Sample records for surface receptor dcir

  1. Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities

    PubMed Central

    Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

    2011-01-01

    C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Lex trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Lex less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Lex at all. PMID:21112966

  2. Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities.

    PubMed

    Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

    2011-04-01

    C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Le(x) trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Le(x) less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Le(x) at all.

  3. Evaluation of selected biomarkers for the detection of chemical sensitization in human skin: a comparative study applying THP-1, MUTZ-3 and primary dendritic cells in culture.

    PubMed

    Hitzler, Manuel; Bergert, Antje; Luch, Andreas; Peiser, Matthias

    2013-09-01

    Dendritic cells (DCs) exhibit the unique capacity to induce T cell differentiation and proliferation, two processes that are crucially involved in allergic reactions. By combining the exclusive potential of DCs as the only professional antigen-presenting cells of the human body with the well known handling advantages of cell lines, cell-based alternative methods aimed at detecting chemical sensitization in vitro commonly apply DC-like cells derived from myeloid cell lines. Here, we present the new biomarkers programmed death-ligand 1 (PD-L1), DC immunoreceptor (DCIR), IL-16, and neutrophil-activating protein-2 (NAP-2), all of which have been detectable in primary human DCs upon exposure to chemical contact allergens. To evaluate the applicability of DC-like cells in the prediction of a chemical's sensitization potential, the expression of cell surface PD-L1 and DCIR was analyzed. In contrast to primary DCs, only minor subpopulations of MUTZ-3 and THP-1 cells presented PD-L1 or DCIR at their surface. After exposure to increasing concentrations of nickel and cinnamic aldehyde, the expression level of PD-L1 and DCIR revealed much stronger affected on monocyte-derived DCs (MoDCs) or Langerhans cells (MoLCs) when compared to THP-1 and MUTZ-3 cells. Applying protein profiler arrays we further identified the soluble factors NAP-2, IL-16, IL-8 and MIP-1α as sensitive biomarkers showing the capacity to discriminate sensitizing from non-sensitizing chemicals or irritants. An allergen-specific release of IL-8 and MIP-1α could be detected in the supernatants of MoDCs and MoLCs and also in MUTZ-3 and THP-1 cells, though at much lower levels. On the protein and transcriptional level, NAP-2 and IL-16 indicated sensitizers most sensitively and specifically in MoDCs. Altogether, we have proven the reciprocal regulated surface molecules PD-L1 and DCIR and the soluble factors MIP-1α, NAP-2 and IL-16 as reliable biomarkers for chemical sensitization. We further show that primary DCs are significantly different in their phenotype and function compared to DC-like cell lines. Since they demonstrated higher absolute values and a broader range in biomarker expression, we propose that MoDCs represent an optimal and robust sensor test system well suited to identify and classify chemicals with an allergic potential. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Single vs. dual color fire detection systems: operational tradeoffs

    NASA Astrophysics Data System (ADS)

    Danino, Meir; Danan, Yossef; Sinvani, Moshe

    2017-10-01

    In attempt to supply a reasonable fire plume detection, multinational cooperation with significant capital is invested in the development of two major Infra-Red (IR) based fire detection alternatives, single-color IR (SCIR) and dual-color IR (DCIR). False alarm rate was expected to be high not only as a result of real heat sources but mainly due to the IR natural clutter especially solar reflections clutter. SCIR uses state-of-the-art technology and sophisticated algorithms to filter out threats from clutter. On the other hand, DCIR are aiming at using additional spectral band measurements (acting as a guard), to allow the implementation of a simpler and more robust approach for performing the same task. In this paper we present the basics of SCIR & DCIR architecture and the main differences between them. In addition, we will present the results from a thorough study conducted for the purpose of learning about the added value of the additional data available from the second spectral band. Here we consider the two CO2 bands of 4-5 micron and of 2.5-3 micron band as well as off peak band (guard). The findings of this study refer also to Missile warning systems (MWS) efficacy, in terms of operational value. We also present a new approach for tunable filter to such sensor.

  5. Phenotypic and Functional Properties of Human Steady State CD14+ and CD1a+ Antigen Presenting Cells and Epidermal Langerhans Cells.

    PubMed

    Fehres, Cynthia M; Bruijns, Sven C M; Sotthewes, Brigit N; Kalay, Hakan; Schaffer, Lana; Head, Steven R; de Gruijl, Tanja D; Garcia-Vallejo, Juan J; van Kooyk, Yvette

    2015-01-01

    Cutaneous antigen presenting cells (APCs) are critical for the induction and regulation of skin immune responses. The human skin contains phenotypically and functionally distinct APCs subsets that are present at two separated locations. While CD1ahigh LCs form a dense network in the epidermis, the CD14+ and CD1a+ APCs reside in the dermal compartment. A better understanding of the biology of human skin APC subsets is necessary for the improvement of vaccine strategies that use the skin as administration route. In particular, progress in the characterization of uptake and activatory receptors will certainly improve APC-targeting strategies in vaccination. Here we performed a detailed analysis of the expression and function of glycan-binding and pattern-recognition receptors in skin APC subsets. The results demonstrate that under steady state conditions human CD1a+ dermal dendritic cells (DCs) were phenotypically most mature as measured by the expression of CD83 and CD86, whereas the CD14+ cells showed a higher expression of the CLRs DC-SIGN, mannose receptor and DCIR and had potent antigen uptake capacity. Furthermore, steady state LCs showed superior antigen cross-presentation as compared to the dermal APC subsets. Our results also demonstrate that the TLR3 ligand polyribosinic-polyribocytidylic acid (pI:C) was the most potent stimulator of cytokine production by both LCs and dDCs. These studies warrant further exploration of human CD1a+ dDCs and LCs as target cells for cancer vaccination to induce anti-tumor immune responses.

  6. Expression of C-type lectin receptor mRNA in chronic otitis media with cholesteatoma.

    PubMed

    Kim, Sang Hoon; Han, Seung-Ho; Byun, Jae Yong; Park, Moon Suh; Kim, Young Il; Yeo, Seung Geun

    2017-06-01

    The levels of expression of various C-type lectin receptors (CLRs) messenger ribo nucleic acids (mRNAs) were significantly higher in cholesteatomas than in normal skin, suggesting that these CLRs may be involved in the pathogenesis of cholesteatoma. Altered expression of pattern recognition receptors may be associated with immune responses in patients with cholesteatoma. This study assessed the levels of expression of CLR mRNAs in normal skin and in cholesteatoma. Cholesteatoma specimens were obtained from 38 patients with acquired cholesteatoma. The levels of expression of various CLR mRNAs were assessed quantitatively using real-time RT-PCR (Reverse transcription polymerase chain reaction) and correlated with age, sex, the presence of bacteria, hearing level, frequency of surgery, and degree of ossicle destruction. The levels of CD206 (cluster of differentiation 206), DEC-205 (Dendritic and epithelial cell-205), MGL (monoacylglycerol lipase), CLEC5A (C-type lectin domain family 5 member A), Dectin-2 (dendrite cell-associated C-type lectin-2), BDCA2 (Blood dendritic cell antigen 2), Mincle, DCIR (dendritic cell immunoreceptor), Dectin-1, MICL (Myeloid inhibitory C type-like lectin), and CLEC12B (C-type lectin domain family 12, member B) mRNAs were significantly higher in cholesteatoma than in control skin samples (p < 0.05). The levels of CLEC5A (C-type lectin domain family 5 member) and Dectin-1 mRNAs were significantly higher in cholesteatomas with ≥2 than ≤1 destroyed ossicles (p < 0.05), and the levels of MGL, Mincle, Dectin-1, and CLEC12B mRNAs were significantly higher in recurrent than initial cholesteatoma specimens (p < 0.05). The level of CLEC5A mRNAs was significantly higher in patients with severe than mild-to-moderate hearing loss (p < 0.05).

  7. CD22 is required for protection against West Nile virus Infection.

    PubMed

    Ma, Daphne Y; Suthar, Mehul S; Kasahara, Shinji; Gale, Michael; Clark, Edward A

    2013-03-01

    West Nile virus (WNV) is a RNA virus of the family Flaviviridae and the leading cause of mosquito-borne encephalitis in the United States. Humoral immunity is essential for protection against WNV infection; however, the requirements for initiating effective antibody responses against WNV infection are still unclear. CD22 (Siglec-2) is expressed on B cells and regulates B cell receptor signaling, cell survival, proliferation, and antibody production. In this study, we investigated how CD22 contributes to protection against WNV infection and found that CD22 knockout (Cd22(-/-)) mice were highly susceptible to WNV infection and had increased viral loads in the serum and central nervous system (CNS) compared to wild-type (WT) mice. This was not due to a defect in humoral immunity, as Cd22(-/-) mice had normal WNV-specific antibody responses. However, Cd22(-/-) mice had decreased WNV-specific CD8(+) T cell responses compared to those of WT mice. These defects were not simply due to reduced cytotoxic activity or increased cell death but, rather, were associated with decreased lymphocyte migration into the draining lymph nodes (dLNs) of infected Cd22(-/-) mice. Cd22(-/-) mice had reduced production of the chemokine CCL3 in the dLNs after infection, suggesting that CD22 affects chemotaxis via controlling chemokine production. CD22 was not restricted to B cells but was also expressed on a subset of splenic DCIR2(+) dendritic cells that rapidly expand early after WNV infection. Thus, CD22 plays an essential role in controlling WNV infection by governing cell migration and CD8(+) T cell responses.

  8. CD22 Is Required for Protection against West Nile Virus Infection

    PubMed Central

    Ma, Daphne Y.; Suthar, Mehul S.; Kasahara, Shinji; Gale, Michael

    2013-01-01

    West Nile virus (WNV) is a RNA virus of the family Flaviviridae and the leading cause of mosquito-borne encephalitis in the United States. Humoral immunity is essential for protection against WNV infection; however, the requirements for initiating effective antibody responses against WNV infection are still unclear. CD22 (Siglec-2) is expressed on B cells and regulates B cell receptor signaling, cell survival, proliferation, and antibody production. In this study, we investigated how CD22 contributes to protection against WNV infection and found that CD22 knockout (Cd22−/−) mice were highly susceptible to WNV infection and had increased viral loads in the serum and central nervous system (CNS) compared to wild-type (WT) mice. This was not due to a defect in humoral immunity, as Cd22−/− mice had normal WNV-specific antibody responses. However, Cd22−/− mice had decreased WNV-specific CD8+ T cell responses compared to those of WT mice. These defects were not simply due to reduced cytotoxic activity or increased cell death but, rather, were associated with decreased lymphocyte migration into the draining lymph nodes (dLNs) of infected Cd22−/− mice. Cd22−/− mice had reduced production of the chemokine CCL3 in the dLNs after infection, suggesting that CD22 affects chemotaxis via controlling chemokine production. CD22 was not restricted to B cells but was also expressed on a subset of splenic DCIR2+ dendritic cells that rapidly expand early after WNV infection. Thus, CD22 plays an essential role in controlling WNV infection by governing cell migration and CD8+ T cell responses. PMID:23302871

  9. Cell surface control of the multiubiquitination and deubiquitination of high-affinity immunoglobulin E receptors.

    PubMed Central

    Paolini, R; Kinet, J P

    1993-01-01

    Multiubiquitination of proteins is a critical step leading to selective degradation for many polypeptides. Therefore, activation-induced multiubiquitination of cell surface receptors, such as the platelet-derived growth factor (PDGF) receptor and the T cell antigen (TCR) receptor, may correspond to a degradation pathway for ligand-receptor complexes. Here we show that the antigen-induced engagement of high-affinity immunoglobulin E receptors (Fc epsilon RI) results in the immediate multiubiquitination of Fc epsilon RI beta and gamma chains. This ubiquitination is independent of receptor phosphorylation and is restricted to activated receptors. Surprisingly, receptor multiubiquitination is immediately reversible when receptors are disengaged. Therefore, multiubiquitination and deubiquitination of Fc epsilon RI receptors is controlled at the cell surface by receptor engagement and disengagement. The rapidity, specificity and, most importantly, the reversibility of the activation-induced receptor multiubiquitination suggest that this process may turn on/off a cell surface receptor signaling function thus far unsuspected. Images PMID:8382611

  10. A protein crosslinking assay for measuring cell surface expression of glutamate receptor subunits in the rodent brain after in vivo treatments

    PubMed Central

    Boudreau, Amy C.; Milovanovic, Mike; Conrad, Kelly L.; Nelson, Christopher; Ferrario, Carrie R.; Wolf, Marina E.

    2012-01-01

    Trafficking of neurotransmitter receptors between intracellular and cell surface compartments is important for regulating neurotransmission. We developed a method for determining if an in vivo treatment has altered receptor distribution in a particular region of rodent brain. After the treatment, brain slices are rapidly prepared from the region of interest. Then cell surface-expressed receptors are covalently crosslinked to nearby proteins using the membrane-impermeable, bifunctional crosslinker bis(sulfosuccinimidyl)suberate (BS3). This increases the apparent molecular weight of surface receptors, while intracellular receptors are not modified. Thus, surface and intracellular receptor pools can be separated and quantified using SDS-PAGE and immunoblotting. This method is particularly useful for analyzing AMPA receptor subunits, offering advantages in accuracy, efficiency and cost compared to biotinylation. A disadvantage is that some antibodies no longer recognize their target protein after crosslinking. We have used this method to quantify changes in receptor distribution after acute and chronic exposure to psychomotor stimulants. PMID:22470150

  11. Heterogeneity of chemokine cell-surface receptor expression in triple-negative breast cancer

    PubMed Central

    Norton, Kerri-Ann; Popel, Aleksander S; Pandey, Niranjan B

    2015-01-01

    Introduction: Tumor heterogeneity is a well-established concept in cancer research. In this paper, we examine an additional type of tumor cell heterogeneity - tumor cell-surface receptor heterogeneity. Methods: We use flow cytometry to measure the frequency and numbers of cell-surface receptors on triple negative breast cancer cell lines. Results: We find two distinct populations of human triple-negative breast cancer cells MDA-MB-231 when they are grown in culture, one with low surface levels of various chemokine receptors and a second with much higher levels. The population with high surface levels of these receptors is increased in the more metastatic MDA-MB-231-luc-d3h2ln cell line. Conclusion: We hypothesize that this high cell-surface receptor population is involved in metastasis. We find that the receptor high populations can be modulated by tumor conditioned media and IL6 treatment indicating that the tumor microenvironment is important for the maintenance and sizes of these populations. PMID:26101698

  12. Investigation of the Comparative Effects of Red and Infrared Laser Therapy on Skeletal Muscle Repair in Diabetic Rats.

    PubMed

    Assis, Lívia; Manis, Camila; Fernandes, Kelly Rossetti; Cabral, Daniel; Magri, Angela; Veronez, Suellen; Renno, Ana Claudia Muniz

    2016-07-01

    The aim of this study was to evaluate the in vivo response of 2 different laser wavelengths (red and infrared) on skeletal muscle repair process in diabetic rats. Forty Wistar rats were randomly divided into 4 experimental groups: basal control-nondiabetic and muscle-injured animals without treatment (BC); diabetic muscle-injured without treatment (DC); diabetic muscle-injured, treated with red laser (DCR) and infrared laser (DCIR). The injured region was irradiated daily for 7 consecutive days, starting immediately after the injury using a red (660 nm) and an infrared (808 nm) laser. The histological results demonstrated in both treated groups (red and infrared wavelengths) a modulation of the inflammatory process and a better tissue organization located in the site of the injury. However, only infrared light significantly reduced the injured area and increased MyoD and myogenin protein expression. Moreover, both red and infrared light increased the expression of the proangiogenic vascular endothelial growth factor and reduced the cyclooxygenase 2 protein expression. These results suggest that low-level laser therapy was efficient in promoting skeletal muscle repair in diabetic rats. However, the effect of infrared wavelength was more pronounced by reducing the area of the injury and modulating the expression proteins related to the repair.

  13. Regulated internalization of NMDA receptors drives PKD1-mediated suppression of the activity of residual cell-surface NMDA receptors.

    PubMed

    Fang, Xiao-Qian; Qiao, Haifa; Groveman, Bradley R; Feng, Shuang; Pflueger, Melissa; Xin, Wen-Kuan; Ali, Mohammad K; Lin, Shuang-Xiu; Xu, Jindong; Duclot, Florian; Kabbaj, Mohamed; Wang, Wei; Ding, Xin-Sheng; Santiago-Sim, Teresa; Jiang, Xing-Hong; Salter, Michael W; Yu, Xian-Min

    2015-11-19

    Constitutive and regulated internalization of cell surface proteins has been extensively investigated. The regulated internalization has been characterized as a principal mechanism for removing cell-surface receptors from the plasma membrane, and signaling to downstream targets of receptors. However, so far it is still not known whether the functional properties of remaining (non-internalized) receptor/channels may be regulated by internalization of the same class of receptor/channels. The N-methyl-D-aspartate receptor (NMDAR) is a principal subtype of glutamate-gated ion channel and plays key roles in neuronal plasticity and memory functions. NMDARs are well-known to undergo two types of regulated internalization - homologous and heterologous, which can be induced by high NMDA/glycine and DHPG, respectively. In the present work, we investigated effects of regulated NMDAR internalization on the activity of residual cell-surface NMDARs and neuronal functions. In electrophysiological experiments we discovered that the regulated internalization of NMDARs not only reduced the number of cell surface NMDARs but also caused an inhibition of the activity of remaining (non-internalized) surface NMDARs. In biochemical experiments we identified that this functional inhibition of remaining surface NMDARs was mediated by increased serine phosphorylation of surface NMDARs, resulting from the activation of protein kinase D1 (PKD1). Knockdown of PKD1 did not affect NMDAR internalization but prevented the phosphorylation and inhibition of remaining surface NMDARs and NMDAR-mediated synaptic functions. These data demonstrate a novel concept that regulated internalization of cell surface NMDARs not only reduces the number of NMDARs on the cell surface but also causes an inhibition of the activity of remaining surface NMDARs through intracellular signaling pathway(s). Furthermore, modulating the activity of remaining surface receptors may be an effective approach for treating receptor internalization-induced changes in neuronal functions of the CNS.

  14. The N-terminal region of the dopamine D2 receptor, a rhodopsin-like GPCR, regulates correct integration into the plasma membrane and endocytic routes

    PubMed Central

    Cho, DI; Min, C; Jung, KS; Cheong, SY; Zheng, M; Cheong, SJ; Oak, MH; Cheong, JH; Lee, BK; Kim, KM

    2012-01-01

    BACKGROUND AND PURPOSE Functional roles of the N-terminal region of rhodopsin-like GPCR family remain unclear. Using dopamine D2 and D3 receptors as a model system, we probed the roles of the N-terminal region in the signalling, intracellular trafficking of receptor proteins, and explored the critical factors that determine the functionality of the N-terminal region. EXPERIMENTAL APPROACH The N-terminal region of the D2 receptor was gradually shortened or switched with that of the D3 receptor or a non-specific sequence (FLAG), or potential N-terminal glycosylation sites were mutated. Effects of these manipulations on surface expression, internalization, post-endocytic behaviours and signalling were determined. KEY RESULTS Shortening the N-terminal region of the D2 receptor enhanced receptor internalization and impaired surface expression and signalling; ligand binding, desensitization and down-regulation were not affected but their association with a particular microdomain, caveolae, was disrupted. Replacement of critical residues within the N-terminal region with the FLAG epitope failed to restore surface expression but partially restored the altered internalization and signalling. When the N-terminal regions were switched between D2 and D3 receptors, cell surface expression pattern of each receptor was switched. Mutations of potential N-terminal glycosylation sites inhibited surface expression but enhanced internalization of D2 receptors. CONCLUSIONS AND IMPLICATIONS Shortening of N-terminus or mutation of glycosylation sites located within the N-terminus enhanced receptor internalization but impaired the surface expression of D2 receptors. The N-terminal region of the D2 receptor, in a sequence-specific manner, controls the receptor's conformation and integration into the plasma membrane, which determine its subcellular localization, intracellular trafficking and signalling properties. PMID:22117524

  15. Infection of Polarized MDCK Cells with Herpes Simplex Virus 1: Two Asymmetrically Distributed Cell Receptors Interact with Different Viral Proteins

    NASA Astrophysics Data System (ADS)

    Sears, Amy E.; McGwire, Bradford S.; Roizman, Bernard

    1991-06-01

    Herpes simplex virus 1 attaches to at least two cell surface receptors. In polarized epithelial (Madin-Darby canine kidney; MDCK) cells one receptor is located in the apical surface and attachment to the cells requires the presence of glycoprotein C in the virus. The second receptor is located in the basal surface and does not require the presence of glycoprotein C. Exposure of MDCK cells at either the apical or basal surface to wild-type virus yields plaques and viral products whereas infection by a glycoprotein C-negative mutant yields identical results only after exposure of MDCK cells to virus at the basal surface. Multiple receptors for viral entry into cells expand the host range of the virus. The observation that glycoprotein C-negative mutants are infectious in many nonpolarized cell lines suggests that cells in culture may express more than one receptor and explains why genes that specify the viral proteins that recognize redundant receptors, like glycoprotein C, are expendable.

  16. Surface receptors on human haematopoietic cell lines.

    PubMed Central

    Huber, C; Sundström, C; Nilsson, K; Wigzell, H

    1976-01-01

    The expression of complement receptors, of Fc receptors, of SRBC receptors and of S-Ig was investigated on human haematopoietic cell lines of proved malignant derivation. According to their origin and to a panel of phenotypic markers these lines have been classified into lymphoma lines, myeloma lines and leukemia lines. Results were compared with those obtained on non-malignant EBV carrying lymphoblastoid cell lines (LCL). Among the lymphoid cell lines the LCL showed a pattern of B-lymphocyte surface markers, i.e. surface immunoglobulins, C3 receptors but low density of Fc receptors. The non-Burkitt lymphoma lines bore in varying degree these B-lymphocyte markers. The lines U-698 M and DG-75 were exceptional in having only surface immunoglobulin. The Burkitt lymphoma lines had all B-lymphocyte markers. The myeloma lines differed from the lymphoid lines in lacking C3 and Fc receptors and showed only trace amounts of surface immunoglobulins. In contrast to lymphoid and myeloma lines, the leukaemia lines were completely lacking surface immunoglobulins, but showed C3 and Fc receptors in variable densities. On line, the ALL derived line MOLT-3 showed the capacity to spontaneous rosette formation with SRBC. The findings that LCL presented a homogeneous pattern of B-lymphocyte surface markers may be of value in order to discriminate between these lines and lines derived from haematopoietic malignancies other than Burkitt lymphomas. PMID:963908

  17. Sorting receptor Rer1 controls surface expression of muscle acetylcholine receptors by ER retention of unassembled alpha-subunits.

    PubMed

    Valkova, Christina; Albrizio, Marina; Röder, Ira V; Schwake, Michael; Betto, Romeo; Rudolf, Rüdiger; Kaether, Christoph

    2011-01-11

    The nicotinic acetylcholine receptor of skeletal muscle is composed of five subunits that are assembled in a stepwise manner. Quality control mechanisms ensure that only fully assembled receptors reach the cell surface. Here, we show that Rer1, a putative Golgi-ER retrieval receptor, is involved in the biogenesis of acetylcholine receptors. Rer1 is expressed in the early secretory pathway in the myoblast line C2C12 and in mouse skeletal muscle, and up-regulated during myogenesis. Upon down-regulation of Rer1 in C2C12 cells, unassembled acetylcholine receptor α-subunits escape from the ER and are transported to the plasma membrane and lysosomes, where they are degraded. As a result, the amount of fully assembled receptor at the cell surface is reduced. In vivo Rer1 knockdown and genetic inactivation of one Rer1 allele lead to significantly smaller neuromuscular junctions in mice. Our data show that Rer1 is a functionally important unique factor that controls surface expression of muscle acetylcholine receptors by localizing unassembled α-subunits to the early secretory pathway.

  18. Sustained neurotensin exposure promotes cell surface recruitment of NTS2 receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perron, Amelie; Sharif, Nadder; Gendron, Louis

    2006-05-12

    In this study, we investigated whether persistent agonist stimulation of NTS2 receptors gives rise to down-regulation, in light of reports that their activation induced long-lasting effects. To address this issue, we incubated COS-7 cells expressing the rat NTS2 with neurotensin (NT) for up to 24 h and measured resultant cell surface [{sup 125}I]-NT binding. We found that NTS2-expressing cells retained the same surface receptor density despite efficient internalization mechanisms. This preservation was neither due to NTS2 neosynthesis nor recycling since it was not blocked by cycloheximide or monensin. However, it appeared to involve translocation of spare receptors from internal stores,more » as NT induced NTS2 migration from trans-Golgi network to endosome-like structures. This stimulation-induced regulation of cell surface NTS2 receptors was even more striking in rat spinal cord neurons. Taken together, these results suggest that sustained NTS2 activation promotes recruitment of intracellular receptors to the cell surface, thereby preventing functional desensitization.« less

  19. Functional dynamics of cell surface membrane proteins

    NASA Astrophysics Data System (ADS)

    Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio

    2014-04-01

    Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules.

  20. Functional dynamics of cell surface membrane proteins.

    PubMed

    Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio

    2014-04-01

    Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Clustering of adhesion receptors following exposure of insect blood cells to foreign surfaces.

    PubMed

    Nardi, James B; Zhuang, Shufei; Pilas, Barbara; Bee, Charles Mark; Kanost, Michael R

    2005-05-01

    Cell-mediated immune responses of insects involve interactions of two main classes of blood cells (hemocytes) known as granular cells and plasmatocytes. In response to a foreign surface, these hemocytes suddenly transform from circulating, non-adherent cells to cells that interact and adhere to each other and the foreign surface. This report presents evidence that during this adhesive transformation the extracellular matrix (ECM) proteins lacunin and a ligand for peanut agglutinin (PNA) lectin are released by granular cells and bind to surfaces of both granular cells and plasmatocytes. ECM protein co-localizes on cell surfaces with the adhesive receptors integrin and neuroglian, a member of the immunoglobulin superfamily. The ECM protein(s) secreted by granular cells are hypothesized to interact with adhesion receptors such as neuroglian and integrin by cross linking and clustering them on hemocyte surfaces. This clustering of receptors is known to enhance the adhesiveness (avidity) of interacting mammalian immune cells. The formation of ring-shaped clusters of these adhesion receptors on surfaces of insect immune cells represents an evolutionary antecedent of the mammalian immunological synapse.

  2. Neutrophil cell surface receptors and their intracellular signal transduction pathways☆

    PubMed Central

    Futosi, Krisztina; Fodor, Szabina; Mócsai, Attila

    2013-01-01

    Neutrophils play a critical role in the host defense against bacterial and fungal infections, but their inappropriate activation also contributes to tissue damage during autoimmune and inflammatory diseases. Neutrophils express a large number of cell surface receptors for the recognition of pathogen invasion and the inflammatory environment. Those include G-protein-coupled chemokine and chemoattractant receptors, Fc-receptors, adhesion receptors such as selectins/selectin ligands and integrins, various cytokine receptors, as well as innate immune receptors such as Toll-like receptors and C-type lectins. The various cell surface receptors trigger very diverse signal transduction pathways including activation of heterotrimeric and monomeric G-proteins, receptor-induced and store-operated Ca2 + signals, protein and lipid kinases, adapter proteins and cytoskeletal rearrangement. Here we provide an overview of the receptors involved in neutrophil activation and the intracellular signal transduction processes they trigger. This knowledge is crucial for understanding how neutrophils participate in antimicrobial host defense and inflammatory tissue damage and may also point to possible future targets of the pharmacological therapy of neutrophil-mediated autoimmune or inflammatory diseases. PMID:23994464

  3. Plant cell surface receptor-mediated signaling - a common theme amid diversity.

    PubMed

    He, Yunxia; Zhou, Jinggeng; Shan, Libo; Meng, Xiangzong

    2018-01-29

    Sessile plants employ a diverse array of plasma membrane-bound receptors to perceive endogenous and exogenous signals for regulation of plant growth, development and immunity. These cell surface receptors include receptor-like kinases (RLKs) and receptor-like proteins (RLPs) that harbor different extracellular domains for perception of distinct ligands. Several RLK and RLP signaling pathways converge at the somatic embryogenesis receptor kinases (SERKs), which function as shared co-receptors. A repertoire of receptor-like cytoplasmic kinases (RLCKs) associate with the receptor complexes to relay intracellular signaling. Downstream of the receptor complexes, mitogen-activated protein kinase (MAPK) cascades are among the key signaling modules at which the signals converge, and these cascades regulate diverse cellular and physiological responses through phosphorylation of different downstream substrates. In this Review, we summarize the emerging common theme that underlies cell surface receptor-mediated signaling pathways in Arabidopsis thaliana : the dynamic association of RLKs and RLPs with specific co-receptors and RLCKs for signal transduction. We further discuss how signaling specificities are maintained through modules at which signals converge, with a focus on SERK-mediated receptor signaling. © 2018. Published by The Company of Biologists Ltd.

  4. Development of B cells expressing surface immunoglobulin molecules that lack V(D)J-encoded determinants in the avian embryo bursa of Fabricius

    PubMed Central

    Sayegh, Camil E.; Demaries, Sandra L.; Iacampo, Sandra; Ratcliffe, Michael J. H.

    1999-01-01

    Immunoglobulin gene rearrangement in avian B cell precursors generates surface Ig receptors of limited diversity. It has been proposed that specificities encoded by these receptors play a critical role in B lineage development by recognizing endogenous ligands within the bursa of Fabricius. To address this issue directly we have introduced a truncated surface IgM, lacking variable region domains, into developing B precursors by retroviral gene transfer in vivo. Cells expressing this truncated receptor lack endogenous surface IgM, and the low level of endogenous Ig rearrangements that have occurred within this population of cells has not been selected for having a productive reading frame. Such cells proliferate rapidly within bursal epithelial buds of normal morphology. In addition, despite reduced levels of endogenous light chain rearrangement, those light chain rearrangements that have occurred have undergone variable region diversification by gene conversion. Therefore, although surface expression of an Ig receptor is required for bursal colonization and the induction of gene conversion, the specificity encoded by the prediversified receptor is irrelevant and, consequently, there is no obligate ligand for V(D)J-encoded determinants of prediversified avian cell surface IgM receptor. PMID:10485907

  5. Immunocytochemical localization of muscarinic, adrenergic and AT1 receptors.

    PubMed

    Schulze, W; Fu, M L

    1996-01-01

    By indirect immunofluorescence and post-embedding EM gold technique, the localization of alpha 1-adrenergic, M2-muscarinic and angiotensin II receptor-I (AT1) were determinated. With antipeptide antibodies directed against the second extracellular loops of all three receptors, these receptors were found to be localized at the sarcolemma of adult rat cardiomyocytes and at the surface membranes of cultivated neonatal heart cells. Additionally, M2 receptors were localized along T-tubule membranes of both rat and human adult cardiomyocytes. alpha 1-Adrenergic receptors were found intracellular near the surface of atrial granules (ANF-granules). By using M2 and alpha 1-adrenergic receptor antibodies the strongest fluorescence was found in the right atrium of the rat. Besides the localization in cardiomyocytes, AT1 receptors were also localized in outer plasma membranes and the endoplasmic reticulum of fibroblasts, and the surface of smooth muscle cells of the major arteries and veins. Likewise, the muscarinic M2 receptors were found along the outer membranes of endothelial cells from capillaries and endocardium.

  6. Structure of colicin I receptor bound to the R-domain of colicin Ia: implications for protein import

    PubMed Central

    Buchanan, Susan K; Lukacik, Petra; Grizot, Sylvestre; Ghirlando, Rodolfo; Ali, Maruf M U; Barnard, Travis J; Jakes, Karen S; Kienker, Paul K; Esser, Lothar

    2007-01-01

    Colicin Ia is a 69 kDa protein that kills susceptible Escherichia coli cells by binding to a specific receptor in the outer membrane, colicin I receptor (70 kDa), and subsequently translocating its channel forming domain across the periplasmic space, where it inserts into the inner membrane and forms a voltage-dependent ion channel. We determined crystal structures of colicin I receptor alone and in complex with the receptor binding domain of colicin Ia. The receptor undergoes large and unusual conformational changes upon colicin binding, opening at the cell surface and positioning the receptor binding domain of colicin Ia directly above it. We modelled the interaction with full-length colicin Ia to show that the channel forming domain is initially positioned 150 Å above the cell surface. Functional data using full-length colicin Ia show that colicin I receptor is necessary for cell surface binding, and suggest that the receptor participates in translocation of colicin Ia across the outer membrane. PMID:17464289

  7. Adenovirus receptors and their implications in gene delivery

    PubMed Central

    Sharma, Anurag; Li, Xiaoxin; Bangari, Dinesh S.; Mittal, Suresh K.

    2010-01-01

    Adenoviruses (Ads) have gained popularity as gene delivery vectors for therapeutic and prophylactic applications. Ad entry into host cells involves specific interactions between cell surface receptors and viral capsid proteins. Several cell surface molecules have been identified as receptors for Ad attachment and entry. Tissue tropism of Ad vectors is greatly influenced by their receptor usage. A variety of strategies have been investigated to modify Ad vector tropism by manipulating the receptor-interacting moieties. Many such strategies are aimed at targeting and/or detargeting of Ad vectors. In this review, we discuss the various cell surface molecules that are implicated as receptors for virus attachment and internalization. Special emphasis is given to Ad types that are utilized as gene delivery vectors. Various strategies to modify Ad tropism using the knowledge of Ad receptors are also discussed. PMID:19647886

  8. Endosomal receptor kinetics determine the stability of intracellular growth factor signalling complexes

    PubMed Central

    Tzafriri, A. Rami; Edelman, Elazer R.

    2006-01-01

    There is an emerging paradigm that growth factor signalling continues in the endosome and that cell response to a growth factor is defined by the integration of cell surface and endosomal events. As activated receptors in the endosome are exposed to a different set of binding partners, they probably elicit differential signals compared with when they are at the cell surface. As such, complete appreciation of growth factor signalling requires understanding of growth factor–receptor binding and trafficking kinetics both at the cell surface and in endosomes. Growth factor binding to surface receptors is well characterized, and endosomal binding is assumed to follow surface kinetics if one accounts for changes in pH. Yet, specific binding kinetics within the endosome has not been examined in detail. To parse the factors governing the binding state of endosomal receptors we analysed a whole-cell mathematical model of epidermal growth factor receptor trafficking and binding. We discovered that the stability of growth factor–receptor complexes within endosomes is governed by three primary independent factors: the endosomal dissociation constant, total endosomal volume and the number of endosomal receptors. These factors were combined into a single dimensionless parameter that determines the endosomal binding state of the growth factor–receptor complex and can distinguish different growth factors from each other and different cell states. Our findings indicate that growth factor binding within endosomal compartments cannot be appreciated solely on the basis of the pH-dependence of the dissociation constant and that the concentration of receptors in the endosomal compartment must also be considered. PMID:17117924

  9. Co-expression in CHO cells of two muscle proteins involved in excitation-contraction coupling.

    PubMed

    Takekura, H; Takeshima, H; Nishimura, S; Takahashi, M; Tanabe, T; Flockerzi, V; Hofmann, F; Franzini-Armstrong, C

    1995-10-01

    Ryanodine receptors and dihydropyridine receptors are located opposite each other at the junctions between sarcoplasmic reticulum and either the surface membrane or the transverse tubules in skeletal muscle. Ryanodine receptors are the calcium release channels of the sarcoplasmic reticulum and their cytoplasmic domains form the feet, connecting sarcoplasmic reticulum to transverse tubules. Dihydropyridine receptors are L-type calcium channels that act as the voltage sensors of excitation-contraction coupling: they sense surface membrane and transverse tubule depolarization and induce opening of the sarcoplasmic reticulum release channels. In skeletal muscle, ryanodine receptors are arranged in extensive arrays and dihydropyridine receptors are grouped into tetrads, which in turn are associated with the four subunits of ryanodine receptors. The disposition allows for a direct interaction between the two sets of molecules. CHO cells were stably transformed with plasmids for skeletal muscle ryanodine receptors and either the skeletal dihydropyridine receptor, or a skeletal-cardiac dihydropyridine receptor chimera (CSk3) which can functionally substitute for the skeletal dihydropyridine receptor, in addition to plasmids for the alpha 2, beta and gamma subunits. RNA blot hybridization gave positive results for all components. Immunoblots, ryanodine binding, electron microscopy and exposure to caffeine show that the expressed ryanodine receptors forms functional tetrameric channels, which are correctly inserted into the endoplasmic reticulum membrane, and form extensive arrays with the same spacings as in skeletal muscle. Since formation of arrays does not require coexpression of dihydropyridine receptors, we conclude that self-aggregation is an independent property of ryanodine receptors. All dihydropyridine receptor-expressing clones show high affinity binding for dihydropyridine and immunolabelling with antibodies against dihydropyridine receptor. The presence of calcium currents with fast kinetics and immunolabelling for dihydropyridine receptors in the surface membrane of CSk3 clones indicate that CSk3-dihydropyridine receptors are appropriately targeted to the cell's plasmalemma. The expressed skeletal-type dihydropyridine receptors, however, remain mostly located within perinuclear membranes. In cells coexpressing functional dihydropyridine receptors and ryanodine receptors, no junctions between feet-bearing endoplasmic reticulum elements and surface membrane are formed, and dihydropyridine receptors do not assemble into tetrads. A separation between dihydropyridine receptors and ryanodine receptors is not unique to CHO cells, but is found also in cardiac muscle, in muscles of invertebrates and, under certain conditions, in skeletal muscle. We suggest that failure to form junctions in co-transfected CHO cell may be due to lack of an essential protein necessary either for the initial docking of the endoplasmic reticulum to the surface membrane or for maintaining the interaction between dihydropyridine receptors and ryanodine receptors. We also conclude that formation of tetrads requires a close interaction between dihydropyridine receptors and ryanodine receptors.

  10. Inhibitory effects of two G protein-coupled receptor kinases on the cell surface expression and signaling of the human adrenomedullin receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuwasako, Kenji, E-mail: kuwasako@med.miyazaki-u.ac.jp; Sekiguchi, Toshio; Nagata, Sayaka

    2016-02-19

    Receptor activity-modifying protein 2 (RAMP2) enables the calcitonin receptor-like receptor (CLR, a family B GPCR) to form the type 1 adrenomedullin receptor (AM{sub 1} receptor). Here, we investigated the effects of the five non-visual GPCR kinases (GRKs 2 through 6) on the cell surface expression of the human (h)AM{sub 1} receptor by cotransfecting each of these GRKs into HEK-293 cells that stably expressed hRAMP2. Flow cytometric analysis revealed that when coexpressed with GRK4 or GRK5, the cell surface expression of the AM{sub 1} receptor was markedly decreased prior to stimulation with AM, thereby attenuating both the specific [{sup 125}I]AM binding andmore » AM-induced cAMP production. These inhibitory effects of both GRKs were abolished by the replacement of the cytoplasmic C-terminal tail (C-tail) of CLR with that of the calcitonin receptor (a family B GPCR) or β{sub 2}-adrenergic receptor (a family A GPCR). Among the sequentially truncated CLR C-tail mutants, those lacking the five residues 449–453 (Ser-Phe-Ser-Asn-Ser) abolished the inhibition of the cell surface expression of CLR via the overexpression of GRK4 or GRK5. Thus, we provided new insight into the function of GRKs in agonist-unstimulated GPCR trafficking using a recombinant AM{sub 1} receptor and further determined the region of the CLR C-tail responsible for this GRK function. - Highlights: • We discovered a novel function of GRKs in GPCR trafficking using human CLR/RAMP2. • GRKs 4 and 5 markedly inhibited the cell surface expression of human CLR/RAMP2. • Both GRKs exhibited highly significant receptor signaling inhibition. • Five residues of the C-terminal tail of CLR govern this function of GRKs.« less

  11. Magnetically-refreshable receptor platform structures for reusable nano-biosensor chips

    NASA Astrophysics Data System (ADS)

    Yoo, Haneul; Lee, Dong Jun; Cho, Dong-guk; Park, Juhun; Nam, Ki Wan; Tak Cho, Young; Park, Jae Yeol; Chen, Xing; Hong, Seunghun

    2016-01-01

    We developed a magnetically-refreshable receptor platform structure which can be integrated with quite versatile nano-biosensor structures to build reusable nano-biosensor chips. This structure allows one to easily remove used receptor molecules from a biosensor surface and reuse the biosensor for repeated sensing operations. Using this structure, we demonstrated reusable immunofluorescence biosensors. Significantly, since our method allows one to place receptor molecules very close to a nano-biosensor surface, it can be utilized to build reusable carbon nanotube transistor-based biosensors which require receptor molecules within a Debye length from the sensor surface. Furthermore, we also show that a single sensor chip can be utilized to detect two different target molecules simply by replacing receptor molecules using our method. Since this method does not rely on any chemical reaction to refresh sensor chips, it can be utilized for versatile biosensor structures and virtually-general receptor molecular species.

  12. The mapping of yeast's G-protein coupled receptor with an atomic force microscope

    NASA Astrophysics Data System (ADS)

    Takenaka, Musashi; Miyachi, Yusuke; Ishii, Jun; Ogino, Chiaki; Kondo, Akihiko

    2015-03-01

    An atomic force microscope (AFM) can measure the adhesion force between a sample and a cantilever while simultaneously applying a rupture force during the imaging of a sample. An AFM should be useful in targeting specific proteins on a cell surface. The present study proposes the use of an AFM to measure the adhesion force between targeting receptors and their ligands, and to map the targeting receptors. In this study, Ste2p, one of the G protein-coupled receptors (GPCRs), was chosen as the target receptor. The specific force between Ste2p on a yeast cell surface and a cantilever modified with its ligand, α-factor, was measured and found to be approximately 250 pN. In addition, through continuous measuring of the cell surface, a mapping of the receptors on the cell surface could be performed, which indicated the differences in the Ste2p expression levels. Therefore, the proposed AFM system is accurate for cell diagnosis.

  13. Cargo binding promotes KDEL receptor clustering at the mammalian cell surface

    PubMed Central

    Becker, Björn; Shaebani, M. Reza; Rammo, Domenik; Bubel, Tobias; Santen, Ludger; Schmitt, Manfred J.

    2016-01-01

    Transmembrane receptor clustering is a ubiquitous phenomenon in pro- and eukaryotic cells to physically sense receptor/ligand interactions and subsequently translate an exogenous signal into a cellular response. Despite that receptor cluster formation has been described for a wide variety of receptors, ranging from chemotactic receptors in bacteria to growth factor and neurotransmitter receptors in mammalian cells, a mechanistic understanding of the underlying molecular processes is still puzzling. In an attempt to fill this gap we followed a combined experimental and theoretical approach by dissecting and modulating cargo binding, internalization and cellular response mediated by KDEL receptors (KDELRs) at the mammalian cell surface after interaction with a model cargo/ligand. Using a fluorescent variant of ricin toxin A chain as KDELR-ligand (eGFP-RTAH/KDEL), we demonstrate that cargo binding induces dose-dependent receptor cluster formation at and subsequent internalization from the membrane which is associated and counteracted by anterograde and microtubule-assisted receptor transport to preferred docking sites at the plasma membrane. By means of analytical arguments and extensive numerical simulations we show that cargo-synchronized receptor transport from and to the membrane is causative for KDELR/cargo cluster formation at the mammalian cell surface. PMID:27353000

  14. Cargo binding promotes KDEL receptor clustering at the mammalian cell surface

    NASA Astrophysics Data System (ADS)

    Becker, Björn; Shaebani, M. Reza; Rammo, Domenik; Bubel, Tobias; Santen, Ludger; Schmitt, Manfred J.

    2016-06-01

    Transmembrane receptor clustering is a ubiquitous phenomenon in pro- and eukaryotic cells to physically sense receptor/ligand interactions and subsequently translate an exogenous signal into a cellular response. Despite that receptor cluster formation has been described for a wide variety of receptors, ranging from chemotactic receptors in bacteria to growth factor and neurotransmitter receptors in mammalian cells, a mechanistic understanding of the underlying molecular processes is still puzzling. In an attempt to fill this gap we followed a combined experimental and theoretical approach by dissecting and modulating cargo binding, internalization and cellular response mediated by KDEL receptors (KDELRs) at the mammalian cell surface after interaction with a model cargo/ligand. Using a fluorescent variant of ricin toxin A chain as KDELR-ligand (eGFP-RTAH/KDEL), we demonstrate that cargo binding induces dose-dependent receptor cluster formation at and subsequent internalization from the membrane which is associated and counteracted by anterograde and microtubule-assisted receptor transport to preferred docking sites at the plasma membrane. By means of analytical arguments and extensive numerical simulations we show that cargo-synchronized receptor transport from and to the membrane is causative for KDELR/cargo cluster formation at the mammalian cell surface.

  15. In vitro evaluation of biodegradable microspheres with surface-bound ligands.

    PubMed

    Keegan, Mark E; Royce, Sara M; Fahmy, Tarek; Saltzman, W Mark

    2006-02-21

    Protein ligands were conjugated to the surface of biodegradable microspheres. These microsphere-ligand conjugates were then used in two in vitro model systems to evaluate the effect of conjugated ligands on microsphere behavior. Microsphere retention in agarose columns was increased by ligands on the microsphere surface specific for receptors on the agarose matrix. In another experiment, conjugating the lectin Ulex europaeus agglutinin 1 to the microsphere surface increased microsphere adhesion to Caco-2 monolayers compared to control microspheres. This increase in microsphere adhesion was negated by co-administration of l-fucose, indicating that the increase in adhesion is due to specific interaction of the ligand with carbohydrate receptors on the cell surface. These results demonstrate that the ligands conjugated to the microspheres maintain their receptor binding activity and are present on the microsphere surface at a density sufficient to target the microspheres to both monolayers and three-dimensional matrices bearing complementary receptors.

  16. Engineering of PDMS Surfaces for use in Microsystems for Capture and Isolation of Complex and Biomedically Important Proteins: Epidermal Growth Factor Receptor as a Model System

    PubMed Central

    Lowe, Aaron M.; Ozer, Byram H.; Wiepz, Gregory J.; Bertics, Paul J.; Abbott, Nicholas L.

    2009-01-01

    Elastomers based on poly(dimethylsiloxane) (PDMS) are promising materials for fabrication of a wide range of microanalytical systems due to their mechanical and optical properties and ease of processing. To date, however, quantitative studies that demonstrate reliable and reproducible methods for attachment of binding groups that capture complex receptor proteins of relevance to biomedical applications of PDMS microsystems have not been reported. Herein we describe methods that lead to the reproducible capture of a transmembrane protein, the human epidermal growth factor (EGF) receptor, onto PDMS surfaces presenting covalently immobilized antibodies for EGF receptor, and subsequent isolation of the captured receptor by mechanical transfer of the receptor onto a chemically functionalized surface of a gold film for detection. This result is particularly significant because the physical properties of transmembrane proteins make this class of proteins a difficult one to analyze. We benchmark the performance of antibodies to the human EGF receptor covalently immobilized on PDMS against the performance of the same antibodies physisorbed to conventional surfaces utilized in ELISA assays through the use of EGF receptor that was 32P-radiolabeled in its autophosphorylation domain. These results reveal that two pan-reactive antibodies for the EGF receptor (H11 and 111.6) and one phosphospecific EGF receptor antibody (pY1068) capture the receptor on both PDMS and ELISA plates. When using H11 antibody to capture EGF receptor and subsequent treatment with a stripping buffer (NaOH and sodium dodecylsulfate) to isolate the receptor, the signal-to-background obtained using the PDMS surface was 82:1, exceeding the signal-to-background measured on the ELISA plate (<48:1). We also characterized the isolation of captured EGF receptor by mechanical contact of the PDMS surface with a chemically functionalized gold film. The efficiency of mechanical transfer of the transmembrane protein from the PDMS surface was found to be 75–81%. However, the transfer of non-specifically bound protein was substantially less than 75%, thus leading to the important finding that mechanical transfer of the EGF receptor leads to an approximately four-fold increase in signal-to-background from 20:1 to 88:1. The signal-to-background obtained following mechanical transfer is also better than that obtained using ELISA plates and stripping buffer (<48:1). The EGF receptor is a clinically important protein and the target of numerous anticancer agents and thus these results, when combined, provide guidance for the design of PDMS-based microanalytical systems for the capture and isolation of complex and clinically important transmembrane proteins. PMID:18651079

  17. Engineering of PDMS surfaces for use in microsystems for capture and isolation of complex and biomedically important proteins: epidermal growth factor receptor as a model system.

    PubMed

    Lowe, Aaron M; Ozer, Byram H; Wiepz, Gregory J; Bertics, Paul J; Abbott, Nicholas L

    2008-08-01

    Elastomers based on poly(dimethylsiloxane) (PDMS) are promising materials for fabrication of a wide range of microanalytical systems due to their mechanical and optical properties and ease of processing. To date, however, quantitative studies that demonstrate reliable and reproducible methods for attachment of binding groups that capture complex receptor proteins of relevance to biomedical applications of PDMS microsystems have not been reported. Herein we describe methods that lead to the reproducible capture of a transmembrane protein, the human epidermal growth factor (EGF) receptor, onto PDMS surfaces presenting covalently immobilized antibodies for EGF receptor, and subsequent isolation of the captured receptor by mechanical transfer of the receptor onto a chemically functionalized surface of a gold film for detection. This result is particularly significant because the physical properties of transmembrane proteins make this class of proteins a difficult one to analyze. We benchmark the performance of antibodies to the human EGF receptor covalently immobilized on PDMS against the performance of the same antibodies physisorbed to conventional surfaces utilized in ELISA assays through the use of EGF receptor that was (32)P-radiolabeled in its autophosphorylation domain. These results reveal that two pan-reactive antibodies for the EGF receptor (clones H11 and 111.6) and one phosphospecific EGF receptor antibody (clone pY1068) capture the receptor on both PDMS and ELISA plates. When using H11 antibody to capture EGF receptor and subsequent treatment with a stripping buffer (NaOH and sodium dodecylsulfate) to isolate the receptor, the signal-to-background obtained using the PDMS surface was 82 : 1, exceeding the signal-to-background measured on the ELISA plate (<48 : 1). We also characterized the isolation of captured EGF receptor by mechanical contact of the PDMS surface with a chemically functionalized gold film. The efficiency of mechanical transfer of the transmembrane protein from the PDMS surface was found to be 75-81%. However, the transfer of non-specifically bound protein was substantially less than 75%, thus leading to the important finding that mechanical transfer of the EGF receptor leads to an approximately four-fold increase in signal-to-background from 20 : 1 to 88 : 1. The signal-to-background obtained following mechanical transfer is also better than that obtained using ELISA plates and stripping buffer (<48 : 1). The EGF receptor is a clinically important protein and the target of numerous anticancer agents and thus these results, when combined, provide guidance for the design of PDMS-based microanalytical systems for the capture and isolation of complex and clinically important transmembrane proteins.

  18. Novel down-regulatory mechanism of the surface expression of the vasopressin V2 receptor by an alternative splice receptor variant.

    PubMed

    Sarmiento, José M; Añazco, Carolina C; Campos, Danae M; Prado, Gregory N; Navarro, Javier; González, Carlos B

    2004-11-05

    In rat kidney, two alternatively spliced transcripts are generated from the V2 vasopressin receptor gene. The large transcript (1.2 kb) encodes the canonical V2 receptor, whereas the small transcript encodes a splice variant displaying a distinct sequence corresponding to the putative seventh transmembrane domain and the intracellular C terminus of the V2 receptor. This work showed that the small spliced transcript is translated in the rat kidney collecting tubules. However, the protein encoded by the small transcript (here called the V2b splice variant) is retained inside the cell, in contrast to the preferential surface distribution of the V2 receptor (here called the V2a receptor). Cells expressing the V2b splice variant do not exhibit binding to 3H-labeled vasopressin. Interestingly, we found that expression of the splice variant V2b down-regulates the surface expression of the V2a receptor, most likely via the formation of V2a.V2b heterodimers as demonstrated by co-immunoprecipitation and fluorescence resonance energy transfer experiments between the V2a receptor and the V2b splice variant. The V2b splice variant would then be acting as a dominant negative. The effect of the V2b splice variant is specific, as it does not affect the surface expression of the G protein-coupled interleukin-8 receptor (CXCR1). Furthermore, the sequence encompassing residues 242-339, corresponding to the C-terminal domain of the V2b splice variant, also down-regulates the surface expression of the V2a receptor. We suggest that some forms of nephrogenic diabetes insipidus are due to overexpression of the splice variant V2b, which could retain the wild-type V2a receptor inside the cell via the formation of V2a.V2b heterodimers.

  19. Fast Modulation of μ-Opioid Receptor (MOR) Recycling Is Mediated by Receptor Agonists*

    PubMed Central

    Roman-Vendrell, Cristina; Yu, Y. Joy; Yudowski, Guillermo Ariel

    2012-01-01

    The μ-opioid receptor (MOR) is a member of the G protein-coupled receptor family and the main target of endogenous opioid neuropeptides and morphine. Upon activation by ligands, MORs are rapidly internalized via clathrin-coated pits in heterologous cells and dissociated striatal neurons. After initial endocytosis, resensitized receptors recycle back to the cell surface by vesicular delivery for subsequent cycles of activation. MOR trafficking has been linked to opioid tolerance after acute exposure to agonist, but it is also involved in the resensitization process. Several studies describe the regulation and mechanism of MOR endocytosis, but little is known about the recycling of resensitized receptors to the cell surface. To study this process, we induced internalization of MOR with [d-Ala2, N-Me-Phe4, Gly5-ol]-enkephalin (DAMGO) and morphine and imaged in real time single vesicles recycling receptors to the cell surface. We determined single vesicle recycling kinetics and the number of receptors contained in them. Then we demonstrated that rapid vesicular delivery of recycling MORs to the cell surface was mediated by the actin-microtubule cytoskeleton. Recycling was also dependent on Rab4, Rab11, and the Ca2+-sensitive motor protein myosin Vb. Finally, we showed that recycling is acutely modulated by the presence of agonists and the levels of cAMP. Our work identifies a novel trafficking mechanism that increases the number of cell surface MORs during acute agonist exposure, effectively reducing the development of opioid tolerance. PMID:22378794

  20. Platelet dysfunction associated with the novel Trp29Cys thromboxane A₂ receptor variant.

    PubMed

    Mumford, A D; Nisar, S; Darnige, L; Jones, M L; Bachelot-Loza, C; Gandrille, S; Zinzindohoue, F; Fischer, A-M; Mundell, S J; Gaussem, P

    2013-03-01

    Genetic variations that affect the structure of the thromboxane A2 receptor (TP receptor) provide insights into the function of this key platelet and vascular receptor, but are very rare in unselected populations. To determine the functional consequences of the TP receptor Trp29Cys (W29C) substitution. We performed a detailed phenotypic analysis of an index case (P1) with reduced platelet aggregation and secretion responses to TP receptor pathway activators, and a heterozygous TP receptor W29C substitution. An analysis of the variant W29C TP receptor expressed in heterologous cells was performed. Total TP receptor expression in platelets from P1 was similar to that of controls, but there was reduced maximum binding and reduced affinity of binding to the TP receptor antagonist [(3) H]SQ29548. HEK293 cells transfected with W29C TP receptor cDNA showed similar total TP receptor expression to wild-type (WT) controls. However, the TP receptor agonist U46619 was less potent at inducing rises in cytosolic free Ca(2+) in HEK293 cells expressing the W29C TP receptor than in WT controls, indicating reduced receptor function. Immunofluorescence microscopy and cell surface ELISA showed intracellular retention and reduced cell surface expression of the W29C TP receptor in HEK293 cells. Consistent with the platelet phenotype, both maximum binding and the affinity of binding of [(3) H]SQ29548 to the W29C TP receptor were reduced compared to WT controls. These findings extend the phenotypic description of the very rare disorder TP receptor deficiency, and show that the W29C substitution reduces TP receptor function by reducing surface receptor expression and by disrupting ligand binding. © 2012 International Society on Thrombosis and Haemostasis.

  1. Single Particle Tracking reveals two distinct environments for CD4 receptors at the surface of living T lymphocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mascalchi, Patrice; Lamort, Anne Sophie; Salome, Laurence

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer We studied the diffusion of single CD4 receptors on living lymphocytes. Black-Right-Pointing-Pointer This study reveals that CD4 receptors have either a random or confined diffusion. Black-Right-Pointing-Pointer The dynamics of unconfined CD4 receptors was accelerated by a temperature raise. Black-Right-Pointing-Pointer The dynamics of confined CD4 receptors was unchanged by a temperature raise. Black-Right-Pointing-Pointer Our results suggest the existence of two different environments for CD4 receptors. -- Abstract: We investigated the lateral diffusion of the HIV receptor CD4 at the surface of T lymphocytes at 20 Degree-Sign C and 37 Degree-Sign C by Single Particle Tracking using Quantum Dots. Wemore » found that the receptors presented two major distinct behaviors that were not equally affected by temperature changes. About half of the receptors showed a random diffusion with a diffusion coefficient increasing upon raising the temperature. The other half of the receptors was permanently or transiently confined with unchanged dynamics on raising the temperature. These observations suggest that two distinct subpopulations of CD4 receptors with different environments are present at the surface of living T lymphocytes.« less

  2. Dramatically reduced surface expression of NK cell receptor KIR2DS3 is attributed to multiple residues throughout the molecule.

    PubMed

    VandenBussche, C J; Mulrooney, T J; Frazier, W R; Dakshanamurthy, S; Hurley, C K

    2009-03-01

    Using flow cytometry, fluorescent microscopy and examination of receptor glycosylation status, we demonstrate that an entire killer cell immunoglobulin-like receptor (KIR) locus (KIR2DS3)--assumed earlier to be surface expressed--appears to have little appreciable surface expression in transfected cells. This phenotype was noted for receptors encoded by three allelic variants including the common KIR2DS3*001 allele. Comparing the surface expression of KIR2DS3 with that of the better-studied KIR2DS1 molecule in two different cell lines, mutational analysis identified multiple polymorphic amino-acid residues that significantly alter the proportion of molecules present on the cell surface. A simultaneous substitution of five residues localized to the leader peptide (residues -18 and -7), second domain (residues 123 and 150) and transmembrane region (residue 234) was required to restore KIR2DS3 to the expression level of KIR2DS1. Corresponding simultaneous substitutions of KIR2DS1 to the KIR2DS3 residues resulted in a dramatically decreased surface expression. Molecular modeling was used to predict how these substitutions contribute to this phenotype. Alterations in receptor surface expression are likely to affect the balance of immune cell signaling impacting the characteristics of the response to pathogens or malignancy.

  3. Heterodimerization with beta2-adrenergic receptors promotes surface expression and functional activity of alpha1D-adrenergic receptors.

    PubMed

    Uberti, Michelle A; Hague, Chris; Oller, Heide; Minneman, Kenneth P; Hall, Randy A

    2005-04-01

    The alpha1D-adrenergic receptor (alpha1D-AR) is a G protein-coupled receptor (GPCR) that is poorly trafficked to the cell surface and largely nonfunctional when heterologously expressed by itself in a variety of cell types. We screened a library of approximately 30 other group I GPCRs in a quantitative luminometer assay for the ability to promote alpha1D-AR cell surface expression. Strikingly, these screens revealed only two receptors capable of inducing robust increases in the amount of alpha1D-AR at the cell surface: alpha1B-AR and beta2-AR. Confocal imaging confirmed that coexpression with beta2-AR resulted in translocation of alpha1D-AR from intracellular sites to the plasma membrane. Additionally, coimmunoprecipitation studies demonstrated that alpha1D-AR and beta2-AR specifically interact to form heterodimers when coexpressed in HEK-293 cells. Ligand binding studies revealed an increase in total alpha1D-AR binding sites upon coexpression with beta2-AR, but no apparent effect on the pharmacological properties of the receptors. In functional studies, coexpression with beta2-AR significantly enhanced the coupling of alpha1D-AR to norepinephrine-stimulated Ca2+ mobilization. Heterodimerization of beta2-AR with alpha1D-AR also conferred the ability of alpha1D-AR to cointernalize upon beta2-AR agonist stimulation, revealing a novel mechanism by which these different adrenergic receptor subtypes may regulate each other's activity. These findings demonstrate that the selective association of alpha1D-AR with other receptors is crucial for receptor surface expression and function and also shed light on a novel mechanism of cross talk between alpha1- and beta2-ARs that is mediated through heterodimerization and cross-internalization.

  4. Structure-activity relationships of seco-prezizaane and picrotoxane/picrodendrane terpenoids by Quasar receptor-surface modeling.

    PubMed

    Schmidt, Thomas J; Gurrath, Marion; Ozoe, Yoshihisa

    2004-08-01

    The seco-prezizaane-type sesquiterpenes pseudoanisatin and parviflorolide from Illicium are noncompetitive antagonists at housefly (Musca domestica) gamma-aminobutyric acid (GABA) receptors. They show selectivity toward the insect receptor and thus represent new leads toward selective insecticides. Based on the binding data for 13 seco-prezizaane terpenoids and 17 picrotoxane and picrodendrane-type terpenoids to housefly and rat GABA receptors, a QSAR study was conducted by quasi-atomistic receptor-surface modeling (Quasar). The resulting models provide insight into the structural basis of selectivity and properties of the binding sites at GABA receptor-coupled chloride channels of insects and mammals.

  5. Intrapulmonary receptors in the Tegu lizard: II. Functional characteristics and localization;.

    PubMed

    Scheid, P; Kuhlmann, W D; Fedde, M R

    1977-02-01

    Intrapulmonary receptors identified in the Tegu lizard by single-unit vagal recording (Fedde et al., 1977) were subjected to a number of stimuli and localized within the lung. Some carbon dioxide receptors could follow periodic changes in intrapulmonary CO2 concentrations as rapidly as 1.3 Hz; No oxygen sensitivity was observed with this receptor type, and halothane markedly depressed the discharge frequency. In response to intravenously injected acetazolamide they increased their discharge frequency and became almost totally insensitive to CO2, suggesting molecular per se is not the direct controller of receptor discharge; These receptors show many of the functional characteristics described for those in the avian lung. Afferent activity from both CO2 and mechanoreceptors could be elicited by electrically stimulating the lung surface. The CO2 receptors appeared to be organized in a receptive field covering more than 1 cm2 of lung surface, multiple receptors being innervated by a single afferent fiber. Activity in afferent fibers from mechanoreceptors could be evoked from only one distinct spot on the lung surface. Conduction velocities of afferent fibers from CO2 receptors ranged from 1 to 3 m-sec-1; from mechanoreceptors, from 1.9 to 5.2 m-sec-1.

  6. Biotin-transfer from a trifunctional crosslinker for identification of cell surface receptors of soluble protein ligands

    PubMed Central

    Tremblay, Tammy-Lynn; Hill, Jennifer J.

    2017-01-01

    Here we describe a novel crosslinker and its application as a biotin-transfer reagent to identify cell surface receptors of soluble protein ligands on live cells. This crosslinker contains three functional groups: an aldehyde-reactive aminooxy group, a sulfhydryl, and a biotin (ASB). It is readily synthesized via a 3-step addition reaction using standard solid-phase peptide synthesis methods and commercially available intermediates, allowing access to laboratories without specialized synthetic chemistry capabilities. For the biotin-transfer method, ASB is linked to a protein ligand through the sulfhydryl group in a two-step process that allows the introduction of a disulfide bond between the ligand and the crosslinker. Incubation of the labelled ligand with oxidized live cells leads to the formation of crosslinks with aldehyde-containing glycans on the cell surface receptor. Subsequent reduction of the disulfide bond results in biotin transfer from the ligand to the cell surface receptor. Protein biotinylation that is mediated by ligand binding to its receptor is differentiated from background biotinylation events by comparison with a similarly labelled control protein using comparative proteomic mass spectrometry to quantify streptavidin-bound proteins. Using this method, we successfully identified the cell surface receptors of a peptide hormone, a monoclonal antibody, and a single-domain antibody-Fc fusion construct. PMID:28422167

  7. Downregulation of cell surface molecules during noncytopathic infection of T cells with human immunodeficiency virus.

    PubMed Central

    Stevenson, M; Zhang, X H; Volsky, D J

    1987-01-01

    Noncytopathic infection of human T-lymphoid cell line CR-10 with human immunodeficiency virus (HIV) (CEM-N1T isolate) resulted in a gradual loss of cell surface receptors for OKT4/OKT4A (HIV receptor), OKT8, OKT3, and OKT11 but not for OKT9 (transferrin receptor) within 10 days after infection. Surface receptor decline was accompanied by a rapid increase in HIV antigens and mRNA expression. Multireceptor downregulation was also observed in three T-lymphoid cell lines (MT-4, CEM, and HBD-1) cytopathically infected with the HIV/N1T virus and in HUT-78 cells infected with the HIV/SF-2 isolate. HIV-infected and uninfected CR-10 cells contained similar levels of mRNAs coding for T3, T8, T9, T11, HLA-A2, and HLA-B7 proteins. By densitometry, fully infected CR-10 cells showed approximately 75% reduction in T4 and tubulin (beta chain) mRNA levels when compared with uninfected CR-10 cells. No such reduction was detected in HIV-infected MT-4 and HBD-1 cells. A T-cell receptor gene (beta chain) rearrangement study revealed that no distinct CR-10 subpopulation was selected out upon infection with HIV. Our results suggest that the reduction in cell surface receptors observed between 1 and 2 weeks postinfection cannot be directly attributed to similar reductions in mRNA levels coding for these receptor proteins. We conclude that HIV infection induces posttranscriptional downregulation of several T-cell surface receptors. Images PMID:3500327

  8. Receptor density balances signal stimulation and attenuation in membrane-assembled complexes of bacterial chemotaxis signaling proteins

    PubMed Central

    Besschetnova, Tatiana Y.; Montefusco, David J.; Asinas, Abdalin E.; Shrout, Anthony L.; Antommattei, Frances M.; Weis, Robert M.

    2008-01-01

    All cells possess transmembrane signaling systems that function in the environment of the lipid bilayer. In the Escherichia coli chemotaxis pathway, the binding of attractants to a two-dimensional array of receptors and signaling proteins simultaneously inhibits an associated kinase and stimulates receptor methylation—a slower process that restores kinase activity. These two opposing effects lead to robust adaptation toward stimuli through a physical mechanism that is not understood. Here, we provide evidence of a counterbalancing influence exerted by receptor density on kinase stimulation and receptor methylation. Receptor signaling complexes were reconstituted over a range of defined surface concentrations by using a template-directed assembly method, and the kinase and receptor methylation activities were measured. Kinase activity and methylation rates were both found to vary significantly with surface concentration—yet in opposite ways: samples prepared at high surface densities stimulated kinase activity more effectively than low-density samples, whereas lower surface densities produced greater methylation rates than higher densities. FRET experiments demonstrated that the cooperative change in kinase activity coincided with a change in the arrangement of the membrane-associated receptor domains. The counterbalancing influence of density on receptor methylation and kinase stimulation leads naturally to a model for signal regulation that is compatible with the known logic of the E. coli pathway. Density-dependent mechanisms are likely to be general and may operate when two or more membrane-related processes are influenced differently by the two-dimensional concentration of pathway elements. PMID:18711126

  9. Reciprocal and activity-dependent regulation of surface AMPA and NMDA receptors in cultured neurons

    PubMed Central

    Li, Guo Hua; Jackson, Michael F; Orser, Beverley A; MacDonald, John F

    2010-01-01

    Activation of NMDA receptors (NMDARs) can modulate excitatory synaptic transmission in the central nervous system by dynamically altering the number of synaptic AMPA receptors (AMPARs). The surface expression of NMDARs themselves is also subject to modulation in an activity-dependent manner. In addition to NMDAR-induced changes in AMPAR expression, AMPARs have also been found to regulate their own surface expression, independently of NMDARs. However, whether or not AMPARs and NMDARs might reciprocally regulate their surface expression has not previously been systematically explored. We utilized surface biotinylation assays and stimulation protocols intended to selectively stimulate various glutamate receptor subpopulations (e.g. AMPARs vs NMDARs; synaptic vs extrasynaptic). We reveal that activation of synaptic NMDARs increases the surface expression of both NMDAR and AMPAR subunits, while activation of extrasynaptic NMDAR produces the opposite effect. Surprisingly, we find that selective activation of AMPARs reduces the surface expression of not only AMPARs but also of NMDARs. These results suggest that both AMPARs and NMDARs at synaptic sites are subject to modulation by multiple signalling pathways in an activity-dependent way. PMID:21383896

  10. Microscopic visualization of metabotropic glutamate receptors on the surface of living cells using bifunctional magnetic resonance imaging probes.

    PubMed

    Mishra, Anurag; Mishra, Ritu; Gottschalk, Sven; Pal, Robert; Sim, Neil; Engelmann, Joern; Goldberg, Martin; Parker, David

    2014-02-19

    A series of bimodal metabotropic glutamate-receptor targeted MRI contrast agents has been developed and evaluated, based on established competitive metabotropic Glu receptor subtype 5 (mGluR5) antagonists. In order to directly visualize mGluR5 binding of these agents on the surface of live astrocytes, variations in the core structure were made. A set of gadolinium conjugates containing either a cyanine dye or a fluorescein moiety was accordingly prepared, to allow visualization by optical microscopy in cellulo. In each case, surface receptor binding was compromised and cell internalization observed. Another approach, examining the location of a terbium analogue via sensitized emission, also exhibited nonspecific cell uptake in neuronal cell line models. Finally, biotin derivatives of two lead compounds were prepared, and the specificity of binding to the mGluR5 cell surface receptors was demonstrated with the aid of their fluorescently labeled avidin conjugates, using both total internal reflection fluorescence (TIRF) and confocal microscopy.

  11. The insulin response integrates increased TGF-β signaling through Akt-induced enhancement of cell surface delivery of TGF-β receptors

    PubMed Central

    Budi, Erine H.; Muthusamy, Baby Periyanayaki; Derynck, Rik

    2015-01-01

    Increased activity of transforming growth factor β (TGF-β), which binds to and stimulates cell surface receptors, contributes to cancer progression and fibrosis by driving epithelial cells toward a migratory mesenchymal phenotype and increasing the abundance of extracellular matrix proteins. The abundance of TGF-β receptors at the cell surface determines cellular responsiveness to TGF-β, which is often produced by the same cells that have the receptors, and thus serves as an autocrine signal. We found that Akt-mediated phosphorylation of AS160, a RabGAP [guanosine triphosphatase (GTPase)-activating protein] promoted the translocation of TGF-β receptors from intracellular stores to the plasma membrane of mouse embryonic fibroblasts (MEFs) and NMuMG epithelial cells. Consequently, insulin, which is commonly used to treat hyperglycemia and activates Akt signaling, increased the amount of TGF-β receptors at the cell surface, thereby enhancing TGF-β responsiveness. This insulin-induced increase in autocrine TGF-β signaling contributed to insulin-induced gene expression responses, attenuated the epithelial phenotype, and promoted the migration of NMuMG cells. Furthermore, the enhanced delivery of TGF-β receptors at the cell surface enabled insulin to increase TGF-β-induced gene responses. The enhancement of TGF-β responsiveness in response to Akt activation may help to explain the biological effects of insulin, the progression of cancers in which Akt is activated, and the increased incidence of fibroses in diabetes. PMID:26420907

  12. A Cleavable N-Terminal Signal Peptide Promotes Widespread Olfactory Receptor Surface Expression in HEK293T Cells

    PubMed Central

    Shepard, Blythe D.; Natarajan, Niranjana; Protzko, Ryan J.; Acres, Omar W.; Pluznick, Jennifer L.

    2013-01-01

    Olfactory receptors (ORs) are G protein-coupled receptors that detect odorants in the olfactory epithelium, and comprise the largest gene family in the genome. Identification of OR ligands typically requires OR surface expression in heterologous cells; however, ORs rarely traffic to the cell surface when exogenously expressed. Therefore, most ORs are orphan receptors with no known ligands. To date, studies have utilized non-cleavable rhodopsin (Rho) tags and/or chaperones (i.e. Receptor Transporting Protein, RTP1S, Ric8b and Gαolf) to improve surface expression. However, even with these tools, many ORs still fail to reach the cell surface. We used a test set of fifteen ORs to examine the effect of a cleavable leucine-rich signal peptide sequence (Lucy tag) on OR surface expression in HEK293T cells. We report here that the addition of the Lucy tag to the N-terminus increases the number of ORs reaching the cell surface to 7 of the 15 ORs (as compared to 3/15 without Rho or Lucy tags). Moreover, when ORs tagged with both Lucy and Rho were co-expressed with previously reported chaperones (RTP1S, Ric8b and Gαolf), we observed surface expression for all 15 receptors examined. In fact, two-thirds of Lucy-tagged ORs are able to reach the cell surface synergistically with chaperones even when the Rho tag is removed (10/15 ORs), allowing for the potential assessment of OR function with only an 8-amino acid Flag tag on the mature protein. As expected for a signal peptide, the Lucy tag was cleaved from the mature protein and did not alter OR-ligand binding and signaling. Our studies demonstrate that widespread surface expression of ORs can be achieved in HEK293T cells, providing promise for future large-scale deorphanization studies. PMID:23840901

  13. The majority of ACTH receptor (MC2R) mutations found in Familial Glucocorticoid Deficiency type 1 lead to defective trafficking of the receptor to the cell surface

    PubMed Central

    TT, Chung; TR, Webb; LF, Chan; SN, Cooray; LA, Metherell; PJ, King; JP, Chapple; AJL, Clark

    2008-01-01

    Context: There are at least twenty-four missense, non-conservative mutations found in the ACTH receptor (Melanocortin 2 receptor, MC2R) which have been associated with the autosomal recessive disease Familial Glucocorticoid Deficiency (FGD) type 1. The characterization of these mutations has been hindered by difficulties in establishing a functional heterologous cell transfection system for MC2R. Recently the melanocortin 2 receptor accessory protein (MRAP) was identified as essential for trafficking of MC2R to the cell surface; therefore a functional characterization of MC2R mutations is now possible. Objective: To elucidate the molecular mechanisms responsible for defective MC2R function in FGD. Methods: Stable cell lines expressing human MRAPα were established and transiently transfected with wild-type or mutant MC2R. Functional characterization of mutant MC2R was performed using a cell surface expression assay, a cAMP reporter assay, confocal microscopy and co-immunoprecipitation of MRAPα. Results: Two thirds of all MC2R mutations had a significant reduction in cell surface trafficking even though MRAPα interacted with all mutants. Analysis of those mutant receptors that reached the cell surface indicated that 4/6 failed to signal, following stimulation with ACTH. Conclusion: The majority of MC2R mutations found in FGD fail to function because they fail to traffic to the cell surface. PMID:18840636

  14. Activation of m1 muscarinic acetylcholine receptor induces surface transport of KCNQ channels through a CRMP-2-mediated pathway.

    PubMed

    Jiang, Ling; Kosenko, Anastasia; Yu, Clinton; Huang, Lan; Li, Xuejun; Hoshi, Naoto

    2015-11-15

    Neuronal excitability is strictly regulated by various mechanisms, including modulation of ion channel activity and trafficking. Stimulation of m1 muscarinic acetylcholine receptor (also known as CHRM1) increases neuronal excitability by suppressing the M-current generated by the Kv7/KCNQ channel family. We found that m1 muscarinic acetylcholine receptor stimulation also triggers surface transport of KCNQ subunits. This receptor-induced surface transport was observed with KCNQ2 as well as KCNQ3 homomeric channels, but not with Kv3.1 channels. Deletion analyses identified that a conserved domain in a proximal region of the N-terminal tail of KCNQ protein is crucial for this surface transport--the translocation domain. Proteins that bind to this domain were identified as α- and β-tubulin and collapsin response mediator protein 2 (CRMP-2; also known as DPYSL2). An inhibitor of casein kinase 2 (CK2) reduced tubulin binding to the translocation domain, whereas an inhibitor of glycogen synthase kinase 3 (GSK3) facilitated CRMP-2 binding to the translocation domain. Consistently, treatment with the GSK3 inhibitor enhanced receptor-induced KCNQ2 surface transport. M-current recordings from neurons showed that treatment with a GSK3 inhibitor shortened the duration of muscarinic suppression and led to over-recovery of the M-current. These results suggest that m1 muscarinic acetylcholine receptor stimulates surface transport of KCNQ channels through a CRMP-2-mediated pathway. © 2015. Published by The Company of Biologists Ltd.

  15. Ras-Directed N-Glycoproteins are Novel Early Biomarkers for Tumorigenesis and Malignant Transformation, and Therapeutic Targets of Neurofibromatosis Type I

    DTIC Science & Technology

    2012-09-01

    translocation of receptors from the cytoplasm to the cell surface and retained receptors in the ER and Golgi apparatus , but had no effect on normal...glucose (2-DG) as two potential glycosylation inhibitors. Because proteins travelling to the Golgi apparatus for the consequent steps of...inhibited the transportation of receptors from the cytoplasm to the cell surface and retained receptors in the ER and Golgi apparatus (Fig 3). To

  16. Functional subcellular distribution of β1- and β2-adrenergic receptors in rat ventricular cardiac myocytes

    PubMed Central

    Cros, Caroline; Brette, Fabien

    2013-01-01

    β-adrenergic stimulation is a key regulator of cardiac function. The localization of major cardiac adrenergic receptors (β1 and β2) has been investigated using biochemical and biophysical approaches and has led to contradictory results. This study investigates the functional subcellular localization of β1- and β2-adrenergic receptors in rat ventricular myocytes using a physiological approach. Ventricular myocytes were isolated from the hearts of rat and detubulated using formamide. Physiological cardiac function was measured as Ca2+ transient using Fura-2-AM and cell shortening. Selective activation of β1- and β2-adrenergic receptors was induced with isoproterenol (0.1 μmol/L) and ICI-118,551 (0.1 μmol/L); and with salbutamol (10 μmol/L) and atenolol (1 μmol/L), respectively. β1- and β2-adrenergic stimulations induced a significant increase in Ca2+ transient amplitude and cell shortening in intact rat ventricular myocytes (i.e., surface sarcolemma and t-tubules) and in detubulated cells (depleted from t-tubules, surface sarcolemma only). Both β1- and β2-adrenergic receptors stimulation caused a greater effect on Ca2+ transient and cell shortening in detubulated myocytes than in control myocytes. Quantitative analysis indicates that β1-adrenergic stimulation is ∼3 times more effective at surface sarcolemma compared to t-tubules, whereas β2- adrenergic stimulation occurs almost exclusively at surface sarcolemma (∼100 times more effective). These physiological data demonstrate that in rat ventricular myocytes, β1-adrenergic receptors are functionally present at surface sarcolemma and t-tubules, while β2-adrenergic receptors stimulation occurs only at surface sarcolemma of cardiac cells. PMID:24303124

  17. DNA-based probes for flow cytometry analysis of endocytosis and recycling.

    PubMed

    Dumont, Claire; Czuba, Ewa; Chen, Moore; Villadangos, Jose A; Johnston, Angus P R; Mintern, Justine D

    2017-04-01

    The internalization of proteins plays a key role in cell development, cell signaling and immunity. We have previously developed a specific hybridization internalization probe (SHIP) to quantitate the internalization of proteins and particles into cells. Herein, we extend the utility of SHIP to examine both the endocytosis and recycling of surface receptors using flow cytometry. SHIP was used to monitor endocytosis of membrane-bound transferrin receptor (TFR) and its soluble ligand transferrin (TF). SHIP enabled measurements of the proportion of surface molecules internalized, the internalization kinetics and the proportion and rate of internalized molecules that recycle to the cell surface with time. Using this method, we have demonstrated the internalization and recycling of holo-TF and an antibody against the TFR behave differently. This assay therefore highlights the implications of receptor internalization and recycling, where the internalization of the receptor-antibody complex behaves differently to the receptor-ligand complex. In addition, we observe distinct internalization patterns for these molecules expressed by different subpopulations of primary cells. SHIP provides a convenient and high throughput technique for analysis of trafficking parameters for both cell surface receptors and their ligands. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Rapid Steroid Hormone Actions Initiated at the Cell Surface and the Receptors that Mediate Them with an Emphasis on Recent Progress in Fish Models

    PubMed Central

    Thomas, Peter

    2011-01-01

    In addition to the classic genomic mechanism of steroid action mediated by activation of intracellular nuclear receptors, there is now extensive evidence that steroids also activate receptors on the cell surface to initiate rapid intracellular signaling and biological responses that are often nongenomic. Recent progress in our understanding of rapid, cell surface-initiated actions of estrogens, progestins, androgens and corticosteroids and the identities of the membrane receptors that act as their intermediaries is briefly reviewed with a special emphasis on studies in teleost fish. Two recently discovered novel proteins with seven-transmembrane domains, G protein-coupled receptor 30 (GPR30), and membrane progestin receptors (mPRs) have the ligand binding and signaling characteristics of estrogen and progestin membrane receptors, respectively, but their functional significance is disputed by some researchers. GPR30 is expressed on the cell surface of fish oocytes and mediates estrogen inhibition of oocyte maturation. mPRα is also expressed on the oocyte cell surface and is the intermediary in progestin induction of oocyte maturation in fish. Recent results suggest there is cross-talk between these two hormonal pathways and that there is reciprocal down-regulation of GPR30 and mPRα expression by estrogens and progestins at different phases of oocyte development to regulate the onset of oocyte maturation. There is also evidence in fish that mPRs are involved in progestin induction of sperm hypermotility and anti-apoptotic actions in ovarian follicle cells. Nonclassical androgen and corticosteroid actions have also been described in fish models but the membrane receptors mediating these actions have not been identified. PMID:22154643

  19. Brain region-selective cellular redistribution of mGlu5 but not GABA(B) receptors following methamphetamine-induced associative learning.

