Sample records for surface receptor function

  1. Regulated internalization of NMDA receptors drives PKD1-mediated suppression of the activity of residual cell-surface NMDA receptors.

    PubMed

    Fang, Xiao-Qian; Qiao, Haifa; Groveman, Bradley R; Feng, Shuang; Pflueger, Melissa; Xin, Wen-Kuan; Ali, Mohammad K; Lin, Shuang-Xiu; Xu, Jindong; Duclot, Florian; Kabbaj, Mohamed; Wang, Wei; Ding, Xin-Sheng; Santiago-Sim, Teresa; Jiang, Xing-Hong; Salter, Michael W; Yu, Xian-Min

    2015-11-19

    Constitutive and regulated internalization of cell surface proteins has been extensively investigated. The regulated internalization has been characterized as a principal mechanism for removing cell-surface receptors from the plasma membrane, and signaling to downstream targets of receptors. However, so far it is still not known whether the functional properties of remaining (non-internalized) receptor/channels may be regulated by internalization of the same class of receptor/channels. The N-methyl-D-aspartate receptor (NMDAR) is a principal subtype of glutamate-gated ion channel and plays key roles in neuronal plasticity and memory functions. NMDARs are well-known to undergo two types of regulated internalization - homologous and heterologous, which can be induced by high NMDA/glycine and DHPG, respectively. In the present work, we investigated effects of regulated NMDAR internalization on the activity of residual cell-surface NMDARs and neuronal functions. In electrophysiological experiments we discovered that the regulated internalization of NMDARs not only reduced the number of cell surface NMDARs but also caused an inhibition of the activity of remaining (non-internalized) surface NMDARs. In biochemical experiments we identified that this functional inhibition of remaining surface NMDARs was mediated by increased serine phosphorylation of surface NMDARs, resulting from the activation of protein kinase D1 (PKD1). Knockdown of PKD1 did not affect NMDAR internalization but prevented the phosphorylation and inhibition of remaining surface NMDARs and NMDAR-mediated synaptic functions. These data demonstrate a novel concept that regulated internalization of cell surface NMDARs not only reduces the number of NMDARs on the cell surface but also causes an inhibition of the activity of remaining surface NMDARs through intracellular signaling pathway(s). Furthermore, modulating the activity of remaining surface receptors may be an effective approach for treating receptor internalization-induced changes in neuronal functions of the CNS.

  2. Functional dynamics of cell surface membrane proteins

    NASA Astrophysics Data System (ADS)

    Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio

    2014-04-01

    Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules.

  3. Functional dynamics of cell surface membrane proteins.

    PubMed

    Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio

    2014-04-01

    Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. The majority of ACTH receptor (MC2R) mutations found in Familial Glucocorticoid Deficiency type 1 lead to defective trafficking of the receptor to the cell surface

    PubMed Central

    TT, Chung; TR, Webb; LF, Chan; SN, Cooray; LA, Metherell; PJ, King; JP, Chapple; AJL, Clark

    2008-01-01

    Context: There are at least twenty-four missense, non-conservative mutations found in the ACTH receptor (Melanocortin 2 receptor, MC2R) which have been associated with the autosomal recessive disease Familial Glucocorticoid Deficiency (FGD) type 1. The characterization of these mutations has been hindered by difficulties in establishing a functional heterologous cell transfection system for MC2R. Recently the melanocortin 2 receptor accessory protein (MRAP) was identified as essential for trafficking of MC2R to the cell surface; therefore a functional characterization of MC2R mutations is now possible. Objective: To elucidate the molecular mechanisms responsible for defective MC2R function in FGD. Methods: Stable cell lines expressing human MRAPα were established and transiently transfected with wild-type or mutant MC2R. Functional characterization of mutant MC2R was performed using a cell surface expression assay, a cAMP reporter assay, confocal microscopy and co-immunoprecipitation of MRAPα. Results: Two thirds of all MC2R mutations had a significant reduction in cell surface trafficking even though MRAPα interacted with all mutants. Analysis of those mutant receptors that reached the cell surface indicated that 4/6 failed to signal, following stimulation with ACTH. Conclusion: The majority of MC2R mutations found in FGD fail to function because they fail to traffic to the cell surface. PMID:18840636

  5. Inhibitory effects of two G protein-coupled receptor kinases on the cell surface expression and signaling of the human adrenomedullin receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuwasako, Kenji, E-mail: kuwasako@med.miyazaki-u.ac.jp; Sekiguchi, Toshio; Nagata, Sayaka

    2016-02-19

    Receptor activity-modifying protein 2 (RAMP2) enables the calcitonin receptor-like receptor (CLR, a family B GPCR) to form the type 1 adrenomedullin receptor (AM{sub 1} receptor). Here, we investigated the effects of the five non-visual GPCR kinases (GRKs 2 through 6) on the cell surface expression of the human (h)AM{sub 1} receptor by cotransfecting each of these GRKs into HEK-293 cells that stably expressed hRAMP2. Flow cytometric analysis revealed that when coexpressed with GRK4 or GRK5, the cell surface expression of the AM{sub 1} receptor was markedly decreased prior to stimulation with AM, thereby attenuating both the specific [{sup 125}I]AM binding andmore » AM-induced cAMP production. These inhibitory effects of both GRKs were abolished by the replacement of the cytoplasmic C-terminal tail (C-tail) of CLR with that of the calcitonin receptor (a family B GPCR) or β{sub 2}-adrenergic receptor (a family A GPCR). Among the sequentially truncated CLR C-tail mutants, those lacking the five residues 449–453 (Ser-Phe-Ser-Asn-Ser) abolished the inhibition of the cell surface expression of CLR via the overexpression of GRK4 or GRK5. Thus, we provided new insight into the function of GRKs in agonist-unstimulated GPCR trafficking using a recombinant AM{sub 1} receptor and further determined the region of the CLR C-tail responsible for this GRK function. - Highlights: • We discovered a novel function of GRKs in GPCR trafficking using human CLR/RAMP2. • GRKs 4 and 5 markedly inhibited the cell surface expression of human CLR/RAMP2. • Both GRKs exhibited highly significant receptor signaling inhibition. • Five residues of the C-terminal tail of CLR govern this function of GRKs.« less

