent functional consequences of cis versus trans interactions. Further analyses identified specific stalk segments that were not required for MHC-I binding in trans but were essential for inhibitory receptor function. These data identify multiple distinct roles of stalk regions for receptor function.« less

  4. Collagenase-3 binds to a specific receptor and requires the low density lipoprotein receptor-related protein for internalization

    NASA Technical Reports Server (NTRS)

    Barmina, O. Y.; Walling, H. W.; Fiacco, G. J.; Freije, J. M.; Lopez-Otin, C.; Jeffrey, J. J.; Partridge, N. C.

    1999-01-01

    We have previously identified a specific receptor for collagenase-3 that mediates the binding, internalization, and degradation of this ligand in UMR 106-01 rat osteoblastic osteosarcoma cells. In the present study, we show that collagenase-3 binding is calcium-dependent and occurs in a variety of cell types, including osteoblastic and fibroblastic cells. We also present evidence supporting a two-step mechanism of collagenase-3 binding and internalization involving both a specific collagenase-3 receptor and the low density lipoprotein receptor-related protein. Ligand blot analysis shows that (125)I-collagenase-3 binds specifically to two proteins ( approximately 170 kDa and approximately 600 kDa) present in UMR 106-01 cells. Western blotting identified the 600-kDa protein as the low density lipoprotein receptor-related protein. Our data suggest that the 170-kDa protein is a specific collagenase-3 receptor. Low density lipoprotein receptor-related protein-null mouse embryo fibroblasts bind but fail to internalize collagenase-3, whereas UMR 106-01 and wild-type mouse embryo fibroblasts bind and internalize collagenase-3. Internalization, but not binding, is inhibited by the 39-kDa receptor-associated protein. We conclude that the internalization of collagenase-3 requires the participation of the low density lipoprotein receptor-related protein and propose a model in which the cell surface interaction of this ligand requires a sequential contribution from two receptors, with the collagenase-3 receptor acting as a high affinity primary binding site and the low density lipoprotein receptor-related protein mediating internalization.

  5. Cell-specific targeting by heterobivalent ligands.

    PubMed

    Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J

    2011-07-20

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.

  6. Cell-Specific Targeting by Heterobivalent Ligands

    PubMed Central

    Josan, Jatinder S.; Handl, Heather L.; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M.; Vagner, Josef; Mash, Eugene A.; Hruby, Victor J.; Gillies, Robert J.

    2012-01-01

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach—to specifically target combinations of cell-surface receptors using heteromultivalent ligands (“receptor combination approach”). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle4, DPhe7]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20–50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH2. Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging. PMID:21639139

  7. Modelling the interdependence between the stoichiometry of receptor oligomerization and ligand binding for a coexisting dimer/tetramer receptor system.

    PubMed

    Rovira, X; Vivó, M; Serra, J; Roche, D; Strange, P G; Giraldo, J

    2009-01-01

    Many G protein-coupled receptors have been shown to exist as oligomers, but the oligomerization state and the effects of this on receptor function are unclear. For some G protein-coupled receptors, in ligand binding assays, different radioligands provide different maximal binding capacities. Here we have developed mathematical models for co-expressed dimeric and tetrameric species of receptors. We have considered models where the dimers and tetramers are in equilibrium and where they do not interconvert and we have also considered the potential influence of the ligands on the degree of oligomerization. By analogy with agonist efficacy, we have considered ligands that promote, inhibit or have no effect on oligomerization. Cell surface receptor expression and the intrinsic capacity of receptors to oligomerize are quantitative parameters of the equations. The models can account for differences in the maximal binding capacities of radioligands in different preparations of receptors and provide a conceptual framework for simulation and data fitting in complex oligomeric receptor situations.

  8. Erythroblast transferrin receptors and transferrin kinetics in iron deficiency and various anemias

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muta, K.; Nishimura, J.; Ideguchi, H.

    1987-06-01

    To clarify the role of transferrin receptors in cases of altered iron metabolism in clinical pathological conditions, we studied: number of binding sites; affinity; and recycling kinetics of transferrin receptors on human erythroblasts. Since transferrin receptors are mainly present on erythroblasts, the number of surface transferrin receptors was determined by assay of binding of /sup 125/I-transferrin and the percentage of erythroblasts in bone marrow mononuclear cells. The number of binding sites on erythroblasts from patients with an iron deficiency anemia was significantly greater than in normal subjects. Among those with an aplastic anemia, hemolytic anemia, myelodysplastic syndrome, and polycythemia veramore » compared to normal subjects, there were no considerable differences in the numbers of binding sites. The dissociation constants (Kd) were measured using Scatchard analysis. The apparent Kd was unchanged (about 10 nmol/L) in patients and normal subjects. The kinetics of endocytosis and exocytosis of /sup 125/I-transferrin, examined by acid treatment, revealed no variations in recycling kinetics among the patients and normal subjects. These data suggest that iron uptake is regulated by modulation of the number of surface transferrin receptors, thereby reflecting the iron demand of the erythroblast.« less

  9. The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, H.; Grubb, J.H.; Sly, W.S.

    1990-10-01

    The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human {beta}-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3{percent} of the total functionalmore » receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of {beta}-glucuronidase. At pH 7.5, the rate of endocytosis was only 14{percent} the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized {beta}-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized {beta}-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor.« less

  10. F104S c-Mpl responds to a transmembrane domain-binding thrombopoietin receptor agonist: proof of concept that selected receptor mutations in congenital amegakaryocytic thrombocytopenia can be stimulated with alternative thrombopoietic agents.

    PubMed

    Fox, Norma E; Lim, Jihyang; Chen, Rose; Geddis, Amy E

    2010-05-01

    To determine whether specific c-Mpl mutations might respond to thrombopoietin receptor agonists. We created cell line models of type II c-Mpl mutations identified in congenital amegakaryocytic thrombocytopenia. We selected F104S c-Mpl for further study because it exhibited surface expression of the receptor. We measured proliferation of cell lines expressing wild-type or F104S c-Mpl in response to thrombopoietin receptor agonists targeting the extracellular (m-AMP4) or transmembrane (LGD-4665) domains of the receptor by 1-methyltetrazole-5-thiol assay. We measured thrombopoietin binding to the mutant receptor using an in vitro thrombopoietin uptake assay and identified F104 as a potentially critical residue for the interaction between the receptor and its ligand by aligning thrombopoietin and erythropoietin receptors from multiple species. Cells expressing F104S c-Mpl proliferated in response to LGD-4665, but not thrombopoietin or m-AMP4. Compared to thrombopoietin, LGD-4665 stimulates signaling with delayed kinetics in both wild-type and F104S c-Mpl-expressing cells. Although F104S c-Mpl is expressed on the cell surface in our BaF3 cell line model, the mutant receptor does not bind thrombopoietin. Comparison to the erythropoietin receptor suggests that F104 engages in hydrogen-bonding interactions that are critical for binding to thrombopoietin. These findings suggest that a small subset of patients with congenital amegakaryocytic thrombocytopenia might respond to treatment with thrombopoietin receptor agonists, but that responsiveness will depend on the type of mutation and agonist used. We postulate that F104 is critical for thrombopoietin binding. The kinetics of signaling in response to a transmembrane domain-binding agonist are delayed in comparison to thrombopoietin. 2010 ISEH Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

  11. The Phosphorylation of Vascular Endothelial Growth Factor Receptor-2 (VEGFR-2) by Engineered Surfaces with Electrostatically or Covalently Immobilized VEGF

    PubMed Central

    Anderson, Sean M.; Chen, Tom T.; Iruela-Arispe, M. Luisa; Segura, Tatiana

    2010-01-01

    Growth factors are a class of signaling proteins that direct cell fate through interaction with cell surface receptors. Although a myriad of possible cell fates stem from a growth factor binding to its receptor, the signaling cascades that result in one fate over another are still being elucidated. One possible mechanism by which nature modulates growth factor signaling is through the method of presentation of the growth factor – soluble or immobilized (matrix bound). Here we present the methodology to study signaling of soluble versus immobilized VEGF through VEGFR-2. We have designed a strategy to covalently immobilize VEGF using its heparin-binding domain to orient the molecule (bind) and a secondary functional group to mediate covalent binding (lock). This bind-and-lock approach aims to allow VEGF to assume a bioactive orientation before covalent immobilization. Surface plasmon resonance (SPR) demonstrated heparin and VEGF binding with surface densities of 60 ng/cm2 and 100 pg/cm2, respectively. ELISA experiments confirmed VEGF surface density and showed that electrostatically bound VEGF releases in cell medium and heparin solutions while covalently bound VEGF remains immobilized. Electrostatically bound VEGF and covalently bound VEGF phosphorylate VEGFR-2 in both VEGFR-2 transfected cells and VEGFR-2 endogenously producing cells. HUVECs plated on VEGF functionalized surfaces showed different morphologies between surface-bound VEGF and soluble VEGF. The surfaces synthesized in these studies allow for the study of VEGF/VEGFR-2 signaling induced by covalently bound, electrostatically bound, and soluble VEGF and may provide further insight into the design of materials for the generation of a mature and stable vasculature. PMID:19540581

  12. Takifugu rubripes cation independent mannose 6-phosphate receptor: Cloning, expression and functional characterization of the IGF-II binding domain.

    PubMed

    A, Ajith Kumar; Nadimpalli, Siva Kumar

    2018-07-01

    Mannose 6-phosphate/IGF-II receptor mediated lysosomal clearance of insulin-like growth factor-II is significantly associated with the evolution of placental mammals. The protein is also referred to as the IGF-II receptor. Earlier studies suggested relatively low binding affinity between the receptor and ligand in prototherian and metatherian mammals. In the present study, we cloned the IGF-II binding domain of the early vertebrate fugu fish and expressed it in bacteria. A 72000Da truncated receptor containing the IGF-II binding domain was obtained. Analysis of this protein (covering domains 11-13 of the CIMPR) for its affinity to fish and human IGF-II by ligand blot assays and ELISA showed that the expressed receptor can specifically bind to both fish and human IGF-II. Additionally, a peptide-specific antibody raised against the region of the IGF-II binding domain also was able to recognize the IGF-II binding regions of mammalian and non-mammalian cation independent MPR protein. These interactions were further characterized by Surface Plasma resonance support that the receptor binds to fish IGF-II, with a dissociation constant of 548nM. Preliminary analysis suggests that the binding mechanism as well as the affinity of the fish and human receptor for IGF-II may have varied according to different evolutionary pressures. Copyright © 2018. Published by Elsevier B.V.

  13. Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors

    PubMed Central

    Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram

    2012-01-01

    The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn91 in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus. PMID:22642577

  14. Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors.

    PubMed

    Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram

    2012-06-15

    The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn(91) in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus.

  15. Antibody neutralization of retargeted measles viruses

    PubMed Central

    Lech, Patrycja J.; Pappoe, Roland; Nakamura, Takafumi; Tobin, Gregory J.; Nara, Peter L.; Russell, Stephen J.

    2014-01-01

    The measles virus (MV) vaccine lineage is a promising oncolytic but prior exposure to the measles vaccine or wild-type MV strains limits treatment utility due to the presence of anti-measles antibodies. MV entry can be redirected by displaying a polypeptide ligand on the Hemagglutinin (H) C-terminus. We hypothesized that retargeted MV would escape neutralization by monoclonal antibodies (mAbs) recognizing the H receptor-binding surface and be less susceptible to neutralization by human antisera. Using chimeric H proteins, with and without mutations that ablate MV receptor binding, we show that retargeted MVs escape mAbs that target the H receptor-binding surface by virtue of mutations that ablate infection via SLAM and CD46. However, C-terminally displayed domains do not mediate virus entry in the presence of human antibodies that bind to the underlying H domain. In conclusion, utility of retargeted oncolytic measles viruses does not extend to evasion of human serum neutralization. PMID:24725950

  16. Crystal Structure of Botulinum Neurotoxin Type a in Complex With the Cell Surface Co-Receptor GT1b-Insight Into the Toxin-Neuron Interaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stenmark, P.; Dupuy, J.; Inamura, A.

    2009-05-26

    Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in themore » toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.« less

  17. Virions at the gates: receptors and the host-virus arms race.

    PubMed

    Coffin, John M

    2013-01-01

    All viruses need to bind to specific receptor molecules on the surface of target cells to initiate infection. Virus-receptor binding is highly specific, and this specificity determines both the species and the cell type that can be infected by a given virus. In some well-studied cases, the virus-binding region on the receptor has been found to be unrelated to the receptor's normal cellular function. Resistance to virus infection can thus evolve by selection of mutations that alter amino acids in the binding region with minimal effect on normal function. This sort of positive selection can be used to infer the history of the host-virus "arms race" during their coevolution. In a new study, Demogines et al. use a combination of phylogenetic, structural, and virological analysis to infer the history and significance of positive selection on the transferrin receptor TfR1, a housekeeping protein required for iron uptake and the cell surface receptor for at least three different types of virus. The authors show that only two parts of the rodent TfR1 molecule have been subject to positive selection and that these correspond to the binding sites for two of these viruses-the mouse mammary tumor virus (a retrovirus) and Machupo virus (an arenavirus). They confirmed this result by introducing the inferred binding site mutations into the wild-type protein and testing for receptor function. Related arenaviruses are beginning to spread in human populations in South America as the cause of often fatal hemorrhagic fevers, and, although Demogines et al. could find no evidence of TfR1 mutations in this region that might have been selected as a consequence of human infection, the authors identified one such mutation in Asian populations that affects infection with these viruses.

  18. The biochemistry and immunology of non-canonical forms of HLA-B27.

    PubMed

    Shaw, Jacqueline; Hatano, Hiroko; Kollnberger, Simon

    2014-01-01

    HLA-B27 (B27) is strongly associated with the spondyloarthritides. B27 is expressed at the cell surface of antigen presenting cells (APC) both as canonical β2m-associated and non-canonical β2m-free heavy chain (FHC) forms which include B27 dimers (termed B272). B27 FHC forms arise in an endosomal compartment from recycling β2m-associated B27. Formation of cell surface FHC dimers is critically dependent on an unpaired reactive cysteine 67 in the α1 helix of the class I heavy chain. HLA-B27 also form redox-inducible β2m-associated dimers on exosomes and apoptosing cells. By contrast with cell surface expressed cysteine 67-dependent heavy chain dimers these dimers are dependent on a cytoplasmic cysteine 325 for their formation. HLA-B27 binds to immunoregulatory receptors including members of the Killer cell Immunoglobulin-like (KIR) and Leukocyte Immunoglobulin-like receptor family. B27 FHC bind to different but overlapping sets of these immunoreceptors compared to classical β2m-associated HLA-B27. B27 FHC bind more strongly to KIR3DL2 and LILRB2 immune receptor than other β2m-associated HLA-class I ligands. Genetic studies have implicated genes which control production of the important proinflammatory cytokine IL-17 in the pathogenesis of spondyloarthritis. Cell surface HLA-B27 FHC binding to these immune receptors or acting through other mechanisms could impact on the pathogenesis of spondyloarthritis by promoting immune cell production of IL-17. Here we review the literature on these non-canonical forms of HLA-B27 and the immune receptors they bind to and discuss the possible relevance of these interactions to the pathogenesis of spondyloarthropathy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. The first three domains of the insulin receptor differ structurally from the insulin-like growth factor 1 receptor in the regions governing ligand specificity

    PubMed Central

    Lou, Meizhen; Garrett, Thomas P. J.; McKern, Neil M.; Hoyne, Peter A.; Epa, V. Chandana; Bentley, John D.; Lovrecz, George O.; Cosgrove, Leah J.; Frenkel, Maurice J.; Ward, Colin W.

    2006-01-01

    The insulin receptor (IR) and the type-1 insulin-like growth factor receptor (IGF1R) are homologous multidomain proteins that bind insulin and IGF with differing specificity. Here we report the crystal structure of the first three domains (L1–CR–L2) of human IR at 2.3 Å resolution and compare it with the previously determined structure of the corresponding fragment of IGF1R. The most important differences seen between the two receptors are in the two regions governing ligand specificity. The first is at the corner of the ligand-binding surface of the L1 domain, where the side chain of F39 in IR forms part of the ligand binding surface involving the second (central) β-sheet. This is very different to the location of its counterpart in IGF1R, S35, which is not involved in ligand binding. The second major difference is in the sixth module of the CR domain, where IR contains a larger loop that protrudes further into the ligand-binding pocket. This module, which governs IGF1-binding specificity, shows negligible sequence identity, significantly more α-helix, an additional disulfide bond, and opposite electrostatic potential compared to that of the IGF1R. PMID:16894147

  20. Sialic acid-dependent cell entry of human enterovirus D68

    DOE PAGES

    Liu, Yue; Sheng, Ju; Baggen, Jim; ...

    2015-11-13

    Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon’ on the virus surface. The sialic acid receptor induces a cascade of conformational changes inmore » the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Furthermore, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry.« less

  1. Sialic acid-dependent cell entry of human enterovirus D68

    PubMed Central

    Liu, Yue; Sheng, Ju; Baggen, Jim; Meng, Geng; Xiao, Chuan; Thibaut, Hendrik J.; van Kuppeveld, Frank J. M.; Rossmann, Michael G.

    2015-01-01

    Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon' on the virus surface. The sialic acid receptor induces a cascade of conformational changes in the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Thus, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry. PMID:26563423

  2. Cell surface distribution and intracellular fate of asialoglycoproteins: a morphological and biochemical study of isolated rat hepatocytes and monolayer cultures

    PubMed Central

    Zeitlin, PL; Hubbard, AL

    1982-01-01

    A combination of biochemistry and morphology was used to demonstrate that more than 95 percent of the isolated rat hepatocytes prepared by collagenase dissociation of rat livers retained the pathway for receptor-mediated endocytosis of asialoglycoproteins (ASGPs). Maximal specific binding of (125)I-asialoorosomucoid ((125)I-ASOR) to dissociated hepatocytes at 5 degrees C (at which temperature no internalization occurred) averaged 100,000-400,000 molecules per cell. Binding, uptake, and degredation of (125)I- ASOR at 37 degrees C occurred at a rate of 1 x 10(6) molecules per cell over 2 h. Light and electron microscopic autoradiography (LM- and EM-ARG) of (125)I-ASOR were used to visualize the surface binding sites at 5 degrees C and the intracellular pathway at 37 degrees C. In the EM-ARG experiments, ARG grains corresponding to (125)I-ASOR were distributed randomly over the cell surface at 5 degrees C but over time at 37 degrees C were concentrated in the lysosome region. Cytochemical detection of an ASOR-horseradish peroxidase conjugate (ASOR-HRP) at the ultrastructural level revealed that at 5 degrees C this specific ASGP tracer was concentrated in pits at the cell surface as well as diffusely distributed along the rest of the plasma membrane. Such a result indicates that redistribution of ASGP surface receptors had occurred. Because the number of surface binding sites of (125)I-ASOR varied among cell preparations, the effect of collagenase on (125)I-ASOR binding was examined. When collagenase-dissociated hepatocytes were re-exposed to collagenase at 37 degrees C, 10-50 percent of control binding was observed. However, by measuring the extent of (125)I-ASOR binding at 5 degrees C in the same cell population before and after collagenase dissociation, little reduction in the number of ASGP surface receptors was found. Therefore, the possibility that the time and temperature of the cell isolations allowed recovery of cell surface receptors following collagenase exposure was tested. Freshly isolated cells, dissociated cells that were re-exposed to collagenase, and perfused livers exposed to collagenase without a Ca(++)-free pre-perfusion, were found to bind 110-240 percent more(125)I-ASOR after 1 h at 37 degrees C that they did at 0 time. This recovery of surface ASGP binding activity occurred in the absence of significant protein synthesis (i.e., basal medium or 1 mM cycloheximide). Suspensions of isolated, unpolarized hepatocytes were placed in monolayer culture for 24 h and confluent cells were demonstrated to reestablish morphologically distinct plasma membrane regions analogous to bile canalicular, lateral, and sinusoidal surfaces in vivo. More than 95 percent of these cells maintained the capacity to bind, internalize, and degrade (125)I-ASOR at levels comparable to those of the freshly isolated population. ASOR-HRP (at 5 degrees C) was specifically bound to all plasma membrane surfaces of repolarized hepatocytes (cultured for 24 h) except those lining bile canalicular-like spaces. Thus, both isolated, unpolarized hepatocytes and cells cultured under conditions that promote morphological reestablishment of polarity maintain the pathway for receptor- mediated endocytosis of ASGPs. PMID:6282890

  3. Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.

    G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the nativemore » ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.« less

  4. Use of polyclonal and monoclonal antibodies to study hCG-receptor interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Milius, R.P.

    1985-01-01

    Although the glycoprotein hormones lutropin (LH), follitropin (FSH), and thyrotropin (TSH) bind to different receptors, each contains an identical alpha subunit. Specificity is somehow endowed by theta subunits which are distinct for each hormone. Human choriogonadotropin (hCG) is a natural LH analog that contains a beta subunit nearly identical to that of LH. The roles of these subunits in the recognition and high affinity binding of hCG to receptor was examined. Polyclonal and monoclonal antibodies specific for the individual subunits of hCG were used to probe the hormone-receptor interaction. Conformation-specific and sequence-specific antibodies were examined for their abilities to bindmore » Triton X-100-solubilized /sup 125/I-hCG-receptor complex and to inhibit hormone binding to crude rat ovarian membranes containing receptor. Even though the immunoreactive sites are not located on the receptor binding surface of the beta subunit, most, but not all, of these polyclonal and monoclonal antibodies were able to inhibit /sup 125/I-hCG binding to receptor. Although the inhibition of binding may be due to steric interference due to the size of the antibody molecules, a two-step model for hCG binding to receptor is presented that also explains these results. In this model, the beta subunit initially binds with the receptor with a highly specific but low affinity interaction. This activates a site for the high affinity binding of the alpha subunit and stabilization of the complex. This is an attractive model as it may be applied to other glycoprotein hormones sharing an alpha subunit.« less

  5. Enhanced In Vivo Tumor Detection by Active Tumor Cell Targeting Using Multiple Tumor Receptor-Binding Peptides Presented on Genetically Engineered Human Ferritin Nanoparticles.

    PubMed

    Kwon, Koo Chul; Ko, Ho Kyung; Lee, Jiyun; Lee, Eun Jung; Kim, Kwangmeyung; Lee, Jeewon

    2016-08-01

    Human ferritin heavy-chain nanoparticle (hFTH) is genetically engineered to present tumor receptor-binding peptides (affibody and/or RGD-derived cyclic peptides, named 4CRGD here) on its surface. The affibody and 4CRGD specifically and strongly binds to human epidermal growth factor receptor I (EGFR) and human integrin αvβ3, respectively, which are overexpressed on various tumor cells. Through in vitro culture of EGFR-overexpressing adenocarcinoma (MDA-MB-468) and integrin-overexpressing glioblastoma cells (U87MG), it is clarified that specific interactions between receptors on tumor cells and receptor-binding peptides on engineered hFTH is critical in active tumor cell targeting. After labeling with the near-infrared fluorescence dye (Cy5.5) and intravenouse injection into MDA-MB-468 or U87MG tumor-bearing mice, the recombinant hFTHs presenting either peptide or both of affibody and 4CRGD are successfully delivered to and retained in the tumor for a prolonged period of time. In particular, the recombinant hFTH presenting both affibody and 4CRGD notably enhances in vivo detection of U87MG tumors that express heterogeneous receptors, integrin and EGFR, compared to the other recombinant hFTHs presenting either affibody or 4CRGD only. Like affibody and 4CRGD used in this study, other multiple tumor receptor-binding peptides can be also genetically introduced to the hFTH surface for actively targeting of in vivo tumors with heterogenous receptors. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Clostridium perfringens epsilon toxin H149A mutant as a platform for receptor binding studies.

    PubMed

    Bokori-Brown, Monika; Kokkinidou, Maria C; Savva, Christos G; Fernandes da Costa, Sérgio; Naylor, Claire E; Cole, Ambrose R; Moss, David S; Basak, Ajit K; Titball, Richard W

    2013-05-01

    Clostridium perfringens epsilon toxin (Etx) is a pore-forming toxin responsible for a severe and rapidly fatal enterotoxemia of ruminants. The toxin is classified as a category B bioterrorism agent by the U.S. Government Centres for Disease Control and Prevention (CDC), making work with recombinant toxin difficult. To reduce the hazard posed by work with recombinant Etx, we have used a variant of Etx that contains a H149A mutation (Etx-H149A), previously reported to have reduced, but not abolished, toxicity. The three-dimensional structure of H149A prototoxin shows that the H149A mutation in domain III does not affect organisation of the putative receptor binding loops in domain I of the toxin. Surface exposed tyrosine residues in domain I of Etx-H149A (Y16, Y20, Y29, Y30, Y36 and Y196) were mutated to alanine and mutants Y30A and Y196A showed significantly reduced binding to MDCK.2 cells relative to Etx-H149A that correlated with their reduced cytotoxic activity. Thus, our study confirms the role of surface exposed tyrosine residues in domain I of Etx in binding to MDCK cells and the suitability of Etx-H149A for further receptor binding studies. In contrast, binding of all of the tyrosine mutants to ACHN cells was similar to that of Etx-H149A, suggesting that Etx can recognise different cell surface receptors. In support of this, the crystal structure of Etx-H149A identified a glycan (β-octyl-glucoside) binding site in domain III of Etx-H149A, which may be a second receptor binding site. These findings have important implications for developing strategies designed to neutralise toxin activity. Copyright © 2013 The Protein Society.

  7. Receptor-mediated binding of IgE-sensitized rat basophilic leukemia cells to antigen-coated substrates under hydrodynamic flow.

    PubMed Central

    Tempelman, L A; Hammer, D A

    1994-01-01

    The physiological function of many cells is dependent on their ability to adhere via receptors to ligand-coated surfaces under fluid flow. We have developed a model experimental system to measure cell adhesion as a function of cell and surface chemistry and fluid flow. Using a parallel-plate flow chamber, we measured the binding of rat basophilic leukemia cells preincubated with anti-dinitrophenol IgE antibody to polyacrylamide gels covalently derivatized with 2,4-dinitrophenol. The rat basophilic leukemia cells' binding behavior is binary: cells are either adherent or continue to travel at their hydrodynamic velocity, and the transition between these two states is abrupt. The spatial location of adherent cells shows cells can adhere many cell diameters down the length of the gel, suggesting that adhesion is a probabilistic process. The majority of experiments were performed in the excess ligand limit in which adhesion depends strongly on the number of receptors but weakly on ligand density. Only 5-fold changes in IgE surface density or in shear rate were necessary to change adhesion from complete to indistinguishable from negative control. Adhesion showed a hyperbolic dependence on shear rate. By performing experiments with two IgE-antigen configurations in which the kinetic rates of receptor-ligand binding are different, we demonstrate that the forward rate of reaction of the receptor-ligand pair is more important than its thermodynamic affinity in the regulation of binding under hydrodynamic flow. In fact, adhesion increases with increasing receptor-ligand reaction rate or decreasing shear rate, and scales with a single dimensionless parameter which compares the relative rates of reaction to fluid shear. Images FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 8 FIGURE 10 PMID:8038394

  8. BINDING OF SOLUBLE IMMUNE COMPLEXES TO HUMAN LYMPHOBLASTOID CELLS

    PubMed Central

    Theofilopoulos, Argyrios N.; Dixon, Frank J.; Bokisch, Viktor A.

    1974-01-01

    In the present work we studied the expression of membrane-bound Ig (MBIg) as well as receptors for IgG Fc and complement on nine human lymphoblastoid cell lines. When MBIg and receptors for IgG Fc were compared, four categories of cell lines could be distinguished: (a) cell lines having both MBIg and receptors for IgG Fc, (b) cell lines having MBIg but lacking receptors for IgG Fc, (c) cell lines lacking MBIg but having receptors for IgG Fc, and (d) cell lines lacking both MBIg and receptors for IgG Fc. Two types of receptors for complement could be detected on the cell lines studied, one for C3-C3b and one for C3d. When sensitized red cells carrying C3b or C3d were used for rosette tests, three categories of cell lines could be distinguished: (a) cell lines having receptors for C3b and C3d, (b) cell lines having receptors only for C3d and (c) cell lines lacking both receptors. However, when a more sensitive immunofluorescent method was used instead of the rosette technique, it was found that cell lines unable to form rosettes with EAC1423bhu were able to bind soluble C3 or C3b which indicated the presence of these receptors on the cell surface. Inhibition experiments showed that receptors for C3-C3b and receptors for C3d are distinct and that receptors for C3-C3b and C3d are different from receptors for IgG Fc. A cell line (Raji) without MBIg but with receptors for IgG Fc, C3-C3b, and C3d was selected for use in studying the binding mechanism of soluble immune complexes to cell surface membrane. Aggregated human gamma globulin was used in place of immune complexes. Immune complexes containing complement bind to Raji cells only via receptors for complement, namely receptors for C3-C3b and C3d. Binding of immune complexes containing complement to cells is much greater than that of complexes without complement. Immune complexes bound to cells via receptors for complement can be partially released from the cell surface by addition of normal human serum as well as isolated human C3 or C3b. We postulate that such release is due to competition of immune complex bound C3b and free C3 or C3b for the receptors on Raji cells. PMID:4139225

  9. The pure estrogen receptor antagonist ICI 182,780 promotes a novel interaction of estrogen receptor-alpha with the 3',5'-cyclic adenosine monophosphate response element-binding protein-binding protein/p300 coactivators.

    PubMed

    Jaber, Basem M; Gao, Tong; Huang, Luping; Karmakar, Sudipan; Smith, Carolyn L

    2006-11-01

    Estrogen receptor-alpha (ERalpha) is a member of the nuclear receptor superfamily of ligand-activated transcription factors. Abundant evidence demonstrates that ERalpha agonists promote, whereas antagonists inhibit, receptor binding to coactivators. In this report we demonstrate that binding of the ICI 182,780 (ICI) pure antiestrogen to ERalpha promotes its interaction with the cAMP response element-binding protein-binding protein (CBP)/p300 but not the p160 family of coactivators, demonstrating the specificity of this interaction. Amino acid mutations within the coactivator binding surface of the ERalpha ligand-binding domain revealed that CBP binds to this region of the ICI-liganded receptor. The carboxy-terminal cysteine-histidine rich domain 3 of CBP, rather than its amino-terminal nuclear interacting domain, shown previously to mediate agonist-dependent interactions of CBP with nuclear receptors, is required for binding to ICI-liganded ERalpha. Chromatin immunoprecipitation assays revealed that ICI but not the partial agonist/antagonist 4-hydroxytamoxifen is able to recruit CBP to the pS2 promoter, and this distinguishes ICI from this class of antiestrogens. Chromatin immunoprecipitation assays for pS2 and cytochrome P450 1B1 promoter regions revealed that ICI-dependent recruitment of CBP, but not receptor, to ERalpha targets is gene specific. ICI treatment did not recruit the steroid receptor coactivator 1 to the pS2 promoter, and it failed to induce the expression of this gene. Taken together, these data indicate that recruitment of the CBP coactivator/cointegrator without steroid receptor coactivator 1 to ERalpha is insufficient to promote transcription of ERalpha target genes.

  10. Ubiquitin Regulates Caspase Recruitment Domain-mediated Signaling by Nucleotide-binding Oligomerization Domain-containing Proteins NOD1 and NOD2*

    PubMed Central

    Ver Heul, Aaron M.; Fowler, C. Andrew; Ramaswamy, S.; Piper, Robert C.

    2013-01-01

    NOD1 and NOD2 (nucleotide-binding oligomerization domain-containing proteins) are intracellular pattern recognition receptors that activate inflammation and autophagy. These pathways rely on the caspase recruitment domains (CARDs) within the receptors, which serve as protein interaction platforms that coordinately regulate immune signaling. We show that NOD1 CARD binds ubiquitin (Ub), in addition to directly binding its downstream targets receptor-interacting protein kinase 2 (RIP2) and autophagy-related protein 16-1 (ATG16L1). NMR spectroscopy and structure-guided mutagenesis identified a small hydrophobic surface of NOD1 CARD that binds Ub. In vitro, Ub competes with RIP2 for association with NOD1 CARD. In vivo, we found that the ligand-stimulated activity of NOD1 with a mutant CARD lacking Ub binding but retaining ATG16L1 and RIP2 binding is increased relative to wild-type NOD1. Likewise, point mutations in the tandem NOD2 CARDs at positions analogous to the surface residues defining the Ub interface on NOD1 resulted in loss of Ub binding and increased ligand-stimulated NOD2 signaling. These data suggest that Ub binding provides a negative feedback loop upon NOD-dependent activation of RIP2. PMID:23300079

  11. Binding constant of cell adhesion receptors and substrate-immobilized ligands depends on the distribution of ligands

    NASA Astrophysics Data System (ADS)

    Li, Long; Hu, Jinglei; Xu, Guangkui; Song, Fan

    2018-01-01

    Cell-cell adhesion and the adhesion of cells to tissues and extracellular matrix, which are pivotal for immune response, tissue development, and cell locomotion, depend sensitively on the binding constant of receptor and ligand molecules anchored on the apposing surfaces. An important question remains of whether the immobilization of ligands affects the affinity of binding with cell adhesion receptors. We have investigated the adhesion of multicomponent membranes to a flat substrate coated with immobile ligands using Monte Carlo simulations of a statistical mesoscopic model with biologically relevant parameters. We find that the binding of the adhesion receptors to ligands immobilized on the substrate is strongly affected by the ligand distribution. In the case of ligand clusters, the receptor-ligand binding constant can be significantly enhanced due to the less translational entropy loss of lipid-raft domains in the model cell membranes upon the formation of additional complexes. For ligands randomly or uniformly immobilized on the substrate, the binding constant is rather decreased since the receptors localized in lipid-raft domains have to pay an energetic penalty in order to bind ligands. Our findings help to understand why cell-substrate adhesion experiments for measuring the impact of lipid rafts on the receptor-ligand interactions led to contradictory results.

  12. Cyclophilin B mediates cyclosporin A incorporation in human blood T-lymphocytes through the specific binding of complexed drug to the cell surface.

    PubMed

    Allain, F; Denys, A; Spik, G

    1996-07-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein located within intracellular vesicles and released in biological fluids. We recently reported the specific binding of this protein to T-cell surface receptor which is internalized even in the presence of CsA. These results suggest that CyPB might target the drug to lymphocytes and consequently modify its activity. To verify this hypothesis, we have first investigated the binding capacity and internalization of the CsA-CyPB complex in human peripheral blood T-lymphocytes and secondly compared the inhibitory effect of both free and CyPB-complexed CsA on the CD3-induced activation and proliferation of T-cells. Here, we present evidence that both the CsA-CyPB complex and free CyPB bind to the T-lymphocyte surface, with similar values of Kd and number of sites. At 37 degrees C, the complex is internalized but, in contrast to the protein, the drug is accumulated within the cell. Moreover, CyPB receptors are internalized together with the ligand and rapidly recycled to the cell surface. Finally, we demonstrate that CyPB-complexed CsA remains as efficient as uncomplexed CsA and that CyPB enhances the immunosuppressive activity of the drug. Taken together, our results support the hypothesis that surface CyPB receptors may be related to the selective and variable action of CsA, through specific binding and targeting of the CyPB-CsA complex to peripheral blood T-lymphocytes.

  13. Identification of Novel 14-3-3 Residues That Are Critical for Isoform-specific Interaction with GluN2C to Regulate N-Methyl-d-aspartate (NMDA) Receptor Trafficking*

    PubMed Central

    Chung, Connie; Wu, Wei-Hua; Chen, Bo-Shiun

    2015-01-01

    The 14-3-3 family of proteins is widely distributed in the CNS where they are major regulators of essential neuronal functions. There are seven known mammalian 14-3-3 isoforms (ζ,, τ, ϵ, η, β, and σ), which generally function as adaptor proteins. Previously, we have demonstrated that 14-3-3ϵ isoform dynamically regulates forward trafficking of GluN2C-containing NMDA receptors (NMDARs) in cerebellar granule neurons, that when expressed on the surface, promotes neuronal survival following NMDA-induced excitotoxicity. Here, we report 14-3-3 isoform-specific binding and functional regulation of GluN2C. In particular, we show that GluN2C C-terminal domain (CTD) binds to all 14-3-3 isoforms except 14-3-3σ, and binding is dependent on GluN2C serine 1096 phosphorylation. Co-expression of 14-3-3 (ζ and ϵ) and GluN1/GluN2C promotes the forward delivery of receptors to the cell surface. We further identify novel residues serine 145, tyrosine 178, and cysteine 189 on α-helices 6, 7, and 8, respectively, within ζ-isoform as part of the GluN2C binding motif and independent of the canonical peptide binding groove. Mutation of these conserved residues abolishes GluN2C binding and has no functional effect on GluN2C trafficking. Reciprocal mutation of alanine 145, histidine 180, and isoleucine 191 on 14-3-3σ isoform promotes GluN2C binding and surface expression. Moreover, inhibiting endogenous 14-3-3 using a high-affinity peptide inhibitor, difopein, greatly diminishes GluN2C surface expression. Together, these findings highlight the isoform-specific structural and functional differences within the 14-3-3 family of proteins, which determine GluN2C binding and its essential role in targeting the receptor to the cell surface to facilitate glutamatergic neurotransmission. PMID:26229101

  14. Electron Tomography Imaging of Surface Glycoproteins on Human Parainfluenza Virus 3: Association of Receptor Binding and Fusion Proteins before Receptor Engagement

    PubMed Central

    Gui, Long; Jurgens, Eric M.; Ebner, Jamie L.

    2015-01-01

    ABSTRACT In order to deliver their genetic material to host cells during infection, enveloped viruses use specialized proteins on their surfaces that bind cellular receptors and induce fusion of the viral and host membranes. In paramyxoviruses, a diverse family of single-stranded RNA (ssRNA) viruses, including several important respiratory pathogens, such as parainfluenza viruses, the attachment and fusion machinery is composed of two separate proteins: a receptor binding protein (hemagglutinin-neuraminidase [HN]) and a fusion (F) protein that interact to effect membrane fusion. Here we used negative-stain and cryo-electron tomography to image the 3-dimensional ultrastructure of human parainfluenza virus 3 (HPIV3) virions in the absence of receptor engagement. We observed that HN exists in at least two organizations. The first were arrays of tetrameric HN that lacked closely associated F proteins: in these purely HN arrays, HN adopted a “heads-down” configuration. In addition, we observed regions of complex surface density that contained HN in an apparently extended “heads-up” form, colocalized with prefusion F trimers. This colocalization with prefusion F prior to receptor engagement supports a model for fusion in which HN in its heads-up state and F may interact prior to receptor engagement without activating F, and that interaction with HN in this configuration is not sufficient to activate F. Only upon receptor engagement by HN’s globular head does HN transmit its activating signal to F. PMID:25691596

  15. Binding-, intracellular transport-, and biosynthesis-defective mutants of vasopressin type 2 receptor in patients with X-linked nephrogenic diabetes insipidus.

    PubMed Central

    Tsukaguchi, H; Matsubara, H; Taketani, S; Mori, Y; Seido, T; Inada, M

    1995-01-01

    Nephrogenic diabetes insipidus (NDI) is most often an X-linked disorder in which urine is not concentrated due to renal resistance to arginine vasopressin. We recently identified four vasopressin type 2 receptor gene mutations in unrelated X-linked NDI families, including R143P, delta V278, R202C, and 804insG. All these mutations reduced ligand binding activity to < 10% of the normal without affecting mRNA accumulation. To elucidate whether the receptors are expressed on the cell surface, we analyzed biosynthesis and localization of tagged or untagged receptors stably expressed in Chinese hamster ovary (CHO) cells, using two antibodies directed against distinct termini. Whole-cell and surface labeling studies revealed that the R202C clone had both surface-localized (50-55 kD) and intracellular proteins (40 and 75 kD), similar to the wild-type AVPR2 clone, whereas the R143P and delta V278 clones lacked the surface receptors, despite relatively increased intracellular components. The 804insG mutant cell produced no proteins despite an adequate mRNA level. Immunofluorescence staining confirmed that the R202C mutant reaches the cell surface, whereas the R143P and delta V278 mutants are retained within the cytoplasmic compartment. Thus, R202C, R143P/delta V278, and 804insG result in three distinct phenotypes, that is, a simple binding impairment at the cell surface, blocked intracellular transport, and ineffective biosynthesis or/and accelerated degradation of the receptor, respectively, and therefore are responsible for NDI. This phenotypic classification will help understanding of molecular pathophysiology of this disorder. Images PMID:7560098

  16. Analysis of a two-domain binding site for the urokinase-type plasminogen activator-plasminogen activator inhibitor-1 complex in low-density-lipoprotein-receptor-related protein.

    PubMed

    Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C

    2001-07-01

    The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.

  17. Digested wheat gluten inhibits binding between leptin and its receptor.

    PubMed

    Jönsson, Tommy; Memon, Ashfaque A; Sundquist, Kristina; Sundquist, Jan; Olsson, Stefan; Nalla, Amarnadh; Bauer, Mikael; Linse, Sara

    2015-01-20

    Leptin resistance is considered a primary risk factor for obesity. It has been hypothesized that dietary cereal grain protein could cause leptin resistance by preventing leptin from binding to its receptor. Non-degraded dietary wheat protein has been found in human serum at a mean level of 41 ng/mL. Here, we report our findings from testing whether enzymatically digested gluten from wheat prevents leptin from binding to the leptin receptor in vitro. Gluten from wheat was digested with pepsin and trypsin under physiological conditions. Pepsin and trypsin activity was removed from the gluten digest with a 10 kDa spin-filter or by heat treatment at 100°C for 30 min. Binding to the leptin receptor of leptin mixed with gluten digest at a series of concentrations was measured using surface plasmon resonance technology. Binding of the gluten digest to the leptin receptor was not detected. Spin-filtered gluten digest inhibited binding of leptin to the leptin receptor, with 50% inhibition at a gluten digest concentration of ~10 ng/mL. Heat-treated gluten digest did not inhibit leptin binding. Digested wheat gluten inhibits binding of leptin to the leptin receptor, with half-maximal inhibition at 10 ng/mL. The inhibition is significant at clinically relevant concentrations and could therefore serve as a novel pathway to investigate to understand the molecular basis of leptin resistance, obesity and associated disorders.

  18. Rigid-body Ligand Recognition Drives Cytotoxic T-lymphocyte Antigen 4 (CTLA-4) Receptor Triggering

    PubMed Central

    Yu, Chao; Sonnen, Andreas F.-P.; George, Roger; Dessailly, Benoit H.; Stagg, Loren J.; Evans, Edward J.; Orengo, Christine A.; Stuart, David I.; Ladbury, John E.; Ikemizu, Shinji; Gilbert, Robert J. C.; Davis, Simon J.

    2011-01-01

    The inhibitory T-cell surface-expressed receptor, cytotoxic T lymphocyte-associated antigen-4 (CTLA-4), which belongs to the class of cell surface proteins phosphorylated by extrinsic tyrosine kinases that also includes antigen receptors, binds the related ligands, B7-1 and B7-2, expressed on antigen-presenting cells. Conformational changes are commonly invoked to explain ligand-induced “triggering” of this class of receptors. Crystal structures of ligand-bound CTLA-4 have been reported, but not the apo form, precluding analysis of the structural changes accompanying ligand binding. The 1.8-Å resolution structure of an apo human CTLA-4 homodimer emphasizes the shared evolutionary history of the CTLA-4/CD28 subgroup of the immunoglobulin superfamily and the antigen receptors. The ligand-bound and unbound forms of both CTLA-4 and B7-1 are remarkably similar, in marked contrast to B7-2, whose binding to CTLA-4 has elements of induced fit. Isothermal titration calorimetry reveals that ligand binding by CTLA-4 is enthalpically driven and accompanied by unfavorable entropic changes. The similarity of the thermodynamic parameters determined for the interactions of CTLA-4 with B7-1 and B7-2 suggests that the binding is not highly specific, but the conformational changes observed for B7-2 binding suggest some level of selectivity. The new structure establishes that rigid-body ligand interactions are capable of triggering CTLA-4 phosphorylation by extrinsic kinase(s). PMID:21156796

  19. Bacterial Surface Glycans: Microarray and QCM Strategies for Glycophenotyping and Exploration of Recognition by Host Receptors.

    PubMed

    Kalograiaki, Ioanna; Campanero-Rhodes, María A; Proverbio, Davide; Euba, Begoña; Garmendia, Junkal; Aastrup, Teodor; Solís, Dolores

    2018-01-01

    Bacterial surfaces are decorated with a diversity of carbohydrate structures that play important roles in the bacteria-host relationships. They may offer protection against host defense mechanisms, elicit strong antigenic responses, or serve as ligands for host receptors, including lectins of the innate immune system. Binding by these lectins may trigger defense responses or, alternatively, promote attachment, thereby enhancing infection. The outcome will depend on the particular bacterial surface landscape, which may substantially differ among species and strains. In this chapter, we describe two novel methods for exploring interactions directly on the bacterial surface, based on the generation of bacterial microarrays and quartz crystal microbalance (QCM) sensor chips. Bacterial microarrays enable profiling of accessible carbohydrate structures and screening of their recognition by host receptors, also providing information on binding avidity, while the QCM approach allows determination of binding affinity and kinetics. In both cases, the chief element is the use of entire bacterial cells, so that recognition of the bacterial glycan epitopes is explored in their natural environment. © 2018 Elsevier Inc. All rights reserved.

  20. 5D-QSAR for spirocyclic sigma1 receptor ligands by Quasar receptor surface modeling.

    PubMed

    Oberdorf, Christoph; Schmidt, Thomas J; Wünsch, Bernhard

    2010-07-01

    Based on a contiguous and structurally as well as biologically diverse set of 87 sigma(1) ligands, a 5D-QSAR study was conducted in which a quasi-atomistic receptor surface modeling approach (program package Quasar) was applied. The superposition of the ligands was performed with the tool Pharmacophore Elucidation (MOE-package), which takes all conformations of the ligands into account. This procedure led to four pharmacophoric structural elements with aromatic, hydrophobic, cationic and H-bond acceptor properties. Using the aligned structures a 3D-model of the ligand binding site of the sigma(1) receptor was obtained, whose general features are in good agreement with previous assumptions on the receptor structure, but revealed some novel insights since it represents the receptor surface in more detail. Thus, e.g., our model indicates the presence of an H-bond acceptor moiety in the binding site as counterpart to the ligands' cationic ammonium center, rather than a negatively charged carboxylate group. The presented QSAR model is statistically valid and represents the biological data of all tested compounds, including a test set of 21 ligands not used in the modeling process, with very good to excellent accuracy [q(2) (training set, n=66; leave 1/3 out) = 0.84, p(2) (test set, n=21)=0.64]. Moreover, the binding affinities of 13 further spirocyclic sigma(1) ligands were predicted with reasonable accuracy (mean deviation in pK(i) approximately 0.8). Thus, in addition to novel insights into the requirements for binding of spirocyclic piperidines to the sigma(1) receptor, the presented model can be used successfully in the rational design of new sigma(1) ligands. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

  1. Variable ligand- and receptor-binding hot spots in key strains of influenza neuraminidase

    PubMed Central

    Votapka, Lane; Demir, Özlem; Swift, Robert V; Walker, Ross C; Amaro, Rommie E

    2012-01-01

    Influenza A continues to be a major public health concern due to its ability to cause epidemic and pandemic disease outbreaks in humans. Computational investigations of structural dynamics of the major influenza glycoproteins, especially the neuraminidase (NA) enzyme, are able to provide key insights beyond what is currently accessible with standard experimental techniques. In particular, all-atom molecular dynamics simulations reveal the varying degrees of flexibility for such enzymes. Here we present an analysis of the relative flexibility of the ligand- and receptor-binding area of three key strains of influenza A: highly pathogenic H5N1, the 2009 pandemic H1N1, and a human N2 strain. Through computational solvent mapping, we investigate the various ligand- and receptor-binding “hot spots” that exist on the surface of NA which interacts with both sialic acid receptors on the host cells and antiviral drugs. This analysis suggests that the variable cavities found in the different strains and their corresponding capacities to bind ligand functional groups may play an important role in the ability of NA to form competent reaction encounter complexes with other species of interest, including antiviral drugs, sialic acid receptors on the host cell surface, and the hemagglutinin protein. Such considerations may be especially useful for the prediction of how such complexes form and with what binding capacity. PMID:22872804

  2. Elucidating the Functional Roles of Spatial Organization in Cross-Membrane Signal Transduction by a Hybrid Simulation Method.

    PubMed

    Chen, Jiawen; Xie, Zhong-Ru; Wu, Yinghao

    2016-07-01

    The ligand-binding of membrane receptors on cell surfaces initiates the dynamic process of cross-membrane signal transduction. It is an indispensable part of the signaling network for cells to communicate with external environments. Recent experiments revealed that molecular components in signal transduction are not randomly mixed, but spatially organized into distinctive patterns. These patterns, such as receptor clustering and ligand oligomerization, lead to very different gene expression profiles. However, little is understood about the molecular mechanisms and functional impacts of this spatial-temporal regulation in cross-membrane signal transduction. In order to tackle this problem, we developed a hybrid computational method that decomposes a model of signaling network into two simulation modules. The physical process of binding between receptors and ligands on cell surfaces are simulated by a diffusion-reaction algorithm, while the downstream biochemical reactions are modeled by stochastic simulation of Gillespie algorithm. These two processes are coupled together by a synchronization framework. Using this method, we tested the dynamics of a simple signaling network in which the ligand binding of cell surface receptors triggers the phosphorylation of protein kinases, and in turn regulates the expression of target genes. We found that spatial aggregation of membrane receptors at cellular interfaces is able to either amplify or inhibit downstream signaling outputs, depending on the details of clustering mechanism. Moreover, by providing higher binding avidity, the co-localization of ligands into multi-valence complex modulates signaling in very different ways that are closely related to the binding affinity between ligand and receptor. We also found that the temporal oscillation of the signaling pathway that is derived from genetic feedback loops can be modified by the spatial clustering of membrane receptors. In summary, our method demonstrates the functional importance of spatial organization in cross-membrane signal transduction. The method can be applied to any specific signaling pathway in cells.

  3. Internalization of the chemokine receptor CCR4 can be evoked by orthosteric and allosteric receptor antagonists

    PubMed Central

    Ajram, Laura; Begg, Malcolm; Slack, Robert; Cryan, Jenni; Hall, David; Hodgson, Simon; Ford, Alison; Barnes, Ashley; Swieboda, Dawid; Mousnier, Aurelie; Solari, Roberto

    2014-01-01

    The chemokine receptor CCR4 has at least two natural agonist ligands, MDC (CCL22) and TARC (CCL17) which bind to the same orthosteric site with a similar affinity. Both ligands are known to evoke chemotaxis of CCR4-bearing T cells and also elicit CCR4 receptor internalization. A series of small molecule allosteric antagonists have been described which displace the agonist ligand, and inhibit chemotaxis. The aim of this study was to determine which cellular coupling pathways are involved in internalization, and if antagonists binding to the CCR4 receptor could themselves evoke receptor internalization. CCL22 binding coupled CCR4 efficiently to β-arrestin and stimulated GTPγS binding however CCL17 did not couple to β-arrestin and only partially stimulated GTPγS binding. CCL22 potently induced internalization of almost all cell surface CCR4, while CCL17 showed only weak effects. We describe four small molecule antagonists that were demonstrated to bind to two distinct allosteric sites on the CCR4 receptor, and while both classes inhibited agonist ligand binding and chemotaxis, one of the allosteric sites also evoked receptor internalization. Furthermore, we also characterize an N-terminally truncated version of CCL22 which acts as a competitive antagonist at the orthosteric site, and surprisingly also evokes receptor internalization without demonstrating any agonist activity. Collectively this study demonstrates that orthosteric and allosteric antagonists of the CCR4 receptor are capable of evoking receptor internalization, providing a novel strategy for drug discovery against this class of target. PMID:24534492

  4. Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site

    PubMed Central

    Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J.

    2016-01-01

    ABSTRACT Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. IMPORTANCE We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. PMID:26764003

  5. Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site.

    PubMed

    Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J; Hogle, James M

    2016-01-13

    Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. A lipid-binding loop of botulinum neurotoxin serotypes B, DC and G is an essential feature to confer their exquisite potency

    PubMed Central

    Le Blanc, Alexander; Mahrhold, Stefan; Piesker, Janett; Luppa, Peter B.

    2018-01-01

    The exceptional toxicity of botulinum neurotoxins (BoNTs) is mediated by high avidity binding to complex polysialogangliosides and intraluminal segments of synaptic vesicle proteins embedded in the presynaptic membrane. One peculiarity is an exposed hydrophobic loop in the toxin’s cell binding domain HC, which is located between the ganglioside- and protein receptor-binding sites, and that is particularly pronounced in the serotypes BoNT/B, DC, and G sharing synaptotagmin as protein receptor. Here, we provide evidence that this HC loop is a critical component of their tripartite receptor recognition complex. Binding to nanodisc-embedded receptors and toxicity were virtually abolished in BoNT mutants lacking residues at the tip of the HC loop. Surface plasmon resonance experiments revealed that only insertion of the HC loop into the lipid-bilayer compensates for the entropic penalty inflicted by the dual-receptor binding. Our results represent a new paradigm of how BoNT/B, DC, and G employ ternary interactions with a protein, ganglioside, and lipids to mediate their extraordinary neurotoxicity. PMID:29718991

  7. Structural basis of arrestin-3 activation and signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Qiuyan; Perry, Nicole A.; Vishnivetskiy, Sergey A.

    A unique aspect of arrestin-3 is its ability to support both receptor-dependent and receptor-independent signaling. Here, we show that inositol hexakisphosphate (IP6) is a non-receptor activator of arrestin-3 and report the structure of IP6-activated arrestin-3 at 2.4-Å resolution. IP6-activated arrestin-3 exhibits an inter-domain twist and a displaced C-tail, hallmarks of active arrestin. IP6 binds to the arrestin phosphate sensor, and is stabilized by trimerization. Analysis of the trimerization surface, which is also the receptor-binding surface, suggests a feature called the finger loop as a key region of the activation sensor. We show that finger loop helicity and flexibility may underliemore » coupling to hundreds of diverse receptors and also promote arrestin-3 activation by IP6. Importantly, we show that effector-binding sites on arrestins have distinct conformations in the basal and activated states, acting as switch regions. These switch regions may work with the inter-domain twist to initiate and direct arrestin-mediated signaling.« less

  8. Calcium-binding proteins and development

    NASA Technical Reports Server (NTRS)

    Beckingham, K.; Lu, A. Q.; Andruss, B. F.; McIntire, L. V. (Principal Investigator)

    1998-01-01

    The known roles for calcium-binding proteins in developmental signaling pathways are reviewed. Current information on the calcium-binding characteristics of three classes of cell-surface developmental signaling proteins (EGF-domain proteins, cadherins and integrins) is presented together with an overview of the intracellular pathways downstream of these surface receptors. The developmental roles delineated to date for the universal intracellular calcium sensor, calmodulin, and its targets, and for calcium-binding regulators of the cytoskeleton are also reviewed.

  9. Antibody neutralization of retargeted measles viruses.

    PubMed

    Lech, Patrycja J; Pappoe, Roland; Nakamura, Takafumi; Tobin, Gregory J; Nara, Peter L; Russell, Stephen J

    2014-04-01

    The measles virus (MV) vaccine lineage is a promising oncolytic but prior exposure to the measles vaccine or wild-type MV strains limits treatment utility due to the presence of anti-measles antibodies. MV entry can be redirected by displaying a polypeptide ligand on the Hemagglutinin (H) C-terminus. We hypothesized that retargeted MV would escape neutralization by monoclonal antibodies (mAbs) recognizing the H receptor-binding surface and be less susceptible to neutralization by human antisera. Using chimeric H proteins, with and without mutations that ablate MV receptor binding, we show that retargeted MVs escape mAbs that target the H receptor-binding surface by virtue of mutations that ablate infection via SLAM and CD46. However, C-terminally displayed domains do not mediate virus entry in the presence of human antibodies that bind to the underlying H domain. In conclusion, utility of retargeted oncolytic measles viruses does not extend to evasion of human serum neutralization. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  10. α-Helical element at the hormone-binding surface of the insulin receptor functions as a signaling element to activate its tyrosine kinase

    PubMed Central

    Whittaker, Jonathan; Whittaker, Linda J.; Roberts, Charles T.; Phillips, Nelson B.; Ismail-Beigi, Faramarz; Lawrence, Michael C.; Weiss, Michael A.

    2012-01-01

    The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo–cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation. PMID:22736795

  11. α-Helical element at the hormone-binding surface of the insulin receptor functions as a signaling element to activate its tyrosine kinase.

    PubMed

    Whittaker, Jonathan; Whittaker, Linda J; Roberts, Charles T; Phillips, Nelson B; Ismail-Beigi, Faramarz; Lawrence, Michael C; Weiss, Michael A

    2012-07-10

    The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo-cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation.

  12. Monomeric ephrinB2 binding induces allosteric changes in Nipah virus G that precede its full activation.

    PubMed

    Wong, Joyce J W; Young, Tracy A; Zhang, Jiayan; Liu, Shiheng; Leser, George P; Komives, Elizabeth A; Lamb, Robert A; Zhou, Z Hong; Salafsky, Joshua; Jardetzky, Theodore S

    2017-10-03

    Nipah virus is an emergent paramyxovirus that causes deadly encephalitis and respiratory infections in humans. Two glycoproteins coordinate the infection of host cells, an attachment protein (G), which binds to cell surface receptors, and a fusion (F) protein, which carries out the process of virus-cell membrane fusion. The G protein binds to ephrin B2/3 receptors, inducing G conformational changes that trigger F protein refolding. Using an optical approach based on second harmonic generation, we show that monomeric and dimeric receptors activate distinct conformational changes in G. The monomeric receptor-induced changes are not detected by conformation-sensitive monoclonal antibodies or through electron microscopy analysis of G:ephrinB2 complexes. However, hydrogen/deuterium exchange experiments confirm the second harmonic generation observations and reveal allosteric changes in the G receptor binding and F-activating stalk domains, providing insights into the pathway of receptor-activated virus entry.Nipah virus causes encephalitis in humans. Here the authors use a multidisciplinary approach to study the binding of the viral attachment protein G to its host receptor ephrinB2 and show that monomeric and dimeric receptors activate distinct conformational changes in G and discuss implications for receptor-activated virus entry.

  13. The epidermal growth factor receptor (EGFR) promotes uptake of influenza A viruses (IAV) into host cells.

    PubMed

    Eierhoff, Thorsten; Hrincius, Eike R; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

    2010-09-09

    Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake.

  14. The Epidermal Growth Factor Receptor (EGFR) Promotes Uptake of Influenza A Viruses (IAV) into Host Cells

    PubMed Central

    Eierhoff, Thorsten; Hrincius, Eike R.; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

    2010-01-01

    Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake. PMID:20844577

  15. Lipoprotein lipase-dependent binding and uptake of low density lipoproteins by THP-1 monocytes and macrophages: possible involvement of lipid rafts.

    PubMed

    Makoveichuk, Elena; Castel, Susanna; Vilaró, Senen; Olivecrona, Gunilla

    2004-11-08

    Lipoprotein lipase (LPL) is produced by cells in the artery wall and can mediate binding of lipoproteins to cell surface heparan sulfate proteoglycans (HSPG), resulting in endocytosis (the bridging function). Active, dimeric LPL may dissociate to inactive monomers, the main form found in plasma. We have studied binding/internalization of human low density lipoprotein (LDL), mediated by bovine LPL, using THP-1 monocytes and macrophages. Uptake of (125)I-LDL was similar in monocytes and macrophages and was not affected by the LDL-receptor family antagonist receptor-associated protein (RAP) or by the phagocytosis inhibitor cytochalasin D. In contrast, uptake depended on HSPG and on membrane cholesterol. Incubation in the presence of dexamethasone increased the endogenous production of LPL by the cells and also increased LPL-mediated binding of LDL to the cell surfaces. Monomeric LPL was bound to the cells mostly in a heparin-resistant fashion. We conclude that the uptake of LDL mediated by LPL dimers is receptor-independent and involves cholesterol-enriched membrane areas (lipid rafts). Dimeric and monomeric LPL differ in their ability to mediate binding/uptake of LDL, probably due to different mechanisms for binding/internalization.

  16. Down-modulation of receptors for phorbol ester tumor promoter in primary epidermal cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solanki, V.; Slaga, T.J.

    1982-01-01

    The specific (20-/sup 3/H)phorbol 12,13-dibutyrate ((/sup 3/H)PDBu) binding to intact epidermal cells displayed the phenomenon of down-modulation, i.e., the specific binding of (/sup 3/H)PDBu to its receptors on primary epidermal cells reached a maximum within 1 h and steadily declined thereafter. The apparent down-modulation of radiolabel resulted from a partial loss in the total number of receptors; the affinity of receptors for the ligand was essentially unchanged. A number of agents such as chloroquine, methylamine, or arginine which are known to prevent clustering, down-modulation, and/or internalization of several hormone receptors did not affect the down-modulation of phorbol ester receptors. Furthermore,more » cycloheximide had no effect either on down-modulation or on the binding capacity of cells. The surface binding capacity of down-modulated cells following a 90-min incubation with unlabeled ligand was almost returned to normal within 1 h. The effect of the antidepressant drug chlorpromazine, which is known to interact with calmodulin, on (/sup 3/H)PDBu binding was also investigated. Our data indicate that the effect of chlorpromazine on (/sup 3/H)PDBu binding is probably unrelated to its calmodulin-binding activity.« less

  17. The neuronal Ca(2+) -binding protein 2 (NECAB2) interacts with the adenosine A(2A) receptor and modulates the cell surface expression and function of the receptor.

    PubMed

    Canela, Laia; Luján, Rafael; Lluís, Carme; Burgueño, Javier; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Ciruela, Francisco

    2007-09-01

    Heptaspanning membrane also known as G protein-coupled receptors (GPCR) do interact with a variety of intracellular proteins whose function is regulate receptor traffic and/or signaling. Using a yeast two-hybrid screen, NECAB2, a neuronal calcium binding protein, was identified as a binding partner for the adenosine A(2A) receptor (A(2A)R) interacting with its C-terminal domain. Co-localization, co-immunoprecipitation and pull-down experiments showed a close and specific interaction between A(2A)R and NECAB2 in both transfected HEK-293 cells and also in rat striatum. Immunoelectron microscopy detection of NECAB2 and A(2A)R in the rat striatopallidal structures indicated that both proteins are co-distributed in the same glutamatergic nerve terminals. The interaction of NECAB2 with A(2A)R modulated the cell surface expression, the ligand-dependent internalization and the receptor-mediated activation of the MAPK pathway. Overall, these results show that A(2A)R interacts with NECAB2 in striatal neurones co-expressing the two proteins and that the interaction is relevant for A(2A)R function.

  18. In vitro expressed GPCR inserted in polymersome membranes for ligand-binding studies.

    PubMed

    May, Sylvia; Andreasson-Ochsner, Mirjam; Fu, Zhikang; Low, Ying Xiu; Tan, Darren; de Hoog, Hans-Peter M; Ritz, Sandra; Nallani, Madhavan; Sinner, Eva-Kathrin

    2013-01-07

    The dopamine receptor D2 (DRD2), a G-protein coupled receptor is expressed into PBd(22)-PEO(13) and PMOXA(20)-PDMS(54)-PMOXA(20) block copolymer vesicles. The conformational integrity of the receptor is confirmed by antibody- and ligand-binding assays. Replacement of bound dopamine is demonstrated on surface-immobilized polymersomes, thus making this a promising platform for drug screening. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Crystal structure of LGR4-Rspo1 complex: insights into the divergent mechanisms of ligand recognition by leucine-rich repeat G-protein-coupled receptors (LGRs).

    PubMed

    Xu, Jin-Gen; Huang, Chunfeng; Yang, Zhengfeng; Jin, Mengmeng; Fu, Panhan; Zhang, Ni; Luo, Jian; Li, Dali; Liu, Mingyao; Zhou, Yan; Zhu, Yongqun

    2015-01-23

    Leucine-rich repeat G-protein-coupled receptors (LGRs) are a unique class of G-protein-coupled receptors characterized by a large extracellular domain to recognize ligands and regulate many important developmental processes. Among the three groups of LGRs, group B members (LGR4-6) recognize R-spondin family proteins (Rspo1-4) to stimulate Wnt signaling. In this study, we successfully utilized the "hybrid leucine-rich repeat technique," which fused LGR4 with the hagfish VLR protein, to obtain two recombinant human LGR4 proteins, LGR415 and LGR49. We determined the crystal structures of ligand-free LGR415 and the LGR49-Rspo1 complex. LGR4 exhibits a twisted horseshoe-like structure. Rspo1 adopts a flat and β-fold architecture and is bound in the concave surface of LGR4 in the complex through electrostatic and hydrophobic interactions. All the Rspo1-binding residues are conserved in LGR4-6, suggesting that LGR4-6 bind R-spondins through an identical surface. Structural analysis of our LGR4-Rspo1 complex with the previously determined LGR4 and LGR5 structures revealed that the concave surface of LGR4 is the sole binding site for R-spondins, suggesting a one-site binding model of LGR4-6 in ligand recognition. The molecular mechanism of LGR4-6 is distinct from the two-step mechanism of group A receptors LGR1-3 and the multiple-interface binding model of group C receptors LGR7-8, suggesting LGRs utilize the divergent mechanisms for ligand recognition. Our structures, together with previous reports, provide a comprehensive understanding of the ligand recognition by LGRs. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Study of Receptor-Chaperone Interactions Using the Optical Technique of Spectroscopic Ellipsometry

    PubMed Central

    Kriechbaumer, Verena; Tsargorodskaya, Anna; Mustafa, Mohd K.; Vinogradova, Tatiana; Lacey, Joanne; Smith, David P.; Abell, Benjamin M.; Nabok, Alexei

    2011-01-01

    This work describes a detailed quantitative interaction study between the novel plastidial chaperone receptor OEP61 and isoforms of the chaperone types Hsp70 and Hsp90 using the optical method of total internal reflection ellipsometry (TIRE). The receptor OEP61 was electrostatically immobilized on a gold surface via an intermediate layer of polycations. The TIRE measurements allowed the evaluation of thickness changes in the adsorbed molecular layers as a result of chaperone binding to receptor proteins. Hsp70 chaperone isoforms but not Hsp90 were shown to be capable of binding OEP61. Dynamic TIRE measurements were carried out to evaluate the affinity constants of the above reactions and resulted in clear discrimination between specific and nonspecific binding of chaperones as well as differences in binding properties between the highly similar Hsp70 isoforms. PMID:21767504

  1. Ligand-independent activation of the oestrogen receptor by mutation of a conserved tyrosine.

    PubMed Central

    White, R; Sjöberg, M; Kalkhoven, E; Parker, M G

    1997-01-01

    The oestrogen receptor is a member of the nuclear receptor family of transcription factors which, on binding the steroid hormone 17beta-oestradiol, interacts with co-activator proteins and stimulates gene expression. Replacement of a single tyrosine in the hormone-binding domain generated activated forms of the receptor which stimulated transcription in the absence of hormone. This increased activation is related to a decrease in hydrophobicity and a reduction in size of the side chain of the amino acid with which the tyrosine is replaced. Ligand-independent, in common with ligand-dependent transcriptional activation, requires an amphipathic alpha-helix at the C-terminus of the ligand-binding domain which is essential for the interaction of the receptor with a number of potential co-activator proteins. In contrast to the wild-type protein, constitutively active receptors were able to bind both the receptor-interacting protein RIP-140 and the steroid receptor co-activator SRC-1 in a ligand-independent manner, although in the case of SRC-1 this was only evident when the receptors were prebound to DNA. We propose, therefore, that this tyrosine is required to maintain the receptor in a transcriptionally inactive state in the absence of hormone. Modification of this residue may generate a conformational change in the ligand-binding domain of the receptor to form an interacting surface which allows the recruitment of co-activators independent of hormone binding. This suggests that this tyrosine may be a target for a different signalling pathway which forms an alternative mechanism of activating oestrogen receptor-mediated transcription. PMID:9135157

  2. Inhibition of experimental ascending urinary tract infection by an epithelial cell-surface receptor analogue

    NASA Astrophysics Data System (ADS)

    Edén, C. Svanborg; Freter, R.; Hagberg, L.; Hull, R.; Hull, S.; Leffler, H.; Schoolnik, G.

    1982-08-01

    It has been shown that the establishment of urinary tract infection by Escherichia coli is dependent on attachment of the bacteria to epithelial cells1-4. The attachment involves specific epithelial cell receptors, which have been characterized as glycolipids5-10. Reversible binding to cell-surface mannosides may also be important4,11-13. This suggests an approach to the treatment of infections-that of blocking bacterial attachment with cell membrane receptor analogues. Using E. coli mutants lacking one or other of the two binding specificities (glycolipid and mannose), we show here that glycolipid analogues can block in vitro adhesion and in vivo urinary tract infection.

  3. Dominant role of local dipolar interactions in phosphate binding to a receptor cleft with an electronegative charge surface: equilibrium, kinetic, and crystallographic studies.

    PubMed

    Ledvina, P S; Tsai, A L; Wang, Z; Koehl, E; Quiocho, F A

    1998-12-01

    Stringent specificity and complementarity between the receptor, a periplasmic phosphate-binding protein (PBP) with a two-domain structure, and the completely buried and dehydrated phosphate are achieved by hydrogen bonding or dipolar interactions. We recently found that the surface charge potential of the cleft between the two domains that contains the anion binding site is intensely electronegative. This novel finding prompted the study reported here of the effect of ionic strength on the equilibrium and rapid kinetics of phosphate binding. To facilitate this study, Ala197, located on the edge of the cleft, was replaced by a Trp residue (A197W PBP) to generate a fluorescence reporter group. The A197W PBP-phosphate complex retains wild-type Kd and X-ray structure beyond the replacement residue. The Kd (0.18 microM) at no salt is increased by 20-fold at greater than 0.30 M NaCl. Stopped-flow fluorescence kinetic studies indicate a two-step binding process: (1) The phosphate (L) binds, at near diffusion-controlled rate, to the open cleft form (Po) of PBP to produce an intermediate, PoL. This rate decreases with increasing ionic strength. (2) The intermediate isomerizes to the closed-conformation form, PcL. The results indicate that the high specificity, affinity, and rate of phosphate binding are not influenced by the noncomplementary electronegative surface potential of the cleft. That binding depends almost entirely on local dipolar interactions with the receptor has important ramification in electrostatic interactions in protein structures and in ligand recognition.