    PubMed

    Herrold, Amy A; Voigt, Robin M; Napier, T Celeste

    2011-12-01

    Alterations in receptor expression and distribution between cell surface and cytoplasm are means by which psychostimulants regulate neurotransmission. Metabotropic glutamate receptor group I, subtype 5 (mGluR5) and GABA(B) receptors (GABA(B) R) are critically involved in the development and expression of stimulant-induced behaviors, including conditioned place preference (CPP), an index of drug-seeking. However, it is not known if psychostimulant-induced CPP alters the trafficking of these receptors. To fill this gap, this study used methamphetamine (Meth)-induced CPP in rats to ascertain if receptor changes occur in limbic brain regions that regulate drug-seeking, the medial prefrontal cortex (mPFC), nucleus accumbens (NAc), and ventral pallidum (VP). To do so, ex vivo tissue was assessed for changes in expression and surface vs. intracellular distribution of mGluR5 and GABA(B) Rs. There was a decrease in the surface to intracellular ratio of mGluR5 in the mPFC in Meth-conditioned rats, commensurate with an increase in intracellular levels. mGluR5 levels in the NAc or the VP were unaltered. There were no changes for GABA(B) R in any brain region assayed. This ex vivo snapshot of metabotropic glutamate and GABA receptor cellular distribution following induction of Meth-induced CPP is the first report to determine if these receptors are differentially altered after Meth-induced CPP. The results suggest that this Meth treatment paradigm likely induced a compensatory change in mGluR5 surface to intracellular ratio such that the surface remains unaltered while an increase in intracellular protein occurred. Copyright © 2011 Wiley-Liss, Inc.

  20. Rapid surface accumulation of NMDA receptors increases glutamatergic excitation during status epilepticus.

    PubMed

    Naylor, David E; Liu, Hantao; Niquet, Jerome; Wasterlain, Claude G

    2013-06-01

    After 1h of lithium-pilocarpine status epilepticus (SE), immunocytochemical labeling of NMDA receptor NR1 subunits reveals relocation of subunits from the interior to the cell surface of dentate gyrus granule cells and CA3 pyramidal cells. Simultaneously, an increase in NMDA-miniature excitatory postsynaptic currents (mEPSC) as well as an increase in NMDA receptor-mediated tonic currents is observed in hippocampal slices after SE. Mean-variance analysis of NMDA-mEPSCs estimates that the number of functional postsynaptic NMDA receptors per synapse increases 38% during SE, and antagonism by ifenprodil suggests that an increase in the surface representation of NR2B-containing NMDA receptors is responsible for the augmentation of both the phasic and tonic excitatory currents with SE. These results provide a potential mechanism for an enhancement of glutamatergic excitation that maintains SE and may contribute to excitotoxic injury during SE. Therapies that directly antagonize NMDA receptors may be a useful therapeutic strategy during refractory SE. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Rapid surface accumulation of NMDA receptors increases glutamatergic excitation during status epilepticus

    PubMed Central

    Naylor, David E.; Liu, Hantao; Niquet, Jerome; Wasterlain, Claude G.

    2017-01-01

    After 1 h of lithium-pilocarpine status epilepticus (SE), immunocytochemical labeling of NMDA receptor NR1 subunits reveals relocation of subunits from the interior to the cell surface of dentate gyrus granule cells and CA3 pyramidal cells. Simultaneously, an increase in NMDA-miniature excitatory postsynaptic currents (mEPSC) as well as an increase in NMDA receptor-mediated tonic currents is observed in hippocampal slices after SE. Mean-variance analysis of NMDA-mEPSCs estimates that the number of functional postsynaptic NMDA receptors per synapse increases 38% during SE, and antagonism by ifenprodil suggests that an increase in the surface representation of NR2B-containing NMDA receptors is responsible for the augmentation of both the phasic and tonic excitatory currents with SE. These results provide a potential mechanism for an enhancement of glutamatergic excitation that maintains SE and may contribute to excitotoxic injury during SE. Therapies that directly antagonize NMDA receptors may be a useful therapeutic strategy during refractory SE. PMID:23313318

  2. Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

    NASA Astrophysics Data System (ADS)

    Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

    1990-10-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

  3. Identification and quantification of the rat hepatocyte asialoglycoprotein receptor.

    PubMed Central

    Schwartz, A L; Marshak-Rothstein, A; Rup, D; Lodish, H F

    1981-01-01

    The asialoglycoprotein receptor from rat liver was purified by solubilization and affinity chromatography on asialoorosomucoid-Sepharose. The preparation yielded four distinct polypeptides of Mr 40,000-120,000. We prepared a monoclonal antibody that both immunoprecipitates solubilized receptor activity and blocks the binding of galactose-terminal glycoproteins to immobilized receptor. The monoclonal antibody and a rabbit antireceptor antiserum immunoprecipitated all four polypeptide species. Peptide analysis by two-dimensional chromatography of the individual 125I-labeled species showed nearly identical patterns, which also suggested that the four polypeptides have a similar primary structure. To identify and quantitate the asialoglycoprotein receptor on the hepatocyte cell surface, intact cells were iodinated with lactoperoxidase, and the solubilized membranes were treated with antireceptor antibody. The Mr 55,000 and Mr 65,000 species were the major species found. Our results suggest that the Mr of the surface receptor is at least 55,000 and that it comprises between 1-2% of the iodinated hepatocyte surface protein. Images PMID:6267585

  4. Early expression of triggering receptors and regulatory role of 2B4 in human natural killer cell precursors undergoing in vitro differentiation

    PubMed Central

    Sivori, Simona; Falco, Michela; Marcenaro, Emanuela; Parolini, Silvia; Biassoni, Roberto; Bottino, Cristina; Moretta, Lorenzo; Moretta, Alessandro

    2002-01-01

    In this study we analyzed the progression of cell surface receptor expression during the in vitro-induced human natural killer (NK) cell maturation from CD34+ Lin− cell precursors. NKp46 and NKp30, two major triggering receptors that play a central role in natural cytotoxicity, were expressed before the HLA class I-specific inhibitory receptors. Moreover, their appearance at the cell surface correlated with the acquisition of cytolytic activity by developing NK cells. Although the early expression of triggering receptors may provide activating signals required for inducing further cell differentiation, it may also affect the self-tolerance of developing NK cells. Our data show that a fail-safe mechanism preventing killing of normal autologous cells may be provided by the 2B4 surface molecule, which, at early stages of NK cell differentiation, functions as an inhibitory rather than as an activating receptor. PMID:11917118

  5. Cranial neural crest recycle surface integrins in a substratum-dependent manner to promote rapid motility.

    PubMed

    Strachan, Lauren R; Condic, Maureen L

    2004-11-08

    Cell migration is essential for proper development of numerous structures derived from embryonic neural crest cells (NCCs). Although the migratory pathways of NCCs have been determined, the molecular mechanisms regulating NCC motility remain unclear. NCC migration is integrin dependent, and recent work has shown that surface expression levels of particular integrin alpha subunits are important determinants of NCC motility in vitro. Here, we provide evidence that rapid cranial NCC motility on laminin requires integrin recycling. NCCs showed both ligand- and receptor-specific integrin regulation in vitro. On laminin, NCCs accumulated internalized laminin but not fibronectin receptors over 20 min, whereas on fibronectin neither type of receptor accumulated internally beyond 2 min. Internalized laminin receptors colocalized with receptor recycling vesicles and were subsequently recycled back to the cell surface. Blocking receptor recycling with bafilomycin A inhibited NCC motility on laminin, indicating that substratum-dependent integrin recycling is essential for rapid cranial neural crest migration.

  6. Distinctive receptor binding properties of the surface glycoprotein of a natural feline leukemia virus isolate with unusual disease spectrum.

    PubMed

    Bolin, Lisa L; Chandhasin, Chandtip; Lobelle-Rich, Patricia A; Albritton, Lorraine M; Levy, Laura S

    2011-05-13

    Feline leukemia virus (FeLV)-945, a member of the FeLV-A subgroup, was previously isolated from a cohort of naturally infected cats. An unusual multicentric lymphoma of non-T-cell origin was observed in natural and experimental infection with FeLV-945. Previous studies implicated the FeLV-945 surface glycoprotein (SU) as a determinant of disease outcome by an as yet unknown mechanism. The present studies demonstrate that FeLV-945 SU confers distinctive properties of binding to the cell surface receptor. Virions bearing the FeLV-945 Env protein were observed to bind the cell surface receptor with significantly increased efficiency, as was soluble FeLV-945 SU protein, as compared to the corresponding virions or soluble protein from a prototype FeLV-A isolate. SU proteins cloned from other cohort isolates exhibited increased binding efficiency comparable to or greater than FeLV-945 SU. Mutational analysis implicated a domain containing variable region B (VRB) to be the major determinant of increased receptor binding, and identified a single residue, valine 186, to be responsible for the effect. The FeLV-945 SU protein binds its cell surface receptor, feTHTR1, with significantly greater efficiency than does that of prototype FeLV-A (FeLV-A/61E) when present on the surface of virus particles or in soluble form, demonstrating a 2-fold difference in the relative dissociation constant. The results implicate a single residue, valine 186, as the major determinant of increased binding affinity. Computational modeling suggests a molecular mechanism by which residue 186 interacts with the receptor-binding domain through residue glutamine 110 to effect increased binding affinity. Through its increased receptor binding affinity, FeLV-945 SU might function in pathogenesis by increasing the rate of virus entry and spread in vivo, or by facilitating entry into a novel target cell with a low receptor density.

  7. Placental expression of asialoglycoprotein receptor associated with Hepatitis B virus transmission from mother to child.

    PubMed

    Vyas, Ashish Kumar; Ramakrishna, Usha; Sen, Bijoya; Islam, Mojahidul; Ramakrishna, Gayatri; Patra, Sharda; Rastogi, Archana; Sarin, Shiv Kumar; Trehanpati, Nirupma

    2018-04-30

    Asialoglycoprotein receptor expression on hepatocytes has been associated with endocytosis, binding and uptake of hepatitis B virus. The role of asialoglycoprotein receptor in hepatitis B virus vertical transmission and its expression on placenta has not yet been studied. Thirty-four HBsAg+ve and 13 healthy pregnant mothers along with their newborns were enrolled. The former were categorized into transmitting and non-transmitting mothers based on their newborns being hepatitis B surface antigen and hepatitis B virus DNA positive. Expression of asialoglycoprotein receptor and hepatitis B surface antigen in placenta and isoform of asialoglycoprotein receptor on dendritic cell in peripheral and cord blood dendritic cells were analysed using flowcytometry, immune histochemistry, immune florescence and qRT-PCR. Twelve HBsAg+ve mothers transmitted hepatitis B virus to their newborns whereas the rest (n = 22) did not. Hepatitis B virus-transmitting mothers showed increased expression of asialoglycoprotein receptor in trophoblasts of placenta. Immunofluorescence microscopy revealed colocalization of hepatitis B surface antigen and asialoglycoprotein receptor in placenta as well as in DCs of transmitting mothers. There was no significant difference in the expression of asialoglycoprotein receptor on peripheral blood mononuclear cells or chord blood mononuclear cells between the 2 groups. However, hepatitis B virus-transmitting mothers and their HBsAg+ve newborns showed increased mRNA levels of isoform of asialoglycoprotein receptor on dendritic cell in peripheral blood mononuclear cells. Hepatitis B virus-transmitting mothers and their HBsAg+ve newborns showed an increased expression of isoform of asialoglycoprotein receptor on dendritic cell on circulating dendritic cells compared to hepatitis B virus non-transmitting mothers and their negative newborns. This study revealed that increased expression of asialoglycoprotein receptor in placenta and colocalization with hepatitis B surface antigen strongly indicates its role in intrauterine transmission of hepatitis B virus. Asialoglycoprotein receptor-blocking strategy can be used for therapeutic intervention of vertical transmission. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Combined sodium ion sensitivity in agonist binding and internalization of vasopressin V1b receptors.

    PubMed

    Koshimizu, Taka-Aki; Kashiwazaki, Aki; Taniguchi, Junichi

    2016-05-03

    Reducing Na(+) in the extracellular environment may lead to two beneficial effects for increasing agonist binding to cell surface G-protein coupled receptors (GPCRs): reduction of Na(+)-mediated binding block and reduce of receptor internalization. However, such combined effects have not been explored. We used Chinese Hamster Ovary cells expressing vasopressin V1b receptors as a model to explore Na(+) sensitivity in agonist binding and receptor internalization. Under basal conditions, a large fraction of V1b receptors is located intracellularly, and a small fraction is in the plasma membrane. Decreases in external Na(+) increased cell surface [(3)H]AVP binding and decreased receptor internalization. Substitution of Na(+) by Cs(+) or NH4(+) inhibited agonist binding. To suppress receptor internalization, the concentration of NaCl, but not of CsCl, had to be less than 50 mM, due to the high sensitivity of the internalization machinery to Na(+) over Cs(+). Iso-osmotic supplementation of glucose or NH4Cl maintained internalization of the V1b receptor, even in a low-NaCl environment. Moreover, iodide ions, which acted as a counter anion, inhibited V1b agonist binding. In summary, we found external ionic conditions that could increase the presence of high-affinity state receptors at the cell surface with minimum internalization during agonist stimulations.

  9. Combined sodium ion sensitivity in agonist binding and internalization of vasopressin V1b receptors

    PubMed Central

    Koshimizu, Taka-aki; Kashiwazaki, Aki; Taniguchi, Junichi

    2016-01-01

    Reducing Na+ in the extracellular environment may lead to two beneficial effects for increasing agonist binding to cell surface G-protein coupled receptors (GPCRs): reduction of Na+-mediated binding block and reduce of receptor internalization. However, such combined effects have not been explored. We used Chinese Hamster Ovary cells expressing vasopressin V1b receptors as a model to explore Na+ sensitivity in agonist binding and receptor internalization. Under basal conditions, a large fraction of V1b receptors is located intracellularly, and a small fraction is in the plasma membrane. Decreases in external Na+ increased cell surface [3H]AVP binding and decreased receptor internalization. Substitution of Na+ by Cs+ or NH4+ inhibited agonist binding. To suppress receptor internalization, the concentration of NaCl, but not of CsCl, had to be less than 50 mM, due to the high sensitivity of the internalization machinery to Na+ over Cs+. Iso-osmotic supplementation of glucose or NH4Cl maintained internalization of the V1b receptor, even in a low-NaCl environment. Moreover, iodide ions, which acted as a counter anion, inhibited V1b agonist binding. In summary, we found external ionic conditions that could increase the presence of high-affinity state receptors at the cell surface with minimum internalization during agonist stimulations. PMID:27138239

  10. Surveying GPCR solubilisation conditions using surface plasmon resonance.

    PubMed

    Navratilova, Iva Hopkins; Aristotelous, Tonia; Bird, Louise E; Hopkins, Andrew L

    2018-06-15

    Biophysical screening techniques, such as surface plasmon resonance, enable detailed kinetic analysis of ligands binding to solubilised G-protein coupled receptors. The activity of a receptor solubilised out of the membrane is crucially dependent on the environment in which it is suspended. Finding the right conditions is challenging due to the number of variables to investigate in order to determine the optimum solubilisation buffer for any given receptor. In this study we used surface plasmon resonance technology to screen a variety of solubilisation conditions including buffers and detergents for two model receptors: CXCR4 and CCR5. We tested 950 different combinations of solubilisation conditions for both receptors. The activity of both receptors was monitored by using conformation dependent monoclonal antibodies and the binding of small molecule ligands. Despite both receptors belonging to the chemokine receptor family they show some differences in their preference for solubilisation conditions that provide the highest level of binding for both the conformation dependent antibodies and small molecules. The study described here is focused not only on finding the best solubilisation conditions for each receptor, but also on factors that determine the sensitivity of the assay for each receptor. We also suggest how these data about different buffers and detergents can be used as a guide for selecting solubilisation conditions for other membrane proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Surface expression of NMDA receptor changes during memory consolidation in the crab Neohelice granulata

    PubMed Central

    Hepp, Yanil; Salles, Angeles; Carbo-Tano, Martin

    2016-01-01

    The aim of the present study was to analyze the surface expression of the NMDA-like receptors during the consolidation of contextual learning in the crab Neohelice granulata. Memory storage is based on alterations in the strength of synaptic connections between neurons. The glutamatergic synapses undergo various forms of N-methyl-D aspartate receptor (NMDAR)-dependent changes in strength, a process that affects the abundance of other receptors at the synapse and underlies some forms of learning and memory. Here we propose a direct regulation of the NMDAR. Changes in NMDAR's functionality might be induced by the modification of the subunit's expression or cellular trafficking. This trafficking does not only include NMDAR's movement between synaptic and extra-synaptic localizations but also the cycling between intracellular compartments and the plasma membrane, a process called surface expression. Consolidation of contextual learning affects the surface expression of the receptor without affecting its general expression. The surface expression of the GluN1 subunit of the NMDAR is down-regulated immediately after training, up-regulated 3 h after training and returns to naïve and control levels 24 h after training. The changes in NMDAR surface expression observed in the central brain are not seen in the thoracic ganglion. A similar increment in surface expression of GluN1 in the central brain is observed 3 h after administration of the competitive GABAA receptor antagonist, bicuculline. These consolidation changes are part of a plasticity event that first, during the down-regulation, stabilizes the trace and later, at 3-h post-training, changes the threshold for synapse activation. PMID:27421895

  12. Particle compositions with a pre-selected cell internalization mode

    NASA Technical Reports Server (NTRS)

    Ferrari, Mauro (Inventor); Decuzzi, Paolo (Inventor)

    2012-01-01

    A method of formulating a particle composition having a pre-selected cell internalization mode involves selecting a target cell having surface receptors and obtaining particles that have i) surface moieties, that have an affinity for or are capable of binding to the surface receptors of the cell and ii) a preselected shape, where a surface distribution of the surface moieties on the particles and the shape of the particles are effective for the pre-selected cell internalization mode.

  13. Quantitative in vivo cell-surface receptor imaging in oncology: kinetic modeling & paired-agent principles from nuclear medicine and optical imaging

    PubMed Central

    Tichauer, Kenneth M.; Wang, Yu; Pogue, Brian W.; Liu, Jonathan T. C.

    2015-01-01

    The development of methods to accurately quantify cell-surface receptors in living tissues would have a seminal impact in oncology. For example, accurate measures of receptor density in vivo could enhance early detection or surgical resection of tumors via protein-based contrast, allowing removal of cancer with high phenotype specificity. Alternatively, accurate receptor expression estimation could be used as a biomarker to guide patient-specific clinical oncology targeting of the same molecular pathway. Unfortunately, conventional molecular contrast-based imaging approaches are not well adapted to accurately estimating the nanomolar-level cell-surface receptor concentrations in tumors, as most images are dominated by nonspecific sources of contrast such as high vascular permeability and lymphatic inhibition. This article reviews approaches for overcoming these limitations based upon tracer kinetic modeling and the use of emerging protocols to estimate binding potential and the related receptor concentration. Methods such as using single time point imaging or a reference-tissue approach tend to have low accuracy in tumors, whereas paired-agent methods or advanced kinetic analyses are more promising to eliminate the dominance of interstitial space in the signals. Nuclear medicine and optical molecular imaging are the primary modalities used, as they have the nanomolar level sensitivity needed to quantify cell-surface receptor concentrations present in tissue, although each likely has a different clinical niche. PMID:26134619

  14. Estradiol coupling to human monocyte nitric oxide release is dependent on intracellular calcium transients: evidence for an estrogen surface receptor.

    PubMed

    Stefano, G B; Prevot, V; Beauvillain, J C; Fimiani, C; Welters, I; Cadet, P; Breton, C; Pestel, J; Salzet, M; Bilfinger, T V

    1999-10-01

    We tested the hypothesis that estrogen acutely stimulates constitutive NO synthase (cNOS) activity in human peripheral monocytes by acting on an estrogen surface receptor. NO release was measured in real time with an amperometric probe. 17beta-estradiol exposure to monocytes stimulated NO release within seconds in a concentration-dependent manner, whereas 17alpha-estradiol had no effect. 17beta-estradiol conjugated to BSA (E2-BSA) also stimulated NO release, suggesting mediation by a membrane surface receptor. Tamoxifen, an estrogen receptor inhibitor, antagonized the action of both 17beta-estradiol and E2-BSA, whereas ICI 182,780, a selective inhibitor of the nuclear estrogen receptor, had no effect. We further showed, using a dual emission microfluorometry in a calcium-free medium, that the 17beta-estradiol-stimulated release of monocyte NO was dependent on the initial stimulation of intracellular calcium transients in a tamoxifen-sensitive process. Leeching out the intracellular calcium stores abolished the effect of 17beta-estradiol on NO release. RT-PCR analysis of RNA obtained from the cells revealed a strong estrogen receptor-alpha amplification signal and a weak beta signal. Taken together, a physiological dose of estrogen acutely stimulates NO release from human monocytes via the activation of an estrogen surface receptor that is coupled to increases in intracellular calcium.

  15. Crystal structure of botulinum neurotoxin type A in complex with the cell surface co-receptor GT1b-insight into the toxin-neuron interaction.

    PubMed

    Stenmark, Pål; Dupuy, Jérôme; Imamura, Akihiro; Kiso, Makoto; Stevens, Raymond C

    2008-08-15

    Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in the toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.

  16. EphrinA2 Receptor (EphA2) Is an Invasion and Intracellular Signaling Receptor for Chlamydia trachomatis

    PubMed Central

    Subbarayal, Prema; Karunakaran, Karthika; Winkler, Ann-Cathrin; Rother, Marion; Gonzalez, Erik; Meyer, Thomas F.; Rudel, Thomas

    2015-01-01

    The obligate intracellular bacterium Chlamydia trachomatis invades into host cells to replicate inside a membrane-bound vacuole called inclusion. Multiple different host proteins are recruited to the inclusion and are functionally modulated to support chlamydial development. Invaded and replicating Chlamydia induces a long-lasting activation of the PI3 kinase signaling pathway that is required for efficient replication. We identified the cell surface tyrosine kinase EphrinA2 receptor (EphA2) as a chlamydial adherence and invasion receptor that induces PI3 kinase (PI3K) activation, promoting chlamydial replication. Interfering with binding of C. trachomatis serovar L2 (Ctr) to EphA2, downregulation of EphA2 expression or inhibition of EphA2 activity significantly reduced Ctr infection. Ctr interacts with and activates EphA2 on the cell surface resulting in Ctr and receptor internalization. During chlamydial replication, EphA2 remains active accumulating around the inclusion and interacts with the p85 regulatory subunit of PI3K to support the activation of the PI3K/Akt signaling pathway that is required for normal chlamydial development. Overexpression of full length EphA2, but not the mutant form lacking the intracellular cytoplasmic domain, enhanced PI3K activation and Ctr infection. Despite the depletion of EphA2 from the cell surface, Ctr infection induces upregulation of EphA2 through the activation of the ERK pathway, which keeps the infected cell in an apoptosis-resistant state. The significance of EphA2 as an entry and intracellular signaling receptor was also observed with the urogenital C. trachomatis-serovar D. Our findings provide the first evidence for a host cell surface receptor that is exploited for invasion as well as for receptor-mediated intracellular signaling to facilitate chlamydial replication. In addition, the engagement of a cell surface receptor at the inclusion membrane is a new mechanism by which Chlamydia subverts the host cell and induces apoptosis resistance. PMID:25906164

  17. EphrinA2 receptor (EphA2) is an invasion and intracellular signaling receptor for Chlamydia trachomatis.

    PubMed

    Subbarayal, Prema; Karunakaran, Karthika; Winkler, Ann-Cathrin; Rother, Marion; Gonzalez, Erik; Meyer, Thomas F; Rudel, Thomas

    2015-04-01

    The obligate intracellular bacterium Chlamydia trachomatis invades into host cells to replicate inside a membrane-bound vacuole called inclusion. Multiple different host proteins are recruited to the inclusion and are functionally modulated to support chlamydial development. Invaded and replicating Chlamydia induces a long-lasting activation of the PI3 kinase signaling pathway that is required for efficient replication. We identified the cell surface tyrosine kinase EphrinA2 receptor (EphA2) as a chlamydial adherence and invasion receptor that induces PI3 kinase (PI3K) activation, promoting chlamydial replication. Interfering with binding of C. trachomatis serovar L2 (Ctr) to EphA2, downregulation of EphA2 expression or inhibition of EphA2 activity significantly reduced Ctr infection. Ctr interacts with and activates EphA2 on the cell surface resulting in Ctr and receptor internalization. During chlamydial replication, EphA2 remains active accumulating around the inclusion and interacts with the p85 regulatory subunit of PI3K to support the activation of the PI3K/Akt signaling pathway that is required for normal chlamydial development. Overexpression of full length EphA2, but not the mutant form lacking the intracellular cytoplasmic domain, enhanced PI3K activation and Ctr infection. Despite the depletion of EphA2 from the cell surface, Ctr infection induces upregulation of EphA2 through the activation of the ERK pathway, which keeps the infected cell in an apoptosis-resistant state. The significance of EphA2 as an entry and intracellular signaling receptor was also observed with the urogenital C. trachomatis-serovar D. Our findings provide the first evidence for a host cell surface receptor that is exploited for invasion as well as for receptor-mediated intracellular signaling to facilitate chlamydial replication. In addition, the engagement of a cell surface receptor at the inclusion membrane is a new mechanism by which Chlamydia subverts the host cell and induces apoptosis resistance.

  18. Contribution of the 37-kDa laminin receptor precursor in the anti-metastatic PSP94-derived peptide PCK3145 cell surface binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Annabi, Borhane; Currie, Jean-Christophe; Bouzeghrane, Mounia

    Purpose: PCK3145 is an anti-metastatic synthetic peptide with promising therapeutic efficacy against hormone-refractory prostate cancer. The characterization of the PCK3145 peptide cell surface binding/internalization mechanisms and of the receptors involved remained to be explored. Results: [{sup 14}C]PCK3145 cell surface binding assays showed rapid and transient kinetic profile, that was inhibited by RGD peptides, laminin, hyaluronan, and type-I collagen. RGD peptides were however unable to inhibit PCK3145 intracellular uptake. Far-Western ligand binding studies enabled the identification of the 37-kDa laminin receptor precursor (37LRP) as a potential ligand for PCK3145. Overexpression of the recombinant 37LRP indeed led to an increase in PCK3145more » binding but unexpectedly not to its uptake. Conclusions: Our data support the implication of laminin receptors in cell surface binding and in transducing PCK3145 anti-metastatic effects, and provide a rational for targeting cancers that express high levels of such laminin receptors.« less

  19. Small GTPase Rab17 Regulates the Surface Expression of Kainate Receptors but Not α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptors in Hippocampal Neurons via Dendritic Trafficking of Syntaxin-4 Protein*

    PubMed Central

    Mori, Yasunori; Fukuda, Mitsunori; Henley, Jeremy M.

    2014-01-01

    Glutamate receptors are fundamental for control synaptic transmission, synaptic plasticity, and neuronal excitability. However, many of the molecular mechanisms underlying their trafficking remain elusive. We previously demonstrated that the small GTPase Rab17 regulates dendritic trafficking in hippocampal neurons. Here, we investigated the role(s) of Rab17 in AMPA receptor (AMPAR) and kainate receptor (KAR) trafficking. Although Rab17 knockdown did not affect surface expression of the AMPAR subunit GluA1 under basal or chemically induced long term potentiation conditions, it significantly reduced surface expression of the KAR subunit GluK2. Rab17 co-localizes with Syntaxin-4 in the soma, dendritic shaft, the tips of developing hippocampal neurons, and in spines. Rab17 knockdown caused Syntaxin-4 redistribution away from dendrites and into axons in developing hippocampal neurons. Syntaxin-4 knockdown reduced GluK2 but had no effect on GluA1 surface expression. Moreover, overexpression of constitutively active Rab17 promoted dendritic surface expression of GluK2 by enhancing Syntaxin-4 translocation to dendrites. These data suggest that Rab17 mediates the dendritic trafficking of Syntaxin-4 to selectively regulate dendritic surface insertion of GluK2-containing KARs in rat hippocampal neurons. PMID:24895134

  20. The Host Cell Receptors for Measles Virus and Their Interaction with the Viral Hemagglutinin (H) Protein

    PubMed Central

    Lin, Liang-Tzung; Richardson, Christopher D.

    2016-01-01

    The hemagglutinin (H) protein of measles virus (MeV) interacts with a cellular receptor which constitutes the initial stage of infection. Binding of H to this host cell receptor subsequently triggers the F protein to activate fusion between virus and host plasma membranes. The search for MeV receptors began with vaccine/laboratory virus strains and evolved to more relevant receptors used by wild-type MeV. Vaccine or laboratory strains of measles virus have been adapted to grow in common cell lines such as Vero and HeLa cells, and were found to use membrane cofactor protein (CD46) as a receptor. CD46 is a regulator that normally prevents cells from complement-mediated self-destruction, and is found on the surface of all human cells, with the exception of erythrocytes. Mutations in the H protein, which occur during adaptation and allow the virus to use CD46 as a receptor, have been identified. Wild-type isolates of measles virus cannot use the CD46 receptor. However, both vaccine/laboratory and wild-type strains can use an immune cell receptor called signaling lymphocyte activation molecule family member 1 (SLAMF1; also called CD150) and a recently discovered epithelial receptor known as Nectin-4. SLAMF1 is found on activated B, T, dendritic, and monocyte cells, and is the initial target for infections by measles virus. Nectin-4 is an adherens junction protein found at the basal surfaces of many polarized epithelial cells, including those of the airways. It is also over-expressed on the apical and basal surfaces of many adenocarcinomas, and is a cancer marker for metastasis and tumor survival. Nectin-4 is a secondary exit receptor which allows measles virus to replicate and amplify in the airways, where the virus is expelled from the body in aerosol droplets. The amino acid residues of H protein that are involved in binding to each of the receptors have been identified through X-ray crystallography and site-specific mutagenesis. Recombinant measles “blind” to each of these receptors have been constructed, allowing the virus to selectively infect receptor specific cell lines. Finally, the observations that SLAMF1 is found on lymphomas and that Nectin-4 is expressed on the cell surfaces of many adenocarcinomas highlight the potential of measles virus for oncolytic therapy. Although CD46 is also upregulated on many tumors, it is less useful as a target for cancer therapy, since normal human cells express this protein on their surfaces. PMID:27657109

  1. The Host Cell Receptors for Measles Virus and Their Interaction with the Viral Hemagglutinin (H) Protein.

    PubMed

    Lin, Liang-Tzung; Richardson, Christopher D

    2016-09-20

    The hemagglutinin (H) protein of measles virus (MeV) interacts with a cellular receptor which constitutes the initial stage of infection. Binding of H to this host cell receptor subsequently triggers the F protein to activate fusion between virus and host plasma membranes. The search for MeV receptors began with vaccine/laboratory virus strains and evolved to more relevant receptors used by wild-type MeV. Vaccine or laboratory strains of measles virus have been adapted to grow in common cell lines such as Vero and HeLa cells, and were found to use membrane cofactor protein (CD46) as a receptor. CD46 is a regulator that normally prevents cells from complement-mediated self-destruction, and is found on the surface of all human cells, with the exception of erythrocytes. Mutations in the H protein, which occur during adaptation and allow the virus to use CD46 as a receptor, have been identified. Wild-type isolates of measles virus cannot use the CD46 receptor. However, both vaccine/laboratory and wild-type strains can use an immune cell receptor called signaling lymphocyte activation molecule family member 1 (SLAMF1; also called CD150) and a recently discovered epithelial receptor known as Nectin-4. SLAMF1 is found on activated B, T, dendritic, and monocyte cells, and is the initial target for infections by measles virus. Nectin-4 is an adherens junction protein found at the basal surfaces of many polarized epithelial cells, including those of the airways. It is also over-expressed on the apical and basal surfaces of many adenocarcinomas, and is a cancer marker for metastasis and tumor survival. Nectin-4 is a secondary exit receptor which allows measles virus to replicate and amplify in the airways, where the virus is expelled from the body in aerosol droplets. The amino acid residues of H protein that are involved in binding to each of the receptors have been identified through X-ray crystallography and site-specific mutagenesis. Recombinant measles "blind" to each of these receptors have been constructed, allowing the virus to selectively infect receptor specific cell lines. Finally, the observations that SLAMF1 is found on lymphomas and that Nectin-4 is expressed on the cell surfaces of many adenocarcinomas highlight the potential of measles virus for oncolytic therapy. Although CD46 is also upregulated on many tumors, it is less useful as a target for cancer therapy, since normal human cells express this protein on their surfaces.

  2. Retrograde transport of the transmembrane estrogen receptor, G-protein-coupled-receptor-30 (GPR30/GPER) from the plasma membrane towards the nucleus.

    PubMed

    Cheng, Shi-Bin; Graeber, Carl T; Quinn, Jeffrey A; Filardo, Edward J

    2011-08-01

    G-protein-coupled receptor 30 (GPR30/GPER) belongs to the seven transmembrane receptor (7TMR) superfamily, the most common class of surface receptor with approximately 800 known members. GPER promotes estrogen binding and rapid signaling via membrane-associated enzymes resulting in increased cAMP and release of heparan bound epidermal growth factor (proHB-EGF) from breast cancer cells. However, GPER is predominately localized intracellularly in breast cancer cells with minor amounts of receptor on the cell surface, an observation that has caused some controversy regarding its potential role as a plasma membrane estrogen receptor. Using the widely employed approach of tracking recombinant 7TMRs by surface labeling live cells, we have begun to characterize and compare the endocytic fate of GPER to other similarly labeled 7TMRs. Upon ectopic expression in human embryonic kidney HEK-293 cells, functional GPER is generated as these cells acquire the capacity to stimulate cAMP and activate cyclic AMP responsive binding protein in response to estradiol-17 beta stimulation. GPER is detectable on the cell surface by immunofluorescent analysis using HA-specific antibodies, albeit the bulk of the receptor is located intracellularly. Like β1AR (beta 1 adrenergic receptor) and CXCR4 (C-X-C chemokine receptor 4), GPER exits the plasma membrane via clathrin-coated pits and enters early endosomes. Interestingly, GPER has a destination that is uncommon among 7TMRs, as it accumulates in a perinuclear compartment. Like many 7TMRs (approximately one-third), GPER trafficking from the plasma membrane is constitutive (occurs in the absence of agonist). However, its route of intracellular trafficking is highly unusual, as 7TMRs typically recycle to the plasma membrane (e.g. β1AR) or are degraded in lysosomes (e.g. CXCR4). The accumulation of GPER in the perinuclear space and its possible significance for attenuating estrogen action via this newly recognized membrane estrogen receptor is discussed herein. Published by Elsevier Inc.

  3. Baclofen mediates neuroprotection on hippocampal CA1 pyramidal cells through the regulation of autophagy under chronic cerebral hypoperfusion

    PubMed Central

    Liu, Li; Li, Chang-jun; Lu, Yun; Zong, Xian-gang; Luo, Chao; Sun, Jun; Guo, Lian-jun

    2015-01-01

    GABA receptors play an important role in ischemic brain injury. Studies have indicated that autophagy is closely related to neurodegenerative diseases. However, during chronic cerebral hypoperfusion, the changes of autophagy in the hippocampal CA1 area, the correlation between GABA receptors and autophagy, and their influences on hippocampal neuronal apoptosis have not been well established. Here, we found that chronic cerebral hypoperfusion resulted in rat hippocampal atrophy, neuronal apoptosis, enhancement and redistribution of autophagy, down-regulation of Bcl-2/Bax ratio, elevation of cleaved caspase-3 levels, reduction of surface expression of GABAA receptor α1 subunit and an increase in surface and mitochondrial expression of connexin 43 (CX43) and CX36. Chronic administration of GABAB receptors agonist baclofen significantly alleviated neuronal damage. Meanwhile, baclofen could up-regulate the ratio of Bcl-2/Bax and increase the activation of Akt, GSK-3β and ERK which suppressed cytodestructive autophagy. The study also provided evidence that baclofen could attenuate the decrease in surface expression of GABAA receptor α1 subunit, and down-regulate surface and mitochondrial expression of CX43 and CX36, which might enhance protective autophagy. The current findings suggested that, under chronic cerebral hypoperfusion, the effects of GABAB receptors activation on autophagy regulation could reverse neuronal damage. PMID:26412641

  4. Regulation of P2Y1 receptor traffic by sorting Nexin 1 is retromer independent.

    PubMed

    Nisar, Shaista; Kelly, Eamonn; Cullen, Pete J; Mundell, Stuart J

    2010-04-01

    The activity and traffic of G-protein coupled receptors (GPCRs) is tightly controlled. Recent work from our laboratory has shown that P2Y(1) and P2Y(12) responsiveness is rapidly and reversibly modulated in human platelets and that the underlying mechanism requires receptor trafficking as an essential part of this process. However, little is known about the molecular mechanisms underlying P2Y receptor traffic. Sorting nexin 1 (SNX1) has been shown to regulate the endosomal sorting of cell surface receptors either to lysosomes where they are downregulated or back to the cell surface. These functions may in part be due to interactions of SNX1 with the mammalian retromer complex. In this study, we investigated the role of SNX1 in P2Y receptor trafficking. We show that P2Y(1) receptors recycle via a slow recycling pathway that is regulated by SNX1, whereas P2Y(12) receptors return to the cell surface via a rapid route that is SNX1 independent. SNX1 inhibition caused a dramatic increase in the rate of P2Y(1) receptor recycling, whereas inhibition of Vps26 and Vps35 known to be present in retromer had no effect, indicating that SNX1 regulation of P2Y(1) receptor recycling is retromer independent. In addition, inhibition of SNX4, 6 and 17 proteins did not affect P2Y(1) receptor recycling. SNX1 has also been implicated in GPCR degradation; however, we provide evidence that P2Y receptor degradation is SNX1 independent. These data describe a novel function of SNX1 in the regulation of P2Y(1) receptor recycling and suggest that SNX1 plays multiple roles in endocytic trafficking of GPCRs.

  5. Ligand affinity of the 67-kD elastin/laminin binding protein is modulated by the protein's lectin domain: visualization of elastin/laminin-receptor complexes with gold-tagged ligands

    PubMed Central

    1991-01-01

    Video-enhanced microscopy was used to examine the interaction of elastin- or laminin-coated gold particles with elastin binding proteins on the surface of live cells. By visualizing the binding events in real time, it was possible to determine the specificity and avidity of ligand binding as well as to analyze the motion of the receptor-ligand complex in the plane of the plasma membrane. Although it was difficult to interpret the rates of binding and release rigorously because of the possibility for multiple interactions between particles and the cell surface, relative changes in binding have revealed important aspects of the regulation of affinity of ligand-receptor interaction in situ. Both elastin and laminin were found to compete for binding to the cell surface and lactose dramatically decreased the affinity of the receptor(s) for both elastin and laminin. These findings were supported by in vitro studies of the detergent-solubilized receptor. Further, immobilization of the ligand-receptor complexes through binding to the cytoskeleton dramatically decreased the ability of bound particles to leave the receptor. The changes in the kinetics of ligand-coated gold binding to living cells suggest that both laminin and elastin binding is inhibited by lactose and that attachment of receptor to the cytoskeleton increases its affinity for the ligand. PMID:1848864

  6. Stress Proteins and Initiation of Immune Response: Chaperokine activity of Hsp72

    PubMed Central

    Asea, Alexzander

    2006-01-01

    From its original description as solely an intracellular molecular chaperone, heat shock proteins have now been shown to function as initiators of the host's immune response. Although the exact mechanism by which intracellular heat shock proteins leave cells is still incompletely understood, recent work from several labs suggest that heat shock proteins are released by both passive (necrotic) and active (physiological) mechanisms. Binding to specific surface receptors is a prerequisite for the initiation of an immune response. To date, several cell surface proteins have been described as the receptor for seventy kilo-Dalton heat shock protein (Hsp70) including Toll-like receptors 2 and 4 with their cofactor CD14, the scavenger receptor CD36, the low-density lipoprotein receptor-related protein CD91, the C-type lectin receptor LOX-1, and another member of the scavenger super-family SR-A plus the co-stimulatory molecule, CD40. Binding of Hsp70 to these surface receptors specifically activates intracellular signaling cascades, which in turn exert immunoregulatory effector functions; a process known as the chaperokine activity of Hsp70. This review will highlight recent advances in understanding the mechanism by which Hsp70 initiates the host's immune response. PMID:16385842

  7. Stress proteins and initiation of immune response: chaperokine activity of hsp72.

    PubMed

    Asea, Alexzander

    2005-01-01

    From its original description as solely an intracellular molecular chaperone, heat shock proteins have now been shown to function as initiators of the host's immune response. Although the exact mechanism by which intracellular heat shock proteins leave cells is still incompletely understood, recent work from several labs suggest that heat shock proteins are released by both passive (necrotic) and active (physiological) mechanisms. Binding to specific surface receptors is a prerequisite for the initiation of an immune response. To date, several cell surface proteins have been described as the receptor for seventy kilo-Dalton heat shock protein (Hsp70) including Toll-like receptors 2 and 4 with their cofactor CD14, the scavenger receptor CD36, the low-density lipoprotein receptor-related protein CD91, the C-type lectin receptor LOX-1, and another member of the scavenger super-family SR-A plus the co-stimulatory molecule, CD40. Binding of Hsp70 to these surface receptors specifically activates intracellular signaling cascades, which in turn exert immunoregulatory effector functions; a process known as the chaperokine activity of Hsp70. This review will highlight recent advances in understanding the mechanism by which Hsp70 initiates the host's immune response.

  8. Surface localization of the nuclear receptor CAR in influenza A virus-infected cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takahashi, Tadanobu; Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, CREST, JST, and COE Program in the 21st Century, Shizuoka 422-8526; Moriyama, Yusuke

    Constitutive active/androstane receptor CAR is a member of the nuclear receptors which regulate transcription of xenobiotic metabolism enzymes. CAR is usually localized in the cytosol and nucleus. Here, we found that CAR was localized at the cell surface of influenza A virus (IAV)-infected cells. Additionally, we demonstrated that expression of a viral envelope glycoprotein, either hemagglutinin (HA) or neuraminidase (NA), but not viral nucleoprotein (NP), was responsible for this localization. This report is the first demonstration of CAR at the surface of tissue culture cells, and suggests that CAR may exert the IAV infection mechanism.

  9. Regulation of AMPA receptor localization in lipid rafts

    PubMed Central

    Hou, Qingming; Huang, Yunfei; Amato, Stephen; Snyder, Solomon H.; Huganir, Richard L.; Man, Heng-Ye

    2009-01-01

    Lipid rafts are special microdomains enriched in cholesterol, sphingolipids and certain proteins, and play important roles in a variety of cellular functions including signal transduction and protein trafficking. We report that in cultured cortical and hippocampal neurons the distribution of lipid rafts is development-dependent. Lipid rafts in mature neurons exist on the entire cell-surface and display a high degree of mobility. AMPA receptors co-localize and associate with lipid rafts in the plasma membrane. The association of AMPARs with rafts is under regulation; through the NOS–NO pathway, NMDA receptor activity increases AMPAR localization in rafts. During membrane targeting, AMPARs insert into or at close proximity of the surface raft domains. Perturbation of lipid rafts dramatically suppresses AMPA receptor exocytosis, resulting in significant reduction in AMPAR cell-surface expression. PMID:18411055

  10. Co-Requirement of PICK1 Binding and PKC Phosphorylation for Stable Surface Expression of the Metabotropic Glutamate Receptor mGluR7

    PubMed Central

    Suh, Young Ho; Pelkey, Kenneth A.; Lavezzari, Gabriela; Roche, Paul A.; Huganir, Richard L.; McBain, Chris J.; Roche, Katherine W.

    2008-01-01

    SUMMARY The presynaptic metabotropic glutamate receptor (mGluR) mGluR7 modulates excitatory neurotransmission by regulating neurotransmitter release, and plays a critical role in certain forms of synaptic plasticity. Although the dynamic regulation of mGluR7 surface expression governs a novel form of metaplasticity in the hippocampus, little is known about the molecular mechanisms regulating mGluR7 trafficking. We now show that mGluR7 surface expression is stabilized by both PKC phosphorylation and by receptor binding to the PDZ domain-containing protein PICK1. Phosphorylation of mGluR7 on serine 862 (S862) inhibits CaM binding thereby increasing mGluR7 surface expression and receptor binding to PICK1. Furthermore, in mice lacking PICK1, PKC-dependent increases in mGluR7 phosphorylation and surface expression are diminished, and mGluR7-dependent plasticity at mossy fiber-interneuron hippocampal synapses is impaired. These data support a model in which PICK1 binding and PKC phosphorylation act together to stabilize mGluR7 on the cell surface in vivo. PMID:18549785

  11. Rearrangement and expression of the human {Psi}C{lambda}6 gene segment results in a surface Ig receptor with a truncated light chain constant region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stiernholm, N.B.J.; Verkoczy, L.K.; Berinstein, N.L.

    1995-05-01

    The constant region of the human Ig{lambda} locus consists of seven tandemly organized J-C gene segments. Although it has been established that the J-C{lambda}1, J-C{lambda}2, J-C{lambda}3, and J-C{lambda}7 gene segments are functional, and code for the four distinct Ig{lambda} isotypes found in human serum, the J-C{lambda}4, J-C{lambda}5, and J-C{lambda}6 gene segments are generally considered to be pseudogenes. Although one example of a functional J-C{lambda}6 gene segment has been documented, in the majority of cases, J-C{lambda}6 is rendered nonfunctional by virtue of a single duplication of four nucleotides, creating a premature translational arrest. We show here that rearrangements to the J-C{lambda}6more » gene segment do occur, and that such a rearrangement encodes an Ig{lambda} protein that lacks the terminal end of the constant region. We also show that this truncated protein is expressed on the surface with the IgH chain, creating an unusual surface Ig (sIg) receptor (sIg{triangle}CL). Cells that express this receptor on the surface do so at significantly reduced levels compared with clonally related variants, which express sIg receptors with conventional Ig{lambda} L chains. However, the effects of sIg cross-linking on tyrosine phosphorylation and surface expression of the CD25 and CD71 Ags are similar in cells that express conventional sIg receptors and in those that express sIg{triangle}CL receptors, suggesting that the latter could possibly function as an Ag receptor. 35 refs., 7 figs.« less

  12. Insulin release: the receptor hypothesis.

    PubMed

    Malaisse, Willy J

    2014-07-01

    It is currently believed that the stimulation of insulin release by nutrient secretagogues reflects their capacity to act as fuel in pancreatic islet beta cells. In this review, it is proposed that such a fuel concept is not incompatible with a receptor hypothesis postulating the participation of cell-surface receptors in the recognition of selected nutrients as insulinotropic agents. Pursuant to this, attention is drawn to such matters as the anomeric specificity of the beta cell secretory response to D-glucose and its perturbation in diabetes mellitus, the insulinotropic action of artificial sweeteners, the possible role of bitter taste receptors in the stimulation of insulin secretion by L-glucose pentaacetate, the recently documented presence of cell-surface sweet taste receptors in insulin-producing cells, the multimodal signalling process resulting from the activation of these latter receptors, and the presence in beta cells of a sweet taste receptor mediating the fructose-induced potentiation of glucose-stimulated insulin secretion.

  13. High cell surface death receptor expression determines type I versus type II signaling.

    PubMed

    Meng, Xue Wei; Peterson, Kevin L; Dai, Haiming; Schneider, Paula; Lee, Sun-Hee; Zhang, Jin-San; Koenig, Alexander; Bronk, Steve; Billadeau, Daniel D; Gores, Gregory J; Kaufmann, Scott H

    2011-10-14

    Previous studies have suggested that there are two signaling pathways leading from ligation of the Fas receptor to induction of apoptosis. Type I signaling involves Fas ligand-induced recruitment of large amounts of FADD (FAS-associated death domain protein) and procaspase 8, leading to direct activation of caspase 3, whereas type II signaling involves Bid-mediated mitochondrial perturbation to amplify a more modest death receptor-initiated signal. The biochemical basis for this dichotomy has previously been unclear. Here we show that type I cells have a longer half-life for Fas message and express higher amounts of cell surface Fas, explaining the increased recruitment of FADD and subsequent signaling. Moreover, we demonstrate that cells with type II Fas signaling (Jurkat or HCT-15) can signal through a type I pathway upon forced receptor overexpression and that shRNA-mediated Fas down-regulation converts cells with type I signaling (A498) to type II signaling. Importantly, the same cells can exhibit type I signaling for Fas and type II signaling for TRAIL (TNF-α-related apoptosis-inducing ligand), indicating that the choice of signaling pathway is related to the specific receptor, not some other cellular feature. Additional experiments revealed that up-regulation of cell surface death receptor 5 levels by treatment with 7-ethyl-10-hydroxy-camptothecin converted TRAIL signaling in HCT116 cells from type II to type I. Collectively, these results suggest that the type I/type II dichotomy reflects differences in cell surface death receptor expression.

  14. Crystal Structure of Botulinum Neurotoxin Type a in Complex With the Cell Surface Co-Receptor GT1b-Insight Into the Toxin-Neuron Interaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stenmark, P.; Dupuy, J.; Inamura, A.

    2009-05-26

    Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in themore » toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.« less

  15. Cloning and Characterization of the Mouse Hepatitis Virus Receptor

    DTIC Science & Technology

    1991-02-11

    materials. Viruses may also adhere to cell surfaces non-specifically through electrostatic interactions (Tardieu et al., 1982). Virus particles might be... viruses can utilize more than one type of receptor and that specific virus receptors may be present in low numbers on the cell surface or may be labile...known example of this type of interaction is the enhancement of virus infection by antibodies, which has been demonstrated for several viruses

  16. Modeling Multivalent Ligand-Receptor Interactions with Steric Constraints on Configurations of Cell-Surface Receptor Aggregates

    PubMed Central

    Monine, Michael I.; Posner, Richard G.; Savage, Paul B.; Faeder, James R.; Hlavacek, William S.

    2010-01-01

    Abstract We use flow cytometry to characterize equilibrium binding of a fluorophore-labeled trivalent model antigen to bivalent IgE-FcεRI complexes on RBL cells. We find that flow cytometric measurements are consistent with an equilibrium model for ligand-receptor binding in which binding sites are assumed to be equivalent and ligand-induced receptor aggregates are assumed to be acyclic. However, this model predicts extensive receptor aggregation at antigen concentrations that yield strong cellular secretory responses, which is inconsistent with the expectation that large receptor aggregates should inhibit such responses. To investigate possible explanations for this discrepancy, we evaluate four rule-based models for interaction of a trivalent ligand with a bivalent cell-surface receptor that relax simplifying assumptions of the equilibrium model. These models are simulated using a rule-based kinetic Monte Carlo approach to investigate the kinetics of ligand-induced receptor aggregation and to study how the kinetics and equilibria of ligand-receptor interaction are affected by steric constraints on receptor aggregate configurations and by the formation of cyclic receptor aggregates. The results suggest that formation of linear chains of cyclic receptor dimers may be important for generating secretory signals. Steric effects that limit receptor aggregation and transient formation of small receptor aggregates may also be important. PMID:20085718

  17. Binding-, intracellular transport-, and biosynthesis-defective mutants of vasopressin type 2 receptor in patients with X-linked nephrogenic diabetes insipidus.

    PubMed Central

    Tsukaguchi, H; Matsubara, H; Taketani, S; Mori, Y; Seido, T; Inada, M

    1995-01-01

    Nephrogenic diabetes insipidus (NDI) is most often an X-linked disorder in which urine is not concentrated due to renal resistance to arginine vasopressin. We recently identified four vasopressin type 2 receptor gene mutations in unrelated X-linked NDI families, including R143P, delta V278, R202C, and 804insG. All these mutations reduced ligand binding activity to < 10% of the normal without affecting mRNA accumulation. To elucidate whether the receptors are expressed on the cell surface, we analyzed biosynthesis and localization of tagged or untagged receptors stably expressed in Chinese hamster ovary (CHO) cells, using two antibodies directed against distinct termini. Whole-cell and surface labeling studies revealed that the R202C clone had both surface-localized (50-55 kD) and intracellular proteins (40 and 75 kD), similar to the wild-type AVPR2 clone, whereas the R143P and delta V278 clones lacked the surface receptors, despite relatively increased intracellular components. The 804insG mutant cell produced no proteins despite an adequate mRNA level. Immunofluorescence staining confirmed that the R202C mutant reaches the cell surface, whereas the R143P and delta V278 mutants are retained within the cytoplasmic compartment. Thus, R202C, R143P/delta V278, and 804insG result in three distinct phenotypes, that is, a simple binding impairment at the cell surface, blocked intracellular transport, and ineffective biosynthesis or/and accelerated degradation of the receptor, respectively, and therefore are responsible for NDI. This phenotypic classification will help understanding of molecular pathophysiology of this disorder. Images PMID:7560098

  18. Protein phosphatase 2A mediates resensitization of the neurokinin 1 receptor

    PubMed Central

    Murphy, Jane E.; Roosterman, Dirk; Cottrell, Graeme S.; Padilla, Benjamin E.; Feld, Micha; Brand, Eva; Cedron, Wendy J.; Steinhoff, Martin

    2011-01-01

    Activated G protein-coupled receptors (GPCRs) are phosphorylated and interact with β-arrestins, which mediate desensitization and endocytosis. Endothelin-converting enzyme-1 (ECE-1) degrades neuropeptides in endosomes and can promote recycling. Although endocytosis, dephosphorylation, and recycling are accepted mechanisms of receptor resensitization, a large proportion of desensitized receptors can remain at the cell surface. We investigated whether reactivation of noninternalized, desensitized (phosphorylated) receptors mediates resensitization of the substance P (SP) neurokinin 1 receptor (NK1R). Herein, we report a novel mechanism of resensitization by which protein phosphatase 2A (PP2A) is recruited to dephosphorylate noninternalized NK1R. A desensitizing concentration of SP reduced cell-surface SP binding sites by only 25%, and SP-induced Ca2+ signals were fully resensitized before cell-surface binding sites started to recover, suggesting resensitization of cell-surface-retained NK1R. SP induced association of β-arrestin1 and PP2A with noninternalized NK1R. β-Arrestin1 small interfering RNA knockdown prevented SP-induced association of cell-surface NK1R with PP2A, indicating that β-arrestin1 mediates this interaction. ECE-1 inhibition, by trapping β-arrestin1 in endosomes, also impeded SP-induced association of cell-surface NK1R with PP2A. Resensitization of NK1R signaling required both PP2A and ECE-1 activity. Thus, after stimulation with SP, PP2A interacts with noninternalized NK1R and mediates resensitization. PP2A interaction with NK1R requires β-arrestin1. ECE-1 promotes this process by releasing β-arrestin1 from NK1R in endosomes. These findings represent a novel mechanism of PP2A- and ECE-1-dependent resensitization of GPCRs. PMID:21795521

  19. The Macrophage Galactose-Type Lectin Can Function as an Attachment and Entry Receptor for Influenza Virus

    PubMed Central

    Ng, Wy Ching; Liong, Stella; Tate, Michelle D.; Irimura, Tatsuro; Denda-Nagai, Kaori; Brooks, Andrew G.; Londrigan, Sarah L.

    2014-01-01

    Specific protein receptors that mediate internalization and entry of influenza A virus (IAV) have not been identified for any cell type. Sialic acid (SIA), the primary attachment factor for IAV hemagglutinin, is expressed by numerous cell surface glycoproteins and glycolipids, confounding efforts to identify specific receptors involved in virus infection. Lec1 Chinese hamster ovary (CHO) epithelial cells express cell surface SIA and bind IAV yet are largely resistant to infection. Here, we demonstrate that expression of the murine macrophage galactose-type lectin 1 (MGL1) by Lec1 cells enhanced Ca2+-dependent IAV binding and restored permissivity to infection. Lec1 cells expressing MGL1 were infected in the presence or absence of cell surface SIA, indicating that MGL1 can act as a primary receptor or as a coreceptor with SIA. Lec1 cells expressing endocytosis-deficient MGL1 mediated Ca2+-dependent IAV binding but were less sensitive to IAV infection, indicating that direct internalization via MGL1 can result in cellular infection. Together, these studies identify MGL1 as a cell surface glycoprotein that can act as an authentic receptor for both attachment and infectious entry of IAV. PMID:24257596

  20. Enhanced Chemokine Receptor Recycling and Impaired S1P1 Expression Promote Leukemic Cell Infiltration of Lymph Nodes in Chronic Lymphocytic Leukemia.

    PubMed

    Patrussi, Laura; Capitani, Nagaja; Martini, Veronica; Pizzi, Marco; Trimarco, Valentina; Frezzato, Federica; Marino, Filippo; Semenzato, Gianpietro; Trentin, Livio; Baldari, Cosima T

    2015-10-01

    Lymphocyte trafficking is orchestrated by chemokine and sphingosine 1-phosphate (S1P) receptors that enable homing and egress from secondary lymphoid organs (SLO). These receptors undergo rapid internalization and plasma membrane recycling to calibrate cellular responses to local chemoattractants. Circulating chronic lymphocytic leukemia (CLL) cells display an abnormal increase in the surface levels of the homing receptors CCR7 and CXCR4 concomitant with low S1P receptor 1 (S1P1) expression. In this study, we investigated the role of receptor recycling on CXCR4/CCR7 surface levels in CLL cells and addressed the impact of quantitative alterations of these receptors and S1P1 on the ability of leukemic cells to accumulate in SLOs. We show that recycling accounts, to a major extent, for the high levels of surface CXCR4/CCR7 on CLL cells. In addition, increased expression of these receptors, together with S1P1 deficiency, is detectable not only in circulating leukemic cells, but also in SLOs of CLL patients with lymphoadenopathy. We further provide evidence that ibrutinib, a Btk inhibitor that promotes mobilization of leukemic cells from SLOs, normalizes the imbalance between CXCR4/CCR7 and S1P1. Taken together, our results highlight the relevance of chemokine and S1P receptor recycling in CLL pathogenesis and clinical outcome. ©2015 American Association for Cancer Research.

  1. Physical Biology in Cancer. 3. The role of cell glycocalyx in vascular transport of circulating tumor cells

    PubMed Central

    Mitchell, Michael J.

    2013-01-01

    Circulating tumor cells (CTCs) in blood are known to adhere to the luminal surface of the microvasculature via receptor-mediated adhesion, which contributes to the spread of cancer metastasis to anatomically distant organs. Such interactions between ligands on CTCs and endothelial cell-bound surface receptors are sensitive to receptor-ligand distances at the nanoscale. The sugar-rich coating expressed on the surface of CTCs and endothelial cells, known as the glycocalyx, serves as a physical structure that can control the spacing and, thus, the availability of such receptor-ligand interactions. The cancer cell glycocalyx can also regulate the ability of therapeutic ligands to bind to CTCs in the bloodstream. Here, we review the role of cell glycocalyx on the adhesion and therapeutic treatment of CTCs in the bloodstream. PMID:24133067

  2. RNA Aptamer-Based Functional Ligands of the Neurotrophin Receptor, TrkB

    PubMed Central

    Huang, Yang Zhong; Hernandez, Frank J.; Gu, Bin; Stockdale, Katie R.; Nanapaneni, Kishore; Scheetz, Todd E.; Behlke, Mark A.; Peek, Andrew S.; Bair, Thomas; Giangrande, Paloma H.

    2012-01-01

    Many cell surface signaling receptors, such as the neurotrophin receptor, TrkB, have emerged as potential therapeutic targets for diverse diseases. Reduced activation of TrkB in particular is thought to contribute to neurodegenerative diseases. Unfortunately, development of therapeutic reagents that selectively activate particular cell surface receptors such as TrkB has proven challenging. Like many cell surface signaling receptors, TrkB is internalized upon activation; in this proof-of-concept study, we exploited this fact to isolate a pool of nuclease-stabilized RNA aptamers enriched for TrkB agonists. One of the selected aptamers, C4-3, was characterized with recombinant protein-binding assays, cell-based signaling and functional assays, and, in vivo in a seizure model in mice. C4-3 binds the extracellular domain of TrkB with high affinity (KD ∼2 nM) and exhibits potent TrkB partial agonistic activity and neuroprotective effects in cultured cortical neurons. In mice, C4-3 activates TrkB upon infusion into the hippocampus; systemic administration of C4-3 potentiates kainic acid-induced seizure development. We conclude that C4-3 is a potentially useful therapeutic agent for neurodegenerative diseases in which reduced TrkB activation has been implicated. We anticipate that the cell-based aptamer selection approach used here will be broadly applicable to the identification of aptamer-based agonists for a variety of cell-surface signaling receptors. PMID:22752556

  3. Activation of the novel estrogen receptor G protein-coupled receptor 30 (GPR30) at the plasma membrane.

    PubMed

    Filardo, E; Quinn, J; Pang, Y; Graeber, C; Shaw, S; Dong, J; Thomas, P

    2007-07-01

    G protein-coupled receptor 30 (GPR30), a seven-transmembrane receptor (7TMR), is associated with rapid estrogen-dependent, G protein signaling and specific estrogen binding. At present, the subcellular site of GPR30 action is unclear. Previous studies using antibodies and fluorochrome-labeled estradiol (E2) have failed to detect GPR30 on the cell surface, suggesting that GPR30 may function uniquely among 7TMRs as an intracellular receptor. Here, we show that detectable expression of GPR30 on the surface of transfected HEK-293 cells can be selected by fluorescence-activated cell sorting. Expression of GPR30 on the cell surface was confirmed by confocal microscopy using the lectin concanavalin A as a plasma membrane marker. Stimulation of GPR30-expressing HEK-293 cells with 17beta-E2 caused sequestration of GPR30 from the cell surface and resulted in its codistribution with clathrin and mobilization of intracellular calcium stores. Evidence that GPR30 signals from the cell surface was obtained from experiments demonstrating that the cell-impermeable E2-protein conjugates E2-BSA and E2-horseradish peroxidase promote GPR30-dependent elevation of intracellular cAMP concentrations. Subcellular fractionation studies further support the plasma membrane as a site of GPR30 action with specific [3H]17beta-E2 binding and G protein activation associated with plasma membrane but not microsomal, or other fractions, prepared from HEK-293 or SKBR3 breast cancer cells. These results suggest that GPR30, like other 7TMRs, functions as a plasma membrane receptor.

  4. Novel Yeast-based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR*

    PubMed Central

    Li, Hao; Redinbo, Matthew R.; Venkatesh, Madhukumar; Ekins, Sean; Chaudhry, Anik; Bloch, Nicolin; Negassa, Abdissa; Mukherjee, Paromita; Kalpana, Ganjam; Mani, Sridhar

    2013-01-01

    The pregnane X receptor (PXR) is a master regulator of xenobiotic metabolism, and its activity is critical toward understanding the pathophysiology of several diseases, including inflammation, cancer, and steatosis. Previous studies have demonstrated that ketoconazole binds to ligand-activated PXR and antagonizes receptor control of gene expression. Structure-function as well as computational docking analysis suggested a putative binding region containing critical charge clamp residues Gln-272, and Phe-264 on the AF-2 surface of PXR. To define the antagonist binding surface(s) of PXR, we developed a novel assay to identify key amino acid residues on PXR based on a yeast two-hybrid screen that examined mutant forms of PXR. This screen identified multiple “gain-of-function” mutants that were “resistant” to the PXR antagonist effects of ketoconazole. We then compared our screen results identifying key PXR residues to those predicted by computational methods. Of 15 potential or putative binding residues based on docking, we identified three residues in the yeast screen that were then systematically verified to functionally interact with ketoconazole using mammalian assays. Among the residues confirmed by our study was Ser-208, which is on the opposite side of the protein from the AF-2 region critical for receptor regulation. The identification of new locations for antagonist binding on the surface or buried in PXR indicates novel aspects to the mechanism of receptor antagonism. These results significantly expand our understanding of antagonist binding sites on the surface of PXR and suggest new avenues to regulate this receptor for clinical applications. PMID:23525103

  5. A mutation in the insulin receptor gene that impairs transport of the receptor to the plasma membrane and causes insulin-resistant diabetes.

    PubMed Central

    Accili, D; Frapier, C; Mosthaf, L; McKeon, C; Elbein, S C; Permutt, M A; Ramos, E; Lander, E; Ullrich, A; Taylor, S I

    1989-01-01

    Insulin binds to a receptor on the cell surface, thereby triggering a biological response within the target cell. Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. We have studied a family in which two sisters have a genetic form of insulin-resistant diabetes mellitus. The technique of homozygosity mapping has been used to demonstrate that the mutation causing diabetes in this consanguineous family is genetically linked to the insulin receptor gene. The two insulin-resistant sisters are homozygous for a mutation encoding substitution of valine for phenylalanine at position 382 in the alpha-subunit of the insulin receptor. Transfection of mutant insulin receptor cDNA into NIH3T3 cells demonstrated that the Val382 mutation impaired post-translational processing and retarded transport of the insulin receptor to the plasma membrane. Thus, the mutation causes insulin resistance by decreasing the number of insulin receptors on the surface of the patients' cells. Images PMID:2573522

  6. Selenoprotein W controls epidermal growth factor receptor surface expression, activation and degradation via receptor ubiquitination

    USDA-ARS?s Scientific Manuscript database

    Epidermal growth factor (EGF) receptor (EGFR) is the founding member of the ErbB family of growth factor receptors that modulate a complex network of intracellular signaling pathways controlling growth, proliferation and differentiation. Selenoprotein W (SEPW1) is a diet-regulated, highly conserved...

  7. Site-specific O-glycosylation of N-terminal serine residues by polypeptide GalNAc-transferase 2 modulates human δ-opioid receptor turnover at the plasma membrane.

    PubMed

    Lackman, Jarkko J; Goth, Christoffer K; Halim, Adnan; Vakhrushev, Sergey Y; Clausen, Henrik; Petäjä-Repo, Ulla E

    2018-01-01

    G protein-coupled receptors (GPCRs) are an important protein family of signalling receptors that govern a wide variety of physiological functions. The capacity to transmit extracellular signals and the extent of cellular response are largely determined by the amount of functional receptors at the cell surface that is subject to complex and fine-tuned regulation. Here, we demonstrate that the cell surface expression level of an inhibitory GPCR, the human δ-opioid receptor (hδOR) involved in pain and mood regulation, is modulated by site-specific N-acetylgalactosamine (GalNAc) -type O-glycosylation. Importantly, we identified one out of the 20 polypeptide GalNAc-transferase isoforms, GalNAc-T2, as the specific regulator of O-glycosylation of Ser6, Ser25 and Ser29 in the N-terminal ectodomain of the receptor. This was demonstrated by in vitro glycosylation assays using peptides corresponding to the hδOR N-terminus, Vicia villosa lectin affinity purification of receptors expressed in HEK293 SimpleCells capable of synthesizing only truncated O-glycans, GalNAc-T edited cell line model systems, and site-directed mutagenesis of the putative O-glycosylation sites. Interestingly, a single-nucleotide polymorphism, at residue 27 (F27C), was found to alter O-glycosylation of the receptor in efficiency as well as in glycosite usage. Furthermore, flow cytometry and cell surface biotinylation assays using O-glycan deficient CHO-ldlD cells revealed that the absence of O-glycans results in decreased receptor levels at the plasma membrane due to enhanced turnover. In addition, mutation of the identified O-glycosylation sites led to a decrease in the number of ligand-binding competent receptors and impaired agonist-mediated inhibition of cyclic AMP accumulation in HEK293 cells. Thus, site-specific O-glycosylation by a selected GalNAc-T isoform can increase the stability of a GPCR, in a process that modulates the constitutive turnover and steady-state levels of functional receptors at the cell surface. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. New molten salt systems for high temperature molten salt batteries: Ternary and quaternary molten salt systems based on LiF-LiCl, LiF-LiBr, and LiCl-LiBr

    NASA Astrophysics Data System (ADS)

    Fujiwara, Syozo; Inaba, Minoru; Tasaka, Akimasa

    Using a new simulative technique developed by us, we systematically investigated new ternary or quaternary molten salt systems, which are based on LiF-LiCl, LiF-LiBr, and LiCl-LiBr binary systems, for use as electrolytes in thermal batteries, and evaluated their ionic conductivities and melting points experimentally. It was confirmed experimentally that LiF-LiBr-KF (melting point: 425 °C, ionic conductivity at 500 °C: 2.52 S cm -1), LiCl-LiBr-KF (405 °C, 2.56 S cm -1), LiCl-LiBr-NaF-KF (425 °C, 3.11 S cm -1), LiCl-LiBr-NaCl-KCl (420 °C, 2.73 S cm -1), and LiCl-LiBr-NaBr-KBr (420 °C, 2.76 S cm -1) meet our targets for both melting point (350-430 °C) and ionic conductivity (2.0 S cm -1 and higher at 500 °C). A single cell using the newly developed LiCl-LiBr-NaCl-KCl molten salt as an electrolyte was prepared, and the DC-IR of the cell decreased by 20% than that of a single cell using the conventional LiCl-KCl molten salt. It was therefore concluded that the use of new quaternary molten salt systems can improve the discharge rate-capability in practical battery applications because of their high ionic conductivities.

  9. Few residues within an extensive binding interface drive receptor interaction and determine the specificity of arrestin proteins.

    PubMed

    Vishnivetskiy, Sergey A; Gimenez, Luis E; Francis, Derek J; Hanson, Susan M; Hubbell, Wayne L; Klug, Candice S; Gurevich, Vsevolod V

    2011-07-08

    Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements.

  10. Few Residues within an Extensive Binding Interface Drive Receptor Interaction and Determine the Specificity of Arrestin Proteins*

    PubMed Central

    Vishnivetskiy, Sergey A.; Gimenez, Luis E.; Francis, Derek J.; Hanson, Susan M.; Hubbell, Wayne L.; Klug, Candice S.; Gurevich, Vsevolod V.

    2011-01-01

    Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements. PMID:21471193

  11. The cell surface environment for pathogen recognition and entry.

    PubMed

    Stow, Jennifer L; Condon, Nicholas D

    2016-04-01

    The surface of mammalian cells offers an interface between the cell interior and its surrounding milieu. As part of the innate immune system, macrophages have cell surface features optimised for probing and sampling as they patrol our tissues for pathogens, debris or dead cells. Their highly dynamic and constantly moving cell surface has extensions such as lamellipodia, filopodia and dorsal ruffles that help detect pathogens. Dorsal ruffles give rise to macropinosomes for rapid, high volume non-selective fluid sampling, receptor internalisation and plasma membrane turnover. Ruffles can also generate phagocytic cups for the receptor-mediated uptake of pathogens or particles. The membrane lipids, actin cytoskeleton, receptors and signalling proteins that constitute these cell surface domains are discussed. Although the cell surface is designed to counteract pathogens, many bacteria, viruses and other pathogens have evolved to circumvent or hijack these cell structures and their underlying machinery for entry and survival. Nevertheless, these features offer important potential for developing vaccines, drugs and preventative measures to help fight infection.

  12. The deubiquitinases USP33 and USP20 coordinate beta2 adrenergic receptor recycling and resensitization.

    PubMed

    Berthouze, Magali; Venkataramanan, Vidya; Li, Yi; Shenoy, Sudha K

    2009-06-17

    Agonist-induced ubiquitination of the beta(2) adrenergic receptor (beta(2)AR) functions as an important post-translational modification to sort internalized receptors to the lysosomes for degradation. We now show that this ubiquitination is reversed by two deubiquitinating enzymes, ubiquitin-specific proteases (USPs) 20 and 33, thus, inhibiting lysosomal trafficking when concomitantly promoting receptor recycling from the late-endosomal compartments as well as resensitization of recycled receptors at the cell surface. Dissociation of constitutively bound endogenously expressed USPs 20 and 33 from the beta(2)AR immediately after agonist stimulation and reassociation on prolonged agonist treatment allows receptors to first become ubiquitinated and then deubiquitinated, thus, providing a 'trip switch' between degradative and recycling pathways at the late-endosomal compartments. Thus, USPs 20 and 33 serve as novel regulators that dictate both post-endocytic sorting as well as the intensity and extent of beta(2)AR signalling from the cell surface.

  13. Active radar guides missile to its target: receptor-based targeted treatment of hepatocellular carcinoma by nanoparticulate systems.

    PubMed

    Yan, Jing-Jun; Liao, Jia-Zhi; Lin, Ju-Sheng; He, Xing-Xing

    2015-01-01

    Patients with hepatocellular carcinoma (HCC) usually present at advanced stages and do not benefit from surgical resection, so drug therapy should deserve a prominent place in unresectable HCC treatment. But chemotherapy agents, such as doxorubicin, cisplatin, and paclitaxel, frequently encounter important problems such as low specificity and non-selective biodistribution. Recently, the development of nanotechnology led to significant breakthroughs to overcome these problems. Decorating the surfaces of nanoparticulate-based drug carriers with homing devices has demonstrated its potential in concentrating chemotherapy agents specifically to HCC cells. In this paper, we reviewed the current status of active targeting strategies for nanoparticulate systems based on various receptors such as asialoglycoprotein receptor, transferrin receptor, epidermal growth factor receptor, folate receptor, integrin, and CD44, which are abundantly expressed on the surfaces of hepatocytes or liver cancer cells. Furthermore, we pointed out their merits and defects and provided theoretical references for further research.

  14. Interaction of tachykinins with phospholipid membranes: A neutron diffraction study

    NASA Astrophysics Data System (ADS)

    Darkes, Malcolm J. M.; Davies, Sarah M. A.; Bradshaw, Jeremy P.

    Tachykinins are a group of peptides which bind to G-protein-coupled receptors. Receptor affinity appears to depend on different secondary structures of tachykinin which share the same hydrophobic carboxy-terminal sequence, FXGLM. Receptor activation is thought to be due to the carboxy-terminal submerging into the bilayer and the amino-terminal binding on the surface. Binding of tachykinins to phospholipid bilayers may take place both on the aqueous membrane surface and in the hydrophobic region. The two-state equilibrium appears to depend on the surface charge of the membrane. Deuterating substance P and neurokinin A at their carboxy-terminals, our results show two populations of label for each peptide. One is very close to the water-hydrocarbon interface, the other some 13 Å deeper. We report that the bilayer location of the two tachykinins is remarkably similar, thereby inferring that receptor specifity must be controlled by finer levels of structure.

  15. THE AP-2 CLATHRIN ADAPTOR MEDIATES ENDOCYTOSIS OF AN INHIBITORY KILLER CELL Ig-LIKE RECEPTOR (KIR) IN HUMAN NK CELLS1

    PubMed Central

    Purdy, Amanda K.; Alvarez-Arias, Diana A.; Oshinsky, Jennifer; James, Ashley M.; Serebriiskii, Ilya; Campbell, Kerry S.

    2014-01-01

    Stable surface expression of human inhibitory killer cell immunoglobulin-like receptors (KIR) is critical for controlling NK cell function and maintaining NK cell tolerance toward normal MHC-I+ cells. Our recent experiments, however, have found that antibody-bound KIR3DL1 (3DL1) readily leaves the cell surface and undergoes endocytosis to early/recycling endosomes and subsequently to late endosomes. We found that 3DL1 internalization is at least partially mediated by an interaction between the μ2 subunit of the AP-2 clathrin adaptor complex and ITIM tyrosine residues in the cytoplasmic domain of 3DL1. Disruption of the 3DL1/μ2 interaction, either by mutation of the ITIM tyrosines in 3DL1 or mutation of μ2, significantly diminished endocytosis and increased surface expression of 3DL1 in human primary NK cells and cell lines. Furthermore, we found that the 3DL1/AP-2 interaction is diminished upon antibody engagement with the receptor, as compared to untreated cells. Thus, we have identified AP-2-mediated endocytosis as a mechanism regulating the surface levels of inhibitory KIR though their ITIM domains. Based upon our results, we propose a model in which non-engaged KIR are internalized by this mechanism, whereas engagement with MHC-I ligand would diminish AP-2 binding, thereby prolonging stable receptor surface expression and promoting inhibitory function. Furthermore, this ITIM-mediated mechanism may similarly regulate the surface expression of other inhibitory immune receptors. PMID:25238755

  16. Unique Directional Motility of Influenza C Virus Controlled by Its Filamentous Morphology and Short-Range Motions.

    PubMed

    Sakai, Tatsuya; Takagi, Hiroaki; Muraki, Yasushi; Saito, Mineki

    2018-01-15

    Influenza virus motility is based on cooperation between two viral spike proteins, hemagglutinin (HA) and neuraminidase (NA), and is a major determinant of virus infectivity. To translocate a virus particle on the cell surface, HA molecules exchange viral receptors and NA molecules accelerate the receptor exchange of HA. This type of virus motility was recently identified in influenza A virus (IAV). To determine if other influenza virus types have a similar receptor exchange mechanism-driven motility, we investigated influenza C virus (ICV) motility on a receptor-fixed glass surface. This system excludes receptor mobility, which makes it more desirable than a cell surface for demonstrating virus motility by receptor exchange. Like IAV, ICV was observed to move across the receptor-fixed surface. However, in contrast to the random movement of IAV, a filamentous ICV strain, Ann Arbor/1/50 (AA), moved in a straight line, in a directed manner, and at a constant rate, whereas a spherical ICV strain, Taylor/1233/47 (Taylor), moved randomly, similar to IAV. The AA and Taylor viruses each moved with a combination of gradual (crawling) and rapid (gliding) motions, but the distances of crawling and gliding for the AA virus were shorter than those of the Taylor virus. Our findings indicate that like IAV, ICV also has a motility that is driven by the receptor exchange mechanism. However, compared with IAV movement, filamentous ICV movement is highly regulated in both direction and speed. Control of ICV movement is based on its specific motility employing short crawling and gliding motions as well as its own filamentous morphology. IMPORTANCE Influenza virus enters into a host cell for infection via cellular endocytosis. Human influenza virus infects epithelial cells of the respiratory tract, the surfaces of which are hidden by abundant cilia that are inactive in endocytosis. An open question is the manner by which the virus migrates to endocytosis-active domains. In analyzing individual virus behaviors through single-virus tracking, we identified a novel function of the hemagglutinin and esterase of influenza C virus (ICV) as the motility machinery. Hemagglutinin iteratively exchanges a viral receptor, causing virus movement. Esterase degrades the receptors along the trajectory traveled by the virus and prevents the virus from moving backward, causing directional movement. We propose that ICV has a unique motile machinery directionally controlled via hemagglutinin sensing the receptor density manipulated by esterase. Copyright © 2018 Sakai et al.

  17. Electron Tomography Imaging of Surface Glycoproteins on Human Parainfluenza Virus 3: Association of Receptor Binding and Fusion Proteins before Receptor Engagement

    PubMed Central

    Gui, Long; Jurgens, Eric M.; Ebner, Jamie L.

    2015-01-01

    ABSTRACT In order to deliver their genetic material to host cells during infection, enveloped viruses use specialized proteins on their surfaces that bind cellular receptors and induce fusion of the viral and host membranes. In paramyxoviruses, a diverse family of single-stranded RNA (ssRNA) viruses, including several important respiratory pathogens, such as parainfluenza viruses, the attachment and fusion machinery is composed of two separate proteins: a receptor binding protein (hemagglutinin-neuraminidase [HN]) and a fusion (F) protein that interact to effect membrane fusion. Here we used negative-stain and cryo-electron tomography to image the 3-dimensional ultrastructure of human parainfluenza virus 3 (HPIV3) virions in the absence of receptor engagement. We observed that HN exists in at least two organizations. The first were arrays of tetrameric HN that lacked closely associated F proteins: in these purely HN arrays, HN adopted a “heads-down” configuration. In addition, we observed regions of complex surface density that contained HN in an apparently extended “heads-up” form, colocalized with prefusion F trimers. This colocalization with prefusion F prior to receptor engagement supports a model for fusion in which HN in its heads-up state and F may interact prior to receptor engagement without activating F, and that interaction with HN in this configuration is not sufficient to activate F. Only upon receptor engagement by HN’s globular head does HN transmit its activating signal to F. PMID:25691596

  18. Surface Expression of NMDA Receptor Changes during Memory Consolidation in the Crab "Neohelice granulata"

    ERIC Educational Resources Information Center

    Hepp, Yanil; Salles, Angeles; Carbo-Tano, Martin; Pedreira, Maria Eugenia; Freudenthal, Ramiro

    2016-01-01

    The aim of the present study was to analyze the surface expression of the NMDA-like receptors during the consolidation of contextual learning in the crab "Neohelice granulata". Memory storage is based on alterations in the strength of synaptic connections between neurons. The glutamatergic synapses undergo various forms of…

  19. Nanomechanical mapping of first binding steps of a virus to animal cells

    NASA Astrophysics Data System (ADS)

    Alsteens, David; Newton, Richard; Schubert, Rajib; Martinez-Martin, David; Delguste, Martin; Roska, Botond; Müller, Daniel J.