  6. Functional subcellular distribution of β1- and β2-adrenergic receptors in rat ventricular cardiac myocytes

    PubMed Central

    Cros, Caroline; Brette, Fabien

    2013-01-01

    β-adrenergic stimulation is a key regulator of cardiac function. The localization of major cardiac adrenergic receptors (β1 and β2) has been investigated using biochemical and biophysical approaches and has led to contradictory results. This study investigates the functional subcellular localization of β1- and β2-adrenergic receptors in rat ventricular myocytes using a physiological approach. Ventricular myocytes were isolated from the hearts of rat and detubulated using formamide. Physiological cardiac function was measured as Ca2+ transient using Fura-2-AM and cell shortening. Selective activation of β1- and β2-adrenergic receptors was induced with isoproterenol (0.1 μmol/L) and ICI-118,551 (0.1 μmol/L); and with salbutamol (10 μmol/L) and atenolol (1 μmol/L), respectively. β1- and β2-adrenergic stimulations induced a significant increase in Ca2+ transient amplitude and cell shortening in intact rat ventricular myocytes (i.e., surface sarcolemma and t-tubules) and in detubulated cells (depleted from t-tubules, surface sarcolemma only). Both β1- and β2-adrenergic receptors stimulation caused a greater effect on Ca2+ transient and cell shortening in detubulated myocytes than in control myocytes. Quantitative analysis indicates that β1-adrenergic stimulation is ∼3 times more effective at surface sarcolemma compared to t-tubules, whereas β2- adrenergic stimulation occurs almost exclusively at surface sarcolemma (∼100 times more effective). These physiological data demonstrate that in rat ventricular myocytes, β1-adrenergic receptors are functionally present at surface sarcolemma and t-tubules, while β2-adrenergic receptors stimulation occurs only at surface sarcolemma of cardiac cells. PMID:24303124

  7. Platelet dysfunction associated with the novel Trp29Cys thromboxane A₂ receptor variant.

    PubMed

    Mumford, A D; Nisar, S; Darnige, L; Jones, M L; Bachelot-Loza, C; Gandrille, S; Zinzindohoue, F; Fischer, A-M; Mundell, S J; Gaussem, P

    2013-03-01

    Genetic variations that affect the structure of the thromboxane A2 receptor (TP receptor) provide insights into the function of this key platelet and vascular receptor, but are very rare in unselected populations. To determine the functional consequences of the TP receptor Trp29Cys (W29C) substitution. We performed a detailed phenotypic analysis of an index case (P1) with reduced platelet aggregation and secretion responses to TP receptor pathway activators, and a heterozygous TP receptor W29C substitution. An analysis of the variant W29C TP receptor expressed in heterologous cells was performed. Total TP receptor expression in platelets from P1 was similar to that of controls, but there was reduced maximum binding and reduced affinity of binding to the TP receptor antagonist [(3) H]SQ29548. HEK293 cells transfected with W29C TP receptor cDNA showed similar total TP receptor expression to wild-type (WT) controls. However, the TP receptor agonist U46619 was less potent at inducing rises in cytosolic free Ca(2+) in HEK293 cells expressing the W29C TP receptor than in WT controls, indicating reduced receptor function. Immunofluorescence microscopy and cell surface ELISA showed intracellular retention and reduced cell surface expression of the W29C TP receptor in HEK293 cells. Consistent with the platelet phenotype, both maximum binding and the affinity of binding of [(3) H]SQ29548 to the W29C TP receptor were reduced compared to WT controls. These findings extend the phenotypic description of the very rare disorder TP receptor deficiency, and show that the W29C substitution reduces TP receptor function by reducing surface receptor expression and by disrupting ligand binding. © 2012 International Society on Thrombosis and Haemostasis.

  8. Surface modification of ZnO nanorods with Hamilton receptors.

    PubMed

    Zeininger, Lukas; Klaumünzer, Martin; Peukert, Wolfgang; Hirsch, Andreas

    2015-04-13

    A new prototype of a Hamilton receptor suitable for the functionalization of inorganic nanoparticles was synthesized and characterized. The hydrogen bonding receptor was coupled to a catechol moiety, which served as anchor group for the functionalization of metal oxides, in particular zinc oxide. Synthesized zinc oxide nanorods [ZnO] were used for surface functionalization. The wet-chemical functionalization procedure towards monolayer-grafted particles [ZnO-HR] is described and a detailed characterization study is presented. In addition, the detection of specific cyanurate molecules is demonstrated. The hybrid structures [ZnO-HR-CA] were stable towards agglomeration and exhibited enhanced dispersability in apolar solvents. This observation, in combination with several spectroscopic experiments gave evidence of the highly directional supramolecular recognition at the surface of nanoparticles.

  9. The N-terminal region of the dopamine D2 receptor, a rhodopsin-like GPCR, regulates correct integration into the plasma membrane and endocytic routes

    PubMed Central

    Cho, DI; Min, C; Jung, KS; Cheong, SY; Zheng, M; Cheong, SJ; Oak, MH; Cheong, JH; Lee, BK; Kim, KM

    2012-01-01

    BACKGROUND AND PURPOSE Functional roles of the N-terminal region of rhodopsin-like GPCR family remain unclear. Using dopamine D2 and D3 receptors as a model system, we probed the roles of the N-terminal region in the signalling, intracellular trafficking of receptor proteins, and explored the critical factors that determine the functionality of the N-terminal region. EXPERIMENTAL APPROACH The N-terminal region of the D2 receptor was gradually shortened or switched with that of the D3 receptor or a non-specific sequence (FLAG), or potential N-terminal glycosylation sites were mutated. Effects of these manipulations on surface expression, internalization, post-endocytic behaviours and signalling were determined. KEY RESULTS Shortening the N-terminal region of the D2 receptor enhanced receptor internalization and impaired surface expression and signalling; ligand binding, desensitization and down-regulation were not affected but their association with a particular microdomain, caveolae, was disrupted. Replacement of critical residues within the N-terminal region with the FLAG epitope failed to restore surface expression but partially restored the altered internalization and signalling. When the N-terminal regions were switched between D2 and D3 receptors, cell surface expression pattern of each receptor was switched. Mutations of potential N-terminal glycosylation sites inhibited surface expression but enhanced internalization of D2 receptors. CONCLUSIONS AND IMPLICATIONS Shortening of N-terminus or mutation of glycosylation sites located within the N-terminus enhanced receptor internalization but impaired the surface expression of D2 receptors. The N-terminal region of the D2 receptor, in a sequence-specific manner, controls the receptor's conformation and integration into the plasma membrane, which determine its subcellular localization, intracellular trafficking and signalling properties. PMID:22117524