  4. In silico analysis of AHJD-like viruses, Staphylococcus aureus phages S24-1 and S13′, and study of phage S24-1 adsorption

    PubMed Central

    Uchiyama, Jumpei; Takemura-Uchiyama, Iyo; Kato, Shin-ichiro; Sato, Miho; Ujihara, Takako; Matsui, Hidehito; Hanaki, Hideaki; Daibata, Masanori; Matsuzaki, Shigenobu

    2014-01-01

    Staphylococcus aureus is a clinically important bacterium that is commensal in both humans and animals. Bacteriophage (phage) attachment to the host bacterial surface is an important process during phage infection, which involves interactions between phage receptor-binding proteins and host receptor molecules. However, little information is available on the receptor-binding protein of S. aureus phages. S. aureus virulent phages S24-1 and S13′ (family Podoviridae, genus AHJD-like viruses) were isolated from sewage. In the present study, we investigated the receptor-binding protein of AHJD-like viruses using phage S24-1. First, based on a comparative genomic analysis of phages S24-1 and S13′, open reading frame 16 (ORF16) of phage S24-1 was speculated to be the receptor-binding protein, which possibly determines the host range. Second, we demonstrated that this was the receptor-binding protein of phage S24-1. Third, our study suggested that wall teichoic acids in the cell walls of S. aureus are the main receptor molecules for ORF16 and phage S24-1. Finally, the C-terminal region of ORF16 may be essential for binding to S. aureus. These results strongly suggest that ORF16 of phage S24-1 and its homologs may be the receptor-binding proteins of AHJD-like viruses. PMID:24591378

  5. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  6. Stress Proteins and Initiation of Immune Response: Chaperokine activity of Hsp72

    PubMed Central

    Asea, Alexzander

    2006-01-01

    From its original description as solely an intracellular molecular chaperone, heat shock proteins have now been shown to function as initiators of the host's immune response. Although the exact mechanism by which intracellular heat shock proteins leave cells is still incompletely understood, recent work from several labs suggest that heat shock proteins are released by both passive (necrotic) and active (physiological) mechanisms. Binding to specific surface receptors is a prerequisite for the initiation of an immune response. To date, several cell surface proteins have been described as the receptor for seventy kilo-Dalton heat shock protein (Hsp70) including Toll-like receptors 2 and 4 with their cofactor CD14, the scavenger receptor CD36, the low-density lipoprotein receptor-related protein CD91, the C-type lectin receptor LOX-1, and another member of the scavenger super-family SR-A plus the co-stimulatory molecule, CD40. Binding of Hsp70 to these surface receptors specifically activates intracellular signaling cascades, which in turn exert immunoregulatory effector functions; a process known as the chaperokine activity of Hsp70. This review will highlight recent advances in understanding the mechanism by which Hsp70 initiates the host's immune response. PMID:16385842

  7. Stress proteins and initiation of immune response: chaperokine activity of hsp72.

    PubMed

    Asea, Alexzander

    2005-01-01

    From its original description as solely an intracellular molecular chaperone, heat shock proteins have now been shown to function as initiators of the host's immune response. Although the exact mechanism by which intracellular heat shock proteins leave cells is still incompletely understood, recent work from several labs suggest that heat shock proteins are released by both passive (necrotic) and active (physiological) mechanisms. Binding to specific surface receptors is a prerequisite for the initiation of an immune response. To date, several cell surface proteins have been described as the receptor for seventy kilo-Dalton heat shock protein (Hsp70) including Toll-like receptors 2 and 4 with their cofactor CD14, the scavenger receptor CD36, the low-density lipoprotein receptor-related protein CD91, the C-type lectin receptor LOX-1, and another member of the scavenger super-family SR-A plus the co-stimulatory molecule, CD40. Binding of Hsp70 to these surface receptors specifically activates intracellular signaling cascades, which in turn exert immunoregulatory effector functions; a process known as the chaperokine activity of Hsp70. This review will highlight recent advances in understanding the mechanism by which Hsp70 initiates the host's immune response.

  8. Characterization of the Igf-II Binding Site of the IGF-II/MAN-6-P Receptor Extracellular Domain.

    NASA Astrophysics Data System (ADS)

    Garmroudi, Farideh

    1995-01-01

    In mammals, insulin-like growth factor II (IGF -II) and glycoproteins bearing the mannose 6-phosphate (Man -6-P) recognition marker bind with high affinity to the same receptor. The functional consequences of IGF-II binding to the receptor at the cell surface are not clear. In these studies, we sought to broaden our understanding of the functional regions of the receptor regarding its IGF -II binding site. The IGF-II binding/cross-linking domain of the IGF-II/Man-6-P receptor was mapped by sequencing receptor fragments covalently attached to IGF-II. Purified rat placental or bovine liver receptors were affinity-labeled, with ^{125}I-IGF-II and digested with endoproteinase Glu-C. Analysis of digests by gel electrophoresis revealed a major radiolabeled band of 18 kDa, which was purified by gel filtration chromatography followed by reverse-phase HPLC and electroblotting. Sequence analysis revealed that, the peptide S(H)VNSXPMF, located within extracellular repeat 10 and beginning with serine 1488 of the bovine receptor, was the best candidate for the IGF-II cross-linked peptide. These data indicated that residues within repeats 10-11 were important for IGF -II binding. To define the location of the IGF-II binding site further, a nested set of six human receptor cDNA constructs was designed to produce epitope-tagged fusion proteins encompassing the region between repeats 8 and 11 of the human IGF-II/Man-6-P receptor extracellular domain. These truncated receptors were transiently expressed in COS-7 cells, immunoprecipitated and analyzed for their abilities to bind and cross-link to IGF-II. All of the constructs were capable of binding/cross-linking to IGF-II, except for the 9.0-11 construct. Displacement curve analysis indicated that the truncated receptors were approximately equivalent in IGF-II binding affinity, but were of 5- to 10-fold lower affinity than full-length receptors. Sequencing of the 9.0-11 construct indicated the presence of a point mutation substituting threonine for isoleucine at position 1621, which is located in the N-terminal half of repeat 11, and was found to abrogate IGF-II binding. Collectively, our work indicates that repeat 11 of the IGF-II/Man-6-P receptor's extracellular domain encompasses the elements both for binding and cross-linking to IGF-II.

  9. Synthetic heparin-binding growth factor analogs

    DOEpatents

    Pena, Louis A.; Zamora, Paul; Lin, Xinhua; Glass, John D.

    2007-01-23

    The invention provides synthetic heparin-binding growth factor analogs having at least one peptide chain that binds a heparin-binding growth factor receptor, covalently bound to a hydrophobic linker, which is in turn covalently bound to a non-signaling peptide that includes a heparin-binding domain. The synthetic heparin-binding growth factor analogs are useful as soluble biologics or as surface coatings for medical devices.

  10. Human adenovirus serotypes 3 and 5 bind to two different cellular receptors via the fiber head domain.

    PubMed Central

    Stevenson, S C; Rollence, M; White, B; Weaver, L; McClelland, A

    1995-01-01

    The adenovirus fiber protein is responsible for attachment of the virion to cell surface receptors. The identity of the cellular receptor which mediates binding is unknown, although there is evidence suggesting that two distinct adenovirus receptors interact with the group C (adenovirus type 5 [Ad5]) and the group B (Ad3) adenoviruses. In order to define the determinants of adenovirus receptor specificity, we have carried out a series of competition binding experiments using recombinant native fiber polypeptides from Ad5 and Ad3 and chimeric fiber proteins in which the head domains of Ad5 and Ad3 were exchanged. Specific binding of fiber to HeLa cell receptors was assessed with radiolabeled protein synthesized in vitro, and by competition analysis with baculovirus-expressed fiber protein. Fiber produced in vitro was found as both monomer and trimer, but only the assembled trimers had receptor binding activity. Competition data support the conclusion that Ad5 and Ad3 interact with different cellular receptors. The Ad5 receptor distribution on several cell lines was assessed with a fiber binding flow cytometric assay. HeLa cells were found to express high levels of receptor, while CHO and human diploid fibroblasts did not. A chimeric fiber containing the Ad5 fiber head domain blocked the binding of Ad5 fiber but not Ad3 fiber. Similarly, a chimeric fiber containing the Ad3 fiber head blocked the binding of labeled Ad3 fiber but not Ad5 fiber. In addition, the isolated Ad3 fiber head domain competed effectively with labeled Ad3 fiber for binding to HeLa cell receptors. These results demonstrate that the determinants of receptor binding are located in the head domain of the fiber and that the isolated head domain is capable of trimerization and binding to cellular receptors. Our results also show that it is possible to change the receptor specificity of the fiber protein by manipulation of sequences contained in the head domain. Modification or replacement of the fiber head domain with novel ligands may permit adenovirus vectors with new receptor specificities which could be useful for targeted gene delivery in vivo to be engineered. PMID:7707507

  11. Rapid molecular evolution across amniotes of the IIS/TOR network

    PubMed Central

    McGaugh, Suzanne E.; Bronikowski, Anne M.; Kuo, Chih-Horng; Reding, Dawn M.; Addis, Elizabeth A.; Flagel, Lex E.; Janzen, Fredric J.

    2015-01-01

    The insulin/insulin-like signaling and target of rapamycin (IIS/TOR) network regulates lifespan and reproduction, as well as metabolic diseases, cancer, and aging. Despite its vital role in health, comparative analyses of IIS/TOR have been limited to invertebrates and mammals. We conducted an extensive evolutionary analysis of the IIS/TOR network across 66 amniotes with 18 newly generated transcriptomes from nonavian reptiles and additional available genomes/transcriptomes. We uncovered rapid and extensive molecular evolution between reptiles (including birds) and mammals: (i) the IIS/TOR network, including the critical nodes insulin receptor substrate (IRS) and phosphatidylinositol 3-kinase (PI3K), exhibit divergent evolutionary rates between reptiles and mammals; (ii) compared with a proxy for the rest of the genome, genes of the IIS/TOR extracellular network exhibit exceptionally fast evolutionary rates; and (iii) signatures of positive selection and coevolution of the extracellular network suggest reptile- and mammal-specific interactions between members of the network. In reptiles, positively selected sites cluster on the binding surfaces of insulin-like growth factor 1 (IGF1), IGF1 receptor (IGF1R), and insulin receptor (INSR); whereas in mammals, positively selected sites clustered on the IGF2 binding surface, suggesting that these hormone-receptor binding affinities are targets of positive selection. Further, contrary to reports that IGF2R binds IGF2 only in marsupial and placental mammals, we found positively selected sites clustered on the hormone binding surface of reptile IGF2R that suggest that IGF2R binds to IGF hormones in diverse taxa and may have evolved in reptiles. These data suggest that key IIS/TOR paralogs have sub- or neofunctionalized between mammals and reptiles and that this network may underlie fundamental life history and physiological differences between these amniote sister clades. PMID:25991861

  12. Rapid molecular evolution across amniotes of the IIS/TOR network.

    PubMed

    McGaugh, Suzanne E; Bronikowski, Anne M; Kuo, Chih-Horng; Reding, Dawn M; Addis, Elizabeth A; Flagel, Lex E; Janzen, Fredric J; Schwartz, Tonia S

    2015-06-02

    The insulin/insulin-like signaling and target of rapamycin (IIS/TOR) network regulates lifespan and reproduction, as well as metabolic diseases, cancer, and aging. Despite its vital role in health, comparative analyses of IIS/TOR have been limited to invertebrates and mammals. We conducted an extensive evolutionary analysis of the IIS/TOR network across 66 amniotes with 18 newly generated transcriptomes from nonavian reptiles and additional available genomes/transcriptomes. We uncovered rapid and extensive molecular evolution between reptiles (including birds) and mammals: (i) the IIS/TOR network, including the critical nodes insulin receptor substrate (IRS) and phosphatidylinositol 3-kinase (PI3K), exhibit divergent evolutionary rates between reptiles and mammals; (ii) compared with a proxy for the rest of the genome, genes of the IIS/TOR extracellular network exhibit exceptionally fast evolutionary rates; and (iii) signatures of positive selection and coevolution of the extracellular network suggest reptile- and mammal-specific interactions between members of the network. In reptiles, positively selected sites cluster on the binding surfaces of insulin-like growth factor 1 (IGF1), IGF1 receptor (IGF1R), and insulin receptor (INSR); whereas in mammals, positively selected sites clustered on the IGF2 binding surface, suggesting that these hormone-receptor binding affinities are targets of positive selection. Further, contrary to reports that IGF2R binds IGF2 only in marsupial and placental mammals, we found positively selected sites clustered on the hormone binding surface of reptile IGF2R that suggest that IGF2R binds to IGF hormones in diverse taxa and may have evolved in reptiles. These data suggest that key IIS/TOR paralogs have sub- or neofunctionalized between mammals and reptiles and that this network may underlie fundamental life history and physiological differences between these amniote sister clades.

  13. Dynamic dual-tracer MRI-guided fluorescence tomography to quantify receptor density in vivo

    PubMed Central

    Davis, Scott C.; Samkoe, Kimberley S.; Tichauer, Kenneth M.; Sexton, Kristian J.; Gunn, Jason R.; Deharvengt, Sophie J.; Hasan, Tayyaba; Pogue, Brian W.

    2013-01-01

    The up-regulation of cell surface receptors has become a central focus in personalized cancer treatment; however, because of the complex nature of contrast agent pharmacokinetics in tumor tissue, methods to quantify receptor binding in vivo remain elusive. Here, we present a dual-tracer optical technique for noninvasive estimation of specific receptor binding in cancer. A multispectral MRI-coupled fluorescence molecular tomography system was used to image the uptake kinetics of two fluorescent tracers injected simultaneously, one tracer targeted to the receptor of interest and the other tracer a nontargeted reference. These dynamic tracer data were then fit to a dual-tracer compartmental model to estimate the density of receptors available for binding in the tissue. Applying this approach to mice with deep-seated gliomas that overexpress the EGF receptor produced an estimate of available receptor density of 2.3 ± 0.5 nM (n = 5), consistent with values estimated in comparative invasive imaging and ex vivo studies. PMID:23671066

  14. Targeted Type 1 phototherapeutic agents using azido-peptide bioconjugates

    NASA Astrophysics Data System (ADS)

    Rajagopalan, Raghavan; Achilefu, Samuel I.; Jimenez, Hermo N.; Webb, Elizabeth G.; Schmidt, Michelle A.; Bugaj, Joseph E.; Dorshow, Richard B.

    2001-07-01

    Five peptides binding to somatostatin and bombesin receptors were conjugated to 4-azido-2,3,4,6-tetrafluorophenylbenzoic acid, a Type 1 photosensitizer, at the N-terminal position. The receptor affinities were determined by competition binding assay using two different pancreatic tumor cell lines, CA20948 and AR42-J, that expresses somatostatin-2 (SST-2) and bombesin receptors receptively. All compounds exhibited high receptor specificity, i.e., the IC50 values ranged between 1.0 to 64.0 nM. These conjugates may be useful for targeted Type 1 phototherapy via the generation of nitrenes at the cell surfaces expressing these receptors.

  15. Measles Virus (MV) Nucleoprotein Binds to a Novel Cell Surface Receptor Distinct from FcγRII via Its C-Terminal Domain: Role in MV-Induced Immunosuppression

    PubMed Central

    Laine, David; Trescol-Biémont, Marie-Claude; Longhi, Sonia; Libeau, Geneviève; Marie, Julien C.; Vidalain, Pierre-Olivier; Azocar, Olga; Diallo, Adama; Canard, Bruno; Rabourdin-Combe, Chantal; Valentin, Hélène

    2003-01-01

    During acute measles virus (MV) infection, an efficient immune response occurs, followed by a transient but profound immunosuppression. MV nucleoprotein (MV-N) has been reported to induce both cellular and humoral immune responses and paradoxically to account for immunosuppression. Thus far, this latter activity has been attributed to MV-N binding to human and murine FcγRII. Here, we show that apoptosis of MV-infected human thymic epithelial cells (TEC) allows the release of MV-N in the extracellular compartment. This extracellular N is then able to bind either to MV-infected or uninfected TEC. We show that recombinant MV-N specifically binds to a membrane protein receptor, different from FcγRII, highly expressed on the cell surface of TEC. This new receptor is referred to as nucleoprotein receptor (NR). In addition, different Ns from other MV-related morbilliviruses can also bind to FcγRII and/or NR. We show that the region of MV-N responsible for binding to NR maps to the C-terminal fragment (NTAIL). Binding of MV-N to NR on TEC triggers sustained calcium influx and inhibits spontaneous cell proliferation by arresting cells in the G0 and G1 phases of the cell cycle. Finally, MV-N binds to both constitutively expressed NR on a large spectrum of cells from different species and to human activated T cells, leading to suppression of their proliferation. These results provide evidence that MV-N, after release in the extracellular compartment, binds to NR and thereby plays a role in MV-induced immunosuppression. PMID:14557619

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Song, Wenfei; Wang, Ying; Wang, Nianshuang

    Middle East respiratory syndrome coronavirus (MERS-CoV) infects host cells through binding the receptor binding domain (RBD) on its spike glycoprotein to human receptor dipeptidyl peptidase 4 (hDPP4). Here, we report identification of critical residues on hDPP4 for RBD binding and virus entry through analysis of a panel of hDPP4 mutants. Based on the RBD–hDPP4 crystal structure we reported, the mutated residues were located at the interface between RBD and hDPP4, which potentially changed the polarity, hydrophobic or hydrophilic properties of hDPP4, thereby interfering or disrupting their interaction with RBD. Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay,more » we showed that several residues in hDPP4–RBD binding interface were important on hDPP4–RBD binding and viral entry. These results provide atomic insights into the features of interactions between hDPP4 and MERS-CoV RBD, and also provide potential explanation for cellular and species tropism of MERS-CoV infection. - Highlights: • It has been demonstrated that MERS-CoV infects host cells through binding its envelope spike (S) glycoprotein to the host cellular receptor dipeptidyl peptidase 4 (DPP4). • To identify the critical residues on hDPP4 for RBD binding and virus entry, we constructed a panel of hDPP4 mutants based on structure-guided mutagenesis. • Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay, we showed that several residues on hDPP4 had significant impacts on virus/receptor interactions and viral entry. • Our study has provided new insights into the features of interactions between hDPP4 and MERS-CoV RBD, and provides potential explanation for cellular and species tropism of MERS-CoV infection.« less

  17. The PD-1/PD-L1 complex resembles the antigen-binding Fv domains of antibodies and T cell receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, David Yin-wei; Tanaka, Yoshimasa; Iwasaki, Masashi

    2008-07-29

    Signaling through the programmed death 1 (PD-1) inhibitory receptor upon binding its ligand, PD-L1, suppresses immune responses against autoantigens and tumors and plays an important role in the maintenance of peripheral immune tolerance. Release from PD-1 inhibitory signaling revives 'exhausted' virus-specific T cells in chronic viral infections. Here we present the crystal structure of murine PD-1 in complex with human PD-L1. PD-1 and PD-L1 interact through the conserved front and side of their Ig variable (IgV) domains, as do the IgV domains of antibodies and T cell receptors. This places the loops at the ends of the IgV domains onmore » the same side of the PD-1/PD-L1 complex, forming a surface that is similar to the antigen-binding surface of antibodies and T cell receptors. Mapping conserved residues allowed the identification of residues that are important in forming the PD-1/PD-L1 interface. Based on the structure, we show that some reported loss-of-binding mutations involve the PD-1/PD-L1 interaction but that others compromise protein folding. The PD-1/PD-L1 interaction described here may be blocked by antibodies or by designed small-molecule drugs to lower inhibitory signaling that results in a stronger immune response. The immune receptor-like loops offer a new surface for further study and potentially the design of molecules that would affect PD-1/PD-L1 complex formation and thereby modulate the immune response.« less

  18. Expression profile and ligand-binding characterization of odorant-binding protein 2 in Batocera horsfieldi (Hope)

    USDA-ARS?s Scientific Manuscript database

    Odorant-binding proteins (OBPs) are important components in insect olfactory systems that transport semiochemicals through the aqueous sensillum lymph to surface of olfactory receptor neurons. In this study, we cloned the cDNA of odorant-binding protein 2 (BhorOBP2) in Batocera horsfieldi (Hope) and...

  19. Mapping the Laminin Receptor Binding Domains of Neisseria meningitidis PorA and Haemophilus influenzae OmpP2

    PubMed Central

    Mahdavi, Jafar; Oldfield, Neil J.; Wheldon, Lee M.; Wooldridge, Karl G.; Ala'Aldeen, Dlawer A. A.

    2012-01-01

    Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae are major bacterial agents of meningitis. They each bind the 37/67-kDa laminin receptor (LamR) via the surface protein adhesins: meningococcal PilQ and PorA, H. influenzae OmpP2 and pneumococcal CbpA. We have previously reported that a surface-exposed loop of the R2 domain of CbpA mediates LamR-binding. Here we have identified the LamR-binding regions of PorA and OmpP2. Using truncated recombinant proteins we show that binding is dependent on amino acids 171–240 and 91–99 of PorA and OmpP2, respectively, which are predicted to localize to the fourth and second surface-exposed loops, respectively, of these proteins. Synthetic peptides corresponding to the loops bound LamR and could block LamR-binding to bacterial ligands in a dose dependant manner. Meningococci expressing PorA lacking the apex of loop 4 and H. influenzae expressing OmpP2 lacking the apex of loop 2 showed significantly reduced LamR binding. Since both loops are hyper-variable, our data may suggest a molecular basis for the range of LamR-binding capabilities previously reported among different meningococcal and H. influenzae strains. PMID:23049988

  20. Mapping the laminin receptor binding domains of Neisseria meningitidis PorA and Haemophilus influenzae OmpP2.

    PubMed

    Abouseada, Noha M; Assafi, Mahde Saleh A; Mahdavi, Jafar; Oldfield, Neil J; Wheldon, Lee M; Wooldridge, Karl G; Ala'Aldeen, Dlawer A A

    2012-01-01

    Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae are major bacterial agents of meningitis. They each bind the 37/67-kDa laminin receptor (LamR) via the surface protein adhesins: meningococcal PilQ and PorA, H. influenzae OmpP2 and pneumococcal CbpA. We have previously reported that a surface-exposed loop of the R2 domain of CbpA mediates LamR-binding. Here we have identified the LamR-binding regions of PorA and OmpP2. Using truncated recombinant proteins we show that binding is dependent on amino acids 171-240 and 91-99 of PorA and OmpP2, respectively, which are predicted to localize to the fourth and second surface-exposed loops, respectively, of these proteins. Synthetic peptides corresponding to the loops bound LamR and could block LamR-binding to bacterial ligands in a dose dependant manner. Meningococci expressing PorA lacking the apex of loop 4 and H. influenzae expressing OmpP2 lacking the apex of loop 2 showed significantly reduced LamR binding. Since both loops are hyper-variable, our data may suggest a molecular basis for the range of LamR-binding capabilities previously reported among different meningococcal and H. influenzae strains.

  1. Presence of Laminin Receptors in Staphylococcus aureus

    NASA Astrophysics Data System (ADS)

    Lopes, J. D.; Dos Reis, M.; Brentani, R. R.

    1985-07-01

    A characteristic feature of infection by Staphylococcus aureus is bloodstream invasion and widespread metastatic abscess formation. The ability to extravasate, which entails crossing the vascular basement membrane, appears to be critical for the organism's pathogenicity. Extravasation by normal and neoplastic mammalian cells has been correlated with the presence of specific cell surface receptors for the basement membrane glycoprotein laminin. Similar laminin receptors were found in Staphylococcus aureus but not in Staphylococcus epidermidis, a noninvasive pathogen. There were about 100 binding sites per cell, with an apparent binding affinity of 2.9 nanomolar. The molecular weight of the receptor was 50,000 and pI was 4.2. Eukaryotic laminin receptors were visualized by means of the binding of S. aureus in the presence of laminin. Prokaryotic and eukaryotic invasive cells might utilize similar, if not identical, mechanisms for invasion.

  2. Phosphatidylserine as an anchor for plasminogen and its plasminogen receptor, Histone H2B, to the macrophage surface

    PubMed Central

    DAS, R.; PLOW, E. F.

    2013-01-01

    Summary Background Plasminogen (Plg) binding to cell surface Plg receptors (Plg-Rs) on the surface of macrophages facilitates Plg activation and migration of these cells. Histone H2B (H2B) acts as a Plg-R and its cell surface expression is upregulated when monocytes are differentiated to macrophages via a pathway dependent on L-type Ca2+ channels and intracellular Ca2+. Objectives We sought to investigate the mechanism by which H2B, a protein without a transmembrane domain, is retained on themacrophage surface. Methods THP-1 monocytoid cells were induced to differentiate with interferon gamma + Vitamin D3 or to undergo apoptosis by treatment with camptothecin. Flow cytometry and cell surface biotinylation followed by Western blotting were used to measure the interrelationship between Plg binding, cell surface expression of H2B and outermembrane exposure of phosphatidylserine (PS). Results H2B interacted directly with PS via an electrostatic interaction. Anti-PS or PS binding proteins, annexin V and protein S, diminished H2B interaction with PS on the surface of differentiated or apoptotic cells and these same reagents inhibited Plg binding to these cells. L-type Ca2+ channels played a significant role in PS exposure, H2B surface expression and Plg binding induced either by differentiation or apoptosis. Conclusions These data suggest that H2B tethers to the surface of cells by interacting with PS on differentiated or apoptotic monocytoid cells. L-type Ca2+ channels regulate PS exposure on the surface of these cells. The exposed PS interacts directly with H2B and hence provides sites for Plg to bind to. PMID:21040449

  3. Receptor-mediated cell mechanosensing

    PubMed Central

    Chen, Yunfeng; Ju, Lining; Rushdi, Muaz; Ge, Chenghao; Zhu, Cheng

    2017-01-01

    Mechanosensing describes the ability of a cell to sense mechanical cues of its microenvironment, including not only all components of force, stress, and strain but also substrate rigidity, topology, and adhesiveness. This ability is crucial for the cell to respond to the surrounding mechanical cues and adapt to the changing environment. Examples of responses and adaptation include (de)activation, proliferation/apoptosis, and (de)differentiation. Receptor-mediated cell mechanosensing is a multistep process that is initiated by binding of cell surface receptors to their ligands on the extracellular matrix or the surface of adjacent cells. Mechanical cues are presented by the ligand and received by the receptor at the binding interface; but their transmission over space and time and their conversion into biochemical signals may involve other domains and additional molecules. In this review, a four-step model is described for the receptor-mediated cell mechanosensing process. Platelet glycoprotein Ib, T-cell receptor, and integrins are used as examples to illustrate the key concepts and players in this process. PMID:28954860

  4. Membrane protein GARP is a receptor for latent TGF-beta on the surface of activated human Treg.

    PubMed

    Stockis, Julie; Colau, Didier; Coulie, Pierre G; Lucas, Sophie

    2009-12-01

    Human Treg and Th clones secrete the latent form of TGF-beta, in which the mature TGF-beta protein is bound to the latency-associated peptide (LAP), and is thereby prevented from binding to the TGF-beta receptor. We previously showed that upon TCR stimulation, human Treg clones but not Th clones produce active TGF-beta and bear LAP on their surface. Here, we show that latent TGF-beta, i.e. both LAP and mature TGF-beta, binds to glycoprotein A repetitions predominant (GARP), a transmembrane protein containing leucine rich repeats, which is present on the surface of stimulated Treg clones but not on Th clones. Membrane localization of latent TGF-beta mediated by binding to GARP may be necessary for the ability of Treg to activate TGF-beta upon TCR stimulation. However, it is not sufficient as lentiviral-mediated expression of GARP in human Th cells induces binding of latent TGF-beta to the cell surface, but does not result in the production of active TGF-beta upon stimulation of these Th cells.

  5. Study of receptor-chaperone interactions using the optical technique of spectroscopic ellipsometry.

    PubMed

    Kriechbaumer, Verena; Tsargorodskaya, Anna; Mustafa, Mohd K; Vinogradova, Tatiana; Lacey, Joanne; Smith, David P; Abell, Benjamin M; Nabok, Alexei

    2011-07-20

    This work describes a detailed quantitative interaction study between the novel plastidial chaperone receptor OEP61 and isoforms of the chaperone types Hsp70 and Hsp90 using the optical method of total internal reflection ellipsometry (TIRE). The receptor OEP61 was electrostatically immobilized on a gold surface via an intermediate layer of polycations. The TIRE measurements allowed the evaluation of thickness changes in the adsorbed molecular layers as a result of chaperone binding to receptor proteins. Hsp70 chaperone isoforms but not Hsp90 were shown to be capable of binding OEP61. Dynamic TIRE measurements were carried out to evaluate the affinity constants of the above reactions and resulted in clear discrimination between specific and nonspecific binding of chaperones as well as differences in binding properties between the highly similar Hsp70 isoforms. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  6. A force-based protein biochip

    NASA Astrophysics Data System (ADS)

    Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.

    2003-09-01

    A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.

  7. Membrane interaction of the N-terminal domain of chemokine receptor CXCR1.

    PubMed

    Haldar, Sourav; Raghuraman, H; Namani, Trishool; Rajarathnam, Krishna; Chattopadhyay, Amitabha

    2010-06-01

    The N-terminal domain of chemokine receptors constitutes one of the two critical ligand binding sites, and plays important roles by mediating binding affinity, receptor selectivity, and regulating function. In this work, we monitored the organization and dynamics of a 34-mer peptide of the CXC chemokine receptor 1 (CXCR1) N-terminal domain and its interaction with membranes by utilizing a combination of fluorescence-based approaches and surface pressure measurements. Our results show that the CXCR1 N-domain 34-mer peptide binds vesicles of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and upon binding, the tryptophan residues of the peptide experience motional restriction and exhibit red edge excitation shift (REES) of 19nm. These results are further supported by increase in fluorescence anisotropy and mean fluorescence lifetime upon membrane binding. These results constitute one of the first reports demonstrating membrane interaction of the N-terminal domain of CXCR1 and gain relevance in the context of the emerging role of cellular membranes in chemokine signaling.

  8. Measurement of Conformational Changes Accompanying Desensitization in an Ionotropic Glutamate Receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Armstrong,N.; Jasti, J.; Beich-Frandsen, M.

    2006-01-01

    The canonical conformational states occupied by most ligand-gated ion channels, and many cell-surface receptors, are the resting, activated, and desensitized states. While the resting and activated states of multiple receptors are well characterized, elaboration of the structural properties of the desensitized state, a state that is by definition inactive, has proven difficult. Here we use electrical, chemical, and crystallographic experiments on the AMPA-sensitive GluR2 receptor, defining the conformational rearrangements of the agonist binding cores that occur upon desensitization of this ligand-gated ion channel. These studies demonstrate that desensitization involves the rupture of an extensive interface between domain 1 of 2-foldmore » related glutamate-binding core subunits, compensating for the ca. 21{sup o} of domain closure induced by glutamate binding. The rupture of the domain 1 interface allows the ion channel to close and thereby provides a simple explanation to the long-standing question of how agonist binding is decoupled from ion channel gating upon receptor desensitization.« less

  9. Effects of egg-adaptation on receptor-binding and antigenic properties of recent influenza A (H3N2) vaccine viruses.

    PubMed

    Parker, Lauren; Wharton, Stephen A; Martin, Stephen R; Cross, Karen; Lin, Yipu; Liu, Yan; Feizi, Ten; Daniels, Rodney S; McCauley, John W

    2016-06-01

    Influenza A virus (subtype H3N2) causes seasonal human influenza and is included as a component of influenza vaccines. The majority of vaccine viruses are isolated and propagated in eggs, which commonly results in amino acid substitutions in the haemagglutinin (HA) glycoprotein. These substitutions can affect virus receptor-binding and alter virus antigenicity, thereby, obfuscating the choice of egg-propagated viruses for development into candidate vaccine viruses. To evaluate the effects of egg-adaptive substitutions seen in H3N2 vaccine viruses on sialic acid receptor-binding, we carried out quantitative measurement of virus receptor-binding using surface biolayer interferometry with haemagglutination inhibition (HI) assays to correlate changes in receptor avidity with antigenic properties. Included in these studies was a panel of H3N2 viruses generated by reverse genetics containing substitutions seen in recent egg-propagated vaccine viruses and corresponding cell culture-propagated wild-type viruses. These assays provide a quantitative approach to investigating the importance of individual amino acid substitutions in influenza receptor-binding. Results show that viruses with egg-adaptive HA substitutions R156Q, S219Y, and I226N, have increased binding avidity to α2,3-linked receptor-analogues and decreased binding avidity to α2,6-linked receptor-analogues. No measurable binding was detected for the viruses with amino acid substitution combination 156Q+219Y and receptor-binding increased in viruses where egg-adaptation mutations were introduced into cell culture-propagated virus. Substitutions at positions 156 and 190 appeared to be primarily responsible for low reactivity in HI assays with post-infection ferret antisera raised against 2012-2013 season H3N2 viruses. Egg-adaptive substitutions at position 186 caused substantial differences in binding avidity with an insignificant effect on antigenicity.

  10. Adherence of oral streptococci: evidence for nonspecific adsorption to saliva-coated hydroxylapatite surfaces.

    PubMed Central

    Staat, R H; Peyton, J C

    1984-01-01

    It is proposed that binding of oral streptococci to saliva-coated hydroxylapatite (SHA) surfaces is a multifactorial process involving both specific and nonspecific receptors. In this context, specific binding is described as a high-affinity, saturable interaction between the cell and binding surface. Conversely, nonspecific binding is considered to be a nonsaturable, generalized, low-affinity reaction. Experimental differentiation of specific binding from nonspecific binding was achieved with a competition assay which utilized a large excess of nonradiolabeled bacteria to compete with the 3H-labeled cells for attachment to receptors on 1.5 mg of SHA crystals. Competition assays of Streptococcus sanguis and Streptococcus mitis adhesion clearly demonstrated that the total binding isotherm was composed of a saturable specific binding reaction and a minor nonspecific binding component. This was further substantiated by analysis of nonlinear Scatchard plots of the total binding data. The competition data for Streptococcus mutans binding indicated that ca. 50% of the S. mutans binding appeared to be specific, although saturation of the SHA surfaces with bacterial cells could not be demonstrated. Experiments measuring desorption of radiolabeled cells from SHA crystals into buffer showed that ca. 50% of the bound S. mutans cells were removed after 4 h, whereas less than 5% of the S. sanguis cells were eluted from the SHA surfaces. The kinetics of attachment were studied by using an extract of Persea americana as a noncompetitive inhibitor of adherence. The total cell binding data for these experiments suggested a very rapid binding reaction followed by a slower rate of attachment. It was concluded from these three different experimental approaches that adherence of selected oral streptococci to SHA surfaces involves specific, high-affinity and nonspecific, low-affinity binding reactions. The concept is developed that in vitro streptococcal attachment to SHA can be described as a two-reaction process in which the low-affinity interaction of the cell with the SHA surface precedes the establishment of the stronger, specific bonds needed for the maintenance of streptococci in the oral cavity. PMID:6327530

  11. Direct recognition of superparamagnetic nanocrystals by macrophage scavenger receptor SR-AI.

    PubMed

    Chao, Ying; Karmali, Priya P; Mukthavaram, Rajesh; Kesari, Santosh; Kouznetsova, Valentina L; Tsigelny, Igor F; Simberg, Dmitri

    2013-05-28

    Scavenger receptors (SRs) are molecular pattern recognition receptors that have been shown to mediate opsonin-independent uptake of therapeutic and imaging nanoparticles, underlying the importance of SRs in nanomedicine. Unlike pathogens, engineered nanomaterials offer great flexibility in control of surface properties, allowing addressing specific questions regarding the molecular mechanisms of nanoparticle recognition. Recently, we showed that SR-type AI/II mediates opsonin-independent internalization of dextran superparamagnetic iron oxide (SPIO) nanoparticles via positively charged extracellular collagen-like domain. To understand the mechanism of opsonin-independent SPIO recognition, we tested the binding and uptake of nanoparticles with different surface coatings by SR-AI. SPIO coated with 10 kDa dextran was efficiently recognized and taken up by SR-AI transfected cells and J774 macrophages, while SPIO with 20 kDa dextran coating or cross-linked dextran hydrogel avoided the binding and uptake. Nanoparticle negative charge density and zeta-potential did not correlate with SR-AI binding/uptake efficiency. Additional experiments and computer modeling revealed that recognition of the iron oxide crystalline core by the positively charged collagen-like domain of SR-AI is sterically hindered by surface polymer coating. Importantly, the modeling revealed a strong complementarity between the surface Fe-OH groups of the magnetite crystal and the charged lysines of the collagen-like domain of SR-AI, suggesting a specific recognition of SPIO crystalline surface. These data provide an insight into the molecular recognition of nanocrystals by innate immunity receptors and the mechanisms whereby polymer coatings promote immune evasion.

  12. Particle compositions with a pre-selected cell internalization mode

    NASA Technical Reports Server (NTRS)

    Ferrari, Mauro (Inventor); Decuzzi, Paolo (Inventor)

    2012-01-01

    A method of formulating a particle composition having a pre-selected cell internalization mode involves selecting a target cell having surface receptors and obtaining particles that have i) surface moieties, that have an affinity for or are capable of binding to the surface receptors of the cell and ii) a preselected shape, where a surface distribution of the surface moieties on the particles and the shape of the particles are effective for the pre-selected cell internalization mode.

  13. Characterization of ligand binding and processing by gastrin-releasing peptide receptors in a small-cell lung cancer cell line.

    PubMed Central

    Cardona, C; Bleehen, N M; Reeve, J G

    1992-01-01

    The ligand-binding properties of the gastrin-releasing peptide (GRP) receptor and the cellular processing of GRP have been studied in the small-cell lung cancer (SCLC) cell line COR-L42. Scatchard analysis of GRP receptor expression indicated a single class of high-affinity receptors (Kd 1.5 nM) and approx. 6700 receptors/cell. GRP bound to its receptor with a Ki of 2.4 nM. The bombesin-related peptides neuromedin B (NMB) and phyllolitorin also bound to GRP receptors with Ki values of 22.7 and 59.1 nM respectively. Binding of 125I-GRP to COR-L42 cells increased rapidly at 37 degrees, achieved a maximum at 10 min and declined rapidly thereafter. At 4 degrees C, maximum binding was achieved at 30 min and the subsequent decline in cell-associated radioactivity was slower than that seen at 37 degrees C. Acid/salt extraction, to separate surface-bound ligand from internalized GRP, indicated that after receptor binding 125I-GRP was rapidly internalized. To determine the pathway of 125I-GRP degradation, binding studies were carried out with the lysosomotropic agent chloroquine (5 mM), and with phosphoramidon (10 microM), an inhibitor of the membrane-bound enzyme (EC 3.4.24.11). Both agents markedly inhibited the degradation of GRP, indicating that this process involves a lysosomal pathway and a phosphoramidon-sensitive pathway, possibly involving the EC 3.4.24.11 enzyme. GRP receptor down-regulation was observed following a 10 min exposure to 100 nM-GRP. With longer pretreatment times the number of binding sites recovered to 80% of control values. Treatment with 5 mM-chloroquine plus GRP or cycloheximide (10 micrograms/ml) plus GRP demonstrated that the majority of GRP receptors are recycled. NMB and phyllolitorin pretreatment did not influence the subsequent binding of 125I-GRP, suggesting that these peptides do not down-regulate GRP receptors. PMID:1310003

  14. Crystal structure of arrestin-3 reveals the basis of the difference in receptor binding between two non-visual subtypes

    PubMed Central

    Zhan, Xuanzhi; Gimenez, Luis E.; Gurevich, Vsevolod V.; Spiller, Benjamin W.

    2011-01-01

    Arrestins are multi-functional proteins that regulate signaling and trafficking of the majority of G protein-coupled receptors (GPCRs), as well as sub-cellular localization and activity of many other signaling proteins. Here we report the first crystal structure of arrestin-3, solved at 3.0Å. Arrestin-3 is an elongated two-domain molecule with the overall fold and key inter-domain interactions that hold free protein in the basal conformation similar to the other subtypes. Arrestin-3 is the least selective member of the family, binding wide variety of GPCRs with high affinity and demonstrating lower preference for active phosphorylated forms of the receptors. In contrast to the other three arrestins, part of the receptor-binding surface in the arrestin-3 C-domain does not form a contiguous β-sheet, consistent with increased flexibility. By swapping the corresponding elements between arrestin-2 and -3 we show that the presence of this loose structure correlates with reduced arrestin selectivity for activated receptor, consistent with a conformational change in this β-sheet upon receptor binding. PMID:21215759

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang,W.; Lin, Y.; Santelli, E.

    Severe acute respiratory syndrome (SARS) is a newly emerged infectious disease that caused pandemic spread in 2003. The etiological agent of SARS is a novel coronavirus (SARS-CoV). The coronaviral surface spike protein S is a type I transmembrane glycoprotein that mediates initial host binding via the cell surface receptor angiotensin-converting enzyme 2 (ACE2), as well as the subsequent membrane fusion events required for cell entry. Here we report the crystal structure of the S1 receptor binding domain (RBD) in complex with a neutralizing antibody, 80R, at 2.3 {angstrom} resolution, as well as the structure of the uncomplexed S1 RBD atmore » 2.2 {angstrom} resolution. We show that the 80R-binding epitope on the S1 RBD overlaps very closely with the ACE2-binding site, providing a rationale for the strong binding and broad neutralizing ability of the antibody. We provide a structural basis for the differential effects of certain mutations in the spike protein on 80R versus ACE2 binding, including escape mutants, which should facilitate the design of immunotherapeutics to treat a future SARS outbreak. We further show that the RBD of S1 forms dimers via an extensive interface that is disrupted in receptor- and antibody-bound crystal structures, and we propose a role for the dimer in virus stability and infectivity.« less

  16. The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanfeng; Varnum, Susan M.

    2012-03-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less

  17. Principles of antibody-mediated TNF receptor activation

    PubMed Central

    Wajant, H

    2015-01-01

    From the beginning of research on receptors of the tumor necrosis factor (TNF) receptor superfamily (TNFRSF), agonistic antibodies have been used to stimulate TNFRSF receptors in vitro and in vivo. Indeed, CD95, one of the first cloned TNFRSF receptors, was solely identified as the target of cell death-inducing antibodies. Early on, it became evident from in vitro studies that valency and Fcγ receptor (FcγR) binding of antibodies targeting TNFRSF receptors can be of crucial relevance for agonistic activity. TNFRSF receptor-specific antibodies of the IgM subclass and secondary cross-linked or aggregation prone dimeric antibodies typically display superior agonistic activity compared with dimeric antibodies. Likewise, anchoring of antibodies to cell surface-expressed FcγRs potentiate their ability to trigger TNFRSF receptor signaling. However, only recently has the relevance of oligomerization and FcγR binding for the in vivo activity of antibody-induced TNFRSF receptor activation been straightforwardly demonstrated in vivo. This review discusses the crucial role of oligomerization and/or FcγR binding for antibody-mediated TNFRSF receptor stimulation in light of current models of TNFRSF receptor activation and especially the overwhelming relevance of these issues for the rational development of therapeutic TNFRSF receptor-targeting antibodies. PMID:26292758

  18. Demonstration of a specific C3a receptor on guinea pig platelets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fukuoka, Y.; Hugli, T.E.

    1988-05-15

    Guinea pig platelets reportedly contain receptors specific for the anaphylatoxin C3a based on both ligand-binding studies and functional responses. A portion of the human 125I-C3a that binds to guinea pig platelets is competitively displaced by excess unlabeled C3a; however, the majority of ligand uptake was nonspecific. Uptake of 125I-C3a by guinea pig platelets is maximal in 1 min, and stimulation of guinea pig platelets by thrombin, ADP, or the Ca2+ ionophore A23187 showed little influence on binding of the ligand. Scatchard analysis indicated that approximately 1200 binding sites for C3a exist per cell with an estimated Kd of 8 xmore » 10(-10) M. Human C3a des Arg also binds to guinea pig platelets, but Scatchard analysis indicated that no specific binding occurred. Because the ligand-binding studies were complicated by high levels of nonspecific uptake, we attempted to chemically cross-link the C3a molecule to a specific component on the platelet surface. Cross-linkage of 125I-C3a to guinea pig platelets with bis(sulfosuccinimidyl)suberate revealed radioactive complexes at 105,000 and 115,000 m.w. on SDS-PAGE gels by autoradiographic analysis. In the presence of excess unlabeled C3a, complex formation was inhibited. No cross-linkage could be demonstrated between the inactive 125I-C3a des Arg and the putative C3a-R on guinea pig platelets. Human C3a, but not C3a des Arg induces serotonin release and aggregation of the guinea pig platelets. Human C3a was unable to induce either serotonin release or promote aggregation of human platelets. Uptake of human 125I-C3a by human platelets was not saturable, and Scatchard analysis was inconclusive. Attempts to cross-link 125I-C3a to components on the surface of human platelets also failed to reveal a ligand-receptor complex. Therefore, we conclude that guinea pig platelets have specific surface receptors to C3a and that human platelets appear devoid of receptors to the anaphylatoxin.« less

  19. Binding of high molecular weight kininogen to human endothelial cells is mediated via a site within domains 2 and 3 of the urokinase receptor.

    PubMed Central

    Colman, R W; Pixley, R A; Najamunnisa, S; Yan, W; Wang, J; Mazar, A; McCrae, K R

    1997-01-01

    The urokinase receptor (uPAR) binds urokinase-type plasminogen activator (u-PA) through specific interactions with uPAR domain 1, and vitronectin through interactions with a site within uPAR domains 2 and 3. These interactions promote the expression of cell surface plasminogen activator activity and cellular adhesion to vitronectin, respectively. High molecular weight kininogen (HK) also stimulates the expression of cell surface plasminogen activator activity through its ability to serve as an acquired receptor for prekallikrein, which, after its activation, may directly activate prourokinase. Here, we report that binding of the cleaved form of HK (HKa) to human umbilical vein endothelial cells (HUVEC) is mediated through zinc-dependent interactions with uPAR. These occur through a site within uPAR domains 2 and 3, since the binding of 125I-HKa to HUVEC is inhibited by vitronectin, anti-uPAR domain 2 and 3 antibodies and soluble, recombinant uPAR (suPAR), but not by antibody 7E3, which recognizes the beta chain of the endothelial cell vitronectin receptor (integrin alphavbeta3), or fibrinogen, another alphavbeta3 ligand. We also demonstrate the formation of a zinc-dependent complex between suPAR and HKa. Interactions of HKa with endothelial cell uPAR may underlie its ability to promote kallikrein-dependent cell surface plasmin generation, and also explain, in part, its antiadhesive properties. PMID:9294114

  20. Murine Polyomavirus Cell Surface Receptors Activate Distinct Signaling Pathways Required for Infection.

    PubMed

    O'Hara, Samantha D; Garcea, Robert L

    2016-11-01

    Virus binding to the cell surface triggers an array of host responses, including activation of specific signaling pathways that facilitate steps in virus entry. Using mouse polyomavirus (MuPyV), we identified host signaling pathways activated upon virus binding to mouse embryonic fibroblasts (MEFs). Pathways activated by MuPyV included the phosphatidylinositol 3-kinase (PI3K), FAK/SRC, and mitogen-activated protein kinase (MAPK) pathways. Gangliosides and α4-integrin are required receptors for MuPyV infection. MuPyV binding to both gangliosides and the α4-integrin receptors was required for activation of the PI3K pathway; however, either receptor interaction alone was sufficient for activation of the MAPK pathway. Using small-molecule inhibitors, we confirmed that the PI3K and FAK/SRC pathways were required for MuPyV infection, while the MAPK pathway was dispensable. Mechanistically, the PI3K pathway was required for MuPyV endocytosis, while the FAK/SRC pathway enabled trafficking of MuPyV along microtubules. Thus, MuPyV interactions with specific cell surface receptors facilitate activation of signaling pathways required for virus entry and trafficking. Understanding how different viruses manipulate cell signaling pathways through interactions with host receptors could lead to the identification of new therapeutic targets for viral infection. Virus binding to cell surface receptors initiates outside-in signaling that leads to virus endocytosis and subsequent virus trafficking. How different viruses manipulate cell signaling through interactions with host receptors remains unclear, and elucidation of the specific receptors and signaling pathways required for virus infection may lead to new therapeutic targets. In this study, we determined that gangliosides and α4-integrin mediate mouse polyomavirus (MuPyV) activation of host signaling pathways. Of these pathways, the PI3K and FAK/SRC pathways were required for MuPyV infection. Both the PI3K and FAK/SRC pathways have been implicated in human diseases, such as heart disease and cancer, and inhibitors directed against these pathways are currently being investigated as therapies. It is possible that these pathways play a role in human PyV infections and could be targeted to inhibit PyV infection in immunosuppressed patients. Copyright © 2016 O’Hara and Garcea.

  1. Conformational dynamics of helix 8 in the GPCR rhodopsin controls arrestin activation in the desensitization process.

    PubMed

    Kirchberg, Kristina; Kim, Tai-Yang; Möller, Martina; Skegro, Darko; Dasara Raju, Gayathri; Granzin, Joachim; Büldt, Georg; Schlesinger, Ramona; Alexiev, Ulrike

    2011-11-15

    Arrestins are regulatory molecules for G-protein coupled receptor function. In visual rhodopsin, selective binding of arrestin to the cytoplasmic side of light-activated, phosphorylated rhodopsin (P-Rh*) terminates signaling via the G-protein transducin. While the "phosphate-sensor" of arrestin for the recognition of receptor-attached phosphates is identified, the molecular mechanism of arrestin binding and the involvement of receptor conformations in this process are still largely hypothetic. Here we used fluorescence pump-probe and time-resolved fluorescence depolarization measurements to investigate the kinetics of arrestin conformational changes and the corresponding nanosecond dynamical changes at the receptor surface. We show that at least two sequential conformational changes of arrestin occur upon interaction with P-Rh*, thus providing a kinetic proof for the suggested multistep nature of arrestin binding. At the cytoplasmic surface of P-Rh*, the structural dynamics of the amphipathic helix 8 (H8), connecting transmembrane helix 7 and the phosphorylated C-terminal tail, depends on the arrestin interaction state. We find that a high mobility of H8 is required in the low-affinity (prebinding) but not in the high-affinity binding state. High-affinity arrestin binding is inhibited when a bulky, inflexible group is bound to H8, indicating close interaction. We further show that this close steric interaction of H8 with arrestin is mandatory for the transition from prebinding to high-affinity binding; i.e., for arrestin activation. This finding implies a regulatory role for H8 in activation of visual arrestin, which shows high selectivity to P-Rh* in contrast to the broad receptor specificity displayed by the two nonvisual arrestins.

  2. Conformational dynamics of helix 8 in the GPCR rhodopsin controls arrestin activation in the desensitization process

    PubMed Central

    Kirchberg, Kristina; Kim, Tai-Yang; Möller, Martina; Skegro, Darko; Dasara Raju, Gayathri; Granzin, Joachim; Büldt, Georg; Schlesinger, Ramona; Alexiev, Ulrike

    2011-01-01

    Arrestins are regulatory molecules for G-protein coupled receptor function. In visual rhodopsin, selective binding of arrestin to the cytoplasmic side of light-activated, phosphorylated rhodopsin (P-Rh*) terminates signaling via the G-protein transducin. While the “phosphate-sensor” of arrestin for the recognition of receptor-attached phosphates is identified, the molecular mechanism of arrestin binding and the involvement of receptor conformations in this process are still largely hypothetic. Here we used fluorescence pump-probe and time-resolved fluorescence depolarization measurements to investigate the kinetics of arrestin conformational changes and the corresponding nanosecond dynamical changes at the receptor surface. We show that at least two sequential conformational changes of arrestin occur upon interaction with P-Rh*, thus providing a kinetic proof for the suggested multistep nature of arrestin binding. At the cytoplasmic surface of P-Rh*, the structural dynamics of the amphipathic helix 8 (H8), connecting transmembrane helix 7 and the phosphorylated C-terminal tail, depends on the arrestin interaction state. We find that a high mobility of H8 is required in the low-affinity (prebinding) but not in the high-affinity binding state. High-affinity arrestin binding is inhibited when a bulky, inflexible group is bound to H8, indicating close interaction. We further show that this close steric interaction of H8 with arrestin is mandatory for the transition from prebinding to high-affinity binding; i.e., for arrestin activation. This finding implies a regulatory role for H8 in activation of visual arrestin, which shows high selectivity to P-Rh* in contrast to the broad receptor specificity displayed by the two nonvisual arrestins. PMID:22039220

  3. A human-infecting H10N8 influenza virus retains a strong preference for avian-type receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Heng; de Vries, Robert  P.; Tzarum, Netanel

    Recent avian-origin H10N8 influenza A viruses that have infected humans pose a potential pandemic threat. Alterations in the viral surface glycoprotein, hemagglutinin (HA), typically are required for influenza A viruses to cross the species barrier for adaptation to a new host, but whether H10N8 contains adaptations supporting human infection remains incompletely understood. In this paper, we investigated whether H10N8 HA can bind human receptors. Sialoside glycan microarray analysis showed that the H10 HA retains a strong preference for avian receptor analogs and negligible binding to human receptor analogs. Crystal structures of H10 HA with avian and human receptor analogs revealedmore » the basis for preferential recognition of avian-like receptors. Furthermore, introduction of mutations into the H10 receptor-binding site (RBS) known to convert other HA subtypes from avian to human receptor specificity failed to switch preference to human receptors. In conclusion, collectively these findings suggest that the current H10N8 human isolates are poorly adapted for efficient human-to-human transmission.« less

  4. A human-infecting H10N8 influenza virus retains a strong preference for avian-type receptors

    DOE PAGES

    Zhang, Heng; de Vries, Robert  P.; Tzarum, Netanel; ...

    2015-03-11

    Recent avian-origin H10N8 influenza A viruses that have infected humans pose a potential pandemic threat. Alterations in the viral surface glycoprotein, hemagglutinin (HA), typically are required for influenza A viruses to cross the species barrier for adaptation to a new host, but whether H10N8 contains adaptations supporting human infection remains incompletely understood. In this paper, we investigated whether H10N8 HA can bind human receptors. Sialoside glycan microarray analysis showed that the H10 HA retains a strong preference for avian receptor analogs and negligible binding to human receptor analogs. Crystal structures of H10 HA with avian and human receptor analogs revealedmore » the basis for preferential recognition of avian-like receptors. Furthermore, introduction of mutations into the H10 receptor-binding site (RBS) known to convert other HA subtypes from avian to human receptor specificity failed to switch preference to human receptors. In conclusion, collectively these findings suggest that the current H10N8 human isolates are poorly adapted for efficient human-to-human transmission.« less

  5. Structural Insights into Cargo Recognition by the Yeast PTS1 Receptor*

    PubMed Central

    Hagen, Stefanie; Drepper, Friedel; Fischer, Sven; Fodor, Krisztian; Passon, Daniel; Platta, Harald W.; Zenn, Michael; Schliebs, Wolfgang; Girzalsky, Wolfgang; Wilmanns, Matthias; Warscheid, Bettina; Erdmann, Ralf

    2015-01-01

    The peroxisomal matrix protein import is facilitated by cycling import receptors that shuttle between the cytosol and the peroxisomal membrane. The import receptor Pex5p mediates the import of proteins harboring a peroxisomal targeting signal of type I (PTS1). Purified recombinant Pex5p forms a dimeric complex with the PTS1-protein Pcs60p in vitro with a KD of 0.19 μm. To analyze the structural basis for receptor-cargo recognition, the PTS1 and adjacent amino acids of Pcs60p were systematically scanned for Pex5p binding by an in vitro site-directed photo-cross-linking approach. The cross-linked binding regions of the receptor were subsequently identified by high resolution mass spectrometry. Most cross-links were found with TPR6, TPR7, as well as the 7C-loop of Pex5p. Surface plasmon resonance analysis revealed a bivalent interaction mode for Pex5p and Pcs60p. Interestingly, Pcs60p lacking its C-terminal tripeptide sequence was efficiently cross-linked to the same regions of Pex5p. The KD value of the interaction of truncated Pcs60p and Pex5p was in the range of 7.7 μm. Isothermal titration calorimetry and surface plasmon resonance measurements revealed a monovalent binding mode for the interaction of Pex5p and Pcs60p lacking the PTS1. Our data indicate that Pcs60p contains a second contact site for its receptor Pex5p, beyond the C-terminal tripeptide. The physiological relevance of the ancillary binding region was supported by in vivo import studies. The bivalent binding mode might be explained by a two-step concept as follows: first, cargo recognition and initial tethering by the PTS1-receptor Pex5p; second, lock-in of receptor and cargo. PMID:26359497

  6. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  7. Identification of key residues for the binding of glucagon to the N-terminal domain of its receptor: an alanine scan and modeling study.

    PubMed

    Prévost, M; Vertongen, P; Waelbroeck, M

    2012-10-01

    Glucagon plays an essential role in the glycemia maintenance during fasting, but also aggravates hyperglycemia in diabetic patients. A series of analogues of glucagon were synthesized replacing each amino acid of the C-terminal region (residues 15-29) with alanine. The residues affecting the binding to the glucagon receptor are found to be located on one face of the glucagon helix. Several 3-dimensional models of the N-terminal domain of the glucagon receptor in complex with its ligand peptide were built and used to analyze the peptide-receptor interface in terms of the nature of the peptide residues and the interactions they form with the receptor. The models suggest that glucagon keeps its native helical structure upon binding, and that a large part of the interface formed with the receptor is hydrophobic. We find that in the C-terminal region, F22, V23, M27, and D15 are the most important residues for peptide binding. They bury a large portion of their solvent accessible surface area and make numerous interactions with the receptor mainly of the hydrophobic type. © Georg Thieme Verlag KG Stuttgart · New York.

  8. Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses.

    PubMed

    Clark, Lars E; Mahmutovic, Selma; Raymond, Donald D; Dilanyan, Taleen; Koma, Takaaki; Manning, John T; Shankar, Sundaresh; Levis, Silvana C; Briggiler, Ana M; Enria, Delia A; Wucherpfennig, Kai W; Paessler, Slobodan; Abraham, Jonathan

    2018-05-14

    While five arenaviruses cause human hemorrhagic fevers in the Western Hemisphere, only Junin virus (JUNV) has a vaccine. The GP1 subunit of their envelope glycoprotein binds transferrin receptor 1 (TfR1) using a surface that substantially varies in sequence among the viruses. As such, receptor-mimicking antibodies described to date are type-specific and lack the usual breadth associated with this mode of neutralization. Here we isolate, from the blood of a recipient of the live attenuated JUNV vaccine, two antibodies that cross-neutralize Machupo virus with varying efficiency. Structures of GP1-Fab complexes explain the basis for efficient cross-neutralization, which involves avoiding receptor mimicry and targeting a conserved epitope within the receptor-binding site (RBS). The viral RBS, despite its extensive sequence diversity, is therefore a target for cross-reactive antibodies with activity against New World arenaviruses of public health concern.

  9. Is receptor oligomerization causally linked to activation of the EGF receptor kinase?

    NASA Technical Reports Server (NTRS)

    Rintoul, D. A.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Transduction of a signal from an extracellular peptide hormone to produce an intracellular response is often mediated by a cell surface receptor, which is usually a glycoprotein. The secondary intracellular signal(s) generated after hormone binding to the receptor have been intensively studied. The nature of the primary signal generated by ligand binding to the receptor is understood less well in most cases. The particular case of the epidermal growth factor (EGF) receptor is analyzed, and evidence for or against two dissimilar models of primary signal transduction is reviewed. Evidence for the most widely accepted current model is found to be unconvincing. Evidence for the other model is substantial but indirect; a direct test of this model remains to be done.

  10. 'Decoy peptide' region (RIFLKRMPSI) of prorenin prosegment plays a crucial role in prorenin binding to the (pro)renin receptor.

    PubMed

    Nabi, A H M Nurun; Biswas, Kazal Boron; Nakagawa, Tsutomu; Ichihara, Atsuhiro; Inagami, Tadashi; Suzuki, Fumiaki

    2009-07-01

    This study investigated a role of decoy peptide region (R10PIFLKRMPSI19P) in prorenin prosegment for prorenin binding to the (pro)renin receptor using the surface plasmon resonance technique. Three kinds of anti-receptor antibodies labeled as anti-107/121, anti-221/235 and anti-His tag antibody were prepared. The respective antigens D107SVANSIHSLFSEET121 (close to the N-terminal side of receptor), E221IGKRYGEDSEQFRD235 (N-terminal side of the transmembrane part of receptor) and 10xHis sequence (C-terminus) were designed based on the sequence of the receptor. These antibodies were immobilized on the CM5 sensor chip by amine coupling and allowed to bind to the receptor. Human prorenin, renin and the decoy bound to the receptor associated with antibodies. Their association (ka) and dissociation (kd) rate constants were measured and the dissociation constants (KD) were determined using Langmuir 1:1 kinetic binding model. The KD for interaction of prorenin and receptor associated to anti-107/121, anti-221/235 and anti-His tag antibodies were 2.9, 1.2 and 7.8 nM, respectively and for renin they were 9.3, 4.4 and 7.1 nM. The decoy bound to the respective immobilized receptor-antibody complexes at KD's of 6.2, 3.5 and 15.2 nM. Prorenin, renin and decoy had lower KD at the nanomolar ranges compared to those of L1PPTD4P in the prorenin prosegment and A248KKRLFDYVV257 in the C-domain of mature renin. The decoy reduced the binding of not only prorenin but also renin to (P)RR. These data are direct evidence that prorenin, renin and the peptides bind to (P)RR and the decoy reduces prorenin binding, supporting our hypothesis that decoy peptide region has a crucial role in prorenin binding.

  11. Inhibitors for Androgen Receptor Activation Surfaces

    DTIC Science & Technology

    2008-09-01

    such as FKBP52 or HSP90 bind in vivo, and started a collaboration with Marc Cox at UT El Paso to test these possibilities. Our assays of mutated amino...will complete testing the compounds in full length AR constructs and publish the results. We have begun two collaborations, one with Marc Cox on...Prof. Marc Cox and Dr. Paul Rennie to identify proteins that bind to BF3 so that we may form crystals of the receptor with these proteins and learn more about function of the human androgen receptor.

  12. Lack of hormone binding in COS-7 cells expressing a mutated growth hormone receptor found in Laron dwarfism.

    PubMed Central

    Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A

    1993-01-01

    A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064

  13. Heterodimerization with beta2-adrenergic receptors promotes surface expression and functional activity of alpha1D-adrenergic receptors.

    PubMed

    Uberti, Michelle A; Hague, Chris; Oller, Heide; Minneman, Kenneth P; Hall, Randy A

    2005-04-01

    The alpha1D-adrenergic receptor (alpha1D-AR) is a G protein-coupled receptor (GPCR) that is poorly trafficked to the cell surface and largely nonfunctional when heterologously expressed by itself in a variety of cell types. We screened a library of approximately 30 other group I GPCRs in a quantitative luminometer assay for the ability to promote alpha1D-AR cell surface expression. Strikingly, these screens revealed only two receptors capable of inducing robust increases in the amount of alpha1D-AR at the cell surface: alpha1B-AR and beta2-AR. Confocal imaging confirmed that coexpression with beta2-AR resulted in translocation of alpha1D-AR from intracellular sites to the plasma membrane. Additionally, coimmunoprecipitation studies demonstrated that alpha1D-AR and beta2-AR specifically interact to form heterodimers when coexpressed in HEK-293 cells. Ligand binding studies revealed an increase in total alpha1D-AR binding sites upon coexpression with beta2-AR, but no apparent effect on the pharmacological properties of the receptors. In functional studies, coexpression with beta2-AR significantly enhanced the coupling of alpha1D-AR to norepinephrine-stimulated Ca2+ mobilization. Heterodimerization of beta2-AR with alpha1D-AR also conferred the ability of alpha1D-AR to cointernalize upon beta2-AR agonist stimulation, revealing a novel mechanism by which these different adrenergic receptor subtypes may regulate each other's activity. These findings demonstrate that the selective association of alpha1D-AR with other receptors is crucial for receptor surface expression and function and also shed light on a novel mechanism of cross talk between alpha1- and beta2-ARs that is mediated through heterodimerization and cross-internalization.

  14. A physical model describing the interaction of nuclear transport receptors with FG nucleoporin domain assemblies.

    PubMed

    Zahn, Raphael; Osmanović, Dino; Ehret, Severin; Araya Callis, Carolina; Frey, Steffen; Stewart, Murray; You, Changjiang; Görlich, Dirk; Hoogenboom, Bart W; Richter, Ralf P

    2016-04-08

    The permeability barrier of nuclear pore complexes (NPCs) controls bulk nucleocytoplasmic exchange. It consists of nucleoporin domains rich in phenylalanine-glycine motifs (FG domains). As a bottom-up nanoscale model for the permeability barrier, we have used planar films produced with three different end-grafted FG domains, and quantitatively analyzed the binding of two different nuclear transport receptors (NTRs), NTF2 and Importin β, together with the concomitant film thickness changes. NTR binding caused only moderate changes in film thickness; the binding isotherms showed negative cooperativity and could all be mapped onto a single master curve. This universal NTR binding behavior - a key element for the transport selectivity of the NPC - was quantitatively reproduced by a physical model that treats FG domains as regular, flexible polymers, and NTRs as spherical colloids with a homogeneous surface, ignoring the detailed arrangement of interaction sites along FG domains and on the NTR surface.

  15. An ubiquitin-binding molecule can work as an inhibitor of ubiquitin processing enzymes and ubiquitin receptors.

    PubMed

    Nguyen, Thanh; Ho, Minh; Ghosh, Ambarnil; Kim, Truc; Yun, Sun Il; Lee, Seung Seo; Kim, Kyeong Kyu

    2016-10-07

    The ubiquitin pathway plays a critical role in regulating diverse biological processes, and its dysregulation is associated with various diseases. Therefore, it is important to have a tool that can control the ubiquitin pathway in order to improve understanding of this pathway and to develop therapeutics against relevant diseases. We found that Chicago Sky Blue 6B binds directly to the β-groove, a major interacting surface of ubiquitin. Hence, it could successfully inhibit the enzymatic activity of ubiquitin processing enzymes and the binding of ubiquitin to the CXCR4, a cell surface ubiquitin receptor. Furthermore, we demonstrated that this ubiquitin binding chemical could effectively suppress the ubiquitin induced cancer cell migration by blocking ubiquitin-CXCR4 interaction. Current results suggest that ubiquitin binding molecules can be developed as inhibitors of ubiquitin-protein interactions, which will have the value not only in unveiling the biological role of ubiquitin but also in treating related diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Surface Display of the Receptor-Binding Region of the Lactobacillus brevis S-Layer Protein in Lactococcus lactis Provides Nonadhesive Lactococci with the Ability To Adhere to Intestinal Epithelial Cells

    PubMed Central

    Åvall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi

    2003-01-01

    Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium. PMID:12676705

  17. Surface display of the receptor-binding region of the Lactobacillus brevis S-layer protein in Lactococcus lactis provides nonadhesive lactococci with the ability to adhere to intestinal epithelial cells.

    PubMed

    Avall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi

    2003-04-01

    Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium.

  18. The 3D Structure of the Binding Pocket of the Human Oxytocin Receptor for Benzoxazine Antagonists, Determined by Molecular Docking, Scoring Functions and 3D-QSAR Methods

    NASA Astrophysics Data System (ADS)

    Jójárt, Balázs; Martinek, Tamás A.; Márki, Árpád

    2005-05-01

    Molecular docking and 3D-QSAR studies were performed to determine the binding mode for a series of benzoxazine oxytocin antagonists taken from the literature. Structural hypotheses were generated by docking the most active molecule to the rigid receptor by means of AutoDock 3.05. The cluster analysis yielded seven possible binding conformations. These structures were refined by using constrained simulated annealing, and the further ligands were aligned in the refined receptor by molecular docking. A good correlation was found between the estimated Δ G bind and the p K i values for complex F. The Connolly-surface analysis, CoMFA and CoMSIA models q CoMFA 2 = 0.653, q CoMSA 2 = 0.630 and r pred,CoMFA 2 = 0.852 , r pred,CoMSIA 2 = 0.815) confirmed the scoring function results. The structural features of the receptor-ligand complex and the CoMFA and CoMSIA fields are in closely connected. These results suggest that receptor-ligand complex F is the most likely binding hypothesis for the studied benzoxazine analogs.

  19. Structural Analysis on the Pathologic Mutant Glucocorticoid Receptor Ligand-Binding Domains.

    PubMed

    Hurt, Darrell E; Suzuki, Shigeru; Mayama, Takafumi; Charmandari, Evangelia; Kino, Tomoshige

    2016-02-01

    Glucocorticoid receptor (GR) gene mutations may cause familial or sporadic generalized glucocorticoid resistance syndrome. Most of the missense forms distribute in the ligand-binding domain and impair its ligand-binding activity and formation of the activation function (AF)-2 that binds LXXLL motif-containing coactivators. We performed molecular dynamics simulations to ligand-binding domain of pathologic GR mutants to reveal their structural defects. Several calculated parameters including interaction energy for dexamethasone or the LXXLL peptide indicate that destruction of ligand-binding pocket (LBP) is a primary character. Their LBP defects are driven primarily by loss/reduction of the electrostatic interaction formed by R611 and T739 of the receptor to dexamethasone and a subsequent conformational mismatch, which deacylcortivazol resolves with its large phenylpyrazole moiety and efficiently stimulates transcriptional activity of the mutant receptors with LBP defect. Reduced affinity of the LXXLL peptide to AF-2 is caused mainly by disruption of the electrostatic bonds to the noncore leucine residues of this peptide that determine the peptide's specificity to GR, as well as by reduced noncovalent interaction against core leucines and subsequent exposure of the AF-2 surface to solvent. The results reveal molecular defects of pathologic mutant receptors and provide important insights to the actions of wild-type GR.

  20. RNA Aptamer-Based Functional Ligands of the Neurotrophin Receptor, TrkB

    PubMed Central

    Huang, Yang Zhong; Hernandez, Frank J.; Gu, Bin; Stockdale, Katie R.; Nanapaneni, Kishore; Scheetz, Todd E.; Behlke, Mark A.; Peek, Andrew S.; Bair, Thomas; Giangrande, Paloma H.

    2012-01-01

    Many cell surface signaling receptors, such as the neurotrophin receptor, TrkB, have emerged as potential therapeutic targets for diverse diseases. Reduced activation of TrkB in particular is thought to contribute to neurodegenerative diseases. Unfortunately, development of therapeutic reagents that selectively activate particular cell surface receptors such as TrkB has proven challenging. Like many cell surface signaling receptors, TrkB is internalized upon activation; in this proof-of-concept study, we exploited this fact to isolate a pool of nuclease-stabilized RNA aptamers enriched for TrkB agonists. One of the selected aptamers, C4-3, was characterized with recombinant protein-binding assays, cell-based signaling and functional assays, and, in vivo in a seizure model in mice. C4-3 binds the extracellular domain of TrkB with high affinity (KD ∼2 nM) and exhibits potent TrkB partial agonistic activity and neuroprotective effects in cultured cortical neurons. In mice, C4-3 activates TrkB upon infusion into the hippocampus; systemic administration of C4-3 potentiates kainic acid-induced seizure development. We conclude that C4-3 is a potentially useful therapeutic agent for neurodegenerative diseases in which reduced TrkB activation has been implicated. We anticipate that the cell-based aptamer selection approach used here will be broadly applicable to the identification of aptamer-based agonists for a variety of cell-surface signaling receptors. PMID:22752556

  1. Augmentor α and β (FAM150) are ligands of the receptor tyrosine kinases ALK and LTK: Hierarchy and specificity of ligand-receptor interactions.