    2017-02-01

    Viral infection is initiated when a virus binds to cell surface receptors. Because the cell membrane is dynamic and heterogeneous, imaging living cells and simultaneously quantifying the first viral binding events is difficult. Here, we show an atomic force and confocal microscopy set-up that allows the surface receptor landscape of cells to be imaged and the virus binding events within the first millisecond of contact with the cell to be mapped at high resolution (<50 nm). We present theoretical approaches to contour the free-energy landscape of early binding events between an engineered virus and cell surface receptors. We find that the first bond formed between the viral glycoprotein and its cognate cell surface receptor has relatively low lifetime and free energy, but this increases as additional bonds form rapidly (≤1 ms). The formation of additional bonds occurs with positive allosteric modulation and the three binding sites of the viral glycoprotein are quickly occupied. Our quantitative approach can be readily applied to study the binding of other viruses to animal cells.

  20. Factor VIII Interacts with the Endocytic Receptor Low-density Lipoprotein Receptor-related Protein 1 via an Extended Surface Comprising "Hot-Spot" Lysine Residues.

    PubMed

    van den Biggelaar, Maartje; Madsen, Jesper J; Faber, Johan H; Zuurveld, Marleen G; van der Zwaan, Carmen; Olsen, Ole H; Stennicke, Henning R; Mertens, Koen; Meijer, Alexander B

    2015-07-03

    Lysine residues are implicated in driving the ligand binding to the LDL receptor family. However, it has remained unclear how specificity is regulated. Using coagulation factor VIII as a model ligand, we now study the contribution of individual lysine residues in the interaction with the largest member of the LDL receptor family, low-density lipoprotein receptor-related protein (LRP1). Using hydrogen-deuterium exchange mass spectrometry (HDX-MS) and SPR interaction analysis on a library of lysine replacement variants as two independent approaches, we demonstrate that the interaction between factor VIII (FVIII) and LRP1 occurs over an extended surface containing multiple lysine residues. None of the individual lysine residues account completely for LRP1 binding, suggesting an additive binding model. Together with structural docking studies, our data suggest that FVIII interacts with LRP1 via an extended surface of multiple lysine residues that starts at the bottom of the C1 domain and winds around the FVIII molecule. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Toward the Understanding of MNEI Sweetness from Hydration Map Surfaces

    PubMed Central

    De Simone, Alfonso; Spadaccini, Roberta; Temussi, Piero A.; Fraternali, Franca

    2006-01-01

    The binding mechanism of sweet proteins to their receptor, a G-protein-coupled receptor, is not supported by direct structural information. In principle, the key groups responsible for biological activity (glucophores) can be localized on a small structural unit (sweet finger) or spread on a larger surface area. A recently proposed model, called “wedge model”, implies a large surface of interaction with the receptor. To explore this model in greater detail, it is necessary to examine the physicochemical features of the surfaces of sweet proteins, since their interaction with the receptor, with respect to that of small sweeteners, is more dependent on general physicochemical properties of the interface, such as electrostatic potential and hydration. In this study, we performed exhaustive molecular dynamics simulations in explicit water of the sweet protein MNEI and of its structural mutant G-16A, whose sweetness is one order of magnitude lower than that of MNEI. Solvent density and self-diffusion calculated from molecular dynamics simulations suggest a likely area of interaction delimited by four stretches arranged as a tetrahedron whose shape is complementary to that of a cavity on the surface of the receptor, in agreement with the wedge model. The suggested area of interaction is amazingly consistent with known mutagenesis data. In addition, the asymmetric hydration of the only helix in both proteins hints at a specific role for this secondary structure element in orienting the protein during the binding process. PMID:16461400

  2. Comprehensive Reactive Receiver Modeling for Diffusive Molecular Communication Systems: Reversible Binding, Molecule Degradation, and Finite Number of Receptors.

    PubMed

    Ahmadzadeh, Arman; Arjmandi, Hamidreza; Burkovski, Andreas; Schober, Robert

    2016-10-01

    This paper studies the problem of receiver modeling in molecular communication systems. We consider the diffusive molecular communication channel between a transmitter nano-machine and a receiver nano-machine in a fluid environment. The information molecules released by the transmitter nano-machine into the environment can degrade in the channel via a first-order degradation reaction and those that reach the receiver nano-machine can participate in a reversible bimolecular reaction with receiver receptor proteins. Thereby, we distinguish between two scenarios. In the first scenario, we assume that the entire surface of the receiver is covered by receptor molecules. We derive a closed-form analytical expression for the expected received signal at the receiver, i.e., the expected number of activated receptors on the surface of the receiver. Then, in the second scenario, we consider the case where the number of receptor molecules is finite and the uniformly distributed receptor molecules cover the receiver surface only partially. We show that the expected received signal for this scenario can be accurately approximated by the expected received signal for the first scenario after appropriately modifying the forward reaction rate constant. The accuracy of the derived analytical results is verified by Brownian motion particle-based simulations of the considered environment, where we also show the impact of the effect of receptor occupancy on the derived analytical results.

  3. Enterovirus 71 Uses Cell Surface Heparan Sulfate Glycosaminoglycan as an Attachment Receptor

    PubMed Central

    Tan, Chee Wah; Poh, Chit Laa; Sam, I-Ching

    2013-01-01

    Enterovirus 71 (EV-71) infections are usually associated with mild hand, foot, and mouth disease in young children but have been reported to cause severe neurological complications with high mortality rates. To date, four EV-71 receptors have been identified, but inhibition of these receptors by antagonists did not completely abolish EV-71 infection, implying that there is an as yet undiscovered receptor(s). Since EV-71 has a wide range of tissue tropisms, we hypothesize that EV-71 infections may be facilitated by using receptors that are widely expressed in all cell types, such as heparan sulfate. In this study, heparin, polysulfated dextran sulfate, and suramin were found to significantly prevent EV-71 infection. Heparin inhibited infection by all the EV-71 strains tested, including those with a single-passage history. Neutralization of the cell surface anionic charge by polycationic poly-d-lysine and blockage of heparan sulfate by an anti-heparan sulfate peptide also inhibited EV-71 infection. Interference with heparan sulfate biosynthesis either by sodium chlorate treatment or through transient knockdown of N-deacetylase/N-sulfotransferase-1 and exostosin-1 expression reduced EV-71 infection in RD cells. Enzymatic removal of cell surface heparan sulfate by heparinase I/II/III inhibited EV-71 infection. Furthermore, the level of EV-71 attachment to CHO cell lines that are variably deficient in cell surface glycosaminoglycans was significantly lower than that to wild-type CHO cells. Direct binding of EV-71 particles to heparin-Sepharose columns under physiological salt conditions was demonstrated. We conclude that EV-71 infection requires initial binding to heparan sulfate as an attachment receptor. PMID:23097443

  4. Topological dispositions of lysine. alpha. 380 and lysine. gamma. 486 in the acetylcholine receptor from Torpedo californica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dwyer, B.P.

    1991-04-23

    The locations have been determined, with respect to the plasma membrane, of lysine {alpha}380 and lysine {gamma}486 in the {alpha} subunit and the {gamma} subunit, respectively, of the nicotinic acetylcholine receptor from Torpedo californica. Immunoadsorbents were constructed that recognize the carboxy terminus of the peptide GVKYIAE released by proteolytic digestion from positions 378-384 in the amino acid sequence of the {alpha} subunit of the acetylcholine receptor and the carboxy terminus of the peptide KYVP released by proteolytic digestion from positions 486-489 in the amino acid sequence of the {gamma} subunit. They were used to isolate these peptides from proteolytic digestsmore » of polypeptides from the acetylcholine receptor. Sealed vesicles containing the native acetylcholine receptor were labeled with pyridoxal phosphate and sodium ({sup 3}H)-borohydride. The effect of saponin on the incorporation of pyridoxamine phosphate into lysine {alpha}380 and lysine {gamma}486 from the acetylcholine receptor in these vesicles was assessed with the immunoadsorbents. The conclusions that follow from these results are that lysine {alpha}380 is on the inside surface of a vesicle and lysine {gamma}486 is on the outside surface. Because a majority (85%) of the total binding sites for {alpha}-bungarotoxin bind the toxin in the absence of saponin, the majority of the vesicles are right side out with the inside of the vesicle corresponding to the cytoplasmic surface and the outside of the vesicle corresponding to the extracytoplasmic, synaptic surface. Because lysine {alpha}380 and lysine {gamma}486 lie on opposite sides of the membrane, a membrane-spanning segment must be located between the two positions occupied by these two amino acids in the common sequence of a polypeptide of the acetylcholine receptor.« less

  5. Proteomic Plasma Membrane Profiling Reveals an Essential Role for gp96 in the Cell Surface Expression of LDLR Family Members, Including the LDL Receptor and LRP6

    PubMed Central

    2012-01-01

    The endoplasmic reticulum chaperone gp96 is required for the cell surface expression of a narrow range of proteins, including toll-like receptors (TLRs) and integrins. To identify a more comprehensive repertoire of proteins whose cell surface expression is dependent on gp96, we developed plasma membrane profiling (PMP), a technique that combines SILAC labeling with selective cell surface aminooxy-biotinylation. This approach allowed us to compare the relative abundance of plasma membrane (PM) proteins on gp96-deficient versus gp96-reconstituted murine pre-B cells. Analysis of unfractionated tryptic peptides initially identified 113 PM proteins, which extended to 706 PM proteins using peptide prefractionation. We confirmed a requirement for gp96 in the cell surface expression of certain TLRs and integrins and found a marked decrease in cell surface expression of four members of the extended LDL receptor family (LDLR, LRP6, Sorl1 and LRP8) in the absence of gp96. Other novel gp96 client proteins included CD180/Ly86, important in the B-cell response to lipopolysaccharide. We highlight common structural motifs in these client proteins that may be recognized by gp96, including the beta-propeller and leucine-rich repeat. This study therefore identifies the extended LDL receptor family as an important new family of proteins whose cell surface expression is regulated by gp96. PMID:22292497

  6. Proteomic plasma membrane profiling reveals an essential role for gp96 in the cell surface expression of LDLR family members, including the LDL receptor and LRP6.

    PubMed

    Weekes, Michael P; Antrobus, Robin; Talbot, Suzanne; Hör, Simon; Simecek, Nikol; Smith, Duncan L; Bloor, Stuart; Randow, Felix; Lehner, Paul J

    2012-03-02

    The endoplasmic reticulum chaperone gp96 is required for the cell surface expression of a narrow range of proteins, including toll-like receptors (TLRs) and integrins. To identify a more comprehensive repertoire of proteins whose cell surface expression is dependent on gp96, we developed plasma membrane profiling (PMP), a technique that combines SILAC labeling with selective cell surface aminooxy-biotinylation. This approach allowed us to compare the relative abundance of plasma membrane (PM) proteins on gp96-deficient versus gp96-reconstituted murine pre-B cells. Analysis of unfractionated tryptic peptides initially identified 113 PM proteins, which extended to 706 PM proteins using peptide prefractionation. We confirmed a requirement for gp96 in the cell surface expression of certain TLRs and integrins and found a marked decrease in cell surface expression of four members of the extended LDL receptor family (LDLR, LRP6, Sorl1 and LRP8) in the absence of gp96. Other novel gp96 client proteins included CD180/Ly86, important in the B-cell response to lipopolysaccharide. We highlight common structural motifs in these client proteins that may be recognized by gp96, including the beta-propeller and leucine-rich repeat. This study therefore identifies the extended LDL receptor family as an important new family of proteins whose cell surface expression is regulated by gp96.

  7. Single-Molecule Light-Sheet Imaging of Suspended T Cells.

    PubMed

    Ponjavic, Aleks; McColl, James; Carr, Alexander R; Santos, Ana Mafalda; Kulenkampff, Klara; Lippert, Anna; Davis, Simon J; Klenerman, David; Lee, Steven F

    2018-05-08

    Adaptive immune responses are initiated by triggering of the T cell receptor. Single-molecule imaging based on total internal reflection fluorescence microscopy at coverslip/basal cell interfaces is commonly used to study this process. These experiments have suggested, unexpectedly, that the diffusional behavior and organization of signaling proteins and receptors may be constrained before activation. However, it is unclear to what extent the molecular behavior and cell state is affected by the imaging conditions, i.e., by the presence of a supporting surface. In this study, we implemented single-molecule light-sheet microscopy, which enables single receptors to be directly visualized at any plane in a cell to study protein dynamics and organization in live, resting T cells. The light sheet enabled the acquisition of high-quality single-molecule fluorescence images that were comparable to those of total internal reflection fluorescence microscopy. By comparing the apical and basal surfaces of surface-contacting T cells using single-molecule light-sheet microscopy, we found that most coated-glass surfaces and supported lipid bilayers profoundly affected the diffusion of membrane proteins (T cell receptor and CD45) and that all the surfaces induced calcium influx to various degrees. Our results suggest that, when studying resting T cells, surfaces are best avoided, which we achieve here by suspending cells in agarose. Copyright © 2018. Published by Elsevier Inc.

  8. Expression and nutritional regulation of the (pro)renin receptor in rat visceral adipose tissue.

    PubMed

    Achard, V; Tassistro, V; Boullu-Ciocca, S; Grino, M

    2011-12-01

    Early life nutritional environment plays an important role in the development of visceral adipose tissue and interacts with nutritional regulations in adulthood, leading to metabolic dysregulations. We hypothesized that the renin-angiotensin system may play a role in the programming-induced development of visceral adipose tissue. We studied, using a model of programming of overweight and glucose intolerance, obtained by post-natal overfeeding with consecutive highfat diet, the status of plasma renin activity and mesenteric adipose renin-angiotensin system, including the recently identified (pro)renin receptor, in adult rats. Post-natal overfeeding or high-fat feeding lead to overweight with increased visceral fat mass and adipocytes surface. When both paradigms were associated, adipocytes surface showed a disproportionate increase. A strong immunoreactivity for (pro)renin receptor was found in stromal cells. Plasma renin activity increased in programmed animals whereas (pro)renin receptor expressing cells density was stimulated by high-fat diet. There was a positive, linear relationship between plasma renin activity and (pro)renin receptor expressing cells density and adipocytes surface. Our experiments demonstrate that association of post-natal overfeeding and high-fat diet increased plasma renin activity and adipose (pro)renin receptor expression. Such phenomenon could explain, at least in part, the associated disproportionate adipocyte hypertrophy and its accompanying increased glucose intolerance.

  9. Intracellular GPCRs Play Key Roles in Synaptic Plasticity.

    PubMed

    Jong, Yuh-Jiin I; Harmon, Steven K; O'Malley, Karen L

    2018-02-16

    The trillions of synaptic connections within the human brain are shaped by experience and neuronal activity, both of which underlie synaptic plasticity and ultimately learning and memory. G protein-coupled receptors (GPCRs) play key roles in synaptic plasticity by strengthening or weakening synapses and/or shaping dendritic spines. While most studies of synaptic plasticity have focused on cell surface receptors and their downstream signaling partners, emerging data point to a critical new role for the very same receptors to signal from inside the cell. Intracellular receptors have been localized to the nucleus, endoplasmic reticulum, lysosome, and mitochondria. From these intracellular positions, such receptors may couple to different signaling systems, display unique desensitization patterns, and/or show distinct patterns of subcellular distribution. Intracellular GPCRs can be activated at the cell surface, endocytosed, and transported to an intracellular site or simply activated in situ by de novo ligand synthesis, diffusion of permeable ligands, or active transport of non-permeable ligands. Current findings reinforce the notion that intracellular GPCRs play a dynamic role in synaptic plasticity and learning and memory. As new intracellular GPCR roles are defined, the need to selectively tailor agonists and/or antagonists to both intracellular and cell surface receptors may lead to the development of more effective therapeutic tools.

  10. Inhibition Of Call-Cell Binding By Kipid Assemblies

    DOEpatents

    Nagy, Jon O. , Bargatze, Robert F.

    2003-12-16

    This invention relates generally to the field of therapeutic compounds designed to interfere between the binding of ligands and their receptors on cell surface. More specifically, it provides products and methods for inhibiting cell migration and activation using lipid assemblies with surface recognition elements that are specific for the receptors involved in cell migration and activation.

  11. Inhibition of cell-cell binding by lipid assemblies

    DOEpatents

    Nagy, Jon O.; Bargatze, Robert F.

    2001-05-22

    This invention relates generally to the field of therapeutic compounds designed to interfere between the binding of ligands and their receptors on cell surface. More specifically, it provides products and methods for inhibiting cell migration and activation using lipid assemblies with surface recognition elements that are specific for the receptors involved in cell migration and activation.

  12. Surface modification of ZnO nanorods with Hamilton receptors.

    PubMed

    Zeininger, Lukas; Klaumünzer, Martin; Peukert, Wolfgang; Hirsch, Andreas

    2015-04-13

    A new prototype of a Hamilton receptor suitable for the functionalization of inorganic nanoparticles was synthesized and characterized. The hydrogen bonding receptor was coupled to a catechol moiety, which served as anchor group for the functionalization of metal oxides, in particular zinc oxide. Synthesized zinc oxide nanorods [ZnO] were used for surface functionalization. The wet-chemical functionalization procedure towards monolayer-grafted particles [ZnO-HR] is described and a detailed characterization study is presented. In addition, the detection of specific cyanurate molecules is demonstrated. The hybrid structures [ZnO-HR-CA] were stable towards agglomeration and exhibited enhanced dispersability in apolar solvents. This observation, in combination with several spectroscopic experiments gave evidence of the highly directional supramolecular recognition at the surface of nanoparticles.

  13. Hippocampal LTP and contextual learning require surface diffusion of AMPA receptors.

    PubMed

    Penn, A C; Zhang, C L; Georges, F; Royer, L; Breillat, C; Hosy, E; Petersen, J D; Humeau, Y; Choquet, D

    2017-09-21

    Long-term potentiation (LTP) of excitatory synaptic transmission has long been considered a cellular correlate for learning and memory. Early LTP (less than 1 h) had initially been explained either by presynaptic increases in glutamate release or by direct modification of postsynaptic AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptor function. Compelling models have more recently proposed that synaptic potentiation can occur by the recruitment of additional postsynaptic AMPA receptors (AMPARs), sourced either from an intracellular reserve pool by exocytosis or from nearby extra-synaptic receptors pre-existing on the neuronal surface. However, the exact mechanism through which synapses can rapidly recruit new AMPARs during early LTP remains unknown. In particular, direct evidence for a pivotal role of AMPAR surface diffusion as a trafficking mechanism in synaptic plasticity is still lacking. Here, using AMPAR immobilization approaches, we show that interfering with AMPAR surface diffusion markedly impairs synaptic potentiation of Schaffer collaterals and commissural inputs to the CA1 area of the mouse hippocampus in cultured slices, acute slices and in vivo. Our data also identify distinct contributions of various AMPAR trafficking routes to the temporal profile of synaptic potentiation. In addition, AMPAR immobilization in vivo in the dorsal hippocampus inhibited fear conditioning, indicating that AMPAR diffusion is important for the early phase of contextual learning. Therefore, our results provide a direct demonstration that the recruitment of new receptors to synapses by surface diffusion is a critical mechanism for the expression of LTP and hippocampal learning. Since AMPAR surface diffusion is dictated by weak Brownian forces that are readily perturbed by protein-protein interactions, we anticipate that this fundamental trafficking mechanism will be a key target for modulating synaptic potentiation and learning.

  14. BINDING OF SOLUBLE IMMUNE COMPLEXES TO HUMAN LYMPHOBLASTOID CELLS

    PubMed Central

    Theofilopoulos, Argyrios N.; Dixon, Frank J.; Bokisch, Viktor A.

    1974-01-01

    In the present work we studied the expression of membrane-bound Ig (MBIg) as well as receptors for IgG Fc and complement on nine human lymphoblastoid cell lines. When MBIg and receptors for IgG Fc were compared, four categories of cell lines could be distinguished: (a) cell lines having both MBIg and receptors for IgG Fc, (b) cell lines having MBIg but lacking receptors for IgG Fc, (c) cell lines lacking MBIg but having receptors for IgG Fc, and (d) cell lines lacking both MBIg and receptors for IgG Fc. Two types of receptors for complement could be detected on the cell lines studied, one for C3-C3b and one for C3d. When sensitized red cells carrying C3b or C3d were used for rosette tests, three categories of cell lines could be distinguished: (a) cell lines having receptors for C3b and C3d, (b) cell lines having receptors only for C3d and (c) cell lines lacking both receptors. However, when a more sensitive immunofluorescent method was used instead of the rosette technique, it was found that cell lines unable to form rosettes with EAC1423bhu were able to bind soluble C3 or C3b which indicated the presence of these receptors on the cell surface. Inhibition experiments showed that receptors for C3-C3b and receptors for C3d are distinct and that receptors for C3-C3b and C3d are different from receptors for IgG Fc. A cell line (Raji) without MBIg but with receptors for IgG Fc, C3-C3b, and C3d was selected for use in studying the binding mechanism of soluble immune complexes to cell surface membrane. Aggregated human gamma globulin was used in place of immune complexes. Immune complexes containing complement bind to Raji cells only via receptors for complement, namely receptors for C3-C3b and C3d. Binding of immune complexes containing complement to cells is much greater than that of complexes without complement. Immune complexes bound to cells via receptors for complement can be partially released from the cell surface by addition of normal human serum as well as isolated human C3 or C3b. We postulate that such release is due to competition of immune complex bound C3b and free C3 or C3b for the receptors on Raji cells. PMID:4139225

  15. Enhancement of the p27Kip1-mediated antiproliferative effect of trastuzumab (Herceptin) on HER2-overexpressing tumor cells.

    PubMed

    Marches, Radu; Uhr, Jonathan W

    2004-11-10

    The oncogenic activity of the overexpressed HER2 tyrosine kinase receptor requires its localization in the plasma membrane. The antitumor effect of anti-HER2 antibodies (Abs) is mainly dependent on receptor downregulation and comprises p27Kip1-mediated G1 cell cycle arrest. However, one major limitation of anti-HER2 therapy is the reversibility of tumor growth inhibition after discontinuation of treatment caused by the mitogenic signaling associated with cell surface receptor re-expression. We found that the level of p27Kip1 upregulation, inhibition of Cdk2 activity and magnitude of G1 arrest induced by the humanized Ab trastuzumab (Herceptin, HCT) on BT474 and SKBr3 HER2-overexpressing breast cancer cells correlates with the level of cell surface receptor. Thus, continuous exposure of cells to HCT for 72 hr results in downregulation of the cell surface receptor and a concurrent increase in the level of p27Kip1 protein. Discontinuation of Ab exposure after the first 8 hr results in failure to upregulate p27Kip1 and arrest of cell cycle progression. We show that the lysosomotropic amine chloroquine (CQ) augments receptor internalization in HER2-overexpressing cells either pretreated or continuously treated with HCT and leads to an increased and sustained inhibitory effect. The enhanced CQ-dependent loss of functional HER2 from the cell surface resulted in sustained inactivation of the serine/threonine kinase Akt, upregulation of p27Kip1 protein and inhibition of cyclin E/Cdk2 activity. Potentiation of the inhibitory effect of HCT by CQ was directly related to loss of HER2 from the plasma membrane since prevention of Ab-mediated receptor endocytosis by engagement of the receptor with immobilized HCT abrogated the effect of CQ.

  16. Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

    PubMed

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

    2012-12-04

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

  17. Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

    PubMed Central

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

    2014-01-01

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

  18. Metabotropic glutamate receptor 5 upregulates surface NMDA receptor expression in striatal neurons via CaMKII.

    PubMed

    Jin, Dao-Zhong; Xue, Bing; Mao, Li-Min; Wang, John Q

    2015-10-22

    Metabotropic and ionotropic glutamate receptors are closely clustered in postsynaptic membranes and are believed to interact actively with each other to control excitatory synaptic transmission. Metabotropic glutamate receptor 5 (mGluR5), for example, has been well documented to potentiate ionotropic NMDA receptor activity, although underlying mechanisms are poorly understood. In this study, we investigated the role of mGluR5 in regulating trafficking and subcellular distribution of NMDA receptors in adult rat striatal neurons. We found that the mGluR1/5 agonist DHPG concentration-dependently increased NMDA receptor GluN1 and GluN2B subunit expression in the surface membrane. Meanwhile, DHPG reduced GluN1 and GluN2B levels in the intracellular compartment. The effect of DHPG was blocked by an mGluR5 selective antagonist MTEP but not by an mGluR1 selective antagonist 3-MATIDA. Pretreatment with an inhibitor or a specific inhibitory peptide for synapse-enriched Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) also blocked the DHPG-stimulated redistribution of GluN1 and GluN2B. In addition, DHPG enhanced CaMKIIα activity and elevated GluN2B phosphorylation at a CaMKII-sensitive site (serine 1303). These results demonstrate that mGluR5 regulates trafficking of NMDA receptors in striatal neurons. Activation of mGluR5 appears to induce rapid trafficking of GluN1 and GluN2B to surface membranes through a signaling pathway involving CaMKII. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Quantification of cell surface receptor expression in live tissue culture media using a dual-tracer stain and rinse approach

    NASA Astrophysics Data System (ADS)

    Xu, Xiaochun; Sinha, Lagnojita; Singh, Aparna; Yang, Cynthia; Xiang, Jialing; Tichauer, Kenneth M.

    2015-03-01

    Immunofluorescence staining is a robust way to visualize the distribution of targeted biomolecules invasively in in fixed tissues and tissue culture. Despite the fact that these methods has been a well-established method in fixed tissue imaging for over 70 years, quantification of receptor concentration still simply assumes that the signal from the targeted fluorescent marker after incubation and sufficient rinsing is directly proportional to the concentration of targeted biomolecules, thus neglecting the experimental inconsistencies in incubation and rinsing procedures and assuming no, nonspecific binding of the fluorescent markers. This work presents the first imaging approach capable of quantifying the concentration of cell surface receptor on cancer cells grown in vitro based on compartment modeling in a nondestructive way. The approach utilizes a dual-tracer protocol where any non-specific retention or variability in incubation and rinsing of a receptor-targeted imaging agent is corrected by simultaneously imaging the retention of a chemically similar, "untargeted" imaging agent. Various different compartment models were used to analyze the data in order to find the optimal procedure for extracting estimates of epidermal growth factor receptor (EGFR) concentration (a receptor overexpressed in many cancers and a key target for emerging molecular therapies) in tissue cultures with varying concentrations of human glioma cells (U251). Preliminary results demonstrated a need to model nonspecific binding of both the targeted and untargeted imaging agents used. The approach could be used to carry out the first repeated measures of cell surface receptor dynamics during 3D tumor mass development, in addition to the receptor response to therapies.

  20. A bacterial tyrosine phosphatase inhibits plant pattern recognition receptor activation

    USDA-ARS?s Scientific Manuscript database

    Perception of pathogen-associated molecular patterns (PAMPs) by surface-localised pattern-recognition receptors (PRRs) is a key component of plant innate immunity. Most known plant PRRs are receptor kinases and initiation of PAMP-triggered immunity (PTI) signalling requires phosphorylation of the PR...

  1. Ultrastructure studies on the papillae and the nonciliated sensory receptors of adult Spirometra erinacei (Cestoda, Pseudophyllidea).

    PubMed

    Okino, T; Hatsushika, R

    1994-01-01

    The small numerous papillae on the ventral surface of the gravid proglottid of adult Spirometra erinacei were studied by scanning electron microscopy. The arrangement of clumps of papillae was recognized on the surface of the central portion around the genital atrium, with lateral clumps being located above a pair of longitudinal nerve cords and marginal ones, on both sides of the proglottid. By transmission electron microscopy, two types of nonciliated sensory receptors were observed within the papillae. The type I, single receptor was embedded within a papilla. This dome-like sensory receptor contained two electron-dense collars and four rootlets surrounded by numerous thin filaments. The type II receptor was found arranged in groups in the area between the papillae, and the apical end was exposed to the external environment. This simple, club-like sensory receptor contained electron-lucent vesicles and microtubules. We believe that the papillae play an important role in cross-insemination.

  2. Receptor-mediated cell mechanosensing

    PubMed Central

    Chen, Yunfeng; Ju, Lining; Rushdi, Muaz; Ge, Chenghao; Zhu, Cheng

    2017-01-01

    Mechanosensing describes the ability of a cell to sense mechanical cues of its microenvironment, including not only all components of force, stress, and strain but also substrate rigidity, topology, and adhesiveness. This ability is crucial for the cell to respond to the surrounding mechanical cues and adapt to the changing environment. Examples of responses and adaptation include (de)activation, proliferation/apoptosis, and (de)differentiation. Receptor-mediated cell mechanosensing is a multistep process that is initiated by binding of cell surface receptors to their ligands on the extracellular matrix or the surface of adjacent cells. Mechanical cues are presented by the ligand and received by the receptor at the binding interface; but their transmission over space and time and their conversion into biochemical signals may involve other domains and additional molecules. In this review, a four-step model is described for the receptor-mediated cell mechanosensing process. Platelet glycoprotein Ib, T-cell receptor, and integrins are used as examples to illustrate the key concepts and players in this process. PMID:28954860

  3. Acute inactivation of PSD-95 destabilizes AMPA receptors at hippocampal synapses.

    PubMed

    Yudowski, Guillermo A; Olsen, Olav; Adesnik, Hillel; Marek, Kurt W; Bredt, David S

    2013-01-01

    Postsynatptic density protein (PSD-95) is a 95 kDa scaffolding protein that assembles signaling complexes at synapses. Over-expression of PSD-95 in primary hippocampal neurons selectively increases synaptic localization of AMPA receptors; however, mice lacking PSD-95 display grossly normal glutamatergic transmission in hippocampus. To further study the scaffolding role of PSD-95 at excitatory synapses, we generated a recombinant PSD-95-4c containing a tetracysteine motif, which specifically binds a fluorescein derivative and allows for acute and permanent inactivation of PSD-95. Interestingly, acute inactivation of PSD-95 in rat hippocampal cultures rapidly reduced surface AMPA receptor immunostaining, but did not affected NMDA or transferrin receptor localization. Acute photoinactivation of PSD-95 in dissociated neurons causes ∼80% decrease in GluR2 surface staining observed by live-cell microscopy within 15 minutes of PSD-95-4c ablation. These results confirm that PSD-95 stabilizes AMPA receptors at postsynaptic sites and provides insight into the dynamic interplay between PSD-95 and AMPA receptors in live neurons.

  4. Emerging intracellular receptors for hemorrhagic fever viruses.

    PubMed

    Jae, Lucas T; Brummelkamp, Thijn R

    2015-07-01

    Ebola virus and Lassa virus belong to different virus families that can cause viral hemorrhagic fever, a life-threatening disease in humans with limited treatment options. To infect a target cell, Ebola and Lassa viruses engage receptors at the cell surface and are subsequently shuttled into the endosomal compartment. Upon arrival in late endosomes/lysosomes, the viruses trigger membrane fusion to release their genome into the cytoplasm. Although contact sites at the cell surface were recognized for Ebola virus and Lassa virus, it was postulated that Ebola virus requires a critical receptor inside the cell. Recent screens for host factors identified such internal receptors for both viruses: Niemann-Pick disease type C1 protein (NPC1) for Ebola virus and lysosome-associated membrane protein 1 (LAMP1) for Lassa virus. A cellular trigger is needed to permit binding of the viral envelope protein to these intracellular receptors. This 'receptor switch' represents a previously unnoticed step in virus entry with implications for host-pathogen interactions and viral tropism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long-term depression

    NASA Astrophysics Data System (ADS)

    Matsuda, Shinji; Kakegawa, Wataru; Budisantoso, Timotheus; Nomura, Toshihiro; Kohda, Kazuhisa; Yuzaki, Michisuke

    2013-11-01

    Long-term depression (LTD) underlies learning and memory in various brain regions. Although postsynaptic AMPA receptor trafficking mediates LTD, its underlying molecular mechanisms remain largely unclear. Here we show that stargazin, a transmembrane AMPA receptor regulatory protein, forms a ternary complex with adaptor proteins AP-2 and AP-3A in hippocampal neurons, depending on its phosphorylation state. Inhibiting the stargazin-AP-2 interaction disrupts NMDA-induced AMPA receptor endocytosis, and inhibiting that of stargazin-AP-3A abrogates the late endosomal/lysosomal trafficking of AMPA receptors, thereby upregulating receptor recycling to the cell surface. Similarly, stargazin’s interaction with AP-2 or AP-3A is necessary for low-frequency stimulus-evoked LTD in CA1 hippocampal neurons. Thus, stargazin has a crucial role in NMDA-dependent LTD by regulating two trafficking pathways of AMPA receptors—transport from the cell surface to early endosomes and from early endosomes to late endosomes/lysosomes—through its sequential binding to AP-2 and AP-3A.

  6. In Vitro and In Vivo Measurement of Percutaneous Penetration of Low Molecular Weight Toxins of Military Interest

    DTIC Science & Technology

    1989-12-15

    epidermal surfaces were exposed to ambient air (220C) during the entire length of the experiment. Penetration of [3H]PbTx-3 into skin layers and receptor...bathed by the receptor fluid and the epidermal surface was exposed to ambient conditions in an en- vironmental chamber. Temperature and relative...DMSO or water. The epidermal surfaces were exposed to ambient conditions in the environmental chamber. In order to determine if constituents leaching

  7. An Arg for Gly substitution at position 31 in the insulin receptor, linked to insulin resistance, inhibits receptor processing and transport.

    PubMed

    van der Vorm, E R; van der Zon, G C; Möller, W; Krans, H M; Lindhout, D; Maassen, J A

    1992-01-05

    In a patient with Leprechaunism, we have characterized a new mutation in the insulin receptor substituting Arg for Gly at position 31. The proband, the mother, and the maternal grandfather were heterozygous for the mutation. Fibroblasts of the proband show a strongly reduced number of high affinity insulin receptors on the cell surface, whereas fibroblasts of the healthy mother and grandfather show moderately reduced insulin receptor numbers. In the other family members neither the binding defect nor the Arg31 mutation was found. The Arg31-mutant receptor was overexpressed in Chinese hamster ovary cells. In these cells the mutant alpha beta-proreceptor was not proteolytically cleaved and no transport to the cell surface took place. The proreceptor was unable to bind insulin and to undergo autophosphorylation. In addition, the proreceptor was not recognized by monoclonal antibodies directed against conformation-dependent epitopes. These findings suggest that the Gly31 to Arg31 mutant is involved in the insulin receptor dysfunction seen in the Leprechaun patient. The mutation seems to alter the conformation of the receptor in such way that the transport of the proreceptor to the Golgi compartment, where proteolytical processing occurs, is inhibited.

  8. Functional characterization of c-Mpl ectodomain mutations that underlie congenital amegakaryocytic thrombocytopenia.

    PubMed

    Varghese, Leila N; Zhang, Jian-Guo; Young, Samuel N; Willson, Tracy A; Alexander, Warren S; Nicola, Nicos A; Babon, Jeffrey J; Murphy, James M

    2014-02-01

    Activation of the cell surface receptor, c-Mpl, by the cytokine, thrombopoietin (TPO), underpins megakaryocyte and platelet production in mammals. In humans, mutations in c-Mpl have been identified as the molecular basis of Congenital Amegakaryocytic Thrombocytopenia (CAMT). Here, we show that CAMT-associated mutations in c-Mpl principally lead to defective receptor presentation on the cell surface. In contrast, one CAMT mutant c-Mpl, F104S, was expressed on the cell surface, but showed defective TPO binding and receptor activation. Using mutational analyses, we examined which residues adjacent to F104 within the membrane-distal cytokine receptor homology module (CRM) of c-Mpl comprise the TPO-binding epitope, revealing residues within the predicted Domain 1 E-F and A-B loops and Domain 2 F'-G' loop as key TPO-binding determinants. These studies underscore the importance of the c-Mpl membrane-distal CRM to TPO-binding and suggest that mutations within this CRM that perturb TPO binding could give rise to CAMT.

  9. CD4-CCR5 interaction in intracellular compartments contributes to receptor expression at the cell surface

    PubMed Central

    Achour, Lamia; Scott, Mark G.H.; Shirvani, Hamasseh; Thuret, Alain; Bismuth, Georges; Labbé-Jullié, Catherine; Marullo, Stefano

    2009-01-01

    The association of CD4, a glycoprotein involved in T cell development and antigen recognition, and CCR5, a chemotactic G protein-coupled receptor, which regulates trafficking and effector functions of immune cells, forms the main receptor for the human immunodeficiency virus HIV. We observed that the vast majority of CCR5 is maintained within the intracellular compartments of primary T lymphocytes and in a monocytic cell line, contrasting with its relative low density at the cell surface. The CCR5-CD4 association, which occurs in the endoplasmic reticulum, enhanced CCR5 export to the plasma membrane in a concentration–dependent manner, whereas inhibition of endogenous CD4 with small interfering RNAs decreased cell surface expression of endogenous CCR5. This effect was specific for CCR5, as CD4 did not affect cell distribution of CXCR4, the other HIV co-receptor. These results reveal a previously unappreciated role of CD4, which contributes to regulate CCR5 export to the plasma membrane. PMID:19064722

  10. Short-term sleep deprivation impairs spatial working memory and modulates expression levels of ionotropic glutamate receptor subunits in hippocampus.

    PubMed

    Xie, Meilan; Yan, Jie; He, Chao; Yang, Li; Tan, Gang; Li, Chao; Hu, Zhian; Wang, Jiali

    2015-06-01

    Hippocampus-dependent learning memory is sensitive to sleep deprivation (SD). Although the ionotropic glutamate receptors play a vital role in synaptic plasticity and learning and memory, however, whether the expression of these receptor subunits is modulated by sleep loss remains unclear. In the present study, western blotting was performed by probing with specific antibodies against the ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunits GluA1, GluA2, GluA3, and against the N-methyl-d-aspartate (NMDA) glutamate receptor subunits GluN1, GluN2A, GluN2B. In hippocampus, down regulation of surface GluA1 and GluN2A surface expression were observed in both SD groups. However, surface expression level of GluA2, GluA3, GluN1 and GluN2B was significantly up-regulated in 8h-SD rats when compared to the 4h-SD rats. In parallel with the complex changes in AMPA and NMDA receptor subunit expressions, we found the 8h-SD impaired rat spatial working memory in 30-s-delay T-maze task, whereas no impairment of spatial learning was observed in 4h-SD rats. These results indicate that sleep loss alters the relative expression levels of the AMPA and NMDA receptors, thus affects the synaptic strength and capacity for plasticity and partially contributes to spatial memory impairment. Copyright © 2015. Published by Elsevier B.V.

  11. Synthetic estrogen derivatives demonstrate the functionality of intracellular GPR30.

    PubMed

    Revankar, Chetana M; Mitchell, Hugh D; Field, Angela S; Burai, Ritwik; Corona, Cesear; Ramesh, Chinnasamy; Sklar, Larry A; Arterburn, Jeffrey B; Prossnitz, Eric R

    2007-08-17

    Estrogen mediates its effects through multiple cellular receptors. In addition to the classical nuclear estrogen receptors (ERalpha and ERbeta), estrogen also signals through the seven-transmembrane G-protein-coupled receptor (GPCR) GPR30. Although estrogen is a cell-permeable ligand, it is often assumed that all GPCRs function solely as cell surface receptors. Our previous results showed that GPR30 appeared to be expressed predominantly in the endoplasmic reticulum. A critical question that arises is whether this localization represents the site of functional receptor. To address this question, we synthesized a collection of cell-permeable and cell-impermeable estrogen derivatives. We hypothesized that if functional GPR30 were expressed at the cell surface, both permeable and impermeable derivatives would show activity. However, if functional GPR30 were predominantly intracellular, like ERalpha, only the permeable ligands should show activity. Cell permeability was assessed using cells expressing ERalpha as a model intracellular estrogen-binding receptor. Our results reveal that despite exhibiting similar binding affinities for GPR30, only the cell-permeable ligands are capable of stimulating rapid calcium mobilization and phosphoinositide 3-kinase (PI3K) activation. We conclude that GPR30 expressed intracellularly is capable of initiating cellular signaling and that there is insufficient GPR30 expressed on the cell surface to initiate signaling in response to impermeable ligands in the cell lines examined. To our knowledge, this is the first definitive demonstration of a functional intracellular transmembrane estrogen receptor.

  12. Quantitative Characterization of Shear-Induced Platelet Receptor Shedding: Glycoprotein Ibα, Glycoprotein VI, and Glycoprotein IIb/IIIa.

    PubMed

    Chen, Zengsheng; Koenig, Steven C; Slaughter, Mark S; Griffith, Bartley P; Wu, Zhongjun J

    2017-11-07

    The structural integrity of platelet receptors is essential for platelets to play the normal hemostatic function. The high non-physiologic shear stress (NPSS) commonly exists in blood-contacting medical devices and has been shown to cause platelet receptor shedding. The loss of platelet receptors may impair the normal hemostatic function of platelets. The aim of this study was to quantify NPSS-induced shedding of three key receptors on the platelet surface. Human blood was subjected to the matrix of well-defined shear stresses and exposure times, generated by using a custom-designed blood-shearing device. The expression of three key platelet receptors, glycoprotein (GP) Ibα, GPVI, and GPIIb/IIIa, in sheared blood was quantified using flow cytometry. The quantitative relationship between the loss of each of the three receptors on the platelet surface and shear condition (shear stress level and exposure time) was explored. It was found that these relationships followed well the power law functional form. The coefficients of the power law models for the shear-induced shedding of these platelet receptors were derived with coefficients of determination (R) of 0.77, 0.73, and 0.78, respectively. The power law models with these coefficients may be potentially used to predict the shear-induced platelet receptor shedding of human blood.

  13. Juno is the egg Izumo receptor and is essential for mammalian fertilisation

    PubMed Central

    Bianchi, Enrica; Doe, Brendan; Goulding, David; Wright, Gavin J.

    2014-01-01

    Fertilisation occurs when sperm and egg recognise each other and fuse to form a new, genetically distinct organism. The molecular basis of sperm-egg recognition is unknown, but is likely to require interactions between receptor proteins displayed on their surface. Izumo1 is an essential sperm cell surface protein, but its egg receptor has remained a mystery. Here, we identify Juno as the receptor for Izumo1 on mouse eggs, and show this interaction is conserved within mammals. Female mice lacking Juno are infertile and Juno-deficient eggs do not fuse with normal sperm. Rapid shedding of Juno from the oolemma after fertilisation suggests a mechanism for the membrane block to polyspermy, ensuring eggs normally fuse with just a single sperm. Our discovery of an essential receptor pair at the nexus of conception provides opportunities for the rational development of new fertility treatments and contraceptives. PMID:24739963

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yue; Sheng, Ju; Baggen, Jim

    Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon’ on the virus surface. The sialic acid receptor induces a cascade of conformational changes inmore » the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Furthermore, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry.« less

  15. Local delivery of molecules from a nanopipette for quantitative receptor mapping on live cells.

    PubMed

    Babakinejad, Babak; Jönsson, Peter; López Córdoba, Ainara; Actis, Paolo; Novak, Pavel; Takahashi, Yasufumi; Shevchuk, Andrew; Anand, Uma; Anand, Praveen; Drews, Anna; Ferrer-Montiel, Antonio; Klenerman, David; Korchev, Yuri E

    2013-10-01

    Using nanopipettes to locally deliver molecules to the surface of living cells could potentially open up studies of biological processes down to the level of single molecules. However, in order to achieve precise and quantitative local delivery it is essential to be able to determine the amount and distribution of the molecules being delivered. In this work, we investigate how the size of the nanopipette, the magnitude of the applied pressure or voltage, which drives the delivery, and the distance to the underlying surface influences the number and spatial distribution of the delivered molecules. Analytical expressions describing the delivery are derived and compared with the results from finite element simulations and experiments on delivery from a 100 nm nanopipette in bulk solution and to the surface of sensory neurons. We then developed a setup for rapid and quantitative delivery to multiple subcellular areas, delivering the molecule capsaicin to stimulate opening of Transient Receptor Potential Vanilloid subfamily member 1 (TRPV1) channels, membrane receptors involved in pain sensation. Overall, precise and quantitative delivery of molecules from nanopipettes has been demonstrated, opening up many applications in biology such as locally stimulating and mapping receptors on the surface of live cells.

  16. Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

    PubMed

    Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

    2017-07-01

    Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.

  17. Effect of the anti-receptor ligand-blocking 225 monoclonal antibody on EGF receptor endocytosis and sorting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaramillo, Maria L.; Leon, Zully; Grothe, Suzanne

    The anti-receptor antibody, 225 mAb, is known to block binding of ligand to the epidermal growth factor receptor (EGFR). However, the effect of this neutralizing antibody on EGFR endocytosis, trafficking and degradation remains unclear. Here, we demonstrate that endocytosis of {sup 125}I-225 mAb occurs, albeit with a slower rate than that of EGF. Using pulse chase assays, we show that internalized {sup 125}I-225 mAb is recycled to the surface much more efficiently than internalized {sup 125}I-EGF. Also, we found that internalization of {sup 125}I-225 mAb, in contrast to that of EGF, is independent of receptor tyrosine kinase activity, as evidencedmore » by its insensitivity to AG1478, a specific EGFR tyrosine kinase inhibitor. Analysis of the levels of cell surface and total EGFR showed that treatment with 225 mAb results in a 30-40% decrease in surface EGFR and a relatively slow downregulation of total EGFR. Taken together, these data indicate that 225 mAb induces internalization and downregulation of EGFR via a mechanism distinct from that underlying EGF-induced EGFR internalization and downregulation.« less

  18. Autoantibodies to Synaptic Receptors and Neuronal Cell Surface Proteins in Autoimmune Diseases of the Central Nervous System

    PubMed Central

    Geis, Christian; Graus, Francesc

    2017-01-01

    Investigations in the last 10 years have revealed a new category of neurological diseases mediated by antibodies against cell surface and synaptic proteins. There are currently 16 such diseases all characterized by autoantibodies against neuronal proteins involved in synaptic signaling and plasticity. In clinical practice these findings have changed the diagnostic and treatment approach to potentially lethal, but now treatable, neurological and psychiatric syndromes previously considered idiopathic or not even suspected to be immune-mediated. Studies show that patients' antibodies can impair the surface dynamics of the target receptors eliminating them from synapses (e.g., NMDA receptor), block the function of the antigens without changing their synaptic density (e.g., GABAb receptor), interfere with synaptic protein-protein interactions (LGI1, Caspr2), alter synapse formation (e.g., neurexin-3α), or by unclear mechanisms associate to a new form of tauopathy (IgLON5). Here we first trace the process of discovery of these diseases, describing the triggers and symptoms related to each autoantigen, and then review in detail the structural and functional alterations caused by the autoantibodies with special emphasis in those (NMDA receptor, amphiphysin) that have been modeled in animals. PMID:28298428

  19. Cell surface retention sequence binding protein-1 interacts with the v-sis gene product and platelet-derived growth factor beta-type receptor in simian sarcoma virus-transformed cells.

    PubMed

    Boensch, C; Huang, S S; Connolly, D T; Huang, J S

    1999-04-09

    The cell surface retention sequence (CRS) binding protein-1 (CRSBP-1) is a newly identified membrane glycoprotein which is hypothesized to be responsible for cell surface retention of the oncogene v-sis and c-sis gene products and other secretory proteins containing CRSs. In simian sarcoma virus-transformed NIH 3T3 cells (SSV-NIH 3T3 cells), a fraction of CRSBP-1 was demonstrated at the cell surface and underwent internalization/recycling as revealed by cell surface 125I labeling and its resistance/sensitivity to trypsin digestion. However, the majority of CRSBP-1 was localized in intracellular compartments as evidenced by the resistance of most of the 35S-metabolically labeled CRSBP-1 to trypsin digestion, and by indirect immunofluorescent staining. CRSBP-1 appeared to form complexes with proteolytically processed forms (generated at and/or after the trans-Golgi network) of the v-sis gene product and with a approximately 140-kDa proteolytically cleaved form of the platelet-derived growth factor (PDGF) beta-type receptor, as demonstrated by metabolic labeling and co-immunoprecipitation. CRSBP-1, like the v-sis gene product and PDGF beta-type receptor, underwent rapid turnover which was blocked in the presence of 100 microM suramin. In normal and other transformed NIH 3T3 cells, CRSBP-1 was relatively stable and did not undergo rapid turnover and internalization/recycling at the cell surface. These results suggest that in SSV-NIH 3T3 cells, CRSBP-1 interacts with and forms ternary and binary complexes with the newly synthesized v-sis gene product and PDGF beta-type receptor at the trans-Golgi network and that the stable binary (CRSBP-1.v-sis gene product) complex is transported to the cell surface where it presents the v-sis gene product to unoccupied PDGF beta-type receptors during internalization/recycling.

  20. SERS diagnostic platforms, methods and systems microarrays, biosensors and biochips

    DOEpatents

    Vo-Dinh, Tuan [Knoxville, TN

    2007-09-11

    A Raman integrated sensor system for the detection of targets including biotargets includes at least one sampling platform, at least one receptor probe disposed on the sampling platform, and an integrated circuit detector system communicably connected to the receptor. The sampling platform is preferably a Raman active surface-enhanced scattering (SERS) platform, wherein the Raman sensor is a SERS sensor. The receptors can include at least one protein receptor and at least one nucleic acid receptor.

  1. Concepts in receptor optimization: targeting the RGD peptide.

    PubMed

    Chen, Wei; Chang, Chia-en; Gilson, Michael K

    2006-04-12

    Synthetic receptors have a wide range of potential applications, but it has been difficult to design low molecular weight receptors that bind ligands with high, "proteinlike" affinities. This study uses novel computational methods to understand why it is hard to design a high-affinity receptor and to explore the limits of affinity, with the bioactive peptide RGD as a model ligand. The M2 modeling method is found to yield excellent agreement with experiment for a known RGD receptor and then is used to analyze a series of receptors generated in silico with a de novo design algorithm. Forces driving binding are found to be systematically opposed by proportionate repulsions due to desolvation and entropy. In particular, strong correlations are found between Coulombic attractions and the electrostatic desolvation penalty and between the mean energy change on binding and the cost in configurational entropy. These correlations help explain why it is hard to achieve high affinity. The change in surface area upon binding is found to correlate poorly with affinity within this series. Measures of receptor efficiency are formulated that summarize how effectively a receptor uses surface area, total energy, and Coulombic energy to achieve affinity. Analysis of the computed efficiencies suggests that a low molecular weight receptor can achieve proteinlike affinity. It is also found that macrocyclization of a receptor can, unexpectedly, increase the entropy cost of binding because the macrocyclic structure further restricts ligand motion.

  2. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  3. Receptor-Targeted Nipah Virus Glycoproteins Improve Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-Proximal Cell Attachment.

    PubMed

    Bender, Ruben R; Muth, Anke; Schneider, Irene C; Friedel, Thorsten; Hartmann, Jessica; Plückthun, Andreas; Maisner, Andrea; Buchholz, Christian J

    2016-06-01

    Receptor-targeted lentiviral vectors (LVs) can be an effective tool for selective transfer of genes into distinct cell types of choice. Moreover, they can be used to determine the molecular properties that cell surface proteins must fulfill to act as receptors for viral glycoproteins. Here we show that LVs pseudotyped with receptor-targeted Nipah virus (NiV) glycoproteins effectively enter into cells when they use cell surface proteins as receptors that bring them closely enough to the cell membrane (less than 100 Å distance). Then, they were flexible in receptor usage as demonstrated by successful targeting of EpCAM, CD20, and CD8, and as selective as LVs pseudotyped with receptor-targeted measles virus (MV) glycoproteins, the current standard for cell-type specific gene delivery. Remarkably, NiV-LVs could be produced at up to two orders of magnitude higher titers compared to their MV-based counterparts and were at least 10,000-fold less effectively neutralized than MV glycoprotein pseudotyped LVs by pooled human intravenous immunoglobulin. An important finding for NiV-LVs targeted to Her2/neu was an about 100-fold higher gene transfer activity when particles were targeted to membrane-proximal regions as compared to particles binding to a more membrane-distal epitope. Likewise, the low gene transfer activity mediated by NiV-LV particles bound to the membrane distal domains of CD117 or the glutamate receptor subunit 4 (GluA4) was substantially enhanced by reducing receptor size to below 100 Å. Overall, the data suggest that the NiV glycoproteins are optimally suited for cell-type specific gene delivery with LVs and, in addition, for the first time define which parts of a cell surface protein should be targeted to achieve optimal gene transfer rates with receptor-targeted LVs.

  4. Reelin Supplementation Enhances Cognitive Ability, Synaptic Plasticity, and Dendritic Spine Density

    ERIC Educational Resources Information Center

    Rogers, Justin T.; Rusiana, Ian; Trotter, Justin; Zhao, Lisa; Donaldson, Erika; Pak, Daniel T.S.; Babus, Lenard W.; Peters, Melinda; Banko, Jessica L.; Chavis, Pascale; Rebeck, G. William; Hoe, Hyang-Sook; Weeber, Edwin J.

    2011-01-01

    Apolipoprotein receptors belong to an evolutionarily conserved surface receptor family that has intimate roles in the modulation of synaptic plasticity and is necessary for proper hippocampal-dependent memory formation. The known lipoprotein receptor ligand Reelin is important for normal synaptic plasticity, dendritic morphology, and cognitive…

  5. Ligand-independent Thrombopoietin Mutant Receptor Requires Cell Surface Localization for Endogenous Activity*

    PubMed Central

    Marty, Caroline; Chaligné, Ronan; Lacout, Catherine; Constantinescu, Stefan N.; Vainchenker, William; Villeval, Jean-Luc

    2009-01-01

    The activating W515L mutation in the thrombopoietin receptor (MPL) has been identified in primary myelofibrosis and essential thrombocythemia. MPL belongs to a subset of the cytokine receptor superfamily that requires the JAK2 kinase for signaling. We examined whether the ligand-independent MPLW515L mutant could signal intracellularly. Addition of the endoplasmic reticulum (ER) retention KDEL sequence to the receptor C terminus efficiently locked MPLW515L within its natural ER/Golgi maturation pathway. In contrast to cells expressing the parental MPLW515L, MPLW515L-KDEL-expressing FDC-P1 cells were unable to grow autonomously and to produce tumors in nude mice. When observed, tumor nodules resulted from in vivo selection of cells leaking the receptor at their surface. JAK2 co-immunoprecipitated with MPLW515L-KDEL but was not phosphorylated. We generated disulfide-bonded MPLW515L homodimers by the S402C substitution, both in the normal and KDEL context. Unlike MPLW515L-KDEL, MPLW515L-S402C-KDEL signaled constitutively and exhibited cell surface localization. These data establish that MPLW515L with appended JAK2 matures through the ER/Golgi system in an inactive conformation and suggest that the MPLW515L/JAK2 complex requires membrane localization for JAK2 phosphorylation, resulting in autonomous receptor signaling. PMID:19261614

  6. Novel Mechanisms in the Regulation of G Protein-coupled Receptor Trafficking to the Plasma Membrane*

    PubMed Central

    Tholanikunnel, Baby G.; Joseph, Kusumam; Kandasamy, Karthikeyan; Baldys, Aleksander; Raymond, John R.; Luttrell, Louis M.; McDermott, Paul J.; Fernandes, Daniel J.

    2010-01-01

    β2-Adrenergic receptors (β2-AR) are low abundance, integral membrane proteins that mediate the effects of catecholamines at the cell surface. Whereas the processes governing desensitization of activated β2-ARs and their subsequent removal from the cell surface have been characterized in considerable detail, little is known about the mechanisms controlling trafficking of neo-synthesized receptors to the cell surface. Since the discovery of the signal peptide, the targeting of the integral membrane proteins to plasma membrane has been thought to be determined by structural features of the amino acid sequence alone. Here we report that localization of translationally silenced β2-AR mRNA to the peripheral cytoplasmic regions is critical for receptor localization to the plasma membrane. β2-AR mRNA is recognized by the nucleocytoplasmic shuttling RNA-binding protein HuR, which silences translational initiation while chaperoning the mRNA-protein complex to the cell periphery. When HuR expression is down-regulated, β2-AR mRNA translation is initiated prematurely in perinuclear polyribosomes, leading to overproduction of receptors but defective trafficking to the plasma membrane. Our results underscore the importance of the spatiotemporal relationship between β2-AR mRNA localization, translation, and trafficking to the plasma membrane, and establish a novel mechanism whereby G protein-coupled receptor (GPCR) responsiveness is regulated by RNA-based signals. PMID:20739277

  7. Activation of 5-HT7 serotonin receptors reverses metabotropic glutamate receptor-mediated synaptic plasticity in wild-type and Fmr1 knockout mice, a model of Fragile X syndrome.

    PubMed

    Costa, Lara; Spatuzza, Michela; D'Antoni, Simona; Bonaccorso, Carmela M; Trovato, Chiara; Musumeci, Sebastiano A; Leopoldo, Marcello; Lacivita, Enza; Catania, Maria V; Ciranna, Lucia

    2012-12-01

    Fragile X syndrome (FXS) is a genetic cause of intellectual disability and autism. Fmr1 knockout (Fmr1 KO) mice, an animal model of FXS, exhibit spatial memory impairment and synapse malfunctioning in the hippocampus, with abnormal enhancement of long-term depression mediated by metabotropic glutamate receptors (mGluR-LTD). The neurotransmitter serotonin (5-HT) modulates hippocampal-dependent learning through serotonin 1A (5-HT1A) and serotonin 7 (5-HT7) receptors; the underlying mechanisms are unknown. We used electrophysiology to test the effects of 5-HT on mGluR-LTD in wild-type and Fmr1 KO mice and immunocytochemistry and biotinylation assay to study related changes of 2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid (AMPA) glutamate receptor surface expression. Application of 5-HT or 8-OH-DPAT (a mixed 5-HT1A/5-HT7 agonist) reversed mGluR-LTD in hippocampal slices. Reversal of mGluR-LTD by 8-OH-DPAT persisted in the presence of the 5-HT1A receptor antagonist WAY-100635, was abolished by SB-269970 (5-HT7 receptor antagonist), and was mimicked by LP-211, a novel selective 5-HT7 receptor agonist. Consistently, 8-OH-DPAT decreased mGluR-mediated reduction of AMPA glutamate receptor 2 (GluR2) subunit surface expression in hippocampal slices and cultured hippocampal neurons, an effect mimicked by LP-211 and blocked by SB-269970. In Fmr1 KO mice, mGluR-LTD was abnormally enhanced; similarly to wild-type, 8-OH-DPAT reversed mGluR-LTD and decreased mGluR-induced reduction of surface AMPA receptors, an effect antagonized by SB-269970. Serotonin 7 receptor activation reverses metabotropic glutamate receptor-induced AMPA receptor internalization and LTD both in wild-type and in Fmr1 KO mice, correcting excessive mGluR-LTD. Therefore, selective activation of 5-HT7 receptors may represent a novel strategy in the therapy of FXS. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  8. Roles for SH2 and SH3 domains in Lyn kinase association with activated FcepsilonRI in RBL mast cells revealed by patterned surface analysis.

    PubMed

    Hammond, Stephanie; Wagenknecht-Wiesner, Alice; Veatch, Sarah L; Holowka, David; Baird, Barbara

    2009-10-01

    In mast cells, antigen-mediated cross-linking of IgE bound to its high-affinity surface receptor, FcepsilonRI, initiates a signaling cascade that culminates in degranulation and release of allergic mediators. Antigen-patterned surfaces, in which the antigen is deposited in micron-sized features on a silicon substrate, were used to examine the spatial relationship between clustered IgE-FcepsilonRI complexes and Lyn, the signal-initiating tyrosine kinase. RBL mast cells expressing wild-type Lyn-EGFP showed co-redistribution of this protein with clustered IgE receptors on antigen-patterned surfaces, whereas Lyn-EGFP containing an inhibitory point mutation in its SH2 domain did not significantly accumulate with the patterned antigen, and Lyn-EGFP with an inhibitory point mutation in its SH3 domain exhibited reduced interactions. Our results using antigen-patterned surfaces and quantitative cross-correlation image analysis reveal that both the SH2 and SH3 domains contribute to interactions between Lyn kinase and cross-linked IgE receptors in stimulated mast cells.

  9. Quartz crystal microbalance (QCM) with immobilized protein receptors: comparison of response to ligand binding for direct protein immobilization and protein attachment via disulfide linker.

    PubMed

    Baltus, Ruth E; Carmon, Kendra S; Luck, Linda A

    2007-03-27

    Results from an investigation of the frequency response resulting from ligand binding for a genetically engineered hormone-binding domain of the alpha-estrogen receptor immobilized to a piezoelectric quartz crystal are reported. Two different approaches were used to attach a genetically altered receptor to the gold electrode on the quartz surface: (1) the mutant receptor containing a single solvent-exposed cysteine was directly attached to the crystal via a sulfur to gold covalent bond, forming a self-assembled protein monolayer, and (2) the N-terminal histidine-tagged end was utilized to attach the receptor via a 3,3-dithiobis[N-(5-amino-5-carboxypentyl)propionamide-N',N'-diacetic acid] linker complexed with nickel. Previous studies have shown that these engineered constructs bind 17beta-estradiol and are fully functional. Exposure of the receptor directly attached to the piezoelectric crystal to the known ligand 17beta-estradiol resulted in a measurable frequency response, consistent with a change in conformation of the receptor with ligand binding. However, no response was observed when the receptor immobilized via the linker was exposed to the same ligand. The presence of the linker between the quartz surface and the protein receptor does not allow the crystal to sense the conformational change in the receptor that occurs with ligand binding. These results illustrate that the immobilization strategy used to bind the receptor to the sensor platform is key to eliciting an appropriate response from this biosensor. This study has important implications for the development of QCM-based sensors using protein receptors.

  10. Role of the glucose-sensing receptor in insulin secretion.

    PubMed

    Kojima, Itaru; Medina, Johan; Nakagawa, Yuko

    2017-09-01

    Glucose is a primary stimulator of insulin secretion. It has been thought that glucose exerts its effect by a mechanism solely dependent on glucose metabolism. We show here that glucose induces rapid Ca 2+ and cyclic AMP signals in β-cells. These rapid signals are independent of glucose-metabolism and are reproduced by non-metabolizable glucose analogues. These results led us to postulate that glucose activates a cell-surface receptor, namely the glucose-sensing receptor. Rapid signals induced by glucose are blocked by inhibition of a sweet taste receptor subunit T1R3 and a calcium-sensing receptor subunit CaSR. In accordance with these observations, T1R3 and CaSR form a heterodimer. In addition, a heterodimer of T1R3 and CaSR is activated by glucose. These results suggest that a heterodimer of T1R3 and CaSR is a major component of the glucose-sensing receptor. When the glucose-sensing receptor is blocked, glucose-induced insulin secretion is inhibited. Also, ATP production is significantly attenuated by the inhibition of the receptor. Conversely, stimulation of the glucose-sensing receptor by either artificial sweeteners or non-metabolizable glucose analogue increases ATP. Hence, the glucose-sensing receptor signals promote glucose metabolism. Collectively, glucose activates the cell-surface glucose-sensing receptor and promotes its own metabolism. Glucose then enters the cells and is metabolized through already activated metabolic pathways. The glucose-sensing receptor is a key molecule regulating the action of glucose in β-cells. © 2017 John Wiley & Sons Ltd.

  11. The lipid habitats of neurotransmitter receptors in brain.

    PubMed

    Borroni, María Virginia; Vallés, Ana Sofía; Barrantes, Francisco J

    2016-11-01

    Neurotransmitter receptors, the macromolecules specialized in decoding the chemical signals encrypted in the chemical signaling mechanism in the nervous system, occur either at the somatic cell surface of chemically excitable cells or at specialized subcellular structures, the synapses. Synapses have lipid compositions distinct from the rest of the cell membrane, suggesting that neurotransmitter receptors and their scaffolding and adaptor protein partners require specific lipid habitats for optimal operation. In this review we discuss some paradigmatic cases of neurotransmitter receptor-lipid interactions, highlighting the chemical nature of the intervening lipid species and providing examples of the receptor mechanisms affected by interaction with lipids. The focus is on the effects of cholesterol, glycerophospholipids and covalent fatty acid acylation on neurotransmitter receptors. We also briefly discuss the role of lipid phase states involving lateral heterogeneities of the host membrane known to modulate membrane transport, protein sorting and signaling. Modulation of neurotransmitter receptors by lipids occurs at multiple levels, affecting a wide span of activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, and recycling, among other important functional properties at the synapse. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Specific Retrograde Transduction of Spinal Motor Neurons Using Lentiviral Vectors Targeted to Presynaptic NMJ Receptors

    PubMed Central

    Eleftheriadou, I; Trabalza, A; Ellison, SM; Gharun, K; Mazarakis, ND

    2014-01-01

    To understand how receptors are involved in neuronal trafficking and to be able to utilize them for specific targeting via the peripheral route would be of great benefit. Here, we describe the generation of novel lentiviral vectors with tropism to motor neurons that were made by coexpressing onto the lentiviral surface a fusogenic glycoprotein (mutated sindbis G) and an antibody against a cell-surface receptor (Thy1.1, p75NTR, or coxsackievirus and adenovirus receptor) on the presynaptic terminal of the neuromuscular junction. These vectors exhibit binding specificity and efficient transduction of receptor positive cell lines and primary motor neurons in vitro. Targeting of each of these receptors conferred to these vectors the capability of being transported retrogradely from the axonal tip, leading to transduction of motor neurons in vitro in compartmented microfluidic cultures. In vivo delivery of coxsackievirus and adenovirus receptor-targeted vectors in leg muscles of mice resulted in predicted patterns of motor neuron labeling in lumbar spinal cord. This opens up the clinical potential of these vectors for minimally invasive administration of central nervous system-targeted therapeutics in motor neuron diseases. PMID:24670531

  13. The G-protein coupled estrogen receptor, GPER: The inside and inside-out story.

    PubMed

    Gaudet, H M; Cheng, S B; Christensen, E M; Filardo, E J

    2015-12-15

    GPER possesses structural and functional characteristics shared by members of the G-protein-coupled receptor (GPCR) superfamily, the largest class of plasma membrane receptors. This newly appreciated estrogen receptor is localized predominately within intracellular membranes in most, but not all, cell types and its surface expression is modulated by steroid hormones and during tissue injury. An intracellular staining pattern is not unique among GPCRs, which employ a diverse array of molecular mechanisms that restrict cell surface expression and effectively regulating receptor binding and activation. The finding that GPER displays an intracellular predisposition has created some confusion as the estrogen-inducible transcription factors, ERα and ERβ, also reside intracellularly, and has led to complex suggestions of receptor interaction. GPER undergoes constitutive retrograde trafficking from the plasma membrane to the endoplasmic reticulum and recent studies indicate its interaction with PDZ binding proteins that sort transmembrane receptors to synaptosomes and endosomes. Genetic targeting and selective ligand approaches as well as cell models that express GPER in the absence of ERs clearly supports GPER as a bonafide "stand alone" receptor. Here, the molecular details that regulate GPER action, its cell biological activities and its implicated roles in physiological and pathological processes are reviewed. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. CD22 is a recycling receptor that can shuttle cargo between the cell surface and endosomal compartments of B cells.

    PubMed

    O'Reilly, Mary K; Tian, Hua; Paulson, James C

    2011-02-01

    CD22 is a member of the sialic acid-binding Ig-like lectin (Siglec) family that is known to be a regulator of B cell signaling. Its B cell-specific expression makes it an attractive target for immunotoxin-mediated B cell depletion therapy for the treatment of B cell lymphomas and autoimmune diseases. Although CD22 is well documented to be an endocytic receptor, it is believed that after internalization, it is targeted for degradation. We show in this study that CD22 is instead constitutively recycled to the cell surface. We also find that glycan ligand-based cargo is released from CD22 and accumulates intracellularly as CD22 recycles between the cell surface and endosomal compartments. In contrast, Abs to CD22 do not accumulate but remain bound to CD22 and recycle to the cell surface. The results have implications for development of agents that target CD22 as an endocytic receptor for delivery of cytotoxic cargo to B cells.

  15. Synthesis and biological evaluation of sialyl-oligonucleotide conjugates targeting leukocyte B trans-membranal receptor CD22 as delivery agents for nucleic acid drugs.

    PubMed

    St-Pierre, Gabrielle; Pal, Sudip; Østergaard, Michael E; Zhou, Tianyuan; Yu, Jinghua; Tanowitz, Michael; Seth, Punit P; Hanessian, Stephen

    2016-06-01

    Antisense oligonucleotides (ASOs) modified with ligands which target cell surface receptors have the potential to significantly improve potency in the target tissue. This has recently been demonstrated using triantennary N-acetyl d-galactosamine conjugated ASOs. CD22 is a cell surface receptor expressed exclusively on B cells thus presenting an attractive target for B cell specific delivery of drugs. Herein, we reported the synthesis of monovalent and trivalent ASO conjugates with biphenylcarbonyl (BPC) modified sialic acids and their study as ASO delivery agents into B cells. CD22 positive cells exhibited reduced potency when treated with ligand modified ASOs and mechanistic examination suggested reduced uptake into cells potentially as a result of sequestration of ASO by other cell-surface proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. TRAIL-death receptor endocytosis and apoptosis are selectively regulated by dynamin-1 activation.

    PubMed

    Reis, Carlos R; Chen, Ping-Hung; Bendris, Nawal; Schmid, Sandra L

    2017-01-17

    Clathrin-mediated endocytosis (CME) constitutes the major pathway for uptake of signaling receptors into eukaryotic cells. As such, CME regulates signaling from cell-surface receptors, but whether and how specific signaling receptors reciprocally regulate the CME machinery remains an open question. Although best studied for its role in membrane fission, the GTPase dynamin also regulates early stages of CME. We recently reported that dynamin-1 (Dyn1), previously assumed to be neuron-specific, can be selectively activated in cancer cells to alter endocytic trafficking. Here we report that dynamin isoforms differentially regulate the endocytosis and apoptotic signaling downstream of TNF-related apoptosis-inducing ligand-death receptor (TRAIL-DR) complexes in several cancer cells. Whereas the CME of constitutively internalized transferrin receptors is mainly dependent on the ubiquitously expressed Dyn2, TRAIL-induced DR endocytosis is selectively regulated by activation of Dyn1. We show that TRAIL stimulation activates ryanodine receptor-mediated calcium release from endoplasmic reticulum stores, leading to calcineurin-mediated dephosphorylation and activation of Dyn1, TRAIL-DR endocytosis, and increased resistance to TRAIL-induced apoptosis. TRAIL-DR-mediated ryanodine receptor activation and endocytosis is dependent on early caspase-8 activation. These findings delineate specific mechanisms for the reciprocal crosstalk between signaling and the regulation of CME, leading to autoregulation of endocytosis and signaling downstream of surface receptors.

  17. TRAIL-death receptor endocytosis and apoptosis are selectively regulated by dynamin-1 activation

    PubMed Central

    Reis, Carlos R.; Chen, Ping-Hung; Bendris, Nawal; Schmid, Sandra L.

    2017-01-01

    Clathrin-mediated endocytosis (CME) constitutes the major pathway for uptake of signaling receptors into eukaryotic cells. As such, CME regulates signaling from cell-surface receptors, but whether and how specific signaling receptors reciprocally regulate the CME machinery remains an open question. Although best studied for its role in membrane fission, the GTPase dynamin also regulates early stages of CME. We recently reported that dynamin-1 (Dyn1), previously assumed to be neuron-specific, can be selectively activated in cancer cells to alter endocytic trafficking. Here we report that dynamin isoforms differentially regulate the endocytosis and apoptotic signaling downstream of TNF-related apoptosis-inducing ligand–death receptor (TRAIL–DR) complexes in several cancer cells. Whereas the CME of constitutively internalized transferrin receptors is mainly dependent on the ubiquitously expressed Dyn2, TRAIL-induced DR endocytosis is selectively regulated by activation of Dyn1. We show that TRAIL stimulation activates ryanodine receptor-mediated calcium release from endoplasmic reticulum stores, leading to calcineurin-mediated dephosphorylation and activation of Dyn1, TRAIL–DR endocytosis, and increased resistance to TRAIL-induced apoptosis. TRAIL–DR-mediated ryanodine receptor activation and endocytosis is dependent on early caspase-8 activation. These findings delineate specific mechanisms for the reciprocal crosstalk between signaling and the regulation of CME, leading to autoregulation of endocytosis and signaling downstream of surface receptors. PMID:28049841

  18. Inhibiting the Epidermal Growth Factor Receptor | Center for Cancer Research

    Cancer.gov

    The Epidermal Growth Factor Receptor (EGFR) is a widely distributed cell surface receptor that responds to several extracellular signaling molecules through an intracellular tyrosine kinase, which phosphorylates target enzymes to trigger a downstream molecular cascade. Since the discovery that EGFR mutations and amplifications are critical in a number of cancers, efforts have

  19. Identification and functional analysis of tomato BRI1 and BAK1 receptor kinase phosphorylation sites

    USDA-ARS?s Scientific Manuscript database

    Brassinosteroids (BRs) are essential plant hormones that are perceived at the cell surface by a membrane bound receptor kinase, BRASSINOSTEROID INSENSITIVE 1 (BRI1). BRI1 interacts with BRI1-ASSOCIATED RECEPTOR KINASE 1 (BAK1) to initiate a signal transduction pathway in which autophosphorylation an...

  20. Cellular localization of the activated EGFR determines its effect on cell growth in MDA-MB-468 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hyatt, Dustin C.; Ceresa, Brian P.

    2008-11-01

    The epidermal growth factor (EGF) receptor (EGFR) is a ubiquitously expressed receptor tyrosine kinase that regulates diverse cell functions that are dependent upon cell type, the presence of downstream effectors, and receptor density. In addition to activating biochemical pathways, ligand stimulation causes the EGFR to enter the cell via clathrin-coated pits. Endocytic trafficking influences receptor signaling by controlling the duration of EGFR phosphorylation and coordinating the receptor's association with downstream effectors. To better understand the individual contributions of cell surface and cytosolic EGFRs on cell physiology, we used EGF that was conjugated to 900 nm polystyrene beads (EGF-beads). EGF-beads canmore » stimulate the EGFR and retain the activated receptor at the plasma membrane. In MDA-MB-468 cells, a breast cancer cell line that over-expresses the EGFR, only internalized, activated EGFRs stimulate caspase-3 and induce cell death. Conversely, signaling cascades triggered from activated EGFR retained at the cell surface inhibit caspase-3 and promote cell proliferation. Thus, through endocytosis, the activated EGFR can differentially regulate cell growth in MDA-MB-468 cells.« less

  1. Virus Infection and Death Receptor-Mediated Apoptosis.

    PubMed

    Zhou, Xingchen; Jiang, Wenbo; Liu, Zhongshun; Liu, Shuai; Liang, Xiaozhen

    2017-10-27

    Virus infection can trigger extrinsic apoptosis. Cell-surface death receptors of the tumor necrosis factor family mediate this process. They either assist persistent viral infection or elicit the elimination of infected cells by the host. Death receptor-mediated apoptosis plays an important role in viral pathogenesis and the host antiviral response. Many viruses have acquired the capability to subvert death receptor-mediated apoptosis and evade the host immune response, mainly by virally encoded gene products that suppress death receptor-mediated apoptosis. In this review, we summarize the current information on virus infection and death receptor-mediated apoptosis, particularly focusing on the viral proteins that modulate death receptor-mediated apoptosis.

  2. Virus Infection and Death Receptor-Mediated Apoptosis

    PubMed Central

    Zhou, Xingchen; Jiang, Wenbo; Liu, Zhongshun; Liu, Shuai; Liang, Xiaozhen

    2017-01-01

    Virus infection can trigger extrinsic apoptosis. Cell-surface death receptors of the tumor necrosis factor family mediate this process. They either assist persistent viral infection or elicit the elimination of infected cells by the host. Death receptor-mediated apoptosis plays an important role in viral pathogenesis and the host antiviral response. Many viruses have acquired the capability to subvert death receptor-mediated apoptosis and evade the host immune response, mainly by virally encoded gene products that suppress death receptor-mediated apoptosis. In this review, we summarize the current information on virus infection and death receptor-mediated apoptosis, particularly focusing on the viral proteins that modulate death receptor-mediated apoptosis. PMID:29077026

  3. GRB2 Interaction with the Ecotropic Murine Leukemia Virus Receptor, mCAT-1, Controls Virus Entry and Is Stimulated by Virus Binding

    PubMed Central

    Chen, Zeming; Kolokoltsov, Andrey A.; Wang, Jia; Adhikary, Shramika; Lorinczi, Marta; Elferink, Lisa A.

    2012-01-01

    For retroviruses such as HIV-1 and murine leukemia virus (MLV), active receptor recruitment and trafficking occur during viral entry. However, the underlying mechanisms and cellular factors involved in the process are largely uncharacterized. The viral receptor for ecotropic MLV (eMLV), a classical model for retrovirus infection mechanisms and pathogenesis, is mouse cationic amino acid transporter 1 (mCAT-1). Growth factor receptor-bound protein 2 (GRB2) is an adaptor protein that has been shown to couple cell surface receptors, such as epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor, to intracellular signaling events. Here we examined if GRB2 could also play a role in controlling infection by retroviruses by affecting receptor function. The GRB2 RNA interference (RNAi)-mediated suppression of endogenous GRB2 resulted in a consistent and significant reduction of virus binding and membrane fusion. The binding between eMLV and cells promoted increased GRB2–mCAT-1 interactions, as detected by immunoprecipitation. Consistently, the increased colocalization of GRB2 and mCAT-1 signals was detected by confocal microscopy. This association was time dependent and paralleled the kinetics of cell-virus membrane fusion. Interestingly, unlike the canonical binding pattern seen for GRB2 and growth factor receptors, GRB2–mCAT-1 binding does not depend on the GRB2-SH2 domain-mediated recognition of tyrosine phosphorylation on the receptor. The inhibition of endogenous GRB2 led to a reduction in surface levels of mCAT-1, which was detected by immunoprecipitation and by a direct binding assay using a recombinant MLV envelope protein receptor binding domain (RBD). Consistent with this observation, the expression of a dominant negative GRB2 mutant (R86K) resulted in the sequestration of mCAT-1 from the cell surface into intracellular vesicles. Taken together, these findings suggest a novel role for GRB2 in ecotropic MLV entry and infection by facilitating mCAT-1 trafficking. PMID:22090132

  4. GRB2 interaction with the ecotropic murine leukemia virus receptor, mCAT-1, controls virus entry and is stimulated by virus binding.

    PubMed

    Chen, Zeming; Kolokoltsov, Andrey A; Wang, Jia; Adhikary, Shramika; Lorinczi, Marta; Elferink, Lisa A; Davey, Robert A

    2012-02-01

    For retroviruses such as HIV-1 and murine leukemia virus (MLV), active receptor recruitment and trafficking occur during viral entry. However, the underlying mechanisms and cellular factors involved in the process are largely uncharacterized. The viral receptor for ecotropic MLV (eMLV), a classical model for retrovirus infection mechanisms and pathogenesis, is mouse cationic amino acid transporter 1 (mCAT-1). Growth factor receptor-bound protein 2 (GRB2) is an adaptor protein that has been shown to couple cell surface receptors, such as epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor, to intracellular signaling events. Here we examined if GRB2 could also play a role in controlling infection by retroviruses by affecting receptor function. The GRB2 RNA interference (RNAi)-mediated suppression of endogenous GRB2 resulted in a consistent and significant reduction of virus binding and membrane fusion. The binding between eMLV and cells promoted increased GRB2-mCAT-1 interactions, as detected by immunoprecipitation. Consistently, the increased colocalization of GRB2 and mCAT-1 signals was detected by confocal microscopy. This association was time dependent and paralleled the kinetics of cell-virus membrane fusion. Interestingly, unlike the canonical binding pattern seen for GRB2 and growth factor receptors, GRB2-mCAT-1 binding does not depend on the GRB2-SH2 domain-mediated recognition of tyrosine phosphorylation on the receptor. The inhibition of endogenous GRB2 led to a reduction in surface levels of mCAT-1, which was detected by immunoprecipitation and by a direct binding assay using a recombinant MLV envelope protein receptor binding domain (RBD). Consistent with this observation, the expression of a dominant negative GRB2 mutant (R86K) resulted in the sequestration of mCAT-1 from the cell surface into intracellular vesicles. Taken together, these findings suggest a novel role for GRB2 in ecotropic MLV entry and infection by facilitating mCAT-1 trafficking.

  5. Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern.

    PubMed

    Kassotis, Christopher D; Alvarez, David A; Taylor, Julia A; vom Saal, Frederick S; Nagel, Susan C; Tillitt, Donald E

    2015-08-15

    Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrations present in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities. Published by Elsevier B.V.

  6. An incomplete trafficking defect to the cell-surface leads to paradoxical thrombocytosis for human and murine MPL P106L.