  10. Synthetic estrogen derivatives demonstrate the functionality of intracellular GPR30.

    PubMed

    Revankar, Chetana M; Mitchell, Hugh D; Field, Angela S; Burai, Ritwik; Corona, Cesear; Ramesh, Chinnasamy; Sklar, Larry A; Arterburn, Jeffrey B; Prossnitz, Eric R

    2007-08-17

    Estrogen mediates its effects through multiple cellular receptors. In addition to the classical nuclear estrogen receptors (ERalpha and ERbeta), estrogen also signals through the seven-transmembrane G-protein-coupled receptor (GPCR) GPR30. Although estrogen is a cell-permeable ligand, it is often assumed that all GPCRs function solely as cell surface receptors. Our previous results showed that GPR30 appeared to be expressed predominantly in the endoplasmic reticulum. A critical question that arises is whether this localization represents the site of functional receptor. To address this question, we synthesized a collection of cell-permeable and cell-impermeable estrogen derivatives. We hypothesized that if functional GPR30 were expressed at the cell surface, both permeable and impermeable derivatives would show activity. However, if functional GPR30 were predominantly intracellular, like ERalpha, only the permeable ligands should show activity. Cell permeability was assessed using cells expressing ERalpha as a model intracellular estrogen-binding receptor. Our results reveal that despite exhibiting similar binding affinities for GPR30, only the cell-permeable ligands are capable of stimulating rapid calcium mobilization and phosphoinositide 3-kinase (PI3K) activation. We conclude that GPR30 expressed intracellularly is capable of initiating cellular signaling and that there is insufficient GPR30 expressed on the cell surface to initiate signaling in response to impermeable ligands in the cell lines examined. To our knowledge, this is the first definitive demonstration of a functional intracellular transmembrane estrogen receptor.

  11. Cell surface control of the multiubiquitination and deubiquitination of high-affinity immunoglobulin E receptors.

    PubMed Central

    Paolini, R; Kinet, J P

    1993-01-01

    Multiubiquitination of proteins is a critical step leading to selective degradation for many polypeptides. Therefore, activation-induced multiubiquitination of cell surface receptors, such as the platelet-derived growth factor (PDGF) receptor and the T cell antigen (TCR) receptor, may correspond to a degradation pathway for ligand-receptor complexes. Here we show that the antigen-induced engagement of high-affinity immunoglobulin E receptors (Fc epsilon RI) results in the immediate multiubiquitination of Fc epsilon RI beta and gamma chains. This ubiquitination is independent of receptor phosphorylation and is restricted to activated receptors. Surprisingly, receptor multiubiquitination is immediately reversible when receptors are disengaged. Therefore, multiubiquitination and deubiquitination of Fc epsilon RI receptors is controlled at the cell surface by receptor engagement and disengagement. The rapidity, specificity and, most importantly, the reversibility of the activation-induced receptor multiubiquitination suggest that this process may turn on/off a cell surface receptor signaling function thus far unsuspected. Images PMID:8382611

  12. Heterodimerization with beta2-adrenergic receptors promotes surface expression and functional activity of alpha1D-adrenergic receptors.

    PubMed

    Uberti, Michelle A; Hague, Chris; Oller, Heide; Minneman, Kenneth P; Hall, Randy A

    2005-04-01

    The alpha1D-adrenergic receptor (alpha1D-AR) is a G protein-coupled receptor (GPCR) that is poorly trafficked to the cell surface and largely nonfunctional when heterologously expressed by itself in a variety of cell types. We screened a library of approximately 30 other group I GPCRs in a quantitative luminometer assay for the ability to promote alpha1D-AR cell surface expression. Strikingly, these screens revealed only two receptors capable of inducing robust increases in the amount of alpha1D-AR at the cell surface: alpha1B-AR and beta2-AR. Confocal imaging confirmed that coexpression with beta2-AR resulted in translocation of alpha1D-AR from intracellular sites to the plasma membrane. Additionally, coimmunoprecipitation studies demonstrated that alpha1D-AR and beta2-AR specifically interact to form heterodimers when coexpressed in HEK-293 cells. Ligand binding studies revealed an increase in total alpha1D-AR binding sites upon coexpression with beta2-AR, but no apparent effect on the pharmacological properties of the receptors. In functional studies, coexpression with beta2-AR significantly enhanced the coupling of alpha1D-AR to norepinephrine-stimulated Ca2+ mobilization. Heterodimerization of beta2-AR with alpha1D-AR also conferred the ability of alpha1D-AR to cointernalize upon beta2-AR agonist stimulation, revealing a novel mechanism by which these different adrenergic receptor subtypes may regulate each other's activity. These findings demonstrate that the selective association of alpha1D-AR with other receptors is crucial for receptor surface expression and function and also shed light on a novel mechanism of cross talk between alpha1- and beta2-ARs that is mediated through heterodimerization and cross-internalization.

  13. Intrapulmonary receptors in the Tegu lizard: II. Functional characteristics and localization;.

    PubMed

    Scheid, P; Kuhlmann, W D; Fedde, M R

    1977-02-01

    Intrapulmonary receptors identified in the Tegu lizard by single-unit vagal recording (Fedde et al., 1977) were subjected to a number of stimuli and localized within the lung. Some carbon dioxide receptors could follow periodic changes in intrapulmonary CO2 concentrations as rapidly as 1.3 Hz; No oxygen sensitivity was observed with this receptor type, and halothane markedly depressed the discharge frequency. In response to intravenously injected acetazolamide they increased their discharge frequency and became almost totally insensitive to CO2, suggesting molecular per se is not the direct controller of receptor discharge; These receptors show many of the functional characteristics described for those in the avian lung. Afferent activity from both CO2 and mechanoreceptors could be elicited by electrically stimulating the lung surface. The CO2 receptors appeared to be organized in a receptive field covering more than 1 cm2 of lung surface, multiple receptors being innervated by a single afferent fiber. Activity in afferent fibers from mechanoreceptors could be evoked from only one distinct spot on the lung surface. Conduction velocities of afferent fibers from CO2 receptors ranged from 1 to 3 m-sec-1; from mechanoreceptors, from 1.9 to 5.2 m-sec-1.