    PubMed

    Reshetnyak, Andrey V; Murray, Phillip B; Shi, Xiarong; Mo, Elizabeth S; Mohanty, Jyotidarsini; Tome, Francisco; Bai, Hanwen; Gunel, Murat; Lax, Irit; Schlessinger, Joseph

    2015-12-29

    Receptor tyrosine kinases (RTKs) are a class of cell surface receptors that, upon ligand binding, stimulate a variety of critical cellular functions. The orphan receptor anaplastic lymphoma kinase (ALK) is one of very few RTKs that remain without a firmly established protein ligand. Here we present a novel cytokine, FAM150B, which we propose naming augmentor-α (AUG-α), as a ligand for ALK. AUG-α binds ALK with high affinity and activates ALK in cells with subnanomolar potency. Detailed binding experiments using cells expressing ALK or the related receptor leukocyte tyrosine kinase (LTK) demonstrate that AUG-α binds and robustly activates both ALK and LTK. We show that the previously established LTK ligand FAM150A (AUG-β) is specific for LTK and only weakly binds to ALK. Furthermore, expression of AUG-α stimulates transformation of NIH/3T3 cells expressing ALK, induces IL-3 independent growth of Ba/F3 cells expressing ALK, and is expressed in neuroblastoma, a cancer partly driven by ALK. These experiments reveal the hierarchy and specificity of two cytokines as ligands for ALK and LTK and set the stage for elucidating their roles in development and disease states.

  2. Isolation and characterization of a specific receptor for human albumin on a group L Streptococcus.

    PubMed

    Lämmler, C

    1988-08-01

    Certain group L streptococci demonstrate surface receptors for human albumin. Binding of 125I-albumin to group L streptococci could be inhibited by unlabelled albumin preparations from humans, dogs, mice and bovines, but not by albumin from rabbits. The albumin-binding proteins (ABP) could be solubilized from the streptococcal surface by hot acid treatment of the bacteria and isolated by affinity chromatography on human-albumin sepharose. ABP and specific antisera produced against ABP inhibited 125I-albumin binding to group L streptococci. The molecular weight of ABP determined by SDS-PAGE and Western blotting, was approximately 48,000 Dalton. ABP preparations of group G streptococci isolated from bovines and humans demonstrated cross reactivity with antiserum produced against group L streptococcal ABP.

  3. Latent myostatin has significant activity and this activity is controlled more efficiently by WFIKKN1 than by WFIKKN2

    PubMed Central

    Szláma, György; Trexler, Mária; Patthy, László

    2013-01-01

    Myostatin, a negative regulator of skeletal muscle growth, is produced from myostatin precursor by multiple steps of proteolytic processing. After cleavage by a furin-type protease, the propeptide and growth factor domains remain associated, forming a noncovalent complex, the latent myostatin complex. Mature myostatin is liberated from latent myostatin by bone morphogenetic protein 1/tolloid proteases. Here, we show that, in reporter assays, latent myostatin preparations have significant myostatin activity, as the noncovalent complex dissociates at an appreciable rate, and both mature and semilatent myostatin (a complex in which the dimeric growth factor domain interacts with only one molecule of myostatin propeptide) bind to myostatin receptor. The interaction of myostatin receptor with semilatent myostatin is efficiently blocked by WAP, Kazal, immunoglobulin, Kunitz and NTR domain-containing protein 1 or growth and differentiation factor-associated serum protein 2 (WFIKKN1), a large extracellular multidomain protein that binds both mature myostatin and myostatin propeptide [Kondás et al. (2008) J Biol Chem 283, 23677–23684]. Interestingly, the paralogous protein WAP, Kazal, immunoglobulin, Kunitz and NTR domain-containing protein 2 or growth and differentiation factor-associated serum protein 1 (WFIKKN2) was less efficient than WFIKKN1 as an antagonist of the interactions of myostatin receptor with semilatent myostatin. Our studies have shown that this difference is attributable to the fact that only WFIKKN1 has affinity for the propeptide domain, and this interaction increases its potency in suppressing the receptor-binding activity of semilatent myostatin. As the interaction of WFIKKN1 with various forms of myostatin permits tighter control of myostatin activity until myostatin is liberated from latent myostatin by bone morphogenetic protein 1/tolloid proteases, WFIKKN1 may have greater potential as an antimyostatic agent than WFIKKN2. Structured digital abstract Furin cleaves Promyostatin by protease assay (View interaction) myostatin binds to PRO by surface plasmon resonance (View interaction) BMP-1 cleaves Promyostatin by protease assay (View interaction) ACR IIB physically interacts with Latent Myostatin by surface plasmon resonance (View interaction) Promyostatin and Promyostatin bind by comigration in gel electrophoresis (View interaction) WFIKKN1 binds to Latent Myostatin by pull down (View interaction) ACR IIB binds to Mature Myostatin by surface plasmon resonance (View Interaction: 1, 2, 3) WFIKKN1 binds to Myostatin Prodomain by surface plasmon resonance (View Interaction: 1, 2, 3) PMID:23829672

  4. An Arg for Gly substitution at position 31 in the insulin receptor, linked to insulin resistance, inhibits receptor processing and transport.

    PubMed

    van der Vorm, E R; van der Zon, G C; Möller, W; Krans, H M; Lindhout, D; Maassen, J A

    1992-01-05

    In a patient with Leprechaunism, we have characterized a new mutation in the insulin receptor substituting Arg for Gly at position 31. The proband, the mother, and the maternal grandfather were heterozygous for the mutation. Fibroblasts of the proband show a strongly reduced number of high affinity insulin receptors on the cell surface, whereas fibroblasts of the healthy mother and grandfather show moderately reduced insulin receptor numbers. In the other family members neither the binding defect nor the Arg31 mutation was found. The Arg31-mutant receptor was overexpressed in Chinese hamster ovary cells. In these cells the mutant alpha beta-proreceptor was not proteolytically cleaved and no transport to the cell surface took place. The proreceptor was unable to bind insulin and to undergo autophosphorylation. In addition, the proreceptor was not recognized by monoclonal antibodies directed against conformation-dependent epitopes. These findings suggest that the Gly31 to Arg31 mutant is involved in the insulin receptor dysfunction seen in the Leprechaun patient. The mutation seems to alter the conformation of the receptor in such way that the transport of the proreceptor to the Golgi compartment, where proteolytical processing occurs, is inhibited.

  5. Quantitative Comparison of Human Parainfluenza Virus Hemagglutinin-Neuraminidase Receptor Binding and Receptor Cleavage

    PubMed Central

    Tappert, Mary M.; Porterfield, J. Zachary; Mehta-D'Souza, Padmaja; Gulati, Shelly

    2013-01-01

    The human parainfluenza virus (hPIV) hemagglutinin-neuraminidase (HN) protein binds (H) oligosaccharide receptors that contain N-acetylneuraminic acid (Neu5Ac) and cleaves (N) Neu5Ac from these oligosaccharides. In order to determine if one of HN′s two functions is predominant, we measured the affinity of H for its ligands by a solid-phase binding assay with two glycoprotein substrates and by surface plasmon resonance with three monovalent glycans. We compared the dissociation constant (Kd) values from these experiments with previously determined Michaelis-Menten constants (Kms) for the enzyme activity. We found that glycoprotein substrates and monovalent glycans containing Neu5Acα2-3Galβ1-4GlcNAc bind HN with Kd values in the 10 to 100 μM range. Km values for HN were previously determined to be on the order of 1 mM (M. M. Tappert, D. F. Smith, and G. M. Air, J. Virol. 85:12146–12159, 2011). A Km value greater than the Kd value indicates that cleavage occurs faster than the dissociation of binding and will dominate under N-permissive conditions. We propose, therefore, that HN is a neuraminidase that can hold its substrate long enough to act as a binding protein. The N activity can therefore regulate binding by reducing virus-receptor interactions when the concentration of receptor is high. PMID:23740997

  6. Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.

    PubMed

    Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias

    2011-12-23

    Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.

  7. Investigation of binding characteristics of immobilized toll-like receptor 3 with poly(I:C) for potential biosensor application.

    PubMed

    Topping, Kristin D; Kelly, David G

    2018-05-26

    Toll-like receptor 3 (TLR3), a pathogen recognition receptor of the innate immune response, recognizes and is activated by double-stranded RNA (dsRNA), which is indicative of viral exposure. A sensor design exercise was conducted, using surface plasmon resonance detection, through the examination of several immobilization approaches for TLR3 as a biorecognition element (BRE) onto a modified gold surface. To examine the TLR3-dsRNA interaction a synthetic analogue mimic, poly (I:C), was used. The interaction binding characteristics were determined and compared to literature data to establish the optimal immobilization method for the TLR3 BRE. A preliminary evaluation of the efficacy of the selected TLR3 surface as a broad-spectrum viral biosensor was also performed. Amine-coupling was found to be the most reliable method for manufacturing repeatable and consistent TLR3 BRE sensor surfaces, although this immobilization schema is not tailored to place the receptor in a spatially-specific orientation. The equilibrium dissociation constant (K D ) measured for this immobilized TLR3-poly (I:C) interaction was 117 ± 3.30 pM. This evaluation included a cross-reactivity study using a selection of purified E. coli and synthetic double- and single-stranded nucleic acids. The results of this design exercise and ligand binding study will inform future work towards the development of a broad-spectrum viral sensor device. Copyright © 2018. Published by Elsevier Inc.

  8. The shape of things to come.

    PubMed

    Akin, Orkun; Zipursky, S Lawrence

    2014-01-16

    Surface receptors can link binding of ligands to changes in the actin-based cell cytoskeleton. Chia et al. and Chen et al. provide evidence for direct binding between the cytoplasmic tails of receptors and the WAVE complex, a regulator of the actin nucleator Arp2/3 complex, which might help to explain how environmental signals are translated into changes in morphology and motility. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Ligand-induced type II interleukin-4 receptor dimers are sustained by rapid re-association within plasma membrane microcompartments

    NASA Astrophysics Data System (ADS)

    Richter, David; Moraga, Ignacio; Winkelmann, Hauke; Birkholz, Oliver; Wilmes, Stephan; Schulte, Markos; Kraich, Michael; Kenneweg, Hella; Beutel, Oliver; Selenschik, Philipp; Paterok, Dirk; Gavutis, Martynas; Schmidt, Thomas; Garcia, K. Christopher; Müller, Thomas D.; Piehler, Jacob

    2017-07-01

    The spatiotemporal organization of cytokine receptors in the plasma membrane is still debated with models ranging from ligand-independent receptor pre-dimerization to ligand-induced receptor dimerization occurring only after receptor uptake into endosomes. Here, we explore the molecular and cellular determinants governing the assembly of the type II interleukin-4 receptor, taking advantage of various agonists binding the receptor subunits with different affinities and rate constants. Quantitative kinetic studies using artificial membranes confirm that receptor dimerization is governed by the two-dimensional ligand-receptor interactions and identify a critical role of the transmembrane domain in receptor dimerization. Single molecule localization microscopy at physiological cell surface expression levels, however, reveals efficient ligand-induced receptor dimerization by all ligands, largely independent of receptor binding affinities, in line with the similar STAT6 activation potencies observed for all IL-4 variants. Detailed spatiotemporal analyses suggest that kinetic trapping of receptor dimers in actin-dependent microcompartments sustains robust receptor dimerization and signalling.

  10. Auto-antibodies to Receptor Tyrosine Kinases TrkA, TrkB and TrkC in Patients with Chronic Chagas’ Disease

    PubMed Central

    Lu, B.; Petrola, Z.; Luquetti, A. O.; PereiraPerrin, M.

    2010-01-01

    The Chagas’ disease parasite Trypanosoma cruzi promotes survival and differentiation of neurones by binding and activating nerve growth factor (NGF) receptor TrkA. The functional mimic of NGF in T. cruzi is a surface-bound and shed immunogenic protein [neurotrophic factor/trans-sialidase (TS)], which raised the possibility that immune response to T. cruzi in general and to neurotrophic factor/TS in particular leads to loss of immunological tolerance to host NGF and/or the NGF-binding partner TrkA. In testing this hypothesis, we found that sera of individuals with chronic Chagas’ disease bear unique IgG2 autoantibodies that bind TrkA and TrkA family members TrkB and TrkC (ATA). Binding of ATA to Trk receptors is specific because the autoantibodies did not cross-react with five other growth factor receptors, NGF and other neurotrophins, and T. cruzi. Thus, individuals with chronic Chagas’ disease produce unique antibodies that react with pan-Trk receptors, one of which (TrkA) T. cruzi exploits to inhibit host cell apoptosis and to promote cellular invasion. PMID:18410251

  11. Structural basis for ligand and innate immunity factor uptake by the trypanosome haptoglobin-haemoglobin receptor.

    PubMed

    Lane-Serff, Harriet; MacGregor, Paula; Lowe, Edward D; Carrington, Mark; Higgins, Matthew K

    2014-12-12

    The haptoglobin-haemoglobin receptor (HpHbR) of African trypanosomes allows acquisition of haem and provides an uptake route for trypanolytic factor-1, a mediator of innate immunity against trypanosome infection. In this study, we report the structure of Trypanosoma brucei HpHbR in complex with human haptoglobin-haemoglobin (HpHb), revealing an elongated ligand-binding site that extends along its membrane distal half. This contacts haptoglobin and the β-subunit of haemoglobin, showing how the receptor selectively binds HpHb over individual components. Lateral mobility of the glycosylphosphatidylinositol-anchored HpHbR, and a ∼50° kink in the receptor, allows two receptors to simultaneously bind one HpHb dimer. Indeed, trypanosomes take up dimeric HpHb at significantly lower concentrations than monomeric HpHb, due to increased ligand avidity that comes from bivalent binding. The structure therefore reveals the molecular basis for ligand and innate immunity factor uptake by trypanosomes and identifies adaptations that allow efficient ligand uptake in the context of the complex trypanosome cell surface.

  12. Complex between α-bungarotoxin and an α7 nicotinic receptor ligand-binding domain chimaera

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Sun; Li, Shu-Xing; Bren, Nina

    2013-09-01

    To identify high-affinity interactions between long-chain α-neurotoxins and nicotinic receptors, we determined the crystal structure of the complex between α-btx (α-bungarotoxin) and a pentameric ligand-binding domain constructed from the human α7 AChR (acetylcholine receptor) and AChBP (acetylcholine-binding protein). The complex buries ~2000 Å 2 (1 Å=0.1 nm) of surface area, within which Arg 36 and Phe 32 from finger II of α-btx form a π-cation stack that aligns edge-to-face with the conserved Tyr 184 from loop-C of α7, while Asp 30 of α-btx forms a hydrogen bond with the hydroxy group of Tyr 184. These inter-residue interactions diverge from thosemore » in a 4.2 Å structure of α-ctx (α-cobratoxin) bound to AChBP, but are similar to those in a 1.94 Å structure of α-btx bound to the monomeric α1 extracellular domain, although compared with the monomer-bound complex, the α-btx backbone exhibits a large shift relative to the protein surface. Mutational analyses show that replacing Tyr 184 with a threonine residue abolishes high-affinity α-btx binding, whereas replacing with a phenylalanine residue maintains high affinity. Comparison of the α-btx complex with that coupled to the agonist epibatidine reveals structural rearrangements within the binding pocket and throughout each subunit. The overall findings highlight structural principles by which α-neurotoxins interact with nicotinic receptors.« less

  13. Charge heterogeneity: Basic antibody charge variants with increased binding to Fc receptors.

    PubMed

    Hintersteiner, Beate; Lingg, Nico; Zhang, Peiqing; Woen, Susanto; Hoi, Kong Meng; Stranner, Stefan; Wiederkum, Susanne; Mutschlechner, Oliver; Schuster, Manfred; Loibner, Hans; Jungbauer, Alois

    We identified active isoforms of the chimeric anti-GD2 antibody, ch14.18, a recombinant antibody produced in Chinese hamster ovary cells, which is already used in clinical trials. 1,2,3 We separated the antibody by high resolution ion-exchange chromatography with linear pH gradient elution into acidic, main and basic charge variants on a preparative scale yielding enough material for an in-depth study of the sources and the effects of microheterogeneity. The binding affinity of the charge variants toward the antigen and various cell surface receptors was studied by Biacore. Effector functions were evaluated using cellular assays for antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity. Basic charge variants showed increased binding to cell surface receptor FcγRIIIa, which plays a major role in regulating effector functions. Furthermore, increased binding of the basic fractions to the neonatal receptor was observed. As this receptor mediates the prolonged half-life of IgG in human serum, this data may well hint at an increased serum half-life of these basic variants compared to their more acidic counterparts. Different glycoform patterns, C-terminal lysine clipping and N-terminal pyroglutamate formation were identified as the main structural sources for the observed isoform pattern. Potential differences in structural stability between individual charge variant fractions by nano differential scanning calorimetry could not been detected. Our in-vitro data suggests that the connection between microheterogeneity and the biological activity of recombinant antibody therapeutics deserves more attention than commonly accepted.

  14. Phosphatidylserine recognition and induction of apoptotic cell clearance by Drosophila engulfment receptor Draper.

    PubMed

    Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu

    2013-05-01

    The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.

  15. GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

    PubMed Central

    Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

    2016-01-01

    Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

  16. Utilization of extracellular information before ligand-receptor binding reaches equilibrium expands and shifts the input dynamic range

    PubMed Central

    Ventura, Alejandra C.; Bush, Alan; Vasen, Gustavo; Goldín, Matías A.; Burkinshaw, Brianne; Bhattacharjee, Nirveek; Folch, Albert; Brent, Roger; Chernomoretz, Ariel; Colman-Lerner, Alejandro

    2014-01-01

    Cell signaling systems sense and respond to ligands that bind cell surface receptors. These systems often respond to changes in the concentration of extracellular ligand more rapidly than the ligand equilibrates with its receptor. We demonstrate, by modeling and experiment, a general “systems level” mechanism cells use to take advantage of the information present in the early signal, before receptor binding reaches a new steady state. This mechanism, pre-equilibrium sensing and signaling (PRESS), operates in signaling systems in which the kinetics of ligand-receptor binding are slower than the downstream signaling steps, and it typically involves transient activation of a downstream step. In the systems where it operates, PRESS expands and shifts the input dynamic range, allowing cells to make different responses to ligand concentrations so high as to be otherwise indistinguishable. Specifically, we show that PRESS applies to the yeast directional polarization in response to pheromone gradients. Consideration of preexisting kinetic data for ligand-receptor interactions suggests that PRESS operates in many cell signaling systems throughout biology. The same mechanism may also operate at other levels in signaling systems in which a slow activation step couples to a faster downstream step. PMID:25172920

  17. Receptor type I and type II binding regions and the peptidyl-prolyl isomerase site of cyclophilin B are required for enhancement of T-lymphocyte adhesion to fibronectin.

    PubMed

    Carpentier, Mathieu; Allain, Fabrice; Slomianny, Marie-Christine; Durieux, Sandrine; Vanpouille, Christophe; Haendler, Bernard; Spik, Geneviève

    2002-04-23

    Cyclophilin B (CyPB), a cyclosporin A (CsA) binding protein, interacts with two types of binding sites at the surface of T-lymphocytes. The type I sites correspond to functional receptors involved in endocytosis and the type II sites to sulfated glycosaminoglycans (GAGs). Mutational analysis of CyPB has revealed that W128, which is part of the CsA-binding pocket, is implicated in the binding to the functional type I receptors and that two amino acid clusters located in the N-terminus ensure the binding to GAGs. The peptidyl-prolyl isomerase activity of CyPB is not required for receptor binding. We have recently demonstrated that CyPB enhances adhesion of peripheral blood T-lymphocytes to fibronectin, a component of the extracellular matrix. We intended to identify additional amino acids involved in the binding of CyPB to its functional type I receptor and to determine regions responsible for the stimulation of peripheral blood T-lymphocyte adhesion. We determined that residues R76, G77, K132, D155, and D158 of the calcineurin (CN) interacting region were implicated in the recognition of type I receptor but not of GAGs. We also found that two different changes in the N-terminal extension that abated binding to GAGs prevented adhesion of peripheral blood T-lymphocytes to coated CyPB, whereas abbrogation of the PPIase activity had no effect. On the other hand, the adhesion of peripheral blood T-lymphocytes to coated fibronectin was not stimulated by CyPB mutants devoid of either type I receptor or GAGs binding activity or by mutants of the PPIase site. Altogether, the results demonstrate that different regions of CyPB are involved in peripheral blood T-lymphocyte activation and imply a novel important physiological function for peptidyl-prolyl isomerase activity.

  18. Fixation of Oligosaccharides to a Surface May Increase the Susceptibility to Human Parainfluenza Virus 1, 2, or 3 Hemagglutinin-Neuraminidase▿†

    PubMed Central

    Tappert, Mary M.; Smith, David F.; Air, Gillian M.

    2011-01-01

    The hemagglutinin-neuraminidase (HN) protein of human parainfluenza viruses (hPIVs) both binds (H) and cleaves (N) oligosaccharides that contain N-acetylneuraminic acid (Neu5Ac). H is thought to correspond to receptor binding and N to receptor-destroying activity. At present, N′s role in infection remains unclear: does it destroy only receptors, or are there other targets? We previously demonstrated that hPIV1 and 3 HNs bind to oligosaccharides containing the motif Neu5Acα2-3Galβ1-4GlcNAc (M. Amonsen, D. F. Smith, R. D. Cummings, and G. M. Air, J. Virol. 81:8341–8345, 2007). In the present study, we tested the binding specificity of hPIV2 on the Consortium for Functional Glycomics' glycan array and found that hPIV2 binds to oligosaccharides containing the same motif. We determined the specificities of N on red blood cells, soluble small-molecule and glycoprotein substrates, and the glycan array and compared them to the specificities of H. hPIV2 and -3, but not hPIV1, cleaved their ligands on red blood cells. hPIV1, -2, and -3 cleaved their NeuAcα2-3 ligands on the glycan array; hPIV2 and -3 also cleaved NeuAcα2-6 ligands bound by influenza A virus. While all three HNs exhibited similar affinities for all cleavable soluble substrates, their activities were 5- to 10-fold higher on small molecules than on glycoproteins. In addition, some soluble glycoproteins were not cleaved, despite containing oligosaccharides that were cleaved on the glycan array. We conclude that the susceptibility of an oligosaccharide substrate to N increases when the substrate is fixed to a surface. These findings suggest that HN may undergo a conformational change that activates N upon receptor binding at a cell surface. PMID:21917945

  19. Studies of the viral binding proteins of shrimp BP53, a receptor of white spot syndrome virus.

    PubMed

    Li, Chen; Gao, Xiao-Xiao; Huang, Jie; Liang, Yan

    2016-02-01

    The specific binding between viral attachment proteins (VAPs) of a virus and its cellular receptors on host cells mediates virus entry into host cells, which triggers subsequent viral infections. Previous studies indicate that F1 ATP synthase β subunit (named BP53), is found on the surface of shrimp cells and involved in white spot syndrome virus (WSSV) infection by functioning as a potential viral receptor. Herein, in a far-western blotting assay, three WSSV proteins with molecular weights of 28 kDa, 37 kDa, and >50 kDa were found to interact with BP53. The 28 kDa and 37 kDa proteins were identified as the envelope protein VP28 and VP37 of WSSV respectively, which could be recognized by the polyclonal antibodies. Enzyme-linked immunosorbent binding assays revealed that VP37 contributed to almost 80% of the binding capability for BP53 compared with the same amount of total WSSV protein. The relationship between BP53 and its complementary interacting protein, VP37, was visualized using a co-localization assay. Bound VP37 on the cell surface co-localized with BP53 and shared a similar subcellular location on the outer surface of shrimp cells. Pearson's correlation coefficients reached to 0.67 ± 0.05 and the Mander's overlap coefficients reached 0.70 ± 0.05, which indicated a strong relationship between the localization of BP53 and bound rVP37. This provides evidence for an interaction between BP53 and VP37 obtained at the molecular and cellular levels, supporting the hypothesis that BP53 serves as a receptor for WSSV by binding to VP37. The identification of the viral binding proteins of shrimp BP53 is helpful for better understanding the pathogenic mechanisms of WSSV to infect shrimp at the cellular level. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Functional dynamics of cell surface membrane proteins

    NASA Astrophysics Data System (ADS)

    Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio

    2014-04-01

    Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules.

  1. Functional dynamics of cell surface membrane proteins.

    PubMed

    Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio

    2014-04-01

    Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Role of Receptors in Bacillus thuringiensis Crystal Toxin Activity

    PubMed Central

    Pigott, Craig R.; Ellar, David J.

    2007-01-01

    Bacillus thuringiensis produces crystalline protein inclusions with insecticidal or nematocidal properties. These crystal (Cry) proteins determine a particular strain's toxicity profile. Transgenic crops expressing one or more recombinant Cry toxins have become agriculturally important. Individual Cry toxins are usually toxic to only a few species within an order, and receptors on midgut epithelial cells have been shown to be critical determinants of Cry specificity. The best characterized of these receptors have been identified for lepidopterans, and two major receptor classes have emerged: the aminopeptidase N (APN) receptors and the cadherin-like receptors. Currently, 38 different APNs have been reported for 12 different lepidopterans. Each APN belongs to one of five groups that have unique structural features and Cry-binding properties. While 17 different APNs have been reported to bind to Cry toxins, only 2 have been shown to mediate toxin susceptibly in vivo. In contrast, several cadherin-like proteins bind to Cry toxins and confer toxin susceptibility in vitro, and disruption of the cadherin gene has been associated with toxin resistance. Nonetheless, only a small subset of the lepidopteran-specific Cry toxins has been shown to interact with cadherin-like proteins. This review analyzes the interactions between Cry toxins and their receptors, focusing on the identification and validation of receptors, the molecular basis for receptor recognition, the role of the receptor in resistant insects, and proposed models to explain the sequence of events at the cell surface by which receptor binding leads to cell death. PMID:17554045

  3. A rigorous multiple independent binding site model for determining cell-based equilibrium dissociation constants.

    PubMed

    Drake, Andrew W; Klakamp, Scott L

    2007-01-10

    A new 4-parameter nonlinear equation based on the standard multiple independent binding site model (MIBS) is presented for fitting cell-based ligand titration data in order to calculate the ligand/cell receptor equilibrium dissociation constant and the number of receptors/cell. The most commonly used linear (Scatchard Plot) or nonlinear 2-parameter model (a single binding site model found in commercial programs like Prism(R)) used for analysis of ligand/receptor binding data assumes only the K(D) influences the shape of the titration curve. We demonstrate using simulated data sets that, depending upon the cell surface receptor expression level, the number of cells titrated, and the magnitude of the K(D) being measured, this assumption of always being under K(D)-controlled conditions can be erroneous and can lead to unreliable estimates for the binding parameters. We also compare and contrast the fitting of simulated data sets to the commonly used cell-based binding equation versus our more rigorous 4-parameter nonlinear MIBS model. It is shown through these simulations that the new 4-parameter MIBS model, when used for cell-based titrations under optimal conditions, yields highly accurate estimates of all binding parameters and hence should be the preferred model to fit cell-based experimental nonlinear titration data.

  4. LeEix1 functions as a decoy receptor to attenuate LeEix2 signaling.

    PubMed

    Bar, Maya; Sharfman, Miya; Avni, Adi

    2011-03-01

    The receptors for the fungal elicitor EIX (LeEix1 and LeEix2) belong to a class of leucine-rich repeat cell-surface glycoproteins with a signal for receptor-mediated endocytosis. Both receptors are able to bind the EIX elicitor while only the LeEix2 receptor mediates defense responses. We show that LeEix1 acts as a decoy receptor and attenuates EIX induced internalization and signaling of the LeEix2 receptor. We demonstrate that BAK1 binds LeEix1 but not LeEix2. In plants where BAK1 was silenced, LeEix1 was no longer able to attenuate plant responses to EIX, indicating that BAK1 is required for this attenuation. We suggest that LeEix1 functions as a decoy receptor for LeEix2, a function which requires the kinase activity of BAK1.

  5. How the Binding of Human Transferrin Primes the Transferrin Receptor Potentiating Iron Release at Endosomal pH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    B Eckenroth; A Steere; N Chasteen

    2011-12-31

    Delivery of iron to cells requires binding of two iron-containing human transferrin (hTF) molecules to the specific homodimeric transferrin receptor (TFR) on the cell surface. Through receptor-mediated endocytosis involving lower pH, salt, and an unidentified chelator, iron is rapidly released from hTF within the endosome. The crystal structure of a monoferric N-lobe hTF/TFR complex (3.22-{angstrom} resolution) features two binding motifs in the N lobe and one in the C lobe of hTF. Binding of Fe{sub N}hTF induces global and site-specific conformational changes within the TFR ectodomain. Specifically, movements at the TFR dimer interface appear to prime the TFR to undergomore » pH-induced movements that alter the hTF/TFR interaction. Iron release from each lobe then occurs by distinctly different mechanisms: Binding of His349 to the TFR (strengthened by protonation at low pH) controls iron release from the C lobe, whereas displacement of one N-lobe binding motif, in concert with the action of the dilysine trigger, elicits iron release from the N lobe. One binding motif in each lobe remains attached to the same {alpha}-helix in the TFR throughout the endocytic cycle. Collectively, the structure elucidates how the TFR accelerates iron release from the C lobe, slows it from the N lobe, and stabilizes binding of apohTF for return to the cell surface. Importantly, this structure provides new targets for mutagenesis studies to further understand and define this system.« less

  6. A sorting nexin 17-binding domain within the LRP1 cytoplasmic tail mediates receptor recycling through the basolateral sorting endosome

    PubMed Central

    Farfán, Pamela; Lee, Jiyeon; Larios, Jorge; Sotelo, Pablo; Bu, Guojun; Marzolo, María-Paz

    2013-01-01

    Sorting nexin 17 (SNX17) is an adaptor protein present in EEA1-positive sorting endosomes that promotes the efficient recycling of low-density lipoprotein receptor-related protein 1 (LRP1) to the plasma membrane through recognition of the first NPxY motif in the cytoplasmic tail of this receptor. The interaction of LRP1 with SNX17 also regulates the basolateral recycling of the receptor from the basolateral sorting endosome (BSE). In contrast, megalin, which is apically distributed in polarized epithelial cells and localizes poorly to EEA1-positive sorting endosomes, does not interact with SNX17, despite containing three NPxY motifs, indicating that this motif is not sufficient for receptor recognition by SNX17. Here, we identified a cluster of 32 amino acids within the cytoplasmic domain of LRP1 that is both necessary and sufficient for SNX17 binding. To delineate the function of this SNX17-binding domain, we generated chimeric proteins in which the SNX17-binding domain was inserted into the cytoplasmic tail of megalin. This insertion mediated the binding of megalin to SNX17 and modified the cell surface expression and recycling of megalin in non-polarized cells. However, the polarized localization of chimeric megalin was not modified in polarized MDCK cells. These results provide evidence regarding the molecular and cellular mechanisms underlying the specificity of SNX17-binding receptors and the restricted function of SNX17 in the BSE. PMID:23593972

  7. β1,4-galactosyltransferase 1 is a novel receptor for IgA in human mesangial cells.

    PubMed

    Molyneux, Karen; Wimbury, David; Pawluczyk, Izabella; Muto, Masahiro; Bhachu, Jasraj; Mertens, Peter R; Feehally, John; Barratt, Jonathan

    2017-12-01

    IgA nephropathy is characterized by mesangial deposition of IgA, mesangial cell proliferation, and extracellular matrix production. Mesangial cells bind IgA, but the identity of all potential receptors involved remains incomplete. The transferrin receptor (CD71) acts as a mesangial cell IgA receptor and its expression is upregulated in many forms of glomerulonephritis, including IgA nephropathy. CD71 is not expressed in healthy glomeruli and blocking CD71 does not completely abrogate mesangial cell IgA binding. Previously we showed that mesangial cells express a receptor that binds the Fc portion of IgA and now report that this receptor is an isoform of β-1,4-galactosyltransferase. A human mesangial cell cDNA library was screened for IgA binding proteins and β-1,4-galactosyltransferase identified. Cell surface expression of the long isoform of β-1,4-galactosyltransferase was shown by flow cytometry and confocal microscopy and confirmed by immunoblotting. Glomerular β-1,4-galactosyltransferase expression was increased in IgA nephropathy. IgA binding and IgA-induced mesangial cell phosphorylation of spleen tyrosine kinase and IL-6 synthesis were inhibited by a panel of β-1,4-galactosyltransferase-specific antibodies, suggesting IgA binds to the catalytic domain of β-1,4-galactosyltransferase. Thus, β-1,4-galactosyltransferase is a constitutively expressed mesangial cell IgA receptor with an important role in both mesangial IgA clearance and the initial response to IgA deposition. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  8. Dual GPCR and GAG mimicry by the M3 chemokine decoy receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexander-Brett, Jennifer M.; Fremont, Daved H.

    2008-09-23

    Viruses have evolved a myriad of evasion strategies focused on undermining chemokine-mediated immune surveillance, exemplified by the mouse {gamma}-herpesvirus 68 M3 decoy receptor. Crystal structures of M3 in complex with C chemokine ligand 1/lymphotactin and CC chemokine ligand 2/monocyte chemoattractant protein 1 reveal that invariant chemokine features associated with G protein-coupled receptor binding are primarily recognized by the decoy C-terminal domain, whereas the N-terminal domain (NTD) reconfigures to engage divergent basic residue clusters on the surface of chemokines. Favorable electrostatic forces dramatically enhance the association kinetics of chemokine binding by M3, with a primary role ascribed to acidic NTD regionsmore » that effectively mimic glycosaminoglycan interactions. Thus, M3 employs two distinct mechanisms of chemical imitation to potently sequester chemokines, thereby inhibiting chemokine receptor binding events as well as the formation of chemotactic gradients necessary for directed leukocyte trafficking.« less

  9. Sustained neurotensin exposure promotes cell surface recruitment of NTS2 receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perron, Amelie; Sharif, Nadder; Gendron, Louis

    2006-05-12

    In this study, we investigated whether persistent agonist stimulation of NTS2 receptors gives rise to down-regulation, in light of reports that their activation induced long-lasting effects. To address this issue, we incubated COS-7 cells expressing the rat NTS2 with neurotensin (NT) for up to 24 h and measured resultant cell surface [{sup 125}I]-NT binding. We found that NTS2-expressing cells retained the same surface receptor density despite efficient internalization mechanisms. This preservation was neither due to NTS2 neosynthesis nor recycling since it was not blocked by cycloheximide or monensin. However, it appeared to involve translocation of spare receptors from internal stores,more » as NT induced NTS2 migration from trans-Golgi network to endosome-like structures. This stimulation-induced regulation of cell surface NTS2 receptors was even more striking in rat spinal cord neurons. Taken together, these results suggest that sustained NTS2 activation promotes recruitment of intracellular receptors to the cell surface, thereby preventing functional desensitization.« less

  10. Agonist-dependent consequences of proline to alanine substitution in the transmembrane helices of the calcitonin receptor

    PubMed Central

    Bailey, R J; Hay, D L

    2007-01-01

    Background and purpose: Transmembrane proline (P) residues in family A G protein-coupled receptors (GPCRs) form functionally important kinks in their helices. These residues are little studied in family B GPCRs but experiments with the VPAC1 receptor and calcitonin receptor-like receptor (CL) show parallels with family A receptors. We sought to determine the function of these residues in the insert negative form of the human calcitonin receptor, a close relative of CL. Experimental approach: Proline residues within the transmembrane domains of the calcitonin receptor (P246, P249, P280, P326, P336) were individually mutated to alanine (A) using site-directed mutagenesis. Receptors were transiently transfected into Cos-7 cells using polyethylenimine and salmon and human calcitonin-induced cAMP responses measured. Salmon and human calcitonin competition binding experiments were also performed and receptor cell-surface expression assessed by whole cell ELISA. Key results: P246A, P249A and P280A were wild-type in terms of human calcitonin-induced cAMP activation. P326A and P336A had reduced function (165 and 12-fold, respectively). In membranes, human calcitonin binding was not detectable for any mutant receptor but in whole cells, binding was detected for all mutants apart from P326A. Salmon calcitonin activated mutant and wild-type receptors equally, although Bmax values were reduced for all mutants apart from P326A. Conclusions and Implications: P326 and P336 are important for the function of human calcitonin receptors and are likely to be involved in generating receptor conformations appropriate for agonist binding and receptor activation. However, agonist-specific effects were observed , implying distinct conformations of the human calcitonin receptor. PMID:17486143

  11. Impact of linker and conjugation chemistry on antigen binding, Fc receptor binding and thermal stability of model antibody-drug conjugates

    PubMed Central

    Acchione, Mauro; Kwon, Hyewon; Jochheim, Claudia M.; Atkins, William M.

    2012-01-01

    Antibody-drug conjugates (ADCs) with biotin as a model cargo tethered to IgG1 mAbs via different linkers and conjugation methods were prepared and tested for thermostability and ability to bind target antigen and Fc receptor. Most conjugates demonstrated decreased thermostability relative to unconjugated antibody, based on DSC, with carbohydrate and amine coupled ADCs showing the least effect compared with thiol coupled conjugates. A strong correlation between biotin-load and loss of stability is observed with thiol conjugation to one IgG scaffold, but the stability of a second IgG scaffold is relatively insensitive to biotin load. The same correlation for amine coupling was less significant. Binding of antibody to antigen and Fc receptor was investigated using surface plasmon resonance. None of the conjugates exhibited altered antigen affinity. Fc receptor FcγIIb (CD32b) interactions were investigated using captured antibody conjugate. Protein G and Protein A, known inhibitors of Fc receptor (FcR) binding to IgG, were also used to extend the analysis of the impact of conjugation on Fc receptor binding. H10NPEG4 was the only conjugate to show significant negative impact to FcR binding, which is likely due to higher biotin-load compared with the other ADCs. The ADC aHISNLC and aHISTPEG8 demonstrated some loss in affinity for FcR, but to much lower extent. The general insensitivity of target binding and effector function of the IgG1 platform to conjugation highlight their utility. The observed changes in thermostability require consideration for the choice of conjugation chemistry, depending on the system being pursued and particular application of the conjugate. PMID:22531451

  12. Activation of the novel estrogen receptor G protein-coupled receptor 30 (GPR30) at the plasma membrane.

    PubMed

    Filardo, E; Quinn, J; Pang, Y; Graeber, C; Shaw, S; Dong, J; Thomas, P

    2007-07-01

    G protein-coupled receptor 30 (GPR30), a seven-transmembrane receptor (7TMR), is associated with rapid estrogen-dependent, G protein signaling and specific estrogen binding. At present, the subcellular site of GPR30 action is unclear. Previous studies using antibodies and fluorochrome-labeled estradiol (E2) have failed to detect GPR30 on the cell surface, suggesting that GPR30 may function uniquely among 7TMRs as an intracellular receptor. Here, we show that detectable expression of GPR30 on the surface of transfected HEK-293 cells can be selected by fluorescence-activated cell sorting. Expression of GPR30 on the cell surface was confirmed by confocal microscopy using the lectin concanavalin A as a plasma membrane marker. Stimulation of GPR30-expressing HEK-293 cells with 17beta-E2 caused sequestration of GPR30 from the cell surface and resulted in its codistribution with clathrin and mobilization of intracellular calcium stores. Evidence that GPR30 signals from the cell surface was obtained from experiments demonstrating that the cell-impermeable E2-protein conjugates E2-BSA and E2-horseradish peroxidase promote GPR30-dependent elevation of intracellular cAMP concentrations. Subcellular fractionation studies further support the plasma membrane as a site of GPR30 action with specific [3H]17beta-E2 binding and G protein activation associated with plasma membrane but not microsomal, or other fractions, prepared from HEK-293 or SKBR3 breast cancer cells. These results suggest that GPR30, like other 7TMRs, functions as a plasma membrane receptor.

  13. Role of the Phosphatidylserine Receptor TIM-1 in Enveloped-Virus Entry

    PubMed Central

    Moller-Tank, Sven; Kondratowicz, Andrew S.; Davey, Robert A.; Rennert, Paul D.

    2013-01-01

    The cell surface receptor T cell immunoglobulin mucin domain 1 (TIM-1) dramatically enhances filovirus infection of epithelial cells. Here, we showed that key phosphatidylserine (PtdSer) binding residues of the TIM-1 IgV domain are critical for Ebola virus (EBOV) entry through direct interaction with PtdSer on the viral envelope. PtdSer liposomes but not phosphatidylcholine liposomes competed with TIM-1 for EBOV pseudovirion binding and transduction. Further, annexin V (AnxV) substituted for the TIM-1 IgV domain, supporting a PtdSer-dependent mechanism. Our findings suggest that TIM-1-dependent uptake of EBOV occurs by apoptotic mimicry. Additionally, TIM-1 enhanced infection of a wide range of enveloped viruses, including alphaviruses and a baculovirus. As further evidence of the critical role of enveloped-virion-associated PtdSer in TIM-1-mediated uptake, TIM-1 enhanced internalization of pseudovirions and virus-like proteins (VLPs) lacking a glycoprotein, providing evidence that TIM-1 and PtdSer-binding receptors can mediate virus uptake independent of a glycoprotein. These results provide evidence for a broad role of TIM-1 as a PtdSer-binding receptor that mediates enveloped-virus uptake. Utilization of PtdSer-binding receptors may explain the wide tropism of many of these viruses and provide new avenues for controlling their virulence. PMID:23698310

  14. A lectin receptor kinase as a potential sensor for extracellular nicotinamide adenine dinucleotide in Arabidopsis thaliana

    PubMed Central

    Wang, Chenggang; Zhou, Mingqi; Zhang, Xudong; Yao, Jin; Zhang, Yanping; Mou, Zhonglin

    2017-01-01

    Nicotinamide adenine dinucleotide (NAD+) participates in intracellular and extracellular signaling events unrelated to metabolism. In animals, purinergic receptors are required for extracellular NAD+ (eNAD+) to evoke biological responses, indicating that eNAD+ may be sensed by cell-surface receptors. However, the identity of eNAD+-binding receptors still remains elusive. Here, we identify a lectin receptor kinase (LecRK), LecRK-I.8, as a potential eNAD+ receptor in Arabidopsis. The extracellular lectin domain of LecRK-I.8 binds NAD+ with a dissociation constant of 436.5 ± 104.8 nM, although much higher concentrations are needed to trigger in vivo responses. Mutations in LecRK-I.8 inhibit NAD+-induced immune responses, whereas overexpression of LecRK-I.8 enhances the Arabidopsis response to NAD+. Furthermore, LecRK-I.8 is required for basal resistance against bacterial pathogens, substantiating a role for eNAD+ in plant immunity. Our results demonstrate that lectin receptors can potentially function as eNAD+-binding receptors and provide direct evidence for eNAD+ being an endogenous signaling molecule in plants. DOI: http://dx.doi.org/10.7554/eLife.25474.001 PMID:28722654

  15. High affinity binding of 125I-neurotensin to dispersed cells from chicken liver and brain.

    PubMed

    Mitra, S P; Carraway, R E

    1997-01-01

    Dispersed cells from chicken brain and liver were found to possess cell surface binding sites for 125I-neurotensin (125I-NT). Scatchard analyses indicated the presence of high affinity (K4, 25-80 pM) and low affinity (Kd, 250-450 pM) components in adult tissues. Binding capacity was reduced 25-40% by incubation with pertussis toxin. Ontogenetic studies indicated that NT receptor capacity increased approximately 20-fold from the embryonic stage to adult. Cross-linking of 125I-NT to intact cells labeled one major band (52 kDa, > or = 90%) and two minor bands (40 and 90 kDa, < or = 10%) which could represent distinct NT-receptors or one receptor partly degraded or cross-linked to G-protein(s). The binding of 125I-NT to dispersed cells was enhanced by reduction with dithoithreitol and suppressed by alkylation with N-ethyl-maleimide (NEM), maleimidocaproic acid (MCA) and p-chloromercuribenzenesulfonate (PCMBS). Since MCA and PCMBS do not permeate cells, this suggests that the sulfhydryl group(s) critical to binding are located within the NT receptor itself. Preincubation of cells with NT prior to treatment with NEM diminished its inhibitory effect, suggesting that the critical SH-group(s) were within the NT binding pocket or were protected by an allosteric effect. These results suggest that one or more of the nine cysteine residues in the NT receptor is involved in the NT binding reaction.

  16. Protein phosphatase 2A mediates resensitization of the neurokinin 1 receptor

    PubMed Central

    Murphy, Jane E.; Roosterman, Dirk; Cottrell, Graeme S.; Padilla, Benjamin E.; Feld, Micha; Brand, Eva; Cedron, Wendy J.; Steinhoff, Martin

    2011-01-01

    Activated G protein-coupled receptors (GPCRs) are phosphorylated and interact with β-arrestins, which mediate desensitization and endocytosis. Endothelin-converting enzyme-1 (ECE-1) degrades neuropeptides in endosomes and can promote recycling. Although endocytosis, dephosphorylation, and recycling are accepted mechanisms of receptor resensitization, a large proportion of desensitized receptors can remain at the cell surface. We investigated whether reactivation of noninternalized, desensitized (phosphorylated) receptors mediates resensitization of the substance P (SP) neurokinin 1 receptor (NK1R). Herein, we report a novel mechanism of resensitization by which protein phosphatase 2A (PP2A) is recruited to dephosphorylate noninternalized NK1R. A desensitizing concentration of SP reduced cell-surface SP binding sites by only 25%, and SP-induced Ca2+ signals were fully resensitized before cell-surface binding sites started to recover, suggesting resensitization of cell-surface-retained NK1R. SP induced association of β-arrestin1 and PP2A with noninternalized NK1R. β-Arrestin1 small interfering RNA knockdown prevented SP-induced association of cell-surface NK1R with PP2A, indicating that β-arrestin1 mediates this interaction. ECE-1 inhibition, by trapping β-arrestin1 in endosomes, also impeded SP-induced association of cell-surface NK1R with PP2A. Resensitization of NK1R signaling required both PP2A and ECE-1 activity. Thus, after stimulation with SP, PP2A interacts with noninternalized NK1R and mediates resensitization. PP2A interaction with NK1R requires β-arrestin1. ECE-1 promotes this process by releasing β-arrestin1 from NK1R in endosomes. These findings represent a novel mechanism of PP2A- and ECE-1-dependent resensitization of GPCRs. PMID:21795521

  17. Toward the Understanding of MNEI Sweetness from Hydration Map Surfaces

    PubMed Central

    De Simone, Alfonso; Spadaccini, Roberta; Temussi, Piero A.; Fraternali, Franca

    2006-01-01

    The binding mechanism of sweet proteins to their receptor, a G-protein-coupled receptor, is not supported by direct structural information. In principle, the key groups responsible for biological activity (glucophores) can be localized on a small structural unit (sweet finger) or spread on a larger surface area. A recently proposed model, called “wedge model”, implies a large surface of interaction with the receptor. To explore this model in greater detail, it is necessary to examine the physicochemical features of the surfaces of sweet proteins, since their interaction with the receptor, with respect to that of small sweeteners, is more dependent on general physicochemical properties of the interface, such as electrostatic potential and hydration. In this study, we performed exhaustive molecular dynamics simulations in explicit water of the sweet protein MNEI and of its structural mutant G-16A, whose sweetness is one order of magnitude lower than that of MNEI. Solvent density and self-diffusion calculated from molecular dynamics simulations suggest a likely area of interaction delimited by four stretches arranged as a tetrahedron whose shape is complementary to that of a cavity on the surface of the receptor, in agreement with the wedge model. The suggested area of interaction is amazingly consistent with known mutagenesis data. In addition, the asymmetric hydration of the only helix in both proteins hints at a specific role for this secondary structure element in orienting the protein during the binding process. PMID:16461400

  18. Structural basis for the specific recognition of IL-18 by its alpha receptor.

    PubMed

    Wei, Hui; Wang, Dongli; Qian, Yun; Liu, Xi; Fan, Shilong; Yin, Hsien-Sheng; Wang, Xinquan

    2014-11-03

    Interleukin 18 (IL-18), a member of the IL-1 family of cytokines, is an important regulator of innate and acquired immune responses. It signals through its ligand-binding primary receptor IL-18Rα and accessory receptor IL-18Rβ. Here we report the crystal structure of IL-18 with the ectodomain of IL-18Rα, which reveals the structural basis for their specific recognition. It confirms that surface charge complementarity determines the ligand-binding specificity of primary receptors in the IL-1 receptor family. We suggest that IL-18 signaling complex adopts an architecture similar to other agonistic cytokines and propose a general ligand-receptor assembly and activation model for the IL-1 family. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  19. In vitro evaluation of biodegradable microspheres with surface-bound ligands.

    PubMed

    Keegan, Mark E; Royce, Sara M; Fahmy, Tarek; Saltzman, W Mark

    2006-02-21

    Protein ligands were conjugated to the surface of biodegradable microspheres. These microsphere-ligand conjugates were then used in two in vitro model systems to evaluate the effect of conjugated ligands on microsphere behavior. Microsphere retention in agarose columns was increased by ligands on the microsphere surface specific for receptors on the agarose matrix. In another experiment, conjugating the lectin Ulex europaeus agglutinin 1 to the microsphere surface increased microsphere adhesion to Caco-2 monolayers compared to control microspheres. This increase in microsphere adhesion was negated by co-administration of l-fucose, indicating that the increase in adhesion is due to specific interaction of the ligand with carbohydrate receptors on the cell surface. These results demonstrate that the ligands conjugated to the microspheres maintain their receptor binding activity and are present on the microsphere surface at a density sufficient to target the microspheres to both monolayers and three-dimensional matrices bearing complementary receptors.

  20. The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity

    PubMed Central

    Shewell, Lucy K.; Harvey, Richard M.; Higgins, Melanie A.; Day, Christopher J.; Hartley-Tassell, Lauren E.; Chen, Austen Y.; Gillen, Christine M.; James, David B. A.; Alonzo, Francis; Torres, Victor J.; Walker, Mark J.; Paton, Adrienne W.; Paton, James C.; Jennings, Michael P.

    2014-01-01

    The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a Kd of 1.88 × 10−5 M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism. PMID:25422425

  1. The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity.

    PubMed

    Shewell, Lucy K; Harvey, Richard M; Higgins, Melanie A; Day, Christopher J; Hartley-Tassell, Lauren E; Chen, Austen Y; Gillen, Christine M; James, David B A; Alonzo, Francis; Torres, Victor J; Walker, Mark J; Paton, Adrienne W; Paton, James C; Jennings, Michael P

    2014-12-09

    The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a K(d) of 1.88 × 10(-5) M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism.

  2. SCM, the M Protein of Streptococcus canis Binds Immunoglobulin G

    PubMed Central

    Bergmann, Simone; Eichhorn, Inga; Kohler, Thomas P.; Hammerschmidt, Sven; Goldmann, Oliver; Rohde, Manfred; Fulde, Marcus

    2017-01-01

    The M protein of Streptococcus canis (SCM) is a virulence factor and serves as a surface-associated receptor with a particular affinity for mini-plasminogen, a cleavage product of the broad-spectrum serine protease plasmin. Here, we report that SCM has an additional high-affinity immunoglobulin G (IgG) binding activity. The ability of a particular S. canis isolate to bind to IgG significantly correlates with a scm-positive phenotype, suggesting a dominant role of SCM as an IgG receptor. Subsequent heterologous expression of SCM in non-IgG binding S. gordonii and Western Blot analysis with purified recombinant SCM proteins confirmed its IgG receptor function. As expected for a zoonotic agent, the SCM-IgG interaction is species-unspecific, with a particular affinity of SCM for IgGs derived from human, cats, dogs, horses, mice, and rabbits, but not from cows and goats. Similar to other streptococcal IgG-binding proteins, the interaction between SCM and IgG occurs via the conserved Fc domain and is, therefore, non-opsonic. Interestingly, the interaction between SCM and IgG-Fc on the bacterial surface specifically prevents opsonization by C1q, which might constitute another anti-phagocytic mechanism of SCM. Extensive binding analyses with a variety of different truncated SCM fragments defined a region of 52 amino acids located in the central part of the mature SCM protein which is important for IgG binding. This binding region is highly conserved among SCM proteins derived from different S. canis isolates but differs significantly from IgG-Fc receptors of S. pyogenes and S. dysgalactiae sub. equisimilis, respectively. In summary, we present an additional role of SCM in the pathogen-host interaction of S. canis. The detailed analysis of the SCM-IgG interaction should contribute to a better understanding of the complex roles of M proteins in streptococcal pathogenesis. PMID:28401063

  3. Structural basis for the antibody neutralization of Herpes simplex virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Cheng-Chung; Lin, Li-Ling; Academia Sinica, Taipei 115, Taiwan

    2013-10-01

    The gD–E317-Fab complex crystal revealed the conformational epitope of human mAb E317 on HSV gD, providing a molecular basis for understanding the viral neutralization mechanism. Glycoprotein D (gD) of Herpes simplex virus (HSV) binds to a host cell surface receptor, which is required to trigger membrane fusion for virion entry into the host cell. gD has become a validated anti-HSV target for therapeutic antibody development. The highly inhibitory human monoclonal antibody E317 (mAb E317) was previously raised against HSV gD for viral neutralization. To understand the structural basis of antibody neutralization, crystals of the gD ectodomain bound to the E317more » Fab domain were obtained. The structure of the complex reveals that E317 interacts with gD mainly through the heavy chain, which covers a large area for epitope recognition on gD, with a flexible N-terminal and C-terminal conformation. The epitope core structure maps to the external surface of gD, corresponding to the binding sites of two receptors, herpesvirus entry mediator (HVEM) and nectin-1, which mediate HSV infection. E317 directly recognizes the gD–nectin-1 interface and occludes the HVEM contact site of gD to block its binding to either receptor. The binding of E317 to gD also prohibits the formation of the N-terminal hairpin of gD for HVEM recognition. The major E317-binding site on gD overlaps with either the nectin-1-binding residues or the neutralizing antigenic sites identified thus far (Tyr38, Asp215, Arg222 and Phe223). The epitopes of gD for E317 binding are highly conserved between two types of human herpesvirus (HSV-1 and HSV-2). This study enables the virus-neutralizing epitopes to be correlated with the receptor-binding regions. The results further strengthen the previously demonstrated therapeutic and diagnostic potential of the E317 antibody.« less

  4. A physical model describing the interaction of nuclear transport receptors with FG nucleoporin domain assemblies

    PubMed Central

    Zahn, Raphael; Osmanović, Dino; Ehret, Severin; Araya Callis, Carolina; Frey, Steffen; Stewart, Murray; You, Changjiang; Görlich, Dirk; Hoogenboom, Bart W; Richter, Ralf P

    2016-01-01

    The permeability barrier of nuclear pore complexes (NPCs) controls bulk nucleocytoplasmic exchange. It consists of nucleoporin domains rich in phenylalanine-glycine motifs (FG domains). As a bottom-up nanoscale model for the permeability barrier, we have used planar films produced with three different end-grafted FG domains, and quantitatively analyzed the binding of two different nuclear transport receptors (NTRs), NTF2 and Importin β, together with the concomitant film thickness changes. NTR binding caused only moderate changes in film thickness; the binding isotherms showed negative cooperativity and could all be mapped onto a single master curve. This universal NTR binding behavior – a key element for the transport selectivity of the NPC – was quantitatively reproduced by a physical model that treats FG domains as regular, flexible polymers, and NTRs as spherical colloids with a homogeneous surface, ignoring the detailed arrangement of interaction sites along FG domains and on the NTR surface. DOI: http://dx.doi.org/10.7554/eLife.14119.001 PMID:27058170

  5. Pancreatic acini possess endothelin receptors whose internalization is regulated by PLC-activating agents.

    PubMed

    Hildebrand, P; Mrozinski, J E; Mantey, S A; Patto, R J; Jensen, R T

    1993-05-01

    Endothelin-1 (ET-1) and ET-3 mRNA have been found in the pancreas. We investigated the ability of ET-1, ET-2, and ET-3 to interact with and alter dispersed rat pancreatic acinar cell function. Radiolabeled ETs bound in a time- and temperature-dependent fashion, which was specific and saturable. Analysis demonstrated two classes of receptors, one class (ETA receptor) had a high affinity for ET-1 but a low affinity for ET-3, and the other class (ETB receptor) had equally high affinities for ET-1 and ET-3. No specific receptor for ET-2 was identified. Pancreatic secretagogues that activate phospholipase C (PLC) inhibited binding of 125I-labeled ET-1 (125I-ET-1) or 125I-ET-3, whereas agents that act through adenosine 3',5'-cyclic monophosphate (cAMP) did not. A23187 had no effect on 125I-ET-1 or 125I-ET-3 binding, whereas the phorbol ester 12-O-tetradecanoylphorbol 13-acetate reduced binding. The effect of cholecystokinin octapeptide (CCK-8) was mediated through its own receptor. Stripping of surface bound ligand studies demonstrated that both 125I-labeled ET-1 and 125I-labeled ET-3 were rapidly internalized. CCK-8 decreased the internalization but did not change the amount of surface bound ligand. Endothelins neither stimulate nor alter changes in enzyme secretion, intracellular calcium, cAMP, or [3H]inositol trisphosphate (IP3). This study demonstrates the presence of ETA and ETB receptors on rat pancreatic acini; occupation of both receptors resulted in rapid internalization, which is regulated by PLC-activating secretagogues. Occupation of either ET receptor did not alter intracellular calcium, cAMP, IP3, or stimulate amylase release.

  6. Live Cell Imaging Confocal Microscopy Analysis of HBV Myr-PreS1 Peptide Binding and Uptake in NTCP-GFP Expressing HepG2 Cells.

    PubMed

    König, Alexander; Glebe, Dieter

    2017-01-01

    To obtain basic knowledge about specific molecular mechanisms involved in the entry of pathogens into cells is the basis for establishing pharmacologic substances blocking initial viral binding, infection, and subsequent viral spread. Lack of information about key cellular factors involved in the initial steps of HBV infection has hampered the characterization of HBV binding and entry for decades. However, recently, the liver-specific sodium-dependent taurocholate cotransporting polypeptide (NTCP) has been discovered as a functional receptor for HBV and HDV, thus opening the field for new concepts of basic binding and entry of HBV and HDV. Here, we describe practical issues of a basic in vitro assay system to examine kinetics and mechanisms of receptor-dependent HBV binding, uptake, and intracellular trafficking by live-cell imaging confocal microscopy. The assay system is comprised of HepG2 cells expressing a NTCP-GFP fusion-protein and chemically synthesized, fluorophore-labeled part of HBV surface protein, spanning the first N-terminal 48 amino acids of preS1 of the large hepatitis B virus surface protein.

  7. Processing of carcinoembryonic antigen by Kupffer cells: recognition of a penta-peptide sequence.

    PubMed

    Gangopadhyay, A; Thomas, P

    1996-10-01

    Carcinoembryonic antigen (CEA) binds to an 80-kDa cell surface receptor on Kupffer cells via the peptide sequence PELPK (residues 108-112) located at the hinge region between the N and Al immunoglobulin-like domains. This study is aimed at analyzing the specificity of the peptide binding, determining biodistribution of 80-kDa receptor, and processing of CEA by this receptor. We synthesized a number of bovine serum albumin (BSA) derivatives carrying PELPK and related sequences. A series of peptides (YPELPK, YPDLPK, YPDLPR, and YPELGK) were conjugated to bovine serum albumin using N-hydroxysuccinimidyl-4-azidobenzoate. When 125I peptide conjugates, CEA, and BSA were injected intravenously into rats CEA and the PELPK-albumin conjugate were cleared rapidly. The other peptide conjugates and BSA cleared at a much slower rate. Activity of 125I-labeled CEA and PELPK-albumin conjugate per gram of tissue was highest for the liver and spleen. Clearance of 125I-CEA was inhibited by the presence of higher concentrations of the PELPK-albumin conjugate. With isolated rat Kupffer cells, only CEA and the PELPK-albumin conjugate were bound and internalized in vitro and CEA binding was inhibited by higher concentrations of the PELPK-albumin conjugate. Similarly, binding of the PELPK-albumin conjugate was inhibited by the presence of unlabeled CEA. Use of a heterobifunctional cross linking agent demonstrated reaction of the PELPK-albumin with an 80-kDa protein on the Kupffer cell surface by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). This semisynthetic ligand (PELPK-albumin) allows us to examine the function of the 80-kDa receptor without interference due to other properties of CEA including its ability to bind lectins and to cause homotypic aggregation of cells. The consequences of CEA binding to the 80-kDa receptor may have implications in the development of hepatic metastasis from colorectal cancer.

  8. The G-protein coupled estrogen receptor, GPER: The inside and inside-out story.

    PubMed

    Gaudet, H M; Cheng, S B; Christensen, E M; Filardo, E J

    2015-12-15

    GPER possesses structural and functional characteristics shared by members of the G-protein-coupled receptor (GPCR) superfamily, the largest class of plasma membrane receptors. This newly appreciated estrogen receptor is localized predominately within intracellular membranes in most, but not all, cell types and its surface expression is modulated by steroid hormones and during tissue injury. An intracellular staining pattern is not unique among GPCRs, which employ a diverse array of molecular mechanisms that restrict cell surface expression and effectively regulating receptor binding and activation. The finding that GPER displays an intracellular predisposition has created some confusion as the estrogen-inducible transcription factors, ERα and ERβ, also reside intracellularly, and has led to complex suggestions of receptor interaction. GPER undergoes constitutive retrograde trafficking from the plasma membrane to the endoplasmic reticulum and recent studies indicate its interaction with PDZ binding proteins that sort transmembrane receptors to synaptosomes and endosomes. Genetic targeting and selective ligand approaches as well as cell models that express GPER in the absence of ERs clearly supports GPER as a bonafide "stand alone" receptor. Here, the molecular details that regulate GPER action, its cell biological activities and its implicated roles in physiological and pathological processes are reviewed. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Phospholipids as an alternative to direct covalent coupling: surface functionalization of nanoporous alumina for protein recognition and purification.

    PubMed

    Lazzara, Thomas D; Behn, Daniela; Kliesch, Torben-Tobias; Janshoff, Andreas; Steinem, Claudia

    2012-01-15

    Anodic aluminum oxide (AAO) substrates with aligned, cylindrical, non-intersecting pores with diameters of 75 nm and depths of 3.5 or 10 μm were functionalized with lipid monolayers harboring different receptor lipids. AAO was first functionalized with dodecyl-trichlorosilane, followed by fusion of small unilamellar vesicles (SUVs) forming a lipid monolayer. The SUVs' lipid composition was transferred onto the AAO surface, allowing us to control the surface receptor density. Owing to the optical transparency of the AAO, the overall vesicle spreading process and subsequent protein binding to the receptor-doped lipid monolayers could be investigated in situ by optical waveguide spectroscopy (OWS). SUV spreading occurred at the pore-rim interface, followed by lateral diffusion of lipids within the pore-interior surface until homogeneous coverage was achieved with a lipid monolayer. The functionality of the system was demonstrated through streptavidin binding onto a biotin-DOPE containing POPC membrane, showing maximum protein coverage at 10 mol% of biotin-DOPE. The system enabled us to monitor in real-time the selective extraction of two histidine-tagged proteins, PIGEA14 (14 kDa) and ezrin (70 kDa), directly from cell lysate solutions using a DOGS-NTA(Ni)/DOPC (1:9) membrane. The purification process including protein binding and elution was monitored by OWS and confirmed by SDS-PAGE. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Receptor-binding region in human choriogonadotropin/lutropin. beta. subunit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keutmann, H.T.; Charlesworth, M.C.; Mason, K.A.

    1987-04-01

    Synthetic fragments have not been widely used thus far to evaluate structure-activity relations in the glycoprotein hormones. The authors prepared a series of peptides representing the intercysteine loop sequence (residues 38-57) in human choriogonadotropin (hCG) and lutropin (hLH) ..beta.. subunits, anticipating that it might be oriented toward the surface and accessible to receptors. The peptides were characterized chemically and tested for bioactivity by binding to rat ovarian membrane receptor and stimulation of Leydig cell testosterone production. The hCG..beta..-(38-57) and hLH..beta..-(38-57) peptides inhibited binding of /sup 125/I-labeled hCG half-maximally at 1.51 x 10/sup -4/ and 2.03 x 10/sup -5/ M, respectively,more » while other peptide hormones and fragments from elsewhere in the ..beta.. subunit were inactive. Both peptides stimulated testosterone production, with half-maximal responses at 3.55 x 10/sup -5/ M (hCG) and 2.18 x 10/sup -5/ M (hLH). By radioimmunoassay with an antibody to thyroglobulin-conjugated hCG..beta..-(38-57) peptide, native hCG and ..beta.. subunit were highly reactive, as were the reduced and carboxymethylated subunit and peptide. These results indicate that the 38-57 region of ..beta.. subunit is exposed on the surface and constitutes a component in the receptor-binding domain for hCG and hLH. A region of amphipathic-helical structure in the 38-57 sequence may promote hormone-receptor interactions in a manner proposed for several other peptide hormones.« less

  11. Regulation of B cell functions by the sialic acid-binding receptors siglec-G and CD22.

    PubMed

    Jellusova, Julia; Nitschke, Lars

    2011-01-01

    B cell antigen receptor (BCR) engagement can lead to many different physiologic outcomes. To achieve an appropriate response, the BCR signal is interpreted in the context of other stimuli and several additional receptors on the B cell surface participate in the modulation of the signal. Two members of the Siglec (sialic acid-binding immunoglobulin-like lectin) family, CD22 and Siglec-G have been shown to inhibit the BCR signal. Recent findings indicate that the ability of these two receptors to bind sialic acids might be important to induce tolerance to self-antigens. Sialylated glycans are usually absent on microbes but abundant in higher vertebrates and might therefore provide an important tolerogenic signal. Since the expression of the specific ligands for Siglec-G and CD22 is tightly regulated and since Siglecs are not only able to bind their ligands in trans but also on the same cell surface this might provide additional mechanisms to control the BCR signal. Although both Siglec-G and CD22 are expressed on B cells and are able to inhibit BCR mediated signaling, they also show unique biological functions. While CD22 is the dominant regulator of calcium signaling on conventional B2 cells and also seems to play a role on marginal zone B cells, Siglec-G exerts its function mainly on B1 cells and influences their lifespan and antibody production. Both Siglec-G and CD22 have also recently been linked to toll-like receptor signaling and may provide a link in the regulation of the adaptive and innate immune response of B cells.

  12. Charge heterogeneity: Basic antibody charge variants with increased binding to Fc receptors

    PubMed Central

    Hintersteiner, Beate; Lingg, Nico; Zhang, Peiqing; Woen, Susanto; Hoi, Kong Meng; Stranner, Stefan; Wiederkum, Susanne; Mutschlechner, Oliver; Schuster, Manfred; Loibner, Hans; Jungbauer, Alois

    2016-01-01

    ABSTRACT We identified active isoforms of the chimeric anti-GD2 antibody, ch14.18, a recombinant antibody produced in Chinese hamster ovary cells, which is already used in clinical trials.1,2,3 We separated the antibody by high resolution ion-exchange chromatography with linear pH gradient elution into acidic, main and basic charge variants on a preparative scale yielding enough material for an in-depth study of the sources and the effects of microheterogeneity. The binding affinity of the charge variants toward the antigen and various cell surface receptors was studied by Biacore. Effector functions were evaluated using cellular assays for antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity. Basic charge variants showed increased binding to cell surface receptor FcγRIIIa, which plays a major role in regulating effector functions. Furthermore, increased binding of the basic fractions to the neonatal receptor was observed. As this receptor mediates the prolonged half-life of IgG in human serum, this data may well hint at an increased serum half-life of these basic variants compared to their more acidic counterparts. Different glycoform patterns, C-terminal lysine clipping and N-terminal pyroglutamate formation were identified as the main structural sources for the observed isoform pattern. Potential differences in structural stability between individual charge variant fractions by nano differential scanning calorimetry could not been detected. Our in-vitro data suggests that the connection between microheterogeneity and the biological activity of recombinant antibody therapeutics deserves more attention than commonly accepted. PMID:27559765

  13. Analysis of CD44-Hyaluronan Interactions in an Artificial Membrane System

    PubMed Central

    Wolny, Patricia M.; Banerji, Suneale; Gounou, Céline; Brisson, Alain R.; Day, Anthony J.; Jackson, David G.; Richter, Ralf P.

    2010-01-01

    CD44 is a major cell surface receptor for the large polydisperse glycosaminoglycan hyaluronan (HA). Binding of the long and flexible HA chains is thought to be stabilized by the multivalent nature of the sugar molecule. In addition, high and low molecular weight forms of HA provoke distinct proinflammatory and anti-inflammatory effects upon binding to CD44 and can deliver either proliferative or antiproliferative signals in appropriate cell types. Despite the importance of such interactions, however, neither the stoichiometry of multivalent HA binding at the cell surface nor the molecular basis for functional distinction between different HA size categories is understood. Here we report on the design of a supported lipid bilayer system that permits quantitative analysis of multivalent binding through presentation of CD44 in a stable, natively oriented manner and at controlled density. Using this system in combination with biophysical techniques, we show that the amount of HA binding to bilayers that are densely coated with CD44 increases as a function of HA size, with half-maximal saturation at ∼30 kDa. Moreover, reversible binding was confined to the smaller HA species (molecular weight of ≤10 kDa), whereas the interaction was essentially irreversible with larger polymers. The amount of bound HA decreased with decreasing receptor surface density, but the stability of binding was not affected. From a physico-chemical perspective, the binding properties of HA share many similarities with the typical behavior of a flexible polymer as it adsorbs onto a homogeneously attractive surface. These findings provide new insight into the multivalent nature of CD44-HA interactions and suggest a molecular basis for the distinct biological properties of different size fractions of hyaluronan. PMID:20663884

  14. Nectin-like interactions between poliovirus and its receptor trigger conformational changes associated with cell entry.

    PubMed

    Strauss, Mike; Filman, David J; Belnap, David M; Cheng, Naiqian; Noel, Roane T; Hogle, James M

    2015-04-01

    Poliovirus infection is initiated by attachment to a receptor on the cell surface called Pvr or CD155. At physiological temperatures, the receptor catalyzes an irreversible expansion of the virus to form an expanded form of the capsid called the 135S particle. This expansion results in the externalization of the myristoylated capsid protein VP4 and the N-terminal extension of the capsid protein VP1, both of which become inserted into the cell membrane. Structures of the expanded forms of poliovirus and of several related viruses have recently been reported. However, until now, it has been unclear how receptor binding triggers viral expansion at physiological temperature. Here, we report poliovirus in complex with an enzymatically partially deglycosylated form of the 3-domain ectodomain of Pvr at a 4-Å resolution, as determined by cryo-electron microscopy. The interaction of the receptor with the virus in this structure is reminiscent of the interactions of Pvr with its natural ligands. At a low temperature, the receptor induces very few changes in the structure of the virus, with the largest changes occurring within the footprint of the receptor, and in a loop of the internal protein VP4. Changes in the vicinity of the receptor include the displacement of a natural lipid ligand (called "pocket factor"), demonstrating that the loss of this ligand, alone, is not sufficient to induce particle expansion. Finally, analogies with naturally occurring ligand binding in the nectin family suggest which specific structural rearrangements in the virus-receptor complex could help to trigger the irreversible expansion of the capsid. The cell-surface receptor (Pvr) catalyzes a large structural change in the virus that exposes membrane-binding protein chains. We fitted known atomic models of the virus and Pvr into three-dimensional experimental maps of the receptor-virus complex. The molecular interactions we see between poliovirus and its receptor are reminiscent of the nectin family, by involving the burying of otherwise-exposed hydrophobic groups. Importantly, poliovirus expansion is regulated by the binding of a lipid molecule within the viral capsid. We show that receptor binding either causes this molecule to be expelled or requires it, but that its loss is not sufficient to trigger irreversible expansion. Based on our model, we propose testable hypotheses to explain how the viral shell becomes destabilized, leading to RNA uncoating. These findings give us a better understanding of how poliovirus has evolved to exploit a natural process of its host to penetrate the membrane barrier. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Nectin-Like Interactions between Poliovirus and Its Receptor Trigger Conformational Changes Associated with Cell Entry

    PubMed Central

    Strauss, Mike; Filman, David J.; Belnap, David M.; Cheng, Naiqian; Noel, Roane T.