    PubMed

    Favale, Fabrizia; Messaoudi, Kahia; Varghese, Leila N; Boukour, Siham; Pecquet, Christian; Gryshkova, Vitalina; Defour, Jean Philippe; Albu, Roxana-Irina; Bluteau, Olivier; Ballerini, Paola; Leverger, Guy; Plo, Isabelle; Debili, Najet; Raslova, Hana; Favier, Remi; Constantinescu, Stefan N; Vainchenker, William

    2016-12-29

    The mechanisms behind the hereditary thrombocytosis induced by the thrombopoietin (THPO) receptor MPL P106L mutant remain unknown. A complete trafficking defect to the cell surface has been reported, suggesting either weak constitutive activity or nonconventional THPO-dependent mechanisms. Here, we report that the thrombocytosis phenotype induced by MPL P106L belongs to the paradoxical group, where low MPL levels on platelets and mature megakaryocytes (MKs) lead to high serum THPO levels, whereas weak but not absent MPL cell-surface localization in earlier MK progenitors allows response to THPO by signaling and amplification of the platelet lineage. MK progenitors from patients showed no spontaneous growth and responded to THPO, and MKs expressed MPL on their cell surface at low levels, whereas their platelets did not respond to THPO. Transduction of MPL P106L in CD34 + cells showed that this receptor was more efficiently localized at the cell surface on immature than on mature MKs, explaining a proliferative response to THPO of immature cells and a defect in THPO clearance in mature cells. In a retroviral mouse model performed in Mpl -/- mice, MPL P106L could induce a thrombocytosis phenotype with high circulating THPO levels. Furthermore, we could select THPO-dependent cell lines with more cell-surface MPL P106L localization that was detected by flow cytometry and [ 125 I]-THPO binding. Altogether, these results demonstrate that MPL P106L is a receptor with an incomplete defect in trafficking, which induces a low but not absent localization of the receptor on cell surface and a response to THPO in immature MK cells. © 2016 by The American Society of Hematology.

  7. Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern

    USGS Publications Warehouse

    Kassotis, Christopher D.; Alvarez, David A.; Taylor, Julia A.; vom Saal, Frederick S.; Nagel, Susan C.; Tillitt, Donald E.

    2015-01-01

    Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrationspresent in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities.

  8. Receptor trafficking via the perinuclear recycling compartment accompanied by cell division is necessary for permanent neurotensin cell sensitization and leads to chronic mitogen-activated protein kinase activation.

    PubMed

    Toy-Miou-Leong, Mireille; Cortes, Catherine Llorens; Beaudet, Alain; Rostène, William; Forgez, Patricia

    2004-03-26

    Most G protein-coupled receptors are internalized after interaction with their respective ligand, a process that subsequently contributes to cell desensitization, receptor endocytosis, trafficking, and finally cell resensitization. Although cellular mechanisms leading to cell desensitization have been widely studied, those responsible for cell resensitization are still poorly understood. We examined here the traffic of the high affinity neurotensin receptor (NT1 receptor) following prolonged exposure to high agonist concentration. Fluorescence and confocal microscopy of Chinese hamster ovary, human neuroblastoma (CHP 212), and murine neuroblastoma (N1E-115) cells expressing green fluorescent protein-tagged NT1 receptor revealed that under prolonged treatment with saturating concentrations of neurotensin (NT) agonist, NT1 receptor and NT transiently accumulated in the perinuclear recycling compartment (PNRC). During this cellular event, cell surface receptors remained markedly depleted as detected by both confocal microscopy and (125)I-NT binding assays. In dividing cells, we observed that following prolonged NT agonist stimulation, NT1 receptors were removed from the PNRC, accumulated in dispersed vesicles inside the cytoplasm, and subsequently reappeared at the cell surface. This NT binding recovery allowed for constant cell sensitization and led to a chronic activation of mitogen-activated protein kinases p42 and p44. Under these conditions, the constant activation of NT1 receptor generates an oncogenic regulation. These observations support the potent role for neuropeptides, such as NT, in cancer progression.

  9. α-Helical element at the hormone-binding surface of the insulin receptor functions as a signaling element to activate its tyrosine kinase

    PubMed Central

    Whittaker, Jonathan; Whittaker, Linda J.; Roberts, Charles T.; Phillips, Nelson B.; Ismail-Beigi, Faramarz; Lawrence, Michael C.; Weiss, Michael A.

    2012-01-01

    The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo–cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation. PMID:22736795

  10. α-Helical element at the hormone-binding surface of the insulin receptor functions as a signaling element to activate its tyrosine kinase.

    PubMed

    Whittaker, Jonathan; Whittaker, Linda J; Roberts, Charles T; Phillips, Nelson B; Ismail-Beigi, Faramarz; Lawrence, Michael C; Weiss, Michael A

    2012-07-10

    The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo-cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation.

  11. Model for capping of membrane receptors based on boundary surface effects

    PubMed Central

    Gershon, N. D.

    1978-01-01

    Crosslinking of membrane surface receptors may lead to their segregation into patches and then into a single large aggregate at one pole of the cell. This process is called capping. Here, a novel explanation of such a process is presented in which the membrane is viewed as a supersaturated solution of receptors in the lipid bilayer and the adjacent two aqueous layers. Without a crosslinking agent, a patch of receptors that is less than a certain size cannot stay in equilibrium with the solution and thus should dissolve. Patches greater than a certain size are stable and can, in principle, grow by the precipitation of the remaining dissolved receptors from the supersaturated solution. The task of the crosslinking molecules is to form such stable patches. These considerations are based on a qualitative thermodynamic calculation that takes into account the existence of a boundary tension in a patch (in analogy to the surface tension of a droplet). Thermodynamically, these systems should cap spontaneously after the patches have reached a certain size. But, in practice, such a process can be very slow. A suspension of patches may stay practically stable. The ways in which a cell may abolish this metastable equilibrium and thus achieve capping are considered and possible effects of capping inhibitors are discussed. PMID:274724

  12. Amino Acid Residues Critical for Endoplasmic Reticulum Export and Trafficking of Platelet-activating Factor Receptor*

    PubMed Central

    Hirota, Nobuaki; Yasuda, Daisuke; Hashidate, Tomomi; Yamamoto, Teruyasu; Yamaguchi, Satoshi; Nagamune, Teruyuki; Nagase, Takahide; Shimizu, Takao; Nakamura, Motonao

    2010-01-01

    Several residues are conserved in the transmembrane domains (TMs) of G-protein coupled receptors. Here we demonstrate that a conserved proline, Pro247, in TM6 of platelet-activating factor receptor (PAFR) is required for endoplasmic reticulum (ER) export and trafficking after agonist-induced internalization. Alanine-substituted mutants of the conserved residues of PAFRs, including P247A, were retained in the ER. Because a PAFR antagonist, Y-24180, acted as a pharmacological chaperone to rescue ER retention, this retention is due to misfolding of PAFR. Methylcarbamyl (mc)-PAF, a PAFR agonist, did not increase the cell surface expression of P247A, even though another ER-retained mutant, D63A, was effectively trafficked. Signaling and accumulation of the receptors in the early endosomes were observed in the mc-PAF-treated P247A-expressing cells, suggesting that P247A was trafficked to the cell surface by mc-PAF, and thereafter disappeared from the surface due to aberrant trafficking, e.g. enhanced internalization, deficiency in recycling, and/or accelerated degradation. The aberrant trafficking was confirmed with a sortase-A-mediated method for labeling cell surface proteins. These results demonstrate that the conserved proline in TM6 is crucial for intracellular trafficking of PAFR. PMID:20007715

  13. Crosslinking of surface antibodies and Fc sub. gamma. receptors: Theory and application

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wofsy, C.; Goldstein, B.

    1991-03-15

    In an immune response, the crosslinking of surface immunoglobulin (sIg) on B cells by multiply-bound ligand activates a range of cell responses, culminating in the production of antibody-secreting cells. However, when the crosslinking agent is itself an antibody, B cell activation is inhibited. Solution antibody (IgG) can bind simultaneously to sIg and to another cell surface receptor, Fc{sub {gamma}}R, co-crosslinking' the distinct receptors. Experiments point to co-crosslinking as the inhibitory signal. It is not clear how co-crosslinking inhibits B cell stimulation. The authors construct and analyze a mathematical model aimed at clarifying the nature and mechanisms of action of themore » separate cell signals controlling B cell responses to antibodies. Basophils and mast cells respond to the crosslinking of cell surface antibody by releasing histamine. Like B cells, basophils also express FC{sub {gamma}}R. They use their model to analyze new data on the effect of antibody-induced co-crosslinking of the two types of receptor on this family of cells. Predictions of the model indicate that an observed difference between the response patterns induced by antibodies and by antibody fragments that cannot bind to FC{sub {gamma}}R can be explained if co-crosslinking is neither inhibitory nor stimulatory in this system.« less

  14. Sialylated multivalent antigens engage CD22 in trans and inhibit B cell activation.

    PubMed

    Courtney, Adam H; Puffer, Erik B; Pontrello, Jason K; Yang, Zhi-Qiang; Kiessling, Laura L

    2009-02-24

    CD22 is an inhibitory coreceptor on the surface of B cells that attenuates B cell antigen receptor (BCR) signaling and, therefore, B cell activation. Elucidating the molecular mechanisms underlying the inhibitory activity of CD22 is complicated by the ubiquity of CD22 ligands. Although antigens can display CD22 ligands, the receptor is known to bind to sialylated glycoproteins on the cell surface. The propinquity of CD22 and cell-surface glycoprotein ligands has led to the conclusion that the inhibitory properties of the receptor are due to cis interactions. Here, we examine the functional consequences of trans interactions by employing sialylated multivalent antigens that can engage both CD22 and the BCR. Exposure of B cells to sialylated antigens results in the inhibition of key steps in BCR signaling. These results reveal that antigens bearing CD22 ligands are powerful suppressors of B cell activation. The ability of sialylated antigens to inhibit BCR signaling through trans CD22 interactions reveals a previously unrecognized role for the Siglec-family of receptors as modulators of immune signaling.

  15. Characterizing Spatial Organization of Cell Surface Receptors in Human Breast Cancer with STORM

    NASA Astrophysics Data System (ADS)

    Lyall, Evan; Chapman, Matthew R.; Sohn, Lydia L.

    2012-02-01

    Regulation and control of complex biological functions are dependent upon spatial organization of biological structures at many different length scales. For instance Eph receptors and their ephrin ligands bind when opposing cells come into contact during development, resulting in spatial organizational changes on the nanometer scale that lead to changes on the macro scale, in a process known as organ morphogenesis. One technique able to probe this important spatial organization at both the nanometer and micrometer length scales, including at cell-cell junctions, is stochastic optical reconstruction microscopy (STORM). STORM is a technique that localizes individual fluorophores based on the centroids of their point spread functions and then reconstructs a composite image to produce super resolved structure. We have applied STORM to study spatial organization of the cell surface of human breast cancer cells, specifically the organization of tyrosine kinase receptors and chemokine receptors. A better characterization of spatial organization of breast cancer cell surface proteins is necessary to fully understand the tumorigenisis pathways in the most common malignancy in United States women.

  16. GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

    PubMed Central

    Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

    2016-01-01

    Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

  17. Elevated GnRH receptor expression plus GnRH agonist treatment inhibits the growth of a subset of papillomavirus 18-immortalized human prostate cells.

    PubMed

    Morgan, Kevin; Stavrou, Emmanouil; Leighton, Samuel P; Miller, Nicola; Sellar, Robin; Millar, Robert P

    2011-06-15

    Human metastatic prostate cancer cell growth can be inhibited by GnRH analogs but effects on virus-immortalized prostate cells have not been investigated. Virus-immortalized prostate cells were stably transfected with rat GnRH receptor cDNA and levels of GnRH binding were correlated with GnRH effects on signaling, cell cycle, growth, exosome production, and apoptosis. High levels of cell surface GnRH receptor occurred in transfected papillomavirus-immortalized WPE-1-NB26 epithelial cells but not in non-tumourigenic RWPE-1, myoepithelial WPMY-1 cells, or SV40-immortalized PNT1A. Endogenous cell surface GnRH receptor was undetectable in non-transfected cells or cancer cell lines LNCaP, PC3, and DU145. GnRH receptor levels correlated with induction of inositol phosphates, elevation of intracellular Ca(2+) , cytoskeletal actin reorganization, modulation of ERK activation and cell growth-inhibition with GnRH agonists. Hoechst 33342 DNA staining-cell sorting indicated accumulation of cells in G2 following agonist treatment. Release of exosomes from transfected WPE-1-NB26 was unaffected by agonists, unlike induction observed in HEK293([SCL60]) cells. Increased PARP cleavage and apoptotic body production were undetectable during growth-inhibition in WPE-1-NB26 cells, contrasting with HEK293([SCL60]) . EGF receptor activation inhibited GnRH-induced ERK activation in WPE-1-NB26 but growth-inhibition was not rescued by EGF or PKC inhibitor Ro320432. Growth of cells expressing low levels of GnRH receptor was not affected by agonists. Engineered high-level GnRH receptor activation inhibits growth of a subset of papillomavirus-immortalized prostate cells. Elucidating mechanisms leading to clone-specific differences in cell surface GnRH receptor levels is a valuable next step in developing strategies to exploit prostate cell anti-proliferation using GnRH agonists. Copyright © 2010 Wiley-Liss, Inc.

  18. Basigin-2 Is a Cell Surface Receptor for Soluble Basigin Ligand*S⃞

    PubMed Central

    Belton, Robert J.; Chen, Li; Mesquita, Fernando S.; Nowak, Romana A.

    2008-01-01

    The metastatic spread of a tumor is dependent upon the ability of the tumor to stimulate surrounding stromal cells to express enzymes required for tissue remodeling. The immunoglobulin superfamily protein basigin (EMMPRIN/CD147) is a cell surface glycoprotein expressed by tumor cells that stimulates matrix metalloproteinase and vascular endothelial growth factor expression in stromal cells. The ability of basigin to stimulate expression of molecules involved in tissue remodeling and angiogenesis makes basigin a potential target for the development of strategies to block metastasis. However, the identity of the cell surface receptor for basigin remains controversial. The goal of this study was to determine the identity of the receptor for basigin. Using a novel recombinant basigin protein (rBSG) corresponding to the extracellular domain of basigin, it was demonstrated that the native, nonglycosylated rBSG protein forms dimers in solution. Furthermore, rBSG binds to the surface of uterine fibroblasts, activates the ERK1/2 signaling pathway, and induces expression of matrix metalloproteinases 1, 2, and 3. Proteins that interact with rBSG were isolated using a biotin label transfer technique and sequenced by matrix-assisted laser desorption ionization tandem mass spectrophotometry. The results demonstrate that rBSG interacts with basigin expressed on the surface of fibroblasts and is subsequently internalized. During internalization, rBSG associates with a novel form of human basigin (basigin-3). It was concluded that cell surface basigin functions as a membrane receptor for soluble basigin and this homophilic interaction is not dependent upon glycosylation of the basigin ligand. PMID:18434307

  19. Murine Polyomavirus Cell Surface Receptors Activate Distinct Signaling Pathways Required for Infection.

    PubMed

    O'Hara, Samantha D; Garcea, Robert L

    2016-11-01

    Virus binding to the cell surface triggers an array of host responses, including activation of specific signaling pathways that facilitate steps in virus entry. Using mouse polyomavirus (MuPyV), we identified host signaling pathways activated upon virus binding to mouse embryonic fibroblasts (MEFs). Pathways activated by MuPyV included the phosphatidylinositol 3-kinase (PI3K), FAK/SRC, and mitogen-activated protein kinase (MAPK) pathways. Gangliosides and α4-integrin are required receptors for MuPyV infection. MuPyV binding to both gangliosides and the α4-integrin receptors was required for activation of the PI3K pathway; however, either receptor interaction alone was sufficient for activation of the MAPK pathway. Using small-molecule inhibitors, we confirmed that the PI3K and FAK/SRC pathways were required for MuPyV infection, while the MAPK pathway was dispensable. Mechanistically, the PI3K pathway was required for MuPyV endocytosis, while the FAK/SRC pathway enabled trafficking of MuPyV along microtubules. Thus, MuPyV interactions with specific cell surface receptors facilitate activation of signaling pathways required for virus entry and trafficking. Understanding how different viruses manipulate cell signaling pathways through interactions with host receptors could lead to the identification of new therapeutic targets for viral infection. Virus binding to cell surface receptors initiates outside-in signaling that leads to virus endocytosis and subsequent virus trafficking. How different viruses manipulate cell signaling through interactions with host receptors remains unclear, and elucidation of the specific receptors and signaling pathways required for virus infection may lead to new therapeutic targets. In this study, we determined that gangliosides and α4-integrin mediate mouse polyomavirus (MuPyV) activation of host signaling pathways. Of these pathways, the PI3K and FAK/SRC pathways were required for MuPyV infection. Both the PI3K and FAK/SRC pathways have been implicated in human diseases, such as heart disease and cancer, and inhibitors directed against these pathways are currently being investigated as therapies. It is possible that these pathways play a role in human PyV infections and could be targeted to inhibit PyV infection in immunosuppressed patients. Copyright © 2016 O’Hara and Garcea.

  20. Sialic acid-dependent cell entry of human enterovirus D68

    DOE PAGES

    Liu, Yue; Sheng, Ju; Baggen, Jim; ...

    2015-11-13

    Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon’ on the virus surface. The sialic acid receptor induces a cascade of conformational changes inmore » the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Furthermore, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry.« less

  1. G-Protein Coupled Receptors: Surface Display and Biosensor Technology

    NASA Astrophysics Data System (ADS)

    McMurchie, Edward; Leifert, Wayne

    Signal transduction by G-protein coupled receptors (GPCRs) underpins a multitude of physiological processes. Ligand recognition by the receptor leads to the activation of a generic molecular switch involving heterotrimeric G-proteins and guanine nucleotides. With growing interest and commercial investment in GPCRs in areas such as drug targets, orphan receptors, high-throughput screening of drugs and biosensors, greater attention will focus on assay development to allow for miniaturization, ultrahigh-throughput and, eventually, microarray/biochip assay formats that will require nanotechnology-based approaches. Stable, robust, cell-free signaling assemblies comprising receptor and appropriate molecular switching components will form the basis of future GPCR/G-protein platforms, which should be able to be adapted to such applications as microarrays and biosensors. This chapter focuses on cell-free GPCR assay nanotechnologies and describes some molecular biological approaches for the construction of more sophisticated, surface-immobilized, homogeneous, functional GPCR sensors. The latter points should greatly extend the range of applications to which technologies based on GPCRs could be applied.

  2. Sialic acid-dependent cell entry of human enterovirus D68

    PubMed Central

    Liu, Yue; Sheng, Ju; Baggen, Jim; Meng, Geng; Xiao, Chuan; Thibaut, Hendrik J.; van Kuppeveld, Frank J. M.; Rossmann, Michael G.

    2015-01-01

    Human enterovirus D68 (EV-D68) is a causative agent of childhood respiratory diseases and has now emerged as a global public health threat. Nevertheless, knowledge of the tissue tropism and pathogenesis of EV-D68 has been hindered by a lack of studies on the receptor-mediated EV-D68 entry into host cells. Here we demonstrate that cell surface sialic acid is essential for EV-D68 to bind to and infect susceptible cells. Crystal structures of EV-D68 in complex with sialylated glycan receptor analogues show that they bind into the ‘canyon' on the virus surface. The sialic acid receptor induces a cascade of conformational changes in the virus to eject a fatty-acid-like molecule that regulates the stability of the virus. Thus, virus binding to a sialic acid receptor and to immunoglobulin-like receptors used by most other enteroviruses share a conserved mechanism for priming viral uncoating and facilitating cell entry. PMID:26563423

  3. Molecular recognition at adenine nucleotide (P2) receptors in platelets.

    PubMed

    Jacobson, Kenneth A; Mamedova, Liaman; Joshi, Bhalchandra V; Besada, Pedro; Costanzi, Stefano

    2005-04-01

    Transmembrane signaling through P2Y receptors for extracellular nucleotides controls a diverse array of cellular processes, including thrombosis. Selective agonists and antagonists of the two P2Y receptors present on the platelet surface-the G (q)-coupled P2Y (1) subtype and the G (i)-coupled P2Y (12) subtype-are now known. High-affinity antagonists of each have been developed from nucleotide structures. The (N)-methanocarba bisphosphate derivatives MRS2279 and MRS2500 are potent and selective P2Y (1) receptor antagonists. The carbocyclic nucleoside AZD6140 is an uncharged, orally active P2Y (12) receptor antagonist of nM affinity. Another nucleotide receptor on the platelet surface, the P2X (1) receptor, the activation of which may also be proaggregatory, especially under conditions of high shear stress, has high-affinity ligands, although high selectivity has not yet been achieved. Although alpha,beta-methylene-adenosine triphosphate (ATP) is the classic agonist for the P2X (1) receptor, where it causes rapid desensitization, the agonist BzATP is among the most potent in activating this subtype. The aromatic sulfonates NF279 and NF449 are potent antagonists of the P2X (1) receptor. The structures of the two platelet P2Y receptors have been modeled, based on a rhodopsin template, to explain the basis for nucleotide recognition within the putative transmembrane binding sites. The P2Y (1) receptor model, especially, has been exploited in the design and optimization of antagonists targeted to interact selectively with that subtype.

  4. Exploiting cancer’s phenotypic guise against itself: targeting ectopically expressed peptide G-protein coupled receptors for lung cancer therapy

    PubMed Central

    Khan, Mahjabin; Huang, Tao; Lin, Cheng-Yuan; Wu, Jiang; Fan, Bao-Min; Bian, Zhao-Xiang

    2017-01-01

    Lung cancer, claiming millions of lives annually, has the highest mortality rate worldwide. This advocates the development of novel cancer therapies that are highly toxic for cancer cells but negligibly toxic for healthy cells. One of the effective treatments is targeting overexpressed surface receptors of cancer cells with receptor-specific drugs. The receptors-in-focus in the current review are the G-protein coupled receptors (GPCRs), which are often overexpressed in various types of tumors. The peptide subfamily of GPCRs is the pivot of the current article owing to the high affinity and specificity to and of their cognate peptide ligands, and the proven efficacy of peptide-based therapeutics. The article summarizes various ectopically expressed peptide GPCRs in lung cancer, namely, Cholecystokinin-B/Gastrin receptor, the Bombesin receptor family, Bradykinin B1 and B2 receptors, Arginine vasopressin receptors 1a, 1b and 2, and the Somatostatin receptor type 2. The autocrine growth and pro-proliferative pathways they mediate, and the distinct tumor-inhibitory effects of somatostatin receptors are then discussed. The next section covers how these pathways may be influenced or ‘corrected’ through therapeutics (involving agonists and antagonists) targeting the overexpressed peptide GPCRs. The review proceeds on to Nano-scaled delivery platforms, which enclose chemotherapeutic agents and are decorated with peptide ligands on their external surface, as an effective means of targeting cancer cells. We conclude that targeting these overexpressed peptide GPCRs is potentially evolving as a highly promising form of lung cancer therapy. PMID:29262666

  5. Structure and signalling functions of C3 receptors on human B cells.

    PubMed

    Frade, R

    1990-03-01

    CR1 (C3b receptor) and CR2 (C3d/EBV receptor) are two C3 receptors expressed on B lymphocytes. CR1 and CR2 have structural similarities and their cross-linking at the B cell surface by antibodies or specific ligands in multimeric forms induce B cell activation. However, activation of human B cells through cell surface interactions or by intracellular protein kinase C activators leads to phosphorylation of CR2 but not CR1. CR2 is phosphorylated on serine and tyrosine residues. Analysis of post-membrane events associated with CR2 revealed intracellular interactions of CR2 with p53, a plasma membrane anti-oncogene-encoded phosphoprotein, and with p120, a nuclear phosphoribonucleoprotein. These intracellular interactions probably represent important steps in the signalling functions of CR2.

  6. Probing transmembrane mechanical coupling and cytomechanics using magnetic twisting cytometry

    NASA Technical Reports Server (NTRS)

    Wang, N.; Ingber, D. E.

    1995-01-01

    We recently developed a magnetic twisting cytometry technique that allows us to apply controlled mechanical stresses to specific cell surface receptors using ligand-coated ferromagnetic microbeads and to simultaneously measure the mechanical response in living cells. Using this technique, we have previously shown the following: (i) beta 1 integrin receptors mediate mechanical force transfer across the cell surface and to the cytoskeleton, whereas other transmembrane receptors (e.g., scavenger receptors) do not; (ii) cytoskeletal stiffness increases in direct proportion to the level of stress applied to integrins; and (iii) the slope of this linear stiffening response differs depending on the shape of the cell. We now show that different integrins (beta 1, alpha V beta 3, alpha V, alpha 5, alpha 2) and other transmembrane receptors (scavenger receptor, platelet endothelial cell adhesion molecule) differ in their ability to mediate force transfer across the cell surface. In addition, the linear stiffening behavior previously observed in endothelial cells was found to be shared by other cell types. Finally, we demonstrate that dynamic changes in cell shape that occur during both cell spreading and retraction are accompanied by coordinate changes in cytoskeletal stiffness. Taken together, these results suggest that the magnetic twisting cytometry technique may be a powerful and versatile tool for studies analyzing the molecular basis of transmembrane mechanical coupling to the cytoskeleton as well as dynamic relations between changes in cytoskeletal structure and alterations in cell form and function.

  7. Direct recognition of superparamagnetic nanocrystals by macrophage scavenger receptor SR-AI.

    PubMed

    Chao, Ying; Karmali, Priya P; Mukthavaram, Rajesh; Kesari, Santosh; Kouznetsova, Valentina L; Tsigelny, Igor F; Simberg, Dmitri

    2013-05-28

    Scavenger receptors (SRs) are molecular pattern recognition receptors that have been shown to mediate opsonin-independent uptake of therapeutic and imaging nanoparticles, underlying the importance of SRs in nanomedicine. Unlike pathogens, engineered nanomaterials offer great flexibility in control of surface properties, allowing addressing specific questions regarding the molecular mechanisms of nanoparticle recognition. Recently, we showed that SR-type AI/II mediates opsonin-independent internalization of dextran superparamagnetic iron oxide (SPIO) nanoparticles via positively charged extracellular collagen-like domain. To understand the mechanism of opsonin-independent SPIO recognition, we tested the binding and uptake of nanoparticles with different surface coatings by SR-AI. SPIO coated with 10 kDa dextran was efficiently recognized and taken up by SR-AI transfected cells and J774 macrophages, while SPIO with 20 kDa dextran coating or cross-linked dextran hydrogel avoided the binding and uptake. Nanoparticle negative charge density and zeta-potential did not correlate with SR-AI binding/uptake efficiency. Additional experiments and computer modeling revealed that recognition of the iron oxide crystalline core by the positively charged collagen-like domain of SR-AI is sterically hindered by surface polymer coating. Importantly, the modeling revealed a strong complementarity between the surface Fe-OH groups of the magnetite crystal and the charged lysines of the collagen-like domain of SR-AI, suggesting a specific recognition of SPIO crystalline surface. These data provide an insight into the molecular recognition of nanocrystals by innate immunity receptors and the mechanisms whereby polymer coatings promote immune evasion.

  8. Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

    DTIC Science & Technology

    2002-01-01

    the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

  9. Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors

    PubMed Central

    Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram

    2012-01-01

    The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn91 in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus. PMID:22642577

  10. Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors.

    PubMed

    Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram

    2012-06-15

    The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn(91) in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus.

  11. T-cell receptor revision: friend or foe?

    PubMed

    Hale, J Scott; Fink, Pamela J

    2010-04-01

    T-cell receptor (TCR) revision is a process of tolerance induction by which peripheral T cells lose surface expression of an autoreactive TCR, reinduce expression of the recombinase machinery, rearrange genes encoding extrathymically generated TCRs for antigen, and express these new receptors on the cell surface. We discuss the evidence for this controversial tolerance mechanism below. Despite the apparent heresy of post-thymic gene rearrangement, we argue here that TCR revision follows the rules obeyed by maturing thymocytes undergoing gene recombination. Expression of the recombinase is carefully controlled both spatially and temporally, and may be initiated by loss of signals through surface TCRs. The resulting TCR repertoire is characterized by its diversity, self major histocompatibility complex restriction, self tolerance, and ability to mount productive immune responses specific for foreign antigens. Hence, TCR revision is a carefully regulated process of tolerance induction that can contribute to the protection of the individual against invading pathogens while preserving the integrity of self tissue.

  12. Structural basis for methylesterase CheB regulation by a phosphorylation-activated domain

    PubMed Central

    Djordjevic, Snezana; Goudreau, Paul N.; Xu, Qingping; Stock, Ann M.; West, Ann H.

    1998-01-01

    We report the x-ray crystal structure of the methylesterase CheB, a phosphorylation-activated response regulator involved in reversible modification of bacterial chemotaxis receptors. Methylesterase CheB and methyltransferase CheR modulate signaling output of the chemotaxis receptors by controlling the level of receptor methylation. The structure of CheB, which consists of an N-terminal regulatory domain and a C-terminal catalytic domain joined by a linker, was solved by molecular replacement methods using independent search models for the two domains. In unphosphorylated CheB, the N-terminal domain packs against the active site of the C-terminal domain and thus inhibits methylesterase activity by directly restricting access to the active site. We propose that phosphorylation of CheB induces a conformational change in the regulatory domain that disrupts the domain interface, resulting in a repositioning of the domains and allowing access to the active site. Structural similarity between the two companion receptor modification enzymes, CheB and CheR, suggests an evolutionary and/or functional relationship. Specifically, the phosphorylated N-terminal domain of CheB may facilitate interaction with the receptors, similar to the postulated role of the N-terminal domain of CheR. Examination of surfaces in the N-terminal regulatory domain of CheB suggests that despite a common fold throughout the response regulator family, surfaces used for protein–protein interactions differ significantly. Comparison between CheB and other response regulators indicates that analogous surfaces are used for different functions and conversely, similar functions are mediated by different molecular surfaces. PMID:9465023

  13. Poliovirus Mutants Resistant to Neutralization with Soluble Cell Receptors

    NASA Astrophysics Data System (ADS)

    Kaplan, Gerardo; Peters, David; Racaniello, Vincent R.

    1990-12-01

    Poliovirus mutants resistant to neutralization with soluble cellular receptor were isolated. Replication of soluble receptor-resistant (srr) mutants was blocked by a monoclonal antibody directed against the HeLa cell receptor for poliovirus, indicating that the mutants use this receptor to enter cells. The srr mutants showed reduced binding to HeLa cells and cell membranes. However, the reduced binding phenotype did not have a major impact on viral replication, as judged by plaque size and one-step growth curves. These results suggest that the use of soluble receptors as antiviral agents could lead to the selection of neutralization-resistant mutants that are able to bind cell surface receptors, replicate, and cause disease.

  14. Amplification of anion sensing by disulfide functionalized ferrocene and ferrocene-calixarene receptors adsorbed onto gold surfaces.

    PubMed

    Cormode, David P; Evans, Andrew J; Davis, Jason J; Beer, Paul D

    2010-07-28

    A disulfide functionalized bis-ferrocene urea acyclic receptor and disulfide functionalized mono- and bis-ferrocene amide and urea appended upper rim calix[4]arene receptors were prepared for the fabrication of SAM redox-active anion sensors. 1H NMR and diffusive voltammetric anion recognition investigations revealed each receptor to be capable of complexing and electrochemically sensing anions via cathodic perturbations of the respective receptor's ferrocene/ferrocenium redox couple. SAMs of a ferrocene urea receptor 3 and ferrocene urea calixarene receptor 17 exhibited significant enhanced magnitudes of cathodic response upon anion addition as compared to observed diffusive perturbations. SAMs of 17 were demonstrated to sense the perrhenate anion in aqueous solutions.

  15. 5D-QSAR for spirocyclic sigma1 receptor ligands by Quasar receptor surface modeling.

    PubMed

    Oberdorf, Christoph; Schmidt, Thomas J; Wünsch, Bernhard

    2010-07-01

    Based on a contiguous and structurally as well as biologically diverse set of 87 sigma(1) ligands, a 5D-QSAR study was conducted in which a quasi-atomistic receptor surface modeling approach (program package Quasar) was applied. The superposition of the ligands was performed with the tool Pharmacophore Elucidation (MOE-package), which takes all conformations of the ligands into account. This procedure led to four pharmacophoric structural elements with aromatic, hydrophobic, cationic and H-bond acceptor properties. Using the aligned structures a 3D-model of the ligand binding site of the sigma(1) receptor was obtained, whose general features are in good agreement with previous assumptions on the receptor structure, but revealed some novel insights since it represents the receptor surface in more detail. Thus, e.g., our model indicates the presence of an H-bond acceptor moiety in the binding site as counterpart to the ligands' cationic ammonium center, rather than a negatively charged carboxylate group. The presented QSAR model is statistically valid and represents the biological data of all tested compounds, including a test set of 21 ligands not used in the modeling process, with very good to excellent accuracy [q(2) (training set, n=66; leave 1/3 out) = 0.84, p(2) (test set, n=21)=0.64]. Moreover, the binding affinities of 13 further spirocyclic sigma(1) ligands were predicted with reasonable accuracy (mean deviation in pK(i) approximately 0.8). Thus, in addition to novel insights into the requirements for binding of spirocyclic piperidines to the sigma(1) receptor, the presented model can be used successfully in the rational design of new sigma(1) ligands. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

  16. A novel thromboxane A2 receptor N42S variant results in reduced surface expression and platelet dysfunction.

    PubMed

    Nisar, Shaista P; Lordkipanidzé, Marie; Jones, Matthew L; Dawood, Ban; Murden, Sherina; Cunningham, Margaret R; Mumford, Andrew D; Wilde, Jonathan T; Watson, Steve P; Mundell, Stuart J; Lowe, Gillian C

    2014-05-05

    A small number of thromboxane receptor variants have been described in patients with a bleeding history that result in platelet dysfunction. We have identified a patient with a history of significant bleeding, who expresses a novel heterozygous thromboxane receptor variant that predicts an asparagine to serine substitution (N42S). This asparagine is conserved across all class A GPCRs, suggesting a vital role for receptor structure and function.We investigated the functional consequences of the TP receptor heterozygous N42S substitution by performing platelet function studies on platelet-rich plasma taken from the patient and healthy controls. We investigated the N42S mutation by expressing the wild-type (WT) and mutant receptor in human embryonic kidney (HEK) cells. Aggregation studies showed an ablation of arachidonic acid responses in the patient, whilst there was right-ward shift of the U46619 concentration response curve (CRC). Thromboxane generation was unaffected. Calcium mobilisation studies in cells lines showed a rightward shift of the U46619 CRC in N42S-expressing cells compared to WT. Radioligand binding studies revealed a reduction in BMax in platelets taken from the patient and in N42S-expressing cells, whilst cell studies confirmed poor surface expression. We have identified a novel thromboxane receptor variant, N42S, which results in platelet dysfunction due to reduced surface expression. It is associated with a significant bleeding history in the patient in whom it was identified. This is the first description of a naturally occurring variant that results in the substitution of this highly conserved residue and confirms the importance of this residue for correct GPCR function.

  17. Ligand-induced type II interleukin-4 receptor dimers are sustained by rapid re-association within plasma membrane microcompartments

    NASA Astrophysics Data System (ADS)

    Richter, David; Moraga, Ignacio; Winkelmann, Hauke; Birkholz, Oliver; Wilmes, Stephan; Schulte, Markos; Kraich, Michael; Kenneweg, Hella; Beutel, Oliver; Selenschik, Philipp; Paterok, Dirk; Gavutis, Martynas; Schmidt, Thomas; Garcia, K. Christopher; Müller, Thomas D.; Piehler, Jacob

    2017-07-01

    The spatiotemporal organization of cytokine receptors in the plasma membrane is still debated with models ranging from ligand-independent receptor pre-dimerization to ligand-induced receptor dimerization occurring only after receptor uptake into endosomes. Here, we explore the molecular and cellular determinants governing the assembly of the type II interleukin-4 receptor, taking advantage of various agonists binding the receptor subunits with different affinities and rate constants. Quantitative kinetic studies using artificial membranes confirm that receptor dimerization is governed by the two-dimensional ligand-receptor interactions and identify a critical role of the transmembrane domain in receptor dimerization. Single molecule localization microscopy at physiological cell surface expression levels, however, reveals efficient ligand-induced receptor dimerization by all ligands, largely independent of receptor binding affinities, in line with the similar STAT6 activation potencies observed for all IL-4 variants. Detailed spatiotemporal analyses suggest that kinetic trapping of receptor dimers in actin-dependent microcompartments sustains robust receptor dimerization and signalling.

  18. Characterization of surface interleukin-2 receptor expression on gated populations of peripheral blood mononuclear cells from manatees, Trichechus manatus latirostris.

    PubMed

    Sweat, J M; Johnson, C M; Marikar, Y; Gibbs, E P

    2005-12-15

    An in vitro system to determine surface interleukin-2 receptor (IL-2R) expression on mitogen-stimulated peripheral blood mononuclear cells (PBMC) from free-ranging manatees, Trichechus manatus latirostris was developed. Human recombinant IL-2, conjugated with a fluorescein dye was used in conjunction with flow cytometric analysis to determine changes in surface expression of IL-2R at sequential times over a 48-h period of in vitro stimulation. Surface expression of IL-2R was detected on manatee PBMC, which also cross-reacted with an anti-feline pan T-cell marker. An expression index (EI) was calculated by comparing mitogen-activated and non-activated PBMC. Based on side- and forward-scatter properties, flow cytometric analysis showed an increase in the number of larger, more granular "lymphoblasts" following concanavalin A (Con A) stimulation. The appearance of lymphoblasts was correlated with an increase in their surface expression of IL-2 receptors. Surface IL-2R expression, in Con A-stimulated PBMC, was detected at 16 h, peaked at 24-36 h, and began to decrease by 48 h. Characterization of the IL-2R expression should provide additional information on the health status of manatees, and the effect of their sub lethal exposure to brevetoxin.

  19. Insulin Mimetic Peptide Disrupts the Primary Binding Site of the Insulin Receptor*

    PubMed Central

    Lawrence, Callum F.; Margetts, Mai B.; Menting, John G.; Smith, Nicholas A.; Smith, Brian J.; Ward, Colin W.; Lawrence, Michael C.

    2016-01-01

    Sets of synthetic peptides that interact with the insulin receptor ectodomain have been discovered by phage display and reported in the literature. These peptides were grouped into three classes termed Site 1, Site 2, and Site 3 based on their mutual competition of binding to the receptor. Further refinement has yielded, in particular, a 36-residue Site 2-Site 1 fusion peptide, S519, that binds the insulin receptor with subnanomolar affinity and exhibits agonist activity in both lipogenesis and glucose uptake assays. Here, we report three-dimensional crystallographic detail of the interaction of the C-terminal, 16-residue Site 1 component (S519C16) of S519 with the first leucine-rich repeat domain (L1) of the insulin receptor. Our structure shows that S519C16 binds to the same site on the L1 surface as that occupied by a critical component of the primary binding site, namely the helical C-terminal segment of the insulin receptor α-chain (termed αCT). In particular, the two phenylalanine residues within the FYXWF motif of S519C16 are seen to engage the insulin receptor L1 domain surface in a fashion almost identical to the respective αCT residues Phe701 and Phe705. The structure provides a platform for the further development of peptidic and/or small molecule agents directed toward the insulin receptor and/or the type 1 insulin-like growth factor receptor. PMID:27281820

  20. Highly sensitive graphene biosensor by monomolecular self-assembly of receptors on graphene surface

    NASA Astrophysics Data System (ADS)

    Kim, Ji Eun; No, Young Hyun; Kim, Joo Nam; Shin, Yong Seon; Kang, Won Tae; Kim, Young Rae; Kim, Kun Nyun; Kim, Yong Ho; Yu, Woo Jong

    2017-05-01

    Graphene has attracted a great deal of interest for applications in bio-sensing devices because of its ultra-thin structure, which enables strong electrostatic coupling with target molecules, and its excellent electrical mobility promising for ultra-fast sensing speeds. However, thickly stacked receptors on the graphene's surface interrupts electrostatic coupling between graphene and charged biomolecules, which can reduce the sensitivity of graphene biosensors. Here, we report a highly sensitive graphene biosensor by the monomolecular self-assembly of designed peptide protein receptors. The graphene channel was non-covalently functionalized using peptide protein receptors via the π-π interaction along the graphene's Bravais lattice, allowing ultra-thin monomolecular self-assembly through the graphene lattice. In thickness dependent characterization, a graphene sensor with a monomolecular receptor (thickness less than 3 nm) showed five times higher sensitivity and three times higher voltage shifts than graphene sensors with thick receptor stacks (thicknesses greater than 20 nm), which is attributed to excellent gate coupling between graphene and streptavidin via an ultrathin receptor insulator. In addition to having a fast-inherent response time (less than 0.6 s) based on fast binding speed between biotin and streptavidin, our graphene biosensor is a promising platform for highly sensitive real-time monitoring of biomolecules with high spatiotemporal resolution.

  1. Role of receptor occupancy assays by flow cytometry in drug development.

    PubMed

    Stewart, Jennifer J; Green, Cherie L; Jones, Nicholas; Liang, Meina; Xu, Yuanxin; Wilkins, Danice E C; Moulard, Maxime; Czechowska, Kamila; Lanham, David; McCloskey, Thomas W; Ferbas, John; van der Strate, Barry W A; Högerkorp, Carl-Magnus; Wyant, Timothy; Lackey, Alan; Litwin, Virginia

    2016-03-01

    The measurement of the binding of a biotherapeutic to its cellular target, receptor occupancy (RO), is increasingly important in development of biologically-based therapeutic agents. Receptor occupancy (RO) assays by flow cytometry describe the qualitative and/or quantitative assessment of the binding of a therapeutic agent to its cell surface target. Such RO assays can be as simple as measuring the number of cell surface receptors bound by an antireceptor therapeutic agent or can be designed to address more complicated scenarios such as internalization or shedding events once a receptor engages the administered therapeutic agent. Data generated from RO assays can also be used to model whether given doses of an experimental therapeutic agent and their administration schedules lead to predicted levels of receptor occupancy and whether the receptor is modulated (up or down) on cells engaged by the therapeutic agent. There are a variety of approaches that can be used when undertaking RO assays and with the ability to measure distinct subsets in heterogeneous populations, flow cytometry is ideally suited to RO measurements. This article highlights the importance of RO assays on the flow cytometric platform in the development of biotherapeutic agents. © 2016 The Authors Cytometry Part B: Clinical Cytometry Published by Wiley Periodicals, Inc.

  2. Inhibition of experimental ascending urinary tract infection by an epithelial cell-surface receptor analogue

    NASA Astrophysics Data System (ADS)

    Edén, C. Svanborg; Freter, R.; Hagberg, L.; Hull, R.; Hull, S.; Leffler, H.; Schoolnik, G.

    1982-08-01

    It has been shown that the establishment of urinary tract infection by Escherichia coli is dependent on attachment of the bacteria to epithelial cells1-4. The attachment involves specific epithelial cell receptors, which have been characterized as glycolipids5-10. Reversible binding to cell-surface mannosides may also be important4,11-13. This suggests an approach to the treatment of infections-that of blocking bacterial attachment with cell membrane receptor analogues. Using E. coli mutants lacking one or other of the two binding specificities (glycolipid and mannose), we show here that glycolipid analogues can block in vitro adhesion and in vivo urinary tract infection.

  3. A fractal analysis of protein to DNA binding kinetics using biosensors.

    PubMed

    Sadana, Ajit

    2003-08-01

    A fractal analysis of a confirmative nature only is presented for the binding of estrogen receptor (ER) in solution to its corresponding DNA (estrogen response element, ERE) immobilized on a sensor chip surface [J. Biol. Chem. 272 (1997) 11384], and for the cooperative binding of human 1,25-dihydroxyvitamin D(3) receptor (VDR) to DNA with the 9-cis-retinoic acid receptor (RXR) [Biochemistry 35 (1996) 3309]. Ligands were also used to modulate the first reaction. Data taken from the literature may be modeled by using a single- or a dual-fractal analysis. Relationships are presented for the binding rate coefficient as a function of either the analyte concentration in solution or the fractal dimension that exists on the biosensor surface. The binding rate expressions developed exhibit a wide range of dependence on the degree of heterogeneity that exists on the surface, ranging from sensitive (order of dependence equal to 1.202) to very sensitive (order of dependence equal to 12.239). In general, the binding rate coefficient increases as the degree of heterogeneity or the fractal dimension of the surface increases. The predictive relationships presented provide further physical insights into the reactions occurring on the biosensor surface. Even though these reactions are occurring on the biosensor surface, the relationships presented should assist in understanding and in possibly manipulating the reactions occurring on cellular surfaces.

  4. Cell-specific targeting by heterobivalent ligands.

    PubMed

    Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J

    2011-07-20

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.

  5. Cell-Specific Targeting by Heterobivalent Ligands

    PubMed Central

    Josan, Jatinder S.; Handl, Heather L.; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M.; Vagner, Josef; Mash, Eugene A.; Hruby, Victor J.; Gillies, Robert J.

    2012-01-01

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach—to specifically target combinations of cell-surface receptors using heteromultivalent ligands (“receptor combination approach”). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle4, DPhe7]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20–50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH2. Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging. PMID:21639139

  6. Appropriate polarization following pharmacological rescue of V2 vasopressin receptors encoded by X-linked nephrogenic diabetes insipidus alleles involves a conformation of the receptor that also attains mature glycosylation.

    PubMed

    Tan, Christopher M; Nickols, Hilary Highfield; Limbird, Lee E

    2003-09-12

    To understand the mechanisms of G protein-coupled receptor delivery and steady state localization, we examined the trafficking itineraries of wild type (WT) and mutant V2 vasopressin receptors (V2Rs) in polarized Madin-Darby canine kidney II (MDCK II) cells and in COS M6 cells; the mutant V2Rs represent selected alleles responsible for X-linked nephrogenic diabetes insipidus. The WT V2R is localized on the plasma membrane and mediates arginine vasopressin (AVP)-stimulated cAMP accumulation, whereas the clinically relevant V2R mutants, L292P V2R, Delta V278 V2R, and R337X V2R, are retained intracellularly, are insensitive to extracellularly added AVP, and are not processed beyond initial immature glycosylation, manifest by their endoglycosidase H sensitivity. Reduced temperature and pharmacological, but not chemical, strategies rescue mutant V2Rs to the cell surface of COS M6 cells; surface rescue of L292P V2R and R337X V2R, but not of Delta V278 V2R, parallels acquisition of AVP-stimulated cAMP production. Pharmacological rescue of the L292P or R337X V2R by incubation with the membrane-permeant V2R antagonist, SR121463B, leads to a mature glycosylated form of the receptor that achieves localization on the basolateral surface of polarized MDCK II cells indistinguishable from that of the WT V2R. Surprisingly, however, the immature form of the mutant L292P V2R escapes to the apical, but not basolateral, surface of polarized MDCK II cells, even in the absence of SR121463B. These findings are consistent with the interpretation that the receptor conformation that allows appropriate processing through the N-linked glycosylation pathway is also essential for V2R targeting to the appropriate surface of polarized epithelial cells.

  7. The glucagon-like peptide-2 receptor C terminus modulates beta-arrestin-2 association but is dispensable for ligand-induced desensitization, endocytosis, and G-protein-dependent effector activation.

    PubMed

    Estall, Jennifer L; Koehler, Jacqueline A; Yusta, Bernardo; Drucker, Daniel J

    2005-06-10

    Classic models of receptor desensitization and internalization have been largely based on the behavior of Family A G-protein-coupled receptors (GPCRs). The glucagon-like peptide-2 receptor (GLP-2R) is a member of the Family B glucagon-secretin GPCR family, which exhibit significant sequence and structural differences from the Family A receptors in their intracellular and extracellular domains. To identify structural motifs that regulate GLP-2R signaling and cell surface receptor expression, we analyzed the functional properties of a series of mutant GLP-2Rs. The majority of the C-terminal receptor tail was dispensable for GLP-2-induced cAMP accumulation, ERK1/2 activation, and endocytosis in transfected cells. However, progressive truncation of the C terminus reduced cell surface receptor expression, altered agonist-induced GLP-2R trafficking, and abrogated protein kinase A-mediated heterologous receptor desensitization. Elimination of the distal 21 amino acids of the receptor was sufficient to promote constitutive receptor internalization and prevent agonist-induced recruitment of beta-arrestin-2. Site-directed mutagenesis identified specific amino acid residues within the distal GLP-2R C terminus that mediate the stable association with beta-arrestin-2. Surprisingly, although the truncated mutant receptors failed to interact with beta-arrestin-2, they underwent homologous desensitization and subsequent resensitization with kinetics similar to that observed with the wild-type GLP-2R. Our data suggest that, although the GLP-2R C terminus is not required for coupling to cellular machinery regulating signaling or desensitization, it may serve as a sorting signal for intracellular trafficking. Taken together with the previously demonstrated clathrin and dynamin-independent, lipid-raft-dependent pathways for internalization, our data suggest that GLP-2 receptor signaling has evolved unique structural and functional mechanisms for control of receptor trafficking, desensitization, and resensitization.

  8. Modulation of Fc gamma receptors on I cells and monocytes by 15 hydroperoxyeicosatetranoic acid.

    PubMed

    Goodwin, J S; Gualde, N; Aldigier, J; Rigaud, M; Vanderhoek, J Y

    1984-01-01

    We investigated the effects of the 15-lipoxygenase products, 15 hydroperoxyeicosatetranoic acid (15 HPETE) and 15 hydroxyeicosatetranoic acid (15 HETE) on Fc gamma receptor expression on human T cells and monocytes. Incubation of these cells with 15 HPETE but not 15 HETE results in a shift to decreased density of Fc gamma receptors on the cell surface.

  9. Biology and clinical relevance of chemokines and chemokine receptors CXCR4 and CCR5 in human diseases

    PubMed Central

    Choi, Won-Tak; An, Jing

    2014-01-01

    Chemokines and their receptors are implicated in a wide range of human diseases, including acquired immune deficiency syndrome (AIDS). The entry of human immunodeficiency virus type 1 (HIV-1) into a cell is initiated by the interaction of the virus’s surface envelope proteins with two cell surface components of the target cell, namely CD4 and a chemokine co-receptor, usually CXCR4 or CCR5. Typical anti-HIV-1 agents include protease and reverse transcriptase inhibitors, but the targets of these agents tend to show rapid mutation rates. As such, strategies based on HIV-1 co-receptors have appeal because they target invariant host determinants. Chemokines and their receptors are also of general interest since they play important roles in numerous physiological and pathological processes in addition to AIDS. Therefore, intensive basic and translational research is ongoing for the dissection of their structure – function relationships in an effort to understand the molecular mechanism of chemokine – receptor interactions and signal transductions across cellular membranes. This paper reviews and discusses recent advances and the translation of new knowledge and discoveries into novel interventional strategies for clinical application. PMID:21565895

  10. Erythroblast transferrin receptors and transferrin kinetics in iron deficiency and various anemias

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muta, K.; Nishimura, J.; Ideguchi, H.

    1987-06-01

    To clarify the role of transferrin receptors in cases of altered iron metabolism in clinical pathological conditions, we studied: number of binding sites; affinity; and recycling kinetics of transferrin receptors on human erythroblasts. Since transferrin receptors are mainly present on erythroblasts, the number of surface transferrin receptors was determined by assay of binding of /sup 125/I-transferrin and the percentage of erythroblasts in bone marrow mononuclear cells. The number of binding sites on erythroblasts from patients with an iron deficiency anemia was significantly greater than in normal subjects. Among those with an aplastic anemia, hemolytic anemia, myelodysplastic syndrome, and polycythemia veramore » compared to normal subjects, there were no considerable differences in the numbers of binding sites. The dissociation constants (Kd) were measured using Scatchard analysis. The apparent Kd was unchanged (about 10 nmol/L) in patients and normal subjects. The kinetics of endocytosis and exocytosis of /sup 125/I-transferrin, examined by acid treatment, revealed no variations in recycling kinetics among the patients and normal subjects. These data suggest that iron uptake is regulated by modulation of the number of surface transferrin receptors, thereby reflecting the iron demand of the erythroblast.« less

  11. The neuronal Ca(2+) -binding protein 2 (NECAB2) interacts with the adenosine A(2A) receptor and modulates the cell surface expression and function of the receptor.

    PubMed

    Canela, Laia; Luján, Rafael; Lluís, Carme; Burgueño, Javier; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Ciruela, Francisco

    2007-09-01

    Heptaspanning membrane also known as G protein-coupled receptors (GPCR) do interact with a variety of intracellular proteins whose function is regulate receptor traffic and/or signaling. Using a yeast two-hybrid screen, NECAB2, a neuronal calcium binding protein, was identified as a binding partner for the adenosine A(2A) receptor (A(2A)R) interacting with its C-terminal domain. Co-localization, co-immunoprecipitation and pull-down experiments showed a close and specific interaction between A(2A)R and NECAB2 in both transfected HEK-293 cells and also in rat striatum. Immunoelectron microscopy detection of NECAB2 and A(2A)R in the rat striatopallidal structures indicated that both proteins are co-distributed in the same glutamatergic nerve terminals. The interaction of NECAB2 with A(2A)R modulated the cell surface expression, the ligand-dependent internalization and the receptor-mediated activation of the MAPK pathway. Overall, these results show that A(2A)R interacts with NECAB2 in striatal neurones co-expressing the two proteins and that the interaction is relevant for A(2A)R function.

  12. Reaction and Aggregation Dynamics of Cell Surface Receptors

    NASA Astrophysics Data System (ADS)

    Wang, Michelle Dong

    This dissertation is composed of both theoretical and experimental studies of cell surface receptor reaction and aggregation. Project I studies the reaction rate enhancement due to surface diffusion of a bulk dissolved ligand with its membrane embedded target, using numerical calculations. The results show that the reaction rate enhancement is determined by ligand surface adsorption and desorption kinetic rates, surface and bulk diffusion coefficients, and geometry. In particular, we demonstrate that the ligand surface adsorption and desorption kinetic rates, rather than their ratio (the equilibrium constant), are important in rate enhancement. The second and third projects are studies of acetylcholine receptor clusters on cultured rat myotubes using fluorescence techniques after labeling the receptors with tetramethylrhodamine -alpha-bungarotoxin. The second project studies when and where the clusters form by making time-lapse movies. The movies are made from overlay of the pseudocolored total internal reflection fluorescence (TIRF) images of the cluster, and the schlieren images of the cell cultures. These movies are the first movies made using TIRF, and they clearly show the cluster formation from the myoblast fusion, the first appearance of clusters, and the eventual disappearance of clusters. The third project studies the fine structural features of individual clusters observed under TIRF. The features were characterized with six parameters by developing a novel fluorescence technique: spatial fluorescence autocorrelation. These parameters were then used to study the feature variations with age, and with treatments of drugs (oligomycin and carbachol). The results show little variation with age. However, drug treatment induced significant changes in some parameters. These changes were different for oligomycin and carbachol, which indicates that the two drugs may eliminate clusters through different mechanisms.

  13. Mechanotransduction through Integrins

    NASA Technical Reports Server (NTRS)

    Ingber, Donald

    2004-01-01

    The goal of this project was to characterize the molecular mechanism by which cells recognize and respond to physical forces in their local environment. The project was based on the working hypothesis that cells sense mechanical stresses through cell surface integrin receptors and through their interconnections with the underlying cytoskeleton. Work completed and published in past funding period had provided direct support for this hypothesis. In particular, we demonstrated that application of mechanical stresses to activated integrin receptors (but not inactive integrins or other control transmembrane receptors) resulted in stress-dependent activation of the CAMP signaling pathway leading to gene transcription. We also showed that this form of mechanotransduction requires activation of heterotrimeric G proteins. In this grant, our specific aims included: 1) to characterize the signal processing capabilities of different integrins and other cell surface receptors, 2) to identify heterotrimeric G proteins that mediate CAMP signaling by stresses applied to integrins, 3) to identify molecules that mediate transmembrane mechanochemical coupling between integrins and G proteins, and 4) to use genome-wide gene expression profiling techniques to identify other genes and signaling pathways that are activated by mechanical forces transmitted over specific cell surface receptors. Elucidation of the mechanism by which cells sense mechanical stresses through integrins and translate them into a biochemical response should help us to understand the molecular basis of the cellular response to gravity as well as many other forms of mechanosensation and tissue regulation.

  14. Theory and simulations of adhesion receptor dimerization on membrane surfaces.

    PubMed

    Wu, Yinghao; Honig, Barry; Ben-Shaul, Avinoam

    2013-03-19

    The equilibrium constants of trans and cis dimerization of membrane bound (2D) and freely moving (3D) adhesion receptors are expressed and compared using elementary statistical-thermodynamics. Both processes are mediated by the binding of extracellular subdomains whose range of motion in the 2D environment is reduced upon dimerization, defining a thin reaction shell where dimer formation and dissociation take place. We show that the ratio between the 2D and 3D equilibrium constants can be expressed as a product of individual factors describing, respectively, the spatial ranges of motions of the adhesive domains, and their rotational freedom within the reaction shell. The results predicted by the theory are compared to those obtained from a novel, to our knowledge, dynamical simulations methodology, whereby pairs of receptors perform realistic translational, internal, and rotational motions in 2D and 3D. We use cadherins as our model system. The theory and simulations explain how the strength of cis and trans interactions of adhesive receptors are affected both by their presence in the constrained intermembrane space and by the 2D environment of membrane surfaces. Our work provides fundamental insights as to the mechanism of lateral clustering of adhesion receptors after cell-cell contact and, more generally, to the formation of lateral microclusters of proteins on cell surfaces. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  15. Localization of functional receptor epitopes on the structure of ciliary neurotrophic factor indicates a conserved, function-related epitope topography among helical cytokines.

    PubMed

    Panayotatos, N; Radziejewska, E; Acheson, A; Somogyi, R; Thadani, A; Hendrickson, W A; McDonald, N Q

    1995-06-09

    By rational mutagenesis, receptor-specific functional analysis, and visualization of complex formation in solution, we identified individual amino acid side chains involved specifically in the interaction of ciliary neurotrophic factor (CNTF) with CNTFR alpha and not with the beta-components, gp130 and LIFR. In the crystal structure, the side chains of these residues, which are located in helix A, the AB loop, helix B, and helix D, are surface accessible and are clustered in space, thus constituting an epitope for CNTFR alpha. By the same analysis, a partial epitope for gp130 was also identified on the surface of helix A that faces away from the alpha-epitope. Superposition of the CNTF and growth hormone structures showed that the location of these epitopes on CNTF is analogous to the location of the first and second receptor epitopes on the surface of growth hormone. Further comparison with proposed binding sites for alpha- and beta-receptors on interleukin-6 and leukemia inhibitory factor indicated that this epitope topology is conserved among helical cytokines. In each case, epitope I is utilized by the specificity-conferring component, whereas epitopes II and III are used by accessory components. Thus, in addition to a common fold, helical cytokines share a conserved order of receptor epitopes that is function related.

  16. Bacterial Surface Glycans: Microarray and QCM Strategies for Glycophenotyping and Exploration of Recognition by Host Receptors.

    PubMed

    Kalograiaki, Ioanna; Campanero-Rhodes, María A; Proverbio, Davide; Euba, Begoña; Garmendia, Junkal; Aastrup, Teodor; Solís, Dolores

    2018-01-01

    Bacterial surfaces are decorated with a diversity of carbohydrate structures that play important roles in the bacteria-host relationships. They may offer protection against host defense mechanisms, elicit strong antigenic responses, or serve as ligands for host receptors, including lectins of the innate immune system. Binding by these lectins may trigger defense responses or, alternatively, promote attachment, thereby enhancing infection. The outcome will depend on the particular bacterial surface landscape, which may substantially differ among species and strains. In this chapter, we describe two novel methods for exploring interactions directly on the bacterial surface, based on the generation of bacterial microarrays and quartz crystal microbalance (QCM) sensor chips. Bacterial microarrays enable profiling of accessible carbohydrate structures and screening of their recognition by host receptors, also providing information on binding avidity, while the QCM approach allows determination of binding affinity and kinetics. In both cases, the chief element is the use of entire bacterial cells, so that recognition of the bacterial glycan epitopes is explored in their natural environment. © 2018 Elsevier Inc. All rights reserved.

  17. Virtual Ligand Screening Using PL-PatchSurfer2, a Molecular Surface-Based Protein-Ligand Docking Method.

    PubMed

    Shin, Woong-Hee; Kihara, Daisuke

    2018-01-01

    Virtual screening is a computational technique for predicting a potent binding compound for a receptor protein from a ligand library. It has been a widely used in the drug discovery field to reduce the efforts of medicinal chemists to find hit compounds by experiments.Here, we introduce our novel structure-based virtual screening program, PL-PatchSurfer, which uses molecular surface representation with the three-dimensional Zernike descriptors, which is an effective mathematical representation for identifying physicochemical complementarities between local surfaces of a target protein and a ligand. The advantage of the surface-patch description is its tolerance on a receptor and compound structure variation. PL-PatchSurfer2 achieves higher accuracy on apo form and computationally modeled receptor structures than conventional structure-based virtual screening programs. Thus, PL-PatchSurfer2 opens up an opportunity for targets that do not have their crystal structures. The program is provided as a stand-alone program at http://kiharalab.org/plps2 . We also provide files for two ligand libraries, ChEMBL and ZINC Drug-like.

  18. Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.

    G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the nativemore » ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.« less

  19. B Cell Antigen Receptor Signaling and Internalization Are Mutually Exclusive Events

    PubMed Central

    Hou, Ping; Araujo, Elizabeth; Zhao, Tong; Zhang, Miao; Massenburg, Don; Veselits, Margaret; Doyle, Colleen; Dinner, Aaron R; Clark, Marcus R

    2006-01-01

    Engagement of the B cell antigen receptor initiates two concurrent processes, signaling and receptor internalization. While both are required for normal humoral immune responses, the relationship between these two processes is unknown. Herein, we demonstrate that following receptor ligation, a small subpopulation of B cell antigen receptors are inductively phosphorylated and selectively retained at the cell surface where they can serve as scaffolds for the assembly of signaling molecules. In contrast, the larger population of non-phosphorylated receptors is rapidly endocytosed. Each receptor can undergo only one of two mutually exclusive fates because the tyrosine-based motifs that mediate signaling when phosphorylated mediate internalization when not phosphorylated. Mathematical modeling indicates that the observed competition between receptor phosphorylation and internalization enhances signaling responses to low avidity ligands. PMID:16719564

  20. Blocking Blood Supply to Breast Carcinoma With a DNA Vaccine Encoding VEGF Receptor-2

    DTIC Science & Technology

    2006-03-01

    recognize antigens in the form of 8 to 10 amino acid long peptides, presented to T- cell receptors (TCRs) on the cell surface as complexes with major... receptor , and providing tumor- associated antigens , our DNA vaccine can efficiently activate DCs, NK cells , and CTLs, presumably in Peyer’s patches. The... immunoreceptor in immune cell activation and natural killing. Immunity. 2002;17:19-29. (5) Snyder MR, Weyand CM, Goronzy JJ. The double life of NK receptors

  1. Aspirin inhibits surface glycoprotein IIb/IIIa, P-selectin, CD63, and CD107a receptor expression on human platelets.

    PubMed

    McKenzie, Marcus E; Malinin, Alex I; Bell, Christopher R; Dzhanashvili, Alex; Horowitz, Eric D; Oshrine, Benjamin R; Atar, Dan; Serebruany, Victor L

    2003-04-01

    Platelet inhibition after aspirin therapy reduces the risk for the development of acute coronary syndromes. However, the mechanism by which aspirin affect platelets other than by prostaglandin blockade is unclear. We sought to determine the in vitro effects of aspirin on the surface expression of nine platelet receptors using whole blood flow cytometry. Blood from 24 healthy volunteers was incubated for 30 min with 1.8 and 7.2 mg/l phosphate-buffered saline-diluted acetylsalicylic acid in the presence or absence of apyrase. Platelet serotonin release, and the surface expression of platelet receptors with or without apyrase were determined using the following monoclonal antibodies: anit-CD41 [glycoprotein (GP)IIb/IIIa], CD42b (GPIb), CD62p (P-selectin), CD51/CD61 (vitronectin receptor), CD31 [platelet/endothelial cellular adhesion molecule-1 (PECAM-1)], CD107a [lysosomal associated membrane protein (LAMP)-1], CD107b (LAMP-2), CD63 (LIMP or LAMP-3), and CD151 (PETA-3). Samples were then immediately fixed with 2% paraformaldehyde, and run on the flow cytometer within 48 h. Aspirin does not affect serotonin release from human platelets. Dose-dependent inhibition of GPIIb/IIIa, P-selectin, CD63, and CD107a receptor expression was observed in the aspirin-treated whole-blood samples. Apyrase potentiates the effects of aspirin, and independently inhibits PECAM-1. In addition to the known effect of irreversibly inhibiting platelet cyclooxygenase-1, thereby blocking thromboxane A(2) synthesis, it appears that aspirin exhibits direct effects on selective major platelet receptors.

  2. The type II cGMP dependent protein kinase regulates GluA1 levels at the plasma membrane of developing cerebellar granule cells

    PubMed Central

    Incontro, Salvatore; Ciruela, Francisco; Ziff, Edward; Hofmann, Franz; Sánchez-Prieto, José; Torres, Magdalena

    2014-01-01

    Trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) is regulated by specific interactions with other proteins and by post-translational mechanisms, such as phosphorylation. We have found that the type II cGMP-dependent protein kinase (cGKII) phosphorylates GluA1 (formerly GluR1) at S845, augmenting the surface expression of AMPARs at both synaptic and extrasynaptic sites. Activation of cGKII by 8-Br-cGMP enhances the surface expression of GluA1, whereas its inhibition or suppression effectively diminished the expression of this protein at the cell surface. In granule cells, NMDA receptor activation (NMDAR) stimulates nitric oxide and cGMP production, which in turn activates cGKII and induces the phosphorylation of GluA1, promoting its accumulation in the plasma membrane. GluA1 is mainly incorporated into calcium permeable AMPARs as exposure to 8-Br-cGMP or NMDA activation enhanced AMPA-elicited calcium responses that are sensitive to NASPM inhibition. We summarize evidence for an increase of calcium permeable AMPA receptors downstream of NMDA receptor activation that might be relevant for granule cell development and plasticity. PMID:23545413

  3. Down-modulation of the G-protein-coupled Estrogen Receptor, GPER, from the Cell Surface Occurs via a trans-Golgi-Proteasome Pathway*

    PubMed Central

    Cheng, Shi-Bin; Quinn, Jeffrey A.; Graeber, Carl T.; Filardo, Edward J.

    2011-01-01

    GPER is a Gs-coupled seven-transmembrane receptor that has been linked to specific estrogen binding and signaling activities that are manifested by plasma membrane-associated enzymes. However, in many cell types, GPER is predominately localized to the endoplasmic reticulum (ER), and only minor amounts of receptor are detectable at the cell surface, an observation that has caused controversy regarding its role as a plasma membrane estrogen receptor. Here, we show that GPER constitutively buds intracellularly into EEA-1+ endosomes from clathrin-coated pits. Nonvisual arrestins-2/-3 do not co-localize with GPER, and expression of arrestin-2 dominant-negative mutants lacking clathrin- or β-adaptin interaction sites fails to block GPER internalization suggesting that arrestins are not involved in GPER endocytosis. Like β1AR, which recycles to the plasma membrane, GPER co-traffics with transferrin+, Rab11+ recycling endosomes. However, endocytosed GPER does not recycle to the cell surface, but instead returns to the trans-Golgi network (TGN) and does not re-enter the ER. GPER is ubiquitinated at the cell surface, exhibits a short half-life (t½ <1 h), and is protected from degradation by the proteasome inhibitor, MG132. Disruption of the TGN by brefeldin A induces the accumulation of endocytosed GPER in Rab11+ perinuclear endosomes and prevents GPER degradation. Our results provide an explanation as to why GPER is not readily detected on the cell surface in some cell types and further suggest that TGN serves as the checkpoint for degradation of endocytosed GPER. PMID:21540189

  4. MD-2 residues tyrosine 42, arginine 69, aspartic acid 122, and leucine 125 provide species specificity for lipid IVA.

    PubMed

    Meng, Jianmin; Drolet, Joshua R; Monks, Brian G; Golenbock, Douglas T

    2010-09-03

    Lipopolysaccharide (LPS) activates the innate immune response through the Toll-like receptor 4 (TLR4).MD-2 complex. A synthetic lipid A precursor, lipid IV(A), induces an innate immune response in mice but not in humans. Both TLR4 and MD-2 are required for the agonist activity of lipid IV(A) in mice, with TLR4 interacting through specific surface charges at the dimerization interface. In this study, we used site-directed mutagenesis to identify the MD-2 residues that determine lipid IV(A) species specificity. A single mutation of murine MD-2 at the hydrophobic pocket entrance, E122K, substantially reduced the response to lipid IV(A). Combining the murine MD-2 E122K with the murine TLR4 K367E/S386K/R434Q mutations completely abolished the response to lipid IV(A), effectively converting the murine cellular response to a human-like response. In human cells, however, simultaneous mutations of K122E, K125L, Y41F, and R69G on human MD-2 were required to promote a response to lipid IV(A). Combining the human MD-2 quadruple mutations with the human TLR4 E369K/Q436R mutations completely converted the human MD-2/human TLR4 receptor to a murine-like receptor. Because MD-2 residues 122 and 125 reside at the dimerization interface near the pocket entrance, surface charge differences here directly affect receptor dimerization. In comparison, residues 42 and 69 reside at the MD-2/TLR4 interaction surface opposite the dimerization interface. Surface charge differences there likely affect the binding angle and/or rigidity between MD-2 and TLR4, exerting an indirect influence on receptor dimerization and activation. Thus, surface charge differences at the two MD-2/TLR4 interfaces determine the species-specific activation of lipid IV(A).

  5. NMDA Receptor Autoantibodies in Autoimmune Encephalitis Cause a Subunit-Specific Nanoscale Redistribution of NMDA Receptors.

    PubMed

    Ladépêche, Laurent; Planagumà, Jesús; Thakur, Shreyasi; Suárez, Irina; Hara, Makoto; Borbely, Joseph Steven; Sandoval, Angel; Laparra-Cuervo, Lara; Dalmau, Josep; Lakadamyali, Melike

    2018-06-26

    Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis is a severe neuropsychiatric disorder mediated by autoantibodies against the GluN1 subunit of the NMDAR. Patients' antibodies cause cross-linking and internalization of NMDAR, but the synaptic events leading to depletion of NMDAR are poorly understood. Using super-resolution microscopy, we studied the effects of the autoantibodies on the nanoscale distribution of NMDAR in cultured neurons. Our findings show that, under control conditions, NMDARs form nanosized objects and patients' antibodies increase the clustering of synaptic and extrasynaptic receptors inside the nano-objects. This clustering is subunit specific and predominantly affects GluN2B-NMDARs. Following internalization, the remaining surface NMDARs return to control clustering levels but are preferentially retained at the synapse. Monte Carlo simulations using a model in which antibodies induce NMDAR cross-linking and disruption of interactions with other proteins recapitulated these results. Finally, activation of EphB2 receptor partially antagonized the antibody-mediated disorganization of the nanoscale surface distribution of NMDARs. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Structural basis of arrestin-3 activation and signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Qiuyan; Perry, Nicole A.; Vishnivetskiy, Sergey A.

    A unique aspect of arrestin-3 is its ability to support both receptor-dependent and receptor-independent signaling. Here, we show that inositol hexakisphosphate (IP6) is a non-receptor activator of arrestin-3 and report the structure of IP6-activated arrestin-3 at 2.4-Å resolution. IP6-activated arrestin-3 exhibits an inter-domain twist and a displaced C-tail, hallmarks of active arrestin. IP6 binds to the arrestin phosphate sensor, and is stabilized by trimerization. Analysis of the trimerization surface, which is also the receptor-binding surface, suggests a feature called the finger loop as a key region of the activation sensor. We show that finger loop helicity and flexibility may underliemore » coupling to hundreds of diverse receptors and also promote arrestin-3 activation by IP6. Importantly, we show that effector-binding sites on arrestins have distinct conformations in the basal and activated states, acting as switch regions. These switch regions may work with the inter-domain twist to initiate and direct arrestin-mediated signaling.« less

  7. Endocytosis as a mechanism of regulating natural killer cell function: unique endocytic and trafficking pathway for CD94/NKG2A.

    PubMed

    Peruzzi, Giovanna; Masilamani, Madhan; Borrego, Francisco; Coligan, John E

    2009-01-01

    Natural killer (NK) cells are lymphocytes generally recognized as sentinels of the innate immune system due to their inherent capacity to deal with diseased (stressed) cells, including malignant and infected. This ability to recognize many potentially pathogenic situations is due to the expression of a diverse panel of activation receptors. Because NK cell activation triggers an aggressive inflammatory response, it is important to have a means of throttling this response. Hence, NK cells also express a panel of inhibitory receptors that recognize ligands expressed by "normal" cells. Little or nothing is known about the endocytosis and trafficking of NK cell receptors, which are of great relevance to understanding how NK cells maintain the appropriate balance of activating and inhibitory receptors on their cell surface. In this review, we focus on the ITIM-containing inhibitory receptor CD94/NKG2A showing that it is endocytosed by a previously undescribed macropinocytic-like process that may be related to the maintenance of its surface expression.

  8. Coarsening of protein clusters on subcellular drops exhibits strong and sudden size selectivity

    NASA Astrophysics Data System (ADS)

    Brown, Aidan; Rutenberg, Andrew

    2015-03-01

    Autophagy is an important process for the degradation of cellular components, with receptor proteins targeting substrates to downstream autophagy machinery. An important question is how receptor protein interactions lead to their selective accumulation on autophagy substrates. Receptor proteins have recently been observed in clusters, raising the possibility that clustering could affect autophagy selectivity. We investigate the clustering dynamics of the autophagy receptor protein NBR1. In addition to standard receptor protein domains, NBR1 has a ``J'' domain that anchors it to membranes, and a coiled-coil domain that enhances self-interaction. We model coarsening clusters of NBR1 on the surfaces of a polydisperse collection of drops, representing organelles. Despite the disconnected nature of the drop surfaces, we recover dynamical scaling of cluster sizes. Significantly, we find that at a well-defined time after coarsening begins, clusters evaporate from smaller drops and grow on larger drops. Thus, coarsening-driven size selection will localize protein clusters to larger substrates, leaving smaller substrates without clusters. This provides a possible physical mechanism for autophagy selectivity, and can explain reports of size selection during peroxisome degradation.

  9. Surface heat shock protein 90 serves as a potential receptor for calcium oxalate crystal on apical membrane of renal tubular epithelial cells.

    PubMed

    Fong-Ngern, Kedsarin; Sueksakit, Kanyarat; Thongboonkerd, Visith

    2016-07-01

    Adhesion of calcium oxalate monohydrate (COM) crystals on renal tubular epithelial cells is a crucial step in kidney stone formation. Finding potential crystal receptors on the apical membrane of the cells may lead to a novel approach to prevent kidney stone disease. Our previous study identified a large number of crystal-binding proteins on the apical membrane of MDCK cells. However, their functional role as potential crystal receptors had not been validated. The present study aimed to address the potential role of heat shock protein 90 (HSP90) as a COM crystal receptor. The apical membrane was isolated from polarized MDCK cells by the peeling method and recovered proteins were incubated with COM crystals. Western blot analysis confirmed the presence of HSP90 in the apical membrane and the crystal-bound fraction. Immunofluorescence staining without permeabilization and laser-scanning confocal microscopy confirmed the surface HSP90 expression on the apical membrane of the intact cells. Crystal adhesion assay showed that blocking surface HSP90 by specific anti-HSP90 antibody and knockdown of HSP90 by small interfering RNA (siRNA) dramatically reduced crystal binding on the apical surface of MDCK cells (by approximately 1/2 and 2/3, respectively). Additionally, crystal internalization assay revealed the presence of HSP90 on the membrane of endocytic vesicle containing the internalized COM crystal. Moreover, pretreatment of MDCK cells with anti-HSP90 antibody significantly reduced crystal internalization (by approximately 1/3). Taken together, our data indicate that HSP90 serves as a potential receptor for COM crystals on the apical membrane of renal tubular epithelial cells and is involved in endocytosis/internalization of the crystals into the cells.

  10. The biochemistry and immunology of non-canonical forms of HLA-B27.

    PubMed

    Shaw, Jacqueline; Hatano, Hiroko; Kollnberger, Simon

    2014-01-01

    HLA-B27 (B27) is strongly associated with the spondyloarthritides. B27 is expressed at the cell surface of antigen presenting cells (APC) both as canonical β2m-associated and non-canonical β2m-free heavy chain (FHC) forms which include B27 dimers (termed B272). B27 FHC forms arise in an endosomal compartment from recycling β2m-associated B27. Formation of cell surface FHC dimers is critically dependent on an unpaired reactive cysteine 67 in the α1 helix of the class I heavy chain. HLA-B27 also form redox-inducible β2m-associated dimers on exosomes and apoptosing cells. By contrast with cell surface expressed cysteine 67-dependent heavy chain dimers these dimers are dependent on a cytoplasmic cysteine 325 for their formation. HLA-B27 binds to immunoregulatory receptors including members of the Killer cell Immunoglobulin-like (KIR) and Leukocyte Immunoglobulin-like receptor family. B27 FHC bind to different but overlapping sets of these immunoreceptors compared to classical β2m-associated HLA-B27. B27 FHC bind more strongly to KIR3DL2 and LILRB2 immune receptor than other β2m-associated HLA-class I ligands. Genetic studies have implicated genes which control production of the important proinflammatory cytokine IL-17 in the pathogenesis of spondyloarthritis. Cell surface HLA-B27 FHC binding to these immune receptors or acting through other mechanisms could impact on the pathogenesis of spondyloarthritis by promoting immune cell production of IL-17. Here we review the literature on these non-canonical forms of HLA-B27 and the immune receptors they bind to and discuss the possible relevance of these interactions to the pathogenesis of spondyloarthropathy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.

    PubMed

    Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik

    2018-06-01

    Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.

  12. Surface functions during mitosis. III. Quantitative analysis of ligand- receptor movement into the cleavage furrow: diffusion vs. flow

    PubMed Central

    1982-01-01

    The surface distribution of concanavalin A (Con A) bound to cell membrane receptors varies dramatically as a function of mitotic phase. The lectin is distributed diffusely on cells labeled and observed between mid-prophase and early anaphase, whereas cells observed in late anaphase or telophase demonstrate a marked accumulation of Con A- receptor complexes over the developing cleavage furrow (Berlin, Oliver, and Walter. 1978. Cell. 15:327-341). In this report, we first use a system based on video intensification fluorescence microscopy to describe the simultaneous changes in cell shape and in lectin-receptor complex topography during progression of single cells through the mitotic cycle. The video analysis establishes that fluorescein succinyl Con A (F-S Con A)-receptor complex redistribution begins coincident with the first appearance of the cleavage furrow and is essentially complete within 2-3 min. This remarkable redistribution of surface fluorescence occurs during only a modest change in cell shape from a sphere to a belted cylinder. It reflects the translocation of complexes and not the accumulation of excess labeled membrane in the cleavage furrow: first, bound fluorescent cholera toxin which faithfully outlines the plasma membrane is not accumulated in the cleavage furrow, and, second, electron microscopy of peroxidase-Con A labeled cells undergoing cleavage shows that there is a high linear density of lectin within the furrow while Con A is virtually eliminated from the poles. The rate of surface movement of F-S Con A was quantitated by photon counting during a repetitive series of laser-excited fluorescence scans across dividing cells. Results were analyzed in terms of two alternative models of movement: a flow model in which complexes moved unidirectionally at constant velocity, and a diffusion model in which complexes could diffuse freely but were trapped at the cleavage furrow. According to these models, the observed rates of accumulation were attainable at either an effective flow velocity of approximately 1 micron/min, or an effective diffusion coefficient of approximately 10(- 9) cm2/s. However, in separate experiments the lectin-receptor diffusion rate measured directly by the method of fluorescence recovery after photobleaching (FRAP) on metaphase cells was only approximately 10(-10) cm2/s. Most importantly, photobleaching experiments during the actual period of F-S Con A accumulation showed that lectin-receptor movement during cleavage occurs unidirectionally. These results rule out diffusion and make a process of oriented flow of ligand-receptor complexes the most likely mechanism for ligand-receptor accumulation in the cleavage furrow. PMID:7119007

  13. The C-type Lectin Langerin Functions as a Receptor for Attachment and Infectious Entry of Influenza A Virus

    PubMed Central

    Ng, Wy Ching; Londrigan, Sarah L.; Nasr, Najla; Cunningham, Anthony L.; Turville, Stuart; Brooks, Andrew G.