  14. Co-expression in CHO cells of two muscle proteins involved in excitation-contraction coupling.

    PubMed

    Takekura, H; Takeshima, H; Nishimura, S; Takahashi, M; Tanabe, T; Flockerzi, V; Hofmann, F; Franzini-Armstrong, C

    1995-10-01

    Ryanodine receptors and dihydropyridine receptors are located opposite each other at the junctions between sarcoplasmic reticulum and either the surface membrane or the transverse tubules in skeletal muscle. Ryanodine receptors are the calcium release channels of the sarcoplasmic reticulum and their cytoplasmic domains form the feet, connecting sarcoplasmic reticulum to transverse tubules. Dihydropyridine receptors are L-type calcium channels that act as the voltage sensors of excitation-contraction coupling: they sense surface membrane and transverse tubule depolarization and induce opening of the sarcoplasmic reticulum release channels. In skeletal muscle, ryanodine receptors are arranged in extensive arrays and dihydropyridine receptors are grouped into tetrads, which in turn are associated with the four subunits of ryanodine receptors. The disposition allows for a direct interaction between the two sets of molecules. CHO cells were stably transformed with plasmids for skeletal muscle ryanodine receptors and either the skeletal dihydropyridine receptor, or a skeletal-cardiac dihydropyridine receptor chimera (CSk3) which can functionally substitute for the skeletal dihydropyridine receptor, in addition to plasmids for the alpha 2, beta and gamma subunits. RNA blot hybridization gave positive results for all components. Immunoblots, ryanodine binding, electron microscopy and exposure to caffeine show that the expressed ryanodine receptors forms functional tetrameric channels, which are correctly inserted into the endoplasmic reticulum membrane, and form extensive arrays with the same spacings as in skeletal muscle. Since formation of arrays does not require coexpression of dihydropyridine receptors, we conclude that self-aggregation is an independent property of ryanodine receptors. All dihydropyridine receptor-expressing clones show high affinity binding for dihydropyridine and immunolabelling with antibodies against dihydropyridine receptor. The presence of calcium currents with fast kinetics and immunolabelling for dihydropyridine receptors in the surface membrane of CSk3 clones indicate that CSk3-dihydropyridine receptors are appropriately targeted to the cell's plasmalemma. The expressed skeletal-type dihydropyridine receptors, however, remain mostly located within perinuclear membranes. In cells coexpressing functional dihydropyridine receptors and ryanodine receptors, no junctions between feet-bearing endoplasmic reticulum elements and surface membrane are formed, and dihydropyridine receptors do not assemble into tetrads. A separation between dihydropyridine receptors and ryanodine receptors is not unique to CHO cells, but is found also in cardiac muscle, in muscles of invertebrates and, under certain conditions, in skeletal muscle. We suggest that failure to form junctions in co-transfected CHO cell may be due to lack of an essential protein necessary either for the initial docking of the endoplasmic reticulum to the surface membrane or for maintaining the interaction between dihydropyridine receptors and ryanodine receptors. We also conclude that formation of tetrads requires a close interaction between dihydropyridine receptors and ryanodine receptors.

  15. Rearrangement and expression of the human {Psi}C{lambda}6 gene segment results in a surface Ig receptor with a truncated light chain constant region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stiernholm, N.B.J.; Verkoczy, L.K.; Berinstein, N.L.

    1995-05-01

    The constant region of the human Ig{lambda} locus consists of seven tandemly organized J-C gene segments. Although it has been established that the J-C{lambda}1, J-C{lambda}2, J-C{lambda}3, and J-C{lambda}7 gene segments are functional, and code for the four distinct Ig{lambda} isotypes found in human serum, the J-C{lambda}4, J-C{lambda}5, and J-C{lambda}6 gene segments are generally considered to be pseudogenes. Although one example of a functional J-C{lambda}6 gene segment has been documented, in the majority of cases, J-C{lambda}6 is rendered nonfunctional by virtue of a single duplication of four nucleotides, creating a premature translational arrest. We show here that rearrangements to the J-C{lambda}6more » gene segment do occur, and that such a rearrangement encodes an Ig{lambda} protein that lacks the terminal end of the constant region. We also show that this truncated protein is expressed on the surface with the IgH chain, creating an unusual surface Ig (sIg) receptor (sIg{triangle}CL). Cells that express this receptor on the surface do so at significantly reduced levels compared with clonally related variants, which express sIg receptors with conventional Ig{lambda} L chains. However, the effects of sIg cross-linking on tyrosine phosphorylation and surface expression of the CD25 and CD71 Ags are similar in cells that express conventional sIg receptors and in those that express sIg{triangle}CL receptors, suggesting that the latter could possibly function as an Ag receptor. 35 refs., 7 figs.« less

  16. Amplification of anion sensing by disulfide functionalized ferrocene and ferrocene-calixarene receptors adsorbed onto gold surfaces.

    PubMed

    Cormode, David P; Evans, Andrew J; Davis, Jason J; Beer, Paul D

    2010-07-28

    A disulfide functionalized bis-ferrocene urea acyclic receptor and disulfide functionalized mono- and bis-ferrocene amide and urea appended upper rim calix[4]arene receptors were prepared for the fabrication of SAM redox-active anion sensors. 1H NMR and diffusive voltammetric anion recognition investigations revealed each receptor to be capable of complexing and electrochemically sensing anions via cathodic perturbations of the respective receptor's ferrocene/ferrocenium redox couple. SAMs of a ferrocene urea receptor 3 and ferrocene urea calixarene receptor 17 exhibited significant enhanced magnitudes of cathodic response upon anion addition as compared to observed diffusive perturbations. SAMs of 17 were demonstrated to sense the perrhenate anion in aqueous solutions.