    2015-01-01

    ABSTRACT Poliovirus infection is initiated by attachment to a receptor on the cell surface called Pvr or CD155. At physiological temperatures, the receptor catalyzes an irreversible expansion of the virus to form an expanded form of the capsid called the 135S particle. This expansion results in the externalization of the myristoylated capsid protein VP4 and the N-terminal extension of the capsid protein VP1, both of which become inserted into the cell membrane. Structures of the expanded forms of poliovirus and of several related viruses have recently been reported. However, until now, it has been unclear how receptor binding triggers viral expansion at physiological temperature. Here, we report poliovirus in complex with an enzymatically partially deglycosylated form of the 3-domain ectodomain of Pvr at a 4-Å resolution, as determined by cryo-electron microscopy. The interaction of the receptor with the virus in this structure is reminiscent of the interactions of Pvr with its natural ligands. At a low temperature, the receptor induces very few changes in the structure of the virus, with the largest changes occurring within the footprint of the receptor, and in a loop of the internal protein VP4. Changes in the vicinity of the receptor include the displacement of a natural lipid ligand (called “pocket factor”), demonstrating that the loss of this ligand, alone, is not sufficient to induce particle expansion. Finally, analogies with naturally occurring ligand binding in the nectin family suggest which specific structural rearrangements in the virus-receptor complex could help to trigger the irreversible expansion of the capsid. IMPORTANCE The cell-surface receptor (Pvr) catalyzes a large structural change in the virus that exposes membrane-binding protein chains. We fitted known atomic models of the virus and Pvr into three-dimensional experimental maps of the receptor-virus complex. The molecular interactions we see between poliovirus and its receptor are reminiscent of the nectin family, by involving the burying of otherwise-exposed hydrophobic groups. Importantly, poliovirus expansion is regulated by the binding of a lipid molecule within the viral capsid. We show that receptor binding either causes this molecule to be expelled or requires it, but that its loss is not sufficient to trigger irreversible expansion. Based on our model, we propose testable hypotheses to explain how the viral shell becomes destabilized, leading to RNA uncoating. These findings give us a better understanding of how poliovirus has evolved to exploit a natural process of its host to penetrate the membrane barrier. PMID:25631086

  16. Metformin is a novel suppressor for transforming growth factor (TGF)-β1

    NASA Astrophysics Data System (ADS)

    Xiao, Han; Zhang, Jianshu; Xu, Zhonghe; Feng, Yenan; Zhang, Mingliang; Liu, Jianli; Chen, Ruifei; Shen, Jing; Wu, Jimin; Lu, Zhizhen; Fang, Xiaohong; Li, Jingyuan; Zhang, Youyi

    2016-06-01

    Metformin is a widely used first-line antidiabetic drug that has been shown to protect against a variety of specific diseases in addition to diabetes, including cardiovascular disorders, polycystic ovary syndrome, and cancer. However, the precise mechanisms underlying the diverse therapeutic effects of metformin remain elusive. Here, we report that transforming growth factor-β1 (TGF-β1), which is involved in the pathogenesis of numerous diseases, is a novel target of metformin. Using a surface plasmon resonance-based assay, we identified the direct binding of metformin to TGF-β1 and found that metformin inhibits [125I]-TGF-β1 binding to its receptor. Furthermore, based on molecular docking and molecular dynamics simulations, metformin was predicted to interact with TGF-β1 at its receptor-binding domain. Single-molecule force spectroscopy revealed that metformin reduces the binding probability but not the binding force of TGF-β1 to its type II receptor. Consequently, metformin suppresses type II TGF-β1 receptor dimerization upon exposure to TGF-β1, which is essential for downstream signal transduction. Thus, our results indicate that metformin is a novel TGF-β suppressor with therapeutic potential for numerous diseases in which TGF-β1 hyperfunction is indicated.

  17. Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses

    PubMed Central

    Hendricks, Gabriel L.; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C.; Viswanathan, Karthik; Albers, Leila; Comolli, James C.; Shriver, Zachary; Knipe, David M.; Kurt-Jones, Evelyn A.; Fygenson, Deborah K.; Trevejo, Jose M.

    2016-01-01

    Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as ‘molecular sinks’ and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. PMID:25637710

  18. Single-molecule photobleaching reveals increased MET receptor dimerization upon ligand binding in intact cells

    PubMed Central

    2013-01-01

    Background The human receptor tyrosine kinase MET and its ligand hepatocyte growth factor/scatter factor are essential during embryonic development and play an important role during cancer metastasis and tissue regeneration. In addition, it was found that MET is also relevant for infectious diseases and is the target of different bacteria, amongst them Listeria monocytogenes that induces bacterial uptake through the surface protein internalin B. Binding of ligand to the MET receptor is proposed to lead to receptor dimerization. However, it is also discussed whether preformed MET dimers exist on the cell membrane. Results To address these issues we used single-molecule fluorescence microscopy techniques. Our photobleaching experiments show that MET exists in dimers on the membrane of cells in the absence of ligand and that the proportion of MET dimers increases significantly upon ligand binding. Conclusions Our results indicate that partially preformed MET dimers may play a role in ligand binding or MET signaling. The addition of the bacterial ligand internalin B leads to an increase of MET dimers which is in agreement with the model of ligand-induced dimerization of receptor tyrosine kinases. PMID:23731667

  19. Mesd Is a Universal Inhibitor of Wnt Co-receptor LRP5/6 and Blocks Wnt/β-catenin Signaling in Cancer Cells†

    PubMed Central

    Lu, Wenyan; Liu, Chia-Chen; Thottassery, Jaideep V.; Bu, Guojun; Li, Yonghe

    2010-01-01

    Mesd is a specialized chaperone for the low-density lipoprotein receptor-related protein-5 (LRP5) and LRP6. In our previous studies, we found that Mesd binds to mature LRP6 on the cell surface and blocks the binding of Wnt antagonist Dickkopf-1(Dkk1) to LRP6. Herein, we demonstrated that Mesd also binds to LRP5 with a high affinity, and is a universal inhibitor of LRP5/6 ligands. Mesd not only blocks Wnt antagonists Dkk1 and Sclerostin binding to LRP5/6, but also inhibits Wnt3A and Rspondin1-induced Wnt/β-catenin signaling in LRP5/6 expressing cells. We also found that Mesd, Dkk1 and Sclerostin compete with one another for binding to LRP5 and LRP6 at the cell surface. More importantly, we demonstrated that Mesd is able to suppress LRP6 phosphorylation and Wnt/β-catenin signaling in prostate cancer PC-3 cells, and inhibits PC-3 cell proliferation. Our results indicate that recombinant Mesd protein is a useful tool for studying Wnt/β-catenin signaling on the cell surface, and has a potential therapeutic role in Wnt-dependent cancers. PMID:20446724

  20. The Evolving Field of Human Papillomavirus Receptor Research: a Review of Binding and Entry

    PubMed Central

    Raff, Adam B.; Woodham, Andrew W.; Raff, Laura M.; Skeate, Joseph G.; Yan, Lisa; Da Silva, Diane M.; Schelhaas, Mario

    2013-01-01

    Human papillomaviruses (HPVs) infect epithelia and can lead to the development of lesions, some of which have malignant potential. HPV type 16 (HPV16) is the most oncogenic genotype and causes various types of cancer, including cervical, anal, and head and neck cancers. However, despite significant research, our understanding of the mechanism by which HPV16 binds to and enters host cells remains fragmented. Over several decades, many HPV receptors and entry pathways have been described. This review puts those studies into context and offers a model of HPV16 binding and entry as a framework for future research. Our model suggests that HPV16 binds to heparin sulfate proteoglycans (HSPGs) on either the epithelial cell surface or basement membrane through interactions with the L1 major capsid protein. Growth factor receptors may also become activated through HSPG/growth factor/HPV16 complexes that initiate signaling cascades during early virion-host cell interactions. After binding to HSPGs, the virion undergoes conformational changes, leading to isomerization by cyclophilin B and proprotein convertase-mediated L2 minor capsid protein cleavage that increases L2 N terminus exposure. Along with binding to HSPGs, HPV16 binds to α6 integrins, which initiate further intracellular signaling events. Following these primary binding events, HPV16 binds to a newly identified L2-specific receptor, the annexin A2 heterotetramer. Subsequently, clathrin-, caveolin-, lipid raft-, flotillin-, cholesterol-, and dynamin-independent endocytosis of HPV16 occurs. PMID:23536685

  1. Activation of Membrane Fusion by Murine Leukemia Viruses Is Controlled in cis or in trans by Interactions between the Receptor-Binding Domain and a Conserved Disulfide Loop of the Carboxy Terminus of the Surface Glycoprotein

    PubMed Central

    Lavillette, Dimitri; Boson, Bertrand; Russell, Stephen J.; Cosset, François-Loïc

    2001-01-01

    Cell entry of retroviruses is initiated by the recognition of cellular receptors and the subsequent membrane fusion between viral and cellular membranes. These two steps are mediated by the surface (SU) and transmembrane (TM) subunits of the retroviral envelope glycoprotein (Env), respectively. Determinants regulating membrane fusion have been described throughout SU and TM, but the processes coupling receptor recognition to fusion are still elusive. Here we establish that a critical interaction is formed between the receptor-binding domain (RBD) and the major disulfide loop of the carboxy-terminal domain (C domain) of the murine leukemia virus SU. Receptor binding causes an alteration of this interaction and, in turn, promotes further events of Env fusion activation. We characterize mutations which, by lowering this interaction and reducing the compatibility between the RBD and C domains of Env glycoprotein chimeras, affect both Env fusogenicity and sensitivity to receptor interference. Additionally, we demonstrate that suboptimal interactions in such mutant Env proteins can be compensated in trans by soluble RBDs in a manner that depends on their compatibility with the C domain. Our results therefore indicate that RBD/C domain interactions may occur in cis, via the proper RBD of the viral Env itself, or in trans, via a distinct RBD expressed by virion-free Env glycoproteins expressed endogenously by the infected cells or provided by neighboring Env trimers. PMID:11264358

  2. Crosslinking of surface antibodies and Fc sub. gamma. receptors: Theory and application

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wofsy, C.; Goldstein, B.

    1991-03-15

    In an immune response, the crosslinking of surface immunoglobulin (sIg) on B cells by multiply-bound ligand activates a range of cell responses, culminating in the production of antibody-secreting cells. However, when the crosslinking agent is itself an antibody, B cell activation is inhibited. Solution antibody (IgG) can bind simultaneously to sIg and to another cell surface receptor, Fc{sub {gamma}}R, co-crosslinking' the distinct receptors. Experiments point to co-crosslinking as the inhibitory signal. It is not clear how co-crosslinking inhibits B cell stimulation. The authors construct and analyze a mathematical model aimed at clarifying the nature and mechanisms of action of themore » separate cell signals controlling B cell responses to antibodies. Basophils and mast cells respond to the crosslinking of cell surface antibody by releasing histamine. Like B cells, basophils also express FC{sub {gamma}}R. They use their model to analyze new data on the effect of antibody-induced co-crosslinking of the two types of receptor on this family of cells. Predictions of the model indicate that an observed difference between the response patterns induced by antibodies and by antibody fragments that cannot bind to FC{sub {gamma}}R can be explained if co-crosslinking is neither inhibitory nor stimulatory in this system.« less

  3. RECEPTORS ON IMMUNOCOMPETENT CELLS

    PubMed Central

    Davie, Joseph M.; Paul, William E.

    1971-01-01

    Nonimmunized guinea pigs possess rare lymphocytes which bind sufficient 2,4-dinitrophenyl-guinea pig albumin-125I (DNP-GPA) to their surface to be detected by short-term radioautography. The cells occur in the lymph nodes, spleen, peripheral blood, and bone marrow with a frequency of ∼40/100,000 lymphocytes, but are absent from the thymus. The receptors of these cells are largely specific for the haptenic group (ε-DNP-L-lysine) as shown by inhibition of DNP-GPA-125I binding with ε-DNP-L-lysine and with DNP bovine serum albumin (DNP-BSA). Furthermore, these cells specifically adsorb to agarose beads to which either DNP-GPA, DNP-BSA, or DNP-keyhole limpet hemocyanin (KLH) has been covalently linked. This hapten specific depletion of DNP-GPA-125I antigen-binding cells (ABC) correlates with a similar diminution in the capacity of adsorbed populations to transfer primary responsiveness to DNP-KLH to irradiated syngeneic recipients. Fluoresceinated anti-immunoglobulin binds to the surface of some guinea pig lymphocytes, and all DNP-GPA-125I ABC, as shown by a double-label technique. The great majority of DNP-GPA ABC and human γ-globulin ABC possess surface Ig molecules of the γ2 heavy chain class. Preincubation of cell suspensions with anti-γ2 antibody markedly diminishes the number of DNP-GPA-125I ABC which are detected, strongly suggesting that the receptors of these cells are immunoglobulin molecules, most of which possess γ2 heavy chains. The specificity characteristics of DNP-GPA-125I ABC are strikingly different from those of cells mediating a cellular immune response to DNP-GPA, indicating major differences in the specificity and nature of the receptors of these cell types. PMID:4934503

  4. Leptospira interrogans Binds to Cadherins

    PubMed Central

    Evangelista, Karen; Franco, Ricardo; Schwab, Andrew; Coburn, Jenifer

    2014-01-01

    Leptospirosis, caused by pathogenic species of Leptospira, is the most widespread zoonosis and has emerged as a major public health problem worldwide. The adhesion of pathogenic Leptospira to host cells, and to extracellular matrix (ECM) components, is likely to be necessary for the ability of leptospires to penetrate, disseminate and persist in mammalian host tissues. Previous work demonstrated that pathogenic L. interrogans binds to host cells more efficiently than to ECM. Using two independent screening methods, mass spectrometry and protein arrays, members of the cadherin family were identified as potential L. interrogans receptors on mammalian host surfaces. We focused our investigation on vascular endothelial (VE)-cadherin, which is widely expressed on endothelia and is primarily responsible for endothelial cell-cell adhesion. Monolayers of EA.hy926 and HMEC-1 endothelial cells produce VE-cadherin, bind L. interrogans in vitro, and are disrupted upon incubation with the bacteria, which may reflect the endothelial damage seen in vivo. Dose-dependent and saturable binding of L. interrogans to the purified VE-cadherin receptor was demonstrated and pretreatment of purified receptor or endothelial cells with function-blocking antibody against VE-cadherin significantly inhibited bacterial attachment. The contribution of VE-cadherin to leptospiral adherence to host endothelial cell surfaces is biologically significant because VE-cadherin plays an important role in maintaining the barrier properties of the vasculature. Attachment of L. interrogans to the vasculature via VE-cadherin may result in vascular damage, facilitating the escape of the pathogen from the bloodstream into different tissues during disseminated infection, and may contribute to the hemorrhagic manifestations of leptospirosis. This work is first to describe a mammalian cell surface protein as a receptor for L. interrogans. PMID:24498454

  5. Identification of Carbohydrate-Binding Domains in the Attachment Proteins of Type 1 and Type 3 Reoviruses

    PubMed Central

    Chappell, James D.; Duong, Joy L.; Wright, Benjamin W.; Dermody, Terence S.

    2000-01-01

    The reovirus attachment protein, ς1, is responsible for strain-specific patterns of viral tropism in the murine central nervous system and receptor binding on cultured cells. The ς1 protein consists of a fibrous tail domain proximal to the virion surface and a virion-distal globular head domain. To better understand mechanisms of reovirus attachment to cells, we conducted studies to identify the region of ς1 that binds cell surface carbohydrate. Chimeric and truncated ς1 proteins derived from prototype reovirus strains type 1 Lang (T1L) and type 3 Dearing (T3D) were expressed in insect cells by using a baculovirus vector. Assessment of expressed protein susceptibility to proteolytic cleavage, binding to anti-ς1 antibodies, and oligomerization indicates that the chimeric and truncated ς1 proteins are properly folded. To assess carbohydrate binding, recombinant ς1 proteins were tested for the capacity to agglutinate mammalian erythrocytes and to bind sialic acid presented on glycophorin, the cell surface molecule bound by type 3 reovirus on human erythrocytes. Using a panel of two wild-type and ten chimeric and truncated ς1 proteins, the sialic acid-binding domain of type 3 ς1 was mapped to a region of sequence proposed to form the more amino terminal of two predicted β-sheet structures in the tail. This unit corresponds to morphologic region T(iii) observed in computer-processed electron micrographs of ς1 protein purified from virions. In contrast, the homologous region of T1L ς1 sequence was not implicated in carbohydrate binding; rather, sequences in the distal portion of the tail known as the neck were required. Results of these studies demonstrate that a functional receptor-binding domain, which uses sialic acid as its ligand, is contained within morphologic region T(iii) of the type 3 ς1 tail. Furthermore, our findings indicate that T1L and T3D ς1 proteins contain different arrangements of receptor-binding domains. PMID:10954547

  6. Identification of carbohydrate-binding domains in the attachment proteins of type 1 and type 3 reoviruses.

    PubMed

    Chappell, J D; Duong, J L; Wright, B W; Dermody, T S

    2000-09-01

    The reovirus attachment protein, sigma1, is responsible for strain-specific patterns of viral tropism in the murine central nervous system and receptor binding on cultured cells. The sigma1 protein consists of a fibrous tail domain proximal to the virion surface and a virion-distal globular head domain. To better understand mechanisms of reovirus attachment to cells, we conducted studies to identify the region of sigma1 that binds cell surface carbohydrate. Chimeric and truncated sigma1 proteins derived from prototype reovirus strains type 1 Lang (T1L) and type 3 Dearing (T3D) were expressed in insect cells by using a baculovirus vector. Assessment of expressed protein susceptibility to proteolytic cleavage, binding to anti-sigma1 antibodies, and oligomerization indicates that the chimeric and truncated sigma1 proteins are properly folded. To assess carbohydrate binding, recombinant sigma1 proteins were tested for the capacity to agglutinate mammalian erythrocytes and to bind sialic acid presented on glycophorin, the cell surface molecule bound by type 3 reovirus on human erythrocytes. Using a panel of two wild-type and ten chimeric and truncated sigma1 proteins, the sialic acid-binding domain of type 3 sigma1 was mapped to a region of sequence proposed to form the more amino terminal of two predicted beta-sheet structures in the tail. This unit corresponds to morphologic region T(iii) observed in computer-processed electron micrographs of sigma1 protein purified from virions. In contrast, the homologous region of T1L sigma1 sequence was not implicated in carbohydrate binding; rather, sequences in the distal portion of the tail known as the neck were required. Results of these studies demonstrate that a functional receptor-binding domain, which uses sialic acid as its ligand, is contained within morphologic region T(iii) of the type 3 sigma1 tail. Furthermore, our findings indicate that T1L and T3D sigma1 proteins contain different arrangements of receptor-binding domains.

  7. Quantitative Impact of Plasma Clearance and Down-regulation on GLP-1 Receptor Molecular Imaging.

    PubMed

    Zhang, Liang; Thurber, Greg M

    2016-02-01

    Quantitative molecular imaging of beta cell mass (BCM) would enable early detection and treatment monitoring of type 1 diabetes. The glucagon-like peptide-1 (GLP-1) receptor is an attractive target due to its beta cell specificity and cell surface location. We quantitatively investigated the impact of plasma clearance and receptor internalization on targeting efficiency in healthy B6 mice. Four exenatide-based probes were synthesized that varied in molecular weight, binding affinity, and plasma clearance. The GLP-1 receptor internalization rate and in vivo receptor expression were quantified. Receptor internalization (54,000 receptors/cell in vivo) decreased significantly within minutes, reducing the benefit of a slower-clearing agent. The multimers and albumin binding probes had higher kidney and liver uptake, respectively. Slow plasma clearance is beneficial for GLP-1 receptor peptide therapeutics. However, for exendin-based imaging of islets, down-regulation of the GLP-1 receptor and non-specific background uptake result in a higher target-to-background ratio for fast-clearing agents.

  8. Quantitative Impact of Plasma Clearance and Down-regulation on GLP-1 Receptor Molecular Imaging

    PubMed Central

    Zhang, Liang; Thurber, Greg M.

    2016-01-01

    Purpose Quantitative molecular imaging of beta cell mass (BCM) would enable early detection and treatment monitoring of type-1 diabetes. The glucagon like peptide-1 (GLP-1) receptor is an attractive target due to its beta cell specificity and cell surface location. We quantitatively investigated the impact of plasma clearance and receptor internalization on targeting efficiency in healthy B6 mice. Procedures Four exenatide-based probes were synthesized that varied in molecular weight, binding affinity, and plasma clearance. The GLP-1 receptor internalization rate and in vivo receptor expression were quantified. Results Receptor internalization (54,000 receptors/cell in vivo) decreased significantly within minutes, reducing the benefit of a slower clearing agent. The multimers and albumin binding probes had higher kidney and liver uptake, respectively. Conclusions Slow plasma clearance is beneficial for GLP-1 receptor peptide therapeutics. However, for exendin-based imaging of islets, downregulation of the GLP-1 receptor and non-specific background uptake result in a higher TBR for fast-clearing agents. PMID:26194012

  9. X-Ray Crystal Structure of the Ancestral 3-Ketosteroid Receptor-Progesterone-Mifepristone Complex Shows Mifepristone Bound at the Coactivator Binding Interface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Colucci, Jennifer K.; Ortlund, Eric A.

    2013-12-12

    Steroid receptors are a subfamily of nuclear receptors found throughout all metazoans. They are highly important in the regulation of development, inflammation, and reproduction and their misregulation has been implicated in hormone insensitivity syndromes and cancer. Steroid binding to SRs drives a conformational change in the ligand binding domain that promotes nuclear localization and subsequent interaction with coregulator proteins to affect gene regulation. SRs are important pharmaceutical targets, yet most SR-targeting drugs have off-target pharmacology leading to unwanted side effects. A better understanding of the structural mechanisms dictating ligand specificity and the evolution of the forces that created the SR-hormonemore » pairs will enable the design of better pharmaceutical ligands. In order to investigate this relationship, we attempted to crystallize the ancestral 3-ketosteroid receptor (ancSR2) with mifepristone, a SR antagonist. Here, we present the x-ray crystal structure of the ancestral 3-keto steroid receptor (ancSR2)-progesterone complex at a resolution of 2.05 Å. This improves upon our previously reported structure of the ancSR2-progesterone complex, permitting unambiguous assignment of the ligand conformation within the binding pocket. Surprisingly, we find mifepristone, fortuitously docked at the protein surface, poised to interfere with coregulator binding. Recent attention has been given to generating pharmaceuticals that block the coregulator binding site in order to obstruct coregulator binding and achieve tissue-specific SR regulation independent of hormone binding. Mifepristone’s interaction with the coactivator cleft of this SR suggests that it may be a useful molecular scaffold for further coactivator binding inhibitor development.« less

  10. Retrograde transport of the transmembrane estrogen receptor, G-protein-coupled-receptor-30 (GPR30/GPER) from the plasma membrane towards the nucleus.

    PubMed

    Cheng, Shi-Bin; Graeber, Carl T; Quinn, Jeffrey A; Filardo, Edward J

    2011-08-01

    G-protein-coupled receptor 30 (GPR30/GPER) belongs to the seven transmembrane receptor (7TMR) superfamily, the most common class of surface receptor with approximately 800 known members. GPER promotes estrogen binding and rapid signaling via membrane-associated enzymes resulting in increased cAMP and release of heparan bound epidermal growth factor (proHB-EGF) from breast cancer cells. However, GPER is predominately localized intracellularly in breast cancer cells with minor amounts of receptor on the cell surface, an observation that has caused some controversy regarding its potential role as a plasma membrane estrogen receptor. Using the widely employed approach of tracking recombinant 7TMRs by surface labeling live cells, we have begun to characterize and compare the endocytic fate of GPER to other similarly labeled 7TMRs. Upon ectopic expression in human embryonic kidney HEK-293 cells, functional GPER is generated as these cells acquire the capacity to stimulate cAMP and activate cyclic AMP responsive binding protein in response to estradiol-17 beta stimulation. GPER is detectable on the cell surface by immunofluorescent analysis using HA-specific antibodies, albeit the bulk of the receptor is located intracellularly. Like β1AR (beta 1 adrenergic receptor) and CXCR4 (C-X-C chemokine receptor 4), GPER exits the plasma membrane via clathrin-coated pits and enters early endosomes. Interestingly, GPER has a destination that is uncommon among 7TMRs, as it accumulates in a perinuclear compartment. Like many 7TMRs (approximately one-third), GPER trafficking from the plasma membrane is constitutive (occurs in the absence of agonist). However, its route of intracellular trafficking is highly unusual, as 7TMRs typically recycle to the plasma membrane (e.g. β1AR) or are degraded in lysosomes (e.g. CXCR4). The accumulation of GPER in the perinuclear space and its possible significance for attenuating estrogen action via this newly recognized membrane estrogen receptor is discussed herein. Published by Elsevier Inc.

  11. Structural insights into the interaction of IL-33 with its receptors.

    PubMed

    Liu, Xi; Hammel, Michal; He, Yanfeng; Tainer, John A; Jeng, U-Ser; Zhang, Linqi; Wang, Shuying; Wang, Xinquan

    2013-09-10

    Interleukin (IL)-33 is an important member of the IL-1 family that has pleiotropic activities in innate and adaptive immune responses in host defense and disease. It signals through its ligand-binding primary receptor ST2 and IL-1 receptor accessory protein (IL-1RAcP), both of which are members of the IL-1 receptor family. To clarify the interaction of IL-33 with its receptors, we determined the crystal structure of IL-33 in complex with the ectodomain of ST2 at a resolution of 3.27 Å. Coupled with structure-based mutagenesis and binding assay, the structural results define the molecular mechanism by which ST2 specifically recognizes IL-33. Structural comparison with other ligand-receptor complexes in the IL-1 family indicates that surface-charge complementarity is critical in determining ligand-binding specificity of IL-1 primary receptors. Combined crystallography and small-angle X-ray-scattering studies reveal that ST2 possesses hinge flexibility between the D3 domain and D1D2 module, whereas IL-1RAcP exhibits a rigid conformation in the unbound state in solution. The molecular flexibility of ST2 provides structural insights into domain-level conformational change of IL-1 primary receptors upon ligand binding, and the rigidity of IL-1RAcP explains its inability to bind ligands directly. The solution architecture of IL-33-ST2-IL-1RAcP complex from small-angle X-ray-scattering analysis resembles IL-1β-IL-1RII-IL-1RAcP and IL-1β-IL-1RI-IL-1RAcP crystal structures. The collective results confer IL-33 structure-function relationships, supporting and extending a general model for ligand-receptor assembly and activation in the IL-1 family.

  12. NK1 receptor fused to beta-arrestin displays a single-component, high-affinity molecular phenotype.

    PubMed

    Martini, Lene; Hastrup, Hanne; Holst, Birgitte; Fraile-Ramos, Alberto; Marsh, Mark; Schwartz, Thue W

    2002-07-01

    Arrestins are cytosolic proteins that, upon stimulation of seven transmembrane (7TM) receptors, terminate signaling by binding to the receptor, displacing the G protein and targeting the receptor to clathrin-coated pits. Fusion of beta-arrestin1 to the C-terminal end of the neurokinin NK1 receptor resulted in a chimeric protein that was expressed to some extent on the cell surface but also accumulated in transferrin-labeled recycling endosomes independently of agonist stimulation. As expected, the fusion protein was almost totally silenced with respect to agonist-induced signaling through the normal Gq/G11 and Gs pathways. The NK1-beta-arrestin1 fusion construct bound nonpeptide antagonists with increased affinity but surprisingly also bound two types of agonists, substance P and neurokinin A, with high, normal affinity. In the wild-type NK1 receptor, neurokinin A (NKA) competes for binding against substance P and especially against antagonists with up to 1000-fold lower apparent affinity than determined in functional assays and in homologous binding assays. When the NK1 receptor was closely fused to G proteins, this phenomenon was eliminated among agonists, but the agonists still competed with low affinity against antagonists. In contrast, in the NK1-beta-arrestin1 fusion protein, all ligands bound with similar affinity independent of the choice of radioligand and with Hill coefficients near unity. We conclude that the NK1 receptor in complex with arrestin is in a high-affinity, stable, agonist-binding form probably best suited to structural analysis and that the receptor can display binding properties that are nearly theoretically ideal when it is forced to complex with only a single intracellular protein partner.

  13. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody

    PubMed Central

    Kwong, Peter D.; Wyatt, Richard; Robinson, James; Sweet, Raymond W.; Sodroski, Joseph; Hendrickson, Wayne A.

    2017-01-01

    The entry of human immunodeficiency virus (HIV) into cells requires the sequential interaction of the viral exterior envelope glycoprotein, gp120, with the CD4 glycoprotein and a chemokine receptor on the cell surface. These interactions initiate a fusion of the viral and cellular membranes. Although gpl20 can elicit virus-neutralizing antibodies, HIV eludes the immune system. We have solved the X-ray crystal structure at 2.5 Å resolution of an HIV-1 gp120 core complexed with a two-domain fragment of human CD4 and an antigen-binding fragment of a neutralizing antibody that blocks chemokine-receptor binding. The structure reveals a cavity-laden CD4-gp120 interface, a conserved binding site for the chemokine receptor, evidence for a conformational change upon CD4 binding, the nature of a CD4-induced antibody epitope, and specific mechanisms for immune evasion. Our results provide a framework for understanding the complex biology of HIV entry into cells and should guide efforts to intervene. PMID:9641677

  14. Polysaccharide of Dendrobium huoshanense activates macrophages via toll-like receptor 4-mediated signaling pathways.

    PubMed

    Xie, Song-Zi; Hao, Ran; Zha, Xue-Qiang; Pan, Li-Hua; Liu, Jian; Luo, Jian-Ping

    2016-08-01

    The present work aimed at investigating the pattern recognition receptor (PRR) and immunostimulatory mechanism of a purified Dendrobium huoshanense polysaccharide (DHP). We found that DHP could bind to the surface of macrophages and stimulate macrophages to secrete NO, TNF-α and IL-1β. To unravel the mechanism for the binding of DHP to macrophages, flow cytometry, confocal laser-scanning microscopy, affinity electrophoresis, SDS-PAGE and western blotting were employed to verify the type of PRR responsible for the recognition of DHP by RAW264.7 macrophages and peritoneal macrophages of C3H/HeN and C3H/HeJ macrophages. Results showed that toll-like receptor 4 (TLR4) was an essential receptor for macrophages to directly bind DHP. Further, the phosphorylation of ERK, JNK, Akt and p38 were observed to be time-dependently promoted by DHP, as well as the nuclear translocation of NF-κB p65. These results suggest that DHP activates macrophages via its direct binding to TLR4 to trigger TLR4 signaling pathways. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Receptor for advanced glycation end products binds to phosphatidylserine and assists in the clearance of apoptotic cells

    PubMed Central

    He, Mei; Kubo, Hiroshi; Morimoto, Konosuke; Fujino, Naoya; Suzuki, Takaya; Takahasi, Toru; Yamada, Mitsuhiro; Yamaya, Mutsuo; Maekawa, Tomoyuki; Yamamoto, Yasuhiko; Yamamoto, Hiroshi

    2011-01-01

    Clearance of apoptotic cells is necessary for tissue development, homeostasis and resolution of inflammation. The uptake of apoptotic cells is initiated by an ‘eat-me' signal, such as phosphatidylserine, on the cell surface and phagocytes recognize the signal by using specific receptors. In this study, we show that the soluble form of the receptor for advanced glycation end products (RAGE) binds to phosphatidylserine as well as to the apoptotic thymocytes. RAGE-deficient (Rage−/−) alveolar macrophages showed impaired phagocytosis of apoptotic thymocytes and defective clearance of apoptotic neutrophils in Rage−/− mice. Our results indicate that RAGE functions as a phosphatidylserine receptor and assists in the clearance of apoptotic cells. PMID:21399623

  16. A Common Molecular Motif Characterizes Extracellular Allosteric Enhancers of GPCR Aminergic Receptors and Suggests Enhancer Mechanism of Action

    PubMed Central

    Bernstein, Robert Root; Dillon, Patrick F

    2014-01-01

    Several classes of compounds that have no intrinsic activity on aminergic systems nonetheless enhance the potency of aminergic receptor ligands three-fold or more while significantly increasing their duration of activity, preventing tachyphylaxis and reversing fade. Enhancer compounds include ascorbic acid, ethylenediaminetetraacetic acid, cortico-steroids, opioid peptides, opiates and opiate antagonists. This paper provides the first review of aminergic enhancement, demonstrating that all enhancers have a common, inobvious molecular motif and work through a common mechanism that is manifested by three common characteristics. First, aminergic enhancers bind directly to the amines they enhance, suggesting that the common structural motif is reflected in common binding targets. Second, one common target is the first extracellular loop of aminergic receptors. Third, at least some enhancers are antiphosphodiesterases. These observations suggest that aminergic enhancers act on the extracellular surface of aminergic receptors to keep the receptor in its high affinity state, trapping the ligand inside the receptor. Enhancer binding produces allosteric modifications of the receptor structure that interfere with phosphorylation of the receptor, thereby inhibiting down-regulation of the receptor. The mechanism explains how enhancers potentiate aminergic activity and increase duration of activity and makes testable predictions about additional compounds that should act as aminergic enhancers. PMID:25174918

  17. Structural Basis of HCV Neutralization by Human Monoclonal Antibodies Resistant to Viral Neutralization Escape

    PubMed Central

    Krey, Thomas; Meola, Annalisa; Keck, Zhen-yong; Damier-Piolle, Laurence; Foung, Steven K. H.; Rey, Felix A.

    2013-01-01

    The high mutation rate of hepatitis C virus allows it to rapidly evade the humoral immune response. However, certain epitopes in the envelope glycoproteins cannot vary without compromising virus viability. Antibodies targeting these epitopes are resistant to viral escape from neutralization and understanding their binding-mode is important for vaccine design. Human monoclonal antibodies HC84-1 and HC84-27 target conformational epitopes overlapping the CD81 receptor-binding site, formed by segments aa434–446 and aa610–619 within the major HCV glycoprotein E2. No neutralization escape was yet observed for these antibodies. We report here the crystal structures of their Fab fragments in complex with a synthetic peptide comprising aa434–446. The structures show that the peptide adopts an α-helical conformation with the main contact residues F442 and Y443 forming a hydrophobic protrusion. The peptide retained its conformation in both complexes, independently of crystal packing, indicating that it reflects a surface feature of the folded glycoprotein that is exposed similarly on the virion. The same residues of E2 are also involved in interaction with CD81, suggesting that the cellular receptor binds the same surface feature and potential escape mutants critically compromise receptor binding. In summary, our results identify a critical structural motif at the E2 surface, which is essential for virus propagation and therefore represents an ideal candidate for structure-based immunogen design for vaccine development. PMID:23696737

  18. Synthetic estrogen derivatives demonstrate the functionality of intracellular GPR30.

    PubMed

    Revankar, Chetana M; Mitchell, Hugh D; Field, Angela S; Burai, Ritwik; Corona, Cesear; Ramesh, Chinnasamy; Sklar, Larry A; Arterburn, Jeffrey B; Prossnitz, Eric R

    2007-08-17

    Estrogen mediates its effects through multiple cellular receptors. In addition to the classical nuclear estrogen receptors (ERalpha and ERbeta), estrogen also signals through the seven-transmembrane G-protein-coupled receptor (GPCR) GPR30. Although estrogen is a cell-permeable ligand, it is often assumed that all GPCRs function solely as cell surface receptors. Our previous results showed that GPR30 appeared to be expressed predominantly in the endoplasmic reticulum. A critical question that arises is whether this localization represents the site of functional receptor. To address this question, we synthesized a collection of cell-permeable and cell-impermeable estrogen derivatives. We hypothesized that if functional GPR30 were expressed at the cell surface, both permeable and impermeable derivatives would show activity. However, if functional GPR30 were predominantly intracellular, like ERalpha, only the permeable ligands should show activity. Cell permeability was assessed using cells expressing ERalpha as a model intracellular estrogen-binding receptor. Our results reveal that despite exhibiting similar binding affinities for GPR30, only the cell-permeable ligands are capable of stimulating rapid calcium mobilization and phosphoinositide 3-kinase (PI3K) activation. We conclude that GPR30 expressed intracellularly is capable of initiating cellular signaling and that there is insufficient GPR30 expressed on the cell surface to initiate signaling in response to impermeable ligands in the cell lines examined. To our knowledge, this is the first definitive demonstration of a functional intracellular transmembrane estrogen receptor.

  19. A sorting nexin 17-binding domain within the LRP1 cytoplasmic tail mediates receptor recycling through the basolateral sorting endosome.

    PubMed

    Farfán, Pamela; Lee, Jiyeon; Larios, Jorge; Sotelo, Pablo; Bu, Guojun; Marzolo, María-Paz

    2013-07-01

    Sorting nexin 17 (SNX17) is an adaptor protein present in early endosomal antigen 1 (EEA1)-positive sorting endosomes that promotes the efficient recycling of low-density lipoprotein receptor-related protein 1 (LRP1) to the plasma membrane through recognition of the first NPxY motif in the cytoplasmic tail of this receptor. The interaction of LRP1 with SNX17 also regulates the basolateral recycling of the receptor from the basolateral sorting endosome (BSE). In contrast, megalin, which is apically distributed in polarized epithelial cells and localizes poorly to EEA1-positive sorting endosomes, does not interact with SNX17, despite containing three NPxY motifs, indicating that this motif is not sufficient for receptor recognition by SNX17. Here, we identified a cluster of 32 amino acids within the cytoplasmic domain of LRP1 that is both necessary and sufficient for SNX17 binding. To delineate the function of this SNX17-binding domain, we generated chimeric proteins in which the SNX17-binding domain was inserted into the cytoplasmic tail of megalin. This insertion mediated the binding of megalin to SNX17 and modified the cell surface expression and recycling of megalin in non-polarized cells. However, the polarized localization of chimeric megalin was not modified in polarized Madin-Darby canine kidney cells. These results provide evidence regarding the molecular and cellular mechanisms underlying the specificity of SNX17-binding receptors and the restricted function of SNX17 in the BSE. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Tie2 and Eph Receptor Tyrosine Kinase Activation and Signaling

    PubMed Central

    Barton, William A.; Dalton, Annamarie C.; Seegar, Tom C.M.; Himanen, Juha P.

    2014-01-01

    The Eph and Tie cell surface receptors mediate a variety of signaling events during development and in the adult organism. As other receptor tyrosine kinases, they are activated on binding of extracellular ligands and their catalytic activity is tightly regulated on multiple levels. The Eph and Tie receptors display some unique characteristics, including the requirement of ligand-induced receptor clustering for efficient signaling. Interestingly, both Ephs and Ties can mediate different, even opposite, biological effects depending on the specific ligand eliciting the response and on the cellular context. Here we discuss the structural features of these receptors, their interactions with various ligands, as well as functional implications for downstream signaling initiation. The Eph/ephrin structures are already well reviewed and we only provide a brief overview on the initial binding events. We go into more detail discussing the Tie-angiopoietin structures and recognition. PMID:24478383

  1. Identification of the bombesin receptor on murine and human cells by cross-linking experiments.

    PubMed

    Kris, R M; Hazan, R; Villines, J; Moody, T W; Schlessinger, J

    1987-08-15

    The bombesin receptor present on the surface of murine and human cells was identified using 125I-labeled gastrin-releasing peptide as a probe, the cross-linking agent disuccinimidyl suberate, and sodium dodecyl sulfate gels. A clone of NIH-3T3 cells which possesses approximately 80,000 bombesin receptors/cell with a single binding constant of approximately 1.9 X 10(-9) M was used in these studies. In addition, we used Swiss 3T3 cells and a human glioma cell line which possesses approximately 100,000 and approximately 55,000 bombesin receptors/cell, respectively. Under conditions found optimal for binding, it is demonstrated that 125I-labeled gastrin-releasing peptide can be cross-linked specifically to a glycoprotein of apparent molecular mass of 65,000 daltons on the surface of the NIH-3T3 cells. Similar results were obtained when the cross-linked product was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing or non-reducing conditions. Moreover, the cross-linking reaction is specific and saturable and the 65,000-dalton polypeptide is not observed when the cross-linking experiments were performed with a NIH-3T3 cell line which is devoid of bombesin receptors. Interestingly, glycoproteins with apparent molecular weights of 75,000 were labeled specifically by 125I-labeled gastrin-releasing peptide when similar experiments were performed with Swiss 3T3 cells and with human glioma cell line GM-340. These different molecular weights may indicate differential glycosylation as treatment with the enzyme N-glycanase reduced the apparent molecular weight of the cross-linked polypeptide to 45,000. On the basis of these results it is concluded that the cross-linked polypeptides represent the bombesin receptor or the ligand-binding subunit of a putative larger bombesin receptor expressed on the surface of these cells.

  2. Clustering of adhesion receptors following exposure of insect blood cells to foreign surfaces.

    PubMed

    Nardi, James B; Zhuang, Shufei; Pilas, Barbara; Bee, Charles Mark; Kanost, Michael R

    2005-05-01

    Cell-mediated immune responses of insects involve interactions of two main classes of blood cells (hemocytes) known as granular cells and plasmatocytes. In response to a foreign surface, these hemocytes suddenly transform from circulating, non-adherent cells to cells that interact and adhere to each other and the foreign surface. This report presents evidence that during this adhesive transformation the extracellular matrix (ECM) proteins lacunin and a ligand for peanut agglutinin (PNA) lectin are released by granular cells and bind to surfaces of both granular cells and plasmatocytes. ECM protein co-localizes on cell surfaces with the adhesive receptors integrin and neuroglian, a member of the immunoglobulin superfamily. The ECM protein(s) secreted by granular cells are hypothesized to interact with adhesion receptors such as neuroglian and integrin by cross linking and clustering them on hemocyte surfaces. This clustering of receptors is known to enhance the adhesiveness (avidity) of interacting mammalian immune cells. The formation of ring-shaped clusters of these adhesion receptors on surfaces of insect immune cells represents an evolutionary antecedent of the mammalian immunological synapse.

  3. Role of receptor occupancy assays by flow cytometry in drug development.

    PubMed

    Stewart, Jennifer J; Green, Cherie L; Jones, Nicholas; Liang, Meina; Xu, Yuanxin; Wilkins, Danice E C; Moulard, Maxime; Czechowska, Kamila; Lanham, David; McCloskey, Thomas W; Ferbas, John; van der Strate, Barry W A; Högerkorp, Carl-Magnus; Wyant, Timothy; Lackey, Alan; Litwin, Virginia

    2016-03-01

    The measurement of the binding of a biotherapeutic to its cellular target, receptor occupancy (RO), is increasingly important in development of biologically-based therapeutic agents. Receptor occupancy (RO) assays by flow cytometry describe the qualitative and/or quantitative assessment of the binding of a therapeutic agent to its cell surface target. Such RO assays can be as simple as measuring the number of cell surface receptors bound by an antireceptor therapeutic agent or can be designed to address more complicated scenarios such as internalization or shedding events once a receptor engages the administered therapeutic agent. Data generated from RO assays can also be used to model whether given doses of an experimental therapeutic agent and their administration schedules lead to predicted levels of receptor occupancy and whether the receptor is modulated (up or down) on cells engaged by the therapeutic agent. There are a variety of approaches that can be used when undertaking RO assays and with the ability to measure distinct subsets in heterogeneous populations, flow cytometry is ideally suited to RO measurements. This article highlights the importance of RO assays on the flow cytometric platform in the development of biotherapeutic agents. © 2016 The Authors Cytometry Part B: Clinical Cytometry Published by Wiley Periodicals, Inc.

  4. Receptor Surface Models in the Classroom: Introducing Molecular Modeling to Students in a 3-D World

    ERIC Educational Resources Information Center

    Geldenhuys, Werner J.; Hayes, Michael; Van der Schyf, Cornelis J.; Allen, David D.; Malan, Sarel F.

    2007-01-01

    A simple, novel and generally applicable method to demonstrate structure-activity associations of a group of biologically interesting compounds in relation to receptor binding is described. This method is useful for undergraduates and graduate students in medicinal chemistry and computer modeling programs.

  5. Solution structure of the chick TGFbeta type II receptor ligand-binding domain.

    PubMed

    Marlow, Michael S; Brown, Christopher B; Barnett, Joey V; Krezel, Andrzej M

    2003-02-28

    The transforming growth factor beta (TGFbeta) signaling pathway influences cell proliferation, immune responses, and extracellular matrix reorganization throughout the vertebrate life cycle. The signaling cascade is initiated by ligand-binding to its cognate type II receptor. Here, we present the structure of the chick type II TGFbeta receptor determined by solution NMR methods. Distance and angular constraints were derived from 15N and 13C edited NMR experiments. Torsion angle dynamics was used throughout the structure calculations and refinement. The 20 final structures were energy minimized using the generalized Born solvent model. For these 20 structures, the average backbone root-mean-square distance from the average structure is below 0.6A. The overall fold of this 109-residue domain is conserved within the superfamily of these receptors. Chick receptors fully recognize and respond to human TGFbeta ligands despite only 60% identity at the sequence level. Comparison with the human TGFbeta receptor determined by X-ray crystallography reveals different conformations in several regions. Sequence divergence and crystal packing interactions under low pH conditions are likely causes. This solution structure identifies regions were structural changes, however subtle, may occur upon ligand-binding. We also identified two very well conserved molecular surfaces. One was found to bind ligand in the crystallized human TGFbeta3:TGFbeta type II receptor complex. The other, newly identified area can be the interaction site with type I and/or type III receptors of the TGFbeta signaling complex.

  6. Structure of nerve growth factor complexed with the shared neurotrophin receptor p75.

    PubMed

    He, Xiao-Lin; Garcia, K Christopher

    2004-05-07

    Neurotrophins are secreted growth factors critical for the development and maintenance of the vertebrate nervous system. Neurotrophins activate two types of cell surface receptors, the Trk receptor tyrosine kinases and the shared p75 neurotrophin receptor. We have determined the 2.4 A crystal structure of the prototypic neurotrophin, nerve growth factor (NGF), complexed with the extracellular domain of p75. Surprisingly, the complex is composed of an NGF homodimer asymmetrically bound to a single p75. p75 binds along the homodimeric interface of NGF, which disables NGF's symmetry-related second p75 binding site through an allosteric conformational change. Thus, neurotrophin signaling through p75 may occur by disassembly of p75 dimers and assembly of asymmetric 2:1 neurotrophin/p75 complexes, which could potentially engage a Trk receptor to form a trimolecular signaling complex.

  7. Quantification of cell surface receptor expression in live tissue culture media using a dual-tracer stain and rinse approach

    NASA Astrophysics Data System (ADS)

    Xu, Xiaochun; Sinha, Lagnojita; Singh, Aparna; Yang, Cynthia; Xiang, Jialing; Tichauer, Kenneth M.

    2015-03-01

    Immunofluorescence staining is a robust way to visualize the distribution of targeted biomolecules invasively in in fixed tissues and tissue culture. Despite the fact that these methods has been a well-established method in fixed tissue imaging for over 70 years, quantification of receptor concentration still simply assumes that the signal from the targeted fluorescent marker after incubation and sufficient rinsing is directly proportional to the concentration of targeted biomolecules, thus neglecting the experimental inconsistencies in incubation and rinsing procedures and assuming no, nonspecific binding of the fluorescent markers. This work presents the first imaging approach capable of quantifying the concentration of cell surface receptor on cancer cells grown in vitro based on compartment modeling in a nondestructive way. The approach utilizes a dual-tracer protocol where any non-specific retention or variability in incubation and rinsing of a receptor-targeted imaging agent is corrected by simultaneously imaging the retention of a chemically similar, "untargeted" imaging agent. Various different compartment models were used to analyze the data in order to find the optimal procedure for extracting estimates of epidermal growth factor receptor (EGFR) concentration (a receptor overexpressed in many cancers and a key target for emerging molecular therapies) in tissue cultures with varying concentrations of human glioma cells (U251). Preliminary results demonstrated a need to model nonspecific binding of both the targeted and untargeted imaging agents used. The approach could be used to carry out the first repeated measures of cell surface receptor dynamics during 3D tumor mass development, in addition to the receptor response to therapies.

  8. Identification and Characterization of a G Protein-binding Cluster in α7 Nicotinic Acetylcholine Receptors.

    PubMed

    King, Justin R; Nordman, Jacob C; Bridges, Samuel P; Lin, Ming-Kuan; Kabbani, Nadine

    2015-08-14

    α7 nicotinic acetylcholine receptors (nAChRs) play an important role in synaptic transmission and inflammation. In response to ligands, this receptor channel opens to conduct cations into the cell but desensitizes rapidly. In recent studies we show that α7 nAChRs bind signaling proteins such as heterotrimeric GTP-binding proteins (G proteins). Here, we demonstrate that direct coupling of α7 nAChRs to G proteins enables a downstream calcium signaling response that can persist beyond the expected time course of channel activation. This process depends on a G protein-binding cluster (GPBC) in the M3-M4 loop of the receptor. A mutation of the GPBC in the α7 nAChR (α7345-348A) abolishes interaction with Gαq as well as Gβγ while having no effect on receptor synthesis, cell-surface trafficking, or α-bungarotoxin binding. Expression of α7345-348A, however, did significantly attenuate the α7 nAChR-induced Gαq calcium signaling response as evidenced by a decrease in PLC-β activation and IP3R-mediated calcium store release in the presence of the α7 selective agonist choline. Taken together, the data provides new evidence for the existence of a GPBC in nAChRs serving to promote intracellular signaling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Enterovirus 71 Uses Cell Surface Heparan Sulfate Glycosaminoglycan as an Attachment Receptor

    PubMed Central

    Tan, Chee Wah; Poh, Chit Laa; Sam, I-Ching

    2013-01-01

    Enterovirus 71 (EV-71) infections are usually associated with mild hand, foot, and mouth disease in young children but have been reported to cause severe neurological complications with high mortality rates. To date, four EV-71 receptors have been identified, but inhibition of these receptors by antagonists did not completely abolish EV-71 infection, implying that there is an as yet undiscovered receptor(s). Since EV-71 has a wide range of tissue tropisms, we hypothesize that EV-71 infections may be facilitated by using receptors that are widely expressed in all cell types, such as heparan sulfate. In this study, heparin, polysulfated dextran sulfate, and suramin were found to significantly prevent EV-71 infection. Heparin inhibited infection by all the EV-71 strains tested, including those with a single-passage history. Neutralization of the cell surface anionic charge by polycationic poly-d-lysine and blockage of heparan sulfate by an anti-heparan sulfate peptide also inhibited EV-71 infection. Interference with heparan sulfate biosynthesis either by sodium chlorate treatment or through transient knockdown of N-deacetylase/N-sulfotransferase-1 and exostosin-1 expression reduced EV-71 infection in RD cells. Enzymatic removal of cell surface heparan sulfate by heparinase I/II/III inhibited EV-71 infection. Furthermore, the level of EV-71 attachment to CHO cell lines that are variably deficient in cell surface glycosaminoglycans was significantly lower than that to wild-type CHO cells. Direct binding of EV-71 particles to heparin-Sepharose columns under physiological salt conditions was demonstrated. We conclude that EV-71 infection requires initial binding to heparan sulfate as an attachment receptor. PMID:23097443

  10. Topological dispositions of lysine. alpha. 380 and lysine. gamma. 486 in the acetylcholine receptor from Torpedo californica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dwyer, B.P.

    1991-04-23

    The locations have been determined, with respect to the plasma membrane, of lysine {alpha}380 and lysine {gamma}486 in the {alpha} subunit and the {gamma} subunit, respectively, of the nicotinic acetylcholine receptor from Torpedo californica. Immunoadsorbents were constructed that recognize the carboxy terminus of the peptide GVKYIAE released by proteolytic digestion from positions 378-384 in the amino acid sequence of the {alpha} subunit of the acetylcholine receptor and the carboxy terminus of the peptide KYVP released by proteolytic digestion from positions 486-489 in the amino acid sequence of the {gamma} subunit. They were used to isolate these peptides from proteolytic digestsmore » of polypeptides from the acetylcholine receptor. Sealed vesicles containing the native acetylcholine receptor were labeled with pyridoxal phosphate and sodium ({sup 3}H)-borohydride. The effect of saponin on the incorporation of pyridoxamine phosphate into lysine {alpha}380 and lysine {gamma}486 from the acetylcholine receptor in these vesicles was assessed with the immunoadsorbents. The conclusions that follow from these results are that lysine {alpha}380 is on the inside surface of a vesicle and lysine {gamma}486 is on the outside surface. Because a majority (85%) of the total binding sites for {alpha}-bungarotoxin bind the toxin in the absence of saponin, the majority of the vesicles are right side out with the inside of the vesicle corresponding to the cytoplasmic surface and the outside of the vesicle corresponding to the extracytoplasmic, synaptic surface. Because lysine {alpha}380 and lysine {gamma}486 lie on opposite sides of the membrane, a membrane-spanning segment must be located between the two positions occupied by these two amino acids in the common sequence of a polypeptide of the acetylcholine receptor.« less

  11. Synthetic heparin-binding factor analogs

    DOEpatents

    Pena, Louis A [Poquott, NY; Zamora, Paul O [Gaithersburg, MD; Lin, Xinhua [Plainview, NY; Glass, John D [Shoreham, NY

    2010-04-20

    The invention provides synthetic heparin-binding growth factor analogs having at least one peptide chain, and preferably two peptide chains branched from a dipeptide branch moiety composed of two trifunctional amino acid residues, which peptide chain or chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a linker, which may be a hydrophobic linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  12. Leucine-rich Repeats of Bacterial Surface Proteins Serve as Common Pattern Recognition Motifs of Human Scavenger Receptor gp340*

    PubMed Central

    Loimaranta, Vuokko; Hytönen, Jukka; Pulliainen, Arto T.; Sharma, Ashu; Tenovuo, Jorma; Strömberg, Nicklas; Finne, Jukka

    2009-01-01

    Scavenger receptors are innate immune molecules recognizing and inducing the clearance of non-host as well as modified host molecules. To recognize a wide pattern of invading microbes, many scavenger receptors bind to common pathogen-associated molecular patterns, such as lipopolysaccharides and lipoteichoic acids. Similarly, the gp340/DMBT1 protein, a member of the human scavenger receptor cysteine-rich protein family, displays a wide ligand repertoire. The peptide motif VEVLXXXXW derived from its scavenger receptor cysteine-rich domains is involved in some of these interactions, but most of the recognition mechanisms are unknown. In this study, we used mass spectrometry sequencing, gene inactivation, and recombinant proteins to identify Streptococcus pyogenes protein Spy0843 as a recognition receptor of gp340. Antibodies against Spy0843 are shown to protect against S. pyogenes infection, but no function or host receptor have been identified for the protein. Spy0843 belongs to the leucine-rich repeat (Lrr) family of eukaryotic and prokaryotic proteins. Experiments with truncated forms of the recombinant proteins confirmed that the Lrr region is needed in the binding of Spy0843 to gp340. The same motif of two other Lrr proteins, LrrG from the Gram-positive S. agalactiae and BspA from the Gram-negative Tannerella forsythia, also mediated binding to gp340. Moreover, inhibition of Spy0843 binding occurred with peptides containing the VEVLXXXXW motif, but also peptides devoid of the XXXXW motif inhibited binding of Lrr proteins. These results thus suggest that the conserved Lrr motif in bacterial proteins serves as a novel pattern recognition motif for unique core peptides of human scavenger receptor gp340. PMID:19465482

  13. The molecular mechanism of flop-selectivity and subsite recognition for an AMPA receptor allosteric modulator: Structures of GluA2 and GluA3 complexed with PEPA

    PubMed Central

    Ahmed, Ahmed H.; Ptak, Christopher P.; Oswald, Robert E.

    2011-01-01

    Glutamate receptors are important potential drug targets for cognitive enhancement and the treatment of schizophrenia in part because they are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system. One approach to the application of therapeutic agents to the AMPA subtype of glutamate receptors is the use of allosteric modulators, which promote dimerization by binding to a dimer interface thereby reducing desensitization and deactivation. AMPA receptors exist in two alternatively spliced variants (flip and flop) that differ in desensitization and receptor activation profiles. Most of the structural information on modulators of the AMPA receptor target the flip subtype. We report here the crystal structure of the flop-selective allosteric modulator, PEPA, bound to the binding domains of the GluA2 and GluA3 flop isoforms of AMPA receptors. Specific hydrogen bonding patterns can explain the preference for the flop isoform. This includes a bidentate hydrogen bonding pattern between PEPA and N754 of the flop isoforms of GluA2 and GluA3 (the corresponding position in the flip isoform is S754). Comparison with other allosteric modulators provides a framework for the development of new allosteric modulators with preferences for either the flip or flop isoforms. In addition to interactions with N/S754, specific interactions of the sulfonamide with conserved residues in the binding site are characteristics of a number of allosteric modulators. These, in combination, with variable interactions with five subsites on the binding surface lead to different stoichiometries, orientations within the binding pockets, and functional outcomes. PMID:20199107

  14. A fibronectin receptor on Candida albicans mediates adherence of the fungus to extracellular matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klotz, S.A.; Smith, R.L.

    1991-03-01

    Binding of fibronectin, an extracellular matrix (ECM) protein, to Candida albicans was measured, and adherence of the fungus to immobilized ECM proteins, fibronectin, laminin, types I and IV collagen, and subendothelial ECM was studied. 125I-labeled fibronectin was inhibited from binding to the fungus by unlabeled human plasma fibronectin and by Arg-Gly-Asp (RGD), Gly-Arg-Gly-Glu-Ser-Pro (GRGESP), and Gly-Arg-Gly-Asp-Thr-Pro (GRGDTP), but binding was not inhibited by Gly-Arg-Gly-Asp-Ser-Pro. Soluble fibronectin, RGD, GRGESP, and GRGDTP also inhibited fungal adherence to the individual immobilized ECM proteins in a complex pattern, but only soluble fibronectin (10(-7) M) inhibited fungal adherence to subendothelial ECM. Thus, C. albicans possessesmore » at least one type of cell surface receptor for binding soluble fibronectin that can be inhibited with peptides. This receptor apparently is used to bind the fungus to immobilized ECM proteins and to subendothelial ECM and may play a role in the initiation of disseminated disease by bloodborne fungi by providing for adherence of the microorganisms to ECM proteins.« less

  15. Phospho-selective mechanisms of arrestin conformations and functions revealed by unnatural amino acid incorporation and 19F-NMR

    PubMed Central

    Yang, Fan; Yu, Xiao; Liu, Chuan; Qu, Chang-Xiu; Gong, Zheng; Liu, Hong-Da; Li, Fa-Hui; Wang, Hong-Mei; He, Dong-Fang; Yi, Fan; Song, Chen; Tian, Chang-Lin; Xiao, Kun-Hong; Wang, Jiang-Yun; Sun, Jin-Peng

    2015-01-01

    Specific arrestin conformations are coupled to distinct downstream effectors, which underlie the functions of many G-protein-coupled receptors (GPCRs). Here, using unnatural amino acid incorporation and fluorine-19 nuclear magnetic resonance (19F-NMR) spectroscopy, we demonstrate that distinct receptor phospho-barcodes are translated to specific β-arrestin-1 conformations and direct selective signalling. With its phosphate-binding concave surface, β-arrestin-1 ‘reads' the message in the receptor phospho-C-tails and distinct phospho-interaction patterns are revealed by 19F-NMR. Whereas all functional phosphopeptides interact with a common phosphate binding site and induce the movements of finger and middle loops, different phospho-interaction patterns induce distinct structural states of β-arrestin-1 that are coupled to distinct arrestin functions. Only clathrin recognizes and stabilizes GRK2-specific β-arrestin-1 conformations. The identified receptor-phospho-selective mechanism for arrestin conformation and the spacing of the multiple phosphate-binding sites in the arrestin enable arrestin to recognize plethora phosphorylation states of numerous GPCRs, contributing to the functional diversity of receptors. PMID:26347956

  16. The opposing roles of laminin-binding integrins in cancer.

    PubMed

    Ramovs, Veronika; Te Molder, Lisa; Sonnenberg, Arnoud

    2017-01-01

    Integrins play an important role in cell adhesion by linking the cytoskeleton of cells to components in the extracellular matrix. In this capacity, integrins cooperate with different cell surface receptors, including growth factor receptors and G-protein coupled receptors, to regulate intracellular signaling pathways that control cell polarization, spreading, migration, survival, and gene expression. A distinct subfamily of molecules in the integrin family of adhesion receptors is formed by receptors that mediate cell adhesion to laminins, major components of the basement membrane that lie under clusters of cells or surround them, separating them from other cells and/or adjacent connective tissue. During the past decades, many studies have provided evidence for a role of laminin-binding integrins in tumorigenesis, and both tumor-promoting and suppressive activities have been identified. In this review we discuss the dual role of the laminin-binding integrins α3β1 and α6β4 in tumor development and progression, and examine the factors and mechanisms involved in these opposing effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Structure-function Analysis of Receptor-binding in Adeno-Associated Virus Serotype 6 (AAV-6)

    PubMed Central

    Xie, Qing; Lerch, Thomas F.; Meyer, Nancy L.; Chapman, Michael S.

    2011-01-01

    Crystal structures of the AAV-6 capsid at 3 Å reveal a subunit fold homologous to other parvoviruses with greatest differences in two external loops. The electrostatic potential suggests that receptor-attachment is mediated by four residues: Arg576, Lys493, Lys459 and Lys531, defining a positively charged region curving up from the valley between adjacent spikes. It overlaps only partially with the receptor-binding site of AAV-2, and the residues endowing the electrostatic character are not homologous. Mutational substitution of each residue decreases heparin affinity, particularly Lys531 and Lys459. Neither is conserved among heparin-binding serotypes, indicating that diverse modes of receptor attachment have been selected in different serotypes. Surface topology and charge are also distinct at the shoulder of the spike, where linear epitopes for AAV-2’s neutralizing monoclonal antibody A20 come together. Evolutionarily, selection of changed side-chain charge may have offered a conservative means to evade immune neutralization while preserving other essential functionality. PMID:21917284

  18. Ligand-receptor assay for evaluation of functional activity of human recombinant VEGF and VEGFR-1 extracellular fragment.

    PubMed

    Leopol'd, A V; Baklaushev, V P; Korchagina, A A; Shein, S A; Grinenko, N F; Pavlov, K A; Ryabukhin, I A; Chekhonin, V P

    2012-04-01

    cDNA encoding VEGF and Ig-like extracellular domains 2-4 of VEGFR-1 (sFlt-1(2-4)) were cloned into prokaryotic expression vectors pET32a and pQE60. Recombinant proteins were purified (metal affinity chromatography) and renatured. Chemiluminescent study for the interaction of recombinant VEGF and sFlt-1(2-4) showed that biotinylated VEGF specifically binds to the polystyrene-immobilized receptor extracellular fragment. Biotinylated recombinant sFlt-1 interacts with immobilized VEGF. Analysis of the interaction of immobilized recombinant VEGFR-1 and VEGF with C6 glioma cells labeled with CFDA-SE (vital fluorescent dye) showed that recombinant VEGFR-1 also binds to native membrane-associated VEGF. Recombinant VEGF was shown to bind to specific receptors expressed on the surface of C6 glioma cells. Functional activity of these proteins was confirmed by ligand-receptor assay for VEGF and VEGFR-1 (sFlt-1) and quantitative chemiluminescent detection.

  19. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

  20. Conopeptide ρ-TIA Defines a New Allosteric Site on the Extracellular Surface of the α1B-Adrenoceptor*♦

    PubMed Central

    Ragnarsson, Lotten; Wang, Ching-I Anderson; Andersson, Åsa; Fajarningsih, Dewi; Monks, Thea; Brust, Andreas; Rosengren, K. Johan; Lewis, Richard J.

    2013-01-01

    The G protein-coupled receptor (GPCR) superfamily is an important drug target that includes over 1000 membrane receptors that functionally couple extracellular stimuli to intracellular effectors. Despite the potential of extracellular surface (ECS) residues in GPCRs to interact with subtype-specific allosteric modulators, few ECS pharmacophores for class A receptors have been identified. Using the turkey β1-adrenergic receptor crystal structure, we modeled the α1B-adrenoceptor (α1B-AR) to help identify the allosteric site for ρ-conopeptide TIA, an inverse agonist at this receptor. Combining mutational radioligand binding and inositol 1-phosphate signaling studies, together with molecular docking simulations using a refined NMR structure of ρ-TIA, we identified 14 residues on the ECS of the α1B-AR that influenced ρ-TIA binding. Double mutant cycle analysis and docking confirmed that ρ-TIA binding was dominated by a salt bridge and cation-π between Arg-4-ρ-TIA and Asp-327 and Phe-330, respectively, and a T-stacking-π interaction between Trp-3-ρ-TIA and Phe-330. Water-bridging hydrogen bonds between Asn-2-ρ-TIA and Val-197, Trp-3-ρ-TIA and Ser-318, and the positively charged N terminus and Glu-186, were also identified. These interactions reveal that peptide binding to the ECS on transmembrane helix 6 (TMH6) and TMH7 at the base of extracellular loop 3 (ECL3) is sufficient to allosterically inhibit agonist signaling at a GPCR. The ligand-accessible ECS residues identified provide the first view of an allosteric inhibitor pharmacophore for α1-adrenoceptors and mechanistic insight and a new set of structural constraints for the design of allosteric antagonists at related GPCRs. PMID:23184947

  1. Conopeptide ρ-TIA defines a new allosteric site on the extracellular surface of the α1B-adrenoceptor.

    PubMed

    Ragnarsson, Lotten; Wang, Ching-I Anderson; Andersson, Åsa; Fajarningsih, Dewi; Monks, Thea; Brust, Andreas; Rosengren, K Johan; Lewis, Richard J

    2013-01-18

    The G protein-coupled receptor (GPCR) superfamily is an important drug target that includes over 1000 membrane receptors that functionally couple extracellular stimuli to intracellular effectors. Despite the potential of extracellular surface (ECS) residues in GPCRs to interact with subtype-specific allosteric modulators, few ECS pharmacophores for class A receptors have been identified. Using the turkey β(1)-adrenergic receptor crystal structure, we modeled the α(1B)-adrenoceptor (α(1B)-AR) to help identify the allosteric site for ρ-conopeptide TIA, an inverse agonist at this receptor. Combining mutational radioligand binding and inositol 1-phosphate signaling studies, together with molecular docking simulations using a refined NMR structure of ρ-TIA, we identified 14 residues on the ECS of the α(1B)-AR that influenced ρ-TIA binding. Double mutant cycle analysis and docking confirmed that ρ-TIA binding was dominated by a salt bridge and cation-π between Arg-4-ρ-TIA and Asp-327 and Phe-330, respectively, and a T-stacking-π interaction between Trp-3-ρ-TIA and Phe-330. Water-bridging hydrogen bonds between Asn-2-ρ-TIA and Val-197, Trp-3-ρ-TIA and Ser-318, and the positively charged N terminus and Glu-186, were also identified. These interactions reveal that peptide binding to the ECS on transmembrane helix 6 (TMH6) and TMH7 at the base of extracellular loop 3 (ECL3) is sufficient to allosterically inhibit agonist signaling at a GPCR. The ligand-accessible ECS residues identified provide the first view of an allosteric inhibitor pharmacophore for α(1)-adrenoceptors and mechanistic insight and a new set of structural constraints for the design of allosteric antagonists at related GPCRs.

  2. Regulation of B Cell Functions by the Sialic Acid-Binding Receptors Siglec-G and CD22

    PubMed Central

    Jellusova, Julia; Nitschke, Lars

    2011-01-01

    B cell antigen receptor (BCR) engagement can lead to many different physiologic outcomes. To achieve an appropriate response, the BCR signal is interpreted in the context of other stimuli and several additional receptors on the B cell surface participate in the modulation of the signal. Two members of the Siglec (sialic acid-binding immunoglobulin-like lectin) family, CD22 and Siglec-G have been shown to inhibit the BCR signal. Recent findings indicate that the ability of these two receptors to bind sialic acids might be important to induce tolerance to self-antigens. Sialylated glycans are usually absent on microbes but abundant in higher vertebrates and might therefore provide an important tolerogenic signal. Since the expression of the specific ligands for Siglec-G and CD22 is tightly regulated and since Siglecs are not only able to bind their ligands in trans but also on the same cell surface this might provide additional mechanisms to control the BCR signal. Although both Siglec-G and CD22 are expressed on B cells and are able to inhibit BCR mediated signaling, they also show unique biological functions. While CD22 is the dominant regulator of calcium signaling on conventional B2 cells and also seems to play a role on marginal zone B cells, Siglec-G exerts its function mainly on B1 cells and influences their lifespan and antibody production. Both Siglec-G and CD22 have also recently been linked to toll-like receptor signaling and may provide a link in the regulation of the adaptive and innate immune response of B cells. PMID:22566885

  3. Receptor activity-modifying protein-dependent effects of mutations in the calcitonin receptor-like receptor: implications for adrenomedullin and calcitonin gene-related peptide pharmacology

    PubMed Central

    Watkins, H A; Walker, C S; Ly, K N; Bailey, R J; Barwell, J; Poyner, D R; Hay, D L

    2014-01-01

    Background and Purpose Receptor activity-modifying proteins (RAMPs) define the pharmacology of the calcitonin receptor-like receptor (CLR). The interactions of the different RAMPs with this class B GPCR yield high-affinity calcitonin gene-related peptide (CGRP) or adrenomedullin (AM) receptors. However, the mechanism for this is unclear. Experimental Approach Guided by receptor models, we mutated residues in the N-terminal helix of CLR, RAMP2 and RAMP3 hypothesized to be involved in peptide interactions. These were assayed for cAMP production with AM, AM2 and CGRP together with their cell surface expression. Binding studies were also conducted for selected mutants. Key Results An important domain for peptide interactions on CLR from I32 to I52 was defined. Although I41 was universally important for binding and receptor function, the role of other residues depended on both ligand and RAMP. Peptide binding to CLR/RAMP3 involved a more restricted range of residues than that to CLR/RAMP1 or CLR/RAMP2. E101 of RAMP2 had a major role in AM interactions, and F111/W84 of RAMP2/3 was important with each peptide. Conclusions and Implications RAMP-dependent effects of CLR mutations suggest that the different RAMPs control accessibility of peptides to binding residues situated on the CLR N-terminus. RAMP3 appears to alter the role of specific residues at the CLR-RAMP interface compared with RAMP1 and RAMP2. PMID:24199627

  4. Alzheimer's Therapeutics Targeting Amyloid Beta 1–42 Oligomers I: Abeta 42 Oligomer Binding to Specific Neuronal Receptors Is Displaced by Drug Candidates That Improve Cognitive Deficits

    PubMed Central

    Izzo, Nicholas J.; Staniszewski, Agnes; To, Lillian; Fa, Mauro; Teich, Andrew F.; Saeed, Faisal; Wostein, Harrison; Walko, Thomas; Vaswani, Anisha; Wardius, Meghan; Syed, Zanobia; Ravenscroft, Jessica; Mozzoni, Kelsie; Silky, Colleen; Rehak, Courtney; Yurko, Raymond; Finn, Patricia; Look, Gary; Rishton, Gilbert; Safferstein, Hank; Miller, Miles; Johanson, Conrad; Stopa, Edward; Windisch, Manfred; Hutter-Paier, Birgit; Shamloo, Mehrdad; Arancio, Ottavio; LeVine, Harry; Catalano, Susan M.