    2015-01-01

    ABSTRACT It is well established that influenza A virus (IAV) attachment to and infection of epithelial cells is dependent on sialic acid (SIA) at the cell surface, although the specific receptors that mediate IAV entry have not been defined and multiple receptors may exist. Lec2 Chinese hamster ovary (CHO) cells are SIA deficient and resistant to IAV infection. Here we demonstrate that the expression of the C-type lectin receptor langerin in Lec2 cells (Lec2-Lg) rendered them permissive to IAV infection, as measured by replication of the viral genome, transcription of viral mRNA, and synthesis of viral proteins. Unlike SIA-dependent infection of parental CHO cells, IAV attachment and infection of Lec2-Lg cells was mediated via lectin-mediated recognition of mannose-rich glycans expressed by the viral hemagglutinin glycoprotein. Lec2 cells expressing endocytosis-defective langerin bound IAV efficiently but remained resistant to IAV infection, confirming that internalization via langerin was essential for infectious entry. Langerin-mediated infection of Lec2-Lg cells was pH and dynamin dependent, occurred via clathrin- and caveolin-mediated endocytic pathways, and utilized early (Rab5+) but not late (Rab7+) endosomes. This study is the first to demonstrate that langerin represents an authentic receptor that binds and internalizes IAV to facilitate infection. Moreover, it describes a unique experimental system to probe specific pathways and compartments involved in infectious entry following recognition of IAV by a single cell surface receptor. IMPORTANCE On the surface of host cells, sialic acid (SIA) functions as the major attachment factor for influenza A viruses (IAV). However, few studies have identified specific transmembrane receptors that bind and internalize IAV to facilitate infection. Here we identify human langerin as a transmembrane glycoprotein that can act as an attachment factor and a bone fide endocytic receptor for IAV infection. Expression of langerin by an SIA-deficient cell line resistant to IAV rendered cells permissive to infection. As langerin represented the sole receptor for IAV infection in this system, we have defined the pathways and compartments involved in infectious entry of IAV into cells following recognition by langerin. PMID:26468543

  14. The Hinge Region as a Key Regulatory Element of Androgen Receptor Dimerization, DNA Binding and Transactivation

    DTIC Science & Technology

    2006-05-01

    Mutations in the human androgen receptor gene as a learning tool for molecular endocrinology’ III. Poster presentations at international meetings...nonconsensus half-site, the cognate half-complex buries slightly more surface area from solvent (1,230 Å2) than the noncognate one (960 Å2). AR Mutations ...energetic penalty in- Fig. 4. (A) The AR DBD dimer interface. The molecular surfaces of the AR subunits are shown in red and blue. Dashed black lines

  15. An Animal Model to Investigate the Potential for Breast Cancer Metastatic Dissemination Following Surgery Intervention on the Primitive Tumor

    DTIC Science & Technology

    2010-09-01

    cancer cells at the plasma membrane level were measured by cell surface biotinylation, using a dedicated kit (cat. #89881) obtained from Pierce...each form of the receptor at the plasma membrane of transfected cells was confirmed by isolation of cell surface proteins obtained by biotinylation...this receptor to interact with both plasma membrane-bound and soluble FKN. Based on our study, it seems reasonable to postulate that the dissemination

  16. Phenotypic regulation of the sphingosine 1-phosphate receptor miles apart by G protein-coupled receptor kinase 2.

    PubMed

    Burczyk, Martina; Burkhalter, Martin D; Blätte, Tamara; Matysik, Sabrina; Caron, Marc G; Barak, Lawrence S; Philipp, Melanie

    2015-01-27

    The evolutionarily conserved DRY motif at the end of the third helix of rhodopsin-like, class-A G protein-coupled receptors (GPCRs) is a major regulator of receptor stability, signaling activity, and β-arrestin-mediated internalization. Substitution of the DRY arginine with histidine in the human vasopressin receptor results in a loss-of-function phenotype associated with diabetes insipidus. The analogous R150H substitution of the DRY motif in zebrafish sphingosine-1 phosphate receptor 2 (S1p2) produces a mutation, miles apart m(93) (mil(m93)), that not only disrupts signaling but also impairs heart field migration. We hypothesized that constitutive S1p2 desensitization is the underlying cause of this strong zebrafish developmental defect. We observed in cell assays that the wild-type S1p2 receptor is at the cell surface whereas in distinct contrast the S1p2 R150H receptor is found in intracellular vesicles, blocking G protein but not arrestin signaling activity. Surface S1p2 R150H expression could be restored by inhibition of G protein-coupled receptor kinase 2 (GRK2). Moreover, we observed that β-arrestin 2 and GRK2 colocalize with S1p2 in developing zebrafish embryos and depletion of GRK2 in the S1p2 R150H miles apart zebrafish partially rescued cardia bifida. The ability of reduced GRK2 activity to reverse a developmental phenotype associated with constitutive desensitization supports efforts to genetically or pharmacologically target this kinase in diseases involving biased GPCR signaling.

  17. Phenotypic Regulation of the Sphingosine 1-Phosphate Receptor Miles Apart by G Protein-Coupled Receptor Kinase 2

    PubMed Central

    2016-01-01

    The evolutionarily conserved DRY motif at the end of the third helix of rhodopsin-like, class-A G protein-coupled receptors (GPCRs) is a major regulator of receptor stability, signaling activity, and β-arrestin-mediated internalization. Substitution of the DRY arginine with histidine in the human vasopressin receptor results in a loss-of-function phenotype associated with diabetes insipidus. The analogous R150H substitution of the DRY motif in zebrafish sphingosine-1 phosphate receptor 2 (S1p2) produces a mutation, miles apart m93 (milm93), that not only disrupts signaling but also impairs heart field migration. We hypothesized that constitutive S1p2 desensitization is the underlying cause of this strong zebrafish developmental defect. We observed in cell assays that the wild-type S1p2 receptor is at the cell surface whereas in distinct contrast the S1p2 R150H receptor is found in intracellular vesicles, blocking G protein but not arrestin signaling activity. Surface S1p2 R150H expression could be restored by inhibition of G protein-coupled receptor kinase 2 (GRK2). Moreover, we observed that β-arrestin 2 and GRK2 colocalize with S1p2 in developing zebrafish embryos and depletion of GRK2 in the S1p2 R150H miles apart zebrafish partially rescued cardia bifida. The ability of reduced GRK2 activity to reverse a developmental phenotype associated with constitutive desensitization supports efforts to genetically or pharmacologically target this kinase in diseases involving biased GPCR signaling. PMID:25555130

  18. Electrostatic complementarity between proteins and ligands. 1. Charge disposition, dielectric and interface effects

    NASA Astrophysics Data System (ADS)

    Chau, P.-L.; Dean, P. M.

    1994-10-01

    Electrostatic interactions have always been considered an important factor governing ligand-receptor interactions. Previous work in this field has established the existence of electrostatic complementarity between the ligand and its receptor site. However, this property has not been treated rigorously, and the description remains largely qualitative. In this work, 34 data sets of high quality were chosen from the Brookhaven Protein Databank. The electrostatic complementarity has been calculated between the surface potentials; complementarity is absent between adjacent or neighbouring atoms of the ligand and the receptor. There is little difference between complementarities on the total ligand surface and the interfacial region. Altering the homogeneous dielectric to distance-dependent dielectrics reduces the complementarity slightly, but does not affect the pattern of complementarity.

  19. Electrostatic complementarity between proteins and ligands. 1. Charge disposition, dielectric and interface effects.

    PubMed

    Chau, P L; Dean, P M

    1994-10-01

    Electrostatic interactions have always been considered an important factor governing ligand-receptor interactions. Previous work in this field has established the existence of electrostatic complementarity between the ligand and its receptor site. However, this property has not been treated rigorously, and the description remains largely qualitative. In this work, 34 data sets of high quality were chosen from the Brookhaven Protein Databank. The electrostatic complementary has been calculated between the surface potentials; complementarity is absent between adjacent or neighbouring atoms of the ligand and the receptor. There is little difference between complementarities on the total ligand surface and the interfacial region. Altering the homogeneous dielectric to distance-dependent dielectrics reduces the complementarity slightly, but does not affect the pattern of complementarity.

  20. Mechanotransduction across the cell surface and through the cytoskeleton

    NASA Technical Reports Server (NTRS)

    Wang, N.; Butler, J. P.; Ingber, D. E.

    1993-01-01

    Mechanical stresses were applied directly to cell surface receptors with a magnetic twisting device. The extracellular matrix receptor, integrin beta 1, induced focal adhesion formation and supported a force-dependent stiffening response, whereas nonadhesion receptors did not. The cytoskeletal stiffness (ratio of stress to strain) increased in direct proportion to the applied stress and required intact microtubules and intermediate filaments as well as microfilaments. Tensegrity models that incorporate mechanically interdependent struts and strings that reorient globally in response to a localized stress mimicked this response. These results suggest that integrins act as mechanoreceptors and transmit mechanical signals to the cytoskeleton. Mechanotransduction, in turn, may be mediated simultaneously at multiple locations inside the cell through force-induced rearrangements within a tensionally integrated cytoskeleton.

  1. G protein-coupled receptors: the inside story.

    PubMed

    Jalink, Kees; Moolenaar, Wouter H

    2010-01-01

    Recent findings necessitate revision of the traditional view of G protein-coupled receptor (GPCR) signaling and expand the diversity of mechanisms by which receptor signaling influences cell behavior in general. GPCRs elicit signals at the plasma membrane and are then rapidly removed from the cell surface by endocytosis. Internalization of GPCRs has long been thought to serve as a mechanism to terminate the production of second messengers such as cAMP. However, recent studies show that internalized GPCRs can continue to either stimulate or inhibit cAMP production in a sustained manner. They do so by remaining associated with their cognate G protein subunit and adenylyl cyclase at endosomal compartments. Once internalized, the GPCRs produce cellular responses distinct from those elicited at the cell surface.

  2. The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, H.; Grubb, J.H.; Sly, W.S.

    1990-10-01

    The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human {beta}-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3{percent} of the total functionalmore » receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of {beta}-glucuronidase. At pH 7.5, the rate of endocytosis was only 14{percent} the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized {beta}-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized {beta}-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor.« less

  3. Differential expression of the P2X7 receptor in ovarian surface epithelium during the oestrous cycle in the mouse.

    PubMed

    Vázquez-Cuevas, F G; Cruz-Rico, A; Garay, E; García-Carrancá, A; Pérez-Montiel, D; Juárez, B; Arellano, R O

    2013-01-01

    Purinergic signalling has been proposed as an intraovarian regulatory mechanism. Of the receptors responsible for purinergic transmission, the P2X7 receptor is an ATP-gated cationic channel that displays a broad spectrum of cellular functions ranging from apoptosis to cell proliferation and tumourigenesis. In the present study, we investigated the functional expression of P2X7 receptors in ovarian surface epithelium (OSE). P2X7 protein was detected in the OSE layer of the mouse, both in situ and in primary cultures. In cultures, 2'(3')-O-(4-Benzoylbenzoyl)adenosine-5'-triphosphate (BzATP) activation of P2X7 receptors increased [Ca(2+)]i and induced apoptosis. The functionality of the P2X7 receptor was investigated in situ by intrabursal injection of BzATP on each day of the oestrous cycle and evaluation of apoptosis 24h using the terminal deoxyribonucleotidyl transferase-mediated dUTP-fluorescein nick end-labelling (TUNEL) assay. Maximum effects of BzATP were observed during pro-oestrus, with the effects being blocked by A438079, a specific P2X7 receptor antagonist. Immunofluorescence staining for P2X7 protein revealed more robust expression during pro-oestrus and in OSE regions behind the antral follicles, strongly supporting the notion that the differences in apoptosis can be explained by increased receptor expression, which is regulated during the oestrous cycle. Finally, P2X7 receptor expression was detected in the OSE layer of human ovaries, with receptor expression maintained in human ovaries diagnosed with cancer, as well as in the human ovarian carcinoma SKOV3 cell line.

  4. B cell recognition of the conserved HIV-1 co-receptor binding site is altered by endogenous primate CD4.

    PubMed

    Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T

    2008-10-03

    The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.

  5. Adenovirus Entry From the Apical Surface of Polarized Epithelia Is Facilitated by the Host Innate Immune Response

    PubMed Central

    Kotha, Poornima L. N.; Sharma, Priyanka; Kolawole, Abimbola O.; Yan, Ran; Alghamri, Mahmoud S.; Brockman, Trisha L.; Gomez-Cambronero, Julian; Excoffon, Katherine J. D. A.

    2015-01-01

    Prevention of viral-induced respiratory disease begins with an understanding of the factors that increase or decrease susceptibility to viral infection. The primary receptor for most adenoviruses is the coxsackievirus and adenovirus receptor (CAR), a cell-cell adhesion protein normally localized at the basolateral surface of polarized epithelia and involved in neutrophil transepithelial migration. Recently, an alternate isoform of CAR, CAREx8, has been identified at the apical surface of polarized airway epithelia and is implicated in viral infection from the apical surface. We hypothesized that the endogenous role of CAREx8 may be to facilitate host innate immunity. We show that IL-8, a proinflammatory cytokine and a neutrophil chemoattractant, stimulates the protein expression and apical localization of CAREx8 via activation of AKT/S6K and inhibition of GSK3β. Apical CAREx8 tethers infiltrating neutrophils at the apical surface of a polarized epithelium. Moreover, neutrophils present on the apical-epithelial surface enhance adenovirus entry into the epithelium. These findings suggest that adenovirus evolved to co-opt an innate immune response pathway that stimulates the expression of its primary receptor, apical CAREx8, to allow the initial infection the intact epithelium. In addition, CAREx8 is a new target for the development of novel therapeutics for both respiratory inflammatory disease and adenoviral infection. PMID:25768646

  6. Hybrid Antibody-Induced Topographical Redistribution of Surface Immunoglobulins, Alloantigens, and Concanavalin A Receptors on Mouse Lymphoid Cells

    PubMed Central

    Stackpole, Christopher W.; De Milio, Lawrence T.; Hämmerling, Ulrich; Jacobson, Janet B.; Lardis, Michael P.

    1974-01-01

    Redistribution of surface immunoglobulins, H-2b, Thy-1.2, and TL.1,2,3 alloantigens, and concanavalin A receptors on mouse lymphoid cells induced by hybrid rabbit F(ab′)2 antibody (anti-mouse immunoglobulin/anti-visual marker or anti-concanavalin A/anti-visual marker) was studied by immunofluorescence. When used directly to label surface immunoglobulin, and indirectly to label alloantigens and concanavalin A receptors, hybrid antibodies induced similar displacement of all surface components from a uniform distribution into “patches” and “caps” at 37°. One hybrid antibody preparation, antimouse immunoglobulin/anti-ferritin, contained negligible amounts of bivalent anti-mouse immunoglobulin antibody, and was therefore “monovalent” for the antimouse immunoglobulin specificity. This observation suggests that factors other than multivalent crosslinking are responsible for hybrid antibody-induced redistribution of cell-surface components. Cap formation induced by hybrid antibody was enhanced markedly by attachment of the visual marker, either ferritin or southern bean mosaic virus, at 37°. At -5°, hybrid antibody does not displace uniformly distributed H-2b alloantigen-alloantibody complexes, but patches of label develop when ferritin attaches to the hybrid antibody. These results explain the patchy distribution of cell-surface components, which is a temperature-independent characteristic of labeling with hybrid antibodies and visual markers for electron microscopy. Images PMID:4595577

  7. The epidermal growth factor receptor (EGF-R) is present on the basolateral, but not the apical, surface of enterocytes in the human gastrointestinal tract.

    PubMed Central

    Playford, R J; Hanby, A M; Gschmeissner, S; Peiffer, L P; Wright, N A; McGarrity, T

    1996-01-01

    BACKGROUND: While it is clear that luminal epidermal growth factor (EGF) stimulates repair of the damaged bowel, its significance in maintaining normal gut growth remains uncertain. If EGF is important in maintaining normal gut growth, the EGF receptor (EGF-R) should be present on the apical (luminal) surface in addition to the basolateral surface. AIMS/SUBJECTS/METHODS: This study examined the distribution of the EGF-R in the epithelium throughout the human gastro-intestinal tract using immunohistochemistry, electron microscopy, and western blotting of brush border preparations. RESULTS: Immunostaining of the oesophagus showed circumferential EGF-R positivity in the cells of the basal portions of the stratified squamous epithelium but surface cells were EGF-R negative. In the normal stomach, small intestine, and colon, immunostaining localised the receptor to the basolateral surface with the apical membranes being consistently negative. EGF-R positivity within the small intestine appeared to be almost entirely restricted to the proliferative (crypt) region. Western blotting demonstrated a 170 kDa protein in whole tissue homogenates but not in the brush border vesicle preparations. CONCLUSIONS: As the EGF-R is located only on the basolateral surfaces in the normal adult gastrointestinal tract, the major role of luminal EGF is probably to stimulate repair rather than to maintain normal gut growth. Images Figure 1 Figure 2 Figure 3 PMID:8977341

  8. The conserved transmembrane RING finger protein PLR-1 downregulates Wnt signaling by reducing Frizzled, Ror and Ryk cell-surface levels in C. elegans

    PubMed Central

    Moffat, Laura L.; Robinson, Ryan E.; Bakoulis, Anastasia; Clark, Scott G.

    2014-01-01

    Wnts control a wide range of essential developmental processes, including cell fate specification, axon guidance and anteroposterior neuronal polarization. We identified a conserved transmembrane RING finger protein, PLR-1, that governs the response to Wnts by lowering cell-surface levels of the Frizzled family of Wnt receptors in Caenorhabditis elegans. Loss of PLR-1 activity in the neuron AVG causes its anteroposterior polarity to be symmetric or reversed because signaling by the Wnts CWN-1 and CWN-2 are inappropriately activated, whereas ectopic PLR-1 expression blocks Wnt signaling and target gene expression. Frizzleds are enriched at the cell surface; however, when PLR-1 and Frizzled are co-expressed, Frizzled is not detected at the surface but instead is colocalized with PLR-1 in endosomes. The Frizzled cysteine-rich domain (CRD) and invariant second intracellular loop lysine are crucial for PLR-1 downregulation. The PLR-1 RING finger and protease-associated (PA) domain are essential for activity. In a Frizzled-dependent manner, PLR-1 reduces surface levels of the Wnt receptors CAM-1/Ror and LIN-18/Ryk. PLR-1 is a homolog of the mammalian transmembrane E3 ubiquitin ligases RNF43 and ZNRF3, which control Frizzled surface levels in an R-spondin-sensitive manner. We propose that PLR-1 downregulates Wnt receptor surface levels via lysine ubiquitylation of Frizzled to coordinate spatial and temporal responses to Wnts during neuronal development. PMID:24401370

  9. Contribution of extracellular ATP on the cell-surface F1F0-ATP synthase-mediated intracellular triacylglycerol accumulation.

    PubMed

    Kita, Toshiyuki; Arakaki, Naokatu

    2015-01-01

    Cell-surface F1F0-ATP synthase was involved in the cell signaling mediating various biological functions. Recently, we found that cell-surface F1F0-ATP synthase plays a role on intracellular triacylglycerol accumulation in adipocytes, and yet, the underlying mechanisms remained largely unknown. In this study, we investigated the role of extracellular ATP on the intracellular triacylglycerol accumulation. We demonstrated that significant amounts of ATP were produced extracellularly by cultured 3T3-L1 adipocytes and that the antibodies against α and β subunits of F1F0-ATP synthase inhibited the extracellular ATP production. Piceatannol, a F1F0-ATP synthase inhibitor, and apyrase, an enzyme which degrades extracellular ATP, suppressed triacylglycerol accumulation. The selective P2Y1 receptor antagonist MRS2500 significantly inhibited triacylglycerol accumulation, whereas the selective P2X receptor antagonist NF279 has less effect. The present results indicate that cell-surface F1F0-ATP synthase on adipocytes is functional in extracellular ATP production and that the extracellular ATP produced contributes, at least in part, to the cell-surface F1F0-ATP synthase-mediated intracellular triacylglycerol accumulation in adipocytes through P2Y1 receptor.

  10. Histamine H2 receptor trafficking: role of arrestin, dynamin, and clathrin in histamine H2 receptor internalization.

    PubMed

    Fernandez, Natalia; Monczor, Federico; Baldi, Alberto; Davio, Carlos; Shayo, Carina

    2008-10-01

    Agonist-induced internalization of G protein-coupled receptors (GPCRs) has been implicated in receptor desensitization, resensitization, and down-regulation. In the present study, we sought to establish whether the histamine H2 receptor (H2r) agonist amthamine, besides promoting receptor desensitization, induced H2r internalization. We further studied the mechanisms involved and its potential role in receptor resensitization. In COS7 transfected cells, amthamine induced H2r time-dependent internalization, showing 70% of receptor endocytosis after 60-min exposure to amthamine. Agonist removal led to the rapid recovery of resensitized receptors to the cell surface. Similar results were obtained in the presence of cycloheximide, an inhibitor of protein synthesis. Treatment with okadaic acid, an inhibitor of the protein phosphatase 2A (PP2A) family of phosphatases, reduced the recovery of both H2r membrane sites and cAMP response. Arrestin 3 but not arrestin 2 overexpression reduced both H2r membrane sites and H2r-evoked cAMP response. Receptor cotransfection with dominant-negative mutants for arrestin, dynamin, Eps15 (a component of the clathrin-mediated endocytosis machinery), or RNA interference against arrestin 3 abolished both H2r internalization and resensitization. Similar results were obtained in U937 cells endogenously expressing H2r. Our findings suggest that amthamine-induced H2r internalization is crucial for H2r resensitization, processes independent of H2r de novo synthesis but dependent on PP2A-mediated dephosphorylation. Although we do not provide direct evidence for H2r interaction with beta-arrestin, dynamin, and/or clathrin, our results support their involvement in H2r endocytosis. The rapid receptor recycling to the cell surface and the specific involvement of arrestin 3 in receptor internalization further suggest that the H2r belongs to class A GPCRs.

  11. F104S c-Mpl responds to a transmembrane domain-binding thrombopoietin receptor agonist: proof of concept that selected receptor mutations in congenital amegakaryocytic thrombocytopenia can be stimulated with alternative thrombopoietic agents.

    PubMed

    Fox, Norma E; Lim, Jihyang; Chen, Rose; Geddis, Amy E

    2010-05-01

    To determine whether specific c-Mpl mutations might respond to thrombopoietin receptor agonists. We created cell line models of type II c-Mpl mutations identified in congenital amegakaryocytic thrombocytopenia. We selected F104S c-Mpl for further study because it exhibited surface expression of the receptor. We measured proliferation of cell lines expressing wild-type or F104S c-Mpl in response to thrombopoietin receptor agonists targeting the extracellular (m-AMP4) or transmembrane (LGD-4665) domains of the receptor by 1-methyltetrazole-5-thiol assay. We measured thrombopoietin binding to the mutant receptor using an in vitro thrombopoietin uptake assay and identified F104 as a potentially critical residue for the interaction between the receptor and its ligand by aligning thrombopoietin and erythropoietin receptors from multiple species. Cells expressing F104S c-Mpl proliferated in response to LGD-4665, but not thrombopoietin or m-AMP4. Compared to thrombopoietin, LGD-4665 stimulates signaling with delayed kinetics in both wild-type and F104S c-Mpl-expressing cells. Although F104S c-Mpl is expressed on the cell surface in our BaF3 cell line model, the mutant receptor does not bind thrombopoietin. Comparison to the erythropoietin receptor suggests that F104 engages in hydrogen-bonding interactions that are critical for binding to thrombopoietin. These findings suggest that a small subset of patients with congenital amegakaryocytic thrombocytopenia might respond to treatment with thrombopoietin receptor agonists, but that responsiveness will depend on the type of mutation and agonist used. We postulate that F104 is critical for thrombopoietin binding. The kinetics of signaling in response to a transmembrane domain-binding agonist are delayed in comparison to thrombopoietin. 2010 ISEH Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

  12. A cleavable signal peptide enhances cell surface delivery and heterodimerization of Cerulean-tagged angiotensin II AT1 and bradykinin B2 receptor.

    PubMed

    Quitterer, Ursula; Pohl, Armin; Langer, Andreas; Koller, Samuel; Abdalla, Said

    2011-06-10

    Heterodimerization of the angiotensin II AT1 receptor with the receptor for the vasodepressor bradykinin, B2R, is known to sensitize the AT1-stimulated response of hypertensive individuals in vivo. To analyze features of that prototypic receptor heterodimer in vitro, we established a new method that uses fluorescence resonance energy transfer (FRET) and applies for the first time AT1-Cerulean as a FRET donor. The Cerulean variant of the green fluorescent protein as donor fluorophore was fused to the C-terminus of AT1, and the enhanced yellow fluorescent protein (EYFP) as acceptor fluorophore was fused to B2R. In contrast to AT1-EGFP, the AT1-Cerulean fusion protein was retained intracellularly. To facilitate cell surface delivery of AT1-Cerulean, a cleavable signal sequence was fused to the receptor's amino terminus. The plasma membrane-localized AT1-Cerulean resembled the native AT1 receptor regarding ligand binding and receptor activation. A high FRET efficiency of 24.7% between membrane-localized AT1-Cerulean and B2R-EYFP was observed with intact, non-stimulated cells. Confocal FRET microscopy further revealed that the AT1/B2 receptor heterodimer was functionally coupled to receptor desensitization mechanisms because activation of the AT1-Cerulean/B2R-EYFP heterodimer with a single agonist triggered the co-internalization of AT1/B2R. Receptor co-internalization was sensitive to inhibition of G protein-coupled receptor kinases, GRKs, as evidenced by a GRK-specific peptide inhibitor. In agreement with efficient AT1/B2R heterodimerization, confocal FRET imaging of co-enriched receptor proteins immobilized on agarose beads also detected a high FRET efficiency of 24.0%. Taken together confocal FRET imaging revealed efficient heterodimerization of co-enriched and cellular AT1/B2R, and GRK-dependent co-internalization of the AT1/B2R heterodimer. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. T-cell receptor revision: friend or foe?

    PubMed Central

    Hale, J Scott; Fink, Pamela J

    2010-01-01

    T-cell receptor (TCR) revision is a process of tolerance induction by which peripheral T cells lose surface expression of an autoreactive TCR, reinduce expression of the recombinase machinery, rearrange genes encoding extrathymically generated TCRs for antigen, and express these new receptors on the cell surface. We discuss the evidence for this controversial tolerance mechanism below. Despite the apparent heresy of post-thymic gene rearrangement, we argue here that TCR revision follows the rules obeyed by maturing thymocytes undergoing gene recombination. Expression of the recombinase is carefully controlled both spatially and temporally, and may be initiated by loss of signals through surface TCRs. The resulting TCR repertoire is characterized by its diversity, self major histocompatibility complex restriction, self tolerance, and ability to mount productive immune responses specific for foreign antigens. Hence, TCR revision is a carefully regulated process of tolerance induction that can contribute to the protection of the individual against invading pathogens while preserving the integrity of self tissue. PMID:20201984

  14. Multiparameter flow cytometry of a pH sensitive ligand bound to receptors and inside cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fay, S.P.; Habbersett, R.; Posner, R.G.

    1993-01-01

    Because fluoresceinated ligands of the neutrophil formyl peptide receptor can be protonated either upon binding to the receptor on the cell surface or in acidified intracellular compartments, the authors synthesized a ligand conjugated to the pH sensitive fluorescent probe SNAFL (CHO-Met-Leu-Phe-Phe-Lys-SNAFL). In the three laser flow cytometer at LANL, protonated dye is excited at 488 nm and emits at 530 nm; unprotonated dye is excited at 568 nm and emits at 650 nm. Detection at the isobestic and isoemissive points at 528 and 600 nm is used to keep track of variations in ligand concentration from sample to sample. Themore » SNAFL-ligand bound to HL-60 cells (which overexpress the formyl peptide receptor) was compared to the free ligand in solution over a pH range from 6.5 to 9.0. The results suggest that the ligand bound to cell surface receptors was protonated in the binding pocket, possibly by virtue of its proximity to His 90, based on sequence data. When the cells were raised from 4[degrees] to 37[degrees], they also observed a time-dependent acidification of the ligand, indicative of ligand-receptor processing beginning 3-4 minutes after internalization.« less

  15. A pH-sensitive fluor, CypHer 5, used to monitor agonist-induced G protein-coupled receptor internalization in live cells.

    PubMed

    Adie, E J; Kalinka, S; Smith, L; Francis, M J; Marenghi, A; Cooper, M E; Briggs, M; Michael, N P; Milligan, G; Game, S

    2002-11-01

    G protein-coupled receptors (GPCRs) are the largest family of proteins involved in transmembrane signal transduction and are actively studied because of their suitability as therapeutic small-molecule drug targets. Agonist activation of GPCRs almost invariably results in the receptor being desensitized. One of the key events in receptor desensitization is the sequestration of the receptor from the cell surface into acidic intracellular endosomes. Therefore, a convenient, generic, and noninvasive monitor of this process is desirable. A novel, pH-sensitive, red-excited fluorescent dye, CypHer 5, was synthesized. This dye is non-fluorescent at neutral pH and is fluorescent at acidic pH. Anti-epitope antibodies labeled with this dye were internalized in an agonist concentration- and time-dependent manner, following binding on live cells to a range of GPCRs that had been modified to incorporate the epitope tags in their extracellular N-terminal domain. This resulted in a large signal increase over background. When protonated, the red fluorescence of CypHer 5 provides a generic reagent suitable for monitoring the internalization of GPCRs into acidic vesicles. This approach should be amenable to the study of many other classes of cell surface receptors that also internalize following stimulation.

  16. CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

    PubMed

    Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

    2017-07-21

    Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

  17. Targeted Type 1 phototherapeutic agents using azido-peptide bioconjugates

    NASA Astrophysics Data System (ADS)

    Rajagopalan, Raghavan; Achilefu, Samuel I.; Jimenez, Hermo N.; Webb, Elizabeth G.; Schmidt, Michelle A.; Bugaj, Joseph E.; Dorshow, Richard B.

    2001-07-01

    Five peptides binding to somatostatin and bombesin receptors were conjugated to 4-azido-2,3,4,6-tetrafluorophenylbenzoic acid, a Type 1 photosensitizer, at the N-terminal position. The receptor affinities were determined by competition binding assay using two different pancreatic tumor cell lines, CA20948 and AR42-J, that expresses somatostatin-2 (SST-2) and bombesin receptors receptively. All compounds exhibited high receptor specificity, i.e., the IC50 values ranged between 1.0 to 64.0 nM. These conjugates may be useful for targeted Type 1 phototherapy via the generation of nitrenes at the cell surfaces expressing these receptors.

  18. Spatial biomarker of disease and detection of spatial organization of cellular receptors

    DOEpatents

    Salaita, Khalid S.; Nair, Pradeep M.; Das, Debopriya; Gray, Joe W.; Groves, John T.

    2017-07-18

    A signature of a condition of a live cell is established in an assay that allows distribution of the receptors on the cell surface in response to binding a ligand. The receptors can be optically detected and quantified to provide a value for the condition, Test drugs can be screened for therapeutic potential in the assay: a potentially efficacious drug is identified by an ability to modulate an established signature. The receptor distribution signature can be corroborated with an mRNA expression profile of several genes, indicating, for example, metastasis.

  19. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  20. Structural reorganization of the interleukin-7 signaling complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McElroy, Craig A.; Holland, Paul J.; Zhao, Peng

    2012-06-29

    We report here an unliganded receptor structure in the common gamma-chain ({gamma}{sub c}) family of receptors and cytokines. The crystal structure of the unliganded form of the interleukin-7 alpha receptor (IL-7R{alpha}) extracellular domain (ECD) at 2.15 {angstrom} resolution reveals a homodimer forming an 'X' geometry looking down onto the cell surface with the C termini of the two chains separated by 110 {angstrom} and the dimer interface comprising residues critical for IL-7 binding. Further biophysical studies indicate a weak association of the IL-7R{alpha} ECDs but a stronger association between the {gamma}{sub c}/IL-7R{alpha} ECDs, similar to previous studies of the full-lengthmore » receptors on CD4{sup +} T cells. Based on these and previous results, we propose a molecular mechanism detailing the progression from the inactive IL-7R{alpha} homodimer and IL-7R{alpha}-{gamma}{sub c} heterodimer to the active IL-7-IL-7R{alpha}-{gamma}{sub c} ternary complex whereby the two receptors undergo at least a 90{sup o} rotation away from the cell surface, moving the C termini of IL-7R{alpha} and {gamma}{sub c} from a distance of 110 {angstrom} to less than 30 {angstrom} at the cell surface. This molecular mechanism can be used to explain recently discovered IL-7- and {gamma}{sub c}-independent gain-of-function mutations in IL-7R{alpha} from B- and T-cell acute lymphoblastic leukemia patients. The mechanism may also be applicable to other {gamma}{sub c} receptors that form inactive homodimers and heterodimers independent of their cytokines.« less

  1. Receptor-mediated binding of IgE-sensitized rat basophilic leukemia cells to antigen-coated substrates under hydrodynamic flow.

    PubMed Central

    Tempelman, L A; Hammer, D A

    1994-01-01

    The physiological function of many cells is dependent on their ability to adhere via receptors to ligand-coated surfaces under fluid flow. We have developed a model experimental system to measure cell adhesion as a function of cell and surface chemistry and fluid flow. Using a parallel-plate flow chamber, we measured the binding of rat basophilic leukemia cells preincubated with anti-dinitrophenol IgE antibody to polyacrylamide gels covalently derivatized with 2,4-dinitrophenol. The rat basophilic leukemia cells' binding behavior is binary: cells are either adherent or continue to travel at their hydrodynamic velocity, and the transition between these two states is abrupt. The spatial location of adherent cells shows cells can adhere many cell diameters down the length of the gel, suggesting that adhesion is a probabilistic process. The majority of experiments were performed in the excess ligand limit in which adhesion depends strongly on the number of receptors but weakly on ligand density. Only 5-fold changes in IgE surface density or in shear rate were necessary to change adhesion from complete to indistinguishable from negative control. Adhesion showed a hyperbolic dependence on shear rate. By performing experiments with two IgE-antigen configurations in which the kinetic rates of receptor-ligand binding are different, we demonstrate that the forward rate of reaction of the receptor-ligand pair is more important than its thermodynamic affinity in the regulation of binding under hydrodynamic flow. In fact, adhesion increases with increasing receptor-ligand reaction rate or decreasing shear rate, and scales with a single dimensionless parameter which compares the relative rates of reaction to fluid shear. Images FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 8 FIGURE 10 PMID:8038394

  2. Estrogen and androgen receptor activities of hydraulic fracturing chemicals and surface and ground water in a drilling-dense region

    USGS Publications Warehouse

    Kassotis, Christopher D.; Tillitt, Donald E.; Davis, J. Wade; Hormann, Anette M.; Nagel, Susan C.

    2014-01-01

    The rapid rise in natural gas extraction using hydraulic fracturing increases the potential for contamination of surface and ground water from chemicals used throughout the process. Hundreds of products containing more than 750 chemicals and components are potentially used throughout the extraction process, including more than 100 known or suspected endocrine-disrupting chemicals. We hypothesized thataselected subset of chemicalsusedin natural gas drilling operationsandalso surface and ground water samples collected in a drilling-dense region of Garfield County, Colorado, would exhibit estrogen and androgen receptor activities. Water samples were collected, solid-phase extracted, and measured for estrogen and androgen receptor activities using reporter gene assays in human cell lines. Of the 39 unique water samples, 89%, 41%, 12%, and 46% exhibited estrogenic, antiestrogenic, androgenic, and antiandrogenic activities, respectively. Testing of a subset of natural gas drilling chemicals revealed novel antiestrogenic, novel antiandrogenic, and limited estrogenic activities. The Colorado River, the drainage basin for this region, exhibited moderate levels of estrogenic, antiestrogenic, and antiandrogenic activities, suggesting that higher localized activity at sites with known natural gas–related spills surrounding the river might be contributing to the multiple receptor activities observed in this water source. The majority of water samples collected from sites in a drilling-dense region of Colorado exhibited more estrogenic, antiestrogenic, or antiandrogenic activities than reference sites with limited nearby drilling operations. Our data suggest that natural gas drilling operationsmayresult in elevated endocrine-disrupting chemical activity in surface and ground water.

  3. Investigation of binding characteristics of immobilized toll-like receptor 3 with poly(I:C) for potential biosensor application.

    PubMed

    Topping, Kristin D; Kelly, David G

    2018-05-26

    Toll-like receptor 3 (TLR3), a pathogen recognition receptor of the innate immune response, recognizes and is activated by double-stranded RNA (dsRNA), which is indicative of viral exposure. A sensor design exercise was conducted, using surface plasmon resonance detection, through the examination of several immobilization approaches for TLR3 as a biorecognition element (BRE) onto a modified gold surface. To examine the TLR3-dsRNA interaction a synthetic analogue mimic, poly (I:C), was used. The interaction binding characteristics were determined and compared to literature data to establish the optimal immobilization method for the TLR3 BRE. A preliminary evaluation of the efficacy of the selected TLR3 surface as a broad-spectrum viral biosensor was also performed. Amine-coupling was found to be the most reliable method for manufacturing repeatable and consistent TLR3 BRE sensor surfaces, although this immobilization schema is not tailored to place the receptor in a spatially-specific orientation. The equilibrium dissociation constant (K D ) measured for this immobilized TLR3-poly (I:C) interaction was 117 ± 3.30 pM. This evaluation included a cross-reactivity study using a selection of purified E. coli and synthetic double- and single-stranded nucleic acids. The results of this design exercise and ligand binding study will inform future work towards the development of a broad-spectrum viral sensor device. Copyright © 2018. Published by Elsevier Inc.

  4. Characterization of the ligand-binding site of the transferrin receptor in Trypanosoma brucei demonstrates a structural relationship with the N-terminal domain of the variant surface glycoprotein.

    PubMed

    Salmon, D; Hanocq-Quertier, J; Paturiaux-Hanocq, F; Pays, A; Tebabi, P; Nolan, D P; Michel, A; Pays, E

    1997-12-15

    The Trypanosoma brucei transferrin (Tf) receptor is a heterodimer encoded by ESAG7 and ESAG6, two genes contained in the different polycistronic transcription units of the variant surface glycoprotein (VSG) gene. The sequence of ESAG7/6 differs slightly between different units, so that receptors with different affinities for Tf are expressed alternatively following transcriptional switching of VSG expression sites during antigenic variation of the parasite. Based on the sequence homology between pESAG7/6 and the N-terminal domain of VSGs, it can be predicted that the four blocks containing the major sequence differences between pESAG7 and pESAG6 form surface-exposed loops and generate the ligand-binding site. The exchange of a few amino acids in this region between pESAG6s encoded by different VSG units greatly increased the affinity for bovine Tf. Similar changes in other regions were ineffective, while mutations predicted to alter the VSG-like structure abolished the binding. Chimeric proteins containing the N-terminal dimerization domain of VSG and the C-terminal half of either pESAG7 or pESAG6, which contains the ligand-binding domain, can form heterodimers that bind Tf. Taken together, these data provided evidence that the T.brucei Tf receptor is structurally related to the N-terminal domain of the VSG and that the ligand-binding site corresponds to the exposed surface loops of the protein.

  5. Modelling the interdependence between the stoichiometry of receptor oligomerization and ligand binding for a coexisting dimer/tetramer receptor system.

    PubMed

    Rovira, X; Vivó, M; Serra, J; Roche, D; Strange, P G; Giraldo, J

    2009-01-01

    Many G protein-coupled receptors have been shown to exist as oligomers, but the oligomerization state and the effects of this on receptor function are unclear. For some G protein-coupled receptors, in ligand binding assays, different radioligands provide different maximal binding capacities. Here we have developed mathematical models for co-expressed dimeric and tetrameric species of receptors. We have considered models where the dimers and tetramers are in equilibrium and where they do not interconvert and we have also considered the potential influence of the ligands on the degree of oligomerization. By analogy with agonist efficacy, we have considered ligands that promote, inhibit or have no effect on oligomerization. Cell surface receptor expression and the intrinsic capacity of receptors to oligomerize are quantitative parameters of the equations. The models can account for differences in the maximal binding capacities of radioligands in different preparations of receptors and provide a conceptual framework for simulation and data fitting in complex oligomeric receptor situations.

  6. Is receptor oligomerization causally linked to activation of the EGF receptor kinase?

    NASA Technical Reports Server (NTRS)

    Rintoul, D. A.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Transduction of a signal from an extracellular peptide hormone to produce an intracellular response is often mediated by a cell surface receptor, which is usually a glycoprotein. The secondary intracellular signal(s) generated after hormone binding to the receptor have been intensively studied. The nature of the primary signal generated by ligand binding to the receptor is understood less well in most cases. The particular case of the epidermal growth factor (EGF) receptor is analyzed, and evidence for or against two dissimilar models of primary signal transduction is reviewed. Evidence for the most widely accepted current model is found to be unconvincing. Evidence for the other model is substantial but indirect; a direct test of this model remains to be done.

  7. Dynamic complexity: plant receptor complexes at the plasma membrane.

    PubMed

    Burkart, Rebecca C; Stahl, Yvonne

    2017-12-01

    Plant receptor complexes at the cell surface perceive many different external and internal signalling molecules and relay these signals into the cell to regulate development, growth and immunity. Recent progress in the analyses of receptor complexes using different live cell imaging approaches have shown that receptor complex formation and composition are dynamic and take place at specific microdomains at the plasma membrane. In this review we focus on three prominent examples of Arabidopsis thaliana receptor complexes and how their dynamic spatio-temporal distribution at the PM has been studied recently. We will elaborate on the newly emerging concept of plasma membrane microdomains as potential hubs for specific receptor complex assembly and signalling outputs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Cholera Toxin Inhibits the T-Cell Antigen Receptor-Mediated Increases in Inositol Trisphosphate and Cytoplasmic Free Calcium

    NASA Astrophysics Data System (ADS)

    Imboden, John B.; Shoback, Dolores M.; Pattison, Gregory; Stobo, John D.

    1986-08-01

    The addition of monoclonal antibodies to the antigen receptor complex on the malignant human T-cell line Jurkat generates increases in inositol trisphosphate and in the concentration of cytoplasmic free calcium. Exposure of Jurkat cells to cholera toxin for 3 hr inhibited these receptor-mediated events and led to a selective, partial loss of the antigen receptor complex from the cellular surface. None of the effects of cholera toxin on the antigen receptor complex were mimicked by the B subunit of cholera toxin or by increasing intracellular cAMP levels with either forskolin or 8-bromo cAMP. These results suggest that a cholera toxin substrate can regulate signal transduction by the T-cell antigen receptor.

  9. Overlapping but distinct topology for zebrafish V2R-like olfactory receptors reminiscent of odorant receptor spatial expression zones.

    PubMed

    Ahuja, Gaurav; Reichel, Vera; Kowatschew, Daniel; Syed, Adnan S; Kotagiri, Aswani Kumar; Oka, Yuichiro; Weth, Franco; Korsching, Sigrun I

    2018-05-23

    The sense of smell is unrivaled in terms of molecular complexity of its input channels. Even zebrafish, a model vertebrate system in many research fields including olfaction, possesses several hundred different olfactory receptor genes, organized in four different gene families. For one of these families, the initially discovered odorant receptors proper, segregation of expression into distinct spatial subdomains within a common sensory surface has been observed both in teleost fish and in mammals. However, for the remaining three families, little to nothing was known about their spatial coding logic. Here we wished to investigate, whether the principle of spatial segregation observed for odorant receptors extends to another olfactory receptor family, the V2R-related OlfC genes. Furthermore we thought to examine, how expression of OlfC genes is integrated into expression zones of odorant receptor genes, which in fish share a single sensory surface with OlfC genes. To select representative genes, we performed a comprehensive phylogenetic study of the zebrafish OlfC family, which identified a novel OlfC gene, reduced the number of pseudogenes to 1, and brought the total family size to 60 intact OlfC receptors. We analyzed the spatial pattern of OlfC-expressing cells for seven representative receptors in three dimensions (height within the epithelial layer, horizontal distance from the center of the olfactory organ, and height within the olfactory organ). We report non-random distributions of labeled neurons for all OlfC genes analysed. Distributions for sparsely expressed OlfC genes are significantly different from each other in nearly all cases, broad overlap notwithstanding. For two of the three coordinates analyzed, OlfC expression zones are intercalated with those of odorant receptor zones, whereas in the third dimension some segregation is observed. Our results show that V2R-related OlfC genes follow the same spatial logic of expression as odorant receptors and their expression zones intermingle with those of odorant receptor genes. Thus, distinctly different expression zones for individual receptor genes constitute a general feature shared by teleost and tetrapod V2R/OlfC and odorant receptor families alike.

  10. Elucidating the Functional Roles of Spatial Organization in Cross-Membrane Signal Transduction by a Hybrid Simulation Method.

    PubMed

    Chen, Jiawen; Xie, Zhong-Ru; Wu, Yinghao

    2016-07-01

    The ligand-binding of membrane receptors on cell surfaces initiates the dynamic process of cross-membrane signal transduction. It is an indispensable part of the signaling network for cells to communicate with external environments. Recent experiments revealed that molecular components in signal transduction are not randomly mixed, but spatially organized into distinctive patterns. These patterns, such as receptor clustering and ligand oligomerization, lead to very different gene expression profiles. However, little is understood about the molecular mechanisms and functional impacts of this spatial-temporal regulation in cross-membrane signal transduction. In order to tackle this problem, we developed a hybrid computational method that decomposes a model of signaling network into two simulation modules. The physical process of binding between receptors and ligands on cell surfaces are simulated by a diffusion-reaction algorithm, while the downstream biochemical reactions are modeled by stochastic simulation of Gillespie algorithm. These two processes are coupled together by a synchronization framework. Using this method, we tested the dynamics of a simple signaling network in which the ligand binding of cell surface receptors triggers the phosphorylation of protein kinases, and in turn regulates the expression of target genes. We found that spatial aggregation of membrane receptors at cellular interfaces is able to either amplify or inhibit downstream signaling outputs, depending on the details of clustering mechanism. Moreover, by providing higher binding avidity, the co-localization of ligands into multi-valence complex modulates signaling in very different ways that are closely related to the binding affinity between ligand and receptor. We also found that the temporal oscillation of the signaling pathway that is derived from genetic feedback loops can be modified by the spatial clustering of membrane receptors. In summary, our method demonstrates the functional importance of spatial organization in cross-membrane signal transduction. The method can be applied to any specific signaling pathway in cells.

  11. Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant

    PubMed Central

    Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li

    2012-01-01

    GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429

  12. Identification of the bombesin receptor on murine and human cells by cross-linking experiments.

    PubMed

    Kris, R M; Hazan, R; Villines, J; Moody, T W; Schlessinger, J

    1987-08-15

    The bombesin receptor present on the surface of murine and human cells was identified using 125I-labeled gastrin-releasing peptide as a probe, the cross-linking agent disuccinimidyl suberate, and sodium dodecyl sulfate gels. A clone of NIH-3T3 cells which possesses approximately 80,000 bombesin receptors/cell with a single binding constant of approximately 1.9 X 10(-9) M was used in these studies. In addition, we used Swiss 3T3 cells and a human glioma cell line which possesses approximately 100,000 and approximately 55,000 bombesin receptors/cell, respectively. Under conditions found optimal for binding, it is demonstrated that 125I-labeled gastrin-releasing peptide can be cross-linked specifically to a glycoprotein of apparent molecular mass of 65,000 daltons on the surface of the NIH-3T3 cells. Similar results were obtained when the cross-linked product was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing or non-reducing conditions. Moreover, the cross-linking reaction is specific and saturable and the 65,000-dalton polypeptide is not observed when the cross-linking experiments were performed with a NIH-3T3 cell line which is devoid of bombesin receptors. Interestingly, glycoproteins with apparent molecular weights of 75,000 were labeled specifically by 125I-labeled gastrin-releasing peptide when similar experiments were performed with Swiss 3T3 cells and with human glioma cell line GM-340. These different molecular weights may indicate differential glycosylation as treatment with the enzyme N-glycanase reduced the apparent molecular weight of the cross-linked polypeptide to 45,000. On the basis of these results it is concluded that the cross-linked polypeptides represent the bombesin receptor or the ligand-binding subunit of a putative larger bombesin receptor expressed on the surface of these cells.

  13. Cell Surface Trafficking of TLR1 Is Differentially Regulated by the Chaperones PRAT4A and PRAT4B*

    PubMed Central

    Hart, Bryan E.; Tapping, Richard I.

    2012-01-01

    The subcellular localization of Toll-like receptors (TLRs) is critical to their ability to function as innate immune sensors of microbial infection. We previously reported that an I602S polymorphism of human TLR1 is associated with aberrant trafficking of the receptor to the cell surface, loss of responses to TLR1 agonists, and differential susceptibility to diseases caused by pathogenic mycobacteria. Through an extensive analysis of receptor deletion and point mutants we have discovered that position 602 resides within a short 6 amino acid cytoplasmic region that is required for TLR1 surface expression. This short trafficking motif, in conjunction with the adjacent transmembrane domain, is sufficient to direct TLR1 to the cell surface. A serine at position 602 interrupts this trafficking motif and prevents cell surface expression of TLR1. Additionally, we have found that ER-resident TLR chaperones, PRAT4A and PRAT4B, act as positive and negative regulators of TLR1 surface trafficking, respectively. Importantly, either over-expression of PRAT4A or knock-down of PRAT4B rescues cell surface expression of the TLR1 602S variant. We also report that IFN-γ treatment of primary human monocytes derived from homozygous 602S individuals rescues TLR1 cell surface trafficking and cellular responses to soluble agonists. This event appears to be mediated by PRAT4A whose expression is strongly induced in human monocytes by IFN-γ. Collectively, these results provide a mechanism for the differential trafficking of TLR1 I602S variants, and highlight the distinct roles for PRAT4A and PRAT4B in the regulation of TLR1 surface expression. PMID:22447933

  14. Performance assessment of a single-layer moisture store-and-release cover system at a mine waste rock pile in a seasonally humid region (Nova Scotia, Canada).

    PubMed

    Power, Christopher; Ramasamy, Murugan; Mkandawire, Martin

    2018-03-03

    Cover systems are commonly applied to mine waste rock piles (WRPs) to control acid mine drainage (AMD). Single-layer covers utilize the moisture "store-and-release" concept to first store and then release moisture back to the atmosphere via evapotranspiration. Although more commonly used in semi-arid and arid climates, store-and-release covers remain an attractive option in humid climates due to the low cost and relative simplicity of installation. However, knowledge of their performance in these climates is limited. The objective of this study was to assess the performance of moisture store-and-release covers at full-scale WRPs located in humid climates. This cover type was installed at a WRP in Nova Scotia, Canada, alongside state-of-the-art monitoring instrumentation. Field monitoring was conducted over 5 years to assess key components such as meteorological conditions, cover material water dynamics, net percolation, surface runoff, pore-gas, environmental receptor water quality, landform stability and vegetation. Water balances indicate small reductions in water influx to the waste rock (i.e., 34 to 28% of precipitation) with the diminished AMD release also apparent by small improvements in groundwater quality (increase in pH, decrease in sulfate/metals). Surface water quality analysis and field observations of vegetative/aquatic life demonstrate significant improvements in the surface water receptor. The WRP landform is stable and the vegetative cover is thriving. This study has shown that while a simple store-and-release cover may not be a highly effective barrier to water infiltration in humid climates, it can be used to (i) eliminate contaminated surface water runoff, (ii) minimize AMD impacts to surface water receptor(s), (iii) maintain a stable landform, and (iv) provide a sustainable vegetative canopy.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Becker, Verena; Sengupta, D; Ketteler, Robin

    The formation of signal-promoting dimeric or oligomeric receptor complexes at the cell surface is modulated by self-interaction of their transmembrane (TM) domains. To address the importance of TM domain packing density for receptor functionality, we examined a set of asparagine mutants in the TM domain of the erythropoietin receptor (EpoR). We identified EpoR-T242N as a receptor variant that is present at the cell surface similar to wild-type EpoR but lacks visible localization in vesicle-like structures and is impaired in efficient activation of specific signaling cascades. Analysis by a molecular modeling approach indicated an increased interhelical distance for the EpoR-T242N TMmore » dimer. By employing the model, we designed additional mutants with increased or decreased packing volume and confirmed a correlation between packing volume and biological responsiveness. These results propose that the packing density of the TM domain provides a novel layer for fine-tuned regulation of signal transduction and cellular decisions.« less

  16. A2A adenosine receptor ligand binding and signalling is allosterically modulated by adenosine deaminase.

    PubMed

    Gracia, Eduard; Pérez-Capote, Kamil; Moreno, Estefanía; Barkešová, Jana; Mallol, Josefa; Lluís, Carme; Franco, Rafael; Cortés, Antoni; Casadó, Vicent; Canela, Enric I

    2011-05-01

    A2ARs (adenosine A2A receptors) are highly enriched in the striatum, which is the main motor control CNS (central nervous system) area. BRET (bioluminescence resonance energy transfer) assays showed that A2AR homomers may act as cell-surface ADA (adenosine deaminase; EC 3.5.4.4)-binding proteins. ADA binding affected the quaternary structure of A2ARs present on the cell surface. ADA binding to adenosine A2ARs increased both agonist and antagonist affinity on ligand binding to striatal membranes where these proteins are co-expressed. ADA also increased receptor-mediated ERK1/2 (extracellular-signal-regulated kinase 1/2) phosphorylation. Collectively, the results of the present study show that ADA, apart from regulating the concentration of extracellular adenosine, may behave as an allosteric modulator that markedly enhances ligand affinity and receptor function. This powerful regulation may have implications for the physiology and pharmacology of neuronal A2ARs.

  17. Chimeric antigen receptor T cells: a novel therapy for solid tumors.

    PubMed

    Yu, Shengnan; Li, Anping; Liu, Qian; Li, Tengfei; Yuan, Xun; Han, Xinwei; Wu, Kongming

    2017-03-29

    The chimeric antigen receptor T (CAR-T) cell therapy is a newly developed adoptive antitumor treatment. Theoretically, CAR-T cells can specifically localize and eliminate tumor cells by interacting with the tumor-associated antigens (TAAs) expressing on tumor cell surface. Current studies demonstrated that various TAAs could act as target antigens for CAR-T cells, for instance, the type III variant epidermal growth factor receptor (EGFRvIII) was considered as an ideal target for its aberrant expression on the cell surface of several tumor types. CAR-T cell therapy has achieved gratifying breakthrough in hematological malignancies and promising outcome in solid tumor as showed in various clinical trials. The third generation of CAR-T demonstrates increased antitumor cytotoxicity and persistence through modification of CAR structure. In this review, we summarized the preclinical and clinical progress of CAR-T cells targeting EGFR, human epidermal growth factor receptor 2 (HER2), and mesothelin (MSLN), as well as the challenges for CAR-T cell therapy.

  18. Gonadotropin-Releasing Hormone (GnRH) Receptor Structure and GnRH Binding

    PubMed Central

    Flanagan, Colleen A.; Manilall, Ashmeetha

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) regulates reproduction. The human GnRH receptor lacks a cytoplasmic carboxy-terminal tail but has amino acid sequence motifs characteristic of rhodopsin-like, class A, G protein-coupled receptors (GPCRs). This review will consider how recent descriptions of X-ray crystallographic structures of GPCRs in inactive and active conformations may contribute to understanding GnRH receptor structure, mechanism of activation and ligand binding. The structures confirmed that ligands bind to variable extracellular surfaces, whereas the seven membrane-spanning α-helices convey the activation signal to the cytoplasmic receptor surface, which binds and activates heterotrimeric G proteins. Forty non-covalent interactions that bridge topologically equivalent residues in different transmembrane (TM) helices are conserved in class A GPCR structures, regardless of activation state. Conformation-independent interhelical contacts account for a conserved receptor protein structure and their importance in the GnRH receptor structure is supported by decreased expression of receptors with mutations of residues in the network. Many of the GnRH receptor mutations associated with congenital hypogonadotropic hypogonadism, including the Glu2.53(90) Lys mutation, involve amino acids that constitute the conserved network. Half of the ~250 intramolecular interactions in GPCRs differ between inactive and active structures. Conformation-specific interhelical contacts depend on amino acids changing partners during activation. Conserved inactive conformation-specific contacts prevent receptor activation by stabilizing proximity of TM helices 3 and 6 and a closed G protein-binding site. Mutations of GnRH receptor residues involved in these interactions, such as Arg3.50(139) of the DRY/S motif or Tyr7.53(323) of the N/DPxxY motif, increase or decrease receptor expression and efficiency of receptor coupling to G protein signaling, consistent with the native residues stabilizing the inactive GnRH receptor structure. Active conformation-specific interhelical contacts stabilize an open G protein-binding site. Progress in defining the GnRH-binding site has recently slowed, with evidence that Tyr6.58(290) contacts Tyr5 of GnRH, whereas other residues affect recognition of Trp3 and Gly10NH2. The surprisingly consistent observations that GnRH receptor mutations that disrupt GnRH binding have less effect on “conformationally constrained” GnRH peptides may now be explained by crystal structures of agonist-bound peptide receptors. Analysis of GPCR structures provides insight into GnRH receptor function. PMID:29123501

  19. Plasmon Spectroscopy Applied to Biomolecular Interactions in Membranes

    NASA Astrophysics Data System (ADS)

    Tollin, Gordon

    2010-03-01

    Plasmon-waveguide resonance (PWR) is an optical spectroscopy method that can provide information about materials immobilized on the surface of a plasmon resonator consisting of a right angle prism coated with thin layers of a metal (approx. 50 nm; usually silver) and a dielectric (approx. 500 nm; usually silica). The technique has been developed in our laboratory and is an extension of the more commonly used surface plasmon resonance (SPR) method, having higher sensitivity (20-50 fold) and resolution (10-20 fold). The dielectric layer allows plasmon excitation by light whose electric vector is polarized both perpendicular and parallel to the sensor surface, in contrast to SPR that can only utilize perpendicular polarized excitation. This allows both mass density and mass distribution to be characterized in uniaxially oriented deposited materials, such as biomembranes. We have utilized this technique to investigate binding interactions between membrane-incorporated protein receptors and their ligands (both proteins and small molecules), using both purified receptors inserted into lipid bilayers and membranes derived from cells expressing these receptors. Such studies have provided many new insights into biological signaling events. Inasmuch as many of these receptors are targets for approximately 50 percent of ethical drugs, PWR can be a useful methodology for drug discovery in the pharmaceutical industry. Examples of these experiments will be presented.

  20. Studies on gonadotropin receptor of rat ovary and testis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Q.

    1989-01-01

    The subunit structure of the testicular LH/hCG receptor was studied by a chemical cross-linking technique. Leydig cells isolated from rat testis were incubated with {sup 125}I-hCG, following which the bound {sup 125}I-hCG was covalently cross-linked to the receptor on the cell surface with a cleavable or a non-cleavable cross-linking reagent. The hormone-receptor complex was extracted and then either subjected to gel permeation chromatography under nondenaturing conditions, or resolved by SDS-polyacrylamide gel electrophoresis, followed by autoradiographic analysis. The ovarian LH/hCG receptor was studied with luteal cells from pseudopregnant rats. Purification of the receptor was achieved by ligand affinity chromatography following detergentmore » solubilization of the plasma membrane. The purified hCG receptor displayed properties identical to the membrane bound receptor with regard to binding specificity and affinity, and exhibited a molecular weight of approximately 130,000 dalton.« less

  1. LeEix1 functions as a decoy receptor to attenuate LeEix2 signaling.

    PubMed

    Bar, Maya; Sharfman, Miya; Avni, Adi

    2011-03-01

    The receptors for the fungal elicitor EIX (LeEix1 and LeEix2) belong to a class of leucine-rich repeat cell-surface glycoproteins with a signal for receptor-mediated endocytosis. Both receptors are able to bind the EIX elicitor while only the LeEix2 receptor mediates defense responses. We show that LeEix1 acts as a decoy receptor and attenuates EIX induced internalization and signaling of the LeEix2 receptor. We demonstrate that BAK1 binds LeEix1 but not LeEix2. In plants where BAK1 was silenced, LeEix1 was no longer able to attenuate plant responses to EIX, indicating that BAK1 is required for this attenuation. We suggest that LeEix1 functions as a decoy receptor for LeEix2, a function which requires the kinase activity of BAK1.

  2. Inhibitory effect of a toxic peptide isolated from a waterbloom of Microcystis sp. (Cyanobacteria) on iron uptake by rabbit reticulocytes.

    PubMed

    Rojas, M; Nuñez, M T; Zambrano, F

    1990-01-01

    The effect of a soluble toxin purified from the algae bloom of a eutrophic lake dominated by Microcystis on the receptor-mediated endocytosis of ferro-transferrin in rabbit reticulocytes was studied. The toxin was a very effective inhibitor of cell iron uptake. Kinetic studies using 125I, 59Fe-labeled transferrin indicated that the step of ferrotransferrin internalization was selectively inhibited by the toxin while the surface receptor-binding capacity, the externalization of previously internalized transferrin, and the cellular ATP levels were not affected. These findings indicate that the reduction of iron uptake caused by the toxin is due to inhibition of the internalization of surface-located transferrin-transferrin receptor complexes, perhaps due to a disruption of cytoskeleton integrity.

  3. Biological Functionalization of Drug Delivery Carriers to Bypass Size Restrictions of Receptor-Mediated Endocytosis Independently from Receptor Targeting

    PubMed Central

    Ansar, Maria; Serrano, Daniel; Papademetriou, Iason; Bhowmick, Tridib Kumar; Muro, Silvia

    2014-01-01

    Targeting of drug carriers to cell-surface receptors involved in endocytosis is commonly used for intracellular drug delivery. However, most endocytic receptors mediate uptake via clathrin or caveolar pathways associated with ≤200-nm vesicles, restricting carrier design. We recently showed that endocytosis mediated by intercellular adhesion molecule 1 (ICAM-1), which differs from clathrin- and caveolar-mediated pathways, allows uptake of nano- and micro-carriers in cell culture and in vivo due to recruitment of cellular sphingomyelinases to the plasmalemma. This leads to ceramide generation at carrier binding sites and formation of actin stress-fibers, enabling engulfment and uptake of a wide size-range of carriers. Here we adapted this paradigm to enhance uptake of drug carriers targeted to receptors associated with size-restricted pathways. We coated sphingomyelinase onto model (polystyrene) submicro- and micro-carriers targeted to clathrin-associated mannose-6-phosphate receptor. In endothelial cells, this provided ceramide enrichment at the cell surface and actin stress-fiber formation, modifying the uptake pathway and enhancing carrier endocytosis without affecting targeting, endosomal transport, cell-associated degradation, or cell viability. This improvement depended on the carrier size and enzyme dose, and similar results were observed for other receptors (transferrin receptor) and cell types (epithelial cells). This phenomenon also enhanced tissue accumulation of carriers after intravenous injection in mice. Hence, it is possible to maintain targeting toward a selected receptor while bypassing natural size-restrictions of its associated endocytic route by functionalization of drug carriers with biological elements mimicking the ICAM-1 pathway. This strategy holds considerable promise to enhance flexibility of design of targeted drug delivery systems. PMID:24237309

  4. Biological functionalization of drug delivery carriers to bypass size restrictions of receptor-mediated endocytosis independently from receptor targeting.

    PubMed

    Ansar, Maria; Serrano, Daniel; Papademetriou, Iason; Bhowmick, Tridib Kumar; Muro, Silvia

    2013-12-23

    Targeting of drug carriers to cell-surface receptors involved in endocytosis is commonly used for intracellular drug delivery. However, most endocytic receptors mediate uptake via clathrin or caveolar pathways associated with ≤200-nm vesicles, restricting carrier design. We recently showed that endocytosis mediated by intercellular adhesion molecule 1 (ICAM-1), which differs from clathrin- and caveolae-mediated pathways, allows uptake of nano- and microcarriers in cell culture and in vivo due to recruitment of cellular sphingomyelinases to the plasmalemma. This leads to ceramide generation at carrier binding sites and formation of actin stress-fibers, enabling engulfment and uptake of a wide size-range of carriers. Here we adapted this paradigm to enhance uptake of drug carriers targeted to receptors associated with size-restricted pathways. We coated sphingomyelinase onto model (polystyrene) submicro- and microcarriers targeted to clathrin-associated mannose-6-phosphate receptor. In endothelial cells, this provided ceramide enrichment at the cell surface and actin stress-fiber formation, modifying the uptake pathway and enhancing carrier endocytosis without affecting targeting, endosomal transport, cell-associated degradation, or cell viability. This improvement depended on the carrier size and enzyme dose, and similar results were observed for other receptors (transferrin receptor) and cell types (epithelial cells). This phenomenon also enhanced tissue accumulation of carriers after intravenous injection in mice. Hence, it is possible to maintain targeting toward a selected receptor while bypassing natural size restrictions of its associated endocytic route by functionalization of drug carriers with biological elements mimicking the ICAM-1 pathway. This strategy holds considerable promise to enhance flexibility of design of targeted drug delivery systems.

  5. Pancreatic acini possess endothelin receptors whose internalization is regulated by PLC-activating agents.

    PubMed

    Hildebrand, P; Mrozinski, J E; Mantey, S A; Patto, R J; Jensen, R T

    1993-05-01

    Endothelin-1 (ET-1) and ET-3 mRNA have been found in the pancreas. We investigated the ability of ET-1, ET-2, and ET-3 to interact with and alter dispersed rat pancreatic acinar cell function. Radiolabeled ETs bound in a time- and temperature-dependent fashion, which was specific and saturable. Analysis demonstrated two classes of receptors, one class (ETA receptor) had a high affinity for ET-1 but a low affinity for ET-3, and the other class (ETB receptor) had equally high affinities for ET-1 and ET-3. No specific receptor for ET-2 was identified. Pancreatic secretagogues that activate phospholipase C (PLC) inhibited binding of 125I-labeled ET-1 (125I-ET-1) or 125I-ET-3, whereas agents that act through adenosine 3',5'-cyclic monophosphate (cAMP) did not. A23187 had no effect on 125I-ET-1 or 125I-ET-3 binding, whereas the phorbol ester 12-O-tetradecanoylphorbol 13-acetate reduced binding. The effect of cholecystokinin octapeptide (CCK-8) was mediated through its own receptor. Stripping of surface bound ligand studies demonstrated that both 125I-labeled ET-1 and 125I-labeled ET-3 were rapidly internalized. CCK-8 decreased the internalization but did not change the amount of surface bound ligand. Endothelins neither stimulate nor alter changes in enzyme secretion, intracellular calcium, cAMP, or [3H]inositol trisphosphate (IP3). This study demonstrates the presence of ETA and ETB receptors on rat pancreatic acini; occupation of both receptors resulted in rapid internalization, which is regulated by PLC-activating secretagogues. Occupation of either ET receptor did not alter intracellular calcium, cAMP, IP3, or stimulate amylase release.

  6. Mechanical circulatory support is associated with loss of platelet receptors glycoprotein Ibα and glycoprotein VI.

    PubMed

    Lukito, P; Wong, A; Jing, J; Arthur, J F; Marasco, S F; Murphy, D A; Bergin, P J; Shaw, J A; Collecutt, M; Andrews, R K; Gardiner, E E; Davis, A K

    2016-11-01

    Essentials Relationship of acquired von Willebrand disease (VWD) and platelet dysfunction is explored. Patients with ventricular assist devices and on extracorporeal membrane oxygenation are investigated. Acquired VWD and platelet receptor shedding is demonstrated in the majority of patients. Loss of platelet adhesion receptors glycoprotein (GP) Ibα and GPVI may increase bleeding risk. Background Ventricular assist devices (VADs) and extracorporeal membrane oxygenation (ECMO) are associated with bleeding that is not fully explained by anticoagulant or antiplatelet use. Exposure of platelets to elevated shear in vitro leads to increased shedding. Objectives To investigate whether loss of platelet receptors occurs in vivo, and the relationship with acquired von Willebrand syndrome (AVWS). Methods Platelet counts, coagulation tests and von Willebrand factor (VWF) analyses were performed on samples from 21 continuous flow VAD (CF-VAD), 20 ECMO, 12 heart failure and seven aortic stenosis patients. Levels of platelet receptors were measured by flow cytometry or ELISA. Results The loss of high molecular weight VWF multimers was observed in 18 of 19 CF-VAD and 14 of 20 ECMO patients, consistent with AVWS. Platelet receptor shedding was demonstrated by elevated soluble glycoprotein (GP) VI levels in plasma and significantly reduced surface GPIbα and GPVI levels in CF-VAD and ECMO patients as compared with healthy donors. Platelet receptor levels were also significantly reduced in heart failure patients. Conclusions These data link AVWS and increased platelet receptor shedding in patients with CF-VADs or ECMO for the first time. Loss of the platelet surface receptors GPIbα and GPVI in heart failure, CF-VAD and ECMO patients may contribute to ablated platelet adhesion/activation, and limit thrombus formation under high/pathologic shear conditions. © 2016 International Society on Thrombosis and Haemostasis.

  7. Receptor-like kinase SOBIR1/EVR interacts with receptor-like proteins in plant immunity against fungal infection.

    PubMed

    Liebrand, Thomas W H; van den Berg, Grardy C M; Zhang, Zhao; Smit, Patrick; Cordewener, Jan H G; America, Antoine H P; America, Antione H P; Sklenar, Jan; Jones, Alexandra M E; Tameling, Wladimir I L; Robatzek, Silke; Thomma, Bart P H J; Joosten, Matthieu H A J

    2013-06-11

    The plant immune system is activated by microbial patterns that are detected as nonself molecules. Such patterns are recognized by immune receptors that are cytoplasmic or localized at the plasma membrane. Cell surface receptors are represented by receptor-like kinases (RLKs) that frequently contain extracellular leucine-rich repeats and an intracellular kinase domain for activation of downstream signaling, as well as receptor-like proteins (RLPs) that lack this signaling domain. It is therefore hypothesized that RLKs are required for RLPs to activate downstream signaling. The RLPs Cf-4 and Ve1 of tomato (Solanum lycopersicum) mediate resistance to the fungal pathogens Cladosporium fulvum and Verticillium dahliae, respectively. Despite their importance, the mechanism by which these immune receptors mediate downstream signaling upon recognition of their matching ligand, Avr4 and Ave1, remained enigmatic. Here we show that the tomato ortholog of the Arabidopsis thaliana RLK Suppressor Of BIR1-1/Evershed (SOBIR1/EVR) and its close homolog S. lycopersicum (Sl)SOBIR1-like interact in planta with both Cf-4 and Ve1 and are required for the Cf-4- and Ve1-mediated hypersensitive response and immunity. Tomato SOBIR1/EVR interacts with most of the tested RLPs, but not with the RLKs FLS2, SERK1, SERK3a, BAK1, and CLV1. SOBIR1/EVR is required for stability of the Cf-4 and Ve1 receptors, supporting our observation that these RLPs are present in a complex with SOBIR1/EVR in planta. We show that SOBIR1/EVR is essential for RLP-mediated immunity and propose that the protein functions as a regulatory RLK of this type of cell-surface receptors.

  8. Opioid Receptor Function Is Regulated by Post-endocytic Peptide Processing*

    PubMed Central

    Gupta, Achla; Gomes, Ivone; Wardman, Jonathan; Devi, Lakshmi A.

    2014-01-01

    Most neuroendocrine peptides are generated in the secretory compartment by proteolysis of the precursors at classical cleavage sites consisting of basic residues by well studied endopeptidases belonging to the subtilisin superfamily. In contrast, a subset of bioactive peptides is generated by processing at non-classical cleavage sites that do not contain basic residues. Neither the peptidases responsible for non-classical cleavages nor the compartment involved in such processing has been well established. Members of the endothelin-converting enzyme (ECE) family are considered good candidate enzymes because they exhibit functional properties that are consistent with such a role. In this study we have explored a role for ECE2 in endocytic processing of δ opioid peptides and its effect on modulating δ opioid receptor function by using selective inhibitors of ECE2 that we had identified previously by homology modeling and virtual screening of a library of small molecules. We found that agonist treatment led to intracellular co-localization of ECE2 with δ opioid receptors. Furthermore, selective inhibitors of ECE2 and reagents that increase the pH of the acidic compartment impaired receptor recycling by protecting the endocytosed peptide from degradation. This, in turn, led to a substantial decrease in surface receptor signaling. Finally, we showed that treatment of primary neurons with the ECE2 inhibitor during recycling led to increased intracellular co-localization of the receptors and ECE2, which in turn led to decreased receptor recycling and signaling by the surface receptors. Together, these results support a role for differential modulation of opioid receptor signaling by post-endocytic processing of peptide agonists by ECE2. PMID:24847082

  9. Atomic force microscopy recognition of protein A on Staphylococcus aureus cell surfaces by labelling with IgG-Au conjugates.

    PubMed

    Tatlybaeva, Elena B; Nikiyan, Hike N; Vasilchenko, Alexey S; Deryabin, Dmitri G

    2013-01-01

    The labelling of functional molecules on the surface of bacterial cells is one way to recognize the bacteria. In this work, we have developed a method for the selective labelling of protein A on the cell surfaces of Staphylococcus aureus by using nanosized immunogold conjugates as cell-surface markers for atomic force microscopy (AFM). The use of 30-nm size Au nanoparticles conjugated with immunoglobulin G (IgG) allowed the visualization, localization and distribution of protein A-IgG complexes on the surface of S. aureus. The selectivity of the labelling method was confirmed in mixtures of S. aureus with Bacillus licheniformis cells, which differed by size and shape and had no IgG receptors on the surface. A preferential binding of the IgG-Au conjugates to S. aureus was obtained. Thus, this novel approach allows the identification of protein A and other IgG receptor-bearing bacteria, which is useful for AFM indication of pathogenic microorganisms in poly-component associations.

  10. Crosslinking by ligands to surface immunoglobulin triggers mobilization of intracellular 45Ca2+ in B lymphocytes

    PubMed Central

    1979-01-01

    Detailed studies of steady-state ion fluxes in murine lymphocytes were used to examine for possible ionic changes generated by surface Ig, the antigen receptor of B lymphocytes. When bound by ligands, surface Ig triggered the mobilization and release of 45Ca2+ from the cell interior by a transmembrane process requiring crosslinking of the bound receptors. This ionic event was unique for two reasons: (a) it did not occur when other common lymphocyte surface macromolecules were bound with rabbit anti-lymphocyte antibodies; and (b) it was not accompanied by a general perturbation of lymphocyte ionic properties such as a change in 42K+ fluxes nor did it depend on the presence of extracellular ions. Capping of surface Ig shares the same time sequence, dose response, requirement for crosslinking, and lack of dependence on extracellular ions. These correlations suggest that mobilization of intracellular Ca2+ may represent an early ionic signal for the contractile activation of lymphocytes that generates capping of surface Ig. PMID:315942

  11. Functional properties of internalization-deficient P2X4 receptors reveal a novel mechanism of ligand-gated channel facilitation by ivermectin.

    PubMed

    Toulmé, Estelle; Soto, Florentina; Garret, Maurice; Boué-Grabot, Eric

    2006-02-01

    Although P2X receptors within the central nervous system mediate excitatory ATP synaptic transmission, the identity of central ATP-gated channels has not yet been elucidated. P2X(4), the most widely expressed subunit in the brain, was previously shown to undergo clathrin-dependent constitutive internalization by direct interaction between activator protein (AP)2 adaptors and a tyrosine-based sorting signal specifically present in the cytosolic C-terminal tail of mammalian P2X(4) sequences. In this study, we first used internalization-deficient P2X(4) receptor mutants to show that suppression of the endocytosis motif significantly increased the apparent sensitivity to ATP and the ionic permeability of P2X(4) channels. These unique properties, observed at low channel density, suggest that interactions with AP2 complexes may modulate the function of P2X(4) receptors. In addition, ivermectin, an allosteric modulator of several receptor channels, including mammalian P2X(4), did not potentiate the maximal current of internalization-deficient rat or human P2X(4) receptors. We demonstrated that binding of ivermectin onto wild-type P2X(4) channels increased the fraction of plasma membrane P2X(4) receptors, whereas surface expression of internalization-deficient P2X(4) receptors remained unchanged. Disruption of the clathrin-mediated endocytosis with the dominant-negative mutants Eps15 or AP-50 abolished the ivermectin potentiation of wild-type P2X(4) channel currents. Likewise, ivermectin increased the membrane fraction of nicotinic alpha7 acetylcholine (nalpha7ACh) receptors and the potentiation of acetylcholine current by ivermectin was suppressed when the same dominant-negative mutants were expressed. These data showed that potentiation by ivermectin of both P2X(4) and nalpha7ACh receptors was primarily caused by an increase in the number of cell surface receptors resulting from a mechanism dependent on clathrin/AP2-mediated endocytosis.

  12. Enhanced In Vivo Tumor Detection by Active Tumor Cell Targeting Using Multiple Tumor Receptor-Binding Peptides Presented on Genetically Engineered Human Ferritin Nanoparticles.

    PubMed

    Kwon, Koo Chul; Ko, Ho Kyung; Lee, Jiyun; Lee, Eun Jung; Kim, Kwangmeyung; Lee, Jeewon

    2016-08-01

    Human ferritin heavy-chain nanoparticle (hFTH) is genetically engineered to present tumor receptor-binding peptides (affibody and/or RGD-derived cyclic peptides, named 4CRGD here) on its surface. The affibody and 4CRGD specifically and strongly binds to human epidermal growth factor receptor I (EGFR) and human integrin αvβ3, respectively, which are overexpressed on various tumor cells. Through in vitro culture of EGFR-overexpressing adenocarcinoma (MDA-MB-468) and integrin-overexpressing glioblastoma cells (U87MG), it is clarified that specific interactions between receptors on tumor cells and receptor-binding peptides on engineered hFTH is critical in active tumor cell targeting. After labeling with the near-infrared fluorescence dye (Cy5.5) and intravenouse injection into MDA-MB-468 or U87MG tumor-bearing mice, the recombinant hFTHs presenting either peptide or both of affibody and 4CRGD are successfully delivered to and retained in the tumor for a prolonged period of time. In particular, the recombinant hFTH presenting both affibody and 4CRGD notably enhances in vivo detection of U87MG tumors that express heterogeneous receptors, integrin and EGFR, compared to the other recombinant hFTHs presenting either affibody or 4CRGD only. Like affibody and 4CRGD used in this study, other multiple tumor receptor-binding peptides can be also genetically introduced to the hFTH surface for actively targeting of in vivo tumors with heterogenous receptors. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Multiple mechanisms underlying the long duration of action of thienorphine, a novel partial opioid agonist for the treatment of addiction.

    PubMed

    Yu, Gang; Li, Shu-Hui; Cui, Meng-Xun; Yan, Ling-Di; Yong, Zheng; Zhou, Pei-Lan; Su, Rui-Bin; Gong, Ze-Hui

    2014-03-01

    It is considered that a long-acting therapy would be advantageous in the treatment of addiction. In a search for novel buprenorphine analogues, thienorphine was demonstrated to be an extremely long-acting orally active partial opioid agonist. This study explored the mechanisms underlying the long-lasting effects of thienorphine. The binding kinetics of [(3) H]thienorphine were measured in membrane preparations expressing cloned rat opioid receptors. Flow cytometric analysis was used to determine the effect of thienorphine on the surface opioid receptor number. The long-lasting effects of thienorphine were also confirmed at the tissue level and in vivo. At 37°C, [(3) H]thienorphine showed rapid association with μ- and κ-opioid receptors, while its dissociation was sluggish and biphasic (K-1 = 0.21 min(-1) , K-2 = 0.0078 min(-1) for the μ-receptor; K-1 = 0.17 min(-1) , K-2 = 0.0042 min(-1) for the κ-receptor). Treatment with thienorphine for 24, 48, and 72 h downregulated surface μ-receptor in a dose- and time-dependent manner. The inhibitory effect of thienorphine on guinea pig ileum persisted for more than 120 min after prolonged washing. In vivo, thienorphine exhibited significant antagonism of morphine-induced antinociception for more than 7 days. These results indicate that multiple factors, including persistent receptor occupation and enhanced receptor downregulation, may contribute to the long-lasting effects of thienorphine that would be beneficial for its application in addiction treatment. © 2013 John Wiley & Sons Ltd.

  14. Sensitivity of C6 Glioma Cells Carrying the Human Poliovirus Receptor to Oncolytic Polioviruses.

    PubMed

    Sosnovtseva, A O; Lipatova, A V; Grinenko, N F; Baklaushev, V P; Chumakov, P M; Chekhonin, V P

    2016-10-01

    A humanized line of rat C6 glioma cells expressing human poliovirus receptor was obtained and tested for the sensitivity to oncolytic effects of vaccine strains of type 1, 2, and 3 polioviruses. Presentation of the poliovirus receptor on the surface of C6 glioma cells was shown to be a necessary condition for the interaction of cells with polioviruses, but insufficient for complete poliovirus oncolysis.