  17. Stress Proteins and Initiation of Immune Response: Chaperokine activity of Hsp72

    PubMed Central

    Asea, Alexzander

    2006-01-01

    From its original description as solely an intracellular molecular chaperone, heat shock proteins have now been shown to function as initiators of the host's immune response. Although the exact mechanism by which intracellular heat shock proteins leave cells is still incompletely understood, recent work from several labs suggest that heat shock proteins are released by both passive (necrotic) and active (physiological) mechanisms. Binding to specific surface receptors is a prerequisite for the initiation of an immune response. To date, several cell surface proteins have been described as the receptor for seventy kilo-Dalton heat shock protein (Hsp70) including Toll-like receptors 2 and 4 with their cofactor CD14, the scavenger receptor CD36, the low-density lipoprotein receptor-related protein CD91, the C-type lectin receptor LOX-1, and another member of the scavenger super-family SR-A plus the co-stimulatory molecule, CD40. Binding of Hsp70 to these surface receptors specifically activates intracellular signaling cascades, which in turn exert immunoregulatory effector functions; a process known as the chaperokine activity of Hsp70. This review will highlight recent advances in understanding the mechanism by which Hsp70 initiates the host's immune response. PMID:16385842

  18. Stress proteins and initiation of immune response: chaperokine activity of hsp72.

    PubMed

    Asea, Alexzander

    2005-01-01

    From its original description as solely an intracellular molecular chaperone, heat shock proteins have now been shown to function as initiators of the host's immune response. Although the exact mechanism by which intracellular heat shock proteins leave cells is still incompletely understood, recent work from several labs suggest that heat shock proteins are released by both passive (necrotic) and active (physiological) mechanisms. Binding to specific surface receptors is a prerequisite for the initiation of an immune response. To date, several cell surface proteins have been described as the receptor for seventy kilo-Dalton heat shock protein (Hsp70) including Toll-like receptors 2 and 4 with their cofactor CD14, the scavenger receptor CD36, the low-density lipoprotein receptor-related protein CD91, the C-type lectin receptor LOX-1, and another member of the scavenger super-family SR-A plus the co-stimulatory molecule, CD40. Binding of Hsp70 to these surface receptors specifically activates intracellular signaling cascades, which in turn exert immunoregulatory effector functions; a process known as the chaperokine activity of Hsp70. This review will highlight recent advances in understanding the mechanism by which Hsp70 initiates the host's immune response.

  19. Sustained neurotensin exposure promotes cell surface recruitment of NTS2 receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perron, Amelie; Sharif, Nadder; Gendron, Louis

    2006-05-12

    In this study, we investigated whether persistent agonist stimulation of NTS2 receptors gives rise to down-regulation, in light of reports that their activation induced long-lasting effects. To address this issue, we incubated COS-7 cells expressing the rat NTS2 with neurotensin (NT) for up to 24 h and measured resultant cell surface [{sup 125}I]-NT binding. We found that NTS2-expressing cells retained the same surface receptor density despite efficient internalization mechanisms. This preservation was neither due to NTS2 neosynthesis nor recycling since it was not blocked by cycloheximide or monensin. However, it appeared to involve translocation of spare receptors from internal stores,more » as NT induced NTS2 migration from trans-Golgi network to endosome-like structures. This stimulation-induced regulation of cell surface NTS2 receptors was even more striking in rat spinal cord neurons. Taken together, these results suggest that sustained NTS2 activation promotes recruitment of intracellular receptors to the cell surface, thereby preventing functional desensitization.« less

  20. Quantitative Characterization of Shear-Induced Platelet Receptor Shedding: Glycoprotein Ibα, Glycoprotein VI, and Glycoprotein IIb/IIIa.

    PubMed

    Chen, Zengsheng; Koenig, Steven C; Slaughter, Mark S; Griffith, Bartley P; Wu, Zhongjun J

    2017-11-07

    The structural integrity of platelet receptors is essential for platelets to play the normal hemostatic function. The high non-physiologic shear stress (NPSS) commonly exists in blood-contacting medical devices and has been shown to cause platelet receptor shedding. The loss of platelet receptors may impair the normal hemostatic function of platelets. The aim of this study was to quantify NPSS-induced shedding of three key receptors on the platelet surface. Human blood was subjected to the matrix of well-defined shear stresses and exposure times, generated by using a custom-designed blood-shearing device. The expression of three key platelet receptors, glycoprotein (GP) Ibα, GPVI, and GPIIb/IIIa, in sheared blood was quantified using flow cytometry. The quantitative relationship between the loss of each of the three receptors on the platelet surface and shear condition (shear stress level and exposure time) was explored. It was found that these relationships followed well the power law functional form. The coefficients of the power law models for the shear-induced shedding of these platelet receptors were derived with coefficients of determination (R) of 0.77, 0.73, and 0.78, respectively. The power law models with these coefficients may be potentially used to predict the shear-induced platelet receptor shedding of human blood.

  1. Sorting receptor Rer1 controls surface expression of muscle acetylcholine receptors by ER retention of unassembled alpha-subunits.

    PubMed

    Valkova, Christina; Albrizio, Marina; Röder, Ira V; Schwake, Michael; Betto, Romeo; Rudolf, Rüdiger; Kaether, Christoph

    2011-01-11

    The nicotinic acetylcholine receptor of skeletal muscle is composed of five subunits that are assembled in a stepwise manner. Quality control mechanisms ensure that only fully assembled receptors reach the cell surface. Here, we show that Rer1, a putative Golgi-ER retrieval receptor, is involved in the biogenesis of acetylcholine receptors. Rer1 is expressed in the early secretory pathway in the myoblast line C2C12 and in mouse skeletal muscle, and up-regulated during myogenesis. Upon down-regulation of Rer1 in C2C12 cells, unassembled acetylcholine receptor α-subunits escape from the ER and are transported to the plasma membrane and lysosomes, where they are degraded. As a result, the amount of fully assembled receptor at the cell surface is reduced. In vivo Rer1 knockdown and genetic inactivation of one Rer1 allele lead to significantly smaller neuromuscular junctions in mice. Our data show that Rer1 is a functionally important unique factor that controls surface expression of muscle acetylcholine receptors by localizing unassembled α-subunits to the early secretory pathway.

  2. GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

    PubMed Central

    Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

    2016-01-01

    Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

  3. Localization of functional receptor epitopes on the structure of ciliary neurotrophic factor indicates a conserved, function-related epitope topography among helical cytokines.