    2014-01-01

    Synaptic dysfunction and loss caused by age-dependent accumulation of synaptotoxic beta amyloid (Abeta) 1–42 oligomers is proposed to underlie cognitive decline in Alzheimer's disease (AD). Alterations in membrane trafficking induced by Abeta oligomers mediates reduction in neuronal surface receptor expression that is the basis for inhibition of electrophysiological measures of synaptic plasticity and thus learning and memory. We have utilized phenotypic screens in mature, in vitro cultures of rat brain cells to identify small molecules which block or prevent the binding and effects of Abeta oligomers. Synthetic Abeta oligomers bind saturably to a single site on neuronal synapses and induce deficits in membrane trafficking in neuronal cultures with an EC50 that corresponds to its binding affinity. The therapeutic lead compounds we have found are pharmacological antagonists of Abeta oligomers, reducing the binding of Abeta oligomers to neurons in vitro, preventing spine loss in neurons and preventing and treating oligomer-induced deficits in membrane trafficking. These molecules are highly brain penetrant and prevent and restore cognitive deficits in mouse models of Alzheimer's disease. Counter-screening these compounds against a broad panel of potential CNS targets revealed they are highly potent and specific ligands of the sigma-2/PGRMC1 receptor. Brain concentrations of the compounds corresponding to greater than 80% receptor occupancy at the sigma-2/PGRMC1 receptor restore cognitive function in transgenic hAPP Swe/Ldn mice. These studies demonstrate that synthetic and human-derived Abeta oligomers act as pharmacologically-behaved ligands at neuronal receptors - i.e. they exhibit saturable binding to a target, they exert a functional effect related to their binding and their displacement by small molecule antagonists blocks their functional effect. The first-in-class small molecule receptor antagonists described here restore memory to normal in multiple AD models and sustain improvement long-term, representing a novel mechanism of action for disease-modifying Alzheimer's therapeutics. PMID:25390368

  5. Alzheimer's therapeutics targeting amyloid beta 1-42 oligomers I: Abeta 42 oligomer binding to specific neuronal receptors is displaced by drug candidates that improve cognitive deficits.

    PubMed

    Izzo, Nicholas J; Staniszewski, Agnes; To, Lillian; Fa, Mauro; Teich, Andrew F; Saeed, Faisal; Wostein, Harrison; Walko, Thomas; Vaswani, Anisha; Wardius, Meghan; Syed, Zanobia; Ravenscroft, Jessica; Mozzoni, Kelsie; Silky, Colleen; Rehak, Courtney; Yurko, Raymond; Finn, Patricia; Look, Gary; Rishton, Gilbert; Safferstein, Hank; Miller, Miles; Johanson, Conrad; Stopa, Edward; Windisch, Manfred; Hutter-Paier, Birgit; Shamloo, Mehrdad; Arancio, Ottavio; LeVine, Harry; Catalano, Susan M

    2014-01-01

    Synaptic dysfunction and loss caused by age-dependent accumulation of synaptotoxic beta amyloid (Abeta) 1-42 oligomers is proposed to underlie cognitive decline in Alzheimer's disease (AD). Alterations in membrane trafficking induced by Abeta oligomers mediates reduction in neuronal surface receptor expression that is the basis for inhibition of electrophysiological measures of synaptic plasticity and thus learning and memory. We have utilized phenotypic screens in mature, in vitro cultures of rat brain cells to identify small molecules which block or prevent the binding and effects of Abeta oligomers. Synthetic Abeta oligomers bind saturably to a single site on neuronal synapses and induce deficits in membrane trafficking in neuronal cultures with an EC50 that corresponds to its binding affinity. The therapeutic lead compounds we have found are pharmacological antagonists of Abeta oligomers, reducing the binding of Abeta oligomers to neurons in vitro, preventing spine loss in neurons and preventing and treating oligomer-induced deficits in membrane trafficking. These molecules are highly brain penetrant and prevent and restore cognitive deficits in mouse models of Alzheimer's disease. Counter-screening these compounds against a broad panel of potential CNS targets revealed they are highly potent and specific ligands of the sigma-2/PGRMC1 receptor. Brain concentrations of the compounds corresponding to greater than 80% receptor occupancy at the sigma-2/PGRMC1 receptor restore cognitive function in transgenic hAPP Swe/Ldn mice. These studies demonstrate that synthetic and human-derived Abeta oligomers act as pharmacologically-behaved ligands at neuronal receptors--i.e. they exhibit saturable binding to a target, they exert a functional effect related to their binding and their displacement by small molecule antagonists blocks their functional effect. The first-in-class small molecule receptor antagonists described here restore memory to normal in multiple AD models and sustain improvement long-term, representing a novel mechanism of action for disease-modifying Alzheimer's therapeutics.

  6. CD70 is downregulated by interaction with CD27

    PubMed Central

    Kuka, Mirela; Munitic, Ivana; Torchia, Maria Letizia Giardino; Ashwell, Jonathan D.

    2013-01-01

    Engagement of the receptor CD27 by CD70 affects the magnitude and quality of T cell responses in a variety of infection models, and exaggerated signaling via this pathway results in enhanced immune responses and autoimmunity. One means by which signaling is regulated is tight control of cell surface CD70, which is expressed on dendritic, T, and B cells only upon activation. Here we show that there is a second level of regulation. First, although undetectable on the cell surface by flow cytometry, immature dendritic cells (DC) have a small pool of CD70 that continuously recycles from the plasma membrane. In addition, surface levels of CD70 on DC and T cells were higher in mice deficient in CD27, or on DC for which the interaction between CD70 and CD27 was precluded by blocking antibodies. Binding of CD70 by its receptor resulted in downregulation of CD70 transcription and protein levels, suggesting that CD70-mediated “reverse signals” regulate its own levels. Therefore, the ability of CD70 to trigger costimulation is self-regulated when it binds its complementary receptor. PMID:23913967

  7. [Effect of thyroid hormones on the histotopography of lectin receptors in the rat salivary gland].

    PubMed

    Lutsik, A D; Iashchenko, A M; Detiuk, E S

    1987-04-01

    Using lectin-peroxidase technique, the influence of hypo- and hyperthyroidism on histotopography of glycoconjugates has been investigated in rat submandibular gland. The following lectins were used: peanut agglutinin (PNA), wheat germ agglutinin (WGA), Laburnum anagyroides lectin (LAL) and concanavalin A (con A). It has been demonstrated that hyperthyroidism is accompanied by the loss of con A, WGA and LAL receptor sites. Hypothyrodism enhanced con A binding to granular duct cells with a parallel reduction in WGA and LAL binding to these or other duct cells. Hypothyroidism as well as hyperthyroidism markedly enhanced PNA binding to duct epitheliocytes with redistribution of these lectin binding sites from the luminal surface of salivary ducts into the cytoplasm of duct cells. Possible interpretations of the observed phenomena are discussed.

  8. Receptor trafficking via the perinuclear recycling compartment accompanied by cell division is necessary for permanent neurotensin cell sensitization and leads to chronic mitogen-activated protein kinase activation.

    PubMed

    Toy-Miou-Leong, Mireille; Cortes, Catherine Llorens; Beaudet, Alain; Rostène, William; Forgez, Patricia

    2004-03-26

    Most G protein-coupled receptors are internalized after interaction with their respective ligand, a process that subsequently contributes to cell desensitization, receptor endocytosis, trafficking, and finally cell resensitization. Although cellular mechanisms leading to cell desensitization have been widely studied, those responsible for cell resensitization are still poorly understood. We examined here the traffic of the high affinity neurotensin receptor (NT1 receptor) following prolonged exposure to high agonist concentration. Fluorescence and confocal microscopy of Chinese hamster ovary, human neuroblastoma (CHP 212), and murine neuroblastoma (N1E-115) cells expressing green fluorescent protein-tagged NT1 receptor revealed that under prolonged treatment with saturating concentrations of neurotensin (NT) agonist, NT1 receptor and NT transiently accumulated in the perinuclear recycling compartment (PNRC). During this cellular event, cell surface receptors remained markedly depleted as detected by both confocal microscopy and (125)I-NT binding assays. In dividing cells, we observed that following prolonged NT agonist stimulation, NT1 receptors were removed from the PNRC, accumulated in dispersed vesicles inside the cytoplasm, and subsequently reappeared at the cell surface. This NT binding recovery allowed for constant cell sensitization and led to a chronic activation of mitogen-activated protein kinases p42 and p44. Under these conditions, the constant activation of NT1 receptor generates an oncogenic regulation. These observations support the potent role for neuropeptides, such as NT, in cancer progression.

  9. Co-expression in CHO cells of two muscle proteins involved in excitation-contraction coupling.

    PubMed

    Takekura, H; Takeshima, H; Nishimura, S; Takahashi, M; Tanabe, T; Flockerzi, V; Hofmann, F; Franzini-Armstrong, C

    1995-10-01

    Ryanodine receptors and dihydropyridine receptors are located opposite each other at the junctions between sarcoplasmic reticulum and either the surface membrane or the transverse tubules in skeletal muscle. Ryanodine receptors are the calcium release channels of the sarcoplasmic reticulum and their cytoplasmic domains form the feet, connecting sarcoplasmic reticulum to transverse tubules. Dihydropyridine receptors are L-type calcium channels that act as the voltage sensors of excitation-contraction coupling: they sense surface membrane and transverse tubule depolarization and induce opening of the sarcoplasmic reticulum release channels. In skeletal muscle, ryanodine receptors are arranged in extensive arrays and dihydropyridine receptors are grouped into tetrads, which in turn are associated with the four subunits of ryanodine receptors. The disposition allows for a direct interaction between the two sets of molecules. CHO cells were stably transformed with plasmids for skeletal muscle ryanodine receptors and either the skeletal dihydropyridine receptor, or a skeletal-cardiac dihydropyridine receptor chimera (CSk3) which can functionally substitute for the skeletal dihydropyridine receptor, in addition to plasmids for the alpha 2, beta and gamma subunits. RNA blot hybridization gave positive results for all components. Immunoblots, ryanodine binding, electron microscopy and exposure to caffeine show that the expressed ryanodine receptors forms functional tetrameric channels, which are correctly inserted into the endoplasmic reticulum membrane, and form extensive arrays with the same spacings as in skeletal muscle. Since formation of arrays does not require coexpression of dihydropyridine receptors, we conclude that self-aggregation is an independent property of ryanodine receptors. All dihydropyridine receptor-expressing clones show high affinity binding for dihydropyridine and immunolabelling with antibodies against dihydropyridine receptor. The presence of calcium currents with fast kinetics and immunolabelling for dihydropyridine receptors in the surface membrane of CSk3 clones indicate that CSk3-dihydropyridine receptors are appropriately targeted to the cell's plasmalemma. The expressed skeletal-type dihydropyridine receptors, however, remain mostly located within perinuclear membranes. In cells coexpressing functional dihydropyridine receptors and ryanodine receptors, no junctions between feet-bearing endoplasmic reticulum elements and surface membrane are formed, and dihydropyridine receptors do not assemble into tetrads. A separation between dihydropyridine receptors and ryanodine receptors is not unique to CHO cells, but is found also in cardiac muscle, in muscles of invertebrates and, under certain conditions, in skeletal muscle. We suggest that failure to form junctions in co-transfected CHO cell may be due to lack of an essential protein necessary either for the initial docking of the endoplasmic reticulum to the surface membrane or for maintaining the interaction between dihydropyridine receptors and ryanodine receptors. We also conclude that formation of tetrads requires a close interaction between dihydropyridine receptors and ryanodine receptors.

  10. A parallel panning scheme used for selection of a GluA4-specific Fab targeting the ligand-binding domain.

    PubMed

    Clausen, Rasmus P; Mohr, Andreas Ø; Riise, Erik; Jensen, Anders A; Gill, Avinash; Madden, Dean R; Kastrup, Jette S; Skottrup, Peter D

    2016-11-01

    A method for development of murine Fab fragments towards extracellular domains of a surface receptor is presented. The GluA4 ionotropic glutamate receptor is used as a model system. Recombinant GluA4 ectodomain comprising both the N-terminal domain (NTD) and the ligand-binding domain (LBD) in one molecule was used for immunization. A Fab-phage library was constructed and a parallel panning approach enabled selection of murine Fab fragments towards either intact ectodomain or the isolated LBD of the GluA4 receptor. One LBD-Fab (FabL9) showed exclusive selectivity for the GluA4 LBD, over a panel of LBDs from GluA2, GluK1, GluK2 and GluD2. Soluble FabL9 was produced in amounts suitable for characterization. Competitive ELISA and rat-brain immunoprecipitation experiments confirmed that the FabL9 epitope is conserved in the LBD and in the intact native receptor. By an alignment of GluA2 and GluA4, the likely binding epitope for FabL9 was predicted. This study demonstrates a simple approach for development of antibody fragments towards specific sub-domains of a large ligand-gated ion channel, and this method could be utilized for all multi-domain surface receptors where antibody domain-selectivity may be desirable. Furthermore, we present for the first time a GluA4 subtype-specific murine Fab fragment targeting the LBD of the receptor. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Different receptors binding to distinct interfaces on herpes simplex virus gD can trigger events leading to cell fusion and viral entry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spear, Patricia G.; Manoj, Sharmila; Yoon, Miri

    2006-01-05

    One of the herpes simplex virus envelope glycoproteins, designated gD, is the principal determinant of cell recognition for viral entry. Other viral glycoproteins, gB, gH and gL, cooperate with gD to mediate the membrane fusion that is required for viral entry and cell fusion. Membrane fusion is triggered by the binding of gD to one of its receptors. These receptors belong to three different classes of cell surface molecules. This review summarizes recent findings on the structure and function of gD. The results presented indicate that gD may assume more than one conformation, one in the absence of receptor, anothermore » when gD is bound to the herpesvirus entry mediator, a member of the TNF receptor family, and a third when gD is bound to nectin-1, a cell adhesion molecule in the immunoglobulin superfamily. Finally, information and ideas are presented about a membrane-proximal region of gD that is required for membrane fusion, but not for receptor binding, and that may have a role in activating the fusogenic activity of gB, gH and gL.« less

  12. A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Melcher, Karsten; Ng, Ley-Moy; Zhou, X Edward

    2010-01-12

    Abscisic acid (ABA) is a ubiquitous hormone that regulates plant growth, development and responses to environmental stresses. Its action is mediated by the PYR/PYL/RCAR family of START proteins, but it remains unclear how these receptors bind ABA and, in turn, how hormone binding leads to inhibition of the downstream type 2C protein phosphatase (PP2C) effectors. Here we report crystal structures of apo and ABA-bound receptors as well as a ternary PYL2-ABA-PP2C complex. The apo receptors contain an open ligand-binding pocket flanked by a gate that closes in response to ABA by way of conformational changes in two highly conserved β-loopsmore » that serve as a gate and latch. Moreover, ABA-induced closure of the gate creates a surface that enables the receptor to dock into and competitively inhibit the PP2C active site. A conserved tryptophan in the PP2C inserts directly between the gate and latch, which functions to further lock the receptor in a closed conformation. Together, our results identify a conserved gate-latch-lock mechanism underlying ABA signalling.« less

  13. Thematic minireview series: cell biology of G protein signaling.

    PubMed

    Dohlman, Henrik G

    2015-03-13

    This thematic series is on the topic of cell signaling from a cell biology perspective, with a particular focus on G proteins. G protein-coupled receptors (GPCRs, also known as seven-transmembrane receptors) are typically found at the cell surface. Upon agonist binding, these receptors will activate a GTP-binding G protein at the cytoplasmic face of the plasma membrane. Additionally, there is growing evidence that G proteins can also be activated by non-receptor binding partners, and they can signal from non-plasma membrane compartments. The production of second messengers at multiple, spatially distinct locations represents a type of signal encoding that has been largely neglected. The first minireview in the series describes biosensors that are being used to monitor G protein signaling events in live cells. The second describes the implementation of antibody-based biosensors to dissect endosome signaling by G proteins and their receptors. The third describes the function of a non-receptor, cytoplasmic activator of G protein signaling, called GIV (Girdin). Collectively, the advances described in these articles provide a deeper understanding and emerging opportunities for new pharmacology. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo.

    PubMed Central

    Truss, M; Bartsch, J; Schelbert, A; Haché, R J; Beato, M

    1995-01-01

    Hormonal induction of the mouse mammary tumour virus (MMTV) promoter is mediated by interactions between hormone receptors and other transcription factors bound to a complex array of sites. Previous results suggested that access to these sites is modulated by their precise organization into a positioned regulatory nucleosome. Using genomic footprinting, we show that MMTV promoter DNA is rotationally phased in intact cells containing either episomal or chromosomally integrated proviral fragments. Prior to induction there is no evidence for factors bound to the promoter. Following progesterone induction of cells with high levels of receptor, genomic footprinting detects simultaneous protection over the binding sites for hormone receptors, NF-I and the octamer binding proteins. Glucocorticoid or progestin induction leads to a characteristic chromatin remodelling that is independent of ongoing transcription. The centre of the regulatory nucleosome becomes more accessible to DNase I and restriction enzymes, but the limits of the nucleosome are unchanged and the 145 bp core region remains protected against micrococcal nuclease digestion. Thus, the nucleosome covering the MMTV promoter is neither removed nor shifted upon hormone induction, and all relevant transcription factors bind to the surface of the rearranged nucleosome. Since these factors cannot bind simultaneously to free DNA, maintainance of the nucleosome may be required for binding of factors to contiguous sites. Images PMID:7737125

  15. Empty conformers of HLA-B preferentially bind CD8 and regulate CD8+ T cell function.

    PubMed

    Geng, Jie; Altman, John D; Krishnakumar, Sujatha; Raghavan, Malini

    2018-05-09

    When complexed with antigenic peptides, human leukocyte antigen (HLA) class I (HLA-I) molecules initiate CD8 + T cell responses via interaction with the T cell receptor (TCR) and co-receptor CD8. Peptides are generally critical for the stable cell surface expression of HLA-I molecules. However, for HLA-I alleles such as HLA-B*35:01, peptide-deficient (empty) heterodimers are thermostable and detectable on the cell surface. Additionally, peptide-deficient HLA-B*35:01 tetramers preferentially bind CD8 and to a majority of blood-derived CD8 + T cells via a CD8-dependent binding mode. Further functional studies reveal that peptide-deficient conformers of HLA-B*35:01 do not directly activate CD8 + T cells, but accumulate at the immunological synapse in antigen-induced responses, and enhance cognate peptide-induced cell adhesion and CD8 + T cell activation. Together, these findings indicate that HLA-I peptide occupancy influences CD8 binding affinity, and reveal a new set of regulators of CD8 + T cell activation, mediated by the binding of empty HLA-I to CD8. © 2018, Geng et al.

  16. Structure, Receptor Binding, and Antigenicity of Influenza Virus Hemagglutinins from the 1957 H2N2 Pandemic

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Rui; McBride, Ryan; Paulson, James C.

    2010-03-04

    The hemagglutinin (HA) envelope protein of influenza viruses mediates essential viral functions, including receptor binding and membrane fusion, and is the major viral antigen for antibody neutralization. The 1957 H2N2 subtype (Asian flu) was one of the three great influenza pandemics of the last century and caused 1 million deaths globally from 1957 to 1968. Three crystal structures of 1957 H2 HAs have been determined at 1.60 to 1.75 {angstrom} resolutions to investigate the structural basis for their antigenicity and evolution from avian to human binding specificity that contributed to its introduction into the human population. These structures, which representmore » the highest resolutions yet recorded for a complete ectodomain of a glycosylated viral surface antigen, along with the results of glycan microarray binding analysis, suggest that a hydrophobicity switch at residue 226 and elongation of receptor-binding sites were both critical for avian H2 HA to acquire human receptor specificity. H2 influenza viruses continue to circulate in birds and pigs and, therefore, remain a substantial threat for transmission to humans. The H2 HA structure also reveals a highly conserved epitope that could be harnessed in the design of a broader and more universal influenza A virus vaccine.« less

  17. Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses.

    PubMed

    Hendricks, Gabriel L; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C; Viswanathan, Karthik; Albers, Leila; Comolli, James C; Shriver, Zachary; Knipe, David M; Kurt-Jones, Evelyn A; Fygenson, Deborah K; Trevejo, Jose M; Wang, Jennifer P; Finberg, Robert W

    2015-04-01

    Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as 'molecular sinks' and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Activation of G-proteins by receptor-stimulated nucleoside diphosphate kinase in Dictyostelium.

    PubMed Central

    Bominaar, A A; Molijn, A C; Pestel, M; Veron, M; Van Haastert, P J

    1993-01-01

    Recently, interest in the enzyme nucleoside diphosphate kinase (EC2.7.4.6) has increased as a result of its possible involvement in cell proliferation and development. Since NDP kinase is one of the major sources of GTP in cells, it has been suggested that the effects of an altered NDP kinase activity on cellular processes might be the result of altered transmembrane signal transduction via guanine nucleotide-binding proteins (G-proteins). In the cellular slime mould Dictyostelium discoideum, extracellular cAMP induces an increase of phospholipase C activity via a surface cAMP receptor and G-proteins. In this paper it is demonstrated that part of the cellular NDP kinase is associated with the membrane and stimulated by cell surface cAMP receptors. The GTP produced by the action of NDP kinase is capable of activating G-proteins as monitored by altered G-protein-receptor interaction and the activation of the effector enzyme phospholipase C. Furthermore, specific monoclonal antibodies inhibit the effect of NDP kinase on G-protein activation. These results suggest that receptor-stimulated NDP kinase contributes to the mediation of hormone action by producing GTP for the activation of GTP-binding proteins. Images PMID:8389692

  19. Internalisation of the bleomycin molecules responsible for bleomycin toxicity: a receptor-mediated endocytosis mechanism.

    PubMed

    Pron, G; Mahrour, N; Orlowski, S; Tounekti, O; Poddevin, B; Belehradek, J; Mir, L M

    1999-01-01

    Bleomycin (BLM) does not diffuse through the plasma membrane but nevertheless displays cytotoxic activity due to DNA break generation. The aim of the study was to describe the mechanism of BLM internalisation. We previously provided evidence for the existence of BLM-binding sites at the surface of DC-3F Chinese hamster fibroblasts, as well as of their involvement in BLM cytotoxicity on DC-3F cells and related BLM-resistant sublines. Here we report that A253 human cells and their BLM-resistant subline C-10E also possessed a membrane protein of ca. 250 kDa specifically binding BLM. Part of this C-10E cell resistance could be explained by a decrease in the number of BLM-binding sites exposed at the cell surface with respect to A253 cells. The comparison between A253 and DC-3F cells exposing a similar number of BLM-binding sites revealed that the faster the fluid phase endocytosis, the greater the cell sensitivity to BLM. Moreover, the experimental modification of endocytotic vesicle size showed that BLM cytotoxicity was directly correlated with the flux of plasma membrane area engulfed during endocytosis rather than with the fluid phase volume incorporated. Thus, BLM would be internalised by a receptor-mediated endocytosis mechanism which would first require BLM binding to its membrane receptor and then the transfer of the complex into intracellular endocytotic vesicles, followed by BLM entry into the cytosol, probably from a nonacidic compartment.

  20. Free energy simulations reveal a double mutant avian H5N1 virus hemagglutinin with altered receptor binding specificity.

    PubMed

    Das, Payel; Li, Jingyuan; Royyuru, Ajay K; Zhou, Ruhong

    2009-08-01

    Historically, influenza pandemics have been triggered when an avian influenza virus or a human/avian reassorted virus acquires the ability to replicate efficiently and become transmissible in the human population. Most critically, the major surface glycoprotein hemagglutinin (HA) must adapt to the usage of human-like (alpha-2,6-linked) sialylated glycan receptors. Therefore, identification of mutations that can switch the currently circulating H5N1 HA receptor binding specificity from avian to human might provide leads to the emergence of pandemic H5N1 viruses. To define such mutations in the H5 subtype, here we provide a computational framework that combines molecular modeling with extensive free energy simulations. Our results show that the simulated binding affinities are in good agreement with currently available experimental data. Moreover, we predict that one double mutation (V135S and A138S) in HA significantly enhances alpha-2,6-linked receptor recognition by the H5 subtype. Our simulations indicate that this double mutation in H5N1 HA increases the binding affinity to alpha-2,6-linked sialic acid receptors by 2.6 +/- 0.7 kcal/mol per HA monomer that primarily arises from the electrostatic interactions. Further analyses reveal that introduction of this double mutation results in a conformational change in the receptor binding pocket of H5N1 HA. As a result, a major rearrangement occurs in the hydrogen-bonding network of HA with the human receptor, making the human receptor binding pattern of double mutant H5N1 HA surprisingly similar to that observed in human H1N1 HA. These large scale molecular simulations on single and double mutants thus provide new insights into our understanding toward human adaptation of the avian H5N1 virus. 2009 Wiley Periodicals, Inc.

  1. The roles of protein disulphide isomerase family A, member 3 (ERp57) and surface thiol/disulphide exchange in human spermatozoa-zona pellucida binding.

    PubMed

    Wong, Chi-Wai; Lam, Kevin K W; Lee, Cheuk-Lun; Yeung, William S B; Zhao, Wei E; Ho, Pak-Chung; Ou, Jian-Ping; Chiu, Philip C N

    2017-04-01

    Are multimeric sperm plasma membrane protein complexes, ERp57 and sperm surface thiol content involved in human spermatozoa-zona pellucida (ZP) interaction? ERp57 is a component of a multimeric spermatozoa-ZP receptor complex involved in regulation of human spermatozoa-ZP binding via up-regulation of sperm surface thiol content. A spermatozoon acquires its fertilization capacity within the female reproductive tract by capacitation. Spermatozoa-ZP receptor is suggested to be a composite structure that is assembled into a functional complex during capacitation. Sperm surface thiol content is elevated during capacitation. ERp57 is a protein disulphide isomerase that modulates the thiol-disulphide status of proteins. The binding ability and components of protein complexes in extracted membrane protein fractions of spermatozoa were studied. The roles of capacitation, thiol-disulphide reagent treatments and ERp57 on sperm functions and sperm surface thiol content were assessed. Spermatozoa were obtained from semen samples from normozoospermic men. Human oocytes were obtained from an assisted reproduction programme. Blue native polyacrylamide gel electrophoresis, western ligand blotting and mass spectrometry were used to identify the components of solubilized ZP/ZP3-binding complexes. The localization and expression of sperm surface thiol and ERp57 were studied by immunostaining and sperm surface protein biotinylation followed by western blotting. Sperm functions were assessed by standard assays. Several ZP-binding complexes were isolated from the cell membrane of capacitated spermatozoa. ERp57 was a component of one of these complexes. Capacitation significantly increased the sperm surface thiol content, acrosomal thiol distribution and ERp57 expression on sperm surface. Sperm surface thiol and ERp57 immunoreactivity were localized to the acrosomal region of spermatozoa, a region responsible for ZP-binding. Up-regulation of the surface thiol content or ERp57 surface expression in vitro stimulated ZP-binding capacity of human spermatozoa. Blocking of ERp57 function by specific antibody or inhibitors against ERp57 reduced the surface thiol content and ZP-binding capacity of human spermatozoa. N/A. The mechanisms by which up-regulation of surface thiol content stimulates spermatozoa-ZP binding have not been depicted. Thiol-disulphide exchange is a crucial event in capacitation. ERp57 modulates the event and the subsequent fertilization process. Modulation of the surface thiol content of the spermatozoa of subfertile men may help to increase fertilization rate in assisted reproduction. This work was supported by The Hong Kong Research Grant Council Grant HKU764611 and HKU764512M to P.C.N.C. The authors have no competing interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  2. A Role for Small Antibody Fragments to Bind and Neutralize HIV | Center for Cancer Research

    Cancer.gov

    The surface of the Human Immunodeficiency Virus (HIV) is studded with numerous copies of the glycoprotein Env. Each Env spike is composed of three copies of the proteins gp41, which sits in the viral membrane, and gp120, which rests on top of each gp41 molecule. Env is essential for HIV-mediated infection because the binding of gp120 to the T cell surface receptor CD4

  3. Binding of isolated plant lectin by rhizobia during episodes of reduced gravity obtained by parabolic flight

    NASA Technical Reports Server (NTRS)

    Henry, R. L.; Green, P. D.; Wong, P. P.; Guikema, J. A.; Spooner, B. S. (Principal Investigator)

    1990-01-01

    Development of a legume root nodule is a complex process culminating in a plant/bacterial symbiosis possessing the capacity for biological dinitrogen fixation. Formation of root nodules is initiated by the binding and stabilization of rhizobia to plant root hairs, mediated in part by a receptor/ligand recognition system composed of lectins on the plant root surface and lectin-binding sites on the rhizobial cell surface. The dinitrogen fixation activity of these root nodules may be an important feature of enclosed, space-based life support systems, and may provide an ecological method to recycle nitrogen for amino acid production. However, the effects on nodule development of varied gravitational fields, or of root nutrient delivery hardware, remain unknown. We have investigated the effects of microgravity on root nodule formation, with preliminary experiments focused upon the receptor/ligand component. Microgravity, obtained during parabolic flight aboard NASA 930, has no apparent effect on the binding of purified lectin to rhizobia, a result that will facilitate forthcoming experiments using intact root tissues.

  4. Disturbances of Ligand Potency and Enhanced Degradation of the Human Glycine Receptor at Affected Positions G160 and T162 Originally Identified in Patients Suffering from Hyperekplexia

    PubMed Central

    Atak, Sinem; Langlhofer, Georg; Schaefer, Natascha; Kessler, Denise; Meiselbach, Heike; Delto, Carolyn; Schindelin, Hermann; Villmann, Carmen

    2015-01-01

    Ligand-binding of Cys-loop receptors is determined by N-terminal extracellular loop structures from the plus as well as from the minus side of two adjacent subunits in the pentameric receptor complex. An aromatic residue in loop B of the glycine receptor (GlyR) undergoes direct interaction with the incoming ligand via a cation-π interaction. Recently, we showed that mutated residues in loop B identified from human patients suffering from hyperekplexia disturb ligand-binding. Here, we exchanged the affected human residues by amino acids found in related members of the Cys-loop receptor family to determine the effects of side chain volume for ion channel properties. GlyR variants were characterized in vitro following transfection into cell lines in order to analyze protein expression, trafficking, degradation and ion channel function. GlyR α1 G160 mutations significantly decrease glycine potency arguing for a positional effect on neighboring aromatic residues and consequently glycine-binding within the ligand-binding pocket. Disturbed glycinergic inhibition due to T162 α1 mutations is an additive effect of affected biogenesis and structural changes within the ligand-binding site. Protein trafficking from the ER toward the ER-Golgi intermediate compartment, the secretory Golgi pathways and finally the cell surface is largely diminished, but still sufficient to deliver ion channels that are functional at least at high glycine concentrations. The majority of T162 mutant protein accumulates in the ER and is delivered to ER-associated proteasomal degradation. Hence, G160 is an important determinant during glycine binding. In contrast, T162 affects primarily receptor biogenesis whereas exchanges in functionality are secondary effects thereof. PMID:26733802

  5. A camelid single-domain antibody neutralizes botulinum neurotoxin A by blocking host receptor binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Guorui; Lam, Kwok-ho; Weisemann, Jasmin

    Antibody treatment is currently the only available countermeasure for botulism, a fatal illness caused by flaccid paralysis of muscles due to botulinum neurotoxin (BoNT) intoxication. Among the seven major serotypes of BoNT/A-G, BoNT/A poses the most serious threat to humans because of its high potency and long duration of action. Prior to entering neurons and blocking neurotransmitter release, BoNT/A recognizes motoneurons via a dual-receptor binding process in which it engages both the neuron surface polysialoganglioside (PSG) and synaptic vesicle glycoprotein 2 (SV2). Previously, we identified a potent neutralizing antitoxin against BoNT/A1 termed ciA-C2, derived from a camelid heavy-chain-only antibody (VHH).more » In this study, we demonstrate that ciA-C2 prevents BoNT/A1 intoxication by inhibiting its binding to neuronal receptor SV2. Furthermore, we determined the crystal structure of ciA-C2 in complex with the receptor-binding domain of BoNT/A1 (HCA1) at 1.68 Å resolution. The structure revealed that ciA-C2 partially occupies the SV2-binding site on H CA1, causing direct interference of HCA1 interaction with both the N-glycan and peptide-moiety of SV2. Interestingly, this neutralization mechanism is similar to that of a monoclonal antibody in clinical trials, despite that ciA-C2 is more than 10-times smaller. Taken together, these results enlighten our understanding of BoNT/A1 interactions with its neuronal receptor, and further demonstrate that inhibiting toxin binding to the host receptor is an efficient countermeasure strategy.« less

  6. LDL receptor-related protein mediates cell-surface clustering and hepatic sequestration of chylomicron remnants in LDLR-deficient mice.

    PubMed

    Yu, K C; Chen, W; Cooper, A D

    2001-06-01

    It has been proposed that in the liver, chylomicron remnants (lipoproteins carrying dietary lipid) may be sequestered before being internalized by hepatocytes. To study this, chylomicron remnants labeled with a fluorescent dye were perfused into isolated livers of LDL receptor-deficient (LDLR-deficient) mice (Ldlr(-/-)) and examined by confocal microscopy. In contrast to livers from normal mice, there was clustering of the chylomicron remnants on the cell surface in the space of DISSE: These remnant clusters colocalized with clusters of LDLR-related protein (LRP) and could be eliminated by low concentrations of receptor-associated protein, an inhibitor of LRP. When competed with ligands of heparan sulfate proteoglycans (HSPGs), the remnant clusters still appeared but were fewer in number, although syndecans (membrane HSPGs) colocalized with the remnant clusters. This suggests that the clustering of remnants is not dependent on syndecans but that the syndecans may modify the binding of remnants. These results establish that sequestration is a novel process, the clustering of remnants in the space of DISSE: The clustering involves remnants binding to the LRP, and this may be stabilized by binding with syndecans, eventually followed by endocytosis.

  7. IL-4 function can be transferred to the IL-2 receptor by tyrosine containing sequences found in the IL-4 receptor alpha chain.

    PubMed

    Wang, H Y; Paul, W E; Keegan, A D

    1996-02-01

    IL-4 binds to a cell surface receptor complex that consists of the IL-4 binding protein (IL-4R alpha) and the gamma chain of the IL-2 receptor complex (gamma c). The receptors for IL-4 and IL-2 have several features in common; both use the gamma c as a receptor component, and both activate the Janus kinases JAK-1 and JAK-3. In spite of these similarities, IL-4 evokes specific responses, including the tyrosine phosphorylation of 4PS/IRS-2 and the induction of CD23. To determine whether sequences within the cytoplasmic domain of the IL-4R alpha specify these IL-4-specific responses, we transplanted the insulin IL-4 receptor motif (I4R motif) of the huIL-4R alpha to the cytoplasmic domain of a truncated IL-2R beta. In addition, we transplanted a region that contains peptide sequences shown to block Stat6 binding to DNA. We analyzed the ability of cells expressing these IL-2R-IL-4R chimeric constructs to respond to IL-2. We found that IL-4 function could be transplanted to the IL-2 receptor by these regions and that proliferative and differentiative functions can be induced by different receptor sequences.

  8. Density functional theory and conductivity studies of boron-based anion receptors

    DOE PAGES

    Leung, Kevin; Chaudhari, Mangesh I.; Rempe, Susan B.; ...

    2015-07-10

    Anion receptors that bind strongly to fluoride anions in organic solvents can help dissolve the lithium fluoride discharge products of primary carbon monofluoride (CFx) batteries, thereby preventing the clogging of cathode surfaces and improving ion conductivity. The receptors are also potentially beneficial to rechargeable lithium ion and lithium air batteries. We apply Density Functional Theory (DFT) to show that an oxalate-based pentafluorophenyl-boron anion receptor binds as strongly, or more strongly, to fluoride anions than many phenyl-boron anion receptors proposed in the literature. Experimental data shows marked improvement in electrolyte conductivity when this oxalate anion receptor is present. The receptor ismore » sufficiently electrophilic that organic solvent molecules compete with F – for boron-site binding, and specific solvent effects must be considered when predicting its F – affinity. To further illustrate the last point, we also perform computational studies on a geometrically constrained boron ester that exhibits much stronger gas-phase affinity for both F – and organic solvent molecules. After accounting for specific solvent effects, however, its net F – affinity is about the same as the simple oxalate-based anion receptor. Lastly, we propose that LiF dissolution in cyclic carbonate organic solvents, in the absence of anion receptors, is due mostly to the formation of ionic aggregates, not isolated F – ions.« less

  9. Kinetic and Thermodynamic Characterization of Dihydrotestosterone-Induced Conformational Perturbations in Androgen Receptor Ligand-Binding Domain

    PubMed Central

    Jasuja, Ravi; Ulloor, Jagadish; Yengo, Christopher M.; Choong, Karen; Istomin, Andrei Y.; Livesay, Dennis R.; Jacobs, Donald J.; Swerdloff, Ronald S.; Mikšovská, Jaroslava; Larsen, Randy W.; Bhasin, Shalender

    2009-01-01

    Ligand-induced conformational perturbations in androgen receptor (AR) are important in coactivator recruitment and transactivation. However, molecular rearrangements in AR ligand-binding domain (AR-LBD) associated with agonist binding and their kinetic and thermodynamic parameters are poorly understood. We used steady-state second-derivative absorption and emission spectroscopy, pressure and temperature perturbations, and 4,4′-bis-anilinonaphthalene 8-sulfonate (bis-ANS) partitioning to determine the kinetics and thermodynamics of the conformational changes in AR-LBD after dihydrotestosterone (DHT) binding. In presence of DHT, the second-derivative absorption spectrum showed a red shift and a change in peak-to-peak distance. Emission intensity increased upon DHT binding, and center of spectral mass was blue shifted, denoting conformational changes resulting in more hydrophobic environment for tyrosines and tryptophans within a more compact DHT-bound receptor. In pressure perturbation calorimetry, DHT-induced energetic stabilization increased the Gibbs free energy of unfolding to 8.4 ± 1.3 kcal/mol from 3.5 ± 1.6 kcal/mol. Bis-ANS partitioning studies revealed that upon DHT binding, AR-LBD underwent biphasic rearrangement with a high activation energy (13.4 kcal/mol). An initial, molten globule-like burst phase (k ∼30 sec−1) with greater solvent accessibility was followed by rearrangement (k ∼0.01 sec−1), leading to a more compact conformation than apo-AR-LBD. Molecular simulations demonstrated unique sensitivity of tyrosine and tryptophan residues during pressure unfolding with rearrangement of residues in the coactivator recruitment surfaces distant from the ligand-binding pocket. In conclusion, DHT binding leads to energetic stabilization of AR-LBD domain and substantial rearrangement of residues distant from the ligand-binding pocket. DHT binding to AR-LBD involves biphasic receptor rearrangement including population of a molten globule-like intermediate state. PMID:19443608

  10. Comparison of Nerve Growth Factor Receptor Binding Models Using Heterodimeric Muteins

    PubMed Central

    Mehta, Hrishikesh M.; Woo, Sang B.; Neet, Kenneth E.

    2013-01-01

    Nerve growth factor (NGF) is a homodimer that binds to two distinct receptor types, TrkA and p75, to support survival and differentiation of neurons. The high-affinity binding on the cell surface is believed to involve a heteroreceptor complex, but its exact nature is unclear. We developed a heterodimer (heteromutein) of two NGF muteins that can bind p75 and TrkA on opposite sides of the heterodimer, but not two TrkA receptors. Previously described muteins are Δ9/13 that is TrkA negative and 7-84-103 that is signal selective through TrkA. The heteromutein (Htm1) was used to study the heteroreceptor complex formation and function, in the putative absence of NGF-induced TrkA dimerization. Cellular binding assays indicated that Htm1 does not bind TrkA as efficiently as wild-type (wt) NGF but has better affinity than either homodimeric mutein. Htm1, 7-84-103, and Δ9/13 were each able to compete for cold-temperature, cold-chase stable binding on PC12 cells, indicating that binding to p75 was required for a portion of this high-affinity binding. Survival, neurite outgrowth, and MAPK signaling in PC12 cells also showed a reduced response for Htm1, compared with wtNGF, but was better than the parent muteins in the order wtNGF > Htm1 > 7-84-103 >> Δ9/13. Htm1 and 7-84-103 demonstrated similar levels of survival on cells expressing only TrkA. In the longstanding debate on the NGF receptor binding mechanism, our data support the ligand passing of NGF from p75 to TrkA involving a transient heteroreceptor complex of p75-NGF-TrkA. PMID:22903500

  11. Multiparameter flow cytometry of a pH sensitive ligand bound to receptors and inside cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fay, S.P.; Habbersett, R.; Posner, R.G.

    1993-01-01

    Because fluoresceinated ligands of the neutrophil formyl peptide receptor can be protonated either upon binding to the receptor on the cell surface or in acidified intracellular compartments, the authors synthesized a ligand conjugated to the pH sensitive fluorescent probe SNAFL (CHO-Met-Leu-Phe-Phe-Lys-SNAFL). In the three laser flow cytometer at LANL, protonated dye is excited at 488 nm and emits at 530 nm; unprotonated dye is excited at 568 nm and emits at 650 nm. Detection at the isobestic and isoemissive points at 528 and 600 nm is used to keep track of variations in ligand concentration from sample to sample. Themore » SNAFL-ligand bound to HL-60 cells (which overexpress the formyl peptide receptor) was compared to the free ligand in solution over a pH range from 6.5 to 9.0. The results suggest that the ligand bound to cell surface receptors was protonated in the binding pocket, possibly by virtue of its proximity to His 90, based on sequence data. When the cells were raised from 4[degrees] to 37[degrees], they also observed a time-dependent acidification of the ligand, indicative of ligand-receptor processing beginning 3-4 minutes after internalization.« less

  12. Regulation of N-formyl peptide-mediated degranulation by receptor phosphorylation.

    PubMed

    Vines, Charlotte M; Xue, Mei; Maestas, Diane C; Cimino, Daniel F; Prossnitz, Eric R

    2002-12-15

    One of the major functions of the N-formyl peptide receptor (FPR) is to mediate leukocyte degranulation. Phosphorylation of the C-terminal domain of the FPR is required for receptor internalization and desensitization. Although arrestins mediate phosphorylation-dependent desensitization, internalization, and initiation of novel signaling cascades for a number of G protein-coupled receptors, their roles in FPR regulation and signaling remain unclear. CXCR1-mediated degranulation of RBL-2H3 cells is promoted by arrestin binding. To determine whether receptor phosphorylation or arrestin binding is required to promote FPR-mediated degranulation, we used RBL-2H3 cells stably transfected with either the wild-type FPR or a mutant form, DeltaST, which is incapable of undergoing ligand-stimulated phosphorylation. We observed that stimulation of wild-type FPR resulted in very low levels of degranulation compared with that mediated by cross-linking of the Fc(epsilon)RI receptor. Stimulation of the DeltaST mutant, however, resulted in levels of degranulation comparable to those of the Fc(epsilon)RI receptor, demonstrating that neither receptor phosphorylation nor arrestin binding was necessary to initiate FPR-mediated degranulation. Degranulation initiated by the DeltaST mutant was proportional to the level of active cell surface receptor, suggesting that either receptor internalization or desensitization may be responsible for terminating degranulation of the wild-type FPR. To distinguish between these possibilities, we used a partially phosphorylation-deficient mutant of the FPR that can undergo internalization, but not desensitization. Degranulation by this mutant FPR was indistinguishable from that of the DeltaST mutant, indicating that FPR phosphorylation or binding of arrestin but not internalization terminates the degranulation response.

  13. Binding of alpha-fetoprotein by immobilized monoclonal antibodies during episodes of zero-gravity obtained by parabolic flight

    NASA Technical Reports Server (NTRS)

    Spooner, Brian S.; Guikema, James A.; Barnes, Grady

    1990-01-01

    Alpha-fetoprotein (AFP), a single-chain polypeptide which is synthesized by the liver and yolk sac of the human fetus, provided a model ligand for assessing the effects of microgravity on ligand binding to surface-immobilized model receptor molecules. Monoclonal antibodies, used as receptors for AFP, were immobilized by covalent attachment to latex microparticles. Zero gravity environment was obtained by parabolic flight aboard NASA 930, a modified KC-135 aircraft. Buring the onset of an episode of zero gravity, ligand and receptor were mixed. Timed incubation (20 s) was terminated by centrifugation, the supernatant removed, and microparticies were assessed for bound AFP by immunochemical methods. The extent of binding was not influenced by microgravity, when compared with 1-G controls, which suggests that aberrant cellular activities observed in microgravity are not the simple expression of altered macromolecular interactions.

  14. Lipopolysaccharides in liver injury: molecular mechanisms of Kupffer cell activation.

    PubMed

    Su, Grace L

    2002-08-01

    Endogenous gut-derived bacterial lipopolysaccharides have been implicated as important cofactors in the pathogenesis of liver injury. However, the molecular mechanisms by which lipopolysaccharides exert their effect are not entirely clear. Recent studies have pointed to proinflammatory cytokines such as tumor necrosis factor-alpha as mediators of hepatocyte injury. Within the liver, Kupffer cells are major sources of proinflammatory cytokines that are produced in response to lipopolysaccharides. This review will focus on three important molecular components of the pathway by which lipopolysaccharides activate Kupffer cells: CD14, Toll-like receptor 4, and lipopolysaccharide binding protein. Within the liver, lipopolysaccharides bind to lipopolysaccharide binding protein, which then facilitates its transfer to membrane CD14 on the surface of Kupffer cells. Signaling of lipopolysaccharide through CD14 is mediated by the downstream receptor Toll-like receptor 4 and results in activation of Kupffer cells. The role played by these molecules in liver injury will be examined.

  15. Identification of Cell Surface Molecules Involved in Dystroglycan-Independent Lassa Virus Cell Entry

    PubMed Central

    Ströher, Ute; Ebihara, Hideki; Feldmann, Heinz

    2012-01-01

    Although O-mannosylated dystroglycan is a receptor for Lassa virus, a causative agent of Lassa fever, recent findings suggest the existence of an alternative receptor(s). Here we identified four molecules as receptors for Lassa virus: Axl and Tyro3, from the TAM family, and dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN) and liver and lymph node sinusoidal endothelial calcium-dependent lectin (LSECtin), from the C-type lectin family. These molecules enhanced the binding of Lassa virus to cells and mediated infection independently of dystroglycan. Axl- or Tyro3-mediated infection required intracellular signaling via the tyrosine kinase activity of Axl or Tyro3, whereas DC-SIGN- or LSECtin-mediated infection and binding were dependent on a specific carbohydrate and on ions. The identification of these four molecules as Lassa virus receptors advances our understanding of Lassa virus cell entry. PMID:22156524

  16. Visualization of ligand-induced transmembrane signaling in the full-length human insulin receptor

    PubMed Central

    2018-01-01

    Insulin receptor (IR) signaling plays a critical role in the regulation of metabolism and growth in multicellular organisms. IRs are unique among receptor tyrosine kinases in that they exist exclusively as covalent (αβ)2 homodimers at the cell surface. Transmembrane signaling by the IR can therefore not be based on ligand-induced dimerization as such but must involve structural changes within the existing receptor dimer. In this study, using glycosylated full-length human IR reconstituted into lipid nanodiscs, we show by single-particle electron microscopy that insulin binding to the dimeric receptor converts its ectodomain from an inverted U-shaped conformation to a T-shaped conformation. This structural rearrangement of the ectodomain propagates to the transmembrane domains, which are well separated in the inactive conformation but come close together upon insulin binding, facilitating autophosphorylation of the cytoplasmic kinase domains. PMID:29453311

  17. GW domains of the Listeria monocytogenes invasion protein InlB are SH3-like and mediate binding to host ligands

    PubMed Central

    Marino, Michael; Banerjee, Manidipa; Jonquières, Renaud; Cossart, Pascale; Ghosh, Partho

    2002-01-01

    InlB, a surface-localized protein of Listeria monocytogenes, induces phagocytosis in non-phagocytic mammalian cells by activating Met, a receptor tyrosine kinase. InlB also binds glycosaminoglycans and the protein gC1q-R, two additional host ligands implicated in invasion. We present the structure of InlB, revealing a highly elongated molecule with leucine-rich repeats that bind Met at one end, and GW domains that dissociably bind the bacterial surface at the other. Surprisingly, the GW domains are seen to resemble SH3 domains. Despite this, GW domains are unlikely to act as functional mimics of SH3 domains since their potential proline-binding sites are blocked or destroyed. However, we do show that the GW domains, in addition to binding glycosaminoglycans, bind gC1q-R specifically, and that this binding requires release of InlB from the bacterial surface. Dissociable attachment to the bacterial surface via the GW domains may be responsible for restricting Met activation to a small, localized area of the host cell and for coupling InlB-induced host membrane dynamics with bacterial proximity during invasion. PMID:12411480

  18. Structure and Dynamics of the Liver Receptor Homolog 1-PGC1α Complex.

    PubMed

    Mays, Suzanne G; Okafor, C Denise; Tuntland, Micheal L; Whitby, Richard J; Dharmarajan, Venkatasubramanian; Stec, Józef; Griffin, Patrick R; Ortlund, Eric A

    2017-07-01

    Peroxisome proliferator-activated gamma coactivator 1- α (PGC1 α ) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1 α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1 α is known to bind and activate LRH-1, mechanisms through which PGC1 α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1-PGC1 α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1 α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), in coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1-PGC1 α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1 α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1 α but promoted allosteric signaling from the helix 6/ β -sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1-PGC1 α interaction and may illuminate strategies for selective therapeutic targeting of PGC1 α -dependent LRH-1 signaling pathways. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  19. Mutagenesis of Paramyxovirus Hemagglutinin-Neuraminidase Membrane-Proximal Stalk Region Influences Stability, Receptor Binding, and Neuraminidase Activity.

    PubMed

    Adu-Gyamfi, Emmanuel; Kim, Lori S; Jardetzky, Theodore S; Lamb, Robert A

    2016-09-01

    Paramyxoviridae consist of a large family of enveloped, negative-sense, nonsegmented single-stranded RNA viruses that account for a significant number of human and animal diseases. The fusion process for nearly all paramyxoviruses involves the mixing of the host cell plasma membrane and the virus envelope in a pH-independent fashion. Fusion is orchestrated via the concerted action of two surface glycoproteins: an attachment protein called hemagglutinin-neuraminidase (HN [also called H or G depending on virus type and substrate]), which acts as a receptor binding protein, and a fusion (F) protein, which undergoes a major irreversible refolding process to merge the two membranes. Recent biochemical evidence suggests that receptor binding by HN is dispensable for cell-cell fusion. However, factors that influence the stability and/or conformation of the HN 4-helix bundle (4HB) stalk have not been studied. Here, we used oxidative cross-linking as well as functional assays to investigate the role of the structurally unresolved membrane-proximal stalk region (MPSR) (residues 37 to 58) of HN in the context of headless and full-length HN membrane fusion promotion. Our data suggest that the receptor binding head serves to stabilize the stalk to regulate fusion. Moreover, we found that the MPSR of HN modulates receptor binding and neuraminidase activity without a corresponding regulation of F triggering. Paramyxoviruses require two viral membrane glycoproteins, the attachment protein variously called HN, H, or G and the fusion protein (F), to couple host receptor recognition to virus-cell fusion. The HN protein has a globular head that is attached to a membrane-anchored flexible stalk of ∼80 residues and has three activities: receptor binding, neuraminidase, and fusion activation. In this report, we have identified the functional significance of the membrane-proximal stalk region (MPSR) (HN, residues 37 to 56) of the paramyxovirus parainfluenza virus (PIV5), a region of the HN stalk that has not had its structure determined by X-ray crystallography. Our data suggest that the MPSR influences receptor binding and neuraminidase activity via an indirect mechanism. Moreover, the receptor binding head group stabilizes the 4HB stalk as part of the general mechanism to fine-tune F-activation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Structure-Guided Design of a High-Affinity Platelet Integrin αIIbβ3 Receptor Antagonist That Disrupts Mg2+ Binding to the MIDAS | Center for Cancer Research

    Cancer.gov

    A Better Fit. An improved anticoagulant drug called RUC-2 (ball and stick structure) fits snugly into its binding pocket on integrin (blue), a protein found on the surface of platelets. RUC-2 binds both subunits of integrin, inhibiting the excessive blood coagulation that can lead to strokes and heart attacks. Unlike similar drugs that alter integrin's structure when they bind

  1. Thermodynamics of T cell receptor – peptide/MHC interactions: progress and opportunities

    PubMed Central

    Armstrong, Kathryn M.; Insaidoo, Francis K.; Baker, Brian M.

    2013-01-01

    αβ T cell receptors (TCR) recognize peptide antigens presented by class I or class II major histocompatibility complex molecules (pMHC). Here we review the use of thermodynamic measurements in the study of TCR-pMHC interactions, with attention to the diversity in binding thermodynamics and how this is related to the variation in TCR-pMHC interfaces. We show that there is no enthalpic or entropic signature for TCR binding; rather, enthalpy and entropy changes vary in a compensatory manner that reflects a narrow free energy window for the interactions that have been characterized. Binding enthalpy and entropy changes do not correlate with structural features such as buried surface area or the number of hydrogen bonds within TCR-pMHC interfaces, possibly reflecting the myriad of contributors to binding thermodynamics, but likely also reflecting a reliance on van’t Hoff over calorimetric measurements and the unaccounted influence of equilibria linked to binding. TCR-pMHC binding heat capacity changes likewise vary considerably. In some cases the heat capacity changes are consistent with conformational differences between bound and free receptors, but there is little data indicating these conformational differences represent the need to organize commonly disordered CDR loops. In this regard, we discuss how thermodynamics may provide additional insight into conformational changes occurring upon TCR binding. Finally, we highlight opportunities for the further use of thermodynamic measurements in the study of TCR-pMHC interactions, not only for understanding TCR binding in general, but for understanding specifics of individual interactions and the engineering of T cell receptors with desired molecular recognition properties. PMID:18496839

  2. Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

    DTIC Science & Technology

    2002-01-01

    the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

  3. Mapping of monoclonal antibody- and receptor-binding domains on human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) using a surface plasmon resonance-based biosensor.

    PubMed

    Laricchia-Robbio, L; Liedberg, B; Platou-Vikinge, T; Rovero, P; Beffy, P; Revoltella, R P

    1996-10-01

    An automated surface plasmon resonance (SPR)-based biosensor system has been used for mapping antibody and receptor-binding regions on the recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) molecule. A rabbit antimouse IgG1-Fc antibody (RAM.Fc) was coupled to an extended carboxymethylated-hydrogel matrix attached to a gold surface in order to capture an anti-rhGM-CSF monoclonal antibody (MAb) injected over the sensing layer. rhGM-CSF was subsequently injected and allowed to bind to this antibody. Multisite binding assays were then performed, by flowing sequentially other antibodies and peptides over the surface, and the capacity of the latter to interact with the entrapped rhGM-CSF in a multimolecular complex was monitored in real time with SPR. Eleven MAb (all IgG1K), were analyzed: respectively, four antipeptide MAb raised against three distinct epitopes of the cytokine (two clones against residues 14-24, that includes part of the first alpha-helix toward the N-terminal region; one clone against peptide 30-41, an intrahelical loop; and one clone against residues 79-91, including part of the third alpha-helix) and seven antiprotein MAbs raised against the entire rhGM-CSF, whose target native epitopes are still undetermined. In addition, the binding capacity to rhGM-CSF of a synthetic peptide, corresponding to residues 238-254 of the extracellular human GM-CSF receptor alpha-chain, endowed with rhGM-CSF binding activity, was tested. The results from experiments performed with the biosensor were compared with those obtained by a sandwich enzyme-linked immunosorbent assay (ELISA), using the same reagents. The features of the biosensor technology (fully automated, measure in real time, sharpened yes/no response, less background disturbances, no need for washing step or labeling of the reagent) offered several advantages in these studies of MAb immunoreactivity and epitope mapping, giving a much better resolution and enabling more distinct epitopes to be identified over ELISA.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    VanderLinden, Ryan T.; Hemmis, Casey W.; Yao, Tingting

    This work presents that the 26S proteasome is a large cellular assembly that mediates the selective degradation of proteins in the nucleus and cytosol and is an established target for anticancer therapeutics. Protein substrates are typically targeted to the proteasome through modification with a polyubiquitin chain, which can be recognized by several proteasome-associated ubiquitin receptors. One of these receptors, RPN13/ADRM1, is recruited to the proteasome through direct interaction with the large scaffolding protein RPN2 within the 19S regulatory particle. To better understand the interactions between RPN13, RPN2, and ubiquitin, we used human proteins to map the RPN13-binding epitope to themore » C-terminal 14 residues of RPN2, which, like ubiquitin, binds the N-terminal pleckstrin-like receptor of ubiquitin (PRU) domain of RPN13. We also report the crystal structures of the RPN13 PRU domain in complex with peptides corresponding to the RPN2 C terminus and ubiquitin. Through mutational analysis, we validated the RPN2-binding interface revealed by our structures and quantified binding interactions with surface plasmon resonance and fluorescence polarization. In contrast to a previous report, we find that RPN13 binds ubiquitin with an affinity similar to that of other proteasome-associated ubiquitin receptors and that RPN2, ubiquitin, and the deubiquitylase UCH37 bind to RPN13 with independent energetics. In conclusion, these findings provide a detailed characterization of interactions that are important for proteasome function, indicate ubiquitin affinities that are consistent with the role of RPN13 as a proteasomal ubiquitin receptor, and have major implications for the development of novel anticancer therapeutics.« less

  5. Structural Basis of Chemokine Sequestration by CrmD, a Poxvirus-Encoded Tumor Necrosis Factor Receptor

    PubMed Central

    Wang, Dongli; Chen, Dongwei; He, Guangjun; Huang, Li; Wang, Hanzhong; Wang, Xinquan

    2011-01-01

    Pathogens have evolved sophisticated mechanisms to evade detection and destruction by the host immune system. Large DNA viruses encode homologues of chemokines and their receptors, as well as chemokine-binding proteins (CKBPs) to modulate the chemokine network in host response. The SECRET domain (smallpox virus-encoded chemokine receptor) represents a new family of viral CKBPs that binds a subset of chemokines from different classes to inhibit their activities, either independently or fused with viral tumor necrosis factor receptors (vTNFRs). Here we present the crystal structures of the SECRET domain of vTNFR CrmD encoded by ectromelia virus and its complex with chemokine CX3CL1. The SECRET domain adopts a β-sandwich fold and utilizes its β-sheet I surface to interact with CX3CL1, representing a new chemokine-binding manner of viral CKBPs. Structure-based mutagenesis and biochemical analysis identified important basic residues in the 40s loop of CX3CL1 for the interaction. Mutation of corresponding acidic residues in the SECRET domain also affected the binding for other chemokines, indicating that the SECRET domain binds different chemokines in a similar manner. We further showed that heparin inhibited the binding of CX3CL1 by the SECRET domain and the SECRET domain inhibited RAW264.7 cell migration induced by CX3CL1. These results together shed light on the structural basis for the SECRET domain to inhibit chemokine activities by interfering with both chemokine-GAG and chemokine-receptor interactions. PMID:21829356

  6. Cellular level models as tools for cytokine design.

    PubMed

    Radhakrishnan, Mala L; Tidor, Bruce

    2010-01-01

    Cytokines and growth factors are critical regulators that connect intracellular and extracellular environments through binding to specific cell-surface receptors. They regulate a wide variety of immunological, growth, and inflammatory response processes. The overall signal initiated by a population of cytokine molecules over long time periods is controlled by the subtle interplay of binding, signaling, and trafficking kinetics. Building on the work of others, we abstract a simple kinetic model that captures relevant features from cytokine systems as well as related growth factor systems. We explore a large range of potential biochemical behaviors, through systematic examination of the model's parameter space. Different rates for the same reaction topology lead to a dramatic range of biochemical network properties and outcomes. Evolution might productively explore varied and different portions of parameter space to create beneficial behaviors, and effective human therapeutic intervention might be achieved through altering network kinetic properties. Quantitative analysis of the results reveals the basis for tensions among a number of different network characteristics. For example, strong binding of cytokine to receptor can increase short-term receptor activation and signal initiation but decrease long-term signaling due to internalization and degradation. Further analysis reveals the role of specific biochemical processes in modulating such tensions. For instance, the kinetics of cytokine binding and receptor activation modulate whether ligand-receptor dissociation can generally occur before signal initiation or receptor internalization. Beyond analysis, the same models and model behaviors provide an important basis for the design of more potent cytokine therapeutics by providing insight into how binding kinetics affect ligand potency. (c) 2010 American Institute of Chemical Engineers

  7. Development of a Novel Human scFv Against EGFR L2 Domain by Phage Display Technology.

    PubMed

    Rahbarnia, Leila; Farajnia, Safar; Babaei, Hossein; Majidi, Jafar; Veisi, Kamal; Khosroshahi, Shiva Ahdi; Tanomand, Asghar

    2017-01-01

    Epidermal growth factor receptor (EGFR) as a transmembrane tyrosine kinase receptor frequently overexpresses in tumors with epithelial origin. The L2 domain from extracellular part of EGFR is involved in ligand binding and the blockage of this domain prevents activation of related signaling pathways. This study was aimed to develop a novel human scFv against EGFR L2 domain as a promising target for cancer therapy. The L2 recombinant protein was purified and used for panning a human scFv phage library (Tomlinson I). In this study, a novel screening strategy was applied to select clones with high binding and enrichment of rare specific phage clones of the L2 protein. After five biopanning rounds several specific clones were isolated which among them one phage clone with high binding was purified for further analysis. The specific interaction of selected clone against target antigen was confirmed by ELISA and western blotting. Immunofluorescence staining showed that purified scFv binds to A431 cells surface, displaying EGFR surface receptor. In the present study, we isolated for the first time a novel human scFv against EGFR L2 domain. This study can be the groundwork for developing more effective diagnostic and therapeutic agents against EGFR overexpressing cancers using this novel human anti-L2 ScFv. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. Clostridium perfringens Iota Toxin: Binding Studies and Characterization of Cell Surface Receptor by Fluorescence-Activated Cytometry

    PubMed Central

    Stiles, Bradley G.; Hale, Martha L.; Marvaud, Jean-Christophe; Popoff, Michel R.

    2000-01-01

    The binding characteristics of iota toxin, a binary enterotoxin produced by Clostridium perfringens type E, were studied by fluorescence-activated cytometry. The proteolytically activated binding component of iota toxin, iota b (Ib), bound to various cell types when incubated at 4, 25, or 37°C for 10 min. The binding of Ib was inhibited by antisera against C. perfringens type E or Clostridium spiroforme culture supernatants, but not C. perfringens types C or D. Pretreatment of Vero cells with glycosidases or lectins did not affect Ib interactions, while pronase effectively prevented Ib binding to the cell surface. The Ib protomer (Ibp) bound to the cell surface, but trypsinization of Ibp was necessary for docking of the ADP-ribosylating component, iota a (Ia). Ia attached to cell-bound Ib within 10 min at 37°C, but surface levels of Ia decreased 90% after 30 min and were undetectable by 60 min. Detectable surface levels of Ib also diminished over time, and Western blot analysis suggested internalization or embedment of Ib into the membrane. PMID:10816501

  9. Clostridium perfringens iota toxin: binding studies and characterization of cell surface receptor by fluorescence-activated cytometry.

    PubMed

    Stiles, B G; Hale, M L; Marvaud, J C; Popoff, M R

    2000-06-01

    The binding characteristics of iota toxin, a binary enterotoxin produced by Clostridium perfringens type E, were studied by fluorescence-activated cytometry. The proteolytically activated binding component of iota toxin, iota b (Ib), bound to various cell types when incubated at 4, 25, or 37 degrees C for 10 min. The binding of Ib was inhibited by antisera against C. perfringens type E or Clostridium spiroforme culture supernatants, but not C. perfringens types C or D. Pretreatment of Vero cells with glycosidases or lectins did not affect Ib interactions, while pronase effectively prevented Ib binding to the cell surface. The Ib protomer (Ibp) bound to the cell surface, but trypsinization of Ibp was necessary for docking of the ADP-ribosylating component, iota a (Ia). Ia attached to cell-bound Ib within 10 min at 37 degrees C, but surface levels of Ia decreased 90% after 30 min and were undetectable by 60 min. Detectable surface levels of Ib also diminished over time, and Western blot analysis suggested internalization or embedment of Ib into the membrane.

  10. Dual chain synthetic heparin-binding growth factor analogs

    DOEpatents

    Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY

    2012-04-24

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  11. Dual chain synthetic heparin-binding growth factor analogs

    DOEpatents

    Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY

    2009-10-06

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  12. Identification and quantification of the rat hepatocyte asialoglycoprotein receptor.

    PubMed Central

    Schwartz, A L; Marshak-Rothstein, A; Rup, D; Lodish, H F

    1981-01-01

    The asialoglycoprotein receptor from rat liver was purified by solubilization and affinity chromatography on asialoorosomucoid-Sepharose. The preparation yielded four distinct polypeptides of Mr 40,000-120,000. We prepared a monoclonal antibody that both immunoprecipitates solubilized receptor activity and blocks the binding of galactose-terminal glycoproteins to immobilized receptor. The monoclonal antibody and a rabbit antireceptor antiserum immunoprecipitated all four polypeptide species. Peptide analysis by two-dimensional chromatography of the individual 125I-labeled species showed nearly identical patterns, which also suggested that the four polypeptides have a similar primary structure. To identify and quantitate the asialoglycoprotein receptor on the hepatocyte cell surface, intact cells were iodinated with lactoperoxidase, and the solubilized membranes were treated with antireceptor antibody. The Mr 55,000 and Mr 65,000 species were the major species found. Our results suggest that the Mr of the surface receptor is at least 55,000 and that it comprises between 1-2% of the iodinated hepatocyte surface protein. Images PMID:6267585

  13. Physical Biology in Cancer. 3. The role of cell glycocalyx in vascular transport of circulating tumor cells

    PubMed Central

    Mitchell, Michael J.

    2013-01-01

    Circulating tumor cells (CTCs) in blood are known to adhere to the luminal surface of the microvasculature via receptor-mediated adhesion, which contributes to the spread of cancer metastasis to anatomically distant organs. Such interactions between ligands on CTCs and endothelial cell-bound surface receptors are sensitive to receptor-ligand distances at the nanoscale. The sugar-rich coating expressed on the surface of CTCs and endothelial cells, known as the glycocalyx, serves as a physical structure that can control the spacing and, thus, the availability of such receptor-ligand interactions. The cancer cell glycocalyx can also regulate the ability of therapeutic ligands to bind to CTCs in the bloodstream. Here, we review the role of cell glycocalyx on the adhesion and therapeutic treatment of CTCs in the bloodstream. PMID:24133067

  14. A pH-sensitive heparin-binding sequence from Baculovirus gp64 protein is important for binding to mammalian cells but not to Sf9 insect cells.

    PubMed

    Wu, Chunxiao; Wang, Shu

    2012-01-01

    Binding to heparan sulfate is essential for baculovirus transduction of mammalian cells. Our previous study shows that gp64, the major glycoprotein on the virus surface, binds to heparin in a pH-dependent way, with a stronger binding at pH 6.2 than at 7.4. Using fluorescently labeled peptides, we mapped the pH-dependent heparin-binding sequence of gp64 to a 22-amino-acid region between residues 271 and 292. Binding of this region to the cell surface was also pH dependent, and peptides containing this sequence could efficiently inhibit baculovirus transduction of mammalian cells at pH 6.2. When the heparin-binding peptide was immobilized onto the bead surface to mimic the high local concentration of gp64 on the virus surface, the peptide-coated magnetic beads could efficiently pull down cells expressing heparan sulfate but not cells pretreated with heparinase or cells not expressing heparan sulfate. Interestingly, although this heparin-binding function is essential for baculovirus transduction of mammalian cells, it is dispensable for infection of Sf9 insect cells. Virus infectivity on Sf9 cells was not reduced by the presence of heparin or the identified heparin-binding peptide, even though the peptide could bind to Sf9 cell surface and be efficiently internalized. Thus, our data suggest that, depending on the availability of the target molecules on the cell surface, baculoviruses can use two different methods, electrostatic interaction with heparan sulfate and more specific receptor binding, for cell attachment.

  15. The Hinge Region as a Key Regulatory Element of Androgen Receptor Dimerization, DNA Binding and Transactivation

    DTIC Science & Technology

    2006-05-01

    Mutations in the human androgen receptor gene as a learning tool for molecular endocrinology’ III. Poster presentations at international meetings...nonconsensus half-site, the cognate half-complex buries slightly more surface area from solvent (1,230 Å2) than the noncognate one (960 Å2). AR Mutations ...energetic penalty in- Fig. 4. (A) The AR DBD dimer interface. The molecular surfaces of the AR subunits are shown in red and blue. Dashed black lines

  16. Mutations in type 3 reovirus that determine binding to sialic acid are contained in the fibrous tail domain of viral attachment protein sigma1.

    PubMed

    Chappell, J D; Gunn, V L; Wetzel, J D; Baer, G S; Dermody, T S

    1997-03-01

    The reovirus attachment protein, sigma1, determines numerous aspects of reovirus-induced disease, including viral virulence, pathways of spread, and tropism for certain types of cells in the central nervous system. The sigma1 protein projects from the virion surface and consists of two distinct morphologic domains, a virion-distal globular domain known as the head and an elongated fibrous domain, termed the tail, which is anchored into the virion capsid. To better understand structure-function relationships of sigma1 protein, we conducted experiments to identify sequences in sigma1 important for viral binding to sialic acid, a component of the receptor for type 3 reovirus. Three serotype 3 reovirus strains incapable of binding sialylated receptors were adapted to growth in murine erythroleukemia (MEL) cells, in which sialic acid is essential for reovirus infectivity. MEL-adapted (MA) mutant viruses isolated by serial passage in MEL cells acquired the capacity to bind sialic acid-containing receptors and demonstrated a dependence on sialic acid for infection of MEL cells. Analysis of reassortant viruses isolated from crosses of an MA mutant virus and a reovirus strain that does not bind sialic acid indicated that the sigma1 protein is solely responsible for efficient growth of MA mutant viruses in MEL cells. The deduced sigma1 amino acid sequences of the MA mutant viruses revealed that each strain contains a substitution within a short region of sequence in the sigma1 tail predicted to form beta-sheet. These studies identify specific sequences that determine the capacity of reovirus to bind sialylated receptors and suggest a location for a sialic acid-binding domain. Furthermore, the results support a model in which type 3 sigma1 protein contains discrete receptor binding domains, one in the head and another in the tail that binds sialic acid.