  15. Chemokines and their receptors: insights from molecular modeling and crystallography.

    PubMed

    Kufareva, Irina

    2016-10-01

    Chemokines are small secreted proteins that direct cell migration in development, immunity, inflammation, and cancer. They do so by binding and activating specific G protein coupled receptors on the surface of migrating cells. Despite the importance of receptor:chemokine interactions, their structural basis remained unclear for a long time. In 2015, the first atomic resolution insights were obtained with the publication of X-ray structures for two distantly related receptors bound to chemokines. In conjunction with experiment-guided molecular modeling, the structures suggest a conserved receptor:chemokine complex architecture, while highlighting the diverse details and functional roles of individual interaction epitopes. Novel findings promote the development and detailed structural interpretation of the canonical two-site hypothesis of receptor:chemokine recognition, and suggest new avenues for pharmacological modulation of chemokine receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kufareva, Irina; Gustavsson, Martin; Zheng, Yi

    Chemokines and their cell surface G protein–coupled receptors are critical for cell migration, not only in many fundamental biological processes but also in inflammatory diseases and cancer. Recent X-ray structures of two chemokines complexed with full-length receptors provided unprecedented insight into the atomic details of chemokine recognition and receptor activation, and computational modeling informed by new experiments leverages these insights to gain understanding of many more receptor:chemokine pairs. In parallel, chemokine receptor structures with small molecules reveal the complicated and diverse structural foundations of small molecule antagonism and allostery, highlight the inherent physicochemical challenges of receptor:chemokine interfaces, and suggest novelmore » epitopes that can be exploited to overcome these challenges. The structures and models promote unique understanding of chemokine receptor biology, including the interpretation of two decades of experimental studies, and will undoubtedly assist future drug discovery endeavors.« less

  17. Receptor-mediated protein kinase activation and the mechanism of transmembrane signaling in bacterial chemotaxis.

    PubMed Central

    Liu, Y; Levit, M; Lurz, R; Surette, M G; Stock, J B

    1997-01-01

    Chemotaxis responses of Escherichia coli and Salmonella are mediated by type I membrane receptors with N-terminal extracytoplasmic sensing domains connected by transmembrane helices to C-terminal signaling domains in the cytoplasm. Receptor signaling involves regulation of an associated protein kinase, CheA. Here we show that kinase activation by a soluble signaling domain construct involves the formation of a large complex, with approximately 14 receptor signaling domains per CheA dimer. Electron microscopic examination of these active complexes indicates a well defined bundle composed of numerous receptor filaments. Our findings suggest a mechanism for transmembrane signaling whereby stimulus-induced changes in lateral packing interactions within an array of receptor-sensing domains at the cell surface perturb an equilibrium between active and inactive receptor-kinase complexes within the cytoplasm. PMID:9405352

  18. Method and system for measurement of mechanical properties of molecules and cells

    NASA Technical Reports Server (NTRS)

    Fredberg, Jeffrey J. (Inventor); Butler, James P. (Inventor); Ingber, Donald E. (Inventor); Wang, Ning (Inventor)

    1996-01-01

    Mechanical stresses and deformations are applied directly to cell surface receptors or molecules and measured using a system including a magnetic twisting device in combination with ferromagnetic microbeads coated with ligands for integrins or any other surface receptors. The system can be used diagnostically to characterize cells and molecules and to determine the effect of transformation and compounds, including drugs, on the cells and molecules. The system can also be used to induce cells to grow or alter production of molecules by the cells.

  19. Discovery of a Potent Free Fatty Acid 1 Receptor Agonist with Low Lipophilicity, Low Polar Surface Area, and Robust in Vivo Efficacy.

    PubMed

    Hansen, Steffen V F; Christiansen, Elisabeth; Urban, Christian; Hudson, Brian D; Stocker, Claire J; Due-Hansen, Maria E; Wargent, Ed T; Shimpukade, Bharat; Almeida, Reinaldo; Ejsing, Christer S; Cawthorne, Michael A; Kassack, Matthias U; Milligan, Graeme; Ulven, Trond

    2016-03-24

    The free fatty acid receptor 1 (FFA1 or GPR40) is established as an interesting potential target for treatment of type 2 diabetes. However, to obtain optimal ligands, it may be necessary to limit both lipophilicity and polar surface area, translating to a need for small compounds. We here describe the identification of 24, a potent FFA1 agonist with low lipophilicity and very high ligand efficiency that exhibit robust glucose lowering effect.

  20. Physics of chemoreception.

    PubMed Central

    Berg, H C; Purcell, E M

    1977-01-01

    Statistical fluctuations limit the precision with which a microorganism can, in a given time T, determine the concentration of a chemoattractant in the surrounding medium. The best a cell can do is to monitor continually the state of occupation of receptors distributed over its surface. For nearly optimum performance only a small fraction of the surface need be specifically adsorbing. The probability that a molecule that has collided with the cell will find a receptor is Ns/(Ns + pi a), if N receptors, each with a binding site of radius s, are evenly distributed over a cell of radius a. There is ample room for many indenpendent systems of specific receptors. The adsorption rate for molecules of moderate size cannot be significantly enhanced by motion of the cell or by stirring of the medium by the cell. The least fractional error attainable in the determination of a concentration c is approximately (TcaD) - 1/2, where D is diffusion constant of the attractant. The number of specific receptors needed to attain such precision is about a/s. Data on bacteriophage absorption, bacterial chemotaxis, and chemotaxis in a cellular slime mold are evaluated. The chemotactic sensitivity of Escherichia coli approaches that of the cell of optimum design. PMID:911982

  1. Activation of G-proteins by receptor-stimulated nucleoside diphosphate kinase in Dictyostelium.

    PubMed Central

    Bominaar, A A; Molijn, A C; Pestel, M; Veron, M; Van Haastert, P J

    1993-01-01

    Recently, interest in the enzyme nucleoside diphosphate kinase (EC2.7.4.6) has increased as a result of its possible involvement in cell proliferation and development. Since NDP kinase is one of the major sources of GTP in cells, it has been suggested that the effects of an altered NDP kinase activity on cellular processes might be the result of altered transmembrane signal transduction via guanine nucleotide-binding proteins (G-proteins). In the cellular slime mould Dictyostelium discoideum, extracellular cAMP induces an increase of phospholipase C activity via a surface cAMP receptor and G-proteins. In this paper it is demonstrated that part of the cellular NDP kinase is associated with the membrane and stimulated by cell surface cAMP receptors. The GTP produced by the action of NDP kinase is capable of activating G-proteins as monitored by altered G-protein-receptor interaction and the activation of the effector enzyme phospholipase C. Furthermore, specific monoclonal antibodies inhibit the effect of NDP kinase on G-protein activation. These results suggest that receptor-stimulated NDP kinase contributes to the mediation of hormone action by producing GTP for the activation of GTP-binding proteins. Images PMID:8389692

  2. Myelin Proteolipid Protein Complexes with αv Integrin and AMPA Receptors In Vivo and Regulates AMPA-Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell-Surface GluR2 Expression

    PubMed Central

    Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi

    2015-01-01

    In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into demyelinated areas or OPCs in lesions may not mature into myelinating oligodendrocytes. We have found that the myelin proteolipid protein is critical to regulating OPC migratory responses to the neurotransmitter glutamate through modulation of cell-surface expression of the calcium-impermeable GluR2 subunit of the AMPA glutamate receptor and increased intercellular Ca2+ signaling. Altered glutamate homeostasis has been reported in demyelinated lesions. Therefore, understanding how OPCs respond to glutamate has important implications for treatment after white matter injury and disease. PMID:26311781

  3. Mannose phosphate isomerase regulates fibroblast growth factor receptor family signaling and glioma radiosensitivity.

    PubMed

    Cazet, Aurélie; Charest, Jonathan; Bennett, Daniel C; Sambrooks, Cecilia Lopez; Contessa, Joseph N

    2014-01-01

    Asparagine-linked glycosylation is an endoplasmic reticulum co- and post-translational modification that enables the transit and function of receptor tyrosine kinase (RTK) glycoproteins. To gain insight into the regulatory role of glycosylation enzymes on RTK function, we investigated shRNA and siRNA knockdown of mannose phosphate isomerase (MPI), an enzyme required for mature glycan precursor biosynthesis. Loss of MPI activity reduced phosphorylation of FGFR family receptors in U-251 and SKMG-3 malignant glioma cell lines and also resulted in significant decreases in FRS2, Akt, and MAPK signaling. However, MPI knockdown did not affect ligand-induced activation or signaling of EGFR or MET RTKs, suggesting that FGFRs are more susceptible to MPI inhibition. The reductions in FGFR signaling were not caused by loss of FGF ligands or receptors, but instead were caused by interference with receptor dimerization. Investigations into the cellular consequences of MPI knockdown showed that cellular programs driven by FGFR signaling, and integral to the clinical progression of malignant glioma, were impaired. In addition to a blockade of cellular migration, MPI knockdown also significantly reduced glioma cell clonogenic survival following ionizing radiation. Therefore our results suggest that targeted inhibition of enzymes required for cell surface receptor glycosylation can be manipulated to produce discrete and limited consequences for critical client glycoproteins expressed by tumor cells. Furthermore, this work identifies MPI as a potential enzymatic target for disrupting cell surface receptor-dependent survival signaling and as a novel approach for therapeutic radiosensitization.

  4. Insulation of a G protein-coupled receptor on the plasmalemmal surface of the pancreatic acinar cell

    PubMed Central

    1995-01-01

    Receptor desensitization is a key process for the protection of the cell from continuous or repeated exposure to high concentrations of an agonist. Well-established mechanisms for desensitization of guanine nucleotide-binding protein (G protein)-coupled receptors include phosphorylation, sequestration/internalization, and down-regulation. In this work, we have examined some mechanisms for desensitization of the cholecystokinin (CCK) receptor which is native to the pancreatic acinar cell, and have found the predominant mechanism to be distinct from these recognized processes. Upon fluorescent agonist occupancy of the native receptor, it becomes "insulated" from the effects of acid washing and becomes immobilized on the surface of the plasma membrane in a time- and temperature-dependent manner. This localization was assessed by ultrastructural studies using a colloidal gold conjugate of CCK, and lateral mobility of the receptor was assessed using fluorescence recovery after photobleaching. Of note, recent application of the same morphologic techniques to a CCK receptor-bearing Chinese hamster ovary cell line demonstrated prominent internalization via the clathrin-dependent endocytic pathway, as well as entry into caveolae (Roettger, B.F., R.U. Rentsch, D. Pinon, E. Holicky, E. Hadac, J.M. Larkin, and L.J. Miller, 1995, J. Cell Biol. 128: 1029-1041). These organelles are not observed to represent prominent compartments for the same receptor to traverse in the acinar cell, although fluorescent insulin is clearly internalized in these cells via receptor-mediated endocytosis. In this work, the rate of lateral mobility of the CCK receptor is observed to be similar in both cell types (1-3 x 10(-10) cm2/s), while the fate of the agonist-occupied receptor is quite distinct in each cell. This supports the unique nature of desensitization processes which occur in a cell-specific manner. A plasmalemmal site of insulation of this important receptor on the pancreatic acinar cell could be particularly effective to protect the cell from processes which might initiate pancreatitis, while providing for the rapid resensitization of this receptor to ensure appropriate pancreatic secretion to aid in nutrient assimilation for the organism. PMID:7622559

  5. T-Cell Surface Antigens and sCD30 as Biomarkers of the Risk of Rejection in Solid Organ Transplantation.

    PubMed

    Wieland, Eberhard; Shipkova, Maria

    2016-04-01

    T-cell activation is a characteristic of organ rejection. T cells, located in the draining lymph nodes of the transplant recipient, are faced with non-self-molecules presented by antigen presenting cells and become activated. Activated T cells are characterized by up-regulated surface antigens, such as costimulatory molecules, adhesion molecules, chemokine receptors, and major histocompatibility complex class II molecules. Surface antigen expression can be followed by flow cytometry using monoclonal antibodies in either cell function assays using donor-specific or nonspecific stimulation of isolated cells or whole blood and without stimulation on circulating lymphocytes. Molecules such as CD30 can be proteolytically cleaved off the surface of activated cells in vivo, and the determination of the soluble protein (sCD30) in serum or plasma is performed by immunoassays. As promising biomarkers for rejection and long-term transplant outcome, CD28 (costimulatory receptor for CD80 and CD86), CD154 (CD40 ligand), and sCD30 (tumor necrosis factor receptor superfamily, member 8) have been identified. Whereas cell function assays are time-consuming laboratory-developed tests which are difficult to standardize, commercial assays are frequently available for soluble proteins. Therefore, more data from clinical trials have been published for sCD30 compared with the surface antigens on activated T cells. This short review summarizes the association between selected surface antigens and immunosuppression, and rejection in solid organ transplantation.

  6. Activity-dependent downregulation of M-Type (Kv7) K⁺ channels surface expression requires the activation of iGluRs/Ca²⁺/PKC signaling pathway in hippocampal neuron.

    PubMed

    Li, Cai; Lu, Qing; Huang, Pengcheng; Fu, Tianli; Li, Changjun; Guo, Lianjun; Xu, Xulin

    2015-08-01

    M-type (Kv7) K(+) channels, encoded by KCNQ2-KCNQ5 genes, play a pivotal role in controlling neuronal excitability. However, precisely how neuronal activity regulates Kv7 channel translocation has not yet been fully defined. Here we reported activity-dependent changes in Kv7 channel subunits Kv7.2 and Kv7.3 surface expression by glutamate (glu). In the present study, we found that treatment with glutamate rapidly caused a specific decrease in M-current as well as Kv7 channel surface expression in primary cultured hippocampal neurons. The glutamate effects were mimicked by NMDA and AMPA. The glutamate effects on Kv7 channels were partially attenuated by pre-treatment of NMDA receptors antagonist d,l-APV or AMPA-KA receptors antagonist CNQX. The signal required Ca(2+) influx through L-type Ca(2+) channel and intracellular Ca(2+) elevations. PKC activation was involved in the glutamate-induced reduction of Kv7 channel surface expression. Moreover, a significant reduction of Kv7 channel surface expression occurred following glycine-induced "chem"-LTP in vitro and hippocampus-dependent behavioral learning training in vivo. These results demonstrated that activity-dependent reduction of Kv7 channel surface expression through activation of ionotropic glutamate receptors (iGluRs)/Ca(2+)/PKC signaling pathway might be an important molecular mechanism for regulation of neuronal excitability and synaptic plasticity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Role of Receptor Activity Modifying Protein 1 in Function of the Calcium Sensing Receptor in the Human TT Thyroid Carcinoma Cell Line

    PubMed Central

    Desai, Aditya J.; Roberts, David J.

    2014-01-01

    The Calcium Sensing Receptor (CaSR) plays a role in calcium homeostasis by sensing minute changes in serum Ca2+ and modulating secretion of calciotropic hormones. It has been shown in transfected cells that accessory proteins known as Receptor Activity Modifying Proteins (RAMPs), specifically RAMPs 1 and 3, are required for cell-surface trafficking of the CaSR. These effects have only been demonstrated in transfected cells, so their physiological relevance is unclear. Here we explored CaSR/RAMP interactions in detail, and showed that in thyroid human carcinoma cells, RAMP1 is required for trafficking of the CaSR. Furthermore, we show that normal RAMP1 function is required for intracellular responses to ligands. Specifically, to confirm earlier studies with tagged constructs, and to provide the additional benefit of quantitative stoichiometric analysis, we used fluorescence resonance energy transfer to show equal abilities of RAMP1 and 3 to chaperone CaSR to the cell surface, though RAMP3 interacted more efficiently with the receptor. Furthermore, a higher fraction of RAMP3 than RAMP1 was observed in CaSR-complexes on the cell-surface, suggesting different ratios of RAMPs to CaSR. In order to determine relevance of these findings in an endogenous expression system we assessed the effect of RAMP1 siRNA knock-down in medullary thyroid carcinoma TT cells, (which express RAMP1, but not RAMP3 constitutively) and measured a significant 50% attenuation of signalling in response to CaSR ligands Cinacalcet and neomycin. Blockade of RAMP1 using specific antibodies induced a concentration-dependent reduction in CaSR-mediated signalling in response to Cinacalcet in TT cells, suggesting a novel functional role for RAMP1 in regulation of CaSR signalling in addition to its known role in receptor trafficking. These data provide evidence that RAMPs traffic the CaSR as higher-level oligomers and play a role in CaSR signalling even after cell surface localisation has occurred. PMID:24454825

  8. Role of receptor activity modifying protein 1 in function of the calcium sensing receptor in the human TT thyroid carcinoma cell line.

    PubMed

    Desai, Aditya J; Roberts, David J; Richards, Gareth O; Skerry, Timothy M

    2014-01-01

    The Calcium Sensing Receptor (CaSR) plays a role in calcium homeostasis by sensing minute changes in serum Ca(2+) and modulating secretion of calciotropic hormones. It has been shown in transfected cells that accessory proteins known as Receptor Activity Modifying Proteins (RAMPs), specifically RAMPs 1 and 3, are required for cell-surface trafficking of the CaSR. These effects have only been demonstrated in transfected cells, so their physiological relevance is unclear. Here we explored CaSR/RAMP interactions in detail, and showed that in thyroid human carcinoma cells, RAMP1 is required for trafficking of the CaSR. Furthermore, we show that normal RAMP1 function is required for intracellular responses to ligands. Specifically, to confirm earlier studies with tagged constructs, and to provide the additional benefit of quantitative stoichiometric analysis, we used fluorescence resonance energy transfer to show equal abilities of RAMP1 and 3 to chaperone CaSR to the cell surface, though RAMP3 interacted more efficiently with the receptor. Furthermore, a higher fraction of RAMP3 than RAMP1 was observed in CaSR-complexes on the cell-surface, suggesting different ratios of RAMPs to CaSR. In order to determine relevance of these findings in an endogenous expression system we assessed the effect of RAMP1 siRNA knock-down in medullary thyroid carcinoma TT cells, (which express RAMP1, but not RAMP3 constitutively) and measured a significant 50% attenuation of signalling in response to CaSR ligands Cinacalcet and neomycin. Blockade of RAMP1 using specific antibodies induced a concentration-dependent reduction in CaSR-mediated signalling in response to Cinacalcet in TT cells, suggesting a novel functional role for RAMP1 in regulation of CaSR signalling in addition to its known role in receptor trafficking. These data provide evidence that RAMPs traffic the CaSR as higher-level oligomers and play a role in CaSR signalling even after cell surface localisation has occurred.

  9. Predicting receptor functionality of signaling lymphocyte activation molecule for measles virus hemagglutinin by docking simulation.

    PubMed

    Suzuki, Yoshiyuki

    2017-05-01

    Predicting susceptibility of various species to a virus assists assessment of risk of interspecies transmission. Evaluation of receptor functionality may be useful in screening for susceptibility. In this study, docking simulation was conducted for measles virus hemagglutinin (MV-H) and immunoglobulin-like variable domain of signaling lymphocyte activation molecule (SLAM-V). It was observed that the docking scores for MV-H and SLAM-V correlated with the activity of SLAM as an MV receptor. These results suggest that the receptor functionality may be predicted from the docking scores of virion surface proteins and cellular receptor molecules. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  10. Strychnine-blocked glycine receptor is removed from synapses by a shift in insertion/degradation equilibrium.

    PubMed

    Rasmussen, Hanne; Rasmussen, Trine; Triller, Antoine; Vannier, Christian

    2002-02-01

    The long-term inhibition by strychnine of glycine receptor activity in neurons provokes the receptor's selective intracellular accumulation and disappearance from synapses. This could result either from a disruption of the postsynaptic anchoring of the receptor or from an arrest of its exocytic transport. In this study we combined biochemical and fluorescence microscopy analyses to determine on a short time scale the fate of the strychnine-inactivated glycine receptor. Quantification of the cellular content of receptor showed that the rapid accumulation depends on protein synthesis. Cell surface biotinylation of neurons demonstrated that strychnine did not accelerate the turnover rate of the receptor. Labeling of endosomes indicated that, in strychnine-treated cells, the accumulated receptor is not blocked in the endosomal transport pathway. Taken together, these results indicate that strychnine does not destabilize the postsynaptic receptor but triggers its disappearance from synapses by a nondegradative sequestration of newly synthesized molecules in a nonendocytic compartment. (C)2002 Elsevier Science (USA).

  11. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  12. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  13. Quantitative Impact of Plasma Clearance and Down-regulation on GLP-1 Receptor Molecular Imaging.

    PubMed

    Zhang, Liang; Thurber, Greg M

    2016-02-01

    Quantitative molecular imaging of beta cell mass (BCM) would enable early detection and treatment monitoring of type 1 diabetes. The glucagon-like peptide-1 (GLP-1) receptor is an attractive target due to its beta cell specificity and cell surface location. We quantitatively investigated the impact of plasma clearance and receptor internalization on targeting efficiency in healthy B6 mice. Four exenatide-based probes were synthesized that varied in molecular weight, binding affinity, and plasma clearance. The GLP-1 receptor internalization rate and in vivo receptor expression were quantified. Receptor internalization (54,000 receptors/cell in vivo) decreased significantly within minutes, reducing the benefit of a slower-clearing agent. The multimers and albumin binding probes had higher kidney and liver uptake, respectively. Slow plasma clearance is beneficial for GLP-1 receptor peptide therapeutics. However, for exendin-based imaging of islets, down-regulation of the GLP-1 receptor and non-specific background uptake result in a higher target-to-background ratio for fast-clearing agents.

  14. Quantitative Impact of Plasma Clearance and Down-regulation on GLP-1 Receptor Molecular Imaging

    PubMed Central

    Zhang, Liang; Thurber, Greg M.

    2016-01-01

    Purpose Quantitative molecular imaging of beta cell mass (BCM) would enable early detection and treatment monitoring of type-1 diabetes. The glucagon like peptide-1 (GLP-1) receptor is an attractive target due to its beta cell specificity and cell surface location. We quantitatively investigated the impact of plasma clearance and receptor internalization on targeting efficiency in healthy B6 mice. Procedures Four exenatide-based probes were synthesized that varied in molecular weight, binding affinity, and plasma clearance. The GLP-1 receptor internalization rate and in vivo receptor expression were quantified. Results Receptor internalization (54,000 receptors/cell in vivo) decreased significantly within minutes, reducing the benefit of a slower clearing agent. The multimers and albumin binding probes had higher kidney and liver uptake, respectively. Conclusions Slow plasma clearance is beneficial for GLP-1 receptor peptide therapeutics. However, for exendin-based imaging of islets, downregulation of the GLP-1 receptor and non-specific background uptake result in a higher TBR for fast-clearing agents. PMID:26194012

  15. Radixin regulates synaptic GABAA receptor density and is essential for reversal learning and short-term memory

    PubMed Central

    Hausrat, Torben J.; Muhia, Mary; Gerrow, Kimberly; Thomas, Philip; Hirdes, Wiebke; Tsukita, Sachiko; Heisler, Frank F.; Herich, Lena; Dubroqua, Sylvain; Breiden, Petra; Feldon, Joram; Schwarz, Jürgen R; Yee, Benjamin K.; Smart, Trevor G.; Triller, Antoine; Kneussel, Matthias

    2015-01-01

    Neurotransmitter receptor density is a major variable in regulating synaptic strength. Receptors rapidly exchange between synapses and intracellular storage pools through endocytic recycling. In addition, lateral diffusion and confinement exchanges surface membrane receptors between synaptic and extrasynaptic sites. However, the signals that regulate this transition are currently unknown. GABAA receptors containing α5-subunits (GABAAR-α5) concentrate extrasynaptically through radixin (Rdx)-mediated anchorage at the actin cytoskeleton. Here we report a novel mechanism that regulates adjustable plasma membrane receptor pools in the control of synaptic receptor density. RhoA/ROCK signalling regulates an activity-dependent Rdx phosphorylation switch that uncouples GABAAR-α5 from its extrasynaptic anchor, thereby enriching synaptic receptor numbers. Thus, the unphosphorylated form of Rdx alters mIPSCs. Rdx gene knockout impairs reversal learning and short-term memory, and Rdx phosphorylation in wild-type mice exhibits experience-dependent changes when exposed to novel environments. Our data suggest an additional mode of synaptic plasticity, in which extrasynaptic receptor reservoirs supply synaptic GABAARs. PMID:25891999

  16. Principles of antibody-mediated TNF receptor activation

    PubMed Central

    Wajant, H

    2015-01-01

    From the beginning of research on receptors of the tumor necrosis factor (TNF) receptor superfamily (TNFRSF), agonistic antibodies have been used to stimulate TNFRSF receptors in vitro and in vivo. Indeed, CD95, one of the first cloned TNFRSF receptors, was solely identified as the target of cell death-inducing antibodies. Early on, it became evident from in vitro studies that valency and Fcγ receptor (FcγR) binding of antibodies targeting TNFRSF receptors can be of crucial relevance for agonistic activity. TNFRSF receptor-specific antibodies of the IgM subclass and secondary cross-linked or aggregation prone dimeric antibodies typically display superior agonistic activity compared with dimeric antibodies. Likewise, anchoring of antibodies to cell surface-expressed FcγRs potentiate their ability to trigger TNFRSF receptor signaling. However, only recently has the relevance of oligomerization and FcγR binding for the in vivo activity of antibody-induced TNFRSF receptor activation been straightforwardly demonstrated in vivo. This review discusses the crucial role of oligomerization and/or FcγR binding for antibody-mediated TNFRSF receptor stimulation in light of current models of TNFRSF receptor activation and especially the overwhelming relevance of these issues for the rational development of therapeutic TNFRSF receptor-targeting antibodies. PMID:26292758

  17. The C-type Lectin Langerin Functions as a Receptor for Attachment and Infectious Entry of Influenza A Virus.

    PubMed

    Ng, Wy Ching; Londrigan, Sarah L; Nasr, Najla; Cunningham, Anthony L; Turville, Stuart; Brooks, Andrew G; Reading, Patrick C

    2016-01-01

    It is well established that influenza A virus (IAV) attachment to and infection of epithelial cells is dependent on sialic acid (SIA) at the cell surface, although the specific receptors that mediate IAV entry have not been defined and multiple receptors may exist. Lec2 Chinese hamster ovary (CHO) cells are SIA deficient and resistant to IAV infection. Here we demonstrate that the expression of the C-type lectin receptor langerin in Lec2 cells (Lec2-Lg) rendered them permissive to IAV infection, as measured by replication of the viral genome, transcription of viral mRNA, and synthesis of viral proteins. Unlike SIA-dependent infection of parental CHO cells, IAV attachment and infection of Lec2-Lg cells was mediated via lectin-mediated recognition of mannose-rich glycans expressed by the viral hemagglutinin glycoprotein. Lec2 cells expressing endocytosis-defective langerin bound IAV efficiently but remained resistant to IAV infection, confirming that internalization via langerin was essential for infectious entry. Langerin-mediated infection of Lec2-Lg cells was pH and dynamin dependent, occurred via clathrin- and caveolin-mediated endocytic pathways, and utilized early (Rab5(+)) but not late (Rab7(+)) endosomes. This study is the first to demonstrate that langerin represents an authentic receptor that binds and internalizes IAV to facilitate infection. Moreover, it describes a unique experimental system to probe specific pathways and compartments involved in infectious entry following recognition of IAV by a single cell surface receptor. On the surface of host cells, sialic acid (SIA) functions as the major attachment factor for influenza A viruses (IAV). However, few studies have identified specific transmembrane receptors that bind and internalize IAV to facilitate infection. Here we identify human langerin as a transmembrane glycoprotein that can act as an attachment factor and a bone fide endocytic receptor for IAV infection. Expression of langerin by an SIA-deficient cell line resistant to IAV rendered cells permissive to infection. As langerin represented the sole receptor for IAV infection in this system, we have defined the pathways and compartments involved in infectious entry of IAV into cells following recognition by langerin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. The Phosphorylation of Vascular Endothelial Growth Factor Receptor-2 (VEGFR-2) by Engineered Surfaces with Electrostatically or Covalently Immobilized VEGF

    PubMed Central

    Anderson, Sean M.; Chen, Tom T.; Iruela-Arispe, M. Luisa; Segura, Tatiana

    2010-01-01

    Growth factors are a class of signaling proteins that direct cell fate through interaction with cell surface receptors. Although a myriad of possible cell fates stem from a growth factor binding to its receptor, the signaling cascades that result in one fate over another are still being elucidated. One possible mechanism by which nature modulates growth factor signaling is through the method of presentation of the growth factor – soluble or immobilized (matrix bound). Here we present the methodology to study signaling of soluble versus immobilized VEGF through VEGFR-2. We have designed a strategy to covalently immobilize VEGF using its heparin-binding domain to orient the molecule (bind) and a secondary functional group to mediate covalent binding (lock). This bind-and-lock approach aims to allow VEGF to assume a bioactive orientation before covalent immobilization. Surface plasmon resonance (SPR) demonstrated heparin and VEGF binding with surface densities of 60 ng/cm2 and 100 pg/cm2, respectively. ELISA experiments confirmed VEGF surface density and showed that electrostatically bound VEGF releases in cell medium and heparin solutions while covalently bound VEGF remains immobilized. Electrostatically bound VEGF and covalently bound VEGF phosphorylate VEGFR-2 in both VEGFR-2 transfected cells and VEGFR-2 endogenously producing cells. HUVECs plated on VEGF functionalized surfaces showed different morphologies between surface-bound VEGF and soluble VEGF. The surfaces synthesized in these studies allow for the study of VEGF/VEGFR-2 signaling induced by covalently bound, electrostatically bound, and soluble VEGF and may provide further insight into the design of materials for the generation of a mature and stable vasculature. PMID:19540581

  19. Invariant Chain Complexes and Clusters as Platforms for MIF Signaling

    PubMed Central

    Lindner, Robert

    2017-01-01

    Invariant chain (Ii/CD74) has been identified as a surface receptor for migration inhibitory factor (MIF). Most cells that express Ii also synthesize major histocompatibility complex class II (MHC II) molecules, which depend on Ii as a chaperone and a targeting factor. The assembly of nonameric complexes consisting of one Ii trimer and three MHC II molecules (each of which is a heterodimer) has been regarded as a prerequisite for efficient delivery to the cell surface. Due to rapid endocytosis, however, only low levels of Ii-MHC II complexes are displayed on the cell surface of professional antigen presenting cells and very little free Ii trimers. The association of Ii and MHC II has been reported to block the interaction with MIF, thus questioning the role of surface Ii as a receptor for MIF on MHC II-expressing cells. Recent work offers a potential solution to this conundrum: Many Ii-complexes at the cell surface appear to be under-saturated with MHC II, leaving unoccupied Ii subunits as potential binding sites for MIF. Some of this work also sheds light on novel aspects of signal transduction by Ii-bound MIF in B-lymphocytes: membrane raft association of Ii-MHC II complexes enables MIF to target Ii-MHC II to antigen-clustered B-cell-receptors (BCR) and to foster BCR-driven signaling and intracellular trafficking. PMID:28208600

  20. Molecular mechanisms of platelet P2Y(12) receptor regulation.

    PubMed

    Cunningham, Margaret R; Nisar, Shaista P; Mundell, Stuart J

    2013-02-01

    Platelets are critical for haemostasis, however inappropriate activation can lead to the development of arterial thrombosis, which can result in heart attack and stroke. ADP is a key platelet agonist that exerts its actions via stimulation of two surface GPCRs (G-protein-coupled receptors), P2Y(1) and P2Y(12). Similar to most GPCRs, P2Y receptor activity is tightly regulated by a number of complex mechanisms including receptor desensitization, internalization and recycling. In the present article, we review the molecular mechanisms that underlie P2Y(1) and P2Y(12) receptor regulation, with particular emphasis on the structural motifs within the P2Y(12) receptor, which are required to maintain regulatory protein interaction. The implications of these findings for platelet responsiveness are also discussed.

  1. Receptor Surface Models in the Classroom: Introducing Molecular Modeling to Students in a 3-D World

    ERIC Educational Resources Information Center

    Geldenhuys, Werner J.; Hayes, Michael; Van der Schyf, Cornelis J.; Allen, David D.; Malan, Sarel F.

    2007-01-01

    A simple, novel and generally applicable method to demonstrate structure-activity associations of a group of biologically interesting compounds in relation to receptor binding is described. This method is useful for undergraduates and graduate students in medicinal chemistry and computer modeling programs.

  2. Characterization of CD44-Mediated Cancer Cell Uptake and Intracellular Distribution of Hyaluronan-Grafted Liposomes

    PubMed Central

    Qhattal, Hussaini Syed Sha; Liu, Xinli

    2011-01-01

    Hyaluronan (HA) is a biocompatible and biodegradable linear polysaccharide which is of interest for tumor targeting through cell surface CD44 receptors. HA binds with high affinity to CD44 receptors, which are overexpressed in many tumors and involved in cancer metastasis. In the present study, we investigated the impact of HA molecular weight (MW), grafting density, and CD44 receptor density on endocytosis of HA-grafted liposomes (HA-liposomes) by cancer cells. Additionally, the intracellular localization of the HA-liposomes was determined. HAs of different MWs (5-8, 10-12, 175-350, and 1600 kDa) were conjugated to liposomes with varying degrees of grafting density. HA surface density was quantified using the hexadecyltrimethylammonium bromide turbidimetric method. Cellular uptake and subcellular localization of HA-liposomes were evaluated by flow cytometry and fluorescence microscopy. Mean particle sizes of HA-liposomes ranged from 120 to 180 nm and increased with the bigger size of HA. HA-liposome uptake correlated with HA MW (5-8 < 10-12 < 175-350 kDa), grafting density, and CD44 receptor density and exceeded that obtained with unconjugated plain liposomes. HA-liposomes were taken up into cells via lipid raft-mediated endocytosis, which is both energy- and cholesterol-dependent. Once within cells, HA-liposomes localized primarily to endosomes and lysosomes. The results demonstrate that cellular targeting efficiency of HA-liposomes depends strongly upon HA MW, grafting density, and cell surface receptor CD44 density. The results support a role of HA-liposomes for targeted drug delivery. PMID:21696190

  3. The PD-1/PD-L1 complex resembles the antigen-binding Fv domains of antibodies and T cell receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, David Yin-wei; Tanaka, Yoshimasa; Iwasaki, Masashi

    2008-07-29

    Signaling through the programmed death 1 (PD-1) inhibitory receptor upon binding its ligand, PD-L1, suppresses immune responses against autoantigens and tumors and plays an important role in the maintenance of peripheral immune tolerance. Release from PD-1 inhibitory signaling revives 'exhausted' virus-specific T cells in chronic viral infections. Here we present the crystal structure of murine PD-1 in complex with human PD-L1. PD-1 and PD-L1 interact through the conserved front and side of their Ig variable (IgV) domains, as do the IgV domains of antibodies and T cell receptors. This places the loops at the ends of the IgV domains onmore » the same side of the PD-1/PD-L1 complex, forming a surface that is similar to the antigen-binding surface of antibodies and T cell receptors. Mapping conserved residues allowed the identification of residues that are important in forming the PD-1/PD-L1 interface. Based on the structure, we show that some reported loss-of-binding mutations involve the PD-1/PD-L1 interaction but that others compromise protein folding. The PD-1/PD-L1 interaction described here may be blocked by antibodies or by designed small-molecule drugs to lower inhibitory signaling that results in a stronger immune response. The immune receptor-like loops offer a new surface for further study and potentially the design of molecules that would affect PD-1/PD-L1 complex formation and thereby modulate the immune response.« less

  4. In vitro expressed GPCR inserted in polymersome membranes for ligand-binding studies.

    PubMed

    May, Sylvia; Andreasson-Ochsner, Mirjam; Fu, Zhikang; Low, Ying Xiu; Tan, Darren; de Hoog, Hans-Peter M; Ritz, Sandra; Nallani, Madhavan; Sinner, Eva-Kathrin

    2013-01-07

    The dopamine receptor D2 (DRD2), a G-protein coupled receptor is expressed into PBd(22)-PEO(13) and PMOXA(20)-PDMS(54)-PMOXA(20) block copolymer vesicles. The conformational integrity of the receptor is confirmed by antibody- and ligand-binding assays. Replacement of bound dopamine is demonstrated on surface-immobilized polymersomes, thus making this a promising platform for drug screening. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The Effects of Pre-Exposure to DEET on the Downstream Blood-Feeding Behaviors of Aedes aegypti Mosquitoes

    DTIC Science & Technology

    2016-06-10

    house the odorant receptor neurons (Amer 48 DISTRIBUTION STATEMENT A: Approved for public release; distribution is unlimited. UNCLASSIFIED 3 and...Mehlhorn 2006, Hallem et al. 2006, Paluch et al. 2010). The insect olfactory process starts 49 when odorant molecules enter the pores located on the...sensilla. Each sensillum contains 50 olfactory receptor neurons that have odorant receptors on its surface. As the molecule enters the 51 pores, the

  6. Development of Augmented Leukemia/Lymphoma-Specific T-Cell Immunotherapy for Deployment with Haploidentical, Hematompoietic Progenitor-Cell Transplant

    DTIC Science & Technology

    2008-05-01

    adoptive therapy using CD19- specific chimeric antigen receptor re-directed T cells for recurrent/refractory follicular lymphoma. Mol Ther...T- cell therapies for B- cell malignancies we have developed a chimeric antigen receptor (CAR) which when expressed on the cell surface redirects T...that both CD4+ and CD8+ T cells expressing CD19-specific chimeric antigen receptor (CAR) can be generated usmg a novel non-viral gene

  7. Interactions of the α-subunits of heterotrimeric G-proteins with GPCRs, effectors and RGS proteins: a critical review and analysis of interacting surfaces, conformational shifts, structural diversity and electrostatic potentials.

    PubMed

    Baltoumas, Fotis A; Theodoropoulou, Margarita C; Hamodrakas, Stavros J

    2013-06-01

    G-protein coupled receptors (GPCRs) are one of the largest families of membrane receptors in eukaryotes. Heterotrimeric G-proteins, composed of α, β and γ subunits, are important molecular switches in the mediation of GPCR signaling. Receptor stimulation after the binding of a suitable ligand leads to G-protein heterotrimer activation and dissociation into the Gα subunit and Gβγ heterodimer. These subunits then interact with a large number of effectors, leading to several cell responses. We studied the interactions between Gα subunits and their binding partners, using information from structural, mutagenesis and Bioinformatics studies, and conducted a series of comparisons of sequence, structure, electrostatic properties and intermolecular energies among different Gα families and subfamilies. We identified a number of Gα surfaces that may, in several occasions, participate in interactions with receptors as well as effectors. The study of Gα interacting surfaces in terms of sequence, structure and electrostatic potential reveals features that may account for the Gα subunit's behavior towards its interacting partners. The electrostatic properties of the Gα subunits, which in some cases differ greatly not only between families but also between subfamilies, as well as the G-protein interacting surfaces of effectors and regulators of G-protein signaling (RGS) suggest that electrostatic complementarity may be an important factor in G-protein interactions. Energy calculations also support this notion. This information may be useful in future studies of G-protein interactions with GPCRs and effectors. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Positive Charges on the Surface of Thaumatin Are Crucial for the Multi-Point Interaction with the Sweet Receptor.

    PubMed

    Masuda, Tetsuya; Kigo, Satomi; Mitsumoto, Mayuko; Ohta, Keisuke; Suzuki, Mamoru; Mikami, Bunzo; Kitabatake, Naofumi; Tani, Fumito

    2018-01-01

    Thaumatin, an intensely sweet-tasting protein, elicits sweet taste with a threshold of only 50 nM. Previous studies from our laboratory suggested that the complex model between the T1R2-T1R3 sweet receptor and thaumatin depends critically on the complementarity of electrostatic potentials. In order to further validate this model, we focused on three lysine residues (Lys78, Lys106, and Lys137), which were expected to be part of the interaction sites. Three thaumatin mutants (K78A, K106A, and K137A) were prepared and their threshold values of sweetness were examined. The results showed that the sweetness of K106A was reduced by about three times and those of K78A and K137A were reduced by about five times when compared to wild-type thaumatin. The three-dimensional structures of these mutants were also determined by X-ray crystallographic analyses at atomic resolutions. The overall structures of mutant proteins were similar to that of wild-type but the electrostatic potentials around the mutated sites became more negative. Since the three lysine residues are located in 20-40 Å apart each other on the surface of thaumatin molecule, these results suggest the positive charges on the surface of thaumatin play a crucial role in the interaction with the sweet receptor, and are consistent with a large surface is required for interaction with the sweet receptor, as proposed by the multipoint interaction model named wedge model.

  9. Generalized paired-agent kinetic model for in vivo quantification of cancer cell-surface receptors under receptor saturation conditions

    NASA Astrophysics Data System (ADS)

    Sadeghipour, N.; Davis, S. C.; Tichauer, K. M.

    2017-01-01

    New precision medicine drugs oftentimes act through binding to specific cell-surface cancer receptors, and thus their efficacy is highly dependent on the availability of those receptors and the receptor concentration per cell. Paired-agent molecular imaging can provide quantitative information on receptor status in vivo, especially in tumor tissue; however, to date, published approaches to paired-agent quantitative imaging require that only ‘trace’ levels of imaging agent exist compared to receptor concentration. This strict requirement may limit applicability, particularly in drug binding studies, which seek to report on a biological effect in response to saturating receptors with a drug moiety. To extend the regime over which paired-agent imaging may be used, this work presents a generalized simplified reference tissue model (GSRTM) for paired-agent imaging developed to approximate receptor concentration in both non-receptor-saturated and receptor-saturated conditions. Extensive simulation studies show that tumor receptor concentration estimates recovered using the GSRTM are more accurate in receptor-saturation conditions than the standard simple reference tissue model (SRTM) (% error (mean  ±  sd): GSRTM 0  ±  1 and SRTM 50  ±  1) and match the SRTM accuracy in non-saturated conditions (% error (mean  ±  sd): GSRTM 5  ±  5 and SRTM 0  ±  5). To further test the approach, GSRTM-estimated receptor concentration was compared to SRTM-estimated values extracted from tumor xenograft in vivo mouse model data. The GSRTM estimates were observed to deviate from the SRTM in tumors with low receptor saturation (which are likely in a saturated regime). Finally, a general ‘rule-of-thumb’ algorithm is presented to estimate the expected level of receptor saturation that would be achieved in a given tissue provided dose and pharmacokinetic information about the drug or imaging agent being used, and physiological information about the tissue. These studies suggest that the GSRTM is necessary when receptor saturation exceeds 20% and highlight the potential for GSRTM to accurately measure receptor concentrations under saturation conditions, such as might be required during high dose drug studies, or for imaging applications where high concentrations of imaging agent are required to optimize signal-to-noise conditions. This model can also be applied to PET and SPECT imaging studies that tend to suffer from noisier data, but require one less parameter to fit if images are converted to imaging agent concentration (quantitative PET/SPECT).

  10. Detection of the plant parasite Cuscuta reflexa by a tomato cell surface receptor.

    PubMed

    Hegenauer, Volker; Fürst, Ursula; Kaiser, Bettina; Smoker, Matthew; Zipfel, Cyril; Felix, Georg; Stahl, Mark; Albert, Markus

    2016-07-29

    Parasitic plants are a constraint on agriculture worldwide. Cuscuta reflexa is a stem holoparasite that infests most dicotyledonous plants. One exception is tomato, which is resistant to C. reflexa We discovered that tomato responds to a small peptide factor occurring in Cuscuta spp. with immune responses typically activated after perception of microbe-associated molecular patterns. We identified the cell surface receptor-like protein CUSCUTA RECEPTOR 1 (CuRe1) as essential for the perception of this parasite-associated molecular pattern. CuRe1 is sufficient to confer responsiveness to the Cuscuta factor and increased resistance to parasitic C. reflexa when heterologously expressed in otherwise susceptible host plants. Our findings reveal that plants recognize parasitic plants in a manner similar to perception of microbial pathogens. Copyright © 2016, American Association for the Advancement of Science.

  11. Reciprocal Regulation of Endocytosis and Metabolism

    PubMed Central

    Antonescu, Costin N.; McGraw, Timothy E.; Klip, Amira

    2014-01-01

    The cellular uptake of many nutrients and micronutrients governs both their cellular availability and their systemic homeostasis. The cellular rate of nutrient or ion uptake (e.g., glucose, Fe3+, K+) or efflux (e.g., Na+) is governed by a complement of membrane transporters and receptors that show dynamic localization at both the plasma membrane and defined intracellular membrane compartments. Regulation of the rate and mechanism of endocytosis controls the amounts of these proteins on the cell surface, which in many cases determines nutrient uptake or secretion. Moreover, the metabolic action of diverse hormones is initiated upon binding to surface receptors that then undergo regulated endocytosis and show distinct signaling patterns once internalized. Here, we examine how the endocytosis of nutrient transporters and carriers as well as signaling receptors governs cellular metabolism and thereby systemic (whole-body) metabolite homeostasis. PMID:24984778

  12. Regulation of cytokine receptors by Golgi N-glycan processing and endocytosis.

    PubMed

    Partridge, Emily A; Le Roy, Christine; Di Guglielmo, Gianni M; Pawling, Judy; Cheung, Pam; Granovsky, Maria; Nabi, Ivan R; Wrana, Jeffrey L; Dennis, James W

    2004-10-01

    The Golgi enzyme beta1,6 N-acetylglucosaminyltransferase V (Mgat5) is up-regulated in carcinomas and promotes the substitution of N-glycan with poly N-acetyllactosamine, the preferred ligand for galectin-3 (Gal-3). Here, we report that expression of Mgat5 sensitized mouse cells to multiple cytokines. Gal-3 cross-linked Mgat5-modified N-glycans on epidermal growth factor and transforming growth factor-beta receptors at the cell surface and delayed their removal by constitutive endocytosis. Mgat5 expression in mammary carcinoma was rate limiting for cytokine signaling and consequently for epithelial-mesenchymal transition, cell motility, and tumor metastasis. Mgat5 also promoted cytokine-mediated leukocyte signaling, phagocytosis, and extravasation in vivo. Thus, conditional regulation of N-glycan processing drives synchronous modification of cytokine receptors, which balances their surface retention against loss via endocytosis.

  13. Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

    2008-04-11

    Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

  14. Interneuron- and GABAA receptor-specific inhibitory synaptic plasticity in cerebellar Purkinje cells

    NASA Astrophysics Data System (ADS)

    He, Qionger; Duguid, Ian; Clark, Beverley; Panzanelli, Patrizia; Patel, Bijal; Thomas, Philip; Fritschy, Jean-Marc; Smart, Trevor G.

    2015-07-01

    Inhibitory synaptic plasticity is important for shaping both neuronal excitability and network activity. Here we investigate the input and GABAA receptor subunit specificity of inhibitory synaptic plasticity by studying cerebellar interneuron-Purkinje cell (PC) synapses. Depolarizing PCs initiated a long-lasting increase in GABA-mediated synaptic currents. By stimulating individual interneurons, this plasticity was observed at somatodendritic basket cell synapses, but not at distal dendritic stellate cell synapses. Basket cell synapses predominantly express β2-subunit-containing GABAA receptors; deletion of the β2-subunit ablates this plasticity, demonstrating its reliance on GABAA receptor subunit composition. The increase in synaptic currents is dependent upon an increase in newly synthesized cell surface synaptic GABAA receptors and is abolished by preventing CaMKII phosphorylation of GABAA receptors. Our results reveal a novel GABAA receptor subunit- and input-specific form of inhibitory synaptic plasticity that regulates the temporal firing pattern of the principal output cells of the cerebellum.

  15. [GPCRs heterodimerization: a new way towards the discovery of function for the orphan receptors?].

    PubMed

    Levoye, Angélique; Jockers, Ralf

    2007-01-01

    G protein-coupled receptors (GPCRs), also called seven transmembrane domain (7TM) proteins, represent the largest family of cell surface receptors. GPCRs control a variety of physiological processes, are involved in multiple diseases and are major drug targets. Despite a vast effort of academic and industrial research, more than one hundred receptors remain orphans. These orphan GPCRs offer a great potential for drug discovery, as almost 60% of currently prescribed drugs target GPCRs. Deorphenization strategies have concentrated mainly on the identification of the natural ligands of these proteins. Recent advances have shown that orphan GPCRs, similar to orphan nuclear receptors, can regulate the function of non-orphan receptors by heterodimerization. These findings not only help to better understand the extraordinary diversity of GPCRs, but also open new perspectives for the identification of the function of these orphan receptors that hold great therapeutic potential.

  16. Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons.

    PubMed

    Shi, S; Hayashi, Y; Esteban, J A; Malinow, R

    2001-05-04

    AMPA-type glutamate receptors (AMPA-Rs) mediate a majority of excitatory synaptic transmission in the brain. In hippocampus, most AMPA-Rs are hetero-oligomers composed of GluR1/GluR2 or GluR2/GluR3 subunits. Here we show that these AMPA-R forms display different synaptic delivery mechanisms. GluR1/GluR2 receptors are added to synapses during plasticity; this requires interactions between GluR1 and group I PDZ domain proteins. In contrast, GluR2/GluR3 receptors replace existing synaptic receptors continuously; this occurs only at synapses that already have AMPA-Rs and requires interactions by GluR2 with NSF and group II PDZ domain proteins. The combination of regulated addition and continuous replacement of synaptic receptors can stabilize long-term changes in synaptic efficacy and may serve as a general model for how surface receptor number is established and maintained.

  17. REEPs Are Membrane Shaping Adapter Proteins That Modulate Specific G Protein-Coupled Receptor Trafficking by Affecting ER Cargo Capacity

    PubMed Central

    Ho, Vincent K.; Angelotti, Timothy

    2013-01-01

    Receptor expression enhancing proteins (REEPs) were identified by their ability to enhance cell surface expression of a subset of G protein-coupled receptors (GPCRs), specifically GPCRs that have proven difficult to express in heterologous cell systems. Further analysis revealed that they belong to the Yip (Ypt-interacting protein) family and that some REEP subtypes affect ER structure. Yip family comparisons have established other potential roles for REEPs, including regulation of ER-Golgi transport and processing/neuronal localization of cargo proteins. However, these other potential REEP functions and the mechanism by which they selectively enhance GPCR cell surface expression have not been clarified. By utilizing several REEP family members (REEP1, REEP2, and REEP6) and model GPCRs (α2A and α2C adrenergic receptors), we examined REEP regulation of GPCR plasma membrane expression, intracellular processing, and trafficking. Using a combination of immunolocalization and biochemical methods, we demonstrated that this REEP subset is localized primarily to ER, but not plasma membranes. Single cell analysis demonstrated that these REEPs do not specifically enhance surface expression of all GPCRs, but affect ER cargo capacity of specific GPCRs and thus their surface expression. REEP co-expression with α2 adrenergic receptors (ARs) revealed that this REEP subset interacts with and alter glycosidic processing of α2C, but not α2A ARs, demonstrating selective interaction with cargo proteins. Specifically, these REEPs enhanced expression of and interacted with minimally/non-glycosylated forms of α2C ARs. Most importantly, expression of a mutant REEP1 allele (hereditary spastic paraplegia SPG31) lacking the carboxyl terminus led to loss of this interaction. Thus specific REEP isoforms have additional intracellular functions besides altering ER structure, such as enhancing ER cargo capacity, regulating ER-Golgi processing, and interacting with select cargo proteins. Therefore, some REEPs can be further described as ER membrane shaping adapter proteins. PMID:24098485

  18. DYRK1A-mediated phosphorylation of GluN2A at Ser(1048) regulates the surface expression and channel activity of GluN1/GluN2A receptors.

    PubMed

    Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

    2014-01-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser(1048) of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser(1048) hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser(1048) increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons.

  19. DYRK1A-mediated phosphorylation of GluN2A at Ser1048 regulates the surface expression and channel activity of GluN1/GluN2A receptors

    PubMed Central

    Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M.; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

    2014-01-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser1048 of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser1048 hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser1048 increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons. PMID:25368549

  20. Biomimetic approaches to modulate cellular adhesion in biomaterials: A review.

    PubMed

    Rahmany, Maria B; Van Dyke, Mark

    2013-03-01

    Natural extracellular matrix (ECM) proteins possess critical biological characteristics that provide a platform for cellular adhesion and activation of highly regulated signaling pathways. However, ECM-based biomaterials can have several limitations, including poor mechanical properties and risk of immunogenicity. Synthetic biomaterials alleviate the risks associated with natural biomaterials but often lack the robust biological activity necessary to direct cell function beyond initial adhesion. A thorough understanding of receptor-mediated cellular adhesion to the ECM and subsequent signaling activation has facilitated development of techniques that functionalize inert biomaterials to provide a biologically active surface. Here we review a range of approaches used to modify biomaterial surfaces for optimal receptor-mediated cell interactions, as well as provide insights into specific mechanisms of downstream signaling activation. In addition to a brief overview of integrin receptor-mediated cell function, so-called "biomimetic" techniques reviewed here include (i) surface modification of biomaterials with bioadhesive ECM macromolecules or specific binding motifs, (ii) nanoscale patterning of the materials and (iii) the use of "natural-like" biomaterials. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  1. The endometrial cell surface and implantation. Expression of the polymorphic mucin MUC-1 and adhesion molecules during the endometrial cycle.

    PubMed

    Aplin, J D; Seif, M W; Graham, R A; Hey, N A; Behzad, F; Campbell, S

    1994-09-30

    The cell surface mucin MUC-1 is present in endometrial epithelial cells and their associated apical glycocalyx and is also released into gland lumens as a secretory product. MUC-1 mRNA and core protein are found at low levels in the proliferative phase of the cycle, but their abundance increases after ovulation. Endometrial MUC-1 has been found to carry sialokeratan sulphate chains and these show a dramatically increased abundance in cells and secretions in the post-ovulatory phase of the cycle, reaching a maximum in secretions 6-7 days after the LH peak. The apical epithelium also contains adhesion receptor molecules of the integrin and CD44 families. MUC-1 is large and highly glycosylated and probably extends farther from the cell surface than these 'conventional' glycoprotein receptors. It has the potential to inhibit sterically receptor-mediated cell-cell adhesion. However, it is also possible that MUC-1 displays specific (e.g., glycan) recognition structures for the initial attachment of the blastocyst or that the embryo may create a specialised microenvironment in which to implant.

  2. Solitary chemoreceptor cells in the nasal cavity serve as sentinels of respiration

    PubMed Central

    Finger, Thomas E.; Böttger, Bärbel; Hansen, Anne; Anderson, Karl T.; Alimohammadi, Hessamedin; Silver, Wayne L.

    2003-01-01

    Inhalation of irritating substances leads to activation of the trigeminal nerve, triggering protective reflexes that include apnea or sneezing. Receptors for trigeminal irritants are generally assumed to be located exclusively on free nerve endings within the nasal epithelium, requiring that trigeminal irritants diffuse through the junctional barrier at the epithelial surface to activate receptors. We find, in both rats and mice, an extensive population of chemosensory cells that reach the surface of the nasal epithelium and form synaptic contacts with trigeminal afferent nerve fibers. These chemosensory cells express T2R “bitter-taste” receptors and α-gustducin, a G protein involved in chemosensory transduction. Functional studies indicate that bitter substances applied to the nasal epithelium activate the trigeminal nerve and evoke changes in respiratory rate. By extending to the surface of the nasal epithelium, these chemosensory cells serve to expand the repertoire of compounds that can activate trigeminal protective reflexes. The trigeminal chemoreceptor cells are likely to be remnants of the phylogenetically ancient population of solitary chemoreceptor cells found in the epithelium of all anamniote aquatic vertebrates. PMID:12857948

  3. Solitary chemoreceptor cells in the nasal cavity serve as sentinels of respiration.

    PubMed

    Finger, Thomas E; Böttger, Bärbel; Hansen, Anne; Anderson, Karl T; Alimohammadi, Hessamedin; Silver, Wayne L

    2003-07-22

    Inhalation of irritating substances leads to activation of the trigeminal nerve, triggering protective reflexes that include apnea or sneezing. Receptors for trigeminal irritants are generally assumed to be located exclusively on free nerve endings within the nasal epithelium, requiring that trigeminal irritants diffuse through the junctional barrier at the epithelial surface to activate receptors. We find, in both rats and mice, an extensive population of chemosensory cells that reach the surface of the nasal epithelium and form synaptic contacts with trigeminal afferent nerve fibers. These chemosensory cells express T2R "bitter-taste" receptors and alpha-gustducin, a G protein involved in chemosensory transduction. Functional studies indicate that bitter substances applied to the nasal epithelium activate the trigeminal nerve and evoke changes in respiratory rate. By extending to the surface of the nasal epithelium, these chemosensory cells serve to expand the repertoire of compounds that can activate trigeminal protective reflexes. The trigeminal chemoreceptor cells are likely to be remnants of the phylogenetically ancient population of solitary chemoreceptor cells found in the epithelium of all anamniote aquatic vertebrates.

  4. CD70 is downregulated by interaction with CD27

    PubMed Central

    Kuka, Mirela; Munitic, Ivana; Torchia, Maria Letizia Giardino; Ashwell, Jonathan D.

    2013-01-01

    Engagement of the receptor CD27 by CD70 affects the magnitude and quality of T cell responses in a variety of infection models, and exaggerated signaling via this pathway results in enhanced immune responses and autoimmunity. One means by which signaling is regulated is tight control of cell surface CD70, which is expressed on dendritic, T, and B cells only upon activation. Here we show that there is a second level of regulation. First, although undetectable on the cell surface by flow cytometry, immature dendritic cells (DC) have a small pool of CD70 that continuously recycles from the plasma membrane. In addition, surface levels of CD70 on DC and T cells were higher in mice deficient in CD27, or on DC for which the interaction between CD70 and CD27 was precluded by blocking antibodies. Binding of CD70 by its receptor resulted in downregulation of CD70 transcription and protein levels, suggesting that CD70-mediated “reverse signals” regulate its own levels. Therefore, the ability of CD70 to trigger costimulation is self-regulated when it binds its complementary receptor. PMID:23913967

  5. Membrane cholesterol effect on the 5-HT2A receptor: Insights into the lipid-induced modulation of an antipsychotic drug target.

    PubMed

    Ramírez-Anguita, Juan Manuel; Rodríguez-Espigares, Ismael; Guixà-González, Ramon; Bruno, Agostino; Torrens-Fontanals, Mariona; Varela-Rial, Alejandro; Selent, Jana

    2018-01-01

    The serotonin 5-hydroxytryptamine 2A (5-HT 2A ) receptor is a G-protein-coupled receptor (GPCR) relevant for the treatment of CNS disorders. In this regard, neuronal membrane composition in the brain plays a crucial role in the modulation of the receptor functioning. Since cholesterol is an essential component of neuronal membranes, we have studied its effect on the 5-HT 2A receptor dynamics through all-atom MD simulations. We find that the presence of cholesterol in the membrane increases receptor conformational variability in most receptor segments. Importantly, detailed structural analysis indicates that conformational variability goes along with the destabilization of hydrogen bonding networks not only within the receptor but also between receptor and lipids. In addition to increased conformational variability, we also find receptor segments with reduced variability. Our analysis suggests that this increased stabilization is the result of stabilizing effects of tightly bound cholesterol molecules to the receptor surface. Our finding contributes to a better understanding of membrane-induced alterations of receptor dynamics and points to cholesterol-induced stabilizing and destabilizing effects on the conformational variability of GPCRs. © 2017 International Union of Biochemistry and Molecular Biology, Inc.

  6. Membrane receptor location defines receptor interaction with signaling proteins in a polarized epithelium.

    PubMed

    Amsler, K; Kuwada, S K

    1999-01-01

    Signal transduction from receptors is mediated by the interaction of activated receptors with proximate downstream signaling proteins. In polarized epithelial cells, the membrane is divided into subdomains: the apical and basolateral membranes. Membrane receptors may be present in one or both subdomains. Using a combination of immunoprecipitation and Western blot analyses, we tested the hypothesis that a tyrosine kinase growth factor receptor, epidermal growth factor receptor (EGFR), interacts with distinct signaling proteins when present at the apical vs. basolateral membrane of a polarized renal epithelial cell. We report here that tyrosine phosphorylation of phospholipase C-gamma (PLC-gamma) was induced only when basolateral EGFR was activated. In contrast, tyrosine phosphorylation of several other signaling proteins was increased by activation of receptor at either surface. All signaling proteins were distributed diffusely throughout the cytoplasm; however, PLC-gamma protein also displayed a concentration at lateral cell borders. These results demonstrate that in polarized epithelial cells the array of signaling pathways initiated by activation of a membrane receptor is defined, at least in part, by the membrane location of the receptor.

  7. The Structure of the Statocyst of the Freshwater Snail Biomphalaria Glabrata (Pulmonata, Basommatophora)

    NASA Technical Reports Server (NTRS)

    Gao, Wenyuan; Wiederhold, Michael L.

    1997-01-01

    The structure of the statocyst of the freshwater snail Biomphalaria glabrata has been examined by light and electron microscopy. The two statocysts are located on the dorsal-lateral side of the left and right pedal ganglion. The statocysts are spherical, fluid-filled capsules with a diameter of approximately 60 microns for young and 110 microns for adult snails. The wall of the cyst is composed of large receptor cells and many smaller supporting cells. The receptor cells bear cilia which are evenly distributed on the apical surface. The cilia have the typical 9+2 internal tubule configuration. Striate rootlets originate from the base of the basal body and run downward into the cytoplasm. Side-roots arise from one side of the basal body and a basal foot from the other. For each receptor cell, the basal foot always points to the periphery of the surface, indicating that the receptor cell is non-polarized. The receptor cells contain cytoplasmic organelles such as mitochondria, ribosomes, rough and smooth endoplasmic reticulum, compact Golgi bodies and multivesicular bodies. Supporting cells bearing microvilli are interposed between the receptor cells. The junction complex between the supporting cells and the receptor cells is composed of adherens and septate junctions, while between supporting cells only the adherens junctions are present. The static nerve arises from the lateral side of the cyst and contains axons in which parallel neurotubules and mitochondria are found. The axons arise directly from the base of the receptor cells without synapse. In the cyst lumen there are unattached statoconia. The statoconia have a plate-like or concentric membranous ring structure. Based on the morphology, the function of the statocyst in Biomphalaria is discussed.

  8. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor signaling.

    PubMed

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-09-01

    Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of AMPA receptor signaling

    PubMed Central

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-01-01

    Objectives Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. Methods In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Results Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. Conclusions These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. PMID:27687706

  10. Virions at the gates: receptors and the host-virus arms race.

    PubMed

    Coffin, John M

    2013-01-01

    All viruses need to bind to specific receptor molecules on the surface of target cells to initiate infection. Virus-receptor binding is highly specific, and this specificity determines both the species and the cell type that can be infected by a given virus. In some well-studied cases, the virus-binding region on the receptor has been found to be unrelated to the receptor's normal cellular function. Resistance to virus infection can thus evolve by selection of mutations that alter amino acids in the binding region with minimal effect on normal function. This sort of positive selection can be used to infer the history of the host-virus "arms race" during their coevolution. In a new study, Demogines et al. use a combination of phylogenetic, structural, and virological analysis to infer the history and significance of positive selection on the transferrin receptor TfR1, a housekeeping protein required for iron uptake and the cell surface receptor for at least three different types of virus. The authors show that only two parts of the rodent TfR1 molecule have been subject to positive selection and that these correspond to the binding sites for two of these viruses-the mouse mammary tumor virus (a retrovirus) and Machupo virus (an arenavirus). They confirmed this result by introducing the inferred binding site mutations into the wild-type protein and testing for receptor function. Related arenaviruses are beginning to spread in human populations in South America as the cause of often fatal hemorrhagic fevers, and, although Demogines et al. could find no evidence of TfR1 mutations in this region that might have been selected as a consequence of human infection, the authors identified one such mutation in Asian populations that affects infection with these viruses.

  11. Generation of herpesvirus entry mediator (HVEM)-restricted herpes simplex virus type 1 mutant viruses: resistance of HVEM-expressing cells and identification of mutations that rescue nectin-1 recognition.

    PubMed

    Uchida, Hiroaki; Shah, Waris A; Ozuer, Ali; Frampton, Arthur R; Goins, William F; Grandi, Paola; Cohen, Justus B; Glorioso, Joseph C

    2009-04-01

    Both initial infection and cell-to-cell spread by herpes simplex virus type 1 (HSV-1) require the interaction of the viral glycoprotein D (gD) with an entry receptor on the cell surface. The two major HSV entry receptors, herpesvirus entry mediator (HVEM) and nectin-1, mediate infection independently but are coexpressed on a variety of cells. To determine if both receptors are active in these instances, we have established mutant viruses that are selectively impaired for recognition of one or the other receptor. In plaque assays, these viruses showed approximately 1,000-fold selectivity for the matched receptor over the mismatched receptor. Separate assays showed that each virus is impaired for both infection and spread through the mismatched receptor. We tested several human tumor cell lines for susceptibility to these viruses and observed that HT29 colon carcinoma cells are susceptible to infection by nectin-1-restricted virus but are highly resistant to HVEM-restricted virus infection, despite readily detectable HVEM expression on the cell surface. HVEM cDNA isolated from HT29 cells rendered HSV-resistant cells permissive for infection by the HVEM-restricted virus, suggesting that HT29 cells lack a cofactor for HVEM-mediated infection or express an HVEM-specific inhibitory factor. Passaging of HVEM-restricted virus on nectin-1-expressing cells yielded a set of gD missense mutations that each restored functional recognition of nectin-1. These mutations identify residues that likely play a role in shaping the nectin-1 binding site of gD. Our findings illustrate the utility of these receptor-restricted viruses in studying the early events in HSV infection.

  12. Lipid Raft-dependent Glucagon-like Peptide-2 Receptor Trafficking Occurs Independently of Agonist-induced Desensitization

    PubMed Central

    Estall, Jennifer L.; Yusta, Bernardo; Drucker, Daniel J.

    2004-01-01

    The intestinotrophic and cytoprotective actions of glucagon-like peptide-2 (GLP-2) are mediated by the GLP-2 receptor (GLP-2R), a member of the class II glucagon-secretin G protein-coupled receptor superfamily. Although native GLP-2 exhibits a short circulating half-life, long-acting degradation-resistant GLP-2 analogues are being evaluated for therapeutic use in human subjects. Accordingly, we examined the mechanisms regulating signaling, internalization, and trafficking of the GLP-2R to identify determinants of receptor activation and desensitization. Heterologous cells expressing the transfected rat or human GLP-2R exhibited a rapid, dose-dependent, and prolonged desensitization of the GLP-2–stimulated cAMP response and a sustained GLP-2–induced decrease in levels of cell surface receptor. Surprisingly, inhibitors of clathrin-dependent endocytosis failed to significantly decrease GLP-2R internalization, whereas cholesterol sequestration inhibited ligand-induced receptor internalization and potentiated homologous desensitization. The hGLP-2R localized to both Triton X-100–soluble and –insoluble (lipid raft) cellular fractions and colocalized transiently with the lipid raft marker caveolin-1. Although GLP-2R endocytosis was dependent on lipid raft integrity, the receptor transiently associated with green fluorescent protein tagged-early endosome antigen 1–positive vesicles and inhibitors of endosomal acidification attenuated the reappearance of the GLP-2R on the cell surface. Our data demonstrate that GLP-2R desensitization and raft-dependent trafficking represent distinct and independent cellular mechanisms and provide new evidence implicating the importance of a clathrin- and dynamin-independent, lipid raft-dependent pathway for homologous G protein-coupled receptor internalization. PMID:15169869

  13. CARbodies: Human Antibodies Against Cell Surface Tumor Antigens Selected From Repertoires Displayed on T Cell Chimeric Antigen Receptors

    PubMed Central

    Alonso-Camino, Vanesa; Sánchez-Martín, David; Compte, Marta; Nuñez-Prado, Natalia; Diaz, Rosa M; Vile, Richard; Alvarez-Vallina, Luis

    2013-01-01

    A human single-chain variable fragment (scFv) antibody library was expressed on the surface of human T cells after transduction with lentiviral vectors (LVs). The repertoire was fused to a first-generation T cell receptor ζ (TCRζ)-based chimeric antigen receptor (CAR). We used this library to isolate antibodies termed CARbodies that recognize antigens expressed on the tumor cell surface in a proof-of-principle system. After three rounds of activation-selection there was a clear repertoire restriction, with the emergence dominant clones. The CARbodies were purified from bacterial cultures as soluble and active proteins. Furthermore, to validate its potential application for adoptive cell therapy, human T cells were transduced with a LV encoding a second-generation costimulatory CAR (CARv2) bearing the selected CARbodies. Transduced human primary T cells expressed significant levels of the CARbodies-based CARv2 fusion protein on the cell surface, and importantly could be specifically activated, after stimulation with tumor cells. This approach is a promising tool for the generation of antibodies fully adapted to the display format (CAR) and the selection context (cell synapse), which could extend the scope of current adoptive cell therapy strategies with CAR-redirected T cells. PMID:23695536

  14. Unliganded fibroblast growth factor receptor 1 forms density-independent dimers.

    PubMed

    Comps-Agrar, Laëtitia; Dunshee, Diana Ronai; Eaton, Dan L; Sonoda, Junichiro

    2015-10-02

    Fibroblast growth factors receptors (FGFRs) are thought to initiate intracellular signaling cascades upon ligand-induced dimerization of the extracellular domain. Although the existence of unliganded FGFR1 dimers on the surface of living cells has been proposed, this notion remains rather controversial. Here, we employed time-resolved Förster resonance energy transfer combined with SNAP- and ACP-tag labeling in COS7 cells to monitor dimerization of full-length FGFR1 at the cell-surface with or without the coreceptor βKlotho. Using this approach we observed homodimerization of unliganded FGFR1 that is independent of its surface density. The homo-interaction signal observed for FGFR1 was indeed as robust as that obtained for epidermal growth factor receptor (EGFR) and was further increased by the addition of activating ligands or pathogenic mutations. Mutational analysis indicated that the kinase and the transmembrane domains, rather than the extracellular domain, mediate the ligand-independent FGFR1 dimerization. In addition, we observed a formation of a higher order ligand-independent complex by the c-spliced isoform of FGFR1 and βKlotho. Collectively, our approach provides novel insights into the assembly and dynamics of the full-length FGFRs on the cell surface. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Ephrinb1 and Ephrinb2 Are Associated with Interleukin-7 Receptor α and Retard Its Internalization from the Cell Surface*

    PubMed Central

    Luo, Hongyu; Wu, Zenghui; Qi, Shijie; Jin, Wei; Han, Bing; Wu, Jiangping

    2011-01-01

    IL-7 plays vital roles in thymocyte development, T cell homeostasis, and the survival of these cells. IL-7 receptor α (IL-7Rα) on thymocytes and T cells is rapidly internalized upon IL-7 ligation. Ephrins (Efns) are cell surface molecules and ligands of the largest receptor kinase family, Eph kinases. We discovered that T cell-specific double gene knock-out (dKO) of Efnb1 and Efnb2 in mice led to reduced IL-7Rα expression in thymocytes and T cells, and that IL-7Rα down-regulation was accelerated in dKO CD4 cells upon IL-7 treatment. On the other hand, Efnb1 and Efnb2 overexpression on T cell lymphoma EL4 cells retarded IL-7Rα down-regulation. dKO T cells manifested compromised STAT5 activation and homeostatic proliferation, an IL-7-dependent process. Fluorescence resonance energy transfer and immunoprecipitation demonstrated that Efnb1 and Efnb2 interacted physically with IL-7Rα. Such interaction likely retarded IL-7Rα internalization, as Efnb1 and Efnb2 were not internalized. Therefore, we revealed a novel function of Efnb1 and Efnb2 in stabilizing IL-7Rα expression at the post-translational level, and a previously unknown modus operandi of Efnbs in the regulation of expression of other vital cell surface receptors. PMID:22069310

  16. Metal oxide nanosensors using polymeric membranes, enzymes and antibody receptors as ion and molecular recognition elements.

    PubMed

    Willander, Magnus; Khun, Kimleang; Ibupoto, Zafar Hussain

    2014-05-16

    The concept of recognition and biofunctionality has attracted increasing interest in the fields of chemistry and material sciences. Advances in the field of nanotechnology for the synthesis of desired metal oxide nanostructures have provided a solid platform for the integration of nanoelectronic devices. These nanoelectronics-based devices have the ability to recognize molecular species of living organisms, and they have created the possibility for advanced chemical sensing functionalities with low limits of detection in the nanomolar range. In this review, various metal oxides, such as ZnO-, CuO-, and NiO-based nanosensors, are described using different methods (receptors) of functionalization for molecular and ion recognition. These functionalized metal oxide surfaces with a specific receptor involve either a complex formation between the receptor and the analyte or an electrostatic interaction during the chemical sensing of analytes. Metal oxide nanostructures are considered revolutionary nanomaterials that have a specific surface for the immobilization of biomolecules with much needed orientation, good conformation and enhanced biological activity which further improve the sensing properties of nanosensors. Metal oxide nanostructures are associated with certain unique optical, electrical and molecular characteristics in addition to unique functionalities and surface charge features which shows attractive platforms for interfacing biorecognition elements with effective transducing properties for signal amplification. There is a great opportunity in the near future for metal oxide nanostructure-based miniaturization and the development of engineering sensor devices.

  17. Dynamic dual-tracer MRI-guided fluorescence tomography to quantify receptor density in vivo

    PubMed Central

    Davis, Scott C.; Samkoe, Kimberley S.; Tichauer, Kenneth M.; Sexton, Kristian J.; Gunn, Jason R.; Deharvengt, Sophie J.; Hasan, Tayyaba; Pogue, Brian W.

    2013-01-01

    The up-regulation of cell surface receptors has become a central focus in personalized cancer treatment; however, because of the complex nature of contrast agent pharmacokinetics in tumor tissue, methods to quantify receptor binding in vivo remain elusive. Here, we present a dual-tracer optical technique for noninvasive estimation of specific receptor binding in cancer. A multispectral MRI-coupled fluorescence molecular tomography system was used to image the uptake kinetics of two fluorescent tracers injected simultaneously, one tracer targeted to the receptor of interest and the other tracer a nontargeted reference. These dynamic tracer data were then fit to a dual-tracer compartmental model to estimate the density of receptors available for binding in the tissue. Applying this approach to mice with deep-seated gliomas that overexpress the EGF receptor produced an estimate of available receptor density of 2.3 ± 0.5 nM (n = 5), consistent with values estimated in comparative invasive imaging and ex vivo studies. PMID:23671066

  18. Structure of unliganded HSV gD reveals a mechanism for receptor-mediated activation of virus entry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krummenacher, Claude; Supekar, Vinit M.; Whitbeck, J. Charles

    2010-07-19

    Herpes simplex virus (HSV) entry into cells requires binding of the envelope glycoprotein D (gD) to one of several cell surface receptors. The 50 C-terminal residues of the gD ectodomain are essential for virus entry, but not for receptor binding. We have determined the structure of an unliganded gD molecule that includes these C-terminal residues. The structure reveals that the C-terminus is anchored near the N-terminal region and masks receptor-binding sites. Locking the C-terminus in the position observed in the crystals by an intramolecular disulfide bond abolished receptor binding and virus entry, demonstrating that this region of gD moves uponmore » receptor binding. Similarly, a point mutant that would destabilize the C-terminus structure was nonfunctional for entry, despite increased affinity for receptors. We propose that a controlled displacement of the gD C-terminus upon receptor binding is an essential feature of HSV entry, ensuring the timely activation of membrane fusion.« less

  19. Structural basis of ligand interaction with atypical chemokine receptor 3

    NASA Astrophysics Data System (ADS)

    Gustavsson, Martin; Wang, Liwen; van Gils, Noortje; Stephens, Bryan S.; Zhang, Penglie; Schall, Thomas J.; Yang, Sichun; Abagyan, Ruben; Chance, Mark R.; Kufareva, Irina; Handel, Tracy M.

    2017-01-01

    Chemokines drive cell migration through their interactions with seven-transmembrane (7TM) chemokine receptors on cell surfaces. The atypical chemokine receptor 3 (ACKR3) binds chemokines CXCL11 and CXCL12 and signals exclusively through β-arrestin-mediated pathways, without activating canonical G-protein signalling. This receptor is upregulated in numerous cancers making it a potential drug target. Here we collected over 100 distinct structural probes from radiolytic footprinting, disulfide trapping, and mutagenesis to map the structures of ACKR3:CXCL12 and ACKR3:small-molecule complexes, including dynamic regions that proved unresolvable by X-ray crystallography in homologous receptors. The data are integrated with molecular modelling to produce complete and cohesive experimentally driven models that confirm and expand on the existing knowledge of the architecture of receptor:chemokine and receptor:small-molecule complexes. Additionally, we detected and characterized ligand-induced conformational changes in the transmembrane and intracellular regions of ACKR3 that elucidate fundamental structural elements of agonism in this atypical receptor.

  20. Structural basis of ligand interaction with atypical chemokine receptor 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gustavsson, Martin; Wang, Liwen; van Gils, Noortje

    2017-01-18

    Chemokines drive cell migration through their interactions with seven-transmembrane (7TM) chemokine receptors on cell surfaces. The atypical chemokine receptor 3 (ACKR3) binds chemokines CXCL11 and CXCL12 and signals exclusively through β-arrestin-mediated pathways, without activating canonical G-protein signalling. This receptor is upregulated in numerous cancers making it a potential drug target. Here we collected over 100 distinct structural probes from radiolytic footprinting, disulfide trapping, and mutagenesis to map the structures of ACKR3:CXCL12 and ACKR3:small-molecule complexes, including dynamic regions that proved unresolvable by X-ray crystallography in homologous receptors. The data are integrated with molecular modelling to produce complete and cohesive experimentally drivenmore » models that confirm and expand on the existing knowledge of the architecture of receptor:chemokine and receptor:small-molecule complexes. Additionally, we detected and characterized ligand-induced conformational changes in the transmembrane and intracellular regions of ACKR3 that elucidate fundamental structural elements of agonism in this atypical receptor.« less

  1. The role of receptor binding specificity in interspecies transmission of influenza viruses

    PubMed Central

    Imai, Masaki; Kawaoka, Yoshihiro

    2017-01-01

    Influenza A virus infection begins with the binding of the hemagglutinin (HA) glycoprotein to sialic acid-containing receptors on the surface of the target cell. Avian influenza viruses, including avian H5N1, H7, and H9N2 viruses, can occasionally cross the species barrier and infect humans; however, these viruses do not spread efficiently from person to person, perhaps, in part, due to differences in the receptor-binding specificities of human and avian influenza viruses. The HAs of avian influenza viruses must adapt to receptors in humans to acquire efficient human-to-human transmissibility. In this review, we discuss the receptor binding specificity of influenza A viruses and its role in interspecies transmission. PMID:22445963

  2. The calcium receptor and calcimimetics.

    PubMed

    Wada, M; Nagano, N; Nemeth, E F

    1999-07-01

    Parathyroid cells can sense small changes in plasma Ca2+ levels by virtue of a cell surface Ca2+ receptor. Calcimimetics are newly synthesized compounds that act as agonists or positive allosteric modulators at the Ca2+ receptor and can suppress parathyroid hormone secretion. The first-generation calcimimetic, NPS R-568, has undergone clinical trials in primary hyperparathyroidism and in hyperparathyroidism secondary to chronic renal insufficiency. The data accumulated so far demonstrate that calcimimetics have potential as therapeutic agents for hyperparathyroidism and related bone diseases such as osteitis fibrosa.

  3. Combination therapy of potential gene to enhance oral cancer therapeutic effect

    NASA Astrophysics Data System (ADS)

    Yeh, Chia-Hsien; Hsu, Yih-Chih

    2015-03-01

    The epidermal growth factor receptor (EGFR) over-regulation related to uncontrolled cell division and promotes progression in tumor. Over-expression of human epidermal growth factor receptor (EGFR) has been detected in oral cancer cells. EGFR-targeting agents are potential therapeutic modalities for treating oral cancer based on our in vitro study. Liposome nanotechnology is used to encapsulate siRNA and were modified with target ligand to receptors on the surface of tumor cells. We used EGFR siRNA to treat oral cancer in vitro.

  4. Antiandrogenic steroidal sulfonyl heterocycles. Utility of electrostatic complementarity in defining bioisosteric sulfonyl heterocycles.

    PubMed

    Mallamo, J P; Pilling, G M; Wetzel, J R; Kowalczyk, P J; Bell, M R; Kullnig, R K; Batzold, F H; Juniewicz, P E; Winneker, R C; Luss, H R

    1992-05-15

    Complementarity of electrostatic potential surface maps was utilized in defining bioisosteric steroidal androgen receptor antagonists. Semiempirical and ab initio level calculations performed on a series of methanesulfonyl heterocycles indicated the requirement for a partial negative charge at the heteroatom attached to C-3 of the steroid nucleus to attain androgen receptor affinity. Synthesis and testing of six heterocycle A-ring-fused dihydroethisterone derivatives support this hypothesis, and we have identified two new androgen receptor antagonists of this class.