    PubMed

    Panayotatos, N; Radziejewska, E; Acheson, A; Somogyi, R; Thadani, A; Hendrickson, W A; McDonald, N Q

    1995-06-09

    By rational mutagenesis, receptor-specific functional analysis, and visualization of complex formation in solution, we identified individual amino acid side chains involved specifically in the interaction of ciliary neurotrophic factor (CNTF) with CNTFR alpha and not with the beta-components, gp130 and LIFR. In the crystal structure, the side chains of these residues, which are located in helix A, the AB loop, helix B, and helix D, are surface accessible and are clustered in space, thus constituting an epitope for CNTFR alpha. By the same analysis, a partial epitope for gp130 was also identified on the surface of helix A that faces away from the alpha-epitope. Superposition of the CNTF and growth hormone structures showed that the location of these epitopes on CNTF is analogous to the location of the first and second receptor epitopes on the surface of growth hormone. Further comparison with proposed binding sites for alpha- and beta-receptors on interleukin-6 and leukemia inhibitory factor indicated that this epitope topology is conserved among helical cytokines. In each case, epitope I is utilized by the specificity-conferring component, whereas epitopes II and III are used by accessory components. Thus, in addition to a common fold, helical cytokines share a conserved order of receptor epitopes that is function related.

  4. Structure of colicin I receptor bound to the R-domain of colicin Ia: implications for protein import

    PubMed Central

    Buchanan, Susan K; Lukacik, Petra; Grizot, Sylvestre; Ghirlando, Rodolfo; Ali, Maruf M U; Barnard, Travis J; Jakes, Karen S; Kienker, Paul K; Esser, Lothar

    2007-01-01

    Colicin Ia is a 69 kDa protein that kills susceptible Escherichia coli cells by binding to a specific receptor in the outer membrane, colicin I receptor (70 kDa), and subsequently translocating its channel forming domain across the periplasmic space, where it inserts into the inner membrane and forms a voltage-dependent ion channel. We determined crystal structures of colicin I receptor alone and in complex with the receptor binding domain of colicin Ia. The receptor undergoes large and unusual conformational changes upon colicin binding, opening at the cell surface and positioning the receptor binding domain of colicin Ia directly above it. We modelled the interaction with full-length colicin Ia to show that the channel forming domain is initially positioned 150 Å above the cell surface. Functional data using full-length colicin Ia show that colicin I receptor is necessary for cell surface binding, and suggest that the receptor participates in translocation of colicin Ia across the outer membrane. PMID:17464289

  5. Obtaining control of cell surface functionalizations via Pre-targeting and Supramolecular host guest interactions

    NASA Astrophysics Data System (ADS)

    Rood, Mark T. M.; Spa, Silvia J.; Welling, Mick M.; Ten Hove, Jan Bart; van Willigen, Danny M.; Buckle, Tessa; Velders, Aldrik H.; van Leeuwen, Fijs W. B.

    2017-01-01

    The use of mammalian cells for therapeutic applications is finding its way into modern medicine. However, modification or “training” of cells to make them suitable for a specific application remains complex. By envisioning a chemical toolbox that enables specific, but straight-forward and generic cellular functionalization, we investigated how membrane-receptor (pre)targeting could be combined with supramolecular host-guest interactions based on β-cyclodextrin (CD) and adamantane (Ad). The feasibility of this approach was studied in cells with membranous overexpression of the chemokine receptor 4 (CXCR4). By combining specific targeting of CXCR4, using an adamantane (Ad)-functionalized Ac-TZ14011 peptide (guest; KD = 56 nM), with multivalent host molecules that entailed fluorescent β-CD-Poly(isobutylene-alt-maleic-anhydride)-polymers with different fluorescent colors and number of functionalities, host-guest cell-surface modifications could be studied in detail. A second set of Ad-functionalized entities enabled introduction of additional surface functionalities. In addition, the attraction between CD and Ad could be used to drive cell-cell interactions. Combined we have shown that supramolecular interactions, that are based on specific targeting of an overexpressed membrane-receptor, allow specific and stable, yet reversible, surface functionalization of viable cells and how this approach can be used to influence the interaction between cells and their surroundings.

  6. Site-specific O-glycosylation of N-terminal serine residues by polypeptide GalNAc-transferase 2 modulates human δ-opioid receptor turnover at the plasma membrane.

    PubMed

    Lackman, Jarkko J; Goth, Christoffer K; Halim, Adnan; Vakhrushev, Sergey Y; Clausen, Henrik; Petäjä-Repo, Ulla E

    2018-01-01

    G protein-coupled receptors (GPCRs) are an important protein family of signalling receptors that govern a wide variety of physiological functions. The capacity to transmit extracellular signals and the extent of cellular response are largely determined by the amount of functional receptors at the cell surface that is subject to complex and fine-tuned regulation. Here, we demonstrate that the cell surface expression level of an inhibitory GPCR, the human δ-opioid receptor (hδOR) involved in pain and mood regulation, is modulated by site-specific N-acetylgalactosamine (GalNAc) -type O-glycosylation. Importantly, we identified one out of the 20 polypeptide GalNAc-transferase isoforms, GalNAc-T2, as the specific regulator of O-glycosylation of Ser6, Ser25 and Ser29 in the N-terminal ectodomain of the receptor. This was demonstrated by in vitro glycosylation assays using peptides corresponding to the hδOR N-terminus, Vicia villosa lectin affinity purification of receptors expressed in HEK293 SimpleCells capable of synthesizing only truncated O-glycans, GalNAc-T edited cell line model systems, and site-directed mutagenesis of the putative O-glycosylation sites. Interestingly, a single-nucleotide polymorphism, at residue 27 (F27C), was found to alter O-glycosylation of the receptor in efficiency as well as in glycosite usage. Furthermore, flow cytometry and cell surface biotinylation assays using O-glycan deficient CHO-ldlD cells revealed that the absence of O-glycans results in decreased receptor levels at the plasma membrane due to enhanced turnover. In addition, mutation of the identified O-glycosylation sites led to a decrease in the number of ligand-binding competent receptors and impaired agonist-mediated inhibition of cyclic AMP accumulation in HEK293 cells. Thus, site-specific O-glycosylation by a selected GalNAc-T isoform can increase the stability of a GPCR, in a process that modulates the constitutive turnover and steady-state levels of functional receptors at the cell surface. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. A novel thromboxane A2 receptor N42S variant results in reduced surface expression and platelet dysfunction.