  17. Protein Surface Mimetics: Understanding How Ruthenium Tris(Bipyridines) Interact with Proteins.

    PubMed

    Hewitt, Sarah H; Filby, Maria H; Hayes, Ed; Kuhn, Lars T; Kalverda, Arnout P; Webb, Michael E; Wilson, Andrew J

    2017-01-17

    Protein surface mimetics achieve high-affinity binding by exploiting a scaffold to project binding groups over a large area of solvent-exposed protein surface to make multiple cooperative noncovalent interactions. Such recognition is a prerequisite for competitive/orthosteric inhibition of protein-protein interactions (PPIs). This paper describes biophysical and structural studies on ruthenium(II) tris(bipyridine) surface mimetics that recognize cytochrome (cyt) c and inhibit the cyt c/cyt c peroxidase (CCP) PPI. Binding is electrostatically driven, with enhanced affinity achieved through enthalpic contributions thought to arise from the ability of the surface mimetics to make a greater number of noncovalent interactions than CCP with surface-exposed basic residues on cyt c. High-field natural abundance 1 H, 15 N HSQC NMR experiments are consistent with surface mimetics binding to cyt c in similar manner to CCP. This provides a framework for understanding recognition of proteins by supramolecular receptors and informing the design of ligands superior to the protein partners upon which they are inspired. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Adaptation of avian influenza A (H6N1) virus from avian to human receptor-binding preference

    PubMed Central

    Wang, Fei; Qi, Jianxun; Bi, Yuhai; Zhang, Wei; Wang, Min; Zhang, Baorong; Wang, Ming; Liu, Jinhua; Yan, Jinghua; Shi, Yi; Gao, George F

    2015-01-01

    The receptor-binding specificity of influenza A viruses is a major determinant for the host tropism of the virus, which enables interspecies transmission. In 2013, the first human case of infection with avian influenza A (H6N1) virus was reported in Taiwan. To gather evidence concerning the epidemic potential of H6 subtype viruses, we performed comprehensive analysis of receptor-binding properties of Taiwan-isolated H6 HAs from 1972 to 2013. We propose that the receptor-binding properties of Taiwan-isolated H6 HAs have undergone three major stages: initially avian receptor-binding preference, secondarily obtaining human receptor-binding capacity, and recently human receptor-binding preference, which has been confirmed by receptor-binding assessment of three representative virus isolates. Mutagenesis work revealed that E190V and G228S substitutions are important to acquire the human receptor-binding capacity, and the P186L substitution could reduce the binding to avian receptor. Further structural analysis revealed how the P186L substitution in the receptor-binding site of HA determines the receptor-binding preference change. We conclude that the human-infecting H6N1 evolved into a human receptor preference. PMID:25940072

  19. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  20. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  1. Measurement of Bluetongue Virus Binding to a Mammalian Cell Surface Receptor by an In Situ Immune Fluorescent Staining Technique

    USDA-ARS?s Scientific Manuscript database

    A quantifiable in situ immune fluorescent assay (IFA) was developed to measure bluetongue virus (BTV) binding to mammalian cells. The utility of the assay was demonstrated with both Chinese hamster ovary (CHO) and bovine pulmonary artery endothelial (CPAE) cells. Since heparin sulfate (HS) has been ...

  2. Angiogenesis Inhibitors

    MedlinePlus

    ... Leukemia Liver Cancer Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer All Cancer ... as vascular endothelial growth factor (VEGF) , bind to receptors on the surface of normal endothelial cells. When ...

  3. Binding of HBGA-expressing bacteria does not protect Tulane virus from acute heat stress

    USDA-ARS?s Scientific Manuscript database

    Human noroviruses (HuNoVs) are the major cause of gastroenteritis outbreaks worldwide. Human noroviruses can interact with histo-blood group antigens (HBGAs) on the surface of mammalian cells as well as bacterial cells. HBGAs have been considered as putative receptors or co-receptors for HuNoVs in m...

  4. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  5. Cell-surface prion protein interacts with glycosaminoglycans.

    PubMed Central

    Pan, Tao; Wong, Boon-Seng; Liu, Tong; Li, Ruliang; Petersen, Robert B; Sy, Man-Sun

    2002-01-01

    We used ELISA and flow cytometry to study the binding of prion protein PrP to glycosaminoglycans (GAGs). We found that recombinant human PrP (rPrP) binds GAGs including chondroitin sulphate A, chondroitin sulphate B, hyaluronic acid, and heparin. rPrP binding to GAGs occurs via the N-terminus, a region known to bind divalent cations. Additionally, rPrP binding to GAGs is enhanced in the presence of Cu2+ and Zn2+, but not Ca2+ and Mn2+. rPrP binds heparin strongest, and the binding is inhibited by certain heparin analogues, including heparin disaccharide and sulphate-containing monosaccharides, but not by acetylated heparin. Full-length normal cellular prion protein (PrPC), but not N-terminally truncated PrPC species, from human brain bind GAGs in a similar Cu2+/Zn2+-enhanced fashion. We found that GAGs specifically bind to a synthetic peptide corresponding to amino acid residues 23-35 in the N-terminus of rPrP. We further demonstrated that while both wild-type PrPC and an octapeptide-repeat-deleted mutant PrP produced by transfected cells bound heparin at the cell surface, the PrP N-terminal deletion mutant and non-transfectant control failed to bind heparin. Binding of heparin to wild-type PrPC on the cell surface results in a reduction of the level of cell-surface PrPC. These results provide strong evidence that PrPC is a surface receptor for GAGs. PMID:12186633

  6. Anthrax Toxin Receptor 1 / Tumor Endothelial Marker 8: Mutation of Conserved Inserted Domain Residues Overrides Cytosolic Control of Protective Antigen Binding†

    PubMed Central

    Ramey, Jordan D.; Villareal, Valerie A.; Ng, Charles; Ward, Sabrina; Xiong, Jian-Ping; Clubb, Robert T.; Bradley, Kenneth A.

    2010-01-01

    Anthrax toxin receptor 1 (ANTXR1) / tumor endothelial marker 8 (TEM8) is one of two known proteinaceous cell surface anthrax toxin receptors. A metal ion dependent adhesion site (MIDAS) present in the integrin-like inserted (I) domain of ANTXR1 mediates the binding of the anthrax toxin subunit, protective antigen (PA). Here we provide evidence that single point mutations in the I domain can override regulation of ANTXR1 ligand-binding activity mediated by intracellular signals. A previously reported MIDAS-mutant of ANTXR1 (T118A) was found to retain normal metal ion binding and secondary structure but failed to bind PA, consistent with a locked inactive state. Conversely, mutation of a conserved I domain phenylalanine residue to a tryptophan (F205W) increased the proportion of cell-surface ANTXR1 that bound PA, consistent with a locked active state. Interestingly, the KD and total amount of PA bound by the isolated ANTXR1 I domain was not affected by the F205W mutation, indicating that ANTXR1 is preferentially found in the active state in the absence of inside-out signaling. Circular dichroism (CD) spectroscopy and 1H-15N heteronuclear single quantum coherence (HSQC) nuclear magnetic resonance (NMR) revealed that structural changes between T118A, F205W and WT I domains were minor despite a greater than 103-fold difference in their abilities to bind toxin. Regulation of toxin binding has important implications for the design of toxin inhibitors and for the targeting of ANTXR1 for anti-tumor therapies. PMID:20690680

  7. The N-terminal region of the dopamine D2 receptor, a rhodopsin-like GPCR, regulates correct integration into the plasma membrane and endocytic routes

    PubMed Central

    Cho, DI; Min, C; Jung, KS; Cheong, SY; Zheng, M; Cheong, SJ; Oak, MH; Cheong, JH; Lee, BK; Kim, KM

    2012-01-01

    BACKGROUND AND PURPOSE Functional roles of the N-terminal region of rhodopsin-like GPCR family remain unclear. Using dopamine D2 and D3 receptors as a model system, we probed the roles of the N-terminal region in the signalling, intracellular trafficking of receptor proteins, and explored the critical factors that determine the functionality of the N-terminal region. EXPERIMENTAL APPROACH The N-terminal region of the D2 receptor was gradually shortened or switched with that of the D3 receptor or a non-specific sequence (FLAG), or potential N-terminal glycosylation sites were mutated. Effects of these manipulations on surface expression, internalization, post-endocytic behaviours and signalling were determined. KEY RESULTS Shortening the N-terminal region of the D2 receptor enhanced receptor internalization and impaired surface expression and signalling; ligand binding, desensitization and down-regulation were not affected but their association with a particular microdomain, caveolae, was disrupted. Replacement of critical residues within the N-terminal region with the FLAG epitope failed to restore surface expression but partially restored the altered internalization and signalling. When the N-terminal regions were switched between D2 and D3 receptors, cell surface expression pattern of each receptor was switched. Mutations of potential N-terminal glycosylation sites inhibited surface expression but enhanced internalization of D2 receptors. CONCLUSIONS AND IMPLICATIONS Shortening of N-terminus or mutation of glycosylation sites located within the N-terminus enhanced receptor internalization but impaired the surface expression of D2 receptors. The N-terminal region of the D2 receptor, in a sequence-specific manner, controls the receptor's conformation and integration into the plasma membrane, which determine its subcellular localization, intracellular trafficking and signalling properties. PMID:22117524

  8. TLX: An elusive receptor.

    PubMed

    Benod, Cindy; Villagomez, Rosa; Webb, Paul

    2016-03-01

    TLX (tailless receptor) is a member of the nuclear receptor superfamily and belongs to a class of nuclear receptors for which no endogenous or synthetic ligands have yet been identified. TLX is a promising therapeutic target in neurological disorders and brain tumors. Thus, regulatory ligands for TLX need to be identified to complete the validation of TLX as a useful target and would serve as chemical probes to pursue the study of this receptor in disease models. It has recently been proved that TLX is druggable. However, to identify potent and specific TLX ligands with desirable biological activity, a deeper understanding of where ligands bind, how they alter TLX conformation and of the mechanism by which TLX mediates the transcription of its target genes is needed. While TLX is in the process of escaping from orphanhood, future ligand design needs to progress in parallel with improved understanding of (i) the binding cavity or surfaces to target with small molecules on the TLX ligand binding domain and (ii) the nature of the TLX coregulators in particular cell and disease contexts. Both of these topics are discussed in this review. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Cell surface retention sequence binding protein-1 interacts with the v-sis gene product and platelet-derived growth factor beta-type receptor in simian sarcoma virus-transformed cells.

    PubMed

    Boensch, C; Huang, S S; Connolly, D T; Huang, J S

    1999-04-09

    The cell surface retention sequence (CRS) binding protein-1 (CRSBP-1) is a newly identified membrane glycoprotein which is hypothesized to be responsible for cell surface retention of the oncogene v-sis and c-sis gene products and other secretory proteins containing CRSs. In simian sarcoma virus-transformed NIH 3T3 cells (SSV-NIH 3T3 cells), a fraction of CRSBP-1 was demonstrated at the cell surface and underwent internalization/recycling as revealed by cell surface 125I labeling and its resistance/sensitivity to trypsin digestion. However, the majority of CRSBP-1 was localized in intracellular compartments as evidenced by the resistance of most of the 35S-metabolically labeled CRSBP-1 to trypsin digestion, and by indirect immunofluorescent staining. CRSBP-1 appeared to form complexes with proteolytically processed forms (generated at and/or after the trans-Golgi network) of the v-sis gene product and with a approximately 140-kDa proteolytically cleaved form of the platelet-derived growth factor (PDGF) beta-type receptor, as demonstrated by metabolic labeling and co-immunoprecipitation. CRSBP-1, like the v-sis gene product and PDGF beta-type receptor, underwent rapid turnover which was blocked in the presence of 100 microM suramin. In normal and other transformed NIH 3T3 cells, CRSBP-1 was relatively stable and did not undergo rapid turnover and internalization/recycling at the cell surface. These results suggest that in SSV-NIH 3T3 cells, CRSBP-1 interacts with and forms ternary and binary complexes with the newly synthesized v-sis gene product and PDGF beta-type receptor at the trans-Golgi network and that the stable binary (CRSBP-1.v-sis gene product) complex is transported to the cell surface where it presents the v-sis gene product to unoccupied PDGF beta-type receptors during internalization/recycling.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Jinghua; Marnell, Lorraine L.; Marjon, Kristopher D.

    Pentraxins are a family of ancient innate immune mediators conserved throughout evolution. The classical pentraxins include serum amyloid P component (SAP) and C-reactive protein, which are two of the acute-phase proteins synthesized in response to infection. Both recognize microbial pathogens and activate the classical complement pathway through C1q. More recently, members of the pentraxin family were found to interact with cell-surface Fc{gamma} receptors (Fc{gamma}R) and activate leukocyte-mediated phagocytosis. Here we describe the structural mechanism for pentraxin's binding to Fc{gamma}R and its functional activation of Fc{gamma}R-mediated phagocytosis and cytokine secretion. The complex structure between human SAP and Fc{gamma}RIIa reveals a diagonallymore » bound receptor on each SAP pentamer with both D1 and D2 domains of the receptor contacting the ridge helices from two SAP subunits. The 1:1 stoichiometry between SAP and Fc{gamma}RIIa infers the requirement for multivalent pathogen binding for receptor aggregation. Mutational and binding studies show that pentraxins are diverse in their binding specificity for Fc{gamma}R isoforms but conserved in their recognition structure. The shared binding site for SAP and IgG results in competition for Fc{gamma}R binding and the inhibition of immune-complex-mediated phagocytosis by soluble pentraxins. These results establish antibody-like functions for pentraxins in the Fc{gamma}R pathway, suggest an evolutionary overlap between the innate and adaptive immune systems, and have new therapeutic implications for autoimmune diseases.« less

  11. SP-A binding sites on bovine alveolar macrophages.

    PubMed

    Plaga, S; Plattner, H; Schlepper-Schaefer, J

    1998-11-25

    Surfactant protein A (SP-A) binding to bovine alveolar macrophages was examined in order to characterize SP-A binding proteins on the cell surface and to isolate putative receptors from these cells that could be obtained in large amounts. Human SP-A, unlabeled or labeled with gold particles, was bound to freshly isolated macrophages and analyzed with ELISA or the transmission electron microscope. Binding of SP-A was inhibited by Ca2+ chelation, by an excess of unlabeled SP-A, or by the presence of 20 mg/ml mannan. We conclude that bovine alveolar macrophages expose binding sites for SP-A that are specific and that depend on Ca2+ and on mannose residues. For isolation of SP-A receptors with homologous SP-A as ligand we isolated SP-A from bovine lung lavage. SDS-PAGE analysis of the purified SP-A showed a protein of 32-36 kDa. Functional integrity of the protein was demonstrated. Bovine SP-A bound to Dynabeads was used to isolate SP-A binding proteins. From the fractionated and blotted proteins of the receptor preparation two proteins bound SP-A in a Ca2+-dependent manner, a 40-kDa protein showing mannose dependency and a 210-kDa protein, showing no mannose sensitivity. Copyright 1998 Academic Press.

  12. Image Restoration and Analysis of Influenza Virions Binding to Membrane Receptors Reveal Adhesion-Strengthening Kinetics

    PubMed Central

    Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan

    2016-01-01

    With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072

  13. Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes.

    PubMed

    Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S; Taube, Ran; Engel, Stanislav

    2015-01-01

    Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential.

  14. Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes

    PubMed Central

    Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S.; Taube, Ran

    2015-01-01

    Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential. PMID:26629902

  15. Receptors for aggregated IgG on mouse lymphocytes: their presence on thymocytes, thymus-derived, and bone marrow-derived lymphocytes.

    PubMed

    Anderson, C L; Grey, H M

    1974-05-01

    An autoradiographic binding assay employing (125)I-labeled heat-aggregated mouse IgG2b myeloma protein (MOPC 141) was used to demonstrate receptors for IgG on 20-45% of Balb/c thymocytes and on 70-80% of splenocytes. Binding could also be shown with heat or BDB aggregates of another IgG2b (MOPC 195), with IgG1 and with human gamma-globulin, but not with aggregated chicken gamma-globulin, IgA, BSA, nor with aggregated Fab fragments of IgG2b. Optimum binding was obtained at 37 degrees C. Detection of binding was dependent upon aggregate size with complexes of more than 100 IgG molecules being optimal, aggregates of 6-25 detecting splenocytes but not thymocytes, and aggregates of less than 6 binding to a negligible extent. Comparison of grain counts on various cell types showed mastocytoma cells (P815) and macrophages averaging 40-50 grains/cell/day, allogeneically activated thymocytes 20-30, splenocytes 2-3, L5178 lymphoma cells 1, and positive thymocytes 0.6 grains/cell/day. Double labeling experiments for surface Ig, theta-antigen, and agg IgG receptor on mouse spleen cells indicated that a relatively high density of receptor was present on about 80% of B cells, 30% of T cells, and 60% of SIg(-), theta(-), null cells.

  16. Azadirachtin interacts with the tumor necrosis factor (TNF) binding domain of its receptors and inhibits TNF-induced biological responses.

    PubMed

    Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A; Manna, Sunil K

    2010-02-19

    The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor kappaB (NF-kappaB) and also expression of NF-kappaB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-kappaB (IkappaB alpha) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IkappaB alpha kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-kappaB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy.

  17. Azadirachtin Interacts with the Tumor Necrosis Factor (TNF) Binding Domain of Its Receptors and Inhibits TNF-induced Biological Responses*

    PubMed Central

    Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A.; Manna, Sunil K.

    2010-01-01

    The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor κB (NF-κB) and also expression of NF-κB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-κB (IκBα) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IκBα kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-κB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy. PMID:20018848

  18. Somatostatin displayed on filamentous phage as a receptor-specific agonist

    PubMed Central

    Rousch, Mat; Lutgerink, Jan T; Coote, James; de Bruïne, Adriaan; Arends, Jan-Willem; Hoogenboom, Hennie R

    1998-01-01

    In search of methods to identify bio-active ligands specific for G protein-coupled receptors with seven transmembrane spanning regions, we have developed a filamentous phage-based selection and functional screening method. First, methods for panning peptide phage on cells were established, using the hormone somatostatin as a model. Somatostatin was displayed on the surface of filamentous phage by cloning into phage(mid) vectors and fusion to either pIII or pVIII viral coat proteins. Peptide displaying phage bound to a polyclonal anti-somatostatin serum, and, more importantly, to several somatostatin receptor subtypes (Sst) expressed on transfected CHO-K1 cells, in a pattern which was dependent on the used display method. Binding was competed with somatostatin, with an IC50 in the nanomolar range. The phage were specifically enriched by panning on cells, establishing conditions for cell selections of phage libraries. Binding of somatostatin displaying phage to sst2 on a reporter cell line, in which binding of natural ligand reduces secretion of alkaline phosphatase (via a cyclic AMP responsive element sensitive promoter), proved that the phage particles act as receptor-specific agonists. Less than 100 phage particles per cell were required for this activity, which is approximately 1000 fold less than soluble somatostatin, suggesting that phage binding interferes with normal receptor desensitization and/or recycling. The combination of biopanning of phage libraries on cells with functional screening of phage particles for receptor triggering activity, may be used to select novel, bio-active ligands from phage libraries of random peptides, antibody fragments, or libraries based on the natural receptor ligand. PMID:9776337

  19. Midgut GPI-anchored proteins with alkaline phosphatase activity from the cotton boll weevil (Anthonomus grandis) are putative receptors for the Cry1B protein of Bacillus thuringiensis.

    PubMed

    Martins, Erica Soares; Monnerat, Rose Gomes; Queiroz, Paulo Roberto; Dumas, Vinicius Fiuza; Braz, Shélida Vasconcelos; de Souza Aguiar, Raimundo Wagner; Gomes, Ana Cristina Menezes Mendes; Sánchez, Jorge; Bravo, Alejandra; Ribeiro, Bergmann Morais

    2010-02-01

    Cry toxins from Bacillus thuringiensis (Bt) are used for insect control. They interact with specific receptors located on the host cell surface and are activated by host proteases following receptor binding resulting in midgut epithelial cells lysis. In this work we had cloned, sequenced and expressed a cry1Ba toxin gene from the B thuringiensis S601 strain which was previously shown to be toxic to Anthonomus grandis, a cotton pest. The Cry1Ba6 protein expressed in an acrystaliferous B. thuringiensis strain was toxic to A. grandis in bioassays. The binding of Cry1Ba6 toxin to proteins located in the midgut brush border membrane of A. grandis was analyzed and we found that Cry1Ba6 binds to two proteins (62 and 65kDa) that showed alkaline phosphatase (ALP) activity. This work is the first report that shows the localization of Cry toxin receptors in the midgut cells of A. grandis. 2009. Published by Elsevier Ltd.

  20. The Host Cell Receptors for Measles Virus and Their Interaction with the Viral Hemagglutinin (H) Protein

    PubMed Central

    Lin, Liang-Tzung; Richardson, Christopher D.

    2016-01-01

    The hemagglutinin (H) protein of measles virus (MeV) interacts with a cellular receptor which constitutes the initial stage of infection. Binding of H to this host cell receptor subsequently triggers the F protein to activate fusion between virus and host plasma membranes. The search for MeV receptors began with vaccine/laboratory virus strains and evolved to more relevant receptors used by wild-type MeV. Vaccine or laboratory strains of measles virus have been adapted to grow in common cell lines such as Vero and HeLa cells, and were found to use membrane cofactor protein (CD46) as a receptor. CD46 is a regulator that normally prevents cells from complement-mediated self-destruction, and is found on the surface of all human cells, with the exception of erythrocytes. Mutations in the H protein, which occur during adaptation and allow the virus to use CD46 as a receptor, have been identified. Wild-type isolates of measles virus cannot use the CD46 receptor. However, both vaccine/laboratory and wild-type strains can use an immune cell receptor called signaling lymphocyte activation molecule family member 1 (SLAMF1; also called CD150) and a recently discovered epithelial receptor known as Nectin-4. SLAMF1 is found on activated B, T, dendritic, and monocyte cells, and is the initial target for infections by measles virus. Nectin-4 is an adherens junction protein found at the basal surfaces of many polarized epithelial cells, including those of the airways. It is also over-expressed on the apical and basal surfaces of many adenocarcinomas, and is a cancer marker for metastasis and tumor survival. Nectin-4 is a secondary exit receptor which allows measles virus to replicate and amplify in the airways, where the virus is expelled from the body in aerosol droplets. The amino acid residues of H protein that are involved in binding to each of the receptors have been identified through X-ray crystallography and site-specific mutagenesis. Recombinant measles “blind” to each of these receptors have been constructed, allowing the virus to selectively infect receptor specific cell lines. Finally, the observations that SLAMF1 is found on lymphomas and that Nectin-4 is expressed on the cell surfaces of many adenocarcinomas highlight the potential of measles virus for oncolytic therapy. Although CD46 is also upregulated on many tumors, it is less useful as a target for cancer therapy, since normal human cells express this protein on their surfaces. PMID:27657109

  1. The Host Cell Receptors for Measles Virus and Their Interaction with the Viral Hemagglutinin (H) Protein.

    PubMed

    Lin, Liang-Tzung; Richardson, Christopher D

    2016-09-20

    The hemagglutinin (H) protein of measles virus (MeV) interacts with a cellular receptor which constitutes the initial stage of infection. Binding of H to this host cell receptor subsequently triggers the F protein to activate fusion between virus and host plasma membranes. The search for MeV receptors began with vaccine/laboratory virus strains and evolved to more relevant receptors used by wild-type MeV. Vaccine or laboratory strains of measles virus have been adapted to grow in common cell lines such as Vero and HeLa cells, and were found to use membrane cofactor protein (CD46) as a receptor. CD46 is a regulator that normally prevents cells from complement-mediated self-destruction, and is found on the surface of all human cells, with the exception of erythrocytes. Mutations in the H protein, which occur during adaptation and allow the virus to use CD46 as a receptor, have been identified. Wild-type isolates of measles virus cannot use the CD46 receptor. However, both vaccine/laboratory and wild-type strains can use an immune cell receptor called signaling lymphocyte activation molecule family member 1 (SLAMF1; also called CD150) and a recently discovered epithelial receptor known as Nectin-4. SLAMF1 is found on activated B, T, dendritic, and monocyte cells, and is the initial target for infections by measles virus. Nectin-4 is an adherens junction protein found at the basal surfaces of many polarized epithelial cells, including those of the airways. It is also over-expressed on the apical and basal surfaces of many adenocarcinomas, and is a cancer marker for metastasis and tumor survival. Nectin-4 is a secondary exit receptor which allows measles virus to replicate and amplify in the airways, where the virus is expelled from the body in aerosol droplets. The amino acid residues of H protein that are involved in binding to each of the receptors have been identified through X-ray crystallography and site-specific mutagenesis. Recombinant measles "blind" to each of these receptors have been constructed, allowing the virus to selectively infect receptor specific cell lines. Finally, the observations that SLAMF1 is found on lymphomas and that Nectin-4 is expressed on the cell surfaces of many adenocarcinomas highlight the potential of measles virus for oncolytic therapy. Although CD46 is also upregulated on many tumors, it is less useful as a target for cancer therapy, since normal human cells express this protein on their surfaces.

  2. Adenovirus type 5 intrinsic adsorption rates measured by surface plasmon resonance.

    PubMed

    Roper, D Keith; Nakra, Shamit

    2006-01-01

    Intrinsic adsorption rates of whole adenovirus type 5 (Ad5) onto a diethylaminoethyl (DEAE) anion exchange surface are measured for the first time by surface plasmon resonance (SPR). Fitting SPR sensorgrams to a two-compartment mass transport reaction model distinguishes intrinsic adsorption rates from slow diffusive Ad5 mass transport. Ad5 is a widely used viral vector for gene therapy that binds electrostatically to surfaces of cells and synthetics such as membranes, chromatographic resins, and glass. Increasing NaCl concentration from 4.8 to 14.4mM shifts binding of whole Ad5 from diffusion control to a regime where both sorption and diffusion affect binding. Intrinsic adsorption rates for Ad5-DEAE interaction are 16 times faster than intrinsic adsorption rates for Ad5 fiber knob interacting with soluble extracellular domain of coxsackievirus adenovirus receptors (s-CAR).

  3. Ligand binding induces a sharp decrease in hydrophobicity of folate binding protein assessed by 1-anilinonaphthalene-8-sulphonate which suppresses self-association of the hydrophobic apo-protein.

    PubMed

    Holm, Jan; Lawaetz, Anders J; Hansen, Steen I

    2012-08-17

    High affinity folate binding protein (FBP) regulates as a soluble protein and as a cellular receptor intracellular trafficking of folic acid, a vitamin of great importance to cell growth and division. We addressed two issues of potential importance to the biological function of FBP, a possible decrease of the surface hydrophobicity associated with the ligand-induced conformation change of FBP, and protein-inter-protein interactions involved in self-association of hydrophobic apo-FBP. The extrinsic fluorescent apolar dye 1-anilinonaphthalene-8-sulphonate (ANS) exhibited enhanced fluorescence intensity and a blueshift of emission maximum from 510-520 nm to 460-470 nm upon addition of apo-FBP indicating binding to a strongly hydrophobic environment. Neither enhancement of fluorescence nor blueshift of ANS emission maximum occurred when folate-ligated holo-FBP replaced apo-FBP. The drastic decrease in surface hydrophobicity of holo-FBP could have bearings on the biological function of FBP since changes in surface hydrophobicity have critical effects on the biological function of receptors and transport proteins. ANS interacts with exposed hydrophobic surfaces on proteins and may thereby block and prevent aggregation of proteins (chaperone-like effect). Hence, hydrophobic interactions seemed to participate in the concentration-dependent self-association of apo-FBP which was suppressed by high ANS concentrations in light scatter measurements. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Characterization, cell-surface expression and ligand-binding properties of different truncated N-terminal extracellular domains of the ionotropic glutamate receptor subunit GluR1.

    PubMed

    McIlhinney, R A; Molnár, E

    1996-04-01

    To identify the location of the first transmembrane segment of the GluR1 glutamate receptor subunit artificial stop codons have been introduced into the N-terminal domain at amino acid positions 442, 510, and 563, namely just before and spanning the proposed first two transmembrane regions. The resultant truncated N-terminal fragments of GluR1, termed NT1, NT2, and NT3 respectively were expressed in Cos-7 cells and their cellular distribution and cell-surface expression analysed using an N-terminal antibody to GluR1. All of the fragments were fully glycosylated and were found to be associated with cell membranes but none was secreted. Differential extraction of the cell membranes indicated that both NT1 and NT2 behave as peripheral membrane proteins. In contrast NT3, like the full subunit, has integral membrane protein properties. Furthermore only NT3 is expressed at the cell surface as determined by immunofluorescence and cell-surface biotinylation. Protease protection assays indicated that only NT3 had a cytoplasmic tail. Binding studies using the selective ligand [(3)H]alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate ([(3)H]AMPA) demonstrated that NT3 does not bind ligand. Together these results indicate that the first transmembrane domain of the GluR1 subunit lies between residues 509 and 562, that the N-terminal domain alone cannot form a functional ligand-binding site and that this domain can be targeted to the cell surface provided that it has a transmembrane-spanning region.

  5. Structural Basis for Interactions Between Contactin Family Members and Protein-tyrosine Phosphatase Receptor Type G in Neural Tissues

    DOE PAGES

    Nikolaienko, Roman M.; Hammel, Michal; Dubreuil, Véronique; ...

    2016-08-18

    Protein-tyrosine phosphatase receptor type G (RPTPγ/PTPRG) interacts in vitro with contactin-3-6 (CNTN3-6), a group of glycophosphatidylinositol-anchored cell adhesion molecules involved in the wiring of the nervous system. In addition to PTPRG, CNTNs associate with multiple transmembrane proteins and signal inside the cell via cis-binding partners to alleviate the absence of an intracellular region. Here, we use comprehensive biochemical and structural analyses to demonstrate that PTPRG·CNTN3-6 complexes share similar binding affinities and a conserved arrangement. Furthermore, as a first step to identifying PTPRG·CNTN complexes in vivo, we found that PTPRG and CNTN3 associate in the outer segments of mouse rod photoreceptormore » cells. In particular, PTPRG and CNTN3 form cis-complexes at the surface of photoreceptors yet interact in trans when expressed on the surfaces of apposing cells. Further structural analyses suggest that all CNTN ectodomains adopt a bent conformation and might lie parallel to the cell surface to accommodate these cis and trans binding modes. Taken together, these studies identify a PTPRG·CNTN complex in vivo and provide novel insights into PTPRG- and CNTN-mediated signaling.« less

  6. Structure of the Plexin Ectodomain Bound by Semaphorin-Mimicking Antibodies

    PubMed Central

    Omiya, Ryusuke; Matoba, Kyoko; Baba, Takeshi; Suzuki, Sachiyo; Segawa, Hiroaki; Kumanogoh, Atsushi; Iwasaki, Kenji; Hattori, Kunihiro; Takagi, Junichi

    2016-01-01

    Semaphorin family proteins act on cells to mediate both repulsive and attractive guidance via binding to plexin family receptors, thereby playing fundamental roles in the morphogenesis and homeostasis of various tissues. Although semaphorin-plexin signaling is implicated in various diseases and is thus a target of intensive research, our mechanistic understanding of how semaphorins activate plexins on the cell surface is limited. Here, we describe unique anti-plexin-A1 antibodies that can induce a collapsed morphology in mouse dendritic cells as efficiently as the semaphorin 3A (Sema3A) ligand. Precise epitope analysis indicates that these “semaphorin-mimicking” antibodies dimerize cell-surface plexin-A1 by binding to the N-terminal sema domain of the plexin at sites away from the interface used by the Sema3A ligand. Structural analysis of plexin-A1 fragments using negative stain electron microscopy further revealed that this agonistic capacity is closely linked to the location and orientation of antibody binding. In addition, the full-length plexin-A1 ectodomain exhibited a highly curved “C” shape, reinforcing the very unusual dimeric receptor conformation of this protein at the cell surface when engaged with Sema3A or agonistic antibodies. PMID:27258772

  7. CCL2 binding is CCR2 independent in primary adult human astrocytes.

    PubMed

    Fouillet, A; Mawson, J; Suliman, O; Sharrack, B; Romero, I A; Woodroofe, M N

    2012-02-09

    Chemokines are low relative molecular mass proteins, which have chemoattractant actions on many cell types. The chemokine, CCL2, has been shown to play a major role in the recruitment of monocytes in central nervous system (CNS) lesions in multiple sclerosis (MS). Since resident astrocytes constitute a major source of chemokine synthesis including CCL2, we were interested to assess the regulation of CCL2 by astrocytes. We showed that CCL2 bound to the cell surface of astrocytes and binding was not modulated by inflammatory conditions. However, CCR2 protein was not detected nor was activation of the classical CCR2 downstream signaling pathways. Recent studies have shown that non-signaling decoy chemokine receptors bind and modulate the expression of chemokines at site of inflammation. Here, we show that the D6 chemokine decoy receptor is constitutively expressed by primary human adult astrocytes at both mRNA and protein level. In addition, CCL3, which binds to D6, but not CCL19, which does not bind to D6, displaced CCL2 binding to astrocytes; indicating that CCL2 may bind to this cell type via the D6 receptor. Our results suggest that CCL2 binding to primary adult human astrocytes is CCR2-independent and is likely to be mediated via the D6 decoy chemokine receptor. Therefore we propose that astrocytes are implicated in both the establishment of chemokine gradients for the migration of leukocytes into and within the CNS and in the regulation of CCL2 levels at inflammatory sites in the CNS. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Miranda Santos, I.K.; Pereira, M.E.

    1984-09-01

    Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less

  9. Agonist-induced internalization of the substance P (NK1) receptor expressed in epithelial cells.

    PubMed

    Garland, A M; Grady, E F; Payan, D G; Vigna, S R; Bunnett, N W

    1994-10-01

    Internalization of the NK1 receptor (NK1R) and substance P was observed in cells transfected with cDNA encoding the rat NK1R by using anti-receptor antibodies and cyanine 3-labelled substance P (cy3-substance P). After incubation at 4 degrees C, NK1R immunoreactivity and cy3-substance P were confined to the plasma membrane. Within 3 min of incubation at 37 degrees C, NK1R immunoreactivity and cy3-substance P were internalized into small intracellular vesicles located beneath the plasma membrane. Fluorescein isothiocyanate-labelled transferrin and cy3-substance P were internalized into the same vesicles, identifying them as early endosomes. After 60 min at 37 degrees C, NK1R immunoreactivity was detected in larger, perinuclear vesicles. Internalization of 125I-labelled substance P was studied by using an acid wash to dissociate cell-surface label from that which has been internalized. Binding reached equilibrium after incubation for 60 min at 4 degrees C with no detectable internalization. After 10 min incubation at 37 degrees C, 83.5 +/- 1.0% of specifically bound counts were internalized. Hyperosmolar sucrose and phenylarsine oxide, which are inhibitors of endocytosis, prevented internalization of 125I-labelled substance P and accumulation of NK1R immunoreactivity into endosomes. Acidotropic agents caused retention of 125I-labelled substance P within the cell and inhibited degradation of the internalized peptide. Continuous incubation of cells with substance P at 37 degrees C reduced 125I-substance P binding at the cell surface. Therefore, substance P and its receptor are internalized into early endosomes within minutes of binding, and internalized substance P is degraded. Internalization depletes NK1Rs from the cell surface and may down-regulate the response of a cell to substance P.

  10. Structure and energetics of pairwise interactions between proteasome subunits RPN2, RPN13, and ubiquitin clarify a substrate recruitment mechanism

    DOE PAGES

    VanderLinden, Ryan T.; Hemmis, Casey W.; Yao, Tingting; ...

    2017-04-25

    This work presents that the 26S proteasome is a large cellular assembly that mediates the selective degradation of proteins in the nucleus and cytosol and is an established target for anticancer therapeutics. Protein substrates are typically targeted to the proteasome through modification with a polyubiquitin chain, which can be recognized by several proteasome-associated ubiquitin receptors. One of these receptors, RPN13/ADRM1, is recruited to the proteasome through direct interaction with the large scaffolding protein RPN2 within the 19S regulatory particle. To better understand the interactions between RPN13, RPN2, and ubiquitin, we used human proteins to map the RPN13-binding epitope to themore » C-terminal 14 residues of RPN2, which, like ubiquitin, binds the N-terminal pleckstrin-like receptor of ubiquitin (PRU) domain of RPN13. We also report the crystal structures of the RPN13 PRU domain in complex with peptides corresponding to the RPN2 C terminus and ubiquitin. Through mutational analysis, we validated the RPN2-binding interface revealed by our structures and quantified binding interactions with surface plasmon resonance and fluorescence polarization. In contrast to a previous report, we find that RPN13 binds ubiquitin with an affinity similar to that of other proteasome-associated ubiquitin receptors and that RPN2, ubiquitin, and the deubiquitylase UCH37 bind to RPN13 with independent energetics. In conclusion, these findings provide a detailed characterization of interactions that are important for proteasome function, indicate ubiquitin affinities that are consistent with the role of RPN13 as a proteasomal ubiquitin receptor, and have major implications for the development of novel anticancer therapeutics.« less

  11. Structure and energetics of pairwise interactions between proteasome subunits RPN2, RPN13, and ubiquitin clarify a substrate recruitment mechanism.

    PubMed

    VanderLinden, Ryan T; Hemmis, Casey W; Yao, Tingting; Robinson, Howard; Hill, Christopher P

    2017-06-09

    The 26S proteasome is a large cellular assembly that mediates the selective degradation of proteins in the nucleus and cytosol and is an established target for anticancer therapeutics. Protein substrates are typically targeted to the proteasome through modification with a polyubiquitin chain, which can be recognized by several proteasome-associated ubiquitin receptors. One of these receptors, RPN13/ADRM1, is recruited to the proteasome through direct interaction with the large scaffolding protein RPN2 within the 19S regulatory particle. To better understand the interactions between RPN13, RPN2, and ubiquitin, we used human proteins to map the RPN13-binding epitope to the C-terminal 14 residues of RPN2, which, like ubiquitin, binds the N-terminal pleckstrin-like receptor of ubiquitin (PRU) domain of RPN13. We also report the crystal structures of the RPN13 PRU domain in complex with peptides corresponding to the RPN2 C terminus and ubiquitin. Through mutational analysis, we validated the RPN2-binding interface revealed by our structures and quantified binding interactions with surface plasmon resonance and fluorescence polarization. In contrast to a previous report, we find that RPN13 binds ubiquitin with an affinity similar to that of other proteasome-associated ubiquitin receptors and that RPN2, ubiquitin, and the deubiquitylase UCH37 bind to RPN13 with independent energetics. These findings provide a detailed characterization of interactions that are important for proteasome function, indicate ubiquitin affinities that are consistent with the role of RPN13 as a proteasomal ubiquitin receptor, and have major implications for the development of novel anticancer therapeutics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Functional analysis of glyco-molecules that bind with influenza virus.

    PubMed

    Takahashi, Tadanobu

    2016-01-01

    Influenza A virus (IAV) recognizes terminal sialic acid of sialoglyco-conjugates on host cells through the viral envelope glycoprotein hemagglutinin (HA), followed by initiation of entry into the cells. Molecular species of sialic acid are largely divided into two moieties: N-acetylneuraminic acid (Neu5Ac) and N-glycolylneuraminic acid (Neu5Gc). A receptor for IAV infection generally means Neu5Ac. Almost all equine IAVs and some human, swine, and duck IAVs bind not only to Neu5Ac but also to Neu5Gc. In nonhuman animals, Neu5Gc has been detected in swine and equine tracheas and the duck colon, which are the main replication sites of mammalian and avian IAVs. Therefore, Neu5Gc in these sites has been suggested to be a functional receptor for IAV infection. Humans cannot synthesize Neu5Gc due to a genetic defect of the Neu5Gc-synthesizing enzyme. We evaluated the receptor function of Neu5Gc in IAV infection in human cells. Our results indicated that Neu5Gc expression on the surface of human cells is not a functional receptor for IAV infection and that it has a negative effect on infectivity of IAV possessing Neu5Gc binding ability. IAV also binds to non-sialo 3-O-sulfated galactosylceramide (sulfatide). Sulfatide has been suggested to be a functional receptor for IAV infection. However, we have shown that sulfatide is not a functional receptor for IAV infection and that the binding of HA with sulfatide enhances progeny virus production. It is expected that functions of these glyco-molecules can be used in prevention and development of new drugs against IAV.

  13. Structure and Mutagenesis of the Parainfluenza Virus 5 Hemagglutinin-Neuraminidase Stalk Domain Reveals a Four-Helix Bundle and the Role of the Stalk in Fusion Promotion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bose, Sayantan; Welch, Brett D.; Kors, Christopher A.

    2014-10-02

    Paramyxovirus entry into cells requires the fusion protein (F) and a receptor binding protein (hemagglutinin-neuraminidase [HN], H, or G). The multifunctional HN protein of some paramyxoviruses, besides functioning as the receptor (sialic acid) binding protein (hemagglutinin activity) and the receptor-destroying protein (neuraminidase activity), enhances F activity, presumably by lowering the activation energy required for F to mediate fusion of viral and cellular membranes. Before or upon receptor binding by the HN globular head, F is believed to interact with the HN stalk. Unfortunately, until recently none of the receptor binding protein crystal structures have shown electron density for the stalkmore » domain. Parainfluenza virus 5 (PIV5) HN exists as a noncovalent dimer-of-dimers on the surface of cells, linked by a single disulfide bond in the stalk. Here we present the crystal structure of the PIV5-HN stalk domain at a resolution of 2.65 {angstrom}, revealing a four-helix bundle (4HB) with an upper (N-terminal) straight region and a lower (C-terminal) supercoiled part. The hydrophobic core residues are a mix of an 11-mer repeat and a 3- to 4-heptad repeat. To functionally characterize the role of the HN stalk in F interactions and fusion, we designed mutants along the PIV5-HN stalk that are N-glycosylated to physically disrupt F-HN interactions. By extensive study of receptor binding, neuraminidase activity, oligomerization, and fusion-promoting functions of the mutant proteins, we found a correlation between the position of the N-glycosylation mutants on the stalk structure and their neuraminidase activities as well as their abilities to promote fusion.« less

  14. Structure and Mutagenesis of the Parainfluenza Virus 5 Hemagglutinin-Neuraminidase Stalk Domain Reveals a Four-Helix Bundle and the Role of the Stalk in Fusion Promotion▿

    PubMed Central

    Bose, Sayantan; Welch, Brett D.; Kors, Christopher A.; Yuan, Ping; Jardetzky, Theodore S.; Lamb, Robert A.

    2011-01-01

    Paramyxovirus entry into cells requires the fusion protein (F) and a receptor binding protein (hemagglutinin-neuraminidase [HN], H, or G). The multifunctional HN protein of some paramyxoviruses, besides functioning as the receptor (sialic acid) binding protein (hemagglutinin activity) and the receptor-destroying protein (neuraminidase activity), enhances F activity, presumably by lowering the activation energy required for F to mediate fusion of viral and cellular membranes. Before or upon receptor binding by the HN globular head, F is believed to interact with the HN stalk. Unfortunately, until recently none of the receptor binding protein crystal structures have shown electron density for the stalk domain. Parainfluenza virus 5 (PIV5) HN exists as a noncovalent dimer-of-dimers on the surface of cells, linked by a single disulfide bond in the stalk. Here we present the crystal structure of the PIV5-HN stalk domain at a resolution of 2.65 Å, revealing a four-helix bundle (4HB) with an upper (N-terminal) straight region and a lower (C-terminal) supercoiled part. The hydrophobic core residues are a mix of an 11-mer repeat and a 3- to 4-heptad repeat. To functionally characterize the role of the HN stalk in F interactions and fusion, we designed mutants along the PIV5-HN stalk that are N-glycosylated to physically disrupt F-HN interactions. By extensive study of receptor binding, neuraminidase activity, oligomerization, and fusion-promoting functions of the mutant proteins, we found a correlation between the position of the N-glycosylation mutants on the stalk structure and their neuraminidase activities as well as their abilities to promote fusion. PMID:21994464

  15. Species B adenovirus serotypes 3, 7, 11 and 35 share similar binding sites on the membrane cofactor protein CD46 receptor.

    PubMed

    Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

    2007-11-01

    We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.

  16. Interaction of Trypanosoma evansi with the plasminogen-plasmin system.

    PubMed

    Acosta, Héctor; Rondón-Mercado, Rocío; Avilán, Luisana; Concepción, Juan Luis

    2016-08-15

    Trypanosoma evansi is a widely-distributed haemoflagellated parasite of veterinary importance that infects a variety of mammals including horses, mules, camels, buffalos, cattle and deer. It is the causal agent of a trypanosomiasis known as Surra which produces epidemics of great economic importance in Africa, Asia and South America. The main pathology includes an enlarged spleen with hypertrophy of lymphoid follicles, congested lungs, neuronal degeneration and meningoencephalitis, where migration of the parasites from the blood to the tissues is essential. Most cells, including pathogenic cells, use diverse strategies for tissue invasion, such as the expression of surface receptors to bind plasminogen or plasmin. In this work, we show that T. evansi is able to bind plasminogen and plasmin on its surface. The analysis of this binding revealed a high affinity dissociation constant (Kd of 0.080±0.009μM) and 1×10(5) plasminogen binding sites per cell. Also a second population of receptors with a Kd of 0.255±0.070μM and 3.2×10(4) plasminogen binding sites per cell was determined. Several proteins with molecular masses between ∼18 and ∼70kDa are responsible for this binding. This parasite-plasminogen interaction may be important in the establishment of the infection in the vertebrate host, where the physiological concentration of available plasminogen is around 2μM. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Interaction study between synthetic glycoconjugate ligands and endocytic receptors using flow cytometry.

    PubMed

    Yura, Hirofumi; Ishihara, Masayuki; Kanatani, Yasuhiro; Takase, Bonpei; Hattori, Hidemi; Suzuki, Shinya; Kawakami, Mitsuyuki; Matsui, Takemi

    2006-04-01

    Flow cytometric analysis of synthetic galactosyl polymers, asialofetuin and LDL derivatives labeled with FITC (Fluorescein Isothiocyanate) was carried out to determine the phenotypes of endocytic receptors, such as asialoglycoprotein (ASPG) and the LDL receptor, on various types of cells. When FITC-labeled galactosyl polystyrene (GalCPS), being a synthetic ligand of ASPG, was applied to rat hepatocytes and human cancer cells (Hep G2 and Chang Liver), surface fluorescence intensities varied according to receptor expression on the cells. The fluorescence intensity originates from the calcium-dependent binding of the FITC-labeled GalCPS. Although unaltered by pre-treatment with glucosyl polystyrene (GluCPS), fetuin and LDL, the fluorescence intensity was suppressed by pre-treatment with (non-labeled) GalCPS and asialofetuin. Flow cytometry allowed us to demonstrate that the calcium-dependent binding of FITC-labeled LDL (prepared from rabbits) upon the addition of 17alpha-ethinyl estradiol enhances LDL receptor expression, and the expression is suppressed upon the addition of a monoclonal antibody to the LDL receptor. The binding efficiency based on the combination of FITC-labeled ligands suggests a possible application for the classification of cell types and conditions corresponding to endocytic receptor expression without the need for immuno-active antibodies or radiolabeled substances. Furthermore, the synthetic glycoconjugate (GalCPS) is shown to be a sensitive and useful marker for classification based on cell phenotype using flow cytometry.

  18. Protein-protein interactions between SWCNT/chitosan/EGF and EGF receptor: a model of drug delivery system.

    PubMed

    Rungnim, Chompoonut; Rungrotmongkol, Thanyada; Kungwan, Nawee; Hannongbua, Supot

    2016-09-01

    Epidermal growth factor (EGF) was used as the targeting ligand to enhance the specificity of a cancer drug delivery system (DDS) via its specific interaction with the EGF receptor (EGFR) that is overexpressed on the surface of some cancer cells. To investigate the intermolecular interaction and binding affinity between the EGF-conjugated DDS and the EGFR, 50 ns molecular dynamics simulations were performed on the complex of tethered EGFR and EGF linked to single-wall carbon nanotube (SWCNT) through a biopolymer chitosan wrapping the tube outer surface (EGFR·EGF-CS-SWCNT-Drug complex), and compared to the EGFR·EGF complex and free EGFR. The binding pattern of the EGF-CS-SWCNT-Drug complex to the EGFR was broadly comparable to that for EGF, but the binding affinity of the EGF-CS-SWCNT-Drug complex was predicted to be somewhat better than that for EGF alone. Additionally, the chitosan chain could prevent undesired interactions of SWCNT at the binding pocket region. Therefore, EGF connected to SWCNT via a chitosan linker is a seemingly good formulation for developing a smart DDS served as part of an alternative cancer therapy.

  19. Monitoring the kinetics of the pH driven transition of the anthrax toxin prepore to the pore by biolayer interferometry and surface plasmon resonance

    PubMed Central

    Naik, Subhashchandra; Brock, Susan; Akkaladevi, Narahari; Tally, Jon; Mcginn-Straub, Wesley; Zhang, Na; Gao, Phillip; Gogol, E. P.; Pentelute, B. L.; Collier, R. John; Fisher, Mark T.

    2013-01-01

    Domain 2 of the anthrax protective antigen (PA) prepore heptamer unfolds and refolds during endosome acidification to generate an extended 100 Å beta barrel pore that inserts into the endosomal membrane. The PA pore facilitates the pH dependent unfolding and translocation of bound toxin enzymic components, lethal factor (LF) and/or edema factor (EF), from the endosome into the cytoplasm. We constructed immobilized complexes of the prepore with the PA-binding domain of LF (LFN) to monitor the real-time prepore to pore kinetic transition using surface plasmon resonance (SPR) and bio-layer interferometry (BLI). The kinetics of this transition increased as the solution pH was decreased from pH 7.5 to pH 5.0, mirroring acidification of the endosome. Once transitioned, the LFN-PA pore complex was removed from the BLI biosensor tip and deposited onto EM grids, where the PA pore formation was confirmed by negative stain electron microscopy. When the soluble receptor domain (ANTRX2/CMG2) binds the immobilized PA prepore, the transition to the pore state was observed only after the pH was lowered to early or late endosomal pH conditions (5.5 to 5.0 respectively). Once the pore formed, the soluble receptor readily dissociated from the PA pore. Separate binding experiments with immobilized PA pores and soluble receptor indicate that the receptor has a weakened propensity to bind to the transitioned pore. This immobilized anthrax toxin platform can be used to identify or validate potential antimicrobial lead compounds capable of regulating and/or inhibiting anthrax toxin complex formation or pore transitions. PMID:23964683

  20. Monitoring the kinetics of the pH-driven transition of the anthrax toxin prepore to the pore by biolayer interferometry and surface plasmon resonance.

    PubMed

    Naik, Subhashchandra; Brock, Susan; Akkaladevi, Narahari; Tally, Jon; McGinn-Straub, Wesley; Zhang, Na; Gao, Phillip; Gogol, E P; Pentelute, B L; Collier, R John; Fisher, Mark T

    2013-09-17

    Domain 2 of the anthrax protective antigen (PA) prepore heptamer unfolds and refolds during endosome acidification to generate an extended 100 Å β barrel pore that inserts into the endosomal membrane. The PA pore facilitates the pH-dependent unfolding and translocation of bound toxin enzymic components, lethal factor (LF) and/or edema factor, from the endosome to the cytoplasm. We constructed immobilized complexes of the prepore with the PA-binding domain of LF (LFN) to monitor the real-time prepore to pore kinetic transition using surface plasmon resonance and biolayer interferometry (BLI). The kinetics of this transition increased as the solution pH was decreased from 7.5 to 5.0, mirroring acidification of the endosome. Once it had undergone the transition, the LFN-PA pore complex was removed from the BLI biosensor tip and deposited onto electron microscopy grids, where PA pore formation was confirmed by negative stain electron microscopy. When the soluble receptor domain (ANTRX2/CMG2) binds the immobilized PA prepore, the transition to the pore state was observed only after the pH was lowered to early (pH 5.5) or late (pH 5.0) endosomal pH conditions. Once the pore formed, the soluble receptor readily dissociated from the PA pore. Separate binding experiments with immobilized PA pores and the soluble receptor indicate that the receptor has a weakened propensity to bind to the transitioned pore. This immobilized anthrax toxin platform can be used to identify or validate potential antimicrobial lead compounds capable of regulating and/or inhibiting anthrax toxin complex formation or pore transitions.

  1. Functions of transmembrane domain 3 of human melanocortin-4 receptor.

    PubMed

    Mo, Xiu-Lei; Yang, Rui; Tao, Ya-Xiong

    2012-12-01

    The melanocortin-4 receptor (MC4R) is a G protein-coupled receptor critical for maintaining energy homeostasis. Transmembrane domain 3 (TM3) of MC4R contains residues that were suggested to be essential in ligand binding and signaling. Several MC4R mutations in TM3 are associated with human obesity. To gain a better understanding of the functions of TM3, we analyzed the functions of 26 residues in TM3 using alanine-scanning mutagenesis. We showed that all mutants had normal cell-surface expression. Four mutants were defective in ligand binding and signaling and six mutants had normal ligand binding but impaired cAMP production. L140A had increased basal cAMP level. To further characterize the function of L140, we generated 17 additional L140 mutants. Fifteen L140 mutants had significantly decreased cell-surface expression, with L140R and L140V expressed normally. Ten L140 mutants had increased basal cAMP activities. Four L140 mutants were defective in ligand-stimulated cAMP generation. Interestingly, with the ERK1/2 pathway, we showed that nine constitutively active mutants had similar levels of basal pERK1/2 as that of WT, and two signaling defective mutants had similar levels of pERK1/2 as that of WT upon agonist stimulation, different from their cAMP signaling properties, suggesting biased signaling in these mutant receptors. In summary, we identified 13 residues in TM3 that were essential for ligand binding and/or signaling. Moreover, L140 was critical for locking MC4R in inactive conformation and several mutants showed biased signaling in cAMP and ERK1/2 signaling pathways.

  2. Spatial biomarker of disease and detection of spatial organization of cellular receptors

    DOEpatents

    Salaita, Khalid S.; Nair, Pradeep M.; Das, Debopriya; Gray, Joe W.; Groves, John T.

    2017-07-18

    A signature of a condition of a live cell is established in an assay that allows distribution of the receptors on the cell surface in response to binding a ligand. The receptors can be optically detected and quantified to provide a value for the condition, Test drugs can be screened for therapeutic potential in the assay: a potentially efficacious drug is identified by an ability to modulate an established signature. The receptor distribution signature can be corroborated with an mRNA expression profile of several genes, indicating, for example, metastasis.

  3. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  4. Down-regulation of parathyroid hormone (PTH) receptors in cultured bone cells is associated with agonist-specific intracellular processing of PTH-receptor complexes.

    PubMed

    Teitelbaum, A P; Silve, C M; Nyiredy, K O; Arnaud, C D

    1986-02-01

    Exposure of cultured embryonic chicken bone cells to the PTH agonists bovine (b) PTH-(1-34) and [8Nle, 18Nle, 34Tyr]bPTH-(1-34)amide [bPTH-(1-34)A] reduces the subsequent cAMP response to the hormone and decreases the specific binding of 125I-labeled PTH to these cultures. To determine whether PTH receptor down-regulation in cultured bone cells is mediated by cellular internalization of PTH-receptor complexes, we measured the uptake of [125I]bPTH-(1-34) into an acid-resistant compartment. Uptake of radioactivity into this compartment was inhibited by incubating cells at 4 C with phenylarsineoxide and unlabeled bPTH-(1-34). Tracer uptake into the acid-resistant compartment at any time was directly proportional to total cell binding at 22 C. Thus, it is likely that PTH-receptor complexes are internalized by bone cells. This mechanism may explain the loss of cell surface receptors after PTH pretreatment. To determine whether internalized PTH-receptor complexes are reinserted into the plasma membrane, we measured PTH binding and PTH stimulation of cAMP production after cells were exposed to monensin, a known inhibitor of receptor recycling. Monensin (25 microM) had no effect on PTH receptor number or affinity and did not alter PTH-stimulated cAMP accumulation. However, monensin (25 microM) incubated with cells pretreated with various concentrations of bPTH-(1-34) for 1 h potentiated the effect of the hormone to reduce subsequent [125I]bPTH-(1-34) binding and PTH-stimulated cAMP accumulation by more than 2 orders of magnitude. Chloroquine also potentiated PTH-induced down-regulation of PTH receptors. By contrast, neither agent influenced PTH binding or PTH-stimulated cAMP production in cells pretreated with the antagonist bPTH-(3-34)A. Thus, monensin potentiated PTH receptor loss only in cells pretreated with PTH agonists, indicating that antagonist-occupied receptors may be processed differently from agonist-occupied receptors in bone cells. The data further suggest that the attenuation of PTH stimulation of cAMP production in treated bone cells may be, at least in part, due to receptor-mediated endocytosis of the hormone.

  5. Rapid endocytosis of the low density lipoprotein receptor-related protein modulates cell surface distribution and processing of the beta-amyloid precursor protein.

    PubMed

    Cam, Judy A; Zerbinatti, Celina V; Li, Yonghe; Bu, Guojun

    2005-04-15

    The low density lipoprotein receptor-related protein (LRP) is a approximately 600-kDa multifunctional endocytic receptor that is highly expressed in the brain. LRP and its ligands apolipoprotein E, alpha2-macroglobulin, and beta-amyloid precursor protein (APP), are genetically linked to Alzheimer disease and are found in characteristic plaque deposits in brains of patients with Alzheimer disease. To identify which extracellular domains of LRP interact with APP, we used minireceptors of each of the individual LRP ligand binding domains and assessed their ability to bind and degrade a soluble APP fragment. LRP minireceptors containing ligand binding domains II and IV, but not I or III, interacted with APP. To test whether APP trafficking is directly related to the rapid endocytosis of LRP, we generated stable Chinese hamster ovary cell lines expressing either a wild-type LRP minireceptor or its endocytosis mutants. Chinese hamster ovary cells stably expressing wild-type LRP minireceptor had less cell surface APP than pcDNA3 vector-transfected cells, whereas those stably expressing endocytosis-defective LRP minireceptors accumulated APP at the cell surface. We also found that the steady-state levels of the amyloid beta-peptides (Abeta) is dictated by the relative expression levels of APP and LRP, probably reflecting the dual roles of LRP in both Abeta production and clearance. Together, these data establish a relationship between LRP rapid endocytosis and APP trafficking and proteolytic processing to generate Abeta.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mays, Suzanne G.; Okafor, C. Denise; Tuntland, Micheal L.

    Peroxisome proliferator-activated gamma coactivator 1-α (PGC1α) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1α is known to bind and activate LRH-1, mechanisms through which PGC1α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1–PGC1α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), inmore » coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1–PGC1α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1α but promoted allosteric signaling from the helix 6/β-sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1–PGC1α interaction and may illuminate strategies for selective therapeutic targeting of PGC1α-dependent LRH-1 signaling pathways.« less

  7. Discover binding pathways using the sliding binding-box docking approach: application to binding pathways of oseltamivir to avian influenza H5N1 neuraminidase

    NASA Astrophysics Data System (ADS)

    Tran, Diem-Trang T.; Le, Ly T.; Truong, Thanh N.

    2013-08-01

    Drug binding and unbinding are transient processes which are hardly observed by experiment and difficult to analyze by computational techniques. In this paper, we employed a cost-effective method called "pathway docking" in which molecular docking was used to screen ligand-receptor binding free energy surface to reveal possible paths of ligand approaching protein binding pocket. A case study was applied on oseltamivir, the key drug against influenza a virus. The equilibrium pathways identified by this method are found to be similar to those identified in prior studies using highly expensive computational approaches.

  8. Variable Dependence of Signaling Output on Agonist Occupancy of Ste2p, a G Protein-coupled Receptor in Yeast.

    PubMed

    Sridharan, Rajashri; Connelly, Sara M; Naider, Fred; Dumont, Mark E

    2016-11-11

    We report here on the relationship between ligand binding and signaling responses in the yeast pheromone response pathway, a well characterized G protein-coupled receptor system. Responses to agonist (α-factor) by cells expressing widely varying numbers of receptors depend primarily on fractional occupancy, not the absolute number of agonist-bound receptors. Furthermore, the concentration of competitive antagonist required to inhibit α-factor-dependent signaling is more than 10-fold higher than predicted based on the known ligand affinities. Thus, responses to a particular number of agonist-bound receptors can vary greatly, depending on whether there are unoccupied or antagonist-bound receptors present on the same cell surface. This behavior does not appear to be due to pre-coupling of receptors to G protein or to the Sst2p regulator of G protein signaling. The results are consistent with a signaling response that is determined by the integration of positive signals from agonist-occupied receptors and inhibitory signals from unoccupied receptors, where the inhibitory signals can be diminished by antagonist binding. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Structure of the Epstein-Barr virus gp42 protein bound to the MHC class II recepter HLA-DR1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullen, M.; Haan, K.M.; Longnecker, R.

    Epstein-Barr virus (EBV) causes infectious mononucleosis, establishes long-term latent infections, and is associated with a variety of human tumors. The EBV gp42 glycoprotein binds MHC class II molecules, playing a critical role in infection of B lymphocytes. EBV gp42 belongs to the C-type lectin superfamily, with homology to NK receptors of the immune system. We report the crystal structure of gp42 bound to the human MHC class II molecule HLA-DR1. The gp42 binds HLA-DR1 using a surface site that is distinct from the canonical lectin and NK receptor ligand binding sites. At the canonical ligand binding site, gp42 forms amore » large hydrophobic groove, which could interact with other ligands necessary for EBV entry, providing a mechanism for coupling MHC recognition and membrane fusion.« less

  10. Method for screening inhibitors of the toxicity of Bacillus anthracis

    DOEpatents

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  11. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus

    PubMed Central

    Alejo, Alí; Ruiz-Argüello, M. Begoña; Ho, Yin; Smith, Vincent P.; Saraiva, Margarida; Alcami, Antonio

    2006-01-01

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis. PMID:16581912

  12. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus.

    PubMed

    Alejo, Alí; Ruiz-Argüello, M Begoña; Ho, Yin; Smith, Vincent P; Saraiva, Margarida; Alcami, Antonio

    2006-04-11

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis.

  13. Molecular cloning of rat sperm galactosyl receptor, a C-type lectin with in vitro egg binding activity.

    PubMed

    Rivkin, E; Tres, L L; Kaplan-Kraicer, R; Shalgi, R; Kierszenbaum, A L

    2000-07-01

    Rat sperm galactosyl receptor is a member of the C-type animal lectin family showing preferential binding to N-acetylgalactosamine compared to galactose. Binding is mediated by a Ca(2+)-dependent carbohydrate-recognition domain (CRD) identical to that of the minor variant of rat hepatic lectin receptor 2/3 (RHL-2/3). The molecular organization of the genomic DNA, cDNA, and derived amino acid sequence of rat testis galactosyl receptor have been determined and in vitro fertilization studies were conducted to ascertain its role. We have determined that the rat testis galactosyl receptor gene generates two mRNA species: one species, designated liver-type, is identical to RHL-2/3; the other, designated testis-type, contains one unspliced intron (86 nt) which alters the reading frame and changes the amino acid sequence of the carboxyl terminus. As a result, the CRD (glutamine-proline-aspartic acid/QPD) and flanked Ca(2+)-binding amino acid sequences were not present in the testis-type protein. Northern and Southern blots demonstrated presence of transcripts with unspliced intron in rat sperm but not liver. Similarly, antibody, raised against a synthetic 12-amino acid peptide (p12) encoded by the unspliced intron, recognized in immunoblots a 54 kDa receptor protein in protein extracts from testis but not from liver. Immunofluorescence and immunogold electron microscopy studies demonstrated that both protein species localized on the plasma membrane surface of the head and tail of rat sperm. Furthermore, capacitated rat sperm preincubated with polyclonal antisera to RHL-2/3 or to the CRD of the liver-type galactosyl receptor showed a statistically significant decrease in the in vitro fertilization rate. We conclude that rat sperm galactosyl receptor may play a role in egg binding and that an undetermined molecular mechanism operates to generate two proteins with identical intracellular amino terminal domain but only one of them displays a CRD and associated Ca(2+)-binding sites at the carboxyl terminal extracellular domain. Copyright 2000 Wiley-Liss, Inc.

  14. Lack of a direct role for macrosialin in oxidized LDL metabolism.

    PubMed

    de Beer, Maria C; Zhao, Zhenze; Webb, Nancy R; van der Westhuyzen, Deneys R; de Villiers, Willem J S

    2003-04-01

    Murine macrosialin (MS), a scavenger receptor family member, is a heavily glycosylated transmembrane protein expressed predominantly in macrophage late endosomes. MS is also found on the cell surface where it is suggested, on the basis of ligand blotting, to bind oxidized LDL (oxLDL). Here we report on the regulation of MS by an atherogenic high-fat diet and oxLDL, and on the inability of MS in transfected cells to bind oxLDL. MS expression was markedly increased in the livers of atherosclerosis-susceptible C57BL/6 and atherosclerosis-resistant C3H/HeJ mice fed an atherogenic high-fat diet. In resident-mouse peritoneal macrophages, treatment with oxLDL upregulated MS mRNA and protein expression 1.5- to 3-fold. MS, overexpressed in COS-7 cells through adenovirus mediated gene transfer, bound oxLDL by ligand blotting. However, no binding of oxLDL to MS was observed in intact transfected COS-7 and Chinese hamster ovary cells, despite significant cell surface expression of MS. Furthermore, inhibition of MS through gene silencing did not affect the binding of oxLDL to macrophages. We conclude that although MS expression in macrophages and Kupffer cells is responsive to a proatherogenic inflammatory diet and to oxLDL, MS does not function as an oxLDL receptor on the cell surface.

  15. Binding of the Kaposi's Sarcoma-Associated Herpesvirus to the Ephrin Binding Surface of the EphA2 Receptor and Its Inhibition by a Small Molecule

    PubMed Central

    Hahn, Alexander S.

    2014-01-01

    ABSTRACT The ephrin receptor tyrosine kinase A2 (EphA2) is an entry receptor for Kaposi's sarcoma-associated herpesvirus (KSHV) that is engaged by the virus through its gH/gL glycoprotein complex. We describe here that natural ephrin ligands inhibit the gH/gL-EphA2 interaction. The effects of point mutations within EphA2 demonstrated that KSHV gH/gL interacts with EphA2 through a restricted set of the same residues that mediate binding of A-type ephrins. Two previously described inhibitors of the EphA2 interaction with ephrin A5 also inhibited binding of KSHV gH/gL to EphA2. The more potent of the two compounds inhibited KSHV infection of blood vessel and lymphatic endothelial cells in the micromolar concentration range. Our results demonstrate that interaction of KSHV with EphA2 occurs in a fashion similar to that of the natural ephrin ligands. Our data further indicate a new avenue for drug development against KSHV. IMPORTANCE Our study reports two important findings. First, we show that KSHV engages its receptor, the receptor tyrosine kinase EphA2, at a site that overlaps the binding site of the natural ephrin ligands. Second, we demonstrate that KSHV infection of target cells can be blocked by a small-molecule inhibitor of the viral glycoprotein-EphA2 interaction. These findings represent a novel avenue for the development of strategies to treat KSHV-associated diseases. PMID:24899181

  16. Caspase-8 Binding to Cardiolipin in Giant Unilamellar Vesicles Provides a Functional Docking Platform for Bid

    PubMed Central

    Perry, Mark; Granjon, Thierry; Gonzalvez, François; Gottlieb, Eyal; Ayala-Sanmartin, Jesus; Klösgen, Beate; Schwille, Petra; Petit, Patrice X.

    2013-01-01

    Caspase-8 is involved in death receptor-mediated apoptosis in type II cells, the proapoptotic programme of which is triggered by truncated Bid. Indeed, caspase-8 and Bid are the known intermediates of this signalling pathway. Cardiolipin has been shown to provide an anchor and an essential activating platform for caspase-8 at the mitochondrial membrane surface. Destabilisation of this platform alters receptor-mediated apoptosis in diseases such as Barth Syndrome, which is characterised by the presence of immature cardiolipin which does not allow caspase-8 binding. We used a simplified in vitro system that mimics contact sites and/or cardiolipin-enriched microdomains at the outer mitochondrial surface in which the platform consisting of caspase-8, Bid and cardiolipin was reconstituted in giant unilamellar vesicles. We analysed these vesicles by flow cytometry and confirm previous results that demonstrate the requirement for intact mature cardiolipin for caspase-8 activation and Bid binding and cleavage. We also used confocal microscopy to visualise the rupture of the vesicles and their revesiculation at smaller sizes due to alteration of the curvature following caspase-8 and Bid binding. Biophysical approaches, including Laurdan fluorescence and rupture/tension measurements, were used to determine the ability of these three components (cardiolipin, caspase-8 and Bid) to fulfil the minimal requirements for the formation and function of the platform at the mitochondrial membrane. Our results shed light on the active functional role of cardiolipin, bridging the gap between death receptors and mitochondria. PMID:23418437

  17. Nucleolin: acharan sulfate–binding protein on the surface of cancer cells

    PubMed Central

    Joo, Eun Ji; ten Dam, Gerdy B.; van Kuppevelt, Toin H.; Toida, Toshihiko; Linhardt, Robert J.; Kim, Yeong Shik

    2005-01-01

    Glycosaminoglycans (GAGs) are complex polysaccharides that participate in the regulation of physiological processes through the interactions with a wide variety of proteins. Acharan sulfate (AS), isolated from the giant African snail Achatina fulica, primarily consists of the repeating disaccharide structure α-D-N-acetylglucosaminyl (1→4) 2-sulfoiduronic acid. Exogenous AS was injected subcutaneously near the tumor tissue in C57BL/6 mice that had been implanted with Lewis lung carcinoma cells (LLCs). The location of AS in the tumor was assessed by staining of sectioned tissues with alcian blue and periodic acid–Schiff (PAS) reagent. In vitro assays indicated binding of cells to 50 μg/ml AS (or heparin) after a 5-h incubation. Immunofluorescence assays, using anti-AS antibody, detected AS at the cell surface. The outer-surface of LLCs were next biotinylated to identify the AS-binding proteins. Biotinylated cells were lysed, and the lysates were fractionated on the AS affinity column using a stepwise salt gradient (0, 0.1, 0.3, 0.5, 0.7, 1.0, and 2.0 M). The fractions were analyzed by SDS–PAGE with silver staining and western blotting. We focused on the proteins with high affinity for AS (eluting at 1 M NaCl) and detected only two bands by western blotting. ESI Q-TOF MS analysis of one of these bands, molecular weight ~110 kDa, showed it to be nucleolin. A phosphorylated form of nucleolin on the surface of cells acts as a cell surface receptor for a variety of ligands, including growth factors (i.e., basic fibroblast growth factor) and chemokines (i.e., midkine). These results show that nucleolin is one of several AS-binding proteins and suggest that AS might demonstrate its tumor growth inhibitory activity by binding the nucleolin receptor protein on the surface of cancer cells. PMID:15329357

  18. Allelic variation in KIR2DL3 generates a KIR2DL2-like receptor with increased binding to its HLA-C ligand.

    PubMed

    Frazier, William R; Steiner, Noriko; Hou, Lihua; Dakshanamurthy, Sivanesan; Hurley, Carolyn Katovich

    2013-06-15

    Although extensive homology exists between their extracellular domains, NK cell inhibitory receptors killer Ig-like receptor (KIR) 2DL2*001 and KIR2DL3*001 have previously been shown to differ substantially in their HLA-C binding avidity. To explore the largely uncharacterized impact of allelic diversity, the most common KIR2DL2/3 allelic products in European American and African American populations were evaluated for surface expression and binding affinity to their HLA-C group 1 and 2 ligands. Although no significant differences in the degree of cell membrane localization were detected in a transfected human NKL cell line by flow cytometry, surface plasmon resonance and KIR binding to a panel of HLA allotypes demonstrated that KIR2DL3*005 differed significantly from other KIR2DL3 allelic products in its ability to bind HLA-C. The increased affinity and avidity of KIR2DL3*005 for its ligand was also demonstrated to have a larger impact on the inhibition of IFN-γ production by the human KHYG-1 NK cell line compared with KIR2DL3*001, a low-affinity allelic product. Site-directed mutagenesis established that the combination of arginine at residue 11 and glutamic acid at residue 35 in KIR2DL3*005 were critical to the observed phenotype. Although these residues are distal to the KIR/HLA-C interface, molecular modeling suggests that alteration in the interdomain hinge angle of KIR2DL3*005 toward that found in KIR2DL2*001, another strong receptor of the KIR2DL2/3 family, may be the cause of this increased affinity. The regain of inhibitory capacity by KIR2DL3*005 suggests that the rapidly evolving KIR locus may be responding to relatively recent selective pressures placed upon certain human populations.