  5. Human Neural Cell-Based Biosensor

    DTIC Science & Technology

    2010-04-26

    SNAP25 (SNAP25), GluR1 (GRIA1) glutamate receptor , ionotropic , AMPA1, Nav1.2 (SCN2A), Nav1.6 (SCN8A), CaV 2.1 (CACNA1A), HERG (KCNH2), and KCC2...transitions to mesenchymal progenitor cells." Tissue Eng Part A 15(8): 1897-907. Haltiwanger, R. S. and P. Stanley (2002). "Modulation of receptor ...cytometry studies previously conducted by the Stice lab identified ciliary neurotrophic factor receptor alpha (CNTFRα) as a novel cell surface marker to

  6. Characterization of two porcine macrophage cell lines for the expression of pathogen-recognition receptors, defensins, cytokines, chemokines, and surface sialic acid

    USDA-ARS?s Scientific Manuscript database

    Macrophages express various pathogen-recognition receptors (PRRs) which recognize pathogen-associated molecular patterns (PAMPs) and activate genes responsible for host defense. The aim of this study was to characterize two porcine macrophage cell lines (Cdelta+ and Cdelta–) for the expression of P...

  7. Sequence analysis of a bitter taste receptor gene repertoires in different ruminant species

    USDA-ARS?s Scientific Manuscript database

    Bitter taste has been extensively studied in mammalian species and is associated with sensitivity to toxins and with food choices that avoid dangerous substances in the diet. At the molecular level, bitter compounds are sensed by bitter taste receptor proteins (T2R) present at the surface of taste r...

  8. INF-gamma rearranges membrane topography of MHC-I and ICAM-1 in colon carcinoma cells.

    PubMed

    Bacsó, Zsolt; Bene, László; Damjanovich, László; Damjanovich, Sándor

    2002-01-18

    Flow-cytometric fluorescence energy transfer (FCET) measurements between fluorescently labeled cell surface MHC-I and ICAM-1 molecules indicated similar receptor patterns in the plasma membrane of interferon-gamma (INF-gamma)-treated colon carcinoma cells as those observed earlier at the surface of lymphoid cells. INF-gamma activation significantly increased the density of MHC-I and ICAM-1 proteins in the membrane. This increase in receptor density was accompanied by decreased proximity level of the homo-associated MHC-I receptors. Hetero-association of MHC-I and ICAM-1 molecules was increased by INF-gamma treatment. INF-gamma changed neither hetero- nor homo-association of transferrin receptors. By staining the sphingomyelin/cholesterol-enriched lipid microdomains with fluorescently labeled cholera toxin B subunit, we found an increase in the amount of lipid-raft associated G(M1)-gangliosides due to INF-gamma treatment. Confocal microscopic results and FCET measurements show that MHC-I and ICAM-1 are components of G(M1)-ganglioside containing lipid-rafts and also support an increase in the size of these lipid-rafts upon INF-gamma treatment.

  9. Theileria parva infection induces autocrine growth of bovine lymphocytes.

    PubMed Central

    Dobbelaere, D A; Coquerelle, T M; Roditi, I J; Eichhorn, M; Williams, R O

    1988-01-01

    Bovine lymphocytes infected with the parasite Theileria parva continuously secrete a growth factor that is essential for their proliferation in vitro and also constitutively express interleukin 2 receptors on their surface. Dilution of the secreted growth factor, caused by culturing cells at low density, results in retardation of culture growth. Human recombinant interleukin 2, however, effectively substitutes for the diluted growth factor by restoring normal growth rates and also allows Theileria-infected cells to be grown at low density without the use of feeder layers. Secretion of the growth factor and expression of the interleukin 2 receptor depend on the presence of the parasite in the cytoplasm of the host cell. Elimination of the parasite from the cell cytoplasm by the specific antitheilerial drug BW 720c results in the arrest of growth factor secretion and the disappearance of interleukin 2 receptors from the cell surface. This is accompanied by growth arrest and reversion of the infected cells to the morphology of resting lymphocytes. We propose that the continuous proliferation of infected cells in vitro is mediated by autocrine receptor activation. Images PMID:3133661

  10. A role for AT1 receptor-associated proteins in blood pressure regulation.

    PubMed

    Castrop, Hayo

    2015-04-01

    The renin angiotensin-system is one of the most important humoral regulators of blood pressure. The recently discovered angiotensin receptor-associated proteins serve as local modulators of the renin angiotensin-system. These proteins interact with the AT1 receptor in a tissue-specific manner and regulate the sensitivity of the target cell for angiotensin II. The predominant effect of the AT1 receptor-associated proteins on angiotensin II-induced signaling is the modulation of the surface expression of the AT1 receptor. This review provides an overview of our current knowledge with respect to the relevance of AT1 receptor-associated proteins for blood pressure regulation. Two aspects of blood pressure regulation will be discussed in detail: angiotensin II-dependent volume homoeostasis and vascular resistance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Structural basis for the specific recognition of IL-18 by its alpha receptor.

    PubMed

    Wei, Hui; Wang, Dongli; Qian, Yun; Liu, Xi; Fan, Shilong; Yin, Hsien-Sheng; Wang, Xinquan

    2014-11-03

    Interleukin 18 (IL-18), a member of the IL-1 family of cytokines, is an important regulator of innate and acquired immune responses. It signals through its ligand-binding primary receptor IL-18Rα and accessory receptor IL-18Rβ. Here we report the crystal structure of IL-18 with the ectodomain of IL-18Rα, which reveals the structural basis for their specific recognition. It confirms that surface charge complementarity determines the ligand-binding specificity of primary receptors in the IL-1 receptor family. We suggest that IL-18 signaling complex adopts an architecture similar to other agonistic cytokines and propose a general ligand-receptor assembly and activation model for the IL-1 family. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. Laboratory study of SO2 dry deposition on limestone and marble: Effects of humidity and surface variables

    USGS Publications Warehouse

    Spiker, E. C.; Hosker, R.P.; Weintraub, V.C.; Sherwood, S.I.

    1995-01-01

    The dry deposition of gaseous air pollutants on stone and other materials is influenced by atmospheric processes and the chemical characteristics of the deposited gas species and of the specific receptor material. Previous studies have shown that relative humidity, surface moisture, and acid buffering capability of the receptor surface are very important factors. To better quantify this behavior, a special recirculating wind tunnel/environmental chamber was constructed, in which wind speed, turbulence, air temperature, relative humidity, and concentrations of several pollutants (SO2, O3, nitrogen oxides) can be held constant. An airfoil sample holder holds up to eight stone samples (3.8 cm in diameter and 1 cm thick) in nearly identical exposure conditions. SO2 deposition on limestone was found to increase exponentially with increasing relative humidity (RH). Marble behaves similarly, but with a much lower deposition rate. Trends indicate there is little deposition below 20% RH on clean limestone and below 60% RH on clean marble. This large difference is due to the limestone's greater porosity, surface roughness, and effective surface area. These results indicate surface variables generally limit SO2 deposition below about 70% RH on limestone and below at least 95% RH on marble. Aerodynamic variables generally limit deposition at higher relative humidity or when the surface is wet.The dry deposition of gaseous air pollutants on stone and other materials is influenced by atmospheric processes and the chemical characteristics of the deposited gas species and of the specific receptor material. Previous studies have shown that relative humidity, surface moisture, and acid buffering capability of the receptor surface are very important factors. To better quantify this behavior, a special recirculating wind tunnel/environmental chamber was constructed, in which wind speed, turbulence, air temperature, relative humidity, and concentrations of several pollutants (SO2, O3, nitrogen oxides) can be held constant. An airfoil sample holder holds up to eight stone samples (3.8 cm in diameter and 1 cm thick) in nearly identical exposure conditions. SO2 deposition on limestone was found to increase exponentially with increasing relative humidity (RH). Marble behaves similarly, but with a much lower deposition rate. Trends indicate there is little deposition below 20% RH on clean limestone and below 60% RH on clean marble. This large difference is due to the limestone's greater porosity, surface roughness, and effective surface area. These results indicate surface variables generally limit SO2 deposition below about 70% RH on limestone and below at least 95% RH on marble. Aerodynamic variables generally limit deposition at higher relative humidity or when the surface is wet.

  13. Determinants in the β and δ subunit cytoplasmic loop regulate Golgi trafficking and surface expression of the muscle acetylcholine receptor.

    PubMed

    Rudell, Jolene Chang; Borges, Lucia S; Rudell, John B; Beck, Kenneth A; Ferns, Michael J

    2014-01-03

    The molecular determinants that govern nicotinic acetylcholine receptor (AChR) assembly and trafficking are poorly defined, and those identified operate largely during initial receptor biogenesis in the endoplasmic reticulum. To identify determinants that regulate later trafficking steps, we performed an unbiased screen using chimeric proteins consisting of CD4 fused to the muscle AChR subunit cytoplasmic loops. In C2 mouse muscle cells, we found that CD4-β and δ subunit loops were expressed at very low levels on the cell surface, whereas the other subunit loops were robustly expressed on the plasma membrane. The low surface expression of CD4-β and δ loops was due to their pronounced retention in the Golgi apparatus and also to their rapid internalization from the plasma membrane. Both retention and recovery were mediated by the proximal 25-28 amino acids in each loop and were dependent on an ordered sequence of charged and hydrophobic residues. Indeed, βK353L and δK351L mutations increased surface trafficking of the CD4-subunit loops by >6-fold and also decreased their internalization from the plasma membrane. Similarly, combined βK353L and δK351L mutations increased the surface levels of assembled AChR expressed in HEK cells to 138% of wild-type levels. This was due to increased trafficking to the plasma membrane and not decreased AChR turnover. These findings identify novel Golgi retention signals in the β and δ subunit loops that regulate surface trafficking of assembled AChR and may help prevent surface expression of unassembled subunits. Together, these results define molecular determinants that govern a Golgi-based regulatory step in nicotinic AChR trafficking.

  14. Increased Accuracy of Ligand Sensing by Receptor Internalization and Lateral Receptor Diffusion

    NASA Astrophysics Data System (ADS)

    Aquino, Gerardo; Endres, Robert

    2010-03-01

    Many types of cells can sense external ligand concentrations with cell-surface receptors at extremely high accuracy. Interestingly, ligand-bound receptors are often internalized, a process also known as receptor-mediated endocytosis. While internalization is involved in a vast number of important functions for the life of a cell, it was recently also suggested to increase the accuracy of sensing ligand as overcounting of the same ligand molecules is reduced. A similar role may be played by receptor diffusion om the cell membrane. Fast, lateral receptor diffusion is known to be relevant in neurotransmission initiated by release of neurotransmitter glutamate in the synaptic cleft between neurons. By binding ligand and removal by diffusion from the region of release of the neurotransmitter, diffusing receptors can be reasonably expected to reduce the local overcounting of the same ligand molecules in the region of signaling. By extending simple ligand-receptor models to out-of-equilibrium thermodynamics, we show that both receptor internalization and lateral diffusion increase the accuracy with which cells can measure ligand concentrations in the external environment. We confirm this with our model and give quantitative predictions for experimental parameters values. We give quantitative predictions, which compare favorably to experimental data of real receptors.

  15. The importance of electrostatic potential in the interaction of sweet proteins with the sweet taste receptor.

    PubMed

    Esposito, Veronica; Gallucci, Roberta; Picone, Delia; Saviano, Gabriella; Tancredi, Teodorico; Temussi, Piero A

    2006-07-07

    In addition to many small molecular mass sweeteners there are in nature a few sweet proteins. The molecular volume of sweet proteins is so different from that of common sweeteners that it was difficult to understand how molecules as large as proteins can activate a receptor designed to host small molecules. We have recently shown that sweet proteins can activate the sweet receptor by a mechanism of interaction, called ''wedge model", in which proteins fit a large cavity of the receptor with wedge-shaped surfaces of their structures. In order to substantiate this model we have designed, expressed and characterized seven mutants of MNEI, a single chain monellin. Three uncharged residues of the interaction surface, Met42, Tyr63 and Tyr65, were changed either into acidic or basic residues whereas Asp68, a key acidic residue, was changed into a basic one. As a general trend, we observe that an increase of the negative charge is much more detrimental for sweetness than an increase of positive charge. In addition we show that by a careful choice of a residue at the center of the interface between MNEI and receptor, it is possible even to increase the sweetness of MNEI. These results are fully consistent with the wedge model.

  16. Trafficking of α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid Receptor (AMPA) Receptor Subunit GluA2 from the Endoplasmic Reticulum Is Stimulated by a Complex Containing Ca2+/Calmodulin-activated Kinase II (CaMKII) and PICK1 Protein and by Release of Ca2+ from Internal Stores*

    PubMed Central

    Lu, Wei; Khatri, Latika; Ziff, Edward B.

    2014-01-01

    The GluA2 subunit of the AMPA receptor (AMPAR) dominantly blocks AMPAR Ca2+ permeability, and its trafficking to the synapse regulates AMPAR-dependent synapse Ca2+ permeability. Here we show that GluA2 trafficking from the endoplasmic reticulum (ER) to the plasma membrane of cultured hippocampal neurons requires Ca2+ release from internal stores, the activity of Ca2+/calmodulin activated kinase II (CaMKII), and GluA2 interaction with the PDZ protein, PICK1. We show that upon Ca2+ release from the ER via the IP3 and ryanodine receptors, CaMKII that is activated enters a complex that contains PICK1, dependent upon the PICK1 BAR (Bin-amphiphysin-Rvs) domain, and that interacts with the GluA2 C-terminal domain and stimulates GluA2 ER exit and surface trafficking. This study reveals a novel mechanism of regulation of trafficking of GluA2-containing receptors to the surface under the control of intracellular Ca2+ dynamics and CaMKII activity. PMID:24831007

  17. Hyaluronan functionalizing QDs as turn-on fluorescent probe for targeted recognition CD44 receptor

    NASA Astrophysics Data System (ADS)

    Zhou, Shang; Huo, Danqun; Hou, Changjun; Yang, Mei; Fa, Huanbao

    2017-09-01

    The recognition of tumor markers in living cancer cells has attracted increasing interest. In the present study, the turn-on fluorescence probe was designed based on the fluorescence of thiolated chitosan-coated CdTe QDs (CdTe/TCS QDs) quenched by hyaluronan, which could provide the low background signal for sensitive cellular imaging. This system is expected to offer specific recognition of CD44 receptor over other substances owing to the specific affinity of hyaluronan and CD44 receptor ( 8-9 kcal/mol). The probe is stable in aqueous and has little toxicity to living cells; thus, it can be utilized for targeted cancer cell imaging. The living lung cancer cell imaging experiments further demonstrate its value in recognizing cell-surface CD44 receptor with turn-on mode. In addition, the probe can be used to recognize and differentiate the subtypes of lung cancer cells based on the difference of CD44 expression on the surface of lung cancer cells. And, the western blot test further confirmed that the expression level of the CD44 receptor in lung cancer cells is different. Therefore, this probe may be potentially applied in recognizing lung cancer cells with higher contrast and sensitivity and provide new tools for cancer prognosis and therapy. [Figure not available: see fulltext.

  18. Identification of Human P2X1 Receptor-interacting Proteins Reveals a Role of the Cytoskeleton in Receptor Regulation*

    PubMed Central

    Lalo, Ulyana; Roberts, Jonathan A.; Evans, Richard J.

    2011-01-01

    P2X1 receptors are ATP-gated ion channels expressed by smooth muscle and blood cells. Carboxyl-terminally His-FLAG-tagged human P2X1 receptors were stably expressed in HEK293 cells and co-purified with cytoskeletal proteins including actin. Disruption of the actin cytoskeleton with cytochalasin D inhibited P2X1 receptor currents with no effect on the time course of the response or surface expression of the receptor. Stabilization of the cytoskeleton with jasplakinolide had no effect on P2X1 receptor currents but decreased receptor mobility. P2X2 receptor currents were unaffected by cytochalasin, and P2X1/2 receptor chimeras were used to identify the molecular basis of actin sensitivity. These studies showed that the intracellular amino terminus accounts for the inhibitory effects of cytoskeletal disruption similar to that shown for lipid raft/cholesterol sensitivity. Stabilization of the cytoskeleton with jasplakinolide abolished the inhibitory effects of cholesterol depletion on P2X1 receptor currents, suggesting that lipid rafts may regulate the receptor through stabilization of the cytoskeleton. These studies show that the cytoskeleton plays an important role in P2X1 receptor regulation. PMID:21757694

  19. Gβ promotes pheromone receptor polarization and yeast chemotropism by inhibiting receptor phosphorylation.

    PubMed

    Ismael, Amber; Tian, Wei; Waszczak, Nicholas; Wang, Xin; Cao, Youfang; Suchkov, Dmitry; Bar, Eli; Metodiev, Metodi V; Liang, Jie; Arkowitz, Robert A; Stone, David E

    2016-04-12

    Gradient-directed cell migration (chemotaxis) and growth (chemotropism) are processes that are essential to the development and life cycles of all species. Cells use surface receptors to sense the shallow chemical gradients that elicit chemotaxis and chemotropism. Slight asymmetries in receptor activation are amplified by downstream signaling systems, which ultimately induce dynamic reorganization of the cytoskeleton. During the mating response of budding yeast, a model chemotropic system, the pheromone receptors on the plasma membrane polarize to the side of the cell closest to the stimulus. Although receptor polarization occurs before and independently of actin cable-dependent delivery of vesicles to the plasma membrane (directed secretion), it requires receptor internalization. Phosphorylation of pheromone receptors by yeast casein kinase 1 or 2 (Yck1/2) stimulates their internalization. We showed that the pheromone-responsive Gβγ dimer promotes the polarization of the pheromone receptor by interacting with Yck1/2 and locally inhibiting receptor phosphorylation. We also found that receptor phosphorylation is essential for chemotropism, independently of its role in inducing receptor internalization. A mathematical model supports the idea that the interaction between Gβγ and Yck1/2 results in differential phosphorylation and internalization of the pheromone receptor and accounts for its polarization before the initiation of directed secretion. Copyright © 2016, American Association for the Advancement of Science.

  20. Atomic force microscopy recognition of protein A on Staphylococcus aureus cell surfaces by labelling with IgG–Au conjugates

    PubMed Central

    Tatlybaeva, Elena B; Vasilchenko, Alexey S; Deryabin, Dmitri G

    2013-01-01

    Summary The labelling of functional molecules on the surface of bacterial cells is one way to recognize the bacteria. In this work, we have developed a method for the selective labelling of protein A on the cell surfaces of Staphylococcus aureus by using nanosized immunogold conjugates as cell-surface markers for atomic force microscopy (AFM). The use of 30-nm size Au nanoparticles conjugated with immunoglobulin G (IgG) allowed the visualization, localization and distribution of protein A–IgG complexes on the surface of S. aureus. The selectivity of the labelling method was confirmed in mixtures of S. aureus with Bacillus licheniformis cells, which differed by size and shape and had no IgG receptors on the surface. A preferential binding of the IgG–Au conjugates to S. aureus was obtained. Thus, this novel approach allows the identification of protein A and other IgG receptor-bearing bacteria, which is useful for AFM indication of pathogenic microorganisms in poly-component associations. PMID:24367742

  1. Fractal binding and dissociation kinetics of lecithin cholesterol acyl transferase (LCAT), a heart-related compound, on biosensor surfaces

    NASA Astrophysics Data System (ADS)

    Doke, Atul M.; Sadana, Ajit

    2006-05-01

    A fractal analysis is presented for the binding and dissociation of different heart-related compounds in solution to receptors immobilized on biosensor surfaces. The data analyzed include LCAT (lecithin cholesterol acyl transferase) concentrations in solution to egg-white apoA-I rHDL immobilized on a biosensor chip surface.1 Single- and dual- fractal models were employed to fit the data. Values of the binding and the dissociation rate coefficient(s), affinity values, and the fractal dimensions were obtained from the regression analysis provided by Corel Quattro Pro 8.0 (Corel Corporation Limited).2 The binding rate coefficients are quite sensitive to the degree of heterogeneity on the sensor chip surface. Predictive equations are developed for the binding rate coefficient as a function of the degree of heterogeneity present on the sensor chip surface and on the LCAT concentration in solution, and for the affinity as a function of the ratio of fractal dimensions present in the binding and the dissociation phases. The analysis presented provided physical insights into these analyte-receptor reactions occurring on different biosensor surfaces.

  2. Absolute binding free energies between T4 lysozyme and 141 small molecules: calculations based on multiple rigid receptor configurations

    PubMed Central

    Xie, Bing; Nguyen, Trung Hai; Minh, David D. L.

    2017-01-01

    We demonstrate the feasibility of estimating protein-ligand binding free energies using multiple rigid receptor configurations. Based on T4 lysozyme snapshots extracted from six alchemical binding free energy calculations with a flexible receptor, binding free energies were estimated for a total of 141 ligands. For 24 ligands, the calculations reproduced flexible-receptor estimates with a correlation coefficient of 0.90 and a root mean square error of 1.59 kcal/mol. The accuracy of calculations based on Poisson-Boltzmann/Surface Area implicit solvent was comparable to previously reported free energy calculations. PMID:28430432

  3. Opioid receptor trafficking and interaction in nociceptors

    PubMed Central

    Zhang, X; Bao, L; Li, S

    2015-01-01

    Opiate analgesics such as morphine are often used for pain therapy. However, antinociceptive tolerance and dependence may develop with long-term use of these drugs. It was found that μ-opioid receptors can interact with δ-opioid receptors, and morphine antinociceptive tolerance can be reduced by blocking δ-opioid receptors. Recent studies have shown that μ- and δ-opioid receptors are co-expressed in a considerable number of small neurons in the dorsal root ganglion. The interaction of μ-opioid receptors with δ-opioid receptors in the nociceptive afferents is facilitated by the stimulus-induced cell-surface expression of δ-opioid receptors, and contributes to morphine tolerance. Further analysis of the molecular, cellular and neural circuit mechanisms that regulate the trafficking and interaction of opioid receptors and related signalling molecules in the pain pathway would help to elucidate the mechanism of opiate analgesia and improve pain therapy. LINKED ARTICLES This article is part of a themed section on Opioids: New Pathways to Functional Selectivity. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2015.172.issue-2 PMID:24611685

  4. A human-infecting H10N8 influenza virus retains a strong preference for avian-type receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Heng; de Vries, Robert  P.; Tzarum, Netanel

    Recent avian-origin H10N8 influenza A viruses that have infected humans pose a potential pandemic threat. Alterations in the viral surface glycoprotein, hemagglutinin (HA), typically are required for influenza A viruses to cross the species barrier for adaptation to a new host, but whether H10N8 contains adaptations supporting human infection remains incompletely understood. In this paper, we investigated whether H10N8 HA can bind human receptors. Sialoside glycan microarray analysis showed that the H10 HA retains a strong preference for avian receptor analogs and negligible binding to human receptor analogs. Crystal structures of H10 HA with avian and human receptor analogs revealedmore » the basis for preferential recognition of avian-like receptors. Furthermore, introduction of mutations into the H10 receptor-binding site (RBS) known to convert other HA subtypes from avian to human receptor specificity failed to switch preference to human receptors. In conclusion, collectively these findings suggest that the current H10N8 human isolates are poorly adapted for efficient human-to-human transmission.« less

  5. Increased accuracy of ligand sensing by receptor diffusion on cell surface

    NASA Astrophysics Data System (ADS)

    Aquino, Gerardo; Endres, Robert G.

    2010-10-01

    The physical limit with which a cell senses external ligand concentration corresponds to the perfect absorber, where all ligand particles are absorbed and overcounting of same ligand particles does not occur. Here, we analyze how the lateral diffusion of receptors on the cell membrane affects the accuracy of sensing ligand concentration. Specifically, we connect our modeling to neurotransmission in neural synapses where the diffusion of glutamate receptors is already known to refresh synaptic connections. We find that receptor diffusion indeed increases the accuracy of sensing for both the glutamate α -Amino-3-hydroxy-5-Methyl-4-isoxazolePropionic Acid (AMPA) and N -Methyl-D-aspartic Acid (NMDA) receptor, although the NMDA receptor is overall much noisier. We propose that the difference in accuracy of sensing of the two receptors can be linked to their different roles in neurotransmission. Specifically, the high accuracy in sensing glutamate is essential for the AMPA receptor to start membrane depolarization, while the NMDA receptor is believed to work in a second stage as a coincidence detector, involved in long-term potentiation and memory.

  6. A human-infecting H10N8 influenza virus retains a strong preference for avian-type receptors

    DOE PAGES

    Zhang, Heng; de Vries, Robert  P.; Tzarum, Netanel; ...

    2015-03-11

    Recent avian-origin H10N8 influenza A viruses that have infected humans pose a potential pandemic threat. Alterations in the viral surface glycoprotein, hemagglutinin (HA), typically are required for influenza A viruses to cross the species barrier for adaptation to a new host, but whether H10N8 contains adaptations supporting human infection remains incompletely understood. In this paper, we investigated whether H10N8 HA can bind human receptors. Sialoside glycan microarray analysis showed that the H10 HA retains a strong preference for avian receptor analogs and negligible binding to human receptor analogs. Crystal structures of H10 HA with avian and human receptor analogs revealedmore » the basis for preferential recognition of avian-like receptors. Furthermore, introduction of mutations into the H10 receptor-binding site (RBS) known to convert other HA subtypes from avian to human receptor specificity failed to switch preference to human receptors. In conclusion, collectively these findings suggest that the current H10N8 human isolates are poorly adapted for efficient human-to-human transmission.« less

  7. Receptor clustering affects signal transduction at the membrane level in the reaction-limited regime

    NASA Astrophysics Data System (ADS)

    Caré, Bertrand R.; Soula, Hédi A.

    2013-01-01

    Many types of membrane receptors are found to be organized as clusters on the cell surface. We investigate the potential effect of such receptor clustering on the intracellular signal transduction stage. We consider a canonical pathway with a membrane receptor (R) activating a membrane-bound intracellular relay protein (G). We use Monte Carlo simulations to recreate biochemical reactions using different receptor spatial distributions and explore the dynamics of the signal transduction. Results show that activation of G by R is severely impaired by R clustering, leading to an apparent blunted biological effect compared to control. Paradoxically, this clustering decreases the half maximal effective dose (ED50) of the transduction stage, increasing the apparent affinity. We study an example of inter-receptor interaction in order to account for possible compensatory effects of clustering and observe the parameter range in which such interactions slightly counterbalance the loss of activation of G. The membrane receptors’ spatial distribution affects the internal stages of signal amplification, suggesting a functional role for membrane domains and receptor clustering independently of proximity-induced receptor-receptor interactions.

  8. Cell surface distribution and intracellular fate of asialoglycoproteins: a morphological and biochemical study of isolated rat hepatocytes and monolayer cultures

    PubMed Central

    Zeitlin, PL; Hubbard, AL

    1982-01-01

    A combination of biochemistry and morphology was used to demonstrate that more than 95 percent of the isolated rat hepatocytes prepared by collagenase dissociation of rat livers retained the pathway for receptor-mediated endocytosis of asialoglycoproteins (ASGPs). Maximal specific binding of (125)I-asialoorosomucoid ((125)I-ASOR) to dissociated hepatocytes at 5 degrees C (at which temperature no internalization occurred) averaged 100,000-400,000 molecules per cell. Binding, uptake, and degredation of (125)I- ASOR at 37 degrees C occurred at a rate of 1 x 10(6) molecules per cell over 2 h. Light and electron microscopic autoradiography (LM- and EM-ARG) of (125)I-ASOR were used to visualize the surface binding sites at 5 degrees C and the intracellular pathway at 37 degrees C. In the EM-ARG experiments, ARG grains corresponding to (125)I-ASOR were distributed randomly over the cell surface at 5 degrees C but over time at 37 degrees C were concentrated in the lysosome region. Cytochemical detection of an ASOR-horseradish peroxidase conjugate (ASOR-HRP) at the ultrastructural level revealed that at 5 degrees C this specific ASGP tracer was concentrated in pits at the cell surface as well as diffusely distributed along the rest of the plasma membrane. Such a result indicates that redistribution of ASGP surface receptors had occurred. Because the number of surface binding sites of (125)I-ASOR varied among cell preparations, the effect of collagenase on (125)I-ASOR binding was examined. When collagenase-dissociated hepatocytes were re-exposed to collagenase at 37 degrees C, 10-50 percent of control binding was observed. However, by measuring the extent of (125)I-ASOR binding at 5 degrees C in the same cell population before and after collagenase dissociation, little reduction in the number of ASGP surface receptors was found. Therefore, the possibility that the time and temperature of the cell isolations allowed recovery of cell surface receptors following collagenase exposure was tested. Freshly isolated cells, dissociated cells that were re-exposed to collagenase, and perfused livers exposed to collagenase without a Ca(++)-free pre-perfusion, were found to bind 110-240 percent more(125)I-ASOR after 1 h at 37 degrees C that they did at 0 time. This recovery of surface ASGP binding activity occurred in the absence of significant protein synthesis (i.e., basal medium or 1 mM cycloheximide). Suspensions of isolated, unpolarized hepatocytes were placed in monolayer culture for 24 h and confluent cells were demonstrated to reestablish morphologically distinct plasma membrane regions analogous to bile canalicular, lateral, and sinusoidal surfaces in vivo. More than 95 percent of these cells maintained the capacity to bind, internalize, and degrade (125)I-ASOR at levels comparable to those of the freshly isolated population. ASOR-HRP (at 5 degrees C) was specifically bound to all plasma membrane surfaces of repolarized hepatocytes (cultured for 24 h) except those lining bile canalicular-like spaces. Thus, both isolated, unpolarized hepatocytes and cells cultured under conditions that promote morphological reestablishment of polarity maintain the pathway for receptor- mediated endocytosis of ASGPs. PMID:6282890

  9. Detection of p75NTR Trimers: Implications for Receptor Stoichiometry and Activation

    PubMed Central

    Barker, Phillip A.; Chao, Moses V.

    2015-01-01

    The p75 neurotrophin receptor (p75NTR) is a multifunctional receptor that participates in many critical processes in the nervous system, ranging from apoptosis to synaptic plasticity and morphological events. It is a member of the tumor necrosis factor receptor (TNFR) superfamily, whose members undergo trimeric oligomerization. Interestingly, p75NTR interacts with dimeric ligands (i.e., proneurotrophins or mature neurotrophins), but several of the intracellular adaptors that mediate p75NTR signaling are trimeric (i.e., TNFR-associated factor 6 or TRAF6). Consequently, the active receptor signaling unit remains uncertain. To identify the functional receptor complex, we evaluated its oligomerization in vitro and in mice brain tissues using a combination of biochemical techniques. We found that the most abundant homotypic arrangement for p75NTR is a trimer and that monomers and trimers coexist at the cell surface. Interestingly, trimers are not required for ligand-independent or ligand-dependent p75NTR activation in a growth cone retraction functional assay. However, monomers are capable of inducing acute morphological effects in neurons. We propose that p75NTR activation is regulated by its oligomerization status and its levels of expression. These results indicate that the oligomeric state of p75NTR confers differential responses and offers an explanation for the diverse and contradictory actions of this receptor in the nervous system. SIGNIFICANCE STATEMENT The p75 neurotrophin receptor (p75NTR) regulates a wide range of cellular functions, including apoptosis, neuronal processes remodeling, and synaptic plasticity. The goal of our work was to inquire whether oligomers of the receptor are required for function. Here we report that p75NTR predominantly assembles as a trimer, similar to other tumor necrosis factor receptors. Interestingly, monomers and trimers coexist at the cell surface, but trimers are not required for p75NTR activation in a functional assay. However, monomers are capable of inducing acute morphological effects in neurons. Identification of the oligomerization state of p75NTR begins to provide insights to the mechanisms of signal initiation of this noncatalytic receptor, as well as to develop therapeutic interventions to diminish its activity. PMID:26311773

  10. Detection of p75NTR Trimers: Implications for Receptor Stoichiometry and Activation.

    PubMed

    Anastasia, Agustin; Barker, Phillip A; Chao, Moses V; Hempstead, Barbara L

    2015-08-26

    The p75 neurotrophin receptor (p75(NTR)) is a multifunctional receptor that participates in many critical processes in the nervous system, ranging from apoptosis to synaptic plasticity and morphological events. It is a member of the tumor necrosis factor receptor (TNFR) superfamily, whose members undergo trimeric oligomerization. Interestingly, p75(NTR) interacts with dimeric ligands (i.e., proneurotrophins or mature neurotrophins), but several of the intracellular adaptors that mediate p75(NTR) signaling are trimeric (i.e., TNFR-associated factor 6 or TRAF6). Consequently, the active receptor signaling unit remains uncertain. To identify the functional receptor complex, we evaluated its oligomerization in vitro and in mice brain tissues using a combination of biochemical techniques. We found that the most abundant homotypic arrangement for p75(NTR) is a trimer and that monomers and trimers coexist at the cell surface. Interestingly, trimers are not required for ligand-independent or ligand-dependent p75(NTR) activation in a growth cone retraction functional assay. However, monomers are capable of inducing acute morphological effects in neurons. We propose that p75(NTR) activation is regulated by its oligomerization status and its levels of expression. These results indicate that the oligomeric state of p75(NTR) confers differential responses and offers an explanation for the diverse and contradictory actions of this receptor in the nervous system. The p75 neurotrophin receptor (p75(NTR)) regulates a wide range of cellular functions, including apoptosis, neuronal processes remodeling, and synaptic plasticity. The goal of our work was to inquire whether oligomers of the receptor are required for function. Here we report that p75(NTR) predominantly assembles as a trimer, similar to other tumor necrosis factor receptors. Interestingly, monomers and trimers coexist at the cell surface, but trimers are not required for p75(NTR) activation in a functional assay. However, monomers are capable of inducing acute morphological effects in neurons. Identification of the oligomerization state of p75(NTR) begins to provide insights to the mechanisms of signal initiation of this noncatalytic receptor, as well as to develop therapeutic interventions to diminish its activity. Copyright © 2015 the authors 0270-6474/15/3511911-10$15.00/0.

  11. Fluorescence-Raman Dual Modal Endoscopic System for Multiplexed Molecular Diagnostics

    NASA Astrophysics Data System (ADS)

    Jeong, Sinyoung; Kim, Yong-Il; Kang, Homan; Kim, Gunsung; Cha, Myeong Geun; Chang, Hyejin; Jung, Kyung Oh; Kim, Young-Hwa; Jun, Bong-Hyun; Hwang, Do Won; Lee, Yun-Sang; Youn, Hyewon; Lee, Yoon-Sik; Kang, Keon Wook; Lee, Dong Soo; Jeong, Dae Hong

    2015-03-01

    Optical endoscopic imaging, which was recently equipped with bioluminescence, fluorescence, and Raman scattering, allows minimally invasive real-time detection of pathologies on the surface of hollow organs. To characterize pathologic lesions in a multiplexed way, we developed a dual modal fluorescence-Raman endomicroscopic system (FRES), which used fluorescence and surface-enhanced Raman scattering nanoprobes (F-SERS dots). Real-time, in vivo, and multiple target detection of a specific cancer was successful, based on the fast imaging capability of fluorescence signals and the multiplex capability of simultaneously detected SERS signals using an optical fiber bundle for intraoperative endoscopic system. Human epidermal growth factor receptor 2 (HER2) and epidermal growth factor receptor (EGFR) on the breast cancer xenografts in a mouse orthotopic model were successfully detected in a multiplexed way, illustrating the potential of FRES as a molecular diagnostic instrument that enables real-time tumor characterization of receptors during routine endoscopic procedures.

  12. Surface receptors on neutrophils and monocytes from immunodeficient and normal horses.

    PubMed Central

    Banks, K L; McGuire, T C

    1975-01-01

    Surface receptors on peripheral blood neutrophils and monocytes from normal and immunodeficient horses have been studied. Sheep erythrocytes (SRBC) coated with IgG, IgM, and complement but not IgG(T), readily bound to normal equine monocytes and neutrophils. More than 4000 molecules of IgG were required to sensitize each SRBC for adherence to monocytes, and more than 12,000 molecules were required for adherence to neutrophils. Young horses with a severe combined immunodeficiency had an almost total absence of lymphocytes, but normal numbers of monocytes and neutrophils. The number of receptors for immunoglobulin, complement, and phytolectin on monocytes and neutrophils from immunodeficient animals were similar to those on the cells of normal horses. Although the precursor cells of lymphocytes of horses with combined immunodeficiency appear to be defective, no defect in the other cellular products of the bone marrow were apparent. PMID:1126740

  13. Desialylation accelerates platelet clearance after refrigeration and initiates GPIbα metalloproteinase-mediated cleavage in mice.

    PubMed

    Jansen, A J Gerard; Josefsson, Emma C; Rumjantseva, Viktoria; Liu, Qiyong Peter; Falet, Hervé; Bergmeier, Wolfgang; Cifuni, Stephen M; Sackstein, Robert; von Andrian, Ulrich H; Wagner, Denisa D; Hartwig, John H; Hoffmeister, Karin M

    2012-02-02

    When refrigerated platelets are rewarmed, they secrete active sialidases, including the lysosomal sialidase Neu1, and express surface Neu3 that remove sialic acid from platelet von Willebrand factor receptor (VWFR), specifically the GPIbα subunit. The recovery and circulation of refrigerated platelets is greatly improved by storage in the presence of inhibitors of sialidases. Desialylated VWFR is also a target for metalloproteinases (MPs), because GPIbα and GPV are cleaved from the surface of refrigerated platelets. Receptor shedding is inhibited by the MP inhibitor GM6001 and does not occur in Adam17(ΔZn/ΔZn) platelets expressing inactive ADAM17. Critically, desialylation in the absence of MP-mediated receptor shedding is sufficient to cause the rapid clearance of platelets from circulation. Desialylation of platelet VWFR therefore triggers platelet clearance and primes GPIbα and GPV for MP-dependent cleavage.

  14. Desialylation accelerates platelet clearance after refrigeration and initiates GPIbα metalloproteinase-mediated cleavage in mice

    PubMed Central

    Jansen, A. J. Gerard; Josefsson, Emma C.; Rumjantseva, Viktoria; Liu, Qiyong Peter; Falet, Hervé; Bergmeier, Wolfgang; Cifuni, Stephen M.; Sackstein, Robert; von Andrian, Ulrich H.; Wagner, Denisa D.; Hartwig, John H.

    2012-01-01

    When refrigerated platelets are rewarmed, they secrete active sialidases, including the lysosomal sialidase Neu1, and express surface Neu3 that remove sialic acid from platelet von Willebrand factor receptor (VWFR), specifically the GPIbα subunit. The recovery and circulation of refrigerated platelets is greatly improved by storage in the presence of inhibitors of sialidases. Desialylated VWFR is also a target for metalloproteinases (MPs), because GPIbα and GPV are cleaved from the surface of refrigerated platelets. Receptor shedding is inhibited by the MP inhibitor GM6001 and does not occur in Adam17ΔZn/ΔZn platelets expressing inactive ADAM17. Critically, desialylation in the absence of MP-mediated receptor shedding is sufficient to cause the rapid clearance of platelets from circulation. Desialylation of platelet VWFR therefore triggers platelet clearance and primes GPIbα and GPV for MP-dependent cleavage. PMID:22101895

  15. Plant Lectins and Lectin Receptor-Like Kinases: How Do They Sense the Outside?

    PubMed Central

    Bellande, Kevin; Bono, Jean-Jacques; Savelli, Bruno; Jamet, Elisabeth; Canut, Hervé

    2017-01-01

    Lectins are fundamental to plant life and have important roles in cell-to-cell communication; development and defence strategies. At the cell surface; lectins are present both as soluble proteins (LecPs) and as chimeric proteins: lectins are then the extracellular domains of receptor-like kinases (LecRLKs) and receptor-like proteins (LecRLPs). In this review; we first describe the domain architectures of proteins harbouring G-type; L-type; LysM and malectin carbohydrate-binding domains. We then focus on the functions of LecPs; LecRLKs and LecRLPs referring to the biological processes they are involved in and to the ligands they recognize. Together; LecPs; LecRLKs and LecRLPs constitute versatile recognition systems at the cell surface contributing to the detection of symbionts and pathogens; and/or involved in monitoring of the cell wall structure and cell growth. PMID:28561754

  16. Antibody neutralization of retargeted measles viruses

    PubMed Central

    Lech, Patrycja J.; Pappoe, Roland; Nakamura, Takafumi; Tobin, Gregory J.; Nara, Peter L.; Russell, Stephen J.

    2014-01-01

    The measles virus (MV) vaccine lineage is a promising oncolytic but prior exposure to the measles vaccine or wild-type MV strains limits treatment utility due to the presence of anti-measles antibodies. MV entry can be redirected by displaying a polypeptide ligand on the Hemagglutinin (H) C-terminus. We hypothesized that retargeted MV would escape neutralization by monoclonal antibodies (mAbs) recognizing the H receptor-binding surface and be less susceptible to neutralization by human antisera. Using chimeric H proteins, with and without mutations that ablate MV receptor binding, we show that retargeted MVs escape mAbs that target the H receptor-binding surface by virtue of mutations that ablate infection via SLAM and CD46. However, C-terminally displayed domains do not mediate virus entry in the presence of human antibodies that bind to the underlying H domain. In conclusion, utility of retargeted oncolytic measles viruses does not extend to evasion of human serum neutralization. PMID:24725950

  17. Plant Lectins and Lectin Receptor-Like Kinases: How Do They Sense the Outside?

    PubMed

    Bellande, Kevin; Bono, Jean-Jacques; Savelli, Bruno; Jamet, Elisabeth; Canut, Hervé

    2017-05-31

    Lectins are fundamental to plant life and have important roles in cell-to-cell communication; development and defence strategies. At the cell surface; lectins are present both as soluble proteins (LecPs) and as chimeric proteins: lectins are then the extracellular domains of receptor-like kinases (LecRLKs) and receptor-like proteins (LecRLPs). In this review; we first describe the domain architectures of proteins harbouring G-type; L-type; LysM and malectin carbohydrate-binding domains. We then focus on the functions of LecPs; LecRLKs and LecRLPs referring to the biological processes they are involved in and to the ligands they recognize. Together; LecPs; LecRLKs and LecRLPs constitute versatile recognition systems at the cell surface contributing to the detection of symbionts and pathogens; and/or involved in monitoring of the cell wall structure and cell growth.

  18. Targeting prostate cancer cells with hybrid elastin-like polypeptide/liposome nanoparticles

    PubMed Central

    Zhang, Wei; Song, Yunmei; Eldi, Preethi; Guo, Xiuli; Hayball, John D; Garg, Sanjay; Albrecht, Hugo

    2018-01-01

    Prostate cancer cells frequently overexpress the gastrin-releasing peptide receptor, and various strategies have been applied in preclinical settings to target this receptor for the specific delivery of anticancer compounds. Recently, elastin-like polypeptide (ELP)-based self-assembling micelles with tethered GRP on the surface have been suggested to actively target prostate cancer cells. Poorly soluble chemotherapeutics such as docetaxel (DTX) can be loaded into the hydrophobic cores of ELP micelles, but only limited drug retention times have been achieved. Herein, we report the generation of hybrid ELP/liposome nanoparticles which self-assembled rapidly in response to temperature change, encapsulated DTX at high concentrations with slow release, displayed the GRP ligand on the surface, and specifically bound to GRP receptor expressing PC-3 cells as demonstrated by flow cytometry. This novel type of drug nanocarrier was successfully used to reduce cell viability of prostate cancer cells in vitro through the specific delivery of DTX. PMID:29391790

  19. The human immunodeficiency virus type 1 (HIV-1) CD4 receptor and its central role in promotion of HIV-1 infection.

    PubMed Central

    Bour, S; Geleziunas, R; Wainberg, M A

    1995-01-01

    Interactions between the viral envelope glycoprotein gp120 and the cell surface receptor CD4 are responsible for the entry of human immunodeficiency virus type 1 (HIV-1) into host cells in the vast majority of cases. HIV-1 replication is commonly followed by the disappearance or receptor downmodulation of cell surface CD4. This potentially renders cells nonsusceptible to subsequent infection by HIV-1, as well as by other viruses that use CD4 as a portal of entry. Disappearance of CD4 from the cell surface is mediated by several different viral proteins that act at various stages through the course of the viral life cycle, and it occurs in T-cell lines, peripheral blood CD4+ lymphocytes, and monocytes of both primary and cell line origin. At the cell surface, gp120 itself and in the form of antigen-antibody complexes can trigger cellular pathways leading to CD4 internalization. Intracellularly, the mechanisms leading to CD4 downmodulation by HIV-1 are multiple and complex; these include degradation of CD4 by Vpu, formation of intracellular complexes between CD4 and the envelope precursor gp160, and internalization by the Nef protein. Each of the above doubtless contributes to the ultimate depletion of cell surface CD4, although the relative contribution of each mechanism and the manner in which they interact remain to be definitively established. PMID:7708013

  20. Receptor for advanced glycation end products (RAGE) functions as receptor for specific sulfated glycosaminoglycans, and anti-RAGE antibody or sulfated glycosaminoglycans delivered in vivo inhibit pulmonary metastasis of tumor cells.

    PubMed

    Mizumoto, Shuji; Takahashi, Jun; Sugahara, Kazuyuki

    2012-06-01

    Altered expression of chondroitin sulfate (CS) and heparan sulfate (HS) at the surfaces of tumor cells plays a key role in malignant transformation and tumor metastasis. Previously we demonstrated that a Lewis lung carcinoma (LLC)-derived tumor cell line with high metastatic potential had a higher proportion of E-disaccharide units, GlcUA-GalNAc(4,6-O-disulfate), in CS chains than low metastatic LLC cells and that such CS chains are involved in the metastatic process. The metastasis was markedly inhibited by the pre-administration of CS-E from squid cartilage rich in E units or by preincubation with a phage display antibody specific for CS-E. However, the molecular mechanism of the inhibition remains to be investigated. In this study the receptor molecule for CS chains containing E-disaccharides expressed on LLC cells was revealed to be receptor for advanced glycation end products (RAGE), which is a member of the immunoglobulin superfamily predominantly expressed in the lung. Interestingly, RAGE bound strongly to not only E-disaccharide, but also HS-expressing LLC cells. Furthermore, the colonization of the lungs by LLC cells was effectively inhibited by the blocking of CS or HS chains at the tumor cell surface with an anti-RAGE antibody through intravenous injections in a dose-dependent manner. These results provide the clear evidence that RAGE is at least one of the critical receptors for CS and HS chains expressed at the tumor cell surface and involved in experimental lung metastasis and that CS/HS and RAGE are potential molecular targets in the treatment of pulmonary metastasis.

  1. Parkin Deficiency Reduces Hippocampal Glutamatergic Neurotransmission by Impairing AMPA Receptor Endocytosis.

    PubMed

    Cortese, Giuseppe P; Zhu, Mei; Williams, Damian; Heath, Sarah; Waites, Clarissa L

    2016-11-30

    Mutations in the gene encoding Parkin, an E3 ubiquitin ligase, lead to juvenile-onset Parkinson's disease by inducing the selective death of midbrain dopaminergic neurons. Accumulating evidence indicates that Parkin also has an important role in excitatory glutamatergic neurotransmission, although its precise mechanism of action remains unclear. Here, we investigate Parkin's role at glutamatergic synapses of rat hippocampal neurons. We find that Parkin-deficient neurons exhibit significantly reduced AMPA receptor (AMPAR)-mediated currents and cell-surface expression, and that these phenotypes result from decreased postsynaptic expression of the adaptor protein Homer1, which is necessary for coupling AMPAR endocytic zones with the postsynaptic density. Accordingly, Parkin loss of function leads to the reduced density of postsynaptic endocytic zones and to impaired AMPAR internalization. These findings demonstrate a novel and essential role for Parkin in glutamatergic neurotransmission, as a stabilizer of postsynaptic Homer1 and the Homer1-linked endocytic machinery necessary for maintaining normal cell-surface AMPAR levels. Mutations in Parkin, a ubiquitinating enzyme, lead to the selective loss of midbrain dopaminergic neurons and juvenile-onset Parkinson's disease (PD). Parkin loss of function has also been shown to alter hippocampal glutamatergic neurotransmission, providing a potential explanation for PD-associated cognitive impairment. However, very little is known about Parkin's specific sites or mechanisms of action at glutamatergic synapses. Here, we show that Parkin deficiency leads to decreased AMPA receptor-mediated activity due to disruption of the postsynaptic endocytic zones required for maintaining proper cell-surface AMPA receptor levels. These findings demonstrate a novel role for Parkin in synaptic AMPA receptor internalization and suggest a Parkin-dependent mechanism for hippocampal dysfunction that may explain cognitive deficits associated with some forms of PD. Copyright © 2016 the authors 0270-6474/16/3612243-16$15.00/0.

  2. Crystal structure of LGR4-Rspo1 complex: insights into the divergent mechanisms of ligand recognition by leucine-rich repeat G-protein-coupled receptors (LGRs).

    PubMed

    Xu, Jin-Gen; Huang, Chunfeng; Yang, Zhengfeng; Jin, Mengmeng; Fu, Panhan; Zhang, Ni; Luo, Jian; Li, Dali; Liu, Mingyao; Zhou, Yan; Zhu, Yongqun

    2015-01-23

    Leucine-rich repeat G-protein-coupled receptors (LGRs) are a unique class of G-protein-coupled receptors characterized by a large extracellular domain to recognize ligands and regulate many important developmental processes. Among the three groups of LGRs, group B members (LGR4-6) recognize R-spondin family proteins (Rspo1-4) to stimulate Wnt signaling. In this study, we successfully utilized the "hybrid leucine-rich repeat technique," which fused LGR4 with the hagfish VLR protein, to obtain two recombinant human LGR4 proteins, LGR415 and LGR49. We determined the crystal structures of ligand-free LGR415 and the LGR49-Rspo1 complex. LGR4 exhibits a twisted horseshoe-like structure. Rspo1 adopts a flat and β-fold architecture and is bound in the concave surface of LGR4 in the complex through electrostatic and hydrophobic interactions. All the Rspo1-binding residues are conserved in LGR4-6, suggesting that LGR4-6 bind R-spondins through an identical surface. Structural analysis of our LGR4-Rspo1 complex with the previously determined LGR4 and LGR5 structures revealed that the concave surface of LGR4 is the sole binding site for R-spondins, suggesting a one-site binding model of LGR4-6 in ligand recognition. The molecular mechanism of LGR4-6 is distinct from the two-step mechanism of group A receptors LGR1-3 and the multiple-interface binding model of group C receptors LGR7-8, suggesting LGRs utilize the divergent mechanisms for ligand recognition. Our structures, together with previous reports, provide a comprehensive understanding of the ligand recognition by LGRs. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Dexmedetomidine Prevents Excessive γ-Aminobutyric Acid Type A Receptor Function after Anesthesia.

    PubMed

    Wang, Dian-Shi; Kaneshwaran, Kirusanthy; Lei, Gang; Mostafa, Fariya; Wang, Junhui; Lecker, Irene; Avramescu, Sinziana; Xie, Yu-Feng; Chan, Nathan K; Fernandez-Escobar, Alejandro; Woo, Junsung; Chan, Darren; Ramsey, Amy J; Sivak, Jeremy M; Lee, C Justin; Bonin, Robert P; Orser, Beverley A

    2018-06-08

    Postoperative delirium is associated with poor long-term outcomes and increased mortality. General anesthetic drugs may contribute to delirium because they increase cell-surface expression and function of α5 subunit-containing γ-aminobutyric acid type A receptors, an effect that persists long after the drugs have been eliminated. Dexmedetomidine, an α2 adrenergic receptor agonist, prevents delirium in patients and reduces cognitive deficits in animals. Thus, it was postulated that dexmedetomidine prevents excessive function of α5 γ-aminobutyric acid type A receptors. Injectable (etomidate) and inhaled (sevoflurane) anesthetic drugs were studied using cultured murine hippocampal neurons, cultured murine and human cortical astrocytes, and ex vivo murine hippocampal slices. γ-Aminobutyric acid type A receptor function and cell-signaling pathways were studied using electrophysiologic and biochemical methods. Memory and problem-solving behaviors were also studied. The etomidate-induced sustained increase in α5 γ-aminobutyric acid type A receptor cell-surface expression was reduced by dexmedetomidine (mean ± SD, etomidate: 146.4 ± 51.6% vs. etomidate + dexmedetomidine: 118.4 ± 39.1% of control, n = 8 each). Dexmedetomidine also reduced the persistent increase in tonic inhibitory current in hippocampal neurons (etomidate: 1.44 ± 0.33 pA/pF, n = 10; etomidate + dexmedetomidine: 1.01 ± 0.45 pA/pF, n = 9). Similarly, dexmedetomidine prevented a sevoflurane-induced increase in the tonic current. Dexmedetomidine stimulated astrocytes to release brain-derived neurotrophic factor, which acted as a paracrine factor to reduce excessive α5 γ-aminobutyric acid type A receptor function in neurons. Finally, dexmedetomidine attenuated memory and problem-solving deficits after anesthesia. Dexmedetomidine prevented excessive α5 γ-aminobutyric acid type A receptor function after anesthesia. This novel α2 adrenergic receptor- and brain-derived neurotrophic factor-dependent pathway may be targeted to prevent delirium.

  4. Altered Agonist Sensitivity of a Mutant V2 Receptor Suggests a Novel Therapeutic Strategy for Nephrogenic Diabetes Insipidus

    PubMed Central

    Erdélyi, László Sándor; Balla, András; Patócs, Attila; Tóth, Miklós; Várnai, Péter

    2014-01-01

    Loss-of-function mutations of the type 2 vasopressin receptor (V2R) in kidney can lead to nephrogenic diabetes insipidus (NDI). We studied a previously described, but uncharacterized, mutation of the V2R (N321K missense mutation) of a patient with NDI. The properties of the mutant receptor were evaluated. We constructed a highly sensitive Epac-based bioluminescence resonance energy transfer biosensor to perform real-time cAMP measurements after agonist stimulation of transiently transfected HEK293 cells with V2Rs. β-Arrestin binding of the activated receptors was examined with luciferase-tagged β-arrestin and mVenus-tagged V2Rs using the bioluminescence resonance energy transfer technique. Cell surface expression levels of hemagglutinin-tagged receptors were determined with flow cytometry using anti-hemagglutinin-Alexa 488 antibodies. Cellular localization examinations were implemented with fluorescent tagged receptors visualized with confocal laser scanning microscopy. The effect of various vasopressin analogs on the type 1 vasopressin receptor (V1R) was tested on mouse arteries by wire myography. The N321K mutant V2R showed normal cell surface expression, but the potency of arginine vasopressin for cAMP generation was low, whereas the clinically used desmopressin was not efficient. The β-arrestin binding and internalization properties of the mutant receptor were also different than those for the wild type. The function of the mutant receptor can be rescued with administration of the V2R agonist Val4-desmopressin, which had no detectable side effects on V1R in the effective cAMP generating concentrations. Based on these findings we propose a therapeutic strategy for patients with NDI carrying the N321K mutation, as our in vivo experiments suggest that Val4-desmopressin could rescue the function of the N321K-V2R without significant side effects on the V1R. PMID:24628417

  5. Molecular Determinants of the Human α2C-Adrenergic Receptor Temperature-Sensitive Intracellular Traffic

    PubMed Central

    Pullikuth, Ashok K.; Guidry, Jessie J.

    2015-01-01

    The human α2C-adrenergic receptor (α2C-AR) is localized intracellularly at physiologic temperature. Decreasing the environmental temperature strongly stimulates the receptor transport to the cell surface. In contrast, rat and mouse α2C-AR plasma membrane levels are less sensitive to decrease in temperature, whereas the opossum α2C-AR cell surface levels are not changed in these conditions. Structural analysis demonstrated that human α2C-AR has a high number of arginine residues in the third intracellular loop and in the C-terminus, organized as putative RXR motifs. Although these motifs do not affect the receptor subcellular localization at 37°C, deletion of the arginine clusters significantly enhanced receptor plasma membrane levels at reduced temperature. We found that this exaggerated transport of the human receptor is mediated by two functional arginine clusters, one in the third intracellular loop and one in the C-terminus. This effect is mediated by interactions with COPI vesicles, but not by 14-3-3 proteins. In rat α2C-AR, the arginine cluster from the third intracellular loop is shifted to the left due to three missing residues. Reinsertion of these residues in the rat α2C-AR restored the same temperature sensitivity as in the human receptor. Proteomic and coimmunoprecipitation experiments identified pontin as a molecule having stronger interactions with human α2C-AR compared with rat α2C-AR. Inhibition of pontin activity enhanced human receptor plasma membrane levels and signaling at 37°C. Our results demonstrate that human α2C-AR has a unique temperature-sensitive traffic pattern within the G protein–coupled receptor class due to interactions with different molecular chaperones, mediated in part by strict spatial localization of specific arginine residues. PMID:25680754

  6. Altered agonist sensitivity of a mutant v2 receptor suggests a novel therapeutic strategy for nephrogenic diabetes insipidus.

    PubMed

    Erdélyi, László Sándor; Balla, András; Patócs, Attila; Tóth, Miklós; Várnai, Péter; Hunyady, László

    2014-05-01

    Loss-of-function mutations of the type 2 vasopressin receptor (V2R) in kidney can lead to nephrogenic diabetes insipidus (NDI). We studied a previously described, but uncharacterized, mutation of the V2R (N321K missense mutation) of a patient with NDI. The properties of the mutant receptor were evaluated. We constructed a highly sensitive Epac-based bioluminescence resonance energy transfer biosensor to perform real-time cAMP measurements after agonist stimulation of transiently transfected HEK293 cells with V2Rs. β-Arrestin binding of the activated receptors was examined with luciferase-tagged β-arrestin and mVenus-tagged V2Rs using the bioluminescence resonance energy transfer technique. Cell surface expression levels of hemagglutinin-tagged receptors were determined with flow cytometry using anti-hemagglutinin-Alexa 488 antibodies. Cellular localization examinations were implemented with fluorescent tagged receptors visualized with confocal laser scanning microscopy. The effect of various vasopressin analogs on the type 1 vasopressin receptor (V1R) was tested on mouse arteries by wire myography. The N321K mutant V2R showed normal cell surface expression, but the potency of arginine vasopressin for cAMP generation was low, whereas the clinically used desmopressin was not efficient. The β-arrestin binding and internalization properties of the mutant receptor were also different than those for the wild type. The function of the mutant receptor can be rescued with administration of the V2R agonist Val(4)-desmopressin, which had no detectable side effects on V1R in the effective cAMP generating concentrations. Based on these findings we propose a therapeutic strategy for patients with NDI carrying the N321K mutation, as our in vivo experiments suggest that Val(4)-desmopressin could rescue the function of the N321K-V2R without significant side effects on the V1R.

  7. Differential expression of ligands for NKG2D and DNAM-1 receptors by epithelial ovarian cancer-derived exosomes and its influence on NK cell cytotoxicity.

    PubMed

    Labani-Motlagh, Alireza; Israelsson, Pernilla; Ottander, Ulrika; Lundin, Eva; Nagaev, Ivan; Nagaeva, Olga; Dehlin, Eva; Baranov, Vladimir; Mincheva-Nilsson, Lucia

    2016-04-01

    Cancers constitutively produce and secrete into the blood and other biofluids 30-150 nm-sized endosomal vehicles called exosomes. Cancer-derived exosomes exhibit powerful influence on a variety of biological mechanisms to the benefit of the tumors that produce them. We studied the immunosuppressive ability of epithelial ovarian cancer (EOC) exosomes on two cytotoxic pathways of importance for anticancer immunity-the NKG2D receptor-ligand pathway and the DNAM-1-PVR/nectin-2 pathway. Using exosomes, isolated from EOC tumor explant and EOC cell-line culture supernatants, and ascitic fluid from EOC patients, we studied the expression of NKG2D and DNAM-1 ligands on EOC exosomes and their ability to downregulate the cognate receptors. Our results show that EOC exosomes differentially and constitutively express NKG2D ligands from both MICA/B and ULBP families on their surface, while DNAM-1 ligands are more seldom expressed and not associated with the exosomal membrane surface. Consequently, the NKG2D ligand-bearing EOC exosomes significantly downregulated the NKG2D receptor expression on peripheral blood mononuclear cells (PBMC) while the DNAM-1 receptor was unaffected. The downregulation of NKG2D receptor expression was coupled to inhibition of NKG2D receptor-ligand-mediated degranulation and cytotoxicity measured in vitro with OVCAR-3 and K562 cells as targets. The EOC exosomes acted as a decoy impairing the NKG2D mediated cytotoxicity while the DNAM-1 receptor-ligand system remained unchanged. Taken together, our results support and explain the mechanism behind the recently reported finding that in EOC, NK-cell recognition and killing of tumor cells was mainly dependent on DNAM-1 signaling while the contribution of the NKG2D receptor-ligand pathway was complementary and uncertain.

  8. Genetic, immunological, and clinical features of patients with bacterial and fungal infections due to inherited IL-17RA deficiency

    PubMed Central

    Lévy, Romain; Okada, Satoshi; Béziat, Vivien; Moriya, Kunihiko; Liu, Caini; Chai, Louis Yi Ann; Migaud, Mélanie; Hauck, Fabian; Al Ali, Amein; Cyrus, Cyril; Vatte, Chittibabu; Patiroglu, Turkan; Unal, Ekrem; Ferneiny, Marie; Hyakuna, Nobuyuki; Nepesov, Serdar; Oleastro, Matias; Ikinciogullari, Aydan; Dogu, Figen; Asano, Takaki; Ohara, Osamu; Yun, Ling; Della Mina, Erika; Bronnimann, Didier; Itan, Yuval; Gothe, Florian; Bustamante, Jacinta; Boisson-Dupuis, Stéphanie; Tahuil, Natalia; Aytekin, Caner; Salhi, Aicha; Al Muhsen, Saleh; Kobayashi, Masao; Toubiana, Julie; Abel, Laurent; Li, Xiaoxia; Camcioglu, Yildiz; Celmeli, Fatih; Klein, Christoph; AlKhater, Suzan A.; Casanova, Jean-Laurent; Puel, Anne

    2016-01-01

    Chronic mucocutaneous candidiasis (CMC) is defined as recurrent or persistent infection of the skin, nails, and/or mucosae with commensal Candida species. The first genetic etiology of isolated CMC—autosomal recessive (AR) IL-17 receptor A (IL-17RA) deficiency—was reported in 2011, in a single patient. We report here 21 patients with complete AR IL-17RA deficiency, including this first patient. Each patient is homozygous for 1 of 12 different IL-17RA alleles, 8 of which create a premature stop codon upstream from the transmembrane domain and have been predicted and/or shown to prevent expression of the receptor on the surface of circulating leukocytes and dermal fibroblasts. Three other mutant alleles create a premature stop codon downstream from the transmembrane domain, one of which encodes a surface-expressed receptor. Finally, the only known missense allele (p.D387N) also encodes a surface-expressed receptor. All of the alleles tested abolish cellular responses to IL-17A and -17F homodimers and heterodimers in fibroblasts and to IL-17E/IL-25 in leukocytes. The patients are currently aged from 2 to 35 y and originate from 12 unrelated kindreds. All had their first CMC episode by 6 mo of age. Fourteen patients presented various forms of staphylococcal skin disease. Eight were also prone to various bacterial infections of the respiratory tract. Human IL-17RA is, thus, essential for mucocutaneous immunity to Candida and Staphylococcus, but otherwise largely redundant. A diagnosis of AR IL-17RA deficiency should be considered in children or adults with CMC, cutaneous staphylococcal disease, or both, even if IL-17RA is detected on the cell surface. PMID:27930337

  9. UBXD4, a UBX-containing protein, regulates the cell surface number and stability of alpha3-containing nicotinic acetylcholine receptors.

    PubMed

    Rezvani, Khosrow; Teng, Yanfen; Pan, Yaping; Dani, John A; Lindstrom, Jon; García Gras, Eduardo A; McIntosh, J Michael; De Biasi, Mariella

    2009-05-27

    Adaptor proteins are likely to modulate spatially and temporally the trafficking of a number of membrane proteins, including neuronal nicotinic acetylcholine receptors (nAChRs). A yeast two-hybrid screen identified a novel UBX-containing protein, UBXD4, as one of the cytosolic proteins that interact directly with the alpha3 and alpha4 nAChR subunits. The function of UBX-containing proteins is largely unknown. Immunoprecipitation and confocal microscopy confirmed the interaction of UBXD4 with alpha3-containing nAChRs (alpha3* nAChRs) expressed in HEK293 cells, PC12 cells, and rat cortical neurons. Overexpression of UBXD4 in differentiated PC12 cells (dPC12) increased nAChR cell surface expression, especially that of the alpha3beta2 subtype. These findings were corroborated by electrophysiology, immunofluorescent staining, and biotinylation of surface receptors. Silencing of UBXD4 led to a significant reduction of alpha3* nAChRs in rat cortical neurons and dPC12 cells. Biochemical and immunofluorescence studies of endogenous UBXD4 showed that the protein is located in both the ER and cis-Golgi compartments. Our investigations also showed that the alpha3 subunit is ubiquitinated and that UBXD4 can interfere with its ubiquitination and consequent degradation by the proteasome. Our data suggest that UBXD4 modulates the distribution of alpha3* nAChRs between specialized intracellular compartments and the plasma membrane. This effect is achieved by controlling the stability of the alpha3 subunit and, consequently, the number of receptors at the cell surface.

  10. UBXD4, a UBX containing protein, regulates the cell surface number and the stability of α3-containing nicotinic acetylcholine receptors

    PubMed Central

    Rezvani, Khosrow; Teng, Yanfen; Pan, Yaping; Dani, John A.; Lindstrom, Jon.; Gras, Eduardo A. Garcáa; McIntosh, J. Michael; De Biasi, Mariella.

    2010-01-01

    Adaptor proteins are likely to modulate spatially and temporally the trafficking of a number of membrane proteins, including neuronal nicotinic acetylcholine receptors (nAChRs). A yeast two-hybrid screen identified a novel UBX-containing protein, UBXD4, as one of the cytosolic proteins that interact directly with the α3 and α4 nAChR subunits. The function of UBX-containing proteins is largely unknown. Immunoprecipitation and confocal microscopy confirmed the interaction of UBXD4 with α3-containing nAChRs (α3* nAChRs) expressed in HEK293 cells, PC12 cells and rat cortical neurons. Overexpression of UBXD4 in differentiated PC12 cells (dPC12) increased nAChR cell surface expression, especially that of the α3β2 subtype. These findings were corroborated by electrophysiology, immunofluorescent staining and biotinylation of surface receptors. Silencing of UBXD4 led to a significant reduction of α3* nAChRs in rat cortical neurons and dPC12 cells. Biochemical and immunofluorescence studies of endogenous UBXD4 showed that the protein is located in both the ER and cis-Golgi compartments. Our investigations also showed that the α3 subunit is ubiquitinated and that UBXD4 can interfere with its ubiquitination and consequent degradation by the proteasome. Our data suggest that UBXD4 modulates the distribution of α3* nAChRs between specialized intracellular compartments and the plasma membrane. This effect is achieved by controlling the stability of the α3 subunit and, consequently, the number of receptors at the cell surface. PMID:19474315

  11. Oxygen Modulates Human Decidual Natural Killer Cell Surface Receptor Expression and Interactions with Trophoblasts1

    PubMed Central

    Wallace, Alison E.; Goulwara, Sonu S.; Whitley, Guy S.; Cartwright, Judith E.

    2014-01-01

    Decidual natural killer (dNK) cells have been shown to both promote and inhibit trophoblast behavior important for decidual remodeling in pregnancy and have a distinct phenotype compared to peripheral blood NK cells. We investigated whether different levels of oxygen tension, mimicking the physiological conditions of the decidua in early pregnancy, altered cell surface receptor expression and activity of dNK cells and their interactions with trophoblast. dNK cells were isolated from terminated first-trimester pregnancies and cultured in oxygen tensions of 3%, 10%, and 21% for 24 h. Cell surface receptor expression was examined by flow cytometry, and the effects of secreted factors in conditioned medium (CM) on the trophoblast cell line SGHPL-4 were assessed in vitro. SGHPL-4 cells treated with dNK cell CM incubated in oxygen tensions of 10% were significantly more invasive (P < 0.05) and formed endothelial-like networks to a greater extent (P < 0.05) than SGHPL-4 cells treated with dNK cell CM incubated in oxygen tensions of 3% or 21%. After 24 h, a lower percentage of dNK cells expressed CD56 at 21% oxygen (P < 0.05), and an increased percentage of dNK cells expressed NKG2D at 10% oxygen (P < 0.05) compared to other oxygen tensions, with large patient variation. This study demonstrates dNK cell phenotype and secreted factors are modulated by oxygen tension, which induces changes in trophoblast invasion and endovascular-like differentiation. Alterations in dNK cell surface receptor expression and secreted factors at different oxygen tensions may represent regulation of function within the decidua during the first trimester of pregnancy. PMID:25232021

  12. Surface Display of the Receptor-Binding Region of the Lactobacillus brevis S-Layer Protein in Lactococcus lactis Provides Nonadhesive Lactococci with the Ability To Adhere to Intestinal Epithelial Cells

    PubMed Central

    Åvall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi

    2003-01-01

    Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium. PMID:12676705

  13. Surface display of the receptor-binding region of the Lactobacillus brevis S-layer protein in Lactococcus lactis provides nonadhesive lactococci with the ability to adhere to intestinal epithelial cells.

    PubMed

    Avall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi

    2003-04-01

    Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium.

  14. Expression of full-length HER2 protein in Sf9 insect cells and its presentation on the surface of budded virus-like particles.

    PubMed

    Nika, Lisa; Wallner, Jakob; Palmberger, Dieter; Koczka, Krisztina; Vorauer-Uhl, Karola; Grabherr, Reingard

    2017-08-01

    Biomarkers of cancer are often glycosylated membrane receptor proteins present on the cellular surface. In order to develop new antibodies for cancer diagnostics or treatment, it is a main pre-requisite that these target proteins are available in a native conformation. However, membrane receptor proteins are notoriously difficult to produce due to their hydrophobic nature and complex architecture. Here, we used the baculovirus-insect cell expression system to produce budded virus-like particles (VLPs) as the scaffold for the presentation of complex membrane proteins. Since the human epidermal growth factor receptor 2 (HER2) is known to be overexpressed in a number of cancers it was chosen as model for a tumor antigen. VLPs displaying full-length HER2 on the surface were produced in Spodoptera frugiperda 9 (Sf9) insect cells and purified by sucrose gradient ultracentrifugation. The number of secreted particles was quantified by nanoparticle tracking analysis. To confirm the presence of HER2 protein on the surface, VLPs were labeled with gold-conjugated antibodies and analyzed by transmission electron microscopy. Functionality of displayed HER2 was investigated by ELISA and a newly established biolayer interferometry based technique. Detection was accomplished using the specific monoclonal antibody Herceptin and filamentous phages displaying a single-chain variable fragment of an anti-HER2 antibody. Significant stronger binding of Herceptin and anti-HER2 phages to HER2-displaying VLPs as compared to control VLPs was demonstrated. Thus, we suggest that Sf9 insect cells are highly feasible for the fast and easy production of various budded VLPs that serve as a platform for full-length membrane receptor presentation. Copyright © 2017. Published by Elsevier Inc.

  15. The central action of the 5-HT2 receptor agonist 1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI) on cardiac inotropy and vascular resistance in the anaesthetized cat

    PubMed Central

    Ramage, Andrew G; de Burgh Daly, M

    1998-01-01

    Experiments were carried out to determine the effects of the application of the selective 5-HT2 receptor agonist DOI intravenously (in the presence of the peripherally acting 5-HT2 receptor antagonist, BW501C67, 1 mg kg−1, i.v.) or to the `glycine sensitive area' of the ventral surface (30 μg each side) on the left ventricular inotropic (left ventricular dP/dt max) and vascularly isolated hindlimb responses in anaesthetized cats. For the ventral surface experiments, NMDA (10 μg each side) was applied to act as a positive control. In all experiments heart rate and mean arterial blood pressure were held constant to exclude any secondary effects caused by changes in these variables.DOI (n=6) i.v or on the ventral surface had no effect on left ventricular dP/dt max but caused a significant increase in hindlimb perfusion pressure of 40±9 and 50±14 mmHg, respectively. Respiration was unaffected. NMDA (n=6), applied to the ventral surface, caused significant increases in both left ventricular dP/dt max and hindlimb perfusion pressure of 1950±349 mmHg s−1 and 69±17 mmHg respectively, with no associated change in left ventricular end-diastolic pressure. The amplitude of respiratory movements increased.It is concluded that activation of 5-HT2 receptors at the level of the rostral ventrolateral medulla (RVLM) excites sympathetic premotor neurons and/or their antecedents controlling hindlimb vascular resistance but not those controlling the inotropic effects on the left ventricle. PMID:9863644

  16. Current advances in biomarkers for targeted therapy in triple-negative breast cancer

    PubMed Central

    Fleisher, Brett; Clarke, Charlotte; Ait-Oudhia, Sihem

    2016-01-01

    Triple-negative breast cancer (TNBC) is a complex heterogeneous disease characterized by the absence of three hallmark receptors: human epidermal growth factor receptor 2, estrogen receptor, and progesterone receptor. Compared to other breast cancer subtypes, TNBC is more aggressive, has a higher prevalence in African-Americans, and more frequently affects younger patients. Currently, TNBC lacks clinically accepted targets for tailored therapy, warranting the need for candidate biomarkers. BiomarkerBase, an online platform used to find biomarkers reported in clinical trials, was utilized to screen all potential biomarkers for TNBC and select only the ones registered in completed TNBC trials through clinicaltrials.gov. The selected candidate biomarkers were classified as surrogate, prognostic, predictive, or pharmacodynamic (PD) and organized by location in the blood, on the cell surface, in the cytoplasm, or in the nucleus. Blood biomarkers include vascular endothelial growth factor/vascular endothelial growth factor receptor and interleukin-8 (IL-8); cell surface biomarkers include EGFR, insulin-like growth factor binding protein, c-Kit, c-Met, and PD-L1; cytoplasm biomarkers include PIK3CA, pAKT/S6/p4E-BP1, PTEN, ALDH1, and the PIK3CA/AKT/mTOR-related metabolites; and nucleus biomarkers include BRCA1, the gluco-corticoid receptor, TP53, and Ki67. Candidate biomarkers were further organized into a “cellular protein network” that demonstrates potential connectivity. This review provides an inventory and reference point for promising biomarkers for breakthrough targeted therapies in TNBC. PMID:27785100

  17. A comparison of caveolae and caveolin-1 to folate receptor α in retina and retinal pigment epithelium

    PubMed Central

    Bridges, Christy C.; El-Sherbeny, Amira; Roon, Penny; Ola, M. Shamsul; Kekuda, Ramesh; Ganapathy, Vadivel; Cameron, Richard S.; Cameron, Patricia L.

    2015-01-01

    Summary Caveolae are flask-shaped membrane invaginations present in most mammalian cells. They are distinguished by the presence of a striated coat composed of the protein, caveolin. Caveolae have been implicated in numerous cellular processes, including potocytosis in which caveolae are hypothesized to co-localize with folate receptor α and participate in folate uptake. Our laboratory has recently localized folate receptor α to the basolateral surface of the retinal pigment epithelium (RPE). It is present also in many other cells of the retina. In the present study, we asked whether caveolae were present in the RPE, and if so, whether their pattern of distribution was similar to folate receptor α. We also examined the distribution pattern of caveolin-1, which can be a marker of caveolae. Extensive electron microscopical analysis revealed caveolae associated with endothelial cells. However, none were detected in intact or cultured RPE. Laser scanning confocal microscopical analysis of intact RPE localized caveolin-1 to the apical and basal surfaces, a distribution unlike folate receptor α. Western analysis confirmed the presence of caveolin-1 in cultured RPE cells and laser scanning confocal microscopy localized the protein to the basal plasma membrane of the RPE, a distribution like that of folate receptor α. This distribution was confirmed by electron microscopic immunolocalization. The lack of caveolae in the RPE suggests that these structures may not be essential for folate internalization in the RPE. PMID:11508338

  18. Activation of Membrane Fusion by Murine Leukemia Viruses Is Controlled in cis or in trans by Interactions between the Receptor-Binding Domain and a Conserved Disulfide Loop of the Carboxy Terminus of the Surface Glycoprotein

    PubMed Central

    Lavillette, Dimitri; Boson, Bertrand; Russell, Stephen J.; Cosset, François-Loïc

    2001-01-01

    Cell entry of retroviruses is initiated by the recognition of cellular receptors and the subsequent membrane fusion between viral and cellular membranes. These two steps are mediated by the surface (SU) and transmembrane (TM) subunits of the retroviral envelope glycoprotein (Env), respectively. Determinants regulating membrane fusion have been described throughout SU and TM, but the processes coupling receptor recognition to fusion are still elusive. Here we establish that a critical interaction is formed between the receptor-binding domain (RBD) and the major disulfide loop of the carboxy-terminal domain (C domain) of the murine leukemia virus SU. Receptor binding causes an alteration of this interaction and, in turn, promotes further events of Env fusion activation. We characterize mutations which, by lowering this interaction and reducing the compatibility between the RBD and C domains of Env glycoprotein chimeras, affect both Env fusogenicity and sensitivity to receptor interference. Additionally, we demonstrate that suboptimal interactions in such mutant Env proteins can be compensated in trans by soluble RBDs in a manner that depends on their compatibility with the C domain. Our results therefore indicate that RBD/C domain interactions may occur in cis, via the proper RBD of the viral Env itself, or in trans, via a distinct RBD expressed by virion-free Env glycoproteins expressed endogenously by the infected cells or provided by neighboring Env trimers. PMID:11264358

  19. Self-identity reprogrammed by a single residue switch in a cell surface receptor of a social bacterium.

    PubMed

    Cao, Pengbo; Wall, Daniel

    2017-04-04

    The ability to recognize close kin confers survival benefits on single-celled microbes that live in complex and changing environments. Microbial kinship detection relies on perceptible cues that reflect relatedness between individuals, although the mechanisms underlying recognition in natural populations remain poorly understood. In myxobacteria, cells identify related individuals through a polymorphic cell surface receptor, TraA. Recognition of compatible receptors leads to outer membrane exchange among clonemates and fitness consequences. Here, we investigated how a single receptor creates a diversity in recognition across myxobacterial populations. We first show that TraA requires its partner protein TraB to function in cell-cell adhesion. Recognition is shown to be traA allele-specific, where polymorphisms within TraA dictate binding selectivity. We reveal the malleability of TraA recognition, and seemingly minor changes to its variable region reprogram recognition outcomes. Strikingly, we identify a single residue (A/P205) as a molecular switch for TraA recognition. Substitutions at this position change the specificity of a diverse panel of environmental TraA receptors. In addition, we engineered a receptor with unique specificity by simply creating an A205P substitution, suggesting that modest changes in TraA can lead to diversification of new recognition groups in nature. We hypothesize that the malleable property of TraA has allowed it to evolve and create social barriers between myxobacterial populations and in turn avoid adverse interactions with relatives.

  20. Binding of HBGA-expressing bacteria does not protect Tulane virus from acute heat stress

    USDA-ARS?s Scientific Manuscript database

    Human noroviruses (HuNoVs) are the major cause of gastroenteritis outbreaks worldwide. Human noroviruses can interact with histo-blood group antigens (HBGAs) on the surface of mammalian cells as well as bacterial cells. HBGAs have been considered as putative receptors or co-receptors for HuNoVs in m...

  1. Dialing Up an Embryo: Are Olfactory Receptors Digits in a Developmental Code?

    ERIC Educational Resources Information Center

    Travis, John

    1998-01-01

    Scientist William J. Dreyer has hypothesized that the cell surface proteins in the nose that detect odors also help assemble embryos. These olfactory receptors and related proteins act as identifiers, much like the last few digits of a telephone number, that help cells to find their intended neighbors in a developing embryo. Discusses the research…

  2. Biosynthesis and processing of the mannose receptor in human macrophages.

    PubMed

    Lennartz, M R; Cole, F S; Stahl, P D

    1989-02-05

    The biosynthesis and processing of the human mannose receptor has been studied in monocyte-derived macrophages. Adherent cells were labeled for 60 min with Trans35S (a mixture of 35S-labeled methionine and cysteine), chased, and subjected to immunoprecipitation by antibody raised against the human placental receptor. The antibody immunoprecipitated a single protein of molecular mass 162 kDa; precipitation of the labeled receptor could be inhibited by placental receptor. The results presented demonstrate that the receptor is synthesized as a 154-kDa precursor which is processed to 162 kDa in 90 min. The precursor is a glycoprotein bearing endoglycosidase H-sensitive oligosaccharides; the 162-kDa form is endoglycosidase H-resistant but peptide:N-glycanase-sensitive. Desialylation of the mannose receptor with neuraminidase generates a protein which is recognized by peanut agglutinin, a lectin that specifically binds desialylated O-linked oligosaccharides. Thus, the human macrophage mannose receptor bears both N- and O-linked oligosaccharide chains. Newly synthesized mannose receptor exhibits a half-life of 33 h as determined by pulse-chase studies. This indicates that on the average, each molecule of receptor recycles between the cell surface and endosomes hundreds of times before degradation.