    PubMed

    Nisar, Shaista P; Lordkipanidzé, Marie; Jones, Matthew L; Dawood, Ban; Murden, Sherina; Cunningham, Margaret R; Mumford, Andrew D; Wilde, Jonathan T; Watson, Steve P; Mundell, Stuart J; Lowe, Gillian C

    2014-05-05

    A small number of thromboxane receptor variants have been described in patients with a bleeding history that result in platelet dysfunction. We have identified a patient with a history of significant bleeding, who expresses a novel heterozygous thromboxane receptor variant that predicts an asparagine to serine substitution (N42S). This asparagine is conserved across all class A GPCRs, suggesting a vital role for receptor structure and function.We investigated the functional consequences of the TP receptor heterozygous N42S substitution by performing platelet function studies on platelet-rich plasma taken from the patient and healthy controls. We investigated the N42S mutation by expressing the wild-type (WT) and mutant receptor in human embryonic kidney (HEK) cells. Aggregation studies showed an ablation of arachidonic acid responses in the patient, whilst there was right-ward shift of the U46619 concentration response curve (CRC). Thromboxane generation was unaffected. Calcium mobilisation studies in cells lines showed a rightward shift of the U46619 CRC in N42S-expressing cells compared to WT. Radioligand binding studies revealed a reduction in BMax in platelets taken from the patient and in N42S-expressing cells, whilst cell studies confirmed poor surface expression. We have identified a novel thromboxane receptor variant, N42S, which results in platelet dysfunction due to reduced surface expression. It is associated with a significant bleeding history in the patient in whom it was identified. This is the first description of a naturally occurring variant that results in the substitution of this highly conserved residue and confirms the importance of this residue for correct GPCR function.

  8. Predicting receptor functionality of signaling lymphocyte activation molecule for measles virus hemagglutinin by docking simulation.

    PubMed

    Suzuki, Yoshiyuki

    2017-05-01

    Predicting susceptibility of various species to a virus assists assessment of risk of interspecies transmission. Evaluation of receptor functionality may be useful in screening for susceptibility. In this study, docking simulation was conducted for measles virus hemagglutinin (MV-H) and immunoglobulin-like variable domain of signaling lymphocyte activation molecule (SLAM-V). It was observed that the docking scores for MV-H and SLAM-V correlated with the activity of SLAM as an MV receptor. These results suggest that the receptor functionality may be predicted from the docking scores of virion surface proteins and cellular receptor molecules. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  9. Functionalization of Probe Tips and Supports for Single-Molecule Recognition Force Microscopy

    NASA Astrophysics Data System (ADS)

    Ebner, Andreas; Wildling, Linda; Zhu, Rong; Rankl, Christian; Haselgrübler, Thomas; Hinterdorfer, Peter; Gruber, Hermann J.

    The measuring tip of a force microscope can be converted into a monomolecular sensor if one or few "ligand" molecules are attached to the apex of the tip while maintaining ligand function. Functionalized tips are used to study fine details of receptor-ligand interaction by force spectroscopy or to map cognate "receptor" molecules on the sample surface. The receptor (or target) molecules can be present on the surface of a biological specimen; alternatively, soluble target molecules must be immobilized on ultraflat supports. This review describes the methods of tip functionalization, as well as target molecule immobilization. Silicon nitride tips, silicon chips, and mica have usually been functionalized in three steps: (1) aminofunctionalization, (2) crosslinker attachment, and (3) ligand/receptor coupling, whereby numerous crosslinkers are available to couple widely different ligand molecules. Gold-covered tips and/or supports have usually been coated with a self-assembled monolayer, on top of which the ligand/receptor molecule has been coupled either directly or via a crosslinker molecule. Apart from these general strategies, many simplified methods have been used for tip and/or support functionalization, even single-step methods such as adsorption or chemisorption being very efficient under suitable circumstances. All methods are described with the same explicitness and critical parameters are discussed. In conclusion, this review should help to find suitable methods for specific problems of tip and support functionalization.

  10. RNA Aptamer-Based Functional Ligands of the Neurotrophin Receptor, TrkB

    PubMed Central

    Huang, Yang Zhong; Hernandez, Frank J.; Gu, Bin; Stockdale, Katie R.; Nanapaneni, Kishore; Scheetz, Todd E.; Behlke, Mark A.; Peek, Andrew S.; Bair, Thomas; Giangrande, Paloma H.

    2012-01-01

    Many cell surface signaling receptors, such as the neurotrophin receptor, TrkB, have emerged as potential therapeutic targets for diverse diseases. Reduced activation of TrkB in particular is thought to contribute to neurodegenerative diseases. Unfortunately, development of therapeutic reagents that selectively activate particular cell surface receptors such as TrkB has proven challenging. Like many cell surface signaling receptors, TrkB is internalized upon activation; in this proof-of-concept study, we exploited this fact to isolate a pool of nuclease-stabilized RNA aptamers enriched for TrkB agonists. One of the selected aptamers, C4-3, was characterized with recombinant protein-binding assays, cell-based signaling and functional assays, and, in vivo in a seizure model in mice. C4-3 binds the extracellular domain of TrkB with high affinity (KD ∼2 nM) and exhibits potent TrkB partial agonistic activity and neuroprotective effects in cultured cortical neurons. In mice, C4-3 activates TrkB upon infusion into the hippocampus; systemic administration of C4-3 potentiates kainic acid-induced seizure development. We conclude that C4-3 is a potentially useful therapeutic agent for neurodegenerative diseases in which reduced TrkB activation has been implicated. We anticipate that the cell-based aptamer selection approach used here will be broadly applicable to the identification of aptamer-based agonists for a variety of cell-surface signaling receptors. PMID:22752556