  19. Enzymatic treatment of duck hepatitis B virus: Topology of the surface proteins for virions and noninfectious subviral particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Franke, Claudia; Matschl, Urte; Bruns, Michael

    The large surface antigen L of duck hepatitis B virus exhibits a mixed topology with the preS domains of the protein alternatively exposed to the particles' interior or exterior. After separating virions from subviral particles (SVPs), we compared their L topologies and showed that both particle types exhibit the same amount of L with the following differences: 1-preS of intact virions was enzymatically digested with chymotrypsin, whereas in SVPs only half of preS was accessible, 2-phosphorylation of L at S118 was completely removed by phosphatase treatment only in virions, 3-iodine-125 labeling disclosed a higher ratio of exposed preS to Smore » domains in virions compared to SVPs. These data point towards different surface architectures of virions and SVPs. Because the preS domain acts in binding to a cellular receptor of hepatocytes, our findings implicate the exclusion of SVPs as competitors for the receptor binding and entry of virions.« less

  20. Measles virus fusion machinery activated by sialic acid binding globular domain.

    PubMed

    Talekar, Aparna; Moscona, Anne; Porotto, Matteo

    2013-12-01

    Paramyxoviruses, including the human pathogen measles virus (MV) and the avian Newcastle disease virus (NDV), enter host cells through fusion of the viral envelope with the target cell membrane. This fusion is driven by the concerted action of two viral envelope glycoproteins: the receptor binding protein and the fusion protein (F). The MV receptor binding protein (hemagglutinin [H]) attaches to proteinaceous receptors on host cells, while the receptor binding protein of NDV (hemagglutinin-neuraminidase [HN]) interacts with sialic acid-containing receptors. The receptor-bound HN/H triggers F to undergo conformational changes that render it competent to mediate fusion of the viral and cellular membranes. The mechanism of fusion activation has been proposed to be different for sialic acid-binding viruses and proteinaceous receptor-binding viruses. We report that a chimeric protein containing the NDV HN receptor binding region and the MV H stalk domain can activate MV F to fuse, suggesting that the signal to the stalk of a protein-binding receptor binding molecule can be transmitted from a sialic acid binding domain. By engineering the NDV HN globular domain to interact with a proteinaceous receptor, the fusion activation signal was preserved. Our findings are consistent with a unified mechanism of fusion activation, at least for the Paramyxovirinae subfamily, in which the receptor binding domains of the receptor binding proteins are interchangeable and the stalk determines the specificity of F activation.

  1. Quantitative analysis reveals how EGFR activation and downregulation are coupled in normal but not in cancer cells

    PubMed Central

    Capuani, Fabrizio; Conte, Alexia; Argenzio, Elisabetta; Marchetti, Luca; Priami, Corrado; Polo, Simona; Di Fiore, Pier Paolo; Sigismund, Sara; Ciliberto, Andrea

    2015-01-01

    Ubiquitination of the epidermal growth factor receptor (EGFR) that occurs when Cbl and Grb2 bind to three phosphotyrosine residues (pY1045, pY1068 and pY1086) on the receptor displays a sharp threshold effect as a function of EGF concentration. Here we use a simple modelling approach together with experiments to show that the establishment of the threshold requires both the multiplicity of binding sites and cooperative binding of Cbl and Grb2 to the EGFR. While the threshold is remarkably robust, a more sophisticated model predicted that it could be modulated as a function of EGFR levels on the cell surface. We confirmed experimentally that the system has evolved to perform optimally at physiological levels of EGFR. As a consequence, this system displays an intrinsic weakness that causes—at the supraphysiological levels of receptor and/or ligand associated with cancer—uncoupling of the mechanisms leading to signalling through phosphorylation and attenuation through ubiquitination. PMID:26264748

  2. Surface heat shock protein 90 serves as a potential receptor for calcium oxalate crystal on apical membrane of renal tubular epithelial cells.

    PubMed

    Fong-Ngern, Kedsarin; Sueksakit, Kanyarat; Thongboonkerd, Visith

    2016-07-01

    Adhesion of calcium oxalate monohydrate (COM) crystals on renal tubular epithelial cells is a crucial step in kidney stone formation. Finding potential crystal receptors on the apical membrane of the cells may lead to a novel approach to prevent kidney stone disease. Our previous study identified a large number of crystal-binding proteins on the apical membrane of MDCK cells. However, their functional role as potential crystal receptors had not been validated. The present study aimed to address the potential role of heat shock protein 90 (HSP90) as a COM crystal receptor. The apical membrane was isolated from polarized MDCK cells by the peeling method and recovered proteins were incubated with COM crystals. Western blot analysis confirmed the presence of HSP90 in the apical membrane and the crystal-bound fraction. Immunofluorescence staining without permeabilization and laser-scanning confocal microscopy confirmed the surface HSP90 expression on the apical membrane of the intact cells. Crystal adhesion assay showed that blocking surface HSP90 by specific anti-HSP90 antibody and knockdown of HSP90 by small interfering RNA (siRNA) dramatically reduced crystal binding on the apical surface of MDCK cells (by approximately 1/2 and 2/3, respectively). Additionally, crystal internalization assay revealed the presence of HSP90 on the membrane of endocytic vesicle containing the internalized COM crystal. Moreover, pretreatment of MDCK cells with anti-HSP90 antibody significantly reduced crystal internalization (by approximately 1/3). Taken together, our data indicate that HSP90 serves as a potential receptor for COM crystals on the apical membrane of renal tubular epithelial cells and is involved in endocytosis/internalization of the crystals into the cells.

  3. Unsaturated fatty acyl recognition by Frizzled receptors mediates dimerization upon Wnt ligand binding

    PubMed Central

    Nile, Aaron H.; Mukund, Susmith; Stanger, Karen; Wang, Weiru; Hannoush, Rami N.

    2017-01-01

    Frizzled (FZD) receptors mediate Wnt signaling in diverse processes ranging from bone growth to stem cell activity. Moreover, high FZD receptor expression at the cell surface contributes to overactive Wnt signaling in subsets of pancreatic, ovarian, gastric, and colorectal tumors. Despite the progress in biochemical understanding of Wnt–FZD receptor interactions, the molecular basis for recognition of Wnt cis-unsaturated fatty acyl groups by the cysteine-rich domain (CRD) of FZD receptors remains elusive. Here, we determined a crystal structure of human FZD7 CRD unexpectedly bound to a 24-carbon fatty acid. We also report a crystal structure of human FZD5 CRD bound to C16:1 cis-Δ9 unsaturated fatty acid. Both structures reveal a dimeric arrangement of the CRD. The lipid-binding groove exhibits flexibility and spans both monomers, adopting a U-shaped geometry that accommodates the fatty acid. Re-evaluation of the published mouse FZD8 CRD structure reveals that it also shares the same architecture as FZD5 and FZD7 CRDs. Our results define a common molecular mechanism for recognition of the cis-unsaturated fatty acyl group, a necessary posttranslational modification of Wnts, by multiple FZD receptors. The fatty acid bridges two CRD monomers, implying that Wnt binding mediates FZD receptor dimerization. Our data uncover possibilities for the arrangement of Wnt–FZD CRD complexes and shed structural insights that could aide in the identification of pharmacological strategies to modulate FZD receptor function. PMID:28377511

  4. A Modeling and Experimental Investigation of the Effects of Antigen Density, Binding Affinity, and Antigen Expression Ratio on Bispecific Antibody Binding to Cell Surface Targets*

    PubMed Central

    Rhoden, John J.; Dyas, Gregory L.

    2016-01-01

    Despite the increasing number of multivalent antibodies, bispecific antibodies, fusion proteins, and targeted nanoparticles that have been generated and studied, the mechanism of multivalent binding to cell surface targets is not well understood. Here, we describe a conceptual and mathematical model of multivalent antibody binding to cell surface antigens. Our model predicts that properties beyond 1:1 antibody:antigen affinity to target antigens have a strong influence on multivalent binding. Predicted crucial properties include the structure and flexibility of the antibody construct, the target antigen(s) and binding epitope(s), and the density of antigens on the cell surface. For bispecific antibodies, the ratio of the expression levels of the two target antigens is predicted to be critical to target binding, particularly for the lower expressed of the antigens. Using bispecific antibodies of different valencies to cell surface antigens including MET and EGF receptor, we have experimentally validated our modeling approach and its predictions and observed several nonintuitive effects of avidity related to antigen density, target ratio, and antibody affinity. In some biological circumstances, the effect we have predicted and measured varied from the monovalent binding interaction by several orders of magnitude. Moreover, our mathematical framework affords us a mechanistic interpretation of our observations and suggests strategies to achieve the desired antibody-antigen binding goals. These mechanistic insights have implications in antibody engineering and structure/activity relationship determination in a variety of biological contexts. PMID:27022022

  5. Neuronal Calcium Sensor-1 Binds the D2 Dopamine Receptor and G-protein-coupled Receptor Kinase 1 (GRK1) Peptides Using Different Modes of Interactions.

    PubMed

    Pandalaneni, Sravan; Karuppiah, Vijaykumar; Saleem, Muhammad; Haynes, Lee P; Burgoyne, Robert D; Mayans, Olga; Derrick, Jeremy P; Lian, Lu-Yun

    2015-07-24

    Neuronal calcium sensor-1 (NCS-1) is the primordial member of the neuronal calcium sensor family of EF-hand Ca(2+)-binding proteins. It interacts with both the G-protein-coupled receptor (GPCR) dopamine D2 receptor (D2R), regulating its internalization and surface expression, and the cognate kinases GRK1 and GRK2. Determination of the crystal structures of Ca(2+)/NCS-1 alone and in complex with peptides derived from D2R and GRK1 reveals that the differential recognition is facilitated by the conformational flexibility of the C-lobe-binding site. We find that two copies of the D2R peptide bind within the hydrophobic crevice on Ca(2+)/NCS-1, but only one copy of the GRK1 peptide binds. The different binding modes are made possible by the C-lobe-binding site of NCS-1, which adopts alternative conformations in each complex. C-terminal residues Ser-178-Val-190 act in concert with the flexible EF3/EF4 loop region to effectively form different peptide-binding sites. In the Ca(2+)/NCS-1·D2R peptide complex, the C-terminal region adopts a 310 helix-turn-310 helix, whereas in the GRK1 peptide complex it forms an α-helix. Removal of Ser-178-Val-190 generated a C-terminal truncation mutant that formed a dimer, indicating that the NCS-1 C-terminal region prevents NCS-1 oligomerization. We propose that the flexible nature of the C-terminal region is essential to allow it to modulate its protein-binding sites and adapt its conformation to accommodate both ligands. This appears to be driven by the variability of the conformation of the C-lobe-binding site, which has ramifications for the target specificity and diversity of NCS-1. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Neuronal Calcium Sensor-1 Binds the D2 Dopamine Receptor and G-protein-coupled Receptor Kinase 1 (GRK1) Peptides Using Different Modes of Interactions*

    PubMed Central

    Pandalaneni, Sravan; Karuppiah, Vijaykumar; Saleem, Muhammad; Haynes, Lee P.; Burgoyne, Robert D.; Mayans, Olga; Derrick, Jeremy P.; Lian, Lu-Yun

    2015-01-01

    Neuronal calcium sensor-1 (NCS-1) is the primordial member of the neuronal calcium sensor family of EF-hand Ca2+-binding proteins. It interacts with both the G-protein-coupled receptor (GPCR) dopamine D2 receptor (D2R), regulating its internalization and surface expression, and the cognate kinases GRK1 and GRK2. Determination of the crystal structures of Ca2+/NCS-1 alone and in complex with peptides derived from D2R and GRK1 reveals that the differential recognition is facilitated by the conformational flexibility of the C-lobe-binding site. We find that two copies of the D2R peptide bind within the hydrophobic crevice on Ca2+/NCS-1, but only one copy of the GRK1 peptide binds. The different binding modes are made possible by the C-lobe-binding site of NCS-1, which adopts alternative conformations in each complex. C-terminal residues Ser-178–Val-190 act in concert with the flexible EF3/EF4 loop region to effectively form different peptide-binding sites. In the Ca2+/NCS-1·D2R peptide complex, the C-terminal region adopts a 310 helix-turn-310 helix, whereas in the GRK1 peptide complex it forms an α-helix. Removal of Ser-178–Val-190 generated a C-terminal truncation mutant that formed a dimer, indicating that the NCS-1 C-terminal region prevents NCS-1 oligomerization. We propose that the flexible nature of the C-terminal region is essential to allow it to modulate its protein-binding sites and adapt its conformation to accommodate both ligands. This appears to be driven by the variability of the conformation of the C-lobe-binding site, which has ramifications for the target specificity and diversity of NCS-1. PMID:25979333

  7. Biotin-transfer from a trifunctional crosslinker for identification of cell surface receptors of soluble protein ligands

    PubMed Central

    Tremblay, Tammy-Lynn; Hill, Jennifer J.

    2017-01-01

    Here we describe a novel crosslinker and its application as a biotin-transfer reagent to identify cell surface receptors of soluble protein ligands on live cells. This crosslinker contains three functional groups: an aldehyde-reactive aminooxy group, a sulfhydryl, and a biotin (ASB). It is readily synthesized via a 3-step addition reaction using standard solid-phase peptide synthesis methods and commercially available intermediates, allowing access to laboratories without specialized synthetic chemistry capabilities. For the biotin-transfer method, ASB is linked to a protein ligand through the sulfhydryl group in a two-step process that allows the introduction of a disulfide bond between the ligand and the crosslinker. Incubation of the labelled ligand with oxidized live cells leads to the formation of crosslinks with aldehyde-containing glycans on the cell surface receptor. Subsequent reduction of the disulfide bond results in biotin transfer from the ligand to the cell surface receptor. Protein biotinylation that is mediated by ligand binding to its receptor is differentiated from background biotinylation events by comparison with a similarly labelled control protein using comparative proteomic mass spectrometry to quantify streptavidin-bound proteins. Using this method, we successfully identified the cell surface receptors of a peptide hormone, a monoclonal antibody, and a single-domain antibody-Fc fusion construct. PMID:28422167

  8. Analysis of cholera toxin-ganglioside interactions by flow cytometry.

    PubMed

    Lauer, Sabine; Goldstein, Byron; Nolan, Rhiannon L; Nolan, John P

    2002-02-12

    Cholera toxin entry into mammalian cells is mediated by binding of the pentameric B subunit (CTB) to ganglioside GM(1) in the cell membrane. We used flow cytometry to quantitatively measure in real time the interactions of fluorescently labeled pentameric cholera toxin B-subunit (FITC-CTB) with its ganglioside receptor on microsphere-supported phospholipid membranes. A model that describes the multiple steps of this mode of recognition was developed to guide our flow cytometric experiments and extract relevant equilibrium and kinetic rate constants. In contrast to previous studies, our approach takes into account receptor cross-linking, an important feature for multivalent interactions. From equilibrium measurements, we determined an equilibrium binding constant for a single subunit of FITC-CTB binding monovalently to GM(1) presented in bilayers of approximately 8 x 10(7) M(-1) while that for binding to soluble GM(1)-pentasaccharide was found to be approximately 4 x 10(6) M(-1). From kinetic measurements, we determined the rate constant for dissociation of a single site of FITC-CTB from microsphere-supported bilayers to be (3.21 +/- 0.03) x 10(-3) s(-1), and the rate of association of a site on FITC-CTB in solution to a GM(1) in the bilayer to be (2.8 +/- 0.4) x 10(4) M(-1) s(-1). These values yield a lower estimate for the equilibrium binding constant of approximately 1 x 10(7) M(-1). We determined the equilibrium surface cross-linking constant [(1.1 +/- 0.1) x 10(-12) cm(2)] and from this value and the value for the rate constant for dissociation derived a value of approximately 3.5 x 10(-15) cm(2) s(-1) for the forward rate constant for cross-linking. We also compared the interaction of the receptor binding B-subunit with that of the whole toxin (A- and B-subunits). Our results show that the whole toxin binds with approximately 100-fold higher avidity than the pentameric B-subunit alone which is most likely due to the additional interaction of the A(2)-subunit with the membrane surface. Interaction of cholera toxin B-subunit and whole cholera toxin with gangliosides other than GM(1) revealed specific binding only to GD1(b) and asialo-GM(1). These interactions, however, are marked by low avidity and require high receptor concentrations to be observed.

  9. Molecular recognition of human ephrinB2 cell surface receptor by an emergent African henipavirus

    PubMed Central

    Lee, Benhur; Pernet, Olivier; Ahmed, Asim A.; Zeltina, Antra; Beaty, Shannon M.; Bowden, Thomas A.

    2015-01-01

    The discovery of African henipaviruses (HNVs) related to pathogenic Hendra virus (HeV) and Nipah virus (NiV) from Southeast Asia and Australia presents an open-ended health risk. Cell receptor use by emerging African HNVs at the stage of host-cell entry is a key parameter when considering the potential for spillover and infection of human populations. The attachment glycoprotein from a Ghanaian bat isolate (GhV-G) exhibits <30% sequence identity with Asiatic NiV-G/HeV-G. Here, through functional and structural analysis of GhV-G, we show how this African HNV targets the same human cell-surface receptor (ephrinB2) as the Asiatic HNVs. We first characterized this virus−receptor interaction crystallographically. Compared with extant HNV-G–ephrinB2 structures, there was significant structural variation in the six-bladed β-propeller scaffold of the GhV-G receptor-binding domain, but not the Greek key fold of the bound ephrinB2. Analysis revealed a surprisingly conserved mode of ephrinB2 interaction that reflects an ongoing evolutionary constraint among geographically distal and phylogenetically divergent HNVs to maintain the functionality of ephrinB2 recognition during virus–host entry. Interestingly, unlike NiV-G/HeV-G, we could not detect binding of GhV-G to ephrinB3. Comparative structure–function analysis further revealed several distinguishing features of HNV-G function: a secondary ephrinB2 interaction site that contributes to more efficient ephrinB2-mediated entry in NiV-G relative to GhV-G and cognate residues at the very C terminus of GhV-G (absent in Asiatic HNV-Gs) that are vital for efficient receptor-induced fusion, but not receptor binding per se. These data provide molecular-level details for evaluating the likelihood of African HNVs to spill over into human populations. PMID:25825759

  10. Ligand Entry and Exit Pathways in the β2-adrenergic Receptor

    PubMed Central

    Wang, Ting; Duan, Yong

    2009-01-01

    The recently determined crystal structure of the human β2-adrenergic (β2AR) G-protein coupled receptor provides an excellent structural basis for exploring β2AR -ligand binding and dissociation process. Based on this crystal structure, we simulated ligand exit from the β2AR receptor by applying the random acceleration molecular dynamics (RAMD) simulation method. The simulation results showed that the extracellular opening on the receptor surface was the most frequently observed egress point (referred to as pathway A) and a few other pathways through inter-helical clefts were also observed with significantly lower frequencies. In the egress trajectories along pathway A, the D192-K305 salt bridge between the extracellular loop 2 (ECL2) and the apex of the transmembrane helix 7 (TM7) was exclusively broken. The spatial occupancy maps of the ligand computed from the 100 RAMD simulation trajectories indicated that the receptor-ligand interactions that restrained the ligand in the binding pocket were the major resistance encountered by the ligand during exit and no second barrier was notable. We next performed RAMD simulations by using a putative ligand-free conformation of the receptor as input structure. This conformation was obtained in a standard MD simulation in the absence of the ligand and it differed from the ligand-bound conformation in a hydrophobic patch bridging ECL2 and TM7 due to the rotation of F193 of ECL2. Results from the RAMD simulations with this putative ligand-free conformation suggest that the cleft formed by the hydrophobic bridge, TM2, TM3 and TM7 on the extracellular surface likely serves as a more specific ligand-entry site and the ECL2-TM7 hydrophobic junction can be partially interrupted upon the entry of ligand that pushes F193 to rotate, resulting in a conformation as observed in the ligand-bound crystal structure. These results may help design β2AR-targeting drugs with improved efficacy as well as understand the receptor subtype-selectivity of ligand binding in the β family of the adrenergic receptors that share almost identical ligand-binding pockets but show notable amino acid sequence divergence in the putative ligand-entry site, including ECL2 and the extracellular end of TM7. PMID:19665031

  11. Ligand binding and dynamics of the monomeric epidermal growth factor receptor ectodomain

    PubMed Central

    Loeffler, Hannes H; Winn, Martyn D

    2013-01-01

    The ectodomain of the human epidermal growth factor receptor (hEGFR) controls input to several cell signalling networks via binding with extracellular growth factors. To gain insight into the dynamics and ligand binding of the ectodomain, the hEGFR monomer was subjected to molecular dynamics simulation. The monomer was found to be substantially more flexible than the ectodomain dimer studied previously. Simulations where the endogeneous ligand EGF binds to either Subdomain I or Subdomain III, or where hEGFR is unbound, show significant differences in dynamics. The molecular mechanics Poisson–Boltzmann surface area method has been used to derive relative free energies of ligand binding, and we find that the ligand is capable of binding either subdomain with a slight preference for III. Alanine-scanning calculations for the effect of selected ligand mutants on binding reproduce the trends of affinity measurements. Taken together, these results emphasize the possible role of the ectodomain monomer in the initial step of ligand binding, and add details to the static picture obtained from crystal structures. Proteins 2013; 81:1931–1943. © 2013 The Authors. Proteins published by Wiley Periodicals, Inc. PMID:23760854

  12. Applications of Surface Plasmon Resonance for Characterization of Molecules Important in the Pathogenesis and Treatment of Neurodegenerative Diseases

    PubMed Central

    Wittenberg, Nathan J.; Wootla, Bharath; Jordan, Luke R.; Denic, Aleksandar; Warrington, Arthur E.; Oh, Sang-Hyun; Rodriguez, Moses

    2014-01-01

    Characterization of binding kinetics and affinity between a potential new drug and its receptor are key steps in the development of new drugs. Among the techniques available to determine binding affinities, surface plasmon resonance has emerged as the gold standard because it can measure binding and dissociation rates in real-time in a label-free fashion. Surface plasmon resonance is now finding applications in the characterization of molecules for treatment of neurodegenerative diseases, characterization of molecules associated with pathogenesis of neurodegenerative diseases and detection of neurodegenerative disease biomarkers. In addition it has been used in the characterization of a new class of natural autoantibodies that have therapeutic potential in a number of neurologic diseases. In this review we will introduce surface plasmon resonance and describe some applications of the technique that pertain to neurodegenerative disorders and their treatment. PMID:24625008

  13. Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock.

    PubMed

    Van Amersfoort, Edwin S; Van Berkel, Theo J C; Kuiper, Johan

    2003-07-01

    Bacterial sepsis and septic shock result from the overproduction of inflammatory mediators as a consequence of the interaction of the immune system with bacteria and bacterial wall constituents in the body. Bacterial cell wall constituents such as lipopolysaccharide, peptidoglycans, and lipoteichoic acid are particularly responsible for the deleterious effects of bacteria. These constituents interact in the body with a large number of proteins and receptors, and this interaction determines the eventual inflammatory effect of the compounds. Within the circulation bacterial constituents interact with proteins such as plasma lipoproteins and lipopolysaccharide binding protein. The interaction of the bacterial constituents with receptors on the surface of mononuclear cells is mainly responsible for the induction of proinflammatory mediators by the bacterial constituents. The role of individual receptors such as the toll-like receptors and CD14 in the induction of proinflammatory cytokines and adhesion molecules is discussed in detail. In addition, the roles of a number of other receptors that bind bacterial compounds such as scavenger receptors and their modulating role in inflammation are described. Finally, the therapies for the treatment of bacterial sepsis and septic shock are discussed in relation to the action of the aforementioned receptors and proteins.

  14. Leukocyte Cell Surface Proteinases: Regulation of Expression, Functions, and Mechanisms of Surface Localization

    PubMed Central

    Owen, Caroline A.

    2008-01-01

    A number of proteinases are expressed on the surface of leukocytes including members of the serine, metallo-, and cysteine proteinase superfamilies. Some proteinases are anchored to the plasma membrane of leukocytes by a transmembrane domain or a glycosyl phosphatidyl inositol (GPI) anchor. Other proteinases bind with high affinity to classical receptors, or with lower affinity to integrins, proteoglycans, or other leukocyte surface molecules. Leukocyte surface levels of proteinases are regulated by: 1) cytokines, chemokines, bacterial products, and growth factors which stimulate synthesis and/or release of proteinase by cells; 2) the availability of surface binding sites for proteinases; and/or 3) internalization or shedding of surface-bound proteinases. The binding of proteinases to leukocyte surfaces serves many functions including: 1) concentrating the activity of proteinases to the immediate pericellular environment; 2) facilitating pro-enzyme activation; 3) increasing proteinase stability and retention in the extracellular space; 4) regulating leukocyte function by proteinases signaling through cell surface binding sites or other surface proteins; and 5) protecting proteinases from inhibition by extracellular proteinase inhibitors. There is strong evidence that membrane-associated proteinases on leukocytes play critical roles in wound healing, inflammation, extracellular matrix remodeling, fibrinolysis, and coagulation. This review will outline the biology of membrane-associated proteinases expressed by leukocytes and their roles in physiologic and pathologic processes. PMID:18329945

  15. Determinants of glycan receptor specificity of H2N2 influenza A virus hemagglutinin.

    PubMed

    Viswanathan, Karthik; Koh, Xiaoying; Chandrasekaran, Aarthi; Pappas, Claudia; Raman, Rahul; Srinivasan, Aravind; Shriver, Zachary; Tumpey, Terrence M; Sasisekharan, Ram

    2010-10-29

    The H2N2 subtype of influenza A virus was responsible for the Asian pandemic of 1957-58. However, unlike other subtypes that have caused pandemics such as H1N1 and H3N2, which continue to circulate among humans, H2N2 stopped circulating in the human population in 1968. Strains of H2 subtype still continue to circulate in birds and occasionally pigs and could be reintroduced into the human population through antigenic drift or shift. Such an event is a potential global health concern because of the waning population immunity to H2 hemagglutinin (HA). The first step in such a cross-species transmission and human adaptation of influenza A virus is the ability for its surface glycoprotein HA to bind to glycan receptors expressed in the human upper respiratory epithelia. Recent structural and biochemical studies have focused on understanding the glycan receptor binding specificity of the 1957-58 pandemic H2N2 HA. However, there has been considerable HA sequence divergence in the recent avian-adapted H2 strains from the pandemic H2N2 strain. Using a combination of structural modeling, quantitative glycan binding and human respiratory tissue binding methods, we systematically identify mutations in the HA from a recent avian-adapted H2N2 strain (A/Chicken/PA/2004) that make its quantitative glycan receptor binding affinity (defined using an apparent binding constant) comparable to that of a prototypic pandemic H2N2 (A/Albany/6/58) HA.

  16. Determinants of Glycan Receptor Specificity of H2N2 Influenza A Virus Hemagglutinin

    PubMed Central

    Chandrasekaran, Aarthi; Pappas, Claudia; Raman, Rahul; Srinivasan, Aravind; Shriver, Zachary; Tumpey, Terrence M.; Sasisekharan, Ram

    2010-01-01

    The H2N2 subtype of influenza A virus was responsible for the Asian pandemic of 1957-58. However, unlike other subtypes that have caused pandemics such as H1N1 and H3N2, which continue to circulate among humans, H2N2 stopped circulating in the human population in 1968. Strains of H2 subtype still continue to circulate in birds and occasionally pigs and could be reintroduced into the human population through antigenic drift or shift. Such an event is a potential global health concern because of the waning population immunity to H2 hemagglutinin (HA). The first step in such a cross-species transmission and human adaptation of influenza A virus is the ability for its surface glycoprotein HA to bind to glycan receptors expressed in the human upper respiratory epithelia. Recent structural and biochemical studies have focused on understanding the glycan receptor binding specificity of the 1957-58 pandemic H2N2 HA. However, there has been considerable HA sequence divergence in the recent avian-adapted H2 strains from the pandemic H2N2 strain. Using a combination of structural modeling, quantitative glycan binding and human respiratory tissue binding methods, we systematically identify mutations in the HA from a recent avian-adapted H2N2 strain (A/Chicken/PA/2004) that make its quantitative glycan receptor binding affinity (defined using an apparent binding constant) comparable to that of a prototypic pandemic H2N2 (A/Albany/6/58) HA. PMID:21060797

  17. Cholera toxin binding affinity and specificity for gangliosides determined by surface plasmon resonance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuziemko, G.M.; Stroh, M.; Stevens, R.C.

    1996-05-21

    The present study determines the affinity of cholera toxin for the ganglioside series GM1, GM2, GM3, GD1A, GD1B, GT1B, asialo GM1, globotriosyl ceramide, and lactosyl ceramide using real time biospecific interaction analysis (surface plasmon resonance, SPR). SPR shows that cholera toxin preferably binds to gangliosides in the following sequence: GM1 > GM2 > GD1A > GM3 > GT1B > GD1B > asialo-GM1. The measured binding affinity of cholera toxin for the ganglioside sequence ranges from 4.61 {times} 10{sup {minus}12} M for GM1 to 1.88 {times} 10{sup {minus}10} M for asialo GM1. The picomolar values obtained by surface plasmon resonance aremore » similar to K{sub d} values determined with whole-cell binding assays. Both whole-cell assays ans SPR measurements on synthetic membranes are higher than free solution measurements by several orders of magnitude. This difference may be caused by the effects of avidity and charged lipid head-groups, which may play a major role in the binding between cholera toxin, the receptor, and the membrane surface. The primary difference between free solution binding studies and surface plasmon resonance studies is that the latter technique is performed on surfaces resembling the cell membrane. Surface plasmon resonance has the further advantage of measuring apparent kinetic association and dissociation rates in real time, providing direct information about binding events at the membrane surface. 34 refs., 8 figs., 2 tabs.« less

  18. Host-Primed Ebola Virus GP Exposes a Hydrophobic NPC1 Receptor-Binding Pocket, Revealing a Target for Broadly Neutralizing Antibodies.

    PubMed

    Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann

    2016-02-23

    The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.

  19. A human-specific, truncated α7 nicotinic receptor subunit assembles with full-length α7 and forms functional receptors with different stoichiometries.

    PubMed

    Lasala, Matías; Corradi, Jeremías; Bruzzone, Ariana; Esandi, María Del Carmen; Bouzat, Cecilia

    2018-05-21

    The cholinergic α7 nicotinic receptor gene, CHRNA7, encodes a subunit that forms the homopentameric α7 receptor, involved in learning and memory. In humans, exons 5-10 in CHRNA7 are duplicated and fused to the FAM7A genetic element, giving rise to the hybrid gene CHRFAM7A. Its product, dupα7, is a truncated subunit lacking part of the N-terminal extracellular ligand-binding domain and is associated with neurological disorders, including schizophrenia, and immunomodulation.We combined dupα7 expression on mammalian cells with patch clamp recordings to understand its functional role. Transfected cells expressed dupα7 protein, but they exhibited neither surface binding of the α7 antagonist α-bungarotoxin nor responses to acetylcholine (ACh) or to an allosteric agonist that binds to the conserved transmembrane region. To determine if dupα7 assembles with α7, we generated receptors comprising α7 and dupα7 subunits, one of which was tagged with conductance substitutions that report subunit stoichiometry and monitored ACh-elicited channel openings elicited by ACh in the presence of a positive allosteric α7 modulator. We found that α7 and dupα7 subunits co-assemble into functional heteromeric receptors, that at least two α7 subunits are required for channel opening, and that dupα7's presence in the pentameric arrangement does not affect the duration of the potentiated events compare with that of α7. Using an α7 subunit mutant, we found that activation of (α7)2(dupα7)3 receptors occurs through ACh binding at the α7/α7 interfacial binding site. Our study contributes to the understanding of the modulation of α7 function by the human specific, duplicated subunit, associated with human disorders. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Prion Protein-mediated Toxicity of Amyloid-β Oligomers Requires Lipid Rafts and the Transmembrane LRP1*

    PubMed Central

    Rushworth, Jo V.; Griffiths, Heledd H.; Watt, Nicole T.; Hooper, Nigel M.

    2013-01-01

    Soluble oligomers of the amyloid-β (Aβ) peptide cause neurotoxicity, synaptic dysfunction, and memory impairments that underlie Alzheimer disease (AD). The cellular prion protein (PrPC) was recently identified as a high affinity neuronal receptor for Aβ oligomers. We report that fibrillar Aβ oligomers recognized by the OC antibody, which have been shown to correlate with the onset and severity of AD, bind preferentially to cells and neurons expressing PrPC. The binding of Aβ oligomers to cell surface PrPC, as well as their downstream activation of Fyn kinase, was dependent on the integrity of cholesterol-rich lipid rafts. In SH-SY5Y cells, fluorescence microscopy and co-localization with subcellular markers revealed that the Aβ oligomers co-internalized with PrPC, accumulated in endosomes, and subsequently trafficked to lysosomes. The cell surface binding, internalization, and downstream toxicity of Aβ oligomers was dependent on the transmembrane low density lipoprotein receptor-related protein-1 (LRP1). The binding of Aβ oligomers to cell surface PrPC impaired its ability to inhibit the activity of the β-secretase BACE1, which cleaves the amyloid precursor protein to produce Aβ. The green tea polyphenol (−)-epigallocatechin gallate and the red wine extract resveratrol both remodeled the fibrillar conformation of Aβ oligomers. The resulting nonfibrillar oligomers displayed significantly reduced binding to PrPC-expressing cells and were no longer cytotoxic. These data indicate that soluble, fibrillar Aβ oligomers bind to PrPC in a conformation-dependent manner and require the integrity of lipid rafts and the transmembrane LRP1 for their cytotoxicity, thus revealing potential targets to alleviate the neurotoxic properties of Aβ oligomers in AD. PMID:23386614

  1. Analysis of Ethylene Receptors: Ethylene-Binding Assays.

    PubMed

    Binder, Brad M; Schaller, G Eric

    2017-01-01

    Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.

  2. Visualizing High-Efficiency HIV Transfer | Center for Cancer Research

    Cancer.gov

    The Human Immunodeficiency Virus (HIV), the causative agent of Acquired Immunodeficiency Syndrome (AIDS), infects and eventually kills CD4 receptor-expressing T cells, which are critical for proper immune system function. The gp120 protein on the surface of HIV particles is known to bind CD4 and a co-receptor, either CCR5 or CXCR4, leading to fusion of the virus and T cell

  3. Characterization and screening of IgG binding to the neonatal Fc receptor

    PubMed Central

    Neuber, Tobias; Frese, Katrin; Jaehrling, Jan; Jäger, Sebastian; Daubert, Daniela; Felderer, Karin; Linnemann, Mechthild; Höhne, Anne; Kaden, Stefan; Kölln, Johanna; Tiller, Thomas; Brocks, Bodo; Ostendorp, Ralf; Pabst, Stefan

    2014-01-01

    The neonatal Fc receptor (FcRn) protects immunoglobulin G (IgG) from degradation and increases the serum half-life of IgG, thereby contributing to a higher concentration of IgG in the serum. Because altered FcRn binding may result in a reduced or prolonged half-life of IgG molecules, it is advisable to characterize Fc receptor binding of therapeutic antibody lead candidates prior to the start of pre-clinical and clinical studies. In this study, we characterized the interactions between FcRn of different species (human, cynomolgus monkey, mouse and rat) and nine IgG molecules from different species and isotypes with common variable heavy (VH) and variable light chain (VL) domains. Binding was analyzed at acidic and neutral pH using surface plasmon resonance (SPR) and biolayer interferometry (BLI). Furthermore, we transferred the well-accepted, but low throughput SPR-based method for FcRn binding characterization to the BLI-based Octet platform to enable a higher sample throughput allowing the characterization of FcRn binding already during early drug discovery phase. We showed that the BLI-based approach is fit-for-purpose and capable of discriminating between IgG molecules with significant differences in FcRn binding affinities. Using this high-throughput approach we investigated FcRn binding of 36 IgG molecules that represented all VH/VL region combinations available in the fully human, recombinant antibody library Ylanthia®. Our results clearly showed normal FcRn binding profiles for all samples. Hence, the variations among the framework parts, complementarity-determining region (CDR) 1 and CDR2 of the fragment antigen binding (Fab) domain did not significantly change FcRn binding. PMID:24802048

  4. On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

    PubMed

    Speranskiy, Kirill; Kurnikova, Maria

    2005-08-30

    Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

  5. The structure of myostatin:follistatin 288: insights into receptor utilization and heparin binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cash, Jennifer N.; Rejon, Carlis A.; McPherron, Alexandra C.

    2009-09-29

    Myostatin is a member of the transforming growth factor-{beta} (TGF-{beta}) family and a strong negative regulator of muscle growth. Here, we present the crystal structure of myostatin in complex with the antagonist follistatin 288 (Fst288). We find that the prehelix region of myostatin very closely resembles that of TGF-{beta} class members and that this region alone can be swapped into activin A to confer signalling through the non-canonical type I receptor Alk5. Furthermore, the N-terminal domain of Fst288 undergoes conformational rearrangements to bind myostatin and likely acts as a site of specificity for the antagonist. In addition, a unique continuousmore » electropositive surface is created when myostatin binds Fst288, which significantly increases the affinity for heparin. This translates into stronger interactions with the cell surface and enhanced myostatin degradation in the presence of either Fst288 or Fst315. Overall, we have identified several characteristics unique to myostatin that will be paramount to the rational design of myostatin inhibitors that could be used in the treatment of muscle-wasting disorders.« less

  6. Glycan Engagement Dictates Hydrocephalus Induction by Serotype 1 Reovirus

    PubMed Central

    Stencel-Baerenwald, Jennifer; Reiss, Kerstin; Blaum, Bärbel S.; Colvin, Daniel; Li, Xiao-Nan; Abel, Ty; Boyd, Kelli; Stehle, Thilo

    2015-01-01

    ABSTRACT Receptors expressed on the host cell surface adhere viruses to target cells and serve as determinants of viral tropism. Several viruses bind cell surface glycans to facilitate entry, but the contribution of specific glycan moieties to viral disease is incompletely understood. Reovirus provides a tractable experimental model for studies of viral neuropathogenesis. In newborn mice, serotype 1 (T1) reovirus causes hydrocephalus, whereas serotype 3 (T3) reovirus causes encephalitis. T1 and T3 reoviruses engage distinct glycans, suggesting that glycan-binding capacity contributes to these differences in pathogenesis. Using structure-guided mutagenesis, we engineered a mutant T1 reovirus incapable of binding the T1 reovirus-specific glycan receptor, GM2. The mutant virus induced substantially less hydrocephalus than wild-type virus, an effect phenocopied by wild-type virus infection of GM2-deficient mice. In comparison to wild-type virus, yields of mutant virus were diminished in cultured ependymal cells, the cell type that lines the brain ventricles. These findings suggest that GM2 engagement targets reovirus to ependymal cells in mice and illuminate the function of glycan engagement in reovirus serotype-dependent disease. PMID:25736887

  7. Hexapeptide fragment of carcinoembryonic antigen which acts as an agonist of heterogeneous ribonucleoprotein M.

    PubMed

    Palermo, Nicholas Y; Thomas, Peter; Murphy, Richard F; Lovas, Sándor

    2012-04-01

    Colorectal cancers with metastatic potential secrete the glycoprotein carcinoembryonic antigen (CEA). CEA has been implicated in colorectal cancer metastasis by inducing Kupffer cells to produce inflammatory cytokines which, in turn, make the hepatic micro-environment ideal for tumor cell implantation. CEA binds to the heterogeneous ribonucleoprotein M (hnRNP M) which acts as a cell surface receptor in Kupffer cells. The amino acid sequence in CEA, which binds the hnRNP M receptor, is Tyr-Pro-Glu-Leu-Pro-Lys. In this study, the structure of Ac-Tyr-Pro-Glu-Leu-Pro-Lys-NH₂ (YPELPK) was investigated using electronic circular dichroism, vibrational circular dichroism, and molecular dynamics simulations. The binding of the peptide to hnRNP M was also investigated using molecular docking calculations. The biological activity of YPELPK was studied using differentiated human THP-1 cells, which express hnRNP M on their surface and secrete IL-6 when stimulated by CEA. YPELPK forms a stable polyproline-II helix and stimulates IL-6 production of THP-1 cells at micromolar concentrations. Copyright © 2012 European Peptide Society and John Wiley & Sons, Ltd.

  8. Purification, characterization and anticancer activity of a polysaccharide from Panax ginseng.

    PubMed

    Li, Cong; Cai, Jianping; Geng, Jingshu; Li, Yinghong; Wang, Zhenyu; Li, Rui

    2012-12-01

    In this study, we purified a homogeneous polysaccharide (PGPW1) from the root of Panax ginseng. Its molecular weight was estimated to be 3.5×10(5) Da by high performance liquid chromatography (HPLC) and Gas chromatography (GC) analysis identified that PGPW1 contained Glc, Gal, Man and Ara in the molar ratio of 3.3:1.2:0.5:1.1. Furthermore the antitumor potential of PGPW1 on human bladder T24 cells was evaluated in vitro by MTT, lactate dehydrogenase (LDH), wound scratch and transwell motility assays. PGPW1 dose-dependently displayed potent anti-proliferation and anti-metastatic activities. Moreover the modulating effect of PGPW1 on the binding of (3)H-NMS to M3 muscarinic receptors on the surface of T24 cells was evaluated. In muscarinic receptor binding assay, the attenuated expression of M3 muscarinic receptor on the surface of T24 cells by PGPW1 would contribute to its antitumor functions. All the data indicated the potential of its clinical application for the prevention and treatment of bladder cancer metastasis. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. One-step methodology for the direct covalent capture of GPCRs from complex matrices onto solid surfaces based on the bioorthogonal reaction between haloalkane dehalogenase and chloroalkanes† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03887a

    PubMed Central

    Zeng, Kaizhu; Li, Qian; Wang, Jing; Yin, Guowei; Zhang, Yajun; Xiao, Chaoni; Fan, Taiping; Zheng, Xiaohui

    2017-01-01

    Protein immobilization techniques play an important role in the development of assays for disease diagnosis and drug discovery. However, many of these approaches are not applicable to transmembrane proteins. G protein-coupled receptors (GPCRs) are the largest protein superfamily encoded by the human genome and are targeted by a quarter of all prescription drugs. GPCRs are highly dynamic and sensitive to changes in the ambient environment, and current immobilization methodologies are not suitable for GPCRs. We used haloalkane dehalogenase (Halo) as an immobilization tag fused to the β2-adrenoceptor (β2-AR), angiotensin II type 1 (AT1) and angiotensin II type 2 (AT2) receptors. The engineered Halo-tag covalently binds to a specific substrate chloroalkane through Asp 106 in the catalytic pocket. The Halo-tagged GPCRs were expressed in Escherichia coli at a suitable yield. Accordingly, we loaded cell lysate containing Halo-tagged GPCRs onto a macroporous silica gel coated with chloroalkane. Morphological characterization indicated a homogeneous monolayer of immobilized Halo-tagged GPCRs on the silica gel surface. The immobilized receptors proved to be surrounded by specific bound phospholipids including PG C18:1/C18:1. We observed a radio-ligand binding ability and ligand-induced conformational changes in the immobilized GPCRs, suggesting the preservation of bioactivity. This method is a one-step approach for the specific immobilization of GPCRs from cell lysates and validates that immobilized receptors retain canonical ligand binding capacity. Our immobilization strategy circumvents labor-intensive purification procedures and minimizes loss of activity. The immobilized receptors can be applied to high-throughput drug and interaction partner screening for GPCRs. PMID:29629116

  10. Neu1 Sialidase and Matrix Metalloproteinase-9 Cross-talk Is Essential for Toll-like Receptor Activation and Cellular Signaling*

    PubMed Central

    Abdulkhalek, Samar; Amith, Schammim Ray; Franchuk, Susan L.; Jayanth, Preethi; Guo, Merry; Finlay, Trisha; Gilmour, Alanna; Guzzo, Christina; Gee, Katrina; Beyaert, Rudi; Szewczuk, Myron R.

    2011-01-01

    The signaling pathways of mammalian Toll-like receptors (TLRs) are well characterized, but the precise mechanism(s) by which TLRs are activated upon ligand binding remains poorly defined. Recently, we reported a novel membrane sialidase-controlling mechanism that depends on ligand binding to its TLR to induce mammalian neuraminidase-1 (Neu1) activity, to influence receptor desialylation, and subsequently to induce TLR receptor activation and the production of nitric oxide and proinflammatory cytokines in dendritic and macrophage cells. The α-2,3-sialyl residue of TLR was identified as the specific target for hydrolysis by Neu1. Here, we report a membrane signaling paradigm initiated by endotoxin lipopolysaccharide (LPS) binding to TLR4 to potentiate G protein-coupled receptor (GPCR) signaling via membrane Gαi subunit proteins and matrix metalloproteinase-9 (MMP9) activation to induce Neu1. Central to this process is that a Neu1-MMP9 complex is bound to TLR4 on the cell surface of naive macrophage cells. Specific inhibition of MMP9 and GPCR Gαi-signaling proteins blocks LPS-induced Neu1 activity and NFκB activation. Silencing MMP9 mRNA using lentivirus MMP9 shRNA transduction or siRNA transfection of macrophage cells and MMP9 knock-out primary macrophage cells significantly reduced Neu1 activity and NFκB activation associated with LPS-treated cells. These findings uncover a molecular organizational signaling platform of a novel Neu1 and MMP9 cross-talk in alliance with TLR4 on the cell surface that is essential for ligand activation of TLRs and subsequent cellular signaling. PMID:21873432

  11. Molecular Recognition of Corticotropin releasing Factor by Its G protein-coupled Receptor CRFR1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pioszak, Augen A.; Parker, Naomi R.; Suino-Powell, Kelly

    2009-01-15

    The bimolecular interaction between corticotropin-releasing factor (CRF), a neuropeptide, and its type 1 receptor (CRFR1), a class B G-protein-coupled receptor (GPCR), is crucial for activation of the hypothalamic-pituitary-adrenal axis in response to stress, and has been a target of intense drug design for the treatment of anxiety, depression, and related disorders. As a class B GPCR, CRFR1 contains an N-terminal extracellular domain (ECD) that provides the primary ligand binding determinants. Here we present three crystal structures of the human CRFR1 ECD, one in a ligand-free form and two in distinct CRF-bound states. The CRFR1 ECD adopts the alpha-beta-betaalpha fold observedmore » for other class B GPCR ECDs, but the N-terminal alpha-helix is significantly shorter and does not contact CRF. CRF adopts a continuous alpha-helix that docks in a hydrophobic surface of the ECD that is distinct from the peptide-binding site of other class B GPCRs, thereby providing a basis for the specificity of ligand recognition between CRFR1 and other class B GPCRs. The binding of CRF is accompanied by clamp-like conformational changes of two loops of the receptor that anchor the CRF C terminus, including the C-terminal amide group. These structural studies provide a molecular framework for understanding peptide binding and specificity by the CRF receptors as well as a template for designing potent and selective CRFR1 antagonists for therapeutic applications.« less

  12. Affinity of C-Reactive Protein toward FcγRI Is Strongly Enhanced by the γ-Chain

    PubMed Central

    Röcker, Carlheinz; Manolov, Dimitar E.; Kuzmenkina, Elza V.; Tron, Kyrylo; Slatosch, Holger; Torzewski, Jan; Nienhaus, G. Ulrich

    2007-01-01

    C-reactive protein (CRP), the prototype human acute phase protein, is widely regarded as a key player in cardiovascular disease, but the identity of its cellular receptor is still under debate. By using ultrasensitive confocal imaging analysis, we have studied CRP binding to transfected COS-7 cells expressing the high-affinity IgG receptor FcγRI. Here we show that CRP binds to FcγRI on intact cells, with a kd of 10 ± 3 μmol/L. Transfection of COS-7 cells with a plasmid coding for both FcγRI and its functional counterpart, the γ-chain, markedly increases CRP affinity to FcγRI, resulting in a kd of 0.35 ± 0.10 μmol/L. The affinity increase results from an ∼30-fold enhanced association rate coefficient. The pronounced enhancement of affinity by the γ-chain suggests its crucial involvement in the CRP receptor interaction, possibly by mediating interactions between the transmembrane moieties of the receptors. Dissociation of CRP from the cell surfaces cannot be detected throughout the time course of several hours and is thus extremely slow. Considering the pentameric structure of CRP, this result indicates that multivalent binding and receptor clustering are crucially involved in the interaction of CRP with nucleated cells. PMID:17255341

  13. Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

    NASA Technical Reports Server (NTRS)

    Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

    1999-01-01

    Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

  14. High affinity soluble ILT2 receptor: a potent inhibitor of CD8(+) T cell activation.

    PubMed

    Moysey, Ruth K; Li, Yi; Paston, Samantha J; Baston, Emma E; Sami, Malkit S; Cameron, Brian J; Gavarret, Jessie; Todorov, Penio; Vuidepot, Annelise; Dunn, Steven M; Pumphrey, Nicholas J; Adams, Katherine J; Yuan, Fang; Dennis, Rebecca E; Sutton, Deborah H; Johnson, Andy D; Brewer, Joanna E; Ashfield, Rebecca; Lissin, Nikolai M; Jakobsen, Bent K

    2010-12-01

    Using directed mutagenesis and phage display on a soluble fragment of the human immunoglobulin super-family receptor ILT2 (synonyms: LIR1, MIR7, CD85j), we have selected a range of mutants with binding affinities enhanced by up to 168,000-fold towards the conserved region of major histocompatibility complex (MHC) class I molecules. Produced in a dimeric form, either by chemical cross-linking with bivalent polyethylene glycol (PEG) derivatives or as a genetic fusion with human IgG Fc-fragment, the mutants exhibited a further increase in ligand-binding strength due to the avidity effect, with resident half-times (t(1/2)) on the surface of MHC I-positive cells of many hours. The novel compounds antagonized the interaction of CD8 co-receptor with MHC I in vitro without affecting the peptide-specific binding of T-cell receptors (TCRs). In both cytokine-release assays and cell-killing experiments the engineered receptors inhibited the activation of CD8(+) cytotoxic T lymphocytes (CTLs) in the presence of their target cells, with subnanomolar potency and in a dose-dependent manner. As a selective inhibitor of CD8(+) CTL responses, the engineered high affinity ILT2 receptor presents a new tool for studying the activation mechanism of different subsets of CTLs and could have potential for the development of novel autoimmunity therapies.

  15. Sperm Lysozyme-Like Protein 1 (SLLP1), an intra-acrosomal oolemmal-binding sperm protein, reveals filamentous organization in protein crystal form

    PubMed Central

    Zheng, Heping; Mandal, Arabinda; Shumilin, Igor A.; Chordia, Mahendra D.; Panneerdoss, Subbarayalu; Herr, John C.; Minor, Wladek

    2016-01-01

    Sperm Lysozyme-Like Protein 1 (SLLP1) is one of the lysozyme-like proteins predominantly expressed in mammalian testes that lacks bacteriolytic activity, localizes in the sperm acrosome, and exhibits high affinity for an oolemmal receptor, SAS1B. The crystal structure of mouse SLLP1 (mSLLP1) was determined at 2.15Å resolution. mSLLP1 monomer adopts a structural fold similar to that of chicken/mouse lysozymes retaining all four canonical disulfide bonds. mSLLP1 is distinct from c-lysozyme by substituting two essential catalytic residues (E35T/D52N), exhibiting different surface charge distribution, and by forming helical filaments approximately 75Å in diameter with a 25Å central pore comprised of six monomers per helix turn repeating every 33Å. Cross-species alignment of all reported SLLP1 sequences revealed a set of invariant surface regions comprising a characteristic fingerprint uniquely identifying SLLP1 from other c-lysozyme family members. The fingerprint surface regions reside around the lips of the putative glycan binding groove including three polar residues (Y33/E46/H113). A flexible salt bridge (E46-R61) was observed covering the glycan binding groove. The conservation of these regions may be linked to their involvement in oolemmal protein binding. Interaction between SLLP1 monomer and its oolemmal receptor SAS1B was modeled using protein-protein docking algorithms, utilizing the SLLP1 fingerprint regions along with the SAS1B conserved surface regions. This computational model revealed complementarity between the conserved SLLP1/SAS1B interacting surfaces supporting the experimentally-observed SLLP1/SAS1B interaction involved in fertilization. PMID:26198801

  16. Sperm Lysozyme-Like Protein 1 (SLLP1), an intra-acrosomal oolemmal-binding sperm protein, reveals filamentous organization in protein crystal form.

    PubMed

    Zheng, H; Mandal, A; Shumilin, I A; Chordia, M D; Panneerdoss, S; Herr, J C; Minor, W

    2015-07-01

    Sperm lysozyme-like protein 1 (SLLP1) is one of the lysozyme-like proteins predominantly expressed in mammalian testes that lacks bacteriolytic activity, localizes in the sperm acrosome, and exhibits high affinity for an oolemmal receptor, SAS1B. The crystal structure of mouse SLLP1 (mSLLP1) was determined at 2.15 Å resolution. mSLLP1 monomer adopts a structural fold similar to that of chicken/mouse lysozymes retaining all four canonical disulfide bonds. mSLLP1 is distinct from c-lysozyme by substituting two essential catalytic residues (E35T/D52N), exhibiting different surface charge distribution, and by forming helical filaments approximately 75 Å in diameter with a 25 Å central pore comprised of six monomers per helix turn repeating every 33 Å. Cross-species alignment of all reported SLLP1 sequences revealed a set of invariant surface regions comprising a characteristic fingerprint uniquely identifying SLLP1 from other c-lysozyme family members. The fingerprint surface regions reside around the lips of the putative glycan-binding groove including three polar residues (Y33/E46/H113). A flexible salt bridge (E46-R61) was observed covering the glycan-binding groove. The conservation of these regions may be linked to their involvement in oolemmal protein binding. Interaction between SLLP1 monomer and its oolemmal receptor SAS1B was modeled using protein-protein docking algorithms, utilizing the SLLP1 fingerprint regions along with the SAS1B conserved surface regions. This computational model revealed complementarity between the conserved SLLP1/SAS1B interacting surfaces supporting the experimentally observed SLLP1/SAS1B interaction involved in fertilization. © 2015 American Society of Andrology and European Academy of Andrology.

  17. Simulation of Biomolecular Nanomechanical Systems

    DTIC Science & Technology

    2006-10-01

    optimization of doping concentration and minimizing the interface traps. Surface Immobilization of Receptors For biomolecular binding experiments...Biosensors,” Langmuir, Vol. 21, pp. 1956-1961 (2005). 13. M. Yue, Multiplexed Label-Free Bioassays Using Nanomechanics and Nanofluidics , PhD Thesis

  18. Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

    PubMed

    Schumann, Marcel; Armen, Roger S

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

  19. Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

    PubMed Central

    Schumann, Marcel; Armen, Roger S.

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

  20. Interactions of the α-subunits of heterotrimeric G-proteins with GPCRs, effectors and RGS proteins: a critical review and analysis of interacting surfaces, conformational shifts, structural diversity and electrostatic potentials.

    PubMed

    Baltoumas, Fotis A; Theodoropoulou, Margarita C; Hamodrakas, Stavros J

    2013-06-01

    G-protein coupled receptors (GPCRs) are one of the largest families of membrane receptors in eukaryotes. Heterotrimeric G-proteins, composed of α, β and γ subunits, are important molecular switches in the mediation of GPCR signaling. Receptor stimulation after the binding of a suitable ligand leads to G-protein heterotrimer activation and dissociation into the Gα subunit and Gβγ heterodimer. These subunits then interact with a large number of effectors, leading to several cell responses. We studied the interactions between Gα subunits and their binding partners, using information from structural, mutagenesis and Bioinformatics studies, and conducted a series of comparisons of sequence, structure, electrostatic properties and intermolecular energies among different Gα families and subfamilies. We identified a number of Gα surfaces that may, in several occasions, participate in interactions with receptors as well as effectors. The study of Gα interacting surfaces in terms of sequence, structure and electrostatic potential reveals features that may account for the Gα subunit's behavior towards its interacting partners. The electrostatic properties of the Gα subunits, which in some cases differ greatly not only between families but also between subfamilies, as well as the G-protein interacting surfaces of effectors and regulators of G-protein signaling (RGS) suggest that electrostatic complementarity may be an important factor in G-protein interactions. Energy calculations also support this notion. This information may be useful in future studies of G-protein interactions with GPCRs and effectors. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Structural Analysis of Botulinum Neurotoxin Type G Receptor Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmitt, John; Karalewitz, Andrew; Benefield, Desire A.

    2010-10-19

    Botulinum neurotoxin (BoNT) binds peripheral neurons at the neuromuscular junction through a dual-receptor mechanism that includes interactions with ganglioside and protein receptors. The receptor identities vary depending on BoNT serotype (A-G). BoNT/B and BoNT/G bind the luminal domains of synaptotagmin I and II, homologous synaptic vesicle proteins. We observe conditions under which BoNT/B binds both Syt isoforms, but BoNT/G binds only SytI. Both serotypes bind ganglioside G{sub T1b}. The BoNT/G receptor-binding domain crystal structure provides a context for examining these binding interactions and a platform for understanding the physiological relevance of different Syt receptor isoforms in vivo.

  2. Effect of dacarbazine on CD44 in live melanoma cells as measured by atomic force microscopy-based nanoscopy.

    PubMed

    Huang, Xun; He, Jiexiang; Zhang, Huan-Tian; Sun, Kai; Yang, Jie; Wang, Huajun; Zhang, Hongxin; Guo, Zhenzhao; Zha, Zhen-Gang; Zhou, Changren

    2017-01-01

    CD44 ligand-receptor interactions are known to be involved in regulating cell migration and tumor cell metastasis. High expression levels of CD44 correlate with a poor prognosis of melanoma patients. In order to understand not only the mechanistic basis for dacarbazine (DTIC)-based melanoma treatment but also the reason for the poor prognosis of melanoma patients treated with DTIC, dynamic force spectroscopy was used to structurally map single native CD44-coupled receptors on the surface of melanoma cells. The effect of DTIC treatment was quantified by the dynamic binding strength and the ligand-binding free-energy landscape. The results demonstrated no obvious effect of DTIC on the unbinding force between CD44 ligand and its receptor, even when the CD44 nanodomains were reduced significantly. However, DTIC did perturb the kinetic and thermodynamic interactions of the CD44 ligand-receptor, with a resultant greater dissociation rate, lower affinity, lower binding free energy, and a narrower energy valley for the free-energy landscape. For cells treated with 25 and 75 μg/mL DTIC for 24 hours, the dissociation constant for CD44 increased 9- and 70-fold, respectively. The CD44 ligand binding free energy decreased from 9.94 for untreated cells to 8.65 and 7.39 kcal/mol for DTIC-treated cells, which indicated that the CD44 ligand-receptor complexes on DTIC-treated melanoma cells were less stable than on untreated cells. However, affinity remained in the micromolar range, rather than the millimolar range associated with nonaffinity ligands. Hence, the CD44 receptor could still be activated, resulting in intracellular signaling that could trigger a cellular response. These results demonstrate DTIC perturbs, but not completely inhibits, the binding of CD44 ligand to membrane receptors, suggesting a basis for the poor prognosis associated with DTIC treatment of melanoma. Overall, atomic force microscopy-based nanoscopic methods offer thermodynamic and kinetic insight into the effect of DTIC on the CD44 ligand-binding process.

  3. Effect of dacarbazine on CD44 in live melanoma cells as measured by atomic force microscopy-based nanoscopy

    PubMed Central

    Huang, Xun; He, Jiexiang; Zhang, Huan-tian; Sun, Kai; Yang, Jie; Wang, Huajun; Zhang, Hongxin; Guo, Zhenzhao; Zha, Zhen-gang; Zhou, Changren

    2017-01-01

    CD44 ligand–receptor interactions are known to be involved in regulating cell migration and tumor cell metastasis. High expression levels of CD44 correlate with a poor prognosis of melanoma patients. In order to understand not only the mechanistic basis for dacarbazine (DTIC)-based melanoma treatment but also the reason for the poor prognosis of melanoma patients treated with DTIC, dynamic force spectroscopy was used to structurally map single native CD44-coupled receptors on the surface of melanoma cells. The effect of DTIC treatment was quantified by the dynamic binding strength and the ligand-binding free-energy landscape. The results demonstrated no obvious effect of DTIC on the unbinding force between CD44 ligand and its receptor, even when the CD44 nanodomains were reduced significantly. However, DTIC did perturb the kinetic and thermodynamic interactions of the CD44 ligand–receptor, with a resultant greater dissociation rate, lower affinity, lower binding free energy, and a narrower energy valley for the free-energy landscape. For cells treated with 25 and 75 μg/mL DTIC for 24 hours, the dissociation constant for CD44 increased 9- and 70-fold, respectively. The CD44 ligand binding free energy decreased from 9.94 for untreated cells to 8.65 and 7.39 kcal/mol for DTIC-treated cells, which indicated that the CD44 ligand–receptor complexes on DTIC-treated melanoma cells were less stable than on untreated cells. However, affinity remained in the micromolar range, rather than the millimolar range associated with nonaffinity ligands. Hence, the CD44 receptor could still be activated, resulting in intracellular signaling that could trigger a cellular response. These results demonstrate DTIC perturbs, but not completely inhibits, the binding of CD44 ligand to membrane receptors, suggesting a basis for the poor prognosis associated with DTIC treatment of melanoma. Overall, atomic force microscopy-based nanoscopic methods offer thermodynamic and kinetic insight into the effect of DTIC on the CD44 ligand-binding process. PMID:29296081

  4. A mutation in the insulin receptor gene that impairs transport of the receptor to the plasma membrane and causes insulin-resistant diabetes.

    PubMed Central

    Accili, D; Frapier, C; Mosthaf, L; McKeon, C; Elbein, S C; Permutt, M A; Ramos, E; Lander, E; Ullrich, A; Taylor, S I

    1989-01-01

    Insulin binds to a receptor on the cell surface, thereby triggering a biological response within the target cell. Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. We have studied a family in which two sisters have a genetic form of insulin-resistant diabetes mellitus. The technique of homozygosity mapping has been used to demonstrate that the mutation causing diabetes in this consanguineous family is genetically linked to the insulin receptor gene. The two insulin-resistant sisters are homozygous for a mutation encoding substitution of valine for phenylalanine at position 382 in the alpha-subunit of the insulin receptor. Transfection of mutant insulin receptor cDNA into NIH3T3 cells demonstrated that the Val382 mutation impaired post-translational processing and retarded transport of the insulin receptor to the plasma membrane. Thus, the mutation causes insulin resistance by decreasing the number of insulin receptors on the surface of the patients' cells. Images PMID:2573522

  5. Lactose-containing starburst dendrimers: influence of dendrimer generation and binding-site orientation of receptors (plant/animal lectins and immunoglobulins) on binding properties.

    PubMed

    André, S; Ortega, P J; Perez, M A; Roy, R; Gabius, H J

    1999-11-01

    Starburst glycodendrimers offer the potential to serve as high-affinity ligands for clinically relevant sugar receptors. In order to define areas of application, their binding behavior towards sugar receptors with differential binding-site orientation but identical monosaccharide specificity must be evaluated. Using poly(amidoamine) starburst dendrimers of five generations, which contain the p-isothiocyanato derivative of p-aminophenyl-beta-D-lactoside as ligand group, four different types of galactoside-binding proteins were chosen for this purpose, i.e., the (AB)(2)-toxic agglutinin from mistletoe, a human immunoglobulin G fraction, the homodimeric galectin-1 with its two binding sites at opposite ends of the jelly-roll-motif-harboring protein and monomeric galectin-3. Direct solid-phase assays with surface-immobilized glycodendrimers resulted in obvious affinity enhancements by progressive core branching for the plant agglutinin and less pronounced for the antibody and galectin-1. High density of binding of galectin-3 with modest affinity increases only from the level of the 32-mer onwards points to favorable protein-protein interactions of the monomeric lectin and a spherical display of the end groups without a major share of backfolding. When the inhibitory potency of these probes was evaluated as competitor of receptor binding to an immobilized neoglycoprotein or to asialofetuin, a marked selectivity was detected. The 32- and 64-mers were second to none as inhibitors for the plant agglutinin against both ligand-exposing matrices and for galectin-1 on the matrix with a heterogeneous array of interglycoside distances even on the per-sugar basis. In contrast, a neoglycoprotein with the same end group was superior in the case of the antibody and, less pronounced, monomeric galectin-3. Intimate details of topological binding-site presentation and the ligand display on different generations of core assembly are major operative factors which determine the potential of dendrimers for applications as lectin-targeting device, as attested by these observations.

  6. Characterization of Human and Murine T-Cell Immunoglobulin Mucin Domain 4 (TIM-4) IgV Domain Residues Critical for Ebola Virus Entry.

    PubMed

    Rhein, Bethany A; Brouillette, Rachel B; Schaack, Grace A; Chiorini, John A; Maury, Wendy

    2016-07-01

    Phosphatidylserine (PtdSer) receptors that are responsible for the clearance of dying cells have recently been found to mediate enveloped virus entry. Ebola virus (EBOV), a member of the Filoviridae family of viruses, utilizes PtdSer receptors for entry into target cells. The PtdSer receptors human and murine T-cell immunoglobulin mucin (TIM) domain proteins TIM-1 and TIM-4 mediate filovirus entry by binding to PtdSer on the virion surface via a conserved PtdSer binding pocket within the amino-terminal IgV domain. While the residues within the TIM-1 IgV domain that are important for EBOV entry are characterized, the molecular details of virion-TIM-4 interactions have yet to be investigated. As sequences and structural alignments of the TIM proteins suggest distinct differences in the TIM-1 and TIM-4 IgV domain structures, we sought to characterize TIM-4 IgV domain residues required for EBOV entry. Using vesicular stomatitis virus pseudovirions bearing EBOV glycoprotein (EBOV GP/VSVΔG), we evaluated virus binding and entry into cells expressing TIM-4 molecules mutated within the IgV domain, allowing us to identify residues important for entry. Similar to TIM-1, residues in the PtdSer binding pocket of murine and human TIM-4 (mTIM-4 and hTIM-4) were found to be important for EBOV entry. However, additional TIM-4-specific residues were also found to impact EBOV entry, with a total of 8 mTIM-4 and 14 hTIM-4 IgV domain residues being critical for virion binding and internalization. Together, these findings provide a greater understanding of the interaction of TIM-4 with EBOV virions. With more than 28,000 cases and over 11,000 deaths during the largest and most recent Ebola virus (EBOV) outbreak, there has been increased emphasis on the development of therapeutics against filoviruses. Many therapies under investigation target EBOV cell entry. T-cell immunoglobulin mucin (TIM) domain proteins are cell surface factors important for the entry of many enveloped viruses, including EBOV. TIM family member TIM-4 is expressed on macrophages and dendritic cells, which are early cellular targets during EBOV infection. Here, we performed a mutagenesis screening of the IgV domain of murine and human TIM-4 to identify residues that are critical for EBOV entry. Surprisingly, we identified more human than murine TIM-4 IgV domain residues that are required for EBOV entry. Defining the TIM IgV residues needed for EBOV entry clarifies the virus-receptor interactions and paves the way for the development of novel therapeutics targeting virus binding to this cell surface receptor. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. Characterization of Human and Murine T-Cell Immunoglobulin Mucin Domain 4 (TIM-4) IgV Domain Residues Critical for Ebola Virus Entry

    PubMed Central

    Rhein, Bethany A.; Brouillette, Rachel B.; Schaack, Grace A.; Chiorini, John A.

    2016-01-01

    ABSTRACT Phosphatidylserine (PtdSer) receptors that are responsible for the clearance of dying cells have recently been found to mediate enveloped virus entry. Ebola virus (EBOV), a member of the Filoviridae family of viruses, utilizes PtdSer receptors for entry into target cells. The PtdSer receptors human and murine T-cell immunoglobulin mucin (TIM) domain proteins TIM-1 and TIM-4 mediate filovirus entry by binding to PtdSer on the virion surface via a conserved PtdSer binding pocket within the amino-terminal IgV domain. While the residues within the TIM-1 IgV domain that are important for EBOV entry are characterized, the molecular details of virion–TIM-4 interactions have yet to be investigated. As sequences and structural alignments of the TIM proteins suggest distinct differences in the TIM-1 and TIM-4 IgV domain structures, we sought to characterize TIM-4 IgV domain residues required for EBOV entry. Using vesicular stomatitis virus pseudovirions bearing EBOV glycoprotein (EBOV GP/VSVΔG), we evaluated virus binding and entry into cells expressing TIM-4 molecules mutated within the IgV domain, allowing us to identify residues important for entry. Similar to TIM-1, residues in the PtdSer binding pocket of murine and human TIM-4 (mTIM-4 and hTIM-4) were found to be important for EBOV entry. However, additional TIM-4-specific residues were also found to impact EBOV entry, with a total of 8 mTIM-4 and 14 hTIM-4 IgV domain residues being critical for virion binding and internalization. Together, these findings provide a greater understanding of the interaction of TIM-4 with EBOV virions. IMPORTANCE With more than 28,000 cases and over 11,000 deaths during the largest and most recent Ebola virus (EBOV) outbreak, there has been increased emphasis on the development of therapeutics against filoviruses. Many therapies under investigation target EBOV cell entry. T-cell immunoglobulin mucin (TIM) domain proteins are cell surface factors important for the entry of many enveloped viruses, including EBOV. TIM family member TIM-4 is expressed on macrophages and dendritic cells, which are early cellular targets during EBOV infection. Here, we performed a mutagenesis screening of the IgV domain of murine and human TIM-4 to identify residues that are critical for EBOV entry. Surprisingly, we identified more human than murine TIM-4 IgV domain residues that are required for EBOV entry. Defining the TIM IgV residues needed for EBOV entry clarifies the virus-receptor interactions and paves the way for the development of novel therapeutics targeting virus binding to this cell surface receptor. PMID:27122575

  8. Binding and orientation of fibronectin on polystyrene surfaces using immobilized bacterial adhesin-related peptides.

    PubMed

    Klueh, U; Bryers, J D; Kreutzer, D L

    2003-10-01

    Fibronectin (FN) is known to bind to bacteria via high affinity receptors on bacterial surfaces known as adhesins. The binding of bacteria to FN is thought to have a key role in foreign device associated infections. For example, previous studies have indicated that Staphylococcus aureus adhesins bind to the 29 kDa NH(3) terminus end of FN, and thereby promote bacteria adherence to surfaces. Recently, the peptide sequences within the S. aureus adhesin molecule that are responsible for FN binding have been identified. Based on these observations, we hypothesize that functional FN can be bound and specifically oriented on polystyrene surfaces using bacterial adhesin-related (BRP-A) peptide. We further hypothesize that monoclonal antibodies that react with specific epitopes on the FN can be used to quantify both FN binding and orientation on these surfaces. Based on this hypothesis, we initiated a systematic investigation of the binding and orientation of FN on polystyrene surfaces using BRP-A peptide. To test this hypothesis, the binding and orientation of the FN to immobilized BRP-A was quantified using (125)I-FN, and monoclonal antibodies. (125)I-FN was used to quantitate FN binding to peptide-coated polystyrene surfaces. The orientation of bound FN was demonstrated by the use of monoclonal antibodies, which are reactive with the amine (N) or carboxyl (C) termini of the FN. The results of our studies demonstrated that when the BRP-A peptide was used to bind FN to surfaces that: 1. functional FN was bound to the peptide; 2. anti-C terminus antibodies bound to the peptide FN; and 3. only limited binding of anti-N terminus antibodies to peptide-bound FN occurred. We believe that the data that indicate an enhanced binding of anti-C antibodies reactive to anti-N antibodies are a result of the FN binding in an oriented manner with the N termini of FN bound tightly to the BRP-A on the polystyrene surface. Copyright 2003 Wiley Periodicals, Inc. J Biomed Mater Res 67A: 36-43, 2003

  9. Replacement of the V3 domain in the surface subunit of the feline immunodeficiency virus envelope glycoprotein with the equivalent region of a T cell-tropic human immunodeficiency virus type 1 results in a chimeric surface protein that efficiently binds to CXCR4.