  3. The Role of the Calcium-sensing Receptor in Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rodland, Karin D.

    2004-03-01

    The cell surface calcium receptor (Ca2+ receptor) is a particularly difficult receptor to study because its primary physiological ligand, Ca2+, affects numerous biological processes both within and outside of cells. Because of this, distinguishing effects of extracellular Ca2+ mediated by the Ca2+ receptor from those mediated by other mechanisms is challenging. Certain pharmacological approaches, however, when combined with appropriate experimental designs, can be used to more confidently identify cellular responses regulated by the Ca2+ receptor and select those that might be targeted therapeutically. The Ca2+ receptor on parathyroid cells, because it is the primary mechanism regulating secretion of parathyroid hormonemore » (PTH), is one such target. Calcimimetic compounds, which active this Ca2+ receptor and lower circulating levels of PTH, have been developed for treating hyperparathyroidism. The converse pharmaceutical approach, involving calcilytic compounds that block parathyroid cell Ca2+ receptors and stimulate PTH secretion thereby providing an anabolic therapy for osteoporosis, still awaits clinical validation. Although Ca2+ receptors are expressed throughout the body and in many tissues that are not intimately involved in systemic Ca2+ homeostasis, their physiological and/or pathological significance remains speculative and their value as therapeutic targets is unknown.« less

  4. Tie2 and Eph Receptor Tyrosine Kinase Activation and Signaling

    PubMed Central

    Barton, William A.; Dalton, Annamarie C.; Seegar, Tom C.M.; Himanen, Juha P.

    2014-01-01

    The Eph and Tie cell surface receptors mediate a variety of signaling events during development and in the adult organism. As other receptor tyrosine kinases, they are activated on binding of extracellular ligands and their catalytic activity is tightly regulated on multiple levels. The Eph and Tie receptors display some unique characteristics, including the requirement of ligand-induced receptor clustering for efficient signaling. Interestingly, both Ephs and Ties can mediate different, even opposite, biological effects depending on the specific ligand eliciting the response and on the cellular context. Here we discuss the structural features of these receptors, their interactions with various ligands, as well as functional implications for downstream signaling initiation. The Eph/ephrin structures are already well reviewed and we only provide a brief overview on the initial binding events. We go into more detail discussing the Tie-angiopoietin structures and recognition. PMID:24478383

  5. B61 is a ligand for the ECK receptor protein-tyrosine kinase.

    PubMed

    Bartley, T D; Hunt, R W; Welcher, A A; Boyle, W J; Parker, V P; Lindberg, R A; Lu, H S; Colombero, A M; Elliott, R L; Guthrie, B A

    1994-04-07

    A protein ligand for the ECK receptor protein-tyrosine kinase has been isolated by using the extracellular domain (ECK-X) of the receptor as an affinity reagent. Initially, concentrated cell culture supernatants were screened for receptor binding activity using immobilized ECK-X in a surface plasmon resonance detection system. Subsequently, supernatants from selected cell lines were fractionated directly by receptor affinity chromatography, resulting in the single-step purification of B61, a protein previously identified as the product of an early response gene induced by tumour necrosis factor-alpha. We report here that recombinant B61 induces autophosphorylation of ECK in intact cells, consistent with B61 being an authentic ligand for ECK. ECK is a member of a large orphan receptor protein-tyrosine kinase family headed by EPH, and we suggest that ligands for other members of this family will be related to B61, and can be isolated in the same way.

  6. Palmitoylation as a Functional Regulator of Neurotransmitter Receptors

    PubMed Central

    Naumenko, Vladimir S.

    2018-01-01

    The majority of neuronal proteins involved in cellular signaling undergo different posttranslational modifications significantly affecting their functions. One of these modifications is a covalent attachment of a 16-C palmitic acid to one or more cysteine residues (S-palmitoylation) within the target protein. Palmitoylation is a reversible modification, and repeated cycles of palmitoylation/depalmitoylation might be critically involved in the regulation of multiple signaling processes. Palmitoylation also represents a common posttranslational modification of the neurotransmitter receptors, including G protein-coupled receptors (GPCRs) and ligand-gated ion channels (LICs). From the functional point of view, palmitoylation affects a wide span of neurotransmitter receptors activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, recycling, and synaptic clustering. This review summarizes the current knowledge on the palmitoylation of neurotransmitter receptors and its role in the regulation of receptors functions as well as in the control of different kinds of physiological and pathological behavior. PMID:29849559

  7. Temperature-Sensitive Intracellular Traffic of α2C-Adrenergic Receptor.

    PubMed

    Filipeanu, Catalin M

    2015-01-01

    α(2C)-Adrenergic receptor (α(2C)-AR) is the least characterized adrenergic receptor subtype and still very little is known about the intracellular traffic properties and pathophysiological roles of this receptor. α(2C)-AR has an atypical subcellular localization. At 37 °C, in the vascular smooth muscle cells and in fibroblasts, the receptor is poorly localized at the plasma membrane and accumulates inside the cell. Exposure to lower temperatures stimulates α(2C)-AR transport to the cell surface. This particular intracellular trafficking of α(2C)-AR is significant in the pathology of Raynaud phenomenon. In this brief review, I will present general information on the tissue distribution and cellular localization of α(2C)-AR. Also, I will discuss the mechanisms involved in the receptor transport by focusing on the trafficking motifs and on the molecular chaperones. © 2015 Elsevier Inc. All rights reserved.

  8. Specific olfactory receptor populations projecting to identified glomeruli in the rat olfactory bulb.

    PubMed

    Jastreboff, P J; Pedersen, P E; Greer, C A; Stewart, W B; Kauer, J S; Benson, T E; Shepherd, G M

    1984-08-01

    A critical gap exists in our knowledge of the topographical relationship between the olfactory epithelium and olfactory bulb. The present report describes the application to this problem of a method involving horseradish peroxidase conjugated to wheat germ agglutinin. This material was iontophoretically delivered to circumscribed glomeruli in the olfactory bulb and the characteristics and distribution of retrogradely labeled receptor cells were assessed. After discrete injections into small glomerular groups in the caudomedial bulb, topographically defined populations of receptor cells were labeled. Labeled receptor cell somata appeared at several levels within the epithelium. The receptor cell apical dendrites followed a tight helical course towards the surface of the epithelium. The data thus far demonstrate that functional units within the olfactory system may include not only glomeruli as previously suggested but, in addition, a corresponding matrix of receptor cells possessing functional and topographical specificity.

  9. Specific olfactory receptor populations projecting to identified glomeruli in the rat olfactory bulb.

    PubMed Central

    Jastreboff, P J; Pedersen, P E; Greer, C A; Stewart, W B; Kauer, J S; Benson, T E; Shepherd, G M

    1984-01-01

    A critical gap exists in our knowledge of the topographical relationship between the olfactory epithelium and olfactory bulb. The present report describes the application to this problem of a method involving horseradish peroxidase conjugated to wheat germ agglutinin. This material was iontophoretically delivered to circumscribed glomeruli in the olfactory bulb and the characteristics and distribution of retrogradely labeled receptor cells were assessed. After discrete injections into small glomerular groups in the caudomedial bulb, topographically defined populations of receptor cells were labeled. Labeled receptor cell somata appeared at several levels within the epithelium. The receptor cell apical dendrites followed a tight helical course towards the surface of the epithelium. The data thus far demonstrate that functional units within the olfactory system may include not only glomeruli as previously suggested but, in addition, a corresponding matrix of receptor cells possessing functional and topographical specificity. Images PMID:6206495

  10. FMRP acts as a key messenger for dopamine modulation in the forebrain.

    PubMed

    Wang, Hansen; Wu, Long-Jun; Kim, Susan S; Lee, Frank J S; Gong, Bo; Toyoda, Hiroki; Ren, Ming; Shang, Yu-Ze; Xu, Hui; Liu, Fang; Zhao, Ming-Gao; Zhuo, Min

    2008-08-28

    The fragile X mental retardation protein (FMRP) is an RNA-binding protein that controls translational efficiency and regulates synaptic plasticity. Here, we report that FMRP is involved in dopamine (DA) modulation of synaptic potentiation. AMPA glutamate receptor subtype 1 (GluR1) surface expression and phosphorylation in response to D1 receptor stimulation were reduced in cultured Fmr1(-/-) prefrontal cortex (PFC) neurons. Furthermore, D1 receptor signaling was impaired, accompanied by D1 receptor hyperphosphorylation at serine sites and subcellular redistribution of G protein-coupled receptor kinase 2 (GRK2) in both PFC and striatum of Fmr1(-/-) mice. FMRP interacted with GRK2, and pharmacological inhibition of GRK2 rescued D1 receptor signaling in Fmr1(-/-) neurons. Finally, D1 receptor agonist partially rescued hyperactivity and enhanced the motor function of Fmr1(-/-) mice. Our study has identified FMRP as a key messenger for DA modulation in the forebrain and may provide insights into the cellular and molecular mechanisms underlying fragile X syndrome.

  11. Crystal Structure of the Frizzled-Like Cysteine-Rich Domain of the Receptor Tyrosine Kinase MuSK

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stiegler, A.; Burden, S; Hubbard, S

    Muscle-specific kinase (MuSK) is an essential receptor tyrosine kinase for the establishment and maintenance of the neuromuscular junction (NMJ). Activation of MuSK by agrin, a neuronally derived heparan-sulfate proteoglycan, and LRP4 (low-density lipoprotein receptor-related protein-4), the agrin receptor, leads to clustering of acetylcholine receptors on the postsynaptic side of the NMJ. The ectodomain of MuSK comprises three immunoglobulin-like domains and a cysteine-rich domain (Fz-CRD) related to those in Frizzled proteins, the receptors for Wnts. Here, we report the crystal structure of the MuSK Fz-CRD at 2.1 {angstrom} resolution. The structure reveals a five-disulfide-bridged domain similar to CRDs of Frizzled proteinsmore » but with a divergent C-terminal region. An asymmetric dimer present in the crystal structure implicates surface hydrophobic residues that may function in homotypic or heterotypic interactions to mediate co-clustering of MuSK, rapsyn, and acetylcholine receptors at the NMJ.« less

  12. Sensing multiple ligands with single receptor

    NASA Astrophysics Data System (ADS)

    Singh, Vijay; Nemenman, Ilya

    2015-03-01

    Cells use surface receptors to measure concentrations of external ligand molecules. Limits on the accuracy of such sensing are well-known for the scenario where concentration of one molecular species is being determined by one receptor [Endres]. However, in more realistic scenarios, a cognate (high-affinity) ligand competes with many non-cognate (low-affinity) ligands for binding to the receptor. We analyze effects of this competition on the accuracy of sensing. We show that maximum-likelihood statistical inference allows determination of concentrations of multiple ligands, cognate and non-cognate, by the same receptor concurrently. While it is unclear if traditional biochemical circuitry downstream of the receptor can implement such inference exactly, we show that an approximate inference can be performed by coupling the receptor to a kinetic proofreading cascade. We characterize the accuracy of such kinetic proofreading sensing in comparison to the exact maximum-likelihood approach. We acknowledge the support from the James S. McDonnell Foundation and the Human Frontier Science Program.

  13. The Extracellular Surface of the GLP-1 Receptor Is a Molecular Trigger for Biased Agonism.

    PubMed

    Wootten, Denise; Reynolds, Christopher A; Smith, Kevin J; Mobarec, Juan C; Koole, Cassandra; Savage, Emilia E; Pabreja, Kavita; Simms, John; Sridhar, Rohan; Furness, Sebastian G B; Liu, Mengjie; Thompson, Philip E; Miller, Laurence J; Christopoulos, Arthur; Sexton, Patrick M

    2016-06-16

    Ligand-directed signal bias offers opportunities for sculpting molecular events, with the promise of better, safer therapeutics. Critical to the exploitation of signal bias is an understanding of the molecular events coupling ligand binding to intracellular signaling. Activation of class B G protein-coupled receptors is driven by interaction of the peptide N terminus with the receptor core. To understand how this drives signaling, we have used advanced analytical methods that enable separation of effects on pathway-specific signaling from those that modify agonist affinity and mapped the functional consequence of receptor modification onto three-dimensional models of a receptor-ligand complex. This yields molecular insights into the initiation of receptor activation and the mechanistic basis for biased agonism. Our data reveal that peptide agonists can engage different elements of the receptor extracellular face to achieve effector coupling and biased signaling providing a foundation for rational design of biased agonists. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Immunopathology of autoantibody-associated encephalitides: clues for pathogenesis.

    PubMed

    Bien, Christian G; Vincent, Angela; Barnett, Michael H; Becker, Albert J; Blümcke, Ingmar; Graus, Francesc; Jellinger, Kurt A; Reuss, David E; Ribalta, Teresa; Schlegel, Jürgen; Sutton, Ian; Lassmann, Hans; Bauer, Jan

    2012-05-01

    Classical paraneoplastic encephalitis syndromes with 'onconeural' antibodies directed to intracellular antigens, and the recently described paraneoplastic or non-paraneoplastic encephalitides and antibodies against both neural surface antigens (voltage-gated potassium channel-complexes, N-methyl-d-aspartate receptors) and intracellular antigens (glutamic acid decarboxylase-65), constitute an increasingly recognized group of immune-mediated brain diseases. Evidence for specific immune mechanisms, however, is scarce. Here, we report qualitative and quantitative immunopathology in brain tissue (biopsy or autopsy material) of 17 cases with encephalitis and antibodies to either intracellular (Hu, Ma2, glutamic acid decarboxylase) or surface antigenic targets (voltage-gated potassium channel-complex or N-methyl-d-aspartate receptors). We hypothesized that the encephalitides with antibodies against intracellular antigens (intracellular antigen-onconeural and intracellular antigen-glutamic acid decarboxylase groups) would show neurodegeneration mediated by T cell cytotoxicity and the encephalitides with antibodies against surface antigens would be antibody-mediated and would show less T cell involvement. We found a higher CD8/CD3 ratio and more frequent appositions of granzyme-B(+) cytotoxic T cells to neurons, with associated neuronal loss, in the intracellular antigen-onconeural group (anti-Hu and anti-Ma2 cases) compared to the patients with surface antigens (anti-N-methyl-d-aspartate receptors and anti-voltage-gated potassium channel complex cases). One of the glutamic acid decarboxylase antibody encephalitis cases (intracellular antigen-glutamic acid decarboxylase group) showed multiple appositions of GrB-positive T cells to neurons. Generally, however, the glutamic acid decarboxylase antibody cases showed less intense inflammation and also had relatively low CD8/CD3 ratios compared with the intracellular antigen-onconeural cases. Conversely, we found complement C9neo deposition on neurons associated with acute neuronal cell death in the surface antigen group only, specifically in the voltage-gated potassium channel-complex antibody patients. N-methyl-d-aspartate receptors-antibody cases showed no evidence of antibody and complement-mediated tissue injury and were distinguished from all other encephalitides by the absence of clear neuronal pathology and a low density of inflammatory cells. Although tissue samples varied in location and in the stage of disease, our findings strongly support a central role for T cell-mediated neuronal cytotoxicity in encephalitides with antibodies against intracellular antigens. In voltage-gated potassium channel-complex encephalitis, a subset of the surface antigen antibody encephalitides, an antibody- and complement-mediated immune response appears to be responsible for neuronal loss and cerebral atrophy; the apparent absence of these mechanisms in N-methyl-d-aspartate receptors antibody encephalitis is intriguing and requires further study.

  15. Progranulin: A Proteolytically Processed Protein at the Crossroads of Inflammation and Neurodegeneration*

    PubMed Central

    Cenik, Basar; Sephton, Chantelle F.; Kutluk Cenik, Bercin; Herz, Joachim; Yu, Gang

    2012-01-01

    GRN mutations cause frontotemporal lobar degeneration with TDP-43-positive inclusions. The mechanism of pathogenesis is haploinsufficiency. Recently, homozygous GRN mutations were detected in two patients with neuronal ceroid lipofuscinosis, a lysosomal storage disease. It is unknown whether the pathogenesis of these two conditions is related. Progranulin is cleaved into smaller peptides called granulins. Progranulin and granulins are attributed with roles in cancer, inflammation, and neuronal physiology. Cell surface receptors for progranulin, but not granulin peptides, have been reported. Revealing the cell surface receptors and the intracellular functions of granulins and progranulin is crucial for understanding their contributions to neurodegeneration. PMID:22859297

  16. The interaction of F4 fimbriae with porcine enterocytes as analysed by surface plasmon resonance.

    PubMed

    Verdonck, Frank; Cox, Eric; Vancaeneghem, Sabine; Goddeeris, Bruno M

    2004-07-01

    Fimbriae often play a prominent role in anchoring bacterial cells to host tissue and mediate the first step in pathogenesis. As a consequence, there is a continuous development of new strategies to block the binding of fimbriae to their specific receptor on host cells. The present study demonstrates the specific interaction of F4 (K88) fimbriae and porcine enterocytes using a real-time biomolecular interaction analysis system (BIAcore 3000), based on the principles of surface plasmon resonance (SPR). This method offers new opportunities to screen therapeutics for prevention of adhesion and subsequent disease without receptor purification.

  17. Unconventional secretory processing diversifies neuronal ion channel properties

    PubMed Central

    Hanus, Cyril; Geptin, Helene; Tushev, Georgi; Garg, Sakshi; Alvarez-Castelao, Beatriz; Sambandan, Sivakumar; Kochen, Lisa; Hafner, Anne-Sophie; Langer, Julian D; Schuman, Erin M

    2016-01-01

    N-glycosylation – the sequential addition of complex sugars to adhesion proteins, neurotransmitter receptors, ion channels and secreted trophic factors as they progress through the endoplasmic reticulum and the Golgi apparatus – is one of the most frequent protein modifications. In mammals, most organ-specific N-glycosylation events occur in the brain. Yet, little is known about the nature, function and regulation of N-glycosylation in neurons. Using imaging, quantitative immunoblotting and mass spectrometry, we show that hundreds of neuronal surface membrane proteins are core-glycosylated, resulting in the neuronal membrane displaying surprisingly high levels of glycosylation profiles that are classically associated with immature intracellular proteins. We report that while N-glycosylation is generally required for dendritic development and glutamate receptor surface expression, core-glycosylated proteins are sufficient to sustain these processes, and are thus functional. This atypical glycosylation of surface neuronal proteins can be attributed to a bypass or a hypo-function of the Golgi apparatus. Core-glycosylation is regulated by synaptic activity, modulates synaptic signaling and accelerates the turnover of GluA2-containing glutamate receptors, revealing a novel mechanism that controls the composition and sensing properties of the neuronal membrane. DOI: http://dx.doi.org/10.7554/eLife.20609.001 PMID:27677849

  18. Binding of high molecular weight kininogen to human endothelial cells is mediated via a site within domains 2 and 3 of the urokinase receptor.

    PubMed Central

    Colman, R W; Pixley, R A; Najamunnisa, S; Yan, W; Wang, J; Mazar, A; McCrae, K R

    1997-01-01

    The urokinase receptor (uPAR) binds urokinase-type plasminogen activator (u-PA) through specific interactions with uPAR domain 1, and vitronectin through interactions with a site within uPAR domains 2 and 3. These interactions promote the expression of cell surface plasminogen activator activity and cellular adhesion to vitronectin, respectively. High molecular weight kininogen (HK) also stimulates the expression of cell surface plasminogen activator activity through its ability to serve as an acquired receptor for prekallikrein, which, after its activation, may directly activate prourokinase. Here, we report that binding of the cleaved form of HK (HKa) to human umbilical vein endothelial cells (HUVEC) is mediated through zinc-dependent interactions with uPAR. These occur through a site within uPAR domains 2 and 3, since the binding of 125I-HKa to HUVEC is inhibited by vitronectin, anti-uPAR domain 2 and 3 antibodies and soluble, recombinant uPAR (suPAR), but not by antibody 7E3, which recognizes the beta chain of the endothelial cell vitronectin receptor (integrin alphavbeta3), or fibrinogen, another alphavbeta3 ligand. We also demonstrate the formation of a zinc-dependent complex between suPAR and HKa. Interactions of HKa with endothelial cell uPAR may underlie its ability to promote kallikrein-dependent cell surface plasmin generation, and also explain, in part, its antiadhesive properties. PMID:9294114

  19. Label-free detection of 3-nitro-l-tyrosine with nickel-doped graphene localized surface plasmon resonance biosensor.

    PubMed

    Ng, Siu Pang; Qiu, Guangyu; Ding, Ning; Lu, Xiaoqing; Wu, Chi-Man Lawrence

    2017-03-15

    3-nitro-l-tyrosine (3-NT) is believed to be a biomarker of neurodegenerative diseases and metal doped graphene possess exceptionally high binding energy of 3-NT with metal-nitro chemisorption. Here we report a novel label-free detection scheme of 3-NT via nickel-doped graphene (NDG) as the functionalized receptor on our phase detecting localized surface plasmon resonance (LSPR) biosensor. When compared with reported 3-NT immunoassay with enzyme-linked immunosorbent assay (ELISA), our NDG-LSPR platform offers two advantages i.e. 1) label-free and 2) capture of 3-NT by direct chemisorption. Our limit of detection for 3-NT in PBS was found to be 0.13pg/ml and the linear dynamic range of response was from 0.5pg/ml to 1ng/ml, i.e. four orders of magnitude. The specificity of our NDG receptor to 3-NT was also verified with l-tyrosine of equivalent concentrations in PBS and diluted human serum, for which the NDG receptor shows negligible responses. In addition, the adsorption of 3-NT and l-tyrosine to the NDG receptor were also investigated by atomic force microscopy and further verified by surface enhanced Raman spectroscopy. Therefore, our NDG-LSPR biosensor competes favorably against ELISA and we believe it should be an attractive and economical solution to early diagnostic of 3-NT related disorders for clinical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Metal Oxide Nanosensors Using Polymeric Membranes, Enzymes and Antibody Receptors as Ion and Molecular Recognition Elements

    PubMed Central

    Willander, Magnus; Khun, Kimleang; Ibupoto, Zafar Hussain

    2014-01-01

    The concept of recognition and biofunctionality has attracted increasing interest in the fields of chemistry and material sciences. Advances in the field of nanotechnology for the synthesis of desired metal oxide nanostructures have provided a solid platform for the integration of nanoelectronic devices. These nanoelectronics-based devices have the ability to recognize molecular species of living organisms, and they have created the possibility for advanced chemical sensing functionalities with low limits of detection in the nanomolar range. In this review, various metal oxides, such as ZnO-, CuO-, and NiO-based nanosensors, are described using different methods (receptors) of functionalization for molecular and ion recognition. These functionalized metal oxide surfaces with a specific receptor involve either a complex formation between the receptor and the analyte or an electrostatic interaction during the chemical sensing of analytes. Metal oxide nanostructures are considered revolutionary nanomaterials that have a specific surface for the immobilization of biomolecules with much needed orientation, good conformation and enhanced biological activity which further improve the sensing properties of nanosensors. Metal oxide nanostructures are associated with certain unique optical, electrical and molecular characteristics in addition to unique functionalities and surface charge features which shows attractive platforms for interfacing biorecognition elements with effective transducing properties for signal amplification. There is a great opportunity in the near future for metal oxide nanostructure-based miniaturization and the development of engineering sensor devices. PMID:24841244

  1. A simple method to assess unsaturated zone time lag in the travel time from ground surface to receptor.

    PubMed

    Sousa, Marcelo R; Jones, Jon P; Frind, Emil O; Rudolph, David L

    2013-01-01

    In contaminant travel from ground surface to groundwater receptors, the time taken in travelling through the unsaturated zone is known as the unsaturated zone time lag. Depending on the situation, this time lag may or may not be significant within the context of the overall problem. A method is presented for assessing the importance of the unsaturated zone in the travel time from source to receptor in terms of estimates of both the absolute and the relative advective times. A choice of different techniques for both unsaturated and saturated travel time estimation is provided. This method may be useful for practitioners to decide whether to incorporate unsaturated processes in conceptual and numerical models and can also be used to roughly estimate the total travel time between points near ground surface and a groundwater receptor. This method was applied to a field site located in a glacial aquifer system in Ontario, Canada. Advective travel times were estimated using techniques with different levels of sophistication. The application of the proposed method indicates that the time lag in the unsaturated zone is significant at this field site and should be taken into account. For this case, sophisticated and simplified techniques lead to similar assessments when the same knowledge of the hydraulic conductivity field is assumed. When there is significant uncertainty regarding the hydraulic conductivity, simplified calculations did not lead to a conclusive decision. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. T Cells Engineered With Chimeric Antigen Receptors Targeting NKG2D Ligands Display Lethal Toxicity in Mice

    PubMed Central

    VanSeggelen, Heather; Hammill, Joanne A; Dvorkin-Gheva, Anna; Tantalo, Daniela GM; Kwiecien, Jacek M; Denisova, Galina F; Rabinovich, Brian; Wan, Yonghong; Bramson, Jonathan L

    2015-01-01

    Ligands for the NKG2D receptor are overexpressed on tumors, making them interesting immunotherapy targets. To assess the tumoricidal properties of T cells directed to attack NKG2D ligands, we engineered murine T cells with two distinct NKG2D-based chimeric antigen receptors (CARs): (i) a fusion between the NKG2D receptor and the CD3ζ chain and (ii) a conventional second-generation CAR, where the extracellular domain of NKG2D was fused to CD28 and CD3ζ. To enhance the CAR surface expression, we also engineered T cells to coexpress DAP10. In vitro functionality and surface expression levels of all three CARs was greater in BALB/c T cells than C57BL/6 T cells, indicating strain-specific differences. Upon adoptive transfer of NKG2D-CAR-T cells into syngeneic animals, we observed significant clinical toxicity resulting in morbidity and mortality. The severity of these toxicities varied between the CAR configurations and paralleled their in vitro NKG2D surface expression. BALB/c mice were more sensitive to these toxicities than C57BL/6 mice, consistent with the higher in vitro functionality of BALB/c T cells. Treatment with cyclophosphamide prior to adoptive transfer exacerbated the toxicity. We conclude that while NKG2D ligands may be useful targets for immunotherapy, the pursuit of NKG2D-based CAR-T cell therapies should be undertaken with caution. PMID:26122933

  3. Endocytosis of G protein-coupled receptors is regulated by clathrin light chain phosphorylation.

    PubMed

    Ferreira, Filipe; Foley, Matthew; Cooke, Alex; Cunningham, Margaret; Smith, Gemma; Woolley, Robert; Henderson, Graeme; Kelly, Eamonn; Mundell, Stuart; Smythe, Elizabeth

    2012-08-07

    Signaling by transmembrane receptors such as G protein-coupled receptors (GPCRs) occurs at the cell surface and throughout the endocytic pathway, and signaling from the cell surface may differ in magnitude and downstream output from intracellular signaling. As a result, the rate at which signaling molecules traverse the endocytic pathway makes a significant contribution to downstream output. Modulation of the core endocytic machinery facilitates differential uptake of individual cargoes. Clathrin-coated pits are a major entry portal where assembled clathrin forms a lattice around invaginating buds that have captured endocytic cargo. Clathrin assembles into triskelia composed of three clathrin heavy chains and associated clathrin light chains (CLCs). Despite the identification of clathrin-coated pits at the cell surface over 30 years ago, the functions of CLCs in endocytosis have been elusive. In this work, we identify a novel role for CLCs in the regulated endocytosis of specific cargoes. Small interfering RNA-mediated knockdown of either CLCa or CLCb inhibits the uptake of GPCRs. Moreover, we demonstrate that phosphorylation of Ser204 in CLCb is required for efficient endocytosis of a subset of GPCRs and identify G protein-coupled receptor kinase 2 (GRK2) as a kinase that can phosphorylate CLCb on Ser204. Overexpression of CLCb(S204A) specifically inhibits the endocytosis of those GPCRs whose endocytosis is GRK2-dependent. Together, these results indicate that CLCb phosphorylation acts as a discriminator for the endocytosis of specific GPCRs. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. GnRH receptor activation competes at a low level with growth signaling in stably transfected human breast cell lines

    PubMed Central

    2011-01-01

    Background Gonadotrophin releasing hormone (GnRH) analogs lower estrogen levels in pre-menopausal breast cancer patients. GnRH receptor (GnRH-R) activation also directly inhibits the growth of certain cells. The applicability of GnRH anti-proliferation to breast cancer was therefore analyzed. Methods GnRH-R expression in 298 primary breast cancer samples was measured by quantitative immunofluorescence. Levels of functional GnRH-R in breast-derived cell lines were assessed using 125I-ligand binding and stimulation of 3H-inositol phosphate production. Elevated levels of GnRH-R were stably expressed in cells by transfection. Effects of receptor activation on in vitro cell growth were investigated in comparison with IGF-I and EGF receptor inhibition, and correlated with intracellular signaling using western blotting. Results GnRH-R immunoscoring was highest in hormone receptor (triple) negative and grade 3 breast tumors. However prior to transfection, functional endogenous GnRH-R were undetectable in four commonly studied breast cancer cell lines (MCF-7, ZR-75-1, T47D and MDA-MB-231). After transfection with GnRH-R, high levels of cell surface GnRH-R were detected in SVCT and MDA-MB-231 clones while low-moderate levels of GnRH-R occurred in MCF-7 clones and ZR-75-1 clones. MCF-7 sub-clones with high levels of GnRH-R were isolated following hygromycin phosphotransferase transfection. High level cell surface GnRH-R enabled induction of high levels of 3H-inositol phosphate and modest growth-inhibition in SVCT cells. In contrast, growth of MCF-7, ZR-75-1 or MDA-MB-231 clones was unaffected by GnRH-R activation. Cell growth was inhibited by IGF-I or EGF receptor inhibitors. IGF-I receptor inhibitor lowered levels of p-ERK1/2 in MCF-7 clones. Washout of IGF-I receptor inhibitor resulted in transient hyper-elevation of p-ERK1/2, but co-addition of GnRH-R agonist did not alter the dynamics of ERK1/2 re-phosphorylation. Conclusions Breast cancers exhibit a range of GnRH-R immunostaining, with higher levels of expression found in triple-negative and grade 3 cancers. However, functional cell surface receptors are rare in cultured cells. Intense GnRH-R signaling in transfected breast cancer cells did not markedly inhibit growth, in contrast to transfected HEK 293 cells indicating the importance of intracellular context. GnRH-R signaling could not counteract IGF-I receptor-tyrosine kinase addiction in MCF-7 cells. These results suggest that combinatorial strategies with growth factor inhibitors will be needed to enhance GnRH anti-proliferative effects in breast cancer PMID:22051164

  5. Netrin-1 receptor antibodies in thymoma-associated neuromyotonia with myasthenia gravis.

    PubMed

    Torres-Vega, Estefanía; Mancheño, Nuria; Cebrián-Silla, Arantxa; Herranz-Pérez, Vicente; Chumillas, María J; Moris, Germán; Joubert, Bastien; Honnorat, Jérôme; Sevilla, Teresa; Vílchez, Juan J; Dalmau, Josep; Graus, Francesc; García-Verdugo, José Manuel; Bataller, Luis

    2017-03-28

    To identify cell-surface antibodies in patients with neuromyotonia and to describe the main clinical implications. Sera of 3 patients with thymoma-associated neuromyotonia and myasthenia gravis were used to immunoprecipitate and characterize neuronal cell-surface antigens using reported techniques. The clinical significance of antibodies against precipitated proteins was assessed with sera of 98 patients (neuromyotonia 46, myasthenia gravis 52, thymoma 42; 33 of them with overlapping syndromes) and 219 controls (other neurologic diseases, cancer, and healthy volunteers). Immunoprecipitation studies identified 3 targets, including the Netrin-1 receptors DCC (deleted in colorectal carcinoma) and UNC5A (uncoordinated-5A) as well as Caspr2 (contactin-associated protein-like 2). Cell-based assays with these antigens showed that among the indicated patients, 9 had antibodies against Netrin-1 receptors (7 with additional Caspr2 antibodies) and 5 had isolated Caspr2 antibodies. Only one of the 219 controls had isolated Caspr2 antibodies with relapsing myelitis episodes. Among patients with neuromyotonia and/or myasthenia gravis, the presence of Netrin-1 receptor or Caspr2 antibodies predicted thymoma ( p < 0.05). Coexisting Caspr2 and Netrin-1 receptor antibodies were associated with concurrent thymoma, myasthenia gravis, and neuromyotonia, often with Morvan syndrome ( p = 0.009). Expression of DCC, UNC5A, and Caspr2 proteins was demonstrated in paraffin-embedded thymoma samples (3) and normal thymus. Antibodies against Netrin-1 receptors (DCC and UNC5a) and Caspr2 often coexist and associate with thymoma in patients with neuromyotonia and myasthenia gravis. This study provides Class III evidence that antibodies against Netrin-1 receptors can identify patients with thymoma (sensitivity 21.4%, specificity 100%). © 2017 American Academy of Neurology.

  6. The GPRC6A receptor displays constitutive internalization and sorting to the slow recycling pathway.

    PubMed

    Jacobsen, Stine Engesgaard; Ammendrup-Johnsen, Ina; Jansen, Anna Mai; Gether, Ulrik; Madsen, Kenneth Lindegaard; Bräuner-Osborne, Hans

    2017-04-28

    The class C G protein-coupled receptor GPRC6A is a putative nutrient-sensing receptor and represents a possible new drug target in metabolic disorders. However, the specific physiological role of this receptor has yet to be identified, and the mechanisms regulating its activity and cell surface availability also remain enigmatic. In the present study, we investigated the trafficking properties of GPRC6A by use of both a classical antibody feeding internalization assay in which cells were visualized using confocal microscopy and a novel internalization assay that is based on real-time measurements of fluorescence resonance energy transfer. Both assays revealed that GPRC6A predominantly undergoes constitutive internalization, whereas the agonist-induced effects were imperceptible. Moreover, postendocytic sorting was investigated by assessing the co-localization of internalized GPRC6A with selected Rab protein markers. Internalized GPRC6A was mainly co-localized with the early endosome marker Rab5 and the long loop recycling endosome marker Rab11 and to a much lesser extent with the late endosome marker Rab7. This suggests that upon agonist-independent internalization, GPRC6A is recycled via the Rab11-positive slow recycling pathway, which may be responsible for ensuring a persistent pool of GPRC6A receptors at the cell surface despite chronic agonist exposure. Distinct trafficking pathways have been reported for several of the class C receptors, and our results thus substantiate that non-canonical trafficking mechanisms are a common feature for the nutrient-sensing class C family that ensure functional receptors in the cell membrane despite prolonged agonist exposure. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. The GPRC6A receptor displays constitutive internalization and sorting to the slow recycling pathway

    PubMed Central

    Jacobsen, Stine Engesgaard; Ammendrup-Johnsen, Ina; Jansen, Anna Mai; Gether, Ulrik; Madsen, Kenneth Lindegaard; Bräuner-Osborne, Hans

    2017-01-01

    The class C G protein-coupled receptor GPRC6A is a putative nutrient-sensing receptor and represents a possible new drug target in metabolic disorders. However, the specific physiological role of this receptor has yet to be identified, and the mechanisms regulating its activity and cell surface availability also remain enigmatic. In the present study, we investigated the trafficking properties of GPRC6A by use of both a classical antibody feeding internalization assay in which cells were visualized using confocal microscopy and a novel internalization assay that is based on real-time measurements of fluorescence resonance energy transfer. Both assays revealed that GPRC6A predominantly undergoes constitutive internalization, whereas the agonist-induced effects were imperceptible. Moreover, postendocytic sorting was investigated by assessing the co-localization of internalized GPRC6A with selected Rab protein markers. Internalized GPRC6A was mainly co-localized with the early endosome marker Rab5 and the long loop recycling endosome marker Rab11 and to a much lesser extent with the late endosome marker Rab7. This suggests that upon agonist-independent internalization, GPRC6A is recycled via the Rab11-positive slow recycling pathway, which may be responsible for ensuring a persistent pool of GPRC6A receptors at the cell surface despite chronic agonist exposure. Distinct trafficking pathways have been reported for several of the class C receptors, and our results thus substantiate that non-canonical trafficking mechanisms are a common feature for the nutrient-sensing class C family that ensure functional receptors in the cell membrane despite prolonged agonist exposure. PMID:28280242

  8. Different mechanisms are involved in the antibody mediated inhibition of ligand binding to the urokinase receptor: a study based on biosensor technology.

    PubMed

    List, K; Høyer-Hansen, G; Rønne, E; Danø, K; Behrendt, N

    1999-01-01

    Certain monoclonal antibodies are capable of inhibiting the biological binding reactions of their target proteins. At the molecular level, this type of effect may be brought about by completely different mechanisms, such as competition for common binding determinants, steric hindrance or interference with conformational properties of the receptor critical for ligand binding. This distinction is central when employing the antibodies as tools in the elucidation of the structure-function relationship of the protein in question. We have studied the effect of monoclonal antibodies against the urokinase plasminogen activator receptor (uPAR), a protein located on the surface of various types of malignant and normal cells which is involved in the direction of proteolytic degradation reactions in the extracellular matrix. We show that surface plasmon resonance/biomolecular interaction analysis (BIA) can be employed as a highly useful tool to characterize the inhibitory mechanism of specific antagonist antibodies. Two inhibitory antibodies against uPAR, mAb R3 and mAb R5, were shown to exhibit competitive and non-competitive inhibition, respectively, of ligand binding to the receptor. The former antibody efficiently blocked the receptor against subsequent ligand binding but was unable to promote the dissociation of a preformed receptor-ligand complex. The latter antibody was capable of binding the preformed complex, forming a transient trimolecular assembly, and promoting the dissociation of the uPA/uPAR complex. The continuous recording of binding and dissociation, obtained in BIA, is central in characterizing these phenomena. The identification of a non-competitive inhibitory mechanism against this receptor reveals the presence of a determinant which influences the binding properties of a remote site in the molecular structure and which could be an important target for a putative synthetic antagonist.

  9. Lidocaine Stimulates the Function of Natural Killer Cells in Different Experimental Settings.

    PubMed

    Cata, Juan P; Ramirez, Maria F; Velasquez, Jose F; Di, A I; Popat, Keyuri U; Gottumukkala, Vijaya; Black, Dahlia M; Lewis, Valerae O; Vauthey, Jean N

    2017-09-01

    One of the functions of natural killer (NK) cells is to eliminate cancer cells. The cytolytic activity of NK cells is tightly regulated by inhibitory and activation receptors located in the surface membrane. Lidocaine stimulates the function of NK cells at clinically relevant concentrations. It remains unknown whether this effect of lidocaine has an impact on the expression of surface receptors of NK cells, can uniformly stimulate across different cancer cell lines, and enhances the function of cells obtained during oncological surgery. NK cells from healthy donors and 43 patients who had undergone surgery for cancer were isolated. The function of NK cells was measured by lactate dehydrogenase release assay. NK cells were incubated with clinically relevant concentrations of lidocaine. By flow cytometry, we determined the impact of lidocaine on the expression of galactosylgalactosylxylosylprotein3-beta-glucuronosytranferase 1, marker of cell maturation (CD57), killer cell lectin like receptor A, inhibitory (NKG2A) receptors and killer cell lectin like receptor D, activation (NKG2D) receptors of NK cells. Differences in expression at p<0.05 were considered statistically significant. Lidocaine increased the expression of NKG2D receptors and stimulated the function of NK cells against ovarian, pancreatic and ovarian cancer cell lines. Lidocaine also increased the cytolytic activity of NK cells from patients who underwent oncological surgery, except for those who had orthopedic procedures. Lidocaine showed an important stimulatory activity on NK cells. Our findings suggest that lidocaine might be used perioperatively to minimize the impact of surgery on NK cells. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  10. Different processing of LH/hCG receptors in cultured rat luteal cells and murine Leydig tumor cells (MLTC-1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kellokumpu, S.

    1987-02-01

    The metabolic fate of LH/hCG receptors after exposure to human chorionic gonadotropin (hCG) was examined in cultured rat luteal cells and murine Leydig tumor cells (MLTC-1). Kinetic studies performed after pulse-labelling of the cells with (/sup 125/I)hCG indicated that the bound hormone was lost much more rapidly from the tumor cells than from the luteal cells. The tumor cells were also found to internalize and degrade the hormone more effectively than the luteal cells. Chemical cross-linking and analyses by SDS-PAGE of this material revealed that both cell types also released, in addition to intact hCG, two previously characterized receptor fragment-(/supmore » 125/I)hCG complexes (M/sub r/ 96,000 and 74,000) into the medium, although their amount was negligible in MLTC-1 cells. Possibly due to rapid discharge of the ligand from its receptor, no similar complexes could be detected inside the MLTC-1 cells, suggesting that they were released directly from the cell surface. However, the M/sub r/ 74,000 complex was observed inside MLTC-1 cells if chloroquine, a lysosomotropic agent, was present during the incubations. This suggests that the internalized receptor also becomes degraded, at least when complexed to hCG. The results thus provide evidence that there exist two different mechanisms for proteolytic processing of LH/hCG receptors in these target cells. In tumor cells, the degradation seems to occur almost exclusively intracellularly, whereas in luteal cells a substantial portion of the receptors is also degraded at the cell surface.« less

  11. Cryo-electron microscopy structures of the SARS-CoV spike glycoprotein reveal a prerequisite conformational state for receptor binding.

    PubMed

    Gui, Miao; Song, Wenfei; Zhou, Haixia; Xu, Jingwei; Chen, Silian; Xiang, Ye; Wang, Xinquan

    2017-01-01

    The global outbreak of SARS in 2002-2003 was caused by the infection of a new human coronavirus SARS-CoV. The infection of SARS-CoV is mediated mainly through the viral surface glycoproteins, which consist of S1 and S2 subunits and form trimer spikes on the envelope of the virions. Here we report the ectodomain structures of the SARS-CoV surface spike trimer in different conformational states determined by single-particle cryo-electron microscopy. The conformation 1 determined at 4.3 Å resolution is three-fold symmetric and has all the three receptor-binding C-terminal domain 1 (CTD1s) of the S1 subunits in "down" positions. The binding of the "down" CTD1s to the SARS-CoV receptor ACE2 is not possible due to steric clashes, suggesting that the conformation 1 represents a receptor-binding inactive state. Conformations 2-4 determined at 7.3, 5.7 and 6.8 Å resolutions are all asymmetric, in which one RBD rotates away from the "down" position by different angles to an "up" position. The "up" CTD1 exposes the receptor-binding site for ACE2 engagement, suggesting that the conformations 2-4 represent a receptor-binding active state. This conformational change is also required for the binding of SARS-CoV neutralizing antibodies targeting the CTD1. This phenomenon could be extended to other betacoronaviruses utilizing CTD1 of the S1 subunit for receptor binding, which provides new insights into the intermediate states of coronavirus pre-fusion spike trimer during infection.

  12. Acute Mechanisms Underlying Antibody Effects in Anti–N-Methyl-D-Aspartate Receptor Encephalitis

    PubMed Central

    Moscato, Emilia H; Peng, Xiaoyu; Jain, Ankit; Parsons, Thomas D; Dalmau, Josep; Balice-Gordon, Rita J

    2014-01-01

    Objective A severe but treatable form of immune-mediated encephalitis is associated with antibodies in serum and cerebrospinal fluid (CSF) against the GluN1 subunit of the N-methyl-D-aspartate receptor (NMDAR). Prolonged exposure of hippocampal neurons to antibodies from patients with anti-NMDAR encephalitis caused a reversible decrease in the synaptic localization and function of NMDARs. However, acute effects of the antibodies, fate of the internalized receptors, type of neurons affected, and whether neurons develop compensatory homeostatic mechanisms were unknown and are the focus of this study. Methods Dissociated hippocampal neuron cultures and rodent brain sections were used for immunocytochemical, physiological, and molecular studies. Results Patient antibodies bind to NMDARs throughout the rodent brain, and decrease NMDAR cluster density in both excitatory and inhibitory hippocampal neurons. They rapidly increase the internalization rate of surface NMDAR clusters, independent of receptor activity. This internalization likely accounts for the observed decrease in NMDAR-mediated currents, as no evidence of direct blockade was detected. Once internalized, antibody-bound NMDARs traffic through both recycling endosomes and lysosomes, similar to pharmacologically induced NMDAR endocytosis. The antibodies are responsible for receptor internalization, as their depletion from CSF abrogates these effects in hippocampal neurons. We find that although anti-NMDAR antibodies do not induce compensatory changes in glutamate receptor gene expression, they cause a decrease in inhibitory synapse density onto excitatory hippocampal neurons. Interpretation Our data support an antibody-mediated mechanism of disease pathogenesis driven by immunoglobulin-induced receptor internalization. Antibody-mediated downregulation of surface NMDARs engages homeostatic synaptic plasticity mechanisms, which may inadvertently contribute to disease progression. Ann Neurol 2014;76:108–119 PMID:24916964

  13. Netrin-1 receptor antibodies in thymoma-associated neuromyotonia with myasthenia gravis

    PubMed Central

    Torres-Vega, Estefanía; Mancheño, Nuria; Cebrián-Silla, Arantxa; Herranz-Pérez, Vicente; Chumillas, María J.; Moris, Germán; Joubert, Bastien; Honnorat, Jérôme; Sevilla, Teresa; Vílchez, Juan J.; Dalmau, Josep; Graus, Francesc; García-Verdugo, José Manuel

    2017-01-01

    Objective: To identify cell-surface antibodies in patients with neuromyotonia and to describe the main clinical implications. Methods: Sera of 3 patients with thymoma-associated neuromyotonia and myasthenia gravis were used to immunoprecipitate and characterize neuronal cell-surface antigens using reported techniques. The clinical significance of antibodies against precipitated proteins was assessed with sera of 98 patients (neuromyotonia 46, myasthenia gravis 52, thymoma 42; 33 of them with overlapping syndromes) and 219 controls (other neurologic diseases, cancer, and healthy volunteers). Results: Immunoprecipitation studies identified 3 targets, including the Netrin-1 receptors DCC (deleted in colorectal carcinoma) and UNC5A (uncoordinated-5A) as well as Caspr2 (contactin-associated protein-like 2). Cell-based assays with these antigens showed that among the indicated patients, 9 had antibodies against Netrin-1 receptors (7 with additional Caspr2 antibodies) and 5 had isolated Caspr2 antibodies. Only one of the 219 controls had isolated Caspr2 antibodies with relapsing myelitis episodes. Among patients with neuromyotonia and/or myasthenia gravis, the presence of Netrin-1 receptor or Caspr2 antibodies predicted thymoma (p < 0.05). Coexisting Caspr2 and Netrin-1 receptor antibodies were associated with concurrent thymoma, myasthenia gravis, and neuromyotonia, often with Morvan syndrome (p = 0.009). Expression of DCC, UNC5A, and Caspr2 proteins was demonstrated in paraffin-embedded thymoma samples (3) and normal thymus. Conclusions: Antibodies against Netrin-1 receptors (DCC and UNC5a) and Caspr2 often coexist and associate with thymoma in patients with neuromyotonia and myasthenia gravis. Classification of evidence: This study provides Class III evidence that antibodies against Netrin-1 receptors can identify patients with thymoma (sensitivity 21.4%, specificity 100%). PMID:28251919

  14. Inhibitors for Androgen Receptor Activation Surfaces

    DTIC Science & Technology

    2008-09-01

    such as FKBP52 or HSP90 bind in vivo, and started a collaboration with Marc Cox at UT El Paso to test these possibilities. Our assays of mutated amino...will complete testing the compounds in full length AR constructs and publish the results. We have begun two collaborations, one with Marc Cox on...Prof. Marc Cox and Dr. Paul Rennie to identify proteins that bind to BF3 so that we may form crystals of the receptor with these proteins and learn more about function of the human androgen receptor.

  15. Potential for Aedes albopictus and Ochlerotatus j. japonicus to Change the Field Ecology of Arboviruses of Human Health Importance in the Mid-Atlantic Region of the United States

    DTIC Science & Technology

    2001-10-16

    attachment, the viral attachment proteins on the surface of the virion bind to receptors on the microvillar membrane of the mosquito s midgut ...Penetration refers to the process through which the virions enter the midgut cells; arboviruses enter cell through receptor -mediated endocytosis. During...inactivation of the virus by digestive enzymes in the lumen of the midgut , and the absence or reduced number of cellular receptor sites for virus attachment

  16. Obtaining control of cell surface functionalizations via Pre-targeting and Supramolecular host guest interactions

    NASA Astrophysics Data System (ADS)

    Rood, Mark T. M.; Spa, Silvia J.; Welling, Mick M.; Ten Hove, Jan Bart; van Willigen, Danny M.; Buckle, Tessa; Velders, Aldrik H.; van Leeuwen, Fijs W. B.

    2017-01-01

    The use of mammalian cells for therapeutic applications is finding its way into modern medicine. However, modification or “training” of cells to make them suitable for a specific application remains complex. By envisioning a chemical toolbox that enables specific, but straight-forward and generic cellular functionalization, we investigated how membrane-receptor (pre)targeting could be combined with supramolecular host-guest interactions based on β-cyclodextrin (CD) and adamantane (Ad). The feasibility of this approach was studied in cells with membranous overexpression of the chemokine receptor 4 (CXCR4). By combining specific targeting of CXCR4, using an adamantane (Ad)-functionalized Ac-TZ14011 peptide (guest; KD = 56 nM), with multivalent host molecules that entailed fluorescent β-CD-Poly(isobutylene-alt-maleic-anhydride)-polymers with different fluorescent colors and number of functionalities, host-guest cell-surface modifications could be studied in detail. A second set of Ad-functionalized entities enabled introduction of additional surface functionalities. In addition, the attraction between CD and Ad could be used to drive cell-cell interactions. Combined we have shown that supramolecular interactions, that are based on specific targeting of an overexpressed membrane-receptor, allow specific and stable, yet reversible, surface functionalization of viable cells and how this approach can be used to influence the interaction between cells and their surroundings.

  17. Phospholipids as an alternative to direct covalent coupling: surface functionalization of nanoporous alumina for protein recognition and purification.

    PubMed

    Lazzara, Thomas D; Behn, Daniela; Kliesch, Torben-Tobias; Janshoff, Andreas; Steinem, Claudia

    2012-01-15

    Anodic aluminum oxide (AAO) substrates with aligned, cylindrical, non-intersecting pores with diameters of 75 nm and depths of 3.5 or 10 μm were functionalized with lipid monolayers harboring different receptor lipids. AAO was first functionalized with dodecyl-trichlorosilane, followed by fusion of small unilamellar vesicles (SUVs) forming a lipid monolayer. The SUVs' lipid composition was transferred onto the AAO surface, allowing us to control the surface receptor density. Owing to the optical transparency of the AAO, the overall vesicle spreading process and subsequent protein binding to the receptor-doped lipid monolayers could be investigated in situ by optical waveguide spectroscopy (OWS). SUV spreading occurred at the pore-rim interface, followed by lateral diffusion of lipids within the pore-interior surface until homogeneous coverage was achieved with a lipid monolayer. The functionality of the system was demonstrated through streptavidin binding onto a biotin-DOPE containing POPC membrane, showing maximum protein coverage at 10 mol% of biotin-DOPE. The system enabled us to monitor in real-time the selective extraction of two histidine-tagged proteins, PIGEA14 (14 kDa) and ezrin (70 kDa), directly from cell lysate solutions using a DOGS-NTA(Ni)/DOPC (1:9) membrane. The purification process including protein binding and elution was monitored by OWS and confirmed by SDS-PAGE. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Bypassing Protein Corona Issue on Active Targeting: Zwitterionic Coatings Dictate Specific Interactions of Targeting Moieties and Cell Receptors.

    PubMed

    Safavi-Sohi, Reihaneh; Maghari, Shokoofeh; Raoufi, Mohammad; Jalali, Seyed Amir; Hajipour, Mohammad J; Ghassempour, Alireza; Mahmoudi, Morteza

    2016-09-07

    Surface functionalization strategies for targeting nanoparticles (NP) to specific organs, cells, or organelles, is the foundation for new applications of nanomedicine to drug delivery and biomedical imaging. Interaction of NPs with biological media leads to the formation of a biomolecular layer at the surface of NPs so-called as "protein corona". This corona layer can shield active molecules at the surface of NPs and cause mistargeting or unintended scavenging by the liver, kidney, or spleen. To overcome this corona issue, we have designed biotin-cysteine conjugated silica NPs (biotin was employed as a targeting molecule and cysteine was used as a zwitterionic ligand) to inhibit corona-induced mistargeting and thus significantly enhance the active targeting capability of NPs in complex biological media. To probe the targeting yield of our engineered NPs, we employed both modified silicon wafer substrates with streptavidin (i.e., biotin receptor) to simulate a target and a cell-based model platform using tumor cell lines that overexpress biotin receptors. In both cases, after incubation with human plasma (thus forming a protein corona), cellular uptake/substrate attachment of the targeted NPs with zwitterionic coatings were significantly higher than the same NPs without zwitterionic coating. Our results demonstrated that NPs with a zwitterionic surface can considerably facilitate targeting yield of NPs and provide a promising new type of nanocarriers in biological applications.

  19. Application of receptor models on water quality data in source apportionment in Kuantan River Basin

    PubMed Central

    2012-01-01

    Recent techniques in the management of surface river water have been expanding the demand on the method that can provide more representative of multivariate data set. A proper technique of the architecture of artificial neural network (ANN) model and multiple linear regression (MLR) provides an advance tool for surface water modeling and forecasting. The development of receptor model was applied in order to determine the major sources of pollutants at Kuantan River Basin, Malaysia. Thirteen water quality parameters were used in principal component analysis (PCA) and new variables of fertilizer waste, surface runoff, anthropogenic input, chemical and mineral changes and erosion are successfully developed for modeling purposes. Two models were compared in terms of efficiency and goodness-of-fit for water quality index (WQI) prediction. The results show that APCS-ANN model gives better performance with high R2 value (0.9680) and small root mean square error (RMSE) value (2.6409) compared to APCS-MLR model. Meanwhile from the sensitivity analysis, fertilizer waste acts as the dominant pollutant contributor (59.82%) to the basin studied followed by anthropogenic input (22.48%), surface runoff (13.42%), erosion (2.33%) and lastly chemical and mineral changes (1.95%). Thus, this study concluded that receptor modeling of APCS-ANN can be used to solve various constraints in environmental problem that exist between water distribution variables toward appropriate water quality management. PMID:23369363

  20. Influence of the direct NO-donor SIN-1 on the interaction between platelets and stainless steel stents under dynamic conditions.

    PubMed

    Jung, F; Mrowietz, C; Seyfert, U T; Grewe, R; Franke, R P

    2003-01-01

    It was investigated whether the NO-donor SIN-1, the active metabolite of molsidomine, influenced the activation of platelets, the formation of circulating platelet aggregates, the spontaneous aggregation of platelets and the activation of the clotting system triggered by a body foreign surface in an in vitro closed-loop perfusion model. With human platelet-rich plasma at micromolar concentrations SIN-1 exerted pronounced effects on the interaction between platelets and an exogenous surface. In the absence of SIN-1, the number of circulating single platelets decreased significantly, which could be due either to the formation of circulating platelet aggregates or to the adhesion of platelets to the stent. Both these processes were blocked by the addition of SIN-1. Moreover, the platelets exhibited hyperaggregability in the absence of SIN-1 whereas the NO-donor was able to completely inhibit spontaneous platelet aggregation. Similar results were obtained in flow cytometry experiments. Without SIN-1, high platelet surface densities of both the GPIb/IX and GPIIb/IIIa receptors were observed. In addition, the density of the fibrinogen receptor increased significantly with the number of perfusion cycles. SIN-1 was able to suppress the augmented GPIIb/IIIa receptor expression significantly. Molsidomine seemed to have the potential to reduce the incidence of thrombotic processes triggered by the exogenous surface of the stent.

  1. PARTITION COEFFICIENTS FOR METALS IN SURFACE WATER, SOIL, AND WASTE

    EPA Science Inventory

    This report presents metal partition coefficients for the surface water pathway and for the source model used in the Multimedia, Multi-pathway, Multi-receptor Exposure and Risk Assessment (3MRA) technology under development by the U.S. Environmental Protection Agency. Partition ...

  2. How do eggs get fat? Insights into ovarian fatty acid accumulation in the shortfinned eel, Anguilla australis.

    PubMed

    Damsteegt, Erin L; Mizuta, Hiroko; Hiramatsu, Naoshi; Lokman, P Mark

    2015-09-15

    Previous research using eels has shown that 11-ketotestosterone can induce ovarian triacylglyceride accumulation both in vivo and in vitro. Further, accumulation is dramatically enhanced in the presence of very-low density lipoprotein. This study examined the involvement of the low density lipoprotein receptor and vitellogenin receptor in oocyte lipid accumulation. Specific antisera were used in an attempt to block the vitellogenin receptor and/or the low density lipoprotein receptor. Accordingly, incubation with the low density lipoprotein receptor antiserum clearly reduced the oocyte diameter and the amount of oil present within the oocyte. In contrast, blocking the vitellogenin receptor had little effect on either oocyte surface area or the abundance of oil droplets in the cytosol. In keeping with birds, we conclude that the low density lipoprotein receptor is a major player involved in mediating ovarian fatty acid accumulation in the eel. However, lipoprotein lipase-mediated fatty acid accumulation also remains conceivable, for example through interactions between this enzyme and the low density lipoprotein receptor. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Detection of angiotensin II binding to single adrenal zona glomerulosa cells by confocal Raman microspectroscopy

    NASA Astrophysics Data System (ADS)

    McCoy, Michael J.; Habermann, Timothy J.; Hanke, Craig J.; Adar, Fran; Campbell, William B.; Nithipatikom, Kasem

    1999-04-01

    We developed a confocal Raman microspectroscopic technique to study ligand-receptor bindings in single cells using Raman-labeled ligands and surface-enhanced Raman scattering (SERS). The adrenal zona glomerulosa (ZG) cells were used as a model in this study. ZG cells have a high density of angiotensin II (AII) receptors on the cellular membrane. There are two identified subtypes of AII receptors,namely AT1 and AT2 receptors. AII is a peptidic hormone, which upon binding to its receptors, stimulates the release of aldosterone from ZG cells. The cellular localization of these receptors subtypes was detected in single ZG cells by using immunocomplexation of receptors with specific antibodies and confocal Raman microspectroscopy. In the binding study, we used biotin-labeled AII to bind to its receptors in ZG cells. Then, avidin and Raman-labeled AII. The binding was measure directly on the single ZG cells. The results showed that the binding was displaced with unlabeled AII and specific AII antagonists. This is a rapid and sensitive technique for detection of cellular ligand bindings as well as antagonists screening in drug discovery.

  4. Src regulates sequence-dependent beta-2 adrenergic receptor recycling via cortactin phosphorylation*

    PubMed Central

    Vistein, Rachel; Puthenveedu, Manojkumar A.

    2014-01-01

    The recycling of internalized signaling receptors, which has direct functional consequences, is subject to multiple sequence and biochemical requirements. Why signaling receptors recycle via a specialized pathway, unlike many other proteins that recycle by bulk, is a fundamental unanswered question. Here we show that these specialized pathways allow selective control of signaling receptor recycling by heterologous signaling. Using assays to visualize receptor recycling in living cells, we show that the recycling of the beta-2 adrenergic receptor (B2AR), a prototypic signaling receptor, is regulated by Src family kinases. The target of Src is cortactin, an essential factor for B2AR sorting into specialized recycling microdomains on the endosome. Phosphorylation of a single cortactin residue, Y466, regulates the rate of fission of B2AR recycling vesicles from these microdomains, and, therefore, the rate of delivery of B2AR to the cell surface. Together, our results indicate that actin-stabilized microdomains that mediate signaling receptor recycling can serve as a functional point of convergence for crosstalk between signaling pathways. PMID:25077552

  5. Differential effects of BDNF and neurotrophin 4 (NT4) on endocytic sorting of TrkB receptors.

    PubMed

    Proenca, Catia C; Song, Minseok; Lee, Francis S

    2016-08-01

    Neurotrophins are a family of growth factors playing key roles in the survival, development, and function of neurons. The neurotrophins brain-derived neurotrophic factor (BDNF) and NT4 both bind to and activate TrkB receptors, however, they mediate distinct neuronal functions. The molecular mechanism of how TrkB activation by BDNF and NT4 leads to diverse outcomes is unknown. Here, we report that BDNF and NT4 lead to differential endocytic sorting of TrkB receptors resulting in diverse biological functions in cultured cortical neurons. Fluorescent microscopy and surface biotinylation experiments showed that both neurotrophins stimulate internalization of TrkB with similar kinetics. Exposure to BDNF for 2-3 h reduced the surface pool of TrkB receptors to half, whereas a longer treatment (4-5 h) with NT4 was necessary to achieve a similar level of down-regulation. Although BDNF and NT4 induced TrkB phosphorylation with similar intensities, BDNF induced more rapid ubiquitination and degradation of TrkB than NT4. Interestingly, TrkB receptor ubiquitination by these ligands have substantially different pH sensitivities, resulting in varying degrees of receptor ubiquitination at lower pH levels. Consequently, NT4 was capable of maintaining longer sustained downstream signaling activation that correlated with reduced TrkB ubiquitination at endosomal pH. Thus, by leading to altered endocytic trafficking itineraries for TrkB receptors, BDNF and NT4 elicit differential TrkB signaling in terms of duration, intensity, and specificity, which may contribute to their functional differences in vivo. The neurotrophins, brain-derived neurotrophic factor (BDNF) and neurotrophin-4 (NT4), both bind to and activate TrkB receptors, however, they mediate distinct neuronal functions. Here, we propose that BDNF and NT4 lead to differential endocytic sorting of TrkB receptors resulting in diverse biological functions. BDNF induces more rapid ubiquitination and degradation of TrkB than NT4. Consequently, NT4 is capable of maintaining more sustained signaling downstream of TrkB receptors. © 2016 International Society for Neurochemistry.

  6. Nanoarchitectured electrochemical cytosensors for selective detection of leukemia cells and quantitative evaluation of death receptor expression on cell surfaces.

    PubMed

    Zheng, Tingting; Fu, Jia-Ju; Hu, Lihui; Qiu, Fan; Hu, Minjin; Zhu, Jun-Jie; Hua, Zi-Chun; Wang, Hui

    2013-06-04

    The variable susceptibility to the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) treatment observed in various types of leukemia cells is related to the difference in the expression levels of death receptors, DR4 and DR5, on the cell surfaces. Quantifying the DR4/DR5 expression status on leukemia cell surfaces is of vital importance to the development of diagnostic tools to guide death receptor-based leukemia treatment. Taking the full advantages of novel nanobiotechnology, we have developed a robust electrochemical cytosensing approach toward ultrasensitive detection of leukemia cells with detection limit as low as ~40 cells and quantitative evaluation of DR4/DR5 expression on leukemia cell surfaces. The optimization of electron transfer and cell capture processes at specifically tailored nanobiointerfaces and the incorporation of multiple functions into rationally designed nanoprobes provide unique opportunities of integrating high specificity and signal amplification on one electrochemical cytosensor. The high sensitivity and selectivity of this electrochemical cytosensing approach also allows us to evaluate the dynamic alteration of DR4/DR5 expression on the surfaces of living cells in response to drug treatments. Using the TRAIL-resistant HL-60 cells and TRAIL-sensitive Jurkat cells as model cells, we have further verified that the TRAIL susceptibility of various types of leukemia cells is directly correlated to the surface expression levels of DR4/DR5. This versatile electrochemical cytosensing platform is believed to be of great clinical value for the early diagnosis of human leukemia and the evaluation of therapeutic effects on leukemia patients after radiation therapy or drug treatment.

  7. Sialylated Receptor Setting Influences Mycoplasma pneumoniae Attachment and Gliding Motility.

    PubMed

    Williams, Caitlin R; Chen, Li; Driver, Ashley D; Arnold, Edward A; Sheppard, Edward S; Locklin, Jason; Krause, Duncan C

    2018-06-08

    Mycoplasma pneumoniae is a common cause of human respiratory tract infections, including bronchitis and atypical pneumonia. M. pneumoniae binds glycoprotein receptors having terminal sialic acid residues via the P1 adhesin protein. Here we explored the impact of sialic acid presentation on M. pneumoniae adherence and gliding on surfaces coated with sialylated glycoproteins, or chemically functionalized with α-2,3- and α-2,6-sialyllactose ligated individually or in combination to a polymer scaffold in precisely controlled densities. In both models, gliding required a higher receptor density threshold than adherence, and receptor density influenced gliding frequency but not gliding speed. However, very high densities of α-2,3-sialyllactose actually reduced gliding frequency over peak levels observed at lower densities. Both α-2,3- and α-2,6-sialyllactose supported M. pneumoniae adherence, but gliding was only observed on the former. Finally, gliding on α-2,3-sialyllactose was inhibited on surfaces also conjugated with α-2,6-sialyllactose, suggesting that both moieties bind P1 despite the inability of the latter to support gliding. Our results indicate that the nature and density of host receptor moieties profoundly influences M. pneumoniae gliding, which could affect pathogenesis and infection outcome. Furthermore, precise functionalization of polymer scaffolds shows great promise for further analysis of sialic acid presentation and M. pneumoniae adherence and gliding. This article is protected by copyright. All rights reserved. © 2018 John Wiley & Sons Ltd.

  8. Variable ligand- and receptor-binding hot spots in key strains of influenza neuraminidase

    PubMed Central

    Votapka, Lane; Demir, Özlem; Swift, Robert V; Walker, Ross C; Amaro, Rommie E

    2012-01-01

    Influenza A continues to be a major public health concern due to its ability to cause epidemic and pandemic disease outbreaks in humans. Computational investigations of structural dynamics of the major influenza glycoproteins, especially the neuraminidase (NA) enzyme, are able to provide key insights beyond what is currently accessible with standard experimental techniques. In particular, all-atom molecular dynamics simulations reveal the varying degrees of flexibility for such enzymes. Here we present an analysis of the relative flexibility of the ligand- and receptor-binding area of three key strains of influenza A: highly pathogenic H5N1, the 2009 pandemic H1N1, and a human N2 strain. Through computational solvent mapping, we investigate the various ligand- and receptor-binding “hot spots” that exist on the surface of NA which interacts with both sialic acid receptors on the host cells and antiviral drugs. This analysis suggests that the variable cavities found in the different strains and their corresponding capacities to bind ligand functional groups may play an important role in the ability of NA to form competent reaction encounter complexes with other species of interest, including antiviral drugs, sialic acid receptors on the host cell surface, and the hemagglutinin protein. Such considerations may be especially useful for the prediction of how such complexes form and with what binding capacity. PMID:22872804

  9. Identification of pyridinoline, a collagen crosslink, as a novel intrinsic ligand for the receptor for advanced glycation end-products (RAGE).

    PubMed

    Murakami, Yoto; Fujino, Takayuki; Kurachi, Ryotaro; Hasegawa, Toshiki; Usui, Teruyuki; Hayase, Fumitaka; Watanabe, Hirohito

    2018-05-26

    Advanced glycation end-products (AGEs) elicit inflammatory responses via the receptor for AGEs (RAGE) and participate in the pathogenesis of diabetic complications. An earlier study showed that 3-hydroxypyridinium (3-HP), a common moiety of toxic AGEs such as glyceraldehyde-derived pyridinium (GLAP) and GA-pyridine, is essential for the interaction with RAGE. However, the physiological significance of 3-HP recognition by RAGE remains unclear. We hypothesized that pyridinoline (Pyr), a collagen crosslink containing the 3-HP moiety, could have agonist activity with RAGE. To test this hypothesis, we purified Pyr from bovine achilles tendons and examined its cytotoxicity to rat neuronal PC12 cells. Pyr elicited toxicity to PC12 cells in a concentration-dependent manner, and this effect was attenuated in the presence of either the anti-RAGE antibody or the soluble form of RAGE. Moreover, surface plasmon resonance-based analysis showed specific binding of Pyr to RAGE. These data indicate that Pyr is an intrinsic ligand for RAGE. AGEs: advanced glycation end-products; RAGE: receptor for advanced glycation end-products; DAMPs: damage-associated molecular patterns; PRR: pattern recognition receptor; TLR: toll-like receptor; GLAP: glyceraldehyde-derived pyridinium; 3-HP: 3-hydroxypyridinium; Pyr: pyridinoline; HFBA: heptafluorobutyric acid; GST: glutathione S-transferase; SPR: surface plasmon resonance; ECM: extracellular matrix; EMT: epithelial to mesenchymal transition.

  10. The distribution of IL-13 receptor alpha1 expression on B cells, T cells and monocytes and its regulation by IL-13 and IL-4.

    PubMed

    Graber, P; Gretener, D; Herren, S; Aubry, J P; Elson, G; Poudrier, J; Lecoanet-Henchoz, S; Alouani, S; Losberger, C; Bonnefoy, J Y; Kosco-Vilbois, M H; Gauchat, J F

    1998-12-01

    To study the expression of IL-13 receptor alpha1 (IL-13Ralpha1), specific monoclonal antibodies (mAb) were generated. Surface expression of the IL-13Ralpha1 on B cells, monocytes and T cells was assessed by flow cytometry using these specific mAb. Among tonsillar B cells, the expression was the highest on the IgD+ CD38- B cell subpopulation which is believed to represent naive B cells. Expression was also detectable on a large fraction of the IgD-CD38- B cells but not on CD38+ B cells. Activation under conditions which promote B cell Ig class switching up-regulated the expression of the receptor. However, the same stimuli had an opposite effect for IL-13Ralpha1 expression levels on monocytes. While IL-13Ralpha1 mRNA was clearly detectable in T cell preparations, no surface expression was detected. However, permeabilization of the T cells showed a clear intracellular expression of the receptor. A soluble form of the receptor was immunoprecipitated from the supernatant of activated peripheral T cells, suggesting that T cell IL-13Ralpha1 might have functions unrelated to the capacity to form a type II IL-4/IL-13R with IL-4Ralpha.

  11. Functional rescue of the constitutively internalized V2 vasopressin receptor mutant R137H by the pharmacological chaperone action of SR49059.

    PubMed

    Bernier, Virginie; Lagacé, Monique; Lonergan, Michèle; Arthus, Marie-Françoise; Bichet, Daniel G; Bouvier, Michel

    2004-08-01

    In most cases, nephrogenic diabetes insipidus results from mutations in the V2 vasopressin receptor (V2R) gene that cause intracellular retention of improperly folded receptors. We previously reported that cell permeable V2R antagonists act as pharmacological chaperones that rescue folding, trafficking, and function of several V2R mutants. More recently, the vasopressin antagonist, SR49059, was found to be therapeutically active in nephrogenic diabetes insipidus patients. Three of the patients with positive responses harbored the mutation R137H, previously reported to lead to constitutive endocytosis. This raises the possibility that, instead of acting as a pharmacological chaperone by favoring proper maturation of the receptors, SR49059 could mediate its action on R137H V2R by preventing its endocytosis. Here we report that the beta-arrestin-mediated constitutive endocytosis of R137H V2R is not affected by SR49059, indicating that the functional rescue observed does not result from a stabilization of the receptor at the cell surface. Moreover, metabolic labeling revealed that R137H V2R is also poorly processed to the mature form. SR49059 treatment significantly improved its maturation and cell surface targeting, indicating that the functional rescue of R137H V2Rs results from the pharmacological chaperone action of the antagonist.

  12. Functionalization of Probe Tips and Supports for Single-Molecule Recognition Force Microscopy

    NASA Astrophysics Data System (ADS)

    Ebner, Andreas; Wildling, Linda; Zhu, Rong; Rankl, Christian; Haselgrübler, Thomas; Hinterdorfer, Peter; Gruber, Hermann J.

    The measuring tip of a force microscope can be converted into a monomolecular sensor if one or few "ligand" molecules are attached to the apex of the tip while maintaining ligand function. Functionalized tips are used to study fine details of receptor-ligand interaction by force spectroscopy or to map cognate "receptor" molecules on the sample surface. The receptor (or target) molecules can be present on the surface of a biological specimen; alternatively, soluble target molecules must be immobilized on ultraflat supports. This review describes the methods of tip functionalization, as well as target molecule immobilization. Silicon nitride tips, silicon chips, and mica have usually been functionalized in three steps: (1) aminofunctionalization, (2) crosslinker attachment, and (3) ligand/receptor coupling, whereby numerous crosslinkers are available to couple widely different ligand molecules. Gold-covered tips and/or supports have usually been coated with a self-assembled monolayer, on top of which the ligand/receptor molecule has been coupled either directly or via a crosslinker molecule. Apart from these general strategies, many simplified methods have been used for tip and/or support functionalization, even single-step methods such as adsorption or chemisorption being very efficient under suitable circumstances. All methods are described with the same explicitness and critical parameters are discussed. In conclusion, this review should help to find suitable methods for specific problems of tip and support functionalization.

  13. The first three domains of the insulin receptor differ structurally from the insulin-like growth factor 1 receptor in the regions governing ligand specificity

    PubMed Central

    Lou, Meizhen; Garrett, Thomas P. J.; McKern, Neil M.; Hoyne, Peter A.; Epa, V. Chandana; Bentley, John D.; Lovrecz, George O.; Cosgrove, Leah J.; Frenkel, Maurice J.; Ward, Colin W.

    2006-01-01

    The insulin receptor (IR) and the type-1 insulin-like growth factor receptor (IGF1R) are homologous multidomain proteins that bind insulin and IGF with differing specificity. Here we report the crystal structure of the first three domains (L1–CR–L2) of human IR at 2.3 Å resolution and compare it with the previously determined structure of the corresponding fragment of IGF1R. The most important differences seen between the two receptors are in the two regions governing ligand specificity. The first is at the corner of the ligand-binding surface of the L1 domain, where the side chain of F39 in IR forms part of the ligand binding surface involving the second (central) β-sheet. This is very different to the location of its counterpart in IGF1R, S35, which is not involved in ligand binding. The second major difference is in the sixth module of the CR domain, where IR contains a larger loop that protrudes further into the ligand-binding pocket. This module, which governs IGF1-binding specificity, shows negligible sequence identity, significantly more α-helix, an additional disulfide bond, and opposite electrostatic potential compared to that of the IGF1R. PMID:16894147

  14. Optics of the ozone lidar ELSA

    NASA Technical Reports Server (NTRS)

    Porteneuve, J.

    1992-01-01

    In order to study the ozone layer in the Arctic, we have to define a new optical concept for a lidar. It was necessary to build a transportable system with a large collecting surface in a minimum of volume. It was too useful to have a multichannel receptor. A description of the Emettor Receptor System, collecting system, and analysis system is provided.

  15. A T-Cell Receptor Breaks the Rules | Center for Cancer Research

    Cancer.gov

    Most mature T cells function immunologically when a T-cell receptor (TCR) located on the cell surface encounters and engages its ligand, a major histocompatability complex (MHC), which displays a specific part of a target protein called an antigen. This antigen-presenting complex is assembled from one of the dozen or so MHC molecules that every person inherits from their

  16. Neurobeachin and the Kinesin KIF21B Are Critical for Endocytic Recycling of NMDA Receptors and Regulate Social Behavior.

    PubMed

    Gromova, Kira V; Muhia, Mary; Rothammer, Nicola; Gee, Christine E; Thies, Edda; Schaefer, Irina; Kress, Sabrina; Kilimann, Manfred W; Shevchuk, Olga; Oertner, Thomas G; Kneussel, Matthias

    2018-05-29

    Autism spectrum disorders (ASDs) are associated with mutations affecting synaptic components, including GluN2B-NMDA receptors (NMDARs) and neurobeachin (NBEA). NBEA participates in biosynthetic pathways to regulate synapse receptor targeting, synaptic function, cognition, and social behavior. However, the role of NBEA-mediated transport in specific trafficking routes is unclear. Here, we highlight an additional function for NBEA in the local delivery and surface re-insertion of synaptic receptors in mouse neurons. NBEA dynamically interacts with Rab4-positive recycling endosomes, transiently enters spines in an activity-dependent manner, and regulates GluN2B-NMDAR recycling. Furthermore, we show that the microtubule growth inhibitor kinesin KIF21B constrains NBEA dynamics and is present in the NBEA-recycling endosome-NMDAR complex. Notably, Kif21b knockout decreases NMDAR surface expression and alters social behavior in mice, consistent with reported social deficits in Nbea mutants. The influence of NBEA-KIF21B interactions on GluN2B-NMDAR local recycling may be relevant to mechanisms underlying ASD etiology. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Anti-CD30-targeted gold nanoparticles for photothermal therapy of L-428 Hodgkin’s cell

    PubMed Central

    Qu, Xiaochao; Yao, Cuiping; Wang, Jing; Li, Zheng; Zhang, Zhenxi

    2012-01-01

    Purpose Due to the efficient bioconjugation and highly photothermal effect, gold nanoparticles can stain receptor-overexpressing cancer cells through specific targeting of ligands to receptors, strongly absorb specific light and efficiently convert it into heat based on the property of surface plasmon resonance, and then induce the localized protein denaturation and cell death. Methods Two gold nanoparticle–antibody conjugates, gold-BerH2 antibody (anti-CD30 receptor) and gold-ACT1 antibody (anti-CD25-receptor), were synthesized. Gold-BerH2 conjugates can specifically bind to the surface of L-428 Hodgkin’s cells, and gold-ACT1 conjugates were used for the control. The gold nanoparticle-induced L-428 cell-killing experiments were implemented with different experimental parameters. Results At a relatively low concentration of gold and short incubation time, the influence of cytotoxicity of gold on cell viability can be overlooked. Under laser irradiation at suitable power, the high killing efficiency of gold-targeted L-428 cells was achieved, but little damage was done to nontargeted cancer cells. Conclusion Gold nanoparticle-mediated photothermal therapy provides a relatively safe therapeutic technique for cancer treatment. PMID:23269868

  18. Variable Dependence of Signaling Output on Agonist Occupancy of Ste2p, a G Protein-coupled Receptor in Yeast.

    PubMed

    Sridharan, Rajashri; Connelly, Sara M; Naider, Fred; Dumont, Mark E

    2016-11-11

    We report here on the relationship between ligand binding and signaling responses in the yeast pheromone response pathway, a well characterized G protein-coupled receptor system. Responses to agonist (α-factor) by cells expressing widely varying numbers of receptors depend primarily on fractional occupancy, not the absolute number of agonist-bound receptors. Furthermore, the concentration of competitive antagonist required to inhibit α-factor-dependent signaling is more than 10-fold higher than predicted based on the known ligand affinities. Thus, responses to a particular number of agonist-bound receptors can vary greatly, depending on whether there are unoccupied or antagonist-bound receptors present on the same cell surface. This behavior does not appear to be due to pre-coupling of receptors to G protein or to the Sst2p regulator of G protein signaling. The results are consistent with a signaling response that is determined by the integration of positive signals from agonist-occupied receptors and inhibitory signals from unoccupied receptors, where the inhibitory signals can be diminished by antagonist binding. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. THE SHARK RECTAL GLAND MODEL: A CHAMPION OF RECEPTOR MEDIATED CHLORIDE SECRETION THROUGH CFTR

    PubMed Central

    FORREST, JOHN N.

    2016-01-01

    The dogfish shark salt gland was predicted by Smith and discovered by Burger at the Mount Desert Island Biological Laboratory in Salisbury Cove, Maine. It is an epithelial organ in the intestine composed of tubules that serve a single function: the secretion of hypertonic NaCl. Many G protein receptors are present on the basolateral surface of these tubules, including stimulatory receptors for vasoactive intestinal peptide, adenosine A2, growth hormone releasing hormone, and inhibitory receptors for somatostatin and adenosine A1. An entirely different class of stimulatory receptors is present as C-type natriuretic peptide receptors. Each stimulatory receptor evokes powerful NaCl secretion. G protein receptors bind to Gαs to activate the catalytic unit of adenylate cyclase to form cyclic adenosine monophosphate (cAMP) and protein kinase A that phosphorylates the regulatory domain of cystic fibrosis transmembrane conductance regulator, opening the channel. The C-type natriuretic peptide receptor stimulates by activating guanylate cyclase and endogenous cyclic guanosine monophosphate which inhibits type 3 phosphodiesterase, the enzyme that breaks down cAMP, thereby elevating cAMP and activating the protein kinase A pathway. PMID:28066051

  20. Target-specific cellular uptake of PLGA nanoparticles coated with poly(L-lysine)-poly(ethylene glycol)-folate conjugate.

    PubMed

    Kim, Sun Hwa; Jeong, Ji Hoon; Chun, Ki Woo; Park, Tae Gwan

    2005-09-13

    Poly(D,L-lactic-co-glycolic acid) (PLGA) nanoparticles with anionic surface charge were surface coated with cationic di-block copolymer, poly(L-lysine)-poly(ethylene glycol)-folate (PLL-PEG-FOL) conjugate, for enhancing their site-specific intracellular delivery against folate receptor overexpressing cancer cells. The PLGA nanoparticles coated with the conjugate were characterized in terms of size, surface charge, and change in surface composition by XPS. By employing the flow cytometry method and confocal image analysis, the extent of cellular uptake was comparatively evaluated under various conditions. PLL-PEG-FOL coated PLGA nanoparticles demonstrated far greater extent of cellular uptake to KB cells, suggesting that they were mainly taken up by folate receptor-mediated endocytosis. The enhanced cellular uptake was also observed even in the presence of serum proteins, possibly due to the densely seeded PEG chains. The PLL-PEG-FOL coated PLGA nanoparticles could be potentially applied for cancer cell targeted delivery of various therapeutic agents.

Top