    PubMed

    González, Silvia A; Falcón, Juan I; Affranchino, José L

    2014-03-01

    Feline immunodeficiency virus (FIV) and the T cell-tropic strains of human immunodeficiency virus type 1 (HIV-1) share the use of the chemokine receptor CXCR4 for cell entry. To study this process further we developed a cell surface binding assay based on the expression of a soluble version of the FIV SU C-terminally tagged with the influenza virus hemagglutinin epitope (HA). The specificity of the assay was demonstrated by the following evidence: (1) the SU-HA protein bound to HeLa cells that express CXCR4 but not to MDCK cells that lack this chemokine receptor; and (2) binding of the SU-HA to HeLa cells was blocked by incubation with the CXCR4 antagonist AMD3100 as well as with the anti-CXCR4 monoclonal antibody (MAb) 12G5. Deletion of the V3 region from the FIV SU glycoprotein abolished its ability to bind CXCR4-expressing cells. Remarkably, substitution of the V3 domain of the FIV SU by the equivalent region of the HIV-1 NL4-3 isolate resulted in efficient cell surface binding of the chimeric SU protein to CXCR4. Moreover, transfection of MDCK cells with a plasmid encoding human CXCR4 allowed the association of the chimeric SU-HA glycoprotein to the transfected cells. Interestingly, while cell binding of the chimeric FIV-HIV SU was inhibited by an anti-HIV-1 V3 MAb, its association with CXCR4 was found to be resistant to AMD3100. Of note, the chimeric FIV-HIV Env glycoprotein was capable of promoting CXCR4-dependent cell-to-cell fusion.

  10. MicroCantilever (MC) based nanomechanical sensor for detection of molecular interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Kyung

    Specific aims of this study are to investigate the mechanism governing surface stress generation associated with chemical or molecular binding on functionalized microcantilevers. Formation of affinity complexes on cantilever surfaces leads to charge redistribution, configurational change and steric hindrance between neighboring molecules resulting in surface stress change and measureable cantilever deformation. A novel interferometry technique employing two adjacent micromachined cantilevers (a sensing/reference pair) was utilized to measure the cantilever deformation. The sensing principle is that binding/reaction of specific chemical or biological species on the sensing cantilever transduces to mechanical deformation. The differential bending of the sensing cantilever respect to themore » reference cantilever ensures that measured response is insensitive to environmental disturbances. As a proof of principle for the measurement technique, surface stress changes associated with: self-assembly of alkanethiol, hybridization of ssDNA, and the formation of cocaine-aptamer complexes were measured. Dissociation constant (K d) for each molecular reaction was utilized to estimate the surface coverage of affinity complexes. In the cases of DNA hybridization and cocaine-aptamer binding, measured surface stress was found to be dependent on the surface coverage of the affinity complexes. In order to achieve a better sensitivity for DNA hybridization, immobilization of receptor molecules was modified to enhance the deformation of underlying surface. Single-stranded DNA (ssDNA) strands with thiol-modification on both 3-foot and 5-foot ends were immobilized on the gold surface such that both ends are attached to the gold surface. Immobilization condition was controlled to obtain similar receptor density as single-thiolated DNA strands. Hybridization of double-thiolated DNA strands leads to an almost two orders of magnitude increase in cantilever deformation. In both DNA hybridization and the conventional mode for cocaine detection, the lowest detectable concentration was determined by binding activity between the ligand and receptor molecules. In order to overcome this limitation for cocaine detection, a novel competition sensing mode that relies on rate of aptamers unbinding from the cantilever due to either diffusion or reaction with cocaine as target ligands in solution was investigated. The rate of unbinding is found to be dependent on the concentration of cocaine molecules. A model based on diffusion-reaction equation was developed to explain the experimental observation. Experimental results indicate that the competition mode reduces the lowest detectable threshold to 200 nM which is comparable to that achieved analytical techniques such as mass spectrometry.« less

  11. Osteogenic properties of a short BMP-2 chimera peptide.

    PubMed

    Falcigno, Lucia; D'Auria, Gabriella; Calvanese, Luisa; Marasco, Daniela; Iacobelli, Roberta; Scognamiglio, Pasqualina L; Brun, Paola; Danesin, Roberta; Pasqualin, Matteo; Castagliuolo, Ignazio; Dettin, Monica

    2015-09-01

    Bone morphogenetic proteins (BMPs) play a key role in bone and cartilage formation. For these properties, BMPs are employed in the field of tissue engineering to induce bone regeneration in damaged tissues. To overcome drawbacks due to the use of entire proteins, synthetic peptides derived from their parent BMPs have come out as promising molecules for biomaterial design. On the structural ground of the experimental BMP-2 receptor complexes reported in the literature, we designed three peptides, reproducing the BMP-2 region responsible for the binding to the type II receptor, ActRIIB. These peptides were characterized by NMR, and the structural features of the peptide-receptor binding interface were highlighted by docking experiments. Peptide-receptor binding affinities were analyzed by means of ELISA and surface plasmon resonance techniques. Furthermore, cellular assays were performed to assess their osteoinductive properties. A chimera peptide, obtained by combining the sequence portions 73-92 and 30-34 of BMP-2, shows the best affinity for ActRIIB in the series and represents a good starting point for the design of new compounds able to reproduce osteogenic properties of the parent BMP-2. Copyright © 2015 European Peptide Society and John Wiley & Sons, Ltd.

  12. Specificity of marine microbial surface interactions.

    PubMed Central

    Imam, S H; Bard, R F; Tosteson, T R

    1984-01-01

    The macromolecular surface components involved in intraspecific cell surface interactions of the green microalga Chlorella vulgaris and closely associated bacteria were investigated. The specific surface attachment between this alga and its associated bacteria is mediated by lectin-like macromolecules associated with the surfaces of these cells. The binding activity of these surface polymers was inhibited by specific simple sugars; this suggests the involvement of specific receptor-ligand binding sites on the interactive surfaces. Epifluorescent microscopic evaluation of bacteria-alga interactions in the presence and absence of the macromolecules that mediate these interactions showed that the glycoproteins active in these processes were specific to the microbial sources from which they were obtained. The demonstration and definition of the specificity of these interactions in mixed microbial populations may play an important role in our understanding of the dynamics of marine microbial populations in the sea. PMID:6508293

  13. Identification and characterization of a Fc receptor activity on the Toxoplasma gondii tachyzoite.

    PubMed

    Vercammen, M; el Bouhdidi, A; Ben Messaoud, A; de Meuter, F; Bazin, H; Dubremetz, J F; Carlier, Y

    1998-01-01

    The Immunoglobulin (Ig) binding capacity of Toxoplasma gondii tachyzoites was investigated using fluorescence flow-cytometry analysis. Polyclonal mouse, human and rat immunoglobulins without specific anti-Toxoplasma activity bound to parasites in a concentration-dependent manner, saturating them at circulating serum concentrations. The immunoglobulin class and subclass specificity of binding was investigated using irrelevant monoclonal antibodies. IgM, IgA and IgG reacted with the parasite membrane. The attachment of mouse IgM to the parasite surface was hampered by mouse IgG1, IgG2a, IgG2b and IgG3. The binding of mouse IgG was proportionally reduced with increasing concentrations of mouse monoclonal IgM. The binding of murine immunoglobulin was diminished when in presence of human IgG. Purified Fc- but not Fab portions of immunoglobulins, fixed to parasites. Using labelled calibrated beads, the Ig binding capacity of parasites was estimated to be 6900 +/- 500 sites per tachyzoite. The Kd of the T. gondii Fc Receptor (FcR) activity was determined at 1.4 +/- 0.1 microM (mean +/- SEM). Such FcR activity was reduced by phospholipase C, trypsin and pronase treatment of the parasites. These data show a low affinity FcR activity on T. gondii tachyzoites which recognizes Ig of different species and isotypes and is likely supported by a glycosyl-phosphatidylinositol (GPI)-anchored surface protein of the parasite.

  14. Abalone Hemocyanin Blocks the Entry of Herpes Simplex Virus 1 into Cells: a Potential New Antiviral Strategy

    PubMed Central

    Talaei Zanjani, Negar; Miranda-Saksena, Monica; Valtchev, Peter; Hueston, Linda; Diefenbach, Eve; Sairi, Fareed; Gomes, Vincent G.

    2015-01-01

    A marine-derived compound, abalone hemocyanin, from Haliotis rubra was shown to have a unique mechanism of antiviral activity against herpes simplex virus 1 (HSV-1) infections. In vitro assays demonstrated the dose-dependent and inhibitory effect of purified hemocyanin against HSV-1 infection in Vero cells with a 50% effective dose (ED50) of 40 to 50 nM and no significant toxicity. In addition, hemocyanin specifically inhibited viral attachment and entry by binding selectively to the viral surface glycoproteins gD, gB, and gC, probably by mimicking their receptors. However, hemocyanin had no effect on postentry events and did not block infection by binding to cellular receptors for HSV. By the use of different mutants of gD and gB and a competitive heparin binding assay, both protein charge and conformation were shown to be the driving forces of the interaction between hemocyanin and viral glycoproteins. These findings also suggested that hemocyanin may have different motifs for binding to each of the viral glycoproteins B and D. The dimer subunit of hemocyanin with a 10-fold-smaller molecular mass exhibited similar binding to viral surface glycoproteins, showing that the observed inhibition did not require the entire multimer. Therefore, a small hemocyanin analogue could serve as a new antiviral candidate for HSV infections. PMID:26643336

  15. The Neck Region of the C-type Lectin DC-SIGN Regulates Its Surface Spatiotemporal Organization and Virus-binding Capacity on Antigen-presenting Cells*

    PubMed Central

    Manzo, Carlo; Torreno-Pina, Juan A.; Joosten, Ben; Reinieren-Beeren, Inge; Gualda, Emilio J.; Loza-Alvarez, Pablo; Figdor, Carl G.; Garcia-Parajo, Maria F.; Cambi, Alessandra

    2012-01-01

    The C-type lectin DC-SIGN expressed on dendritic cells (DCs) facilitates capture and internalization of a plethora of different pathogens. Although it is known that DC-SIGN organizes in nanoclusters at the surface of DCs, the molecular mechanisms responsible for this well defined nanopatterning and role in viral binding remain enigmatic. By combining biochemical and advanced biophysical techniques, including optical superresolution and single particle tracking, we demonstrate that DC-SIGN intrinsic nanoclustering strictly depends on its molecular structure. DC-SIGN nanoclusters exhibited free, Brownian diffusion on the cell membrane. Truncation of the extracellular neck region, known to abrogate tetramerization, significantly reduced nanoclustering and concomitantly increased lateral diffusion. Importantly, DC-SIGN nanocluster dissolution exclusively compromised binding to nanoscale size pathogens. Monte Carlo simulations revealed that heterogeneity on nanocluster density and spatial distribution confers broader binding capabilities to DC-SIGN. As such, our results underscore a direct relationship between spatial nanopatterning, driven by intermolecular interactions between the neck regions, and receptor diffusion to provide DC-SIGN with the exquisite ability to dock pathogens at the virus length scale. Insight into how virus receptors are organized prior to virus binding and how they assemble into functional platforms for virus docking is helpful to develop novel strategies to prevent virus entry and infection. PMID:23019323

  16. Sialylated Receptor Setting Influences Mycoplasma pneumoniae Attachment and Gliding Motility.

    PubMed

    Williams, Caitlin R; Chen, Li; Driver, Ashley D; Arnold, Edward A; Sheppard, Edward S; Locklin, Jason; Krause, Duncan C

    2018-06-08

    Mycoplasma pneumoniae is a common cause of human respiratory tract infections, including bronchitis and atypical pneumonia. M. pneumoniae binds glycoprotein receptors having terminal sialic acid residues via the P1 adhesin protein. Here we explored the impact of sialic acid presentation on M. pneumoniae adherence and gliding on surfaces coated with sialylated glycoproteins, or chemically functionalized with α-2,3- and α-2,6-sialyllactose ligated individually or in combination to a polymer scaffold in precisely controlled densities. In both models, gliding required a higher receptor density threshold than adherence, and receptor density influenced gliding frequency but not gliding speed. However, very high densities of α-2,3-sialyllactose actually reduced gliding frequency over peak levels observed at lower densities. Both α-2,3- and α-2,6-sialyllactose supported M. pneumoniae adherence, but gliding was only observed on the former. Finally, gliding on α-2,3-sialyllactose was inhibited on surfaces also conjugated with α-2,6-sialyllactose, suggesting that both moieties bind P1 despite the inability of the latter to support gliding. Our results indicate that the nature and density of host receptor moieties profoundly influences M. pneumoniae gliding, which could affect pathogenesis and infection outcome. Furthermore, precise functionalization of polymer scaffolds shows great promise for further analysis of sialic acid presentation and M. pneumoniae adherence and gliding. This article is protected by copyright. All rights reserved. © 2018 John Wiley & Sons Ltd.

  17. Design of an Insulin Analog with Enhanced Receptor Binding Selectivity

    PubMed Central

    Zhao, Ming; Wan, Zhu-li; Whittaker, Linda; Xu, Bin; Phillips, Nelson B.; Katsoyannis, Panayotis G.; Ismail-Beigi, Faramarz; Whittaker, Jonathan; Weiss, Michael A.

    2009-01-01

    Insulin binds with high affinity to the insulin receptor (IR) and with low affinity to the type 1 insulin-like growth factor (IGF) receptor (IGFR). Such cross-binding, which reflects homologies within the insulin-IGF signaling system, is of clinical interest in relation to the association between hyperinsulinemia and colorectal cancer. Here, we employ nonstandard mutagenesis to design an insulin analog with enhanced affinity for the IR but reduced affinity for the IGFR. Unnatural amino acids were introduced by chemical synthesis at the N- and C-capping positions of a recognition α-helix (residues A1 and A8). These sites adjoin the hormone-receptor interface as indicated by photocross-linking studies. Specificity is enhanced more than 3-fold on the following: (i) substitution of GlyA1 by d-Ala or d-Leu, and (ii) substitution of ThrA8 by diaminobutyric acid (Dab). The crystal structure of [d-AlaA1,DabA8]insulin, as determined within a T6 zinc hexamer to a resolution of 1.35 Å, is essentially identical to that of human insulin. The nonstandard side chains project into solvent at the edge of a conserved receptor-binding surface shared by insulin and IGF-I. Our results demonstrate that modifications at this edge discriminate between IR and IGFR. Because hyperinsulinemia is typically characterized by a 3-fold increase in integrated postprandial insulin concentrations, we envisage that such insulin analogs may facilitate studies of the initiation and progression of cancer in animal models. Future development of clinical analogs lacking significant IGFR cross-binding may enhance the safety of insulin replacement therapy in patients with type 2 diabetes mellitus at increased risk of colorectal cancer. PMID:19773552

  18. Role of LAMP1 Binding and pH Sensing by the Spike Complex of Lassa Virus.

    PubMed

    Cohen-Dvashi, Hadas; Israeli, Hadar; Shani, Orly; Katz, Aliza; Diskin, Ron

    2016-11-15

    To effectively infect cells, Lassa virus needs to switch in an endosomal compartment from its primary receptor, α-dystroglycan, to a protein termed LAMP1. A unique histidine triad on the surface of the receptor-binding domain from the glycoprotein spike complex of Lassa virus is important for LAMP1 binding. Here we investigate mutated spikes that have an impaired ability to interact with LAMP1 and show that although LAMP1 is important for efficient infectivity, it is not required for spike-mediated membrane fusion per se Our studies reveal important regulatory roles for histidines from the triad in sensing acidic pH and preventing premature spike triggering. We further show that LAMP1 requires a positively charged His230 residue to engage with the spike complex and that LAMP1 binding promotes membrane fusion. These results elucidate the molecular role of LAMP1 binding during Lassa virus cell entry and provide new insights into how pH is sensed by the spike. Lassa virus is a devastating disease-causing agent in West Africa, with a significant yearly death toll and severe long-term complications associated with its infection in survivors. In recent years, we learned that Lassa virus needs to switch receptors in a pH-dependent manner to efficiently infect cells, but neither the molecular mechanisms that allow switching nor the actual effects of switching were known. Here we investigate the activity of the viral spike complex after abrogation of its ability to switch receptors. These studies inform us about the role of switching receptors and provide new insights into how the spike senses acidic pH. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Common and divergent structural features of a series of corticotropin releasing factor-related peptides.

    PubMed

    Grace, Christy Rani R; Perrin, Marilyn H; Cantle, Jeffrey P; Vale, Wylie W; Rivier, Jean E; Riek, Roland

    2007-12-26

    Members of the corticoliberin family include the corticotropin releasing factors (CRFs), sauvagine, the urotensins, and urocortin 1 (Ucn1), which bind to both the CRF receptors CRF-R1 and CRF-R2, and the urocortins 2 (Ucn2) and 3 (Ucn3), which are selective agonists of CRF-R2. Structure activity relationship studies led to several potent and long-acting analogues with selective binding to either one of the receptors. NMR structures of six ligands of this family (the antagonists astressin B and astressin2-B, the agonists stressin1, and the natural ligands human Ucn1, Ucn2, and Ucn3) were determined in DMSO. These six peptides show differences in binding affinities, receptor-selectivity, and NMR structure. Overall, their backbones are alpha-helical, with a small kink or a turn around residues 25-27, resulting in a helix-loop-helix motif. The C-terminal helices are of amphipathic nature, whereas the N-terminal helices vary in their amphipathicity. The C-terminal helices thereby assume a conformation very similar to that of astressin bound to the ECD1 of CRF-R2 recently reported by our group.1 On the basis of an analysis of the observed 3D structures and relative potencies of [Ala]-substituted analogues, it is proposed that both helices could play a crucial role in receptor binding and selectivity. In conclusion, the C-terminal helices may interact along their hydrophobic faces with the ECD1, whereas the entire N-terminal helical surface may be involved in receptor activation. On the basis of the common and divergent features observed in the 3D structures of these ligands, multiple binding models are proposed that may explain their plurality of actions.

  20. Loop III region of platelet-derived growth factor (PDGF) B-chain mediates binding to PDGF receptors and heparin.

    PubMed Central

    Schilling, D; Reid IV, J D; Hujer, A; Morgan, D; Demoll, E; Bummer, P; Fenstermaker, R A; Kaetzel, D M

    1998-01-01

    Site-directed mutagenesis of the platelet-derived growth factor (PDGF) B-chain was conducted to determine the importance of cationic amino acid residues (Arg160-Lys161-Lys162; RKK) located within the loop III region in mediating the biological and cell-association properties of the molecule. Binding to both PDGF alpha-and beta-receptors was inhibited by the conversion of all three cationic residues into anionic glutamates (RKK-->EEE), whereas an RKK-->SSS mutant also exhibited a modest loss in affinity for beta-receptors. Replacements with serine at either Arg160 (RKK-->SKK) or at all three positions (RKK-->SSS) had little effect on binding to alpha-receptors. Replacements with either glutamic or serine residues at any of the three positions also resulted in significant inhibition of heparin-binding activity. Furthermore, the RKK-->EEE mutant exhibited decreased association with the cell surface and accumulated in the culture medium as 29-32 kDa forms. Stable transfection of U87 astrocytoma cells with RKK-->EEE mutants of either the A-chain or the B-chain inhibited malignant growth in athymic nude mice. Despite altered receptor-binding activities, each of the loop III mutants retained full mitogenic activity when applied to cultured Swiss 3T3 cells. CD spectrophotometric analysis of the RKK-->EEE mutant revealed a secondary structure indistinguishable from the wild type, with a high degree of beta-sheet structure and random coil content (50% and 43% respectively). These findings indicate an important role of the Arg160-Lys161-Lys162 sequence in mediating the biological and cell-associative activities of the PDGF-BB homodimer, and reveal that the mitogenic activity of PDGF-BB is insufficient to mediate its full oncogenic properties. PMID:9677323

  1. Structural Basis for Interactions Between Contactin Family Members and Protein-tyrosine Phosphatase Receptor Type G in Neural Tissues.

    PubMed

    Nikolaienko, Roman M; Hammel, Michal; Dubreuil, Véronique; Zalmai, Rana; Hall, David R; Mehzabeen, Nurjahan; Karuppan, Sebastian J; Harroch, Sheila; Stella, Salvatore L; Bouyain, Samuel

    2016-10-07

    Protein-tyrosine phosphatase receptor type G (RPTPγ/PTPRG) interacts in vitro with contactin-3-6 (CNTN3-6), a group of glycophosphatidylinositol-anchored cell adhesion molecules involved in the wiring of the nervous system. In addition to PTPRG, CNTNs associate with multiple transmembrane proteins and signal inside the cell via cis-binding partners to alleviate the absence of an intracellular region. Here, we use comprehensive biochemical and structural analyses to demonstrate that PTPRG·CNTN3-6 complexes share similar binding affinities and a conserved arrangement. Furthermore, as a first step to identifying PTPRG·CNTN complexes in vivo, we found that PTPRG and CNTN3 associate in the outer segments of mouse rod photoreceptor cells. In particular, PTPRG and CNTN3 form cis-complexes at the surface of photoreceptors yet interact in trans when expressed on the surfaces of apposing cells. Further structural analyses suggest that all CNTN ectodomains adopt a bent conformation and might lie parallel to the cell surface to accommodate these cis and trans binding modes. Taken together, these studies identify a PTPRG·CNTN complex in vivo and provide novel insights into PTPRG- and CNTN-mediated signaling. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Yeast β-1,6-Glucan Is a Primary Target for the Saccharomyces cerevisiae K2 Toxin

    PubMed Central

    Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius

    2015-01-01

    Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. PMID:25710965

  3. A new approach to explore the binding space of polysaccharide-based ligands: selectin antagonists.

    PubMed

    Calosso, Mickael; Charpentier, Daniel; Vaillancourt, Marc; Bencheqroun, Mohammed; St-Pierre, Gabrielle; Wilkes, Brian C; Guindon, Yvan

    2012-12-13

    The discovery of molecules that interfere with the binding of a ligand to a receptor remains a topic of great interest in medicinal chemistry. Herein, we report that a monosaccharide unit of a polysaccharide ligand can be replaced advantageously by a conformationally locked acyclic molecular entity. A cyclic component of the selectin ligand Sialyl Lewis(x), GlcNAc, is replaced by an acyclic tether, tartaric esters, which link two saccharide units. The conformational bias of this acyclic tether originates from the minimization of intramolecular dipole-dipole interaction and the gauche effect. The evaluation of the binding of these derivatives to P-selectin was measured by surface plasmon resonance spectroscopy. The results obtained in our pilot study suggest that the discovery of tunable tethers could facilitate the exploration of the carbohydrate recognition domain of various receptors.

  4. An intact PDZ motif is essential for correct P2Y12 purinoceptor traffic in human platelets.

    PubMed

    Nisar, Shaista; Daly, Martina E; Federici, Augusto B; Artoni, Andrea; Mumford, Andrew D; Watson, Stephen P; Mundell, Stuart J

    2011-11-17

    The platelet P2Y(12) purinoceptor (P2Y(12)R), which plays a crucial role in hemostasis, undergoes internalization and subsequent recycling to maintain receptor responsiveness, processes that are essential for normal platelet function. Here, we observe that P2Y(12)R function is compromised after deletion or mutation of the 4 amino acids at the extreme C-terminus of this receptor (ETPM), a putative postsynaptic density 95/disc large/zonula occludens-1 (PDZ)-binding motif. In cell line models, removal of this sequence or mutation of one of its core residues (P341A), attenuates receptor internalization and receptor recycling back to the membrane, thereby blocking receptor resensitization. The physiologic significance of these findings in the regulation of platelet function is shown by identification of a patient with a heterozygous mutation in the PDZ binding sequence of their P2Y(12)R (P341A) that is associated with reduced expression of the P2Y(12)R on the cell surface. Importantly, platelets from this subject showed significantly compromised P2Y(12)R recycling, emphasizing the importance of the extreme C-terminus of this receptor to ensure correct receptor traffic.

  5. Klotho converts canonical FGF receptor into a specific receptor for FGF23.

    PubMed

    Urakawa, Itaru; Yamazaki, Yuji; Shimada, Takashi; Iijima, Kousuke; Hasegawa, Hisashi; Okawa, Katsuya; Fujita, Toshiro; Fukumoto, Seiji; Yamashita, Takeyoshi

    2006-12-07

    FGF23 is a unique member of the fibroblast growth factor (FGF) family because it acts as a hormone that derives from bone and regulates kidney functions, whereas most other family members are thought to regulate various cell functions at a local level. The renotropic activity of circulating FGF23 indicates the possible presence of an FGF23-specific receptor in the kidney. Here we show that a previously undescribed receptor conversion by Klotho, a senescence-related molecule, generates the FGF23 receptor. Using a renal homogenate, we found that Klotho binds to FGF23. Forced expression of Klotho enabled the high-affinity binding of FGF23 to the cell surface and restored the ability of a renal cell line to respond to FGF23 treatment. Moreover, FGF23 incompetence was induced by injecting wild-type mice with an anti-Klotho monoclonal antibody. Thus, Klotho is essential for endogenous FGF23 function. Because Klotho alone seemed to be incapable of intracellular signalling, we searched for other components of the FGF23 receptor and found FGFR1(IIIc), which was directly converted by Klotho into the FGF23 receptor. Thus, the concerted action of Klotho and FGFR1(IIIc) reconstitutes the FGF23 receptor. These findings provide insights into the diversity and specificity of interactions between FGF and FGF receptors.

  6. Peptide Modulation of Class I Major Histocompatibility Complex Protein Molecular Flexibility and the Implications for Immune Recognition*

    PubMed Central

    Hawse, William F.; Gloor, Brian E.; Ayres, Cory M.; Kho, Kevin; Nuter, Elizabeth; Baker, Brian M.

    2013-01-01

    T cells use the αβ T cell receptor (TCR) to recognize antigenic peptides presented by class I major histocompatibility complex proteins (pMHCs) on the surfaces of antigen-presenting cells. Flexibility in both TCRs and peptides plays an important role in antigen recognition and discrimination. Less clear is the role of flexibility in the MHC protein; although recent observations have indicated that mobility in the MHC can impact TCR recognition in a peptide-dependent fashion, the extent of this behavior is unknown. Here, using hydrogen/deuterium exchange, fluorescence anisotropy, and structural analyses, we show that the flexibility of the peptide binding groove of the class I MHC protein HLA-A*0201 varies significantly with different peptides. The variations extend throughout the binding groove, impacting regions contacted by TCRs as well as other activating and inhibitory receptors of the immune system. Our results are consistent with statistical mechanical models of protein structure and dynamics, in which the binding of different peptides alters the populations and exchange kinetics of substates in the MHC conformational ensemble. Altered MHC flexibility will influence receptor engagement, impacting conformational adaptations, entropic penalties associated with receptor recognition, and the populations of binding-competent states. Our results highlight a previously unrecognized aspect of the “altered self” mechanism of immune recognition and have implications for specificity, cross-reactivity, and antigenicity in cellular immunity. PMID:23836912

  7. Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.

    PubMed

    Murase, Akio; Nakao, Kazunari; Takada, Junji

    2008-01-01

    In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.

  8. A Modeling and Experimental Investigation of the Effects of Antigen Density, Binding Affinity, and Antigen Expression Ratio on Bispecific Antibody Binding to Cell Surface Targets.

    PubMed

    Rhoden, John J; Dyas, Gregory L; Wroblewski, Victor J

    2016-05-20

    Despite the increasing number of multivalent antibodies, bispecific antibodies, fusion proteins, and targeted nanoparticles that have been generated and studied, the mechanism of multivalent binding to cell surface targets is not well understood. Here, we describe a conceptual and mathematical model of multivalent antibody binding to cell surface antigens. Our model predicts that properties beyond 1:1 antibody:antigen affinity to target antigens have a strong influence on multivalent binding. Predicted crucial properties include the structure and flexibility of the antibody construct, the target antigen(s) and binding epitope(s), and the density of antigens on the cell surface. For bispecific antibodies, the ratio of the expression levels of the two target antigens is predicted to be critical to target binding, particularly for the lower expressed of the antigens. Using bispecific antibodies of different valencies to cell surface antigens including MET and EGF receptor, we have experimentally validated our modeling approach and its predictions and observed several nonintuitive effects of avidity related to antigen density, target ratio, and antibody affinity. In some biological circumstances, the effect we have predicted and measured varied from the monovalent binding interaction by several orders of magnitude. Moreover, our mathematical framework affords us a mechanistic interpretation of our observations and suggests strategies to achieve the desired antibody-antigen binding goals. These mechanistic insights have implications in antibody engineering and structure/activity relationship determination in a variety of biological contexts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Atomic Force Microscopy Probing of Receptor–Nanoparticle Interactions for Riboflavin Receptor Targeted Gold–Dendrimer Nanocomposites

    PubMed Central

    2015-01-01

    Riboflavin receptors are overexpressed in malignant cells from certain human breast and prostate cancers, and they constitute a group of potential surface markers important for cancer targeted delivery of therapeutic agents and imaging molecules. Here we report on the fabrication and atomic force microscopy (AFM) characterization of a core–shell nanocomposite consisting of a gold nanoparticle (AuNP) coated with riboflavin receptor-targeting poly(amido amine) dendrimer. We designed this nanocomposite for potential applications such as a cancer targeted imaging material based on its surface plasmon resonance properties conferred by AuNP. We employed AFM as a technique for probing the binding interaction between the nanocomposite and riboflavin binding protein (RfBP) in solution. AFM enabled precise measurement of the AuNP height distribution before (13.5 nm) and after chemisorption of riboflavin-conjugated dendrimer (AuNP–dendrimer; 20.5 nm). Binding of RfBP to the AuNP–dendrimer caused a height increase to 26.7 nm, which decreased to 22.8 nm when coincubated with riboflavin as a competitive ligand, supporting interaction of AuNP–dendrimer and its target protein. In summary, physical determination of size distribution by AFM imaging can serve as a quantitative approach to monitor and characterize the nanoscale interaction between a dendrimer-covered AuNP and target protein molecules in vitro. PMID:24571134

  10. TIM-1 Mediates Dystroglycan-Independent Entry of Lassa Virus.

    PubMed

    Brouillette, Rachel B; Phillips, Elisabeth K; Patel, Radhika; Mahauad-Fernandez, Wadie; Moller-Tank, Sven; Rogers, Kai J; Dillard, Jacob A; Cooney, Ashley L; Martinez-Sobrido, Luis; Okeoma, Chioma; Maury, Wendy

    2018-06-06

    Lassa virus (LASV) is an Old World arenavirus responsible for hundreds of thousands of infections in West Africa every year. LASV entry into a variety of cell types is mediated by interactions with glycosyltransferase LARGE-modified O-linked glycans present on the ubiquitous receptor, α-dystroglycan (αDG). Yet, cells lacking αDG are permissive to LASV infection, suggesting that alternative receptors exist. Previous studies demonstrate that phosphatidylserine (PtdSer)-binding receptors, Axl and Tyro3 along with C-type lectin receptors, mediate αDG-independent entry. Here, we demonstrate that another PtdSer receptor, TIM-1, mediates LASV glycoprotein (GP) pseudotyped virions entry into αDG knocked out HEK 293T and wild-type (WT) Vero which express αDG lacking appropriate glycosylation. To investigate the mechanism by which TIM-1 mediates enhancement of entry, we demonstrate that mutagenesis of the TIM-1 IgV domain PtdSer-binding pocket abrogated transduction. Further, the human TIM-1 IgV domain binding monoclonal antibody, ARD5, blocked transduction of pseudovirions bearing LASV GP in a dose-dependent manner. Finally, as we showed previously for other viruses that use TIM-1 for entry, a chimeric TIM-1 protein that substitutes the proline rich region (PRR) from murine leukemia virus envelope (Env) for the mucin-like domain served as a competent receptor. These studies provide evidence that, in the absence of a functional αDG, TIM-1 mediates entry of LASV pseudoviral particles through interactions of virions with the IgV PtdSer binding pocket of TIM-1. Importance PtdSer receptors, such as TIM-1, are emerging as critical entry factors for many enveloped viruses. Most recently, Hepatitis C virus and Zika virus have been added to a growing list. PtdSer receptors engage with enveloped viruses through binding of PtdSer embedded in the viral envelope, defining them as GP-independent receptors. This GP-independent entry mechanism should effectively mediate entry of all enveloped viruses, yet LASV GP pseudotyped viruses were previously found to be unresponsive to PtdSer receptor enhancement in HEK 293T cells. Here we demonstrate that LASV pseudovirions can utilize the PtdSer receptor TIM-1, but only in the absence of appropriately glycosylated α-dystroglycan (αDG), the high affinity cell surface receptor for LASV. Our studies shed light on LASV receptor utilization and explain why earlier studies performed in α-DG-expressing cells did not find that LASV pseudovirions utilize PtdSer receptors for virus uptake. Copyright © 2018 American Society for Microbiology.

  11. Interaction of Plasmodium vivax Tryptophan-rich Antigen PvTRAg38 with Band 3 on Human Erythrocyte Surface Facilitates Parasite Growth*

    PubMed Central

    Alam, Mohd. Shoeb; Choudhary, Vandana; Zeeshan, Mohammad; Tyagi, Rupesh K.; Rathore, Sumit; Sharma, Yagya D.

    2015-01-01

    Plasmodium tryptophan-rich proteins are involved in host-parasite interaction and thus potential drug/vaccine targets. Recently, we have described several P. vivax tryptophan-rich antigens (PvTRAgs), including merozoite expressed PvTRAg38, from this noncultivable human malaria parasite. PvTRAg38 is highly immunogenic in humans and binds to host erythrocytes, and this binding is inhibited by the patient sera. This binding is also affected if host erythrocytes were pretreated with chymotrypsin. Here, Band 3 has been identified as the chymotrypsin-sensitive erythrocyte receptor for this parasite protein. Interaction of PvTRAg38 with Band 3 has been mapped to its three different ectodomains (loops 1, 3, and 6) exposed at the surface of the erythrocyte. The binding region of PvTRAg38 to Band3 has been mapped to its sequence, KWVQWKNDKIRSWLSSEW, present at amino acid positions 197–214. The recombinant PvTRAg38 was able to inhibit the parasite growth in in vitro Plasmodium falciparum culture probably by competing with the ligand(s) of this heterologous parasite for the erythrocyte Band 3 receptor. In conclusion, the host-parasite interaction at the molecular level is much more complicated than known so far and should be considered during the development of anti-malarial therapeutics. PMID:26149684

  12. Role of the urokinase plasminogen activator receptor in mediating impaired efferocytosis of anti-SSA/Ro-bound apoptotic cardiocytes: Implications in the pathogenesis of congenital heart block.

    PubMed

    Briassouli, Paraskevi; Komissarova, Elena V; Clancy, Robert M; Buyon, Jill P

    2010-08-06

    Binding of maternal anti-Ro/La antibodies to cognate antigen expressed on apoptotic cardiocytes decreases clearance by healthy cardiocytes, which may contribute to the development of autoimmune associated congenital heart block and fatal cardiomyopathy. Given recent evidence implicating the urokinase plasminogen activator receptor (uPAR) as a "don't eat me" signal during efferocytosis, experiments addressed whether surface bound anti-Ro antibodies inhibit apoptotic cell removal via an effect on the expression/function of the urokinase-type plasminogen activator protease uPA/uPAR system. As assessed by flow cytometry and confocal microscopy, uPAR colocalizes and interacts with Ro60 on the surface of apoptotic human fetal cardiocytes. Blocking of uPAR enhances phagocytosis of apoptotic cardiocytes by healthy cardiocytes and reverses the anti-Ro60-dependent impaired clearance of apoptotic cardiocytes. Binding of anti-Ro60 antibodies to apoptotic cardiocytes results in increased uPAR expression, as well as enhanced uPA activity. The binding of anti-Ro60 did not alter other surface molecules involved in cell recognition (calreticulin, CD31, or CD47). These data suggest that increased uPAR expression and uPA activity induced by anti-Ro60 binding to the apoptotic fetal cardiocyte provide a molecular basis by which these antibodies inhibit efferocytosis and ultimately lead to scar of the fetal conduction system and working myocardium.

  13. 78 FR 40757 - Prospective Grant of Start-Up Exclusive Commercialization License: The Development of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-08

    ... Pseudomonas Exotoxin A (cpIL4-PE38KDEL) for the Treatment of Cancers and Urological Disorders AGENCY: National... urological disorders that express the IL4 receptor on their cell surface by using cpIL4-PE38KDEL. DATES: Only... contains a circularly permuted interleukin 4 (cpIL4) ligand, which binds to the IL4 receptor. The IL4...

  14. Inhibitors for Androgen Receptor Activation Surfaces

    DTIC Science & Technology

    2007-09-01

    Inhibitor of Coregulator Binding to the Thyroid Hormone Receptor.. Molecular Endocrinology, 2007 Sep 6; [Epub ahead of print] PMID: 17823305 (related...Kiplin Guy†, Paul Webb‡, and Robert J. Fletterick* *Department of Biochemistry and Biophysics, §Department of Molecular and Cellular Pharmacology, and...are also small but significant shifts in secondary structural elements; residues 720–730 (H3) and 825–847 (H9) exhibit rmsd of 0.33 and 0.44

  15. Platelets regulate lymphatic vascular development through CLEC-2-SLP-76 signaling.

    PubMed

    Bertozzi, Cara C; Schmaier, Alec A; Mericko, Patricia; Hess, Paul R; Zou, Zhiying; Chen, Mei; Chen, Chiu-Yu; Xu, Bin; Lu, Min-min; Zhou, Diane; Sebzda, Eric; Santore, Matthew T; Merianos, Demetri J; Stadtfeld, Matthias; Flake, Alan W; Graf, Thomas; Skoda, Radek; Maltzman, Jonathan S; Koretzky, Gary A; Kahn, Mark L

    2010-07-29

    Although platelets appear by embryonic day 10.5 in the developing mouse, an embryonic role for these cells has not been identified. The SYK-SLP-76 signaling pathway is required in blood cells to regulate embryonic blood-lymphatic vascular separation, but the cell type and molecular mechanism underlying this regulatory pathway are not known. In the present study we demonstrate that platelets regulate lymphatic vascular development by directly interacting with lymphatic endothelial cells through C-type lectin-like receptor 2 (CLEC-2) receptors. PODOPLANIN (PDPN), a transmembrane protein expressed on the surface of lymphatic endothelial cells, is required in nonhematopoietic cells for blood-lymphatic separation. Genetic loss of the PDPN receptor CLEC-2 ablates PDPN binding by platelets and confers embryonic lymphatic vascular defects like those seen in animals lacking PDPN or SLP-76. Platelet factor 4-Cre-mediated deletion of Slp-76 is sufficient to confer lymphatic vascular defects, identifying platelets as the cell type in which SLP-76 signaling is required to regulate lymphatic vascular development. Consistent with these genetic findings, we observe SLP-76-dependent platelet aggregate formation on the surface of lymphatic endothelial cells in vivo and ex vivo. These studies identify a nonhemostatic pathway in which platelet CLEC-2 receptors bind lymphatic endothelial PDPN and activate SLP-76 signaling to regulate embryonic vascular development.

  16. Receptor-like Molecules on Human Intestinal Epithelial Cells Interact with an Adhesion Factor from Lactobacillus reuteri.

    PubMed

    Matsuo, Yosuke; Miyoshi, Yukihiro; Okada, Sanae; Satoh, Eiichi

    2012-01-01

    A surface protein of Lactobacillus reuteri, mucus adhesion-promoting protein (MapA), is considered to be an adhesion factor. MapA is expressed in L. reuteri strains and adheres to piglet gastric mucus, collagen type I, and human intestinal epithelial cells such as Caco-2. The aim of this study was to identify molecules that mediate the attachment of MapA from L. reuteri to the intestinal epithelial cell surface by investigating the adhesion of MapA to receptor-like molecules on Caco-2 cells. MapA-binding receptor-like molecules were detected in Caco-2 cell lysates by 2D-PAGE. Two proteins, annexin A13 (ANXA13) and paralemmin (PALM), were identified by MALDI TOF-MS. The results of a pull-down assay showed that MapA bound directly to ANXA13 and PALM. Fluorescence microscopy studies confirmed that MapA binding to ANXA13 and PALM was colocalized on the Caco-2 cell membrane. To evaluate whether ANXA13 and PALM are important for MapA adhesion, ANXA13 and PALM knockdown cell lines were established. The adhesion of MapA to the abovementioned cell lines was reduced compared with that to wild-type Caco-2 cells. These knockdown experiments established the importance of these receptor-like molecules in MapA adhesion.

  17. Acute inactivation of PSD-95 destabilizes AMPA receptors at hippocampal synapses.

    PubMed

    Yudowski, Guillermo A; Olsen, Olav; Adesnik, Hillel; Marek, Kurt W; Bredt, David S

    2013-01-01

    Postsynatptic density protein (PSD-95) is a 95 kDa scaffolding protein that assembles signaling complexes at synapses. Over-expression of PSD-95 in primary hippocampal neurons selectively increases synaptic localization of AMPA receptors; however, mice lacking PSD-95 display grossly normal glutamatergic transmission in hippocampus. To further study the scaffolding role of PSD-95 at excitatory synapses, we generated a recombinant PSD-95-4c containing a tetracysteine motif, which specifically binds a fluorescein derivative and allows for acute and permanent inactivation of PSD-95. Interestingly, acute inactivation of PSD-95 in rat hippocampal cultures rapidly reduced surface AMPA receptor immunostaining, but did not affected NMDA or transferrin receptor localization. Acute photoinactivation of PSD-95 in dissociated neurons causes ∼80% decrease in GluR2 surface staining observed by live-cell microscopy within 15 minutes of PSD-95-4c ablation. These results confirm that PSD-95 stabilizes AMPA receptors at postsynaptic sites and provides insight into the dynamic interplay between PSD-95 and AMPA receptors in live neurons.

  18. Emerging intracellular receptors for hemorrhagic fever viruses.

    PubMed

    Jae, Lucas T; Brummelkamp, Thijn R

    2015-07-01

    Ebola virus and Lassa virus belong to different virus families that can cause viral hemorrhagic fever, a life-threatening disease in humans with limited treatment options. To infect a target cell, Ebola and Lassa viruses engage receptors at the cell surface and are subsequently shuttled into the endosomal compartment. Upon arrival in late endosomes/lysosomes, the viruses trigger membrane fusion to release their genome into the cytoplasm. Although contact sites at the cell surface were recognized for Ebola virus and Lassa virus, it was postulated that Ebola virus requires a critical receptor inside the cell. Recent screens for host factors identified such internal receptors for both viruses: Niemann-Pick disease type C1 protein (NPC1) for Ebola virus and lysosome-associated membrane protein 1 (LAMP1) for Lassa virus. A cellular trigger is needed to permit binding of the viral envelope protein to these intracellular receptors. This 'receptor switch' represents a previously unnoticed step in virus entry with implications for host-pathogen interactions and viral tropism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long-term depression

    NASA Astrophysics Data System (ADS)

    Matsuda, Shinji; Kakegawa, Wataru; Budisantoso, Timotheus; Nomura, Toshihiro; Kohda, Kazuhisa; Yuzaki, Michisuke

    2013-11-01

    Long-term depression (LTD) underlies learning and memory in various brain regions. Although postsynaptic AMPA receptor trafficking mediates LTD, its underlying molecular mechanisms remain largely unclear. Here we show that stargazin, a transmembrane AMPA receptor regulatory protein, forms a ternary complex with adaptor proteins AP-2 and AP-3A in hippocampal neurons, depending on its phosphorylation state. Inhibiting the stargazin-AP-2 interaction disrupts NMDA-induced AMPA receptor endocytosis, and inhibiting that of stargazin-AP-3A abrogates the late endosomal/lysosomal trafficking of AMPA receptors, thereby upregulating receptor recycling to the cell surface. Similarly, stargazin’s interaction with AP-2 or AP-3A is necessary for low-frequency stimulus-evoked LTD in CA1 hippocampal neurons. Thus, stargazin has a crucial role in NMDA-dependent LTD by regulating two trafficking pathways of AMPA receptors—transport from the cell surface to early endosomes and from early endosomes to late endosomes/lysosomes—through its sequential binding to AP-2 and AP-3A.

  20. Aptamer Based Microsphere Biosensor for Thrombin Detection

    PubMed Central

    Zhu, Hongying; Suter, Jonathan D.; White, Ian M.; Fan, Xudong

    2006-01-01

    We have developed an optical microsphere resonator biosensor using aptamer as receptor for the measurement of the important biomolecule thrombin. The sphere surface is modified with anti-thrombin aptamer, which has excellent binding affinity and selectivity for thrombin. Binding of the thrombin at the sphere surface is monitored by the spectral position of the microsphere's whispering gallery mode resonances. A detection limit on the order of 1 NIH Unit/mL is demonstrated. Control experiments with non-aptamer oligonucleotide and BSA are also carried out to confirm the specific binding between aptamer and thrombin. We expect that this demonstration will lead to the development of highly sensitive biomarker sensors based on aptamer with lower cost and higher throughput than current technology.

  1. An internal thioester in a pathogen surface protein mediates covalent host binding

    PubMed Central

    Walden, Miriam; Edwards, John M; Dziewulska, Aleksandra M; Bergmann, Rene; Saalbach, Gerhard; Kan, Su-Yin; Miller, Ona K; Weckener, Miriam; Jackson, Rosemary J; Shirran, Sally L; Botting, Catherine H; Florence, Gordon J; Rohde, Manfred; Banfield, Mark J; Schwarz-Linek, Ulrich

    2015-01-01

    To cause disease and persist in a host, pathogenic and commensal microbes must adhere to tissues. Colonization and infection depend on specific molecular interactions at the host-microbe interface that involve microbial surface proteins, or adhesins. To date, adhesins are only known to bind to host receptors non-covalently. Here we show that the streptococcal surface protein SfbI mediates covalent interaction with the host protein fibrinogen using an unusual internal thioester bond as a ‘chemical harpoon’. This cross-linking reaction allows bacterial attachment to fibrin and SfbI binding to human cells in a model of inflammation. Thioester-containing domains are unexpectedly prevalent in Gram-positive bacteria, including many clinically relevant pathogens. Our findings support bacterial-encoded covalent binding as a new molecular principle in host-microbe interactions. This represents an as yet unexploited target to treat bacterial infection and may also offer novel opportunities for engineering beneficial interactions. DOI: http://dx.doi.org/10.7554/eLife.06638.001 PMID:26032562

  2. Evidence of a potential receptor-binding site on the Nipah virus G protein (NiV-G): identification of globular head residues with a role in fusion promotion and their localization on an NiV-G structural model.

    PubMed

    Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Wild, T Fabian; Buckland, Robin; Langedijk, Johannes P M

    2006-08-01

    As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such "escape mutants" identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of beta-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin.

  3. Evidence of a Potential Receptor-Binding Site on the Nipah Virus G Protein (NiV-G): Identification of Globular Head Residues with a Role in Fusion Promotion and Their Localization on an NiV-G Structural Model

    PubMed Central

    Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Fabian Wild, T.; Buckland, Robin; Langedijk, Johannes P. M.

    2006-01-01

    As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such “escape mutants” identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of β-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin. PMID:16840334

  4. Receptor density balances signal stimulation and attenuation in membrane-assembled complexes of bacterial chemotaxis signaling proteins

    PubMed Central

    Besschetnova, Tatiana Y.; Montefusco, David J.; Asinas, Abdalin E.; Shrout, Anthony L.; Antommattei, Frances M.; Weis, Robert M.

    2008-01-01

    All cells possess transmembrane signaling systems that function in the environment of the lipid bilayer. In the Escherichia coli chemotaxis pathway, the binding of attractants to a two-dimensional array of receptors and signaling proteins simultaneously inhibits an associated kinase and stimulates receptor methylation—a slower process that restores kinase activity. These two opposing effects lead to robust adaptation toward stimuli through a physical mechanism that is not understood. Here, we provide evidence of a counterbalancing influence exerted by receptor density on kinase stimulation and receptor methylation. Receptor signaling complexes were reconstituted over a range of defined surface concentrations by using a template-directed assembly method, and the kinase and receptor methylation activities were measured. Kinase activity and methylation rates were both found to vary significantly with surface concentration—yet in opposite ways: samples prepared at high surface densities stimulated kinase activity more effectively than low-density samples, whereas lower surface densities produced greater methylation rates than higher densities. FRET experiments demonstrated that the cooperative change in kinase activity coincided with a change in the arrangement of the membrane-associated receptor domains. The counterbalancing influence of density on receptor methylation and kinase stimulation leads naturally to a model for signal regulation that is compatible with the known logic of the E. coli pathway. Density-dependent mechanisms are likely to be general and may operate when two or more membrane-related processes are influenced differently by the two-dimensional concentration of pathway elements. PMID:18711126

  5. Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library*

    PubMed Central

    Kiefer, Jonathan D.; Srinivas, Raja R.; Lobner, Elisabeth; Tisdale, Alison W.; Mehta, Naveen K.; Yang, Nicole J.; Tidor, Bruce; Wittrup, K. Dane

    2016-01-01

    The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (Tm of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. PMID:27582495

  6. The structure of cytomegalovirus immune modulator UL141 highlights structural Ig-fold versatility for receptor binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemčovičová, Ivana; Slovak Academy of Sciences, Dúbravská cesta 9, SK 84505 Bratislava; Zajonc, Dirk M., E-mail: dzajonc@liai.org

    2014-03-01

    The crystal structure of Human cytomegalovirus immune modulator UL141 was solved at 3.25 Å resolution. Here, a detailed analysis of its intimate dimerization interface and the biophysical properties of its receptor (TRAIL-R2 and CD155) binding interactions are presented. Natural killer (NK) cells are critical components of the innate immune system as they rapidly detect and destroy infected cells. To avoid immune recognition and to allow long-term persistence in the host, Human cytomegalovirus (HCMV) has evolved a number of genes to evade or inhibit immune effector pathways. In particular, UL141 can inhibit cell-surface expression of both the NK cell-activating ligand CD155more » as well as the TRAIL death receptors (TRAIL-R1 and TRAIL-R2). The crystal structure of unliganded HCMV UL141 refined to 3.25 Å resolution allowed analysis of its head-to-tail dimerization interface. A ‘dimerization-deficient’ mutant of UL141 (ddUL141) was further designed, which retained the ability to bind to TRAIL-R2 or CD155 while losing the ability to cross-link two receptor monomers. Structural comparison of unliganded UL141 with UL141 bound to TRAIL-R2 further identified a mobile loop that makes intimate contacts with TRAIL-R2 upon receptor engagement. Superposition of the Ig-like domain of UL141 on the CD155 ligand T-cell immunoreceptor with Ig and ITIM domains (TIGIT) revealed that UL141 can potentially engage CD155 similar to TIGIT by using the C′C′′ and GF loops. Further mutations in the TIGIT binding site of CD155 (Q63R and F128R) abrogated UL141 binding, suggesting that the Ig-like domain of UL141 is a viral mimic of TIGIT, as it targets the same binding site on CD155 using similar ‘lock-and-key’ interactions. Sequence alignment of the UL141 gene and its orthologues also showed conservation in this highly hydrophobic (L/A)X{sub 6}G ‘lock’ motif for CD155 binding as well as conservation of the TRAIL-R2 binding patches, suggesting that these host–receptor interactions are evolutionary conserved.« less

  7. Characterization of the interaction between diferric transferrin and transferrin receptor 2 by functional assays and atomic force microscopy*

    PubMed Central

    Ikuta, Katsuya; Yersin, Alexandre; Ikai, Atsushi; Aisen, Philip; Kohgo, Yutaka

    2010-01-01

    Transferrin receptor (TfR2), a homologue of classical transferrin receptor 1 (TfR1), is found in two isoforms, α and β. Like TfR1, TfR2α is a type II membrane protein, but the β form lacks transmembrane portions and therefore is likely to be an intracellular protein. To investigate the functional properties of TfR2α we expressed the protein with FLAG-tagging in transferrin receptor-deficient Chinese hamster ovary cells. The association constant for binding of diferric transferrin (Tf) to TfR2α is 5.6 × 106 M−1, which is about 50 times lower than that of TfR1, with correspondingly reduced rates of iron uptake. Evidence for Tf internalization and recycling via TfR2α without degradation, as in the TfR1 pathway, was also found. The interaction of TfR2α with Tf was further investigated using atomic force microscopy (AFM), a powerful tool for investigation of the interaction between ligand and receptor at the single molecule level on the living cell surface. Dynamic force microscopy reveals a difference in the interactions of Tf with TfR2α and TfR1, with Tf-TfR1 unbinding characterized by 2 energy barriers, while only one is present for Tf-TfR2. We speculate that this difference may reflect Tf binding to TfR2α by a single lobe, whereas two lobes of Tf participate in binding to TfR1. The difference in the binding properties of Tf to TfR1 and TfR2α may help account for the different physiological roles of the two receptors. PMID:20096706

  8. Structure-activity relationships and mechanism of action of Eph-ephrin antagonists: interaction of cholanic acid with the EphA2 receptor

    PubMed Central

    Tognolini, Massimiliano; Incerti, Matteo; Mohamed, Iftiin Hassan; Giorgio, Carmine; Russo, Simonetta; Bruni, Renato; Lelli, Barbara; Bracci, Luisa; Noberini, Roberta; Pasquale, Elena B.; Barocelli, Elisabetta; Vicini, Paola; Mor, Marco

    2012-01-01

    The Eph–ephrin system, including the EphA2 receptor and the ephrin-A1 ligand, plays a critical role in tumor and vascular functions during carcinogenesis. We previously identified (3α,5β)-3-hydroxycholan-24-oic acid (lithocholic acid) as an Eph-ephrin antagonist able to inhibit EphA2 receptor activation and therefore potentially useful as a novel EphA2 receptor targeting agent. Here, we explore the structure-activity relationships of a focused set of lithocholic acid derivatives, based on molecular modelling investigation and displacement binding assays. Our exploration shows that while the 3-α-hydroxyl group of lithocholic acid has a negligible role in the recognition of the EphA2 receptor, its carboxylate group is critical for disrupting the binding of ephrin-A1 to the EphA2. As a result of our investigation, we identified (5β)-cholan-24-oic acid (cholanic acid) as a novel compound that competitively inhibits EphA2-ephrin-A1 interaction with higher potency than lithocholic acid. Surface plasmon resonance analysis indicates that cholanic acid binds specifically and reversibly to the ligand-binding domain of EphA2, with a steady-state dissociation constant (KD) in the low micromolar range. Furthermore, cholanic acid blocks the phosphorylation of EphA2 and cell retraction and rounding in PC3 prostate cancer cells, two effects that depend on EphA2 activation by the ephrin-A1 ligand. These findings suggest that cholanic acid can be used as a template structure to design effective EphA2 antagonists, with potential impact in the elucidation of the role played by this receptor in pathological conditions. PMID:22529030

  9. BA321, a novel carborane analog that binds to androgen and estrogen receptors, acts as a new selective androgen receptor modulator of bone in male mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Kenta; Cooperative Major in Advanced Health Science, Tokyo University of Agriculture and Technology, 2-24-16 Nakamachi, Koganei, Tokyo 184-8588; Hirata, Michiko

    Carboranes are a class of carbon-containing polyhedral boron cluster compounds with globular geometry and hydrophobic surface that interact with hormone receptors such as estrogen receptor (ER) and androgen receptor (AR). We have synthesized BA321, a novel carborane compound, which binds to AR. We found here that it also binds to ERs, ERα and ERβ. In orchidectomized (ORX) mice, femoral bone mass was markedly reduced due to androgen deficiency and BA321 restored bone loss in the male, whilst the decreased weight of seminal vesicle in ORX mice was not recovered by administration of BA321. In female mice, BA321 acts as amore » pure estrogen agonist, and restored both the loss of bone mass and uterine atrophy due to estrogen deficiency in ovariectomized (OVX) mice. In bone tissues, the trabecular bone loss occurred in both ORX and OVX mice, and BA321 completely restored the trabecular bone loss in both sexes. Cortical bone loss occurred in ORX mice but not in OVX mice, and BA321 clearly restored cortical bone loss due to androgen deficiency in ORX mice. Therefore, BA321 is a novel selective androgen receptor modulator (SARM) that may offer a new therapy option for osteoporosis in the male. - Highlights: • A novel carborane compound BA321 binds to both AR and ERs, ERα and ERβ. • BA321 restores bone loss in orchidectomized mice without effects on sex organ. • BA321 acts as an estrogen agonist in bone and uterus in ovariectomized mice. • BA321 may be a new SARM to prevent the loss of musculoskeletal mass in elder men.« less

  10. Monoclonal antibody binding to the macrophage-specific receptor sialoadhesin alters the phagocytic properties of human and mouse macrophages.

    PubMed

    De Schryver, Marjorie; Cappoen, Davie; Elewaut, Dirk; Nauwynck, Hans J; Maes, Louis; Caljon, Guy; Cos, Paul; Delputte, Peter L

    2017-02-01

    Sialoadhesin (Sn) is a surface receptor expressed on macrophages in steady state conditions, but during inflammation, Sn can be upregulated both on macrophages and on circulating monocytes. It was shown for different species that Sn becomes internalized after binding with monoclonal antibodies. These features suggest that Sn is a potential target for immunotherapies. In this study, human and mouse macrophages were treated with anti-Sn monoclonal antibodies or F(ab') 2 fragments and the effect of their binding to Sn on phagocytosis was analyzed. Binding of antibodies to Sn resulted in delayed and reduced phagocytosis of fluorescent beads. No effect was observed on Fc-mediated phagocytosis or phagocytosis of bacteria by human macrophages. In contrast, an enhanced phagocytosis of bacteria by mouse macrophages was detected. These results showed that stimulation of Sn could have different effects on macrophage phagocytosis, depending both on the type of phagocytosis and cellular background. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. (/sup 3/H)Ethylketocyclazocine binding to mouse brain membranes: evidence for a kappa opioid receptor type

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garzon, J.; Sanchez-Blazquez, P.; Lee, N.M.

    1984-10-01

    The binding of the putative kappa agonist ethylketocyclazocine (EKC) to synaptosomal membranes of mouse brain was studied. This benzomorphan was able to bind to different opioid receptors. A portion of this binding was not inhibited by the agonist naloxone, even at high concentrations (10 microM). This population of receptors, to which opioate alkaloids and opiod peptides display very low affinity, is probably the sigma receptor. Another class of binding sites was identified by the simultaneous addition of the selective agonists Sandoz FK-33824 and D-Ala2-D-Leu5-enkephalin, which blocked the access of EKC to mu and delta opioid receptors, respectively, leaving a portionmore » of naloxone-displaceable benzomorphan binding still detectable. Analysis of this remaining binding revealed a small population of receptors of high affinity, the kappa receptor. Therefore, EKC binds to the mu, delta, kappa and sigma receptors in the mouse brain, with similar affinities for the mu and kappa (0.22 and 0.15 nM). These results confirm the existence of a kappa opioid receptor type in the mouse brain.« less

  12. Impaired helix 12 dynamics due to proline 892 substitutions in the androgen receptor are associated with complete androgen insensitivity.

    PubMed

    Elhaji, Youssef A; Stoica, Ileana; Dennis, Sheldon; Purisima, Enrico O; Lumbroso, Rose; Beitel, Lenore K; Trifiro, Mark A

    2006-03-15

    Structural studies of the ligand-binding domain (LBD) of several steroid receptors have revealed that the dynamic properties of the C-terminal helix 12 (H12) are the major determinant of the activation mode of these receptors. H12 exhibits high mobility and different conformations in the absence of ligand. Upon ligand binding, H12 is stabilized in a precise position to seal the ligand-binding pocket and finalize the assembly of the activation function (AF-2) domain. In this study, we investigated the role of the conserved proline 892 of the androgen receptor (AR) in directing the dynamic location and orientation of the AR-H12. We used a combined approach including kinetic and biochemical assays with molecular dynamic simulations to analyze two substitutions (P892A and P892L) identified in individuals with complete androgen insensitivity syndrome. Our analyses revealed distinct mechanisms by which these substitutions impair H12 function resulting in severely defective receptors. The AR-P892A receptor exhibited reduced ligand binding and transactivational potential because of an increased flexibility in H12. The AR-P892L substitution renders the receptor inactive due to a distorted, unstructured and misplaced H12. To confirm the mutants' inability to stabilize H12 in an active position, we have developed a novel in vivo assay to evaluate the accessibility of the H12-docking site on the AR-LBD surface. An extrinsic AR-H12 peptide was able to interact with wild-type and mutant LBDs in the absence of ligand. Ligand-induced proper positioning of the intrinsic H12 of wild-type AR prevented these interactions, whereas the misplacement of the mutants' H12 did not. Proline at this position may be critical for H12 dynamics not only in the AR, but also in other nuclear receptors where this proline is conserved.

  13. Potential for Aedes albopictus and Ochlerotatus j. japonicus to Change the Field Ecology of Arboviruses of Human Health Importance in the Mid-Atlantic Region of the United States

    DTIC Science & Technology

    2001-10-16

    attachment, the viral attachment proteins on the surface of the virion bind to receptors on the microvillar membrane of the mosquito s midgut ...Penetration refers to the process through which the virions enter the midgut cells; arboviruses enter cell through receptor -mediated endocytosis. During...inactivation of the virus by digestive enzymes in the lumen of the midgut , and the absence or reduced number of cellular receptor sites for virus attachment

  14. ADAM10 controls collagen signaling and cell migration on collagen by shedding the ectodomain of discoidin domain receptor 1 (DDR1)

    PubMed Central

    Shitomi, Yasuyuki; Thøgersen, Ida B.; Ito, Noriko; Leitinger, Birgit; Enghild, Jan J.; Itoh, Yoshifumi

    2015-01-01

    Discoidin domain receptor 1 (DDR1) is a receptor tyrosine kinase that binds and transmits signals from various collagens in epithelial cells. However, how DDR1–dependent signaling is regulated has not been understood. Here we report that collagen binding induces ADAM10-dependent ectodomain shedding of DDR1. DDR1 shedding is not a result of an activation of its signaling pathway, since DDR1 mutants defective in signaling were shed in an efficient manner. DDR1 and ADAM10 were found to be in a complex on the cell surface, but shedding did not occur unless collagen bound to DDR1. Using a shedding-resistant DDR1 mutant, we found that ADAM10-dependent DDR1 shedding regulates the half-life of collagen-induced phosphorylation of the receptor. Our data also revealed that ADAM10 plays an important role in regulating DDR1-mediated cell adhesion to achieve efficient cell migration on collagen matrices. PMID:25540428

  15. Very Strong Binding for a Neutral Calix[4]pyrrole Receptor Displaying Positive Allosteric Binding.

    PubMed

    Duedal, Troels; Nielsen, Kent A; Olsen, Gunnar; Rasmussen, Charlotte B G; Kongsted, Jacob; Levillain, Eric; Breton, Tony; Miyazaki, Eigo; Takimiya, Kazuo; Bähring, Steffen; Jeppesen, Jan O

    2017-02-17

    The dual-analyte responsive behavior of tetraTTF-calix[4]pyrrole receptor 1 has been shown to complex electron-deficient planar guests in a 2:1 fashion by adopting a so-called 1,3-alternate conformation. However, stronger 1:1 complexes have been demonstrated with tetraalkylammonium halide salts that defer receptor 1 to its cone conformation. Herein, we report the complexation of an electron-deficient planar guest, 1,4,5,8-naphthalenetetracarboxylic dianhydride (NTCDA, 2) that champions the complexation with 1, resulting in a high association constant K a = 3 × 10 10 M -2 . The tetrathiafulvalene (TTF) subunits in the tetraTTF-calix[4]pyrrole receptor 1 present a near perfect shape and electronic complementarity to the NTCDA guest, which was confirmed by X-ray crystal structure analysis, DFT calculations, and electron density surface mapping. Moreover, the complexation of these species results in the formation of a charge transfer complex (2 2 ⊂1) as visualized by a readily apparent color change from yellow to brown.

  16. Mapping of Adenovirus of serotype 3 fibre interaction to desmoglein 2 revealed a novel 'non-classical' mechanism of viral receptor engagement.

    PubMed

    Vassal-Stermann, Emilie; Mottet, Manon; Ducournau, Corinne; Iseni, Frédéric; Vragniau, Charles; Wang, Hongjie; Zubieta, Chloe; Lieber, André; Fender, Pascal

    2018-05-30

    High-affinity binding of the trimeric fibre protein to a cell surface primary receptor is a common feature shared by all adenovirus serotypes. Recently, a long elusive species B adenovirus receptor has been identified. Desmoglein 2 (DSG2) a component of desmosomal junction, has been reported to interact at high affinity with Human adenoviruses HAd3, HAd7, HAd11 and HAd14. Little is known with respect to the molecular interactions of adenovirus fibre with the DSG2 ectodomain. By using different DSG2 ectodomain constructs and biochemical and biophysical experiments, we report that the third extracellular cadherin domain (EC3) of DSG2 is critical for HAd3 fibre binding. Unexpectedly, stoichiometry studies using multi-angle laser light scattering (MALLS) and analytical ultra-centrifugation (AUC) revealed a non-classical 1:1 interaction (one DSG2 per trimeric fibre), thus differentiating 'DSG2-interacting' adenoviruses from other protein receptor interacting adenoviruses in their infection strategy.

  17. PICK1 interacts with ABP/GRIP to regulate AMPA receptor trafficking.

    PubMed

    Lu, Wei; Ziff, Edward B

    2005-08-04

    PICK1 and ABP/GRIP bind to the AMPA receptor (AMPAR) GluR2 subunit C terminus. Transfer of the receptor from ABP/GRIP to PICK1, facilitated by GluR2 S880 phosphorylation, may initiate receptor trafficking. Here we report protein interactions that regulate these steps. The PICK1 BAR domain interacts intermolecularly with the ABP/GRIP linker II region and intramolecularly with the PICK1 PDZ domain. Binding of PKCalpha or GluR2 to the PICK1 PDZ domain disrupts the intramolecular interaction and facilitates the PICK1 BAR domain association with ABP/GRIP. Interference with the PICK1-ABP/GRIP interaction impairs S880 phosphorylation of GluR2 by PKC and decreases the constitutive surface expression of GluR2, the NMDA-induced endocytosis of GluR2, and recycling of internalized GluR2. We suggest that the PICK1 interaction with ABP/GRIP is a critical step in controlling GluR2 trafficking.

  18. Negative Cooperativity in the EGF Receptor

    PubMed Central

    Pike, Linda J.

    2012-01-01

    Scatchard analyses of the binding of EGF to its receptor yield concave up Scatchard plots, indicative of some type of heterogenity in ligand binding affinity. This was typically interpreted as being due to the presence of two independent binding site–one of high affinity representing ≤10% of the receptor population and one of low affinity making up the bulk of the receptors. However, the concept of two independent binding sites is difficult to reconcile with the X-ray structures of the dimerized EGF receptor that show symmetric binding of the two ligands. A new approach to the analysis of 125I-EGF binding data combined with the structure of the singly-occupied Drosophila EGF receptor have now shown that this heterogeneity is due to the presence of negative cooperativity in the EGF receptor. Concerns that negative cooperativity precludes ligand-induced dimerization of the EGF receptor confuse the concepts of linkage cooperativity. Linkage refers to the effect of ligand on the assembly of dimers while cooperativity refers to the effect of ligand binding to one subunit on ligand binding to the other subunit within a preassembled dimer. Binding of EGF to its receptor is positively linked with dimer assembly but shows negative cooperativity within the dimer. PMID:22260659

  19. CD22 ligand-binding and signaling domains reciprocally regulate B-cell Ca2+ signaling

    PubMed Central

    Müller, Jennifer; Obermeier, Ingrid; Wöhner, Miriam; Brandl, Carolin; Mrotzek, Sarah; Angermüller, Sieglinde; Maity, Palash C.; Reth, Michael; Nitschke, Lars

    2013-01-01

    A high proportion of human B cells carry B-cell receptors (BCRs) that are autoreactive. Inhibitory receptors such as CD22 can downmodulate autoreactive BCR responses. With its extracellular domain, CD22 binds to sialic acids in α2,6 linkages in cis, on the surface of the same B cell or in trans, on other cells. Sialic acids are self ligands, as they are abundant in vertebrates, but are usually not expressed by pathogens. We show that cis-ligand binding of CD22 is crucial for the regulation of B-cell Ca2+ signaling by controlling the CD22 association to the BCR. Mice with a mutated CD22 ligand-binding domain of CD22 showed strongly reduced Ca2+ signaling. In contrast, mice with mutated CD22 immunoreceptor tyrosine-based inhibition motifs have increased B-cell Ca2+ responses, increased B-cell turnover, and impaired survival of the B cells. Thus, the CD22 ligand-binding domain has a crucial function in regulating BCR signaling, which is relevant for controlling autoimmunity. PMID:23836650

  20. CD22 ligand-binding and signaling domains reciprocally regulate B-cell Ca2+ signaling.

    PubMed

    Müller, Jennifer; Obermeier, Ingrid; Wöhner, Miriam; Brandl, Carolin; Mrotzek, Sarah; Angermüller, Sieglinde; Maity, Palash C; Reth, Michael; Nitschke, Lars

    2013-07-23

    A high proportion of human B cells carry B-cell receptors (BCRs) that are autoreactive. Inhibitory receptors such as CD22 can downmodulate autoreactive BCR responses. With its extracellular domain, CD22 binds to sialic acids in α2,6 linkages in cis, on the surface of the same B cell or in trans, on other cells. Sialic acids are self ligands, as they are abundant in vertebrates, but are usually not expressed by pathogens. We show that cis-ligand binding of CD22 is crucial for the regulation of B-cell Ca(2+) signaling by controlling the CD22 association to the BCR. Mice with a mutated CD22 ligand-binding domain of CD22 showed strongly reduced Ca(2+) signaling. In contrast, mice with mutated CD22 immunoreceptor tyrosine-based inhibition motifs have increased B-cell Ca(2+) responses, increased B-cell turnover, and impaired survival of the B cells. Thus, the CD22 ligand-binding domain has a crucial function in regulating BCR signaling, which is relevant for controlling autoimmunity.

Top