  11. Plant cell surface receptor-mediated signaling - a common theme amid diversity.

    PubMed

    He, Yunxia; Zhou, Jinggeng; Shan, Libo; Meng, Xiangzong

    2018-01-29

    Sessile plants employ a diverse array of plasma membrane-bound receptors to perceive endogenous and exogenous signals for regulation of plant growth, development and immunity. These cell surface receptors include receptor-like kinases (RLKs) and receptor-like proteins (RLPs) that harbor different extracellular domains for perception of distinct ligands. Several RLK and RLP signaling pathways converge at the somatic embryogenesis receptor kinases (SERKs), which function as shared co-receptors. A repertoire of receptor-like cytoplasmic kinases (RLCKs) associate with the receptor complexes to relay intracellular signaling. Downstream of the receptor complexes, mitogen-activated protein kinase (MAPK) cascades are among the key signaling modules at which the signals converge, and these cascades regulate diverse cellular and physiological responses through phosphorylation of different downstream substrates. In this Review, we summarize the emerging common theme that underlies cell surface receptor-mediated signaling pathways in Arabidopsis thaliana : the dynamic association of RLKs and RLPs with specific co-receptors and RLCKs for signal transduction. We further discuss how signaling specificities are maintained through modules at which signals converge, with a focus on SERK-mediated receptor signaling. © 2018. Published by The Company of Biologists Ltd.

  12. The neuronal Ca(2+) -binding protein 2 (NECAB2) interacts with the adenosine A(2A) receptor and modulates the cell surface expression and function of the receptor.

    PubMed

    Canela, Laia; Luján, Rafael; Lluís, Carme; Burgueño, Javier; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Ciruela, Francisco

    2007-09-01

    Heptaspanning membrane also known as G protein-coupled receptors (GPCR) do interact with a variety of intracellular proteins whose function is regulate receptor traffic and/or signaling. Using a yeast two-hybrid screen, NECAB2, a neuronal calcium binding protein, was identified as a binding partner for the adenosine A(2A) receptor (A(2A)R) interacting with its C-terminal domain. Co-localization, co-immunoprecipitation and pull-down experiments showed a close and specific interaction between A(2A)R and NECAB2 in both transfected HEK-293 cells and also in rat striatum. Immunoelectron microscopy detection of NECAB2 and A(2A)R in the rat striatopallidal structures indicated that both proteins are co-distributed in the same glutamatergic nerve terminals. The interaction of NECAB2 with A(2A)R modulated the cell surface expression, the ligand-dependent internalization and the receptor-mediated activation of the MAPK pathway. Overall, these results show that A(2A)R interacts with NECAB2 in striatal neurones co-expressing the two proteins and that the interaction is relevant for A(2A)R function.

  13. LeEix1 functions as a decoy receptor to attenuate LeEix2 signaling.

    PubMed

    Bar, Maya; Sharfman, Miya; Avni, Adi

    2011-03-01

    The receptors for the fungal elicitor EIX (LeEix1 and LeEix2) belong to a class of leucine-rich repeat cell-surface glycoproteins with a signal for receptor-mediated endocytosis. Both receptors are able to bind the EIX elicitor while only the LeEix2 receptor mediates defense responses. We show that LeEix1 acts as a decoy receptor and attenuates EIX induced internalization and signaling of the LeEix2 receptor. We demonstrate that BAK1 binds LeEix1 but not LeEix2. In plants where BAK1 was silenced, LeEix1 was no longer able to attenuate plant responses to EIX, indicating that BAK1 is required for this attenuation. We suggest that LeEix1 functions as a decoy receptor for LeEix2, a function which requires the kinase activity of BAK1.

  14. Regulation of P2Y1 receptor traffic by sorting Nexin 1 is retromer independent.

    PubMed

    Nisar, Shaista; Kelly, Eamonn; Cullen, Pete J; Mundell, Stuart J

    2010-04-01

    The activity and traffic of G-protein coupled receptors (GPCRs) is tightly controlled. Recent work from our laboratory has shown that P2Y(1) and P2Y(12) responsiveness is rapidly and reversibly modulated in human platelets and that the underlying mechanism requires receptor trafficking as an essential part of this process. However, little is known about the molecular mechanisms underlying P2Y receptor traffic. Sorting nexin 1 (SNX1) has been shown to regulate the endosomal sorting of cell surface receptors either to lysosomes where they are downregulated or back to the cell surface. These functions may in part be due to interactions of SNX1 with the mammalian retromer complex. In this study, we investigated the role of SNX1 in P2Y receptor trafficking. We show that P2Y(1) receptors recycle via a slow recycling pathway that is regulated by SNX1, whereas P2Y(12) receptors return to the cell surface via a rapid route that is SNX1 independent. SNX1 inhibition caused a dramatic increase in the rate of P2Y(1) receptor recycling, whereas inhibition of Vps26 and Vps35 known to be present in retromer had no effect, indicating that SNX1 regulation of P2Y(1) receptor recycling is retromer independent. In addition, inhibition of SNX4, 6 and 17 proteins did not affect P2Y(1) receptor recycling. SNX1 has also been implicated in GPCR degradation; however, we provide evidence that P2Y receptor degradation is SNX1 independent. These data describe a novel function of SNX1 in the regulation of P2Y(1) receptor recycling and suggest that SNX1 plays multiple roles in endocytic trafficking of GPCRs.

  15. Palmitoylation as a Functional Regulator of Neurotransmitter Receptors

    PubMed Central

    Naumenko, Vladimir S.

    2018-01-01

    The majority of neuronal proteins involved in cellular signaling undergo different posttranslational modifications significantly affecting their functions. One of these modifications is a covalent attachment of a 16-C palmitic acid to one or more cysteine residues (S-palmitoylation) within the target protein. Palmitoylation is a reversible modification, and repeated cycles of palmitoylation/depalmitoylation might be critically involved in the regulation of multiple signaling processes. Palmitoylation also represents a common posttranslational modification of the neurotransmitter receptors, including G protein-coupled receptors (GPCRs) and ligand-gated ion channels (LICs). From the functional point of view, palmitoylation affects a wide span of neurotransmitter receptors activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, recycling, and synaptic clustering. This review summarizes the current knowledge on the palmitoylation of neurotransmitter receptors and its role in the regulation of receptors functions as well as in the control of different kinds of physiological and pathological behavior. PMID:29849559

  16. Structure and signalling functions of C3 receptors on human B cells.

    PubMed

    Frade, R

    1990-03-01

    CR1 (C3b receptor) and CR2 (C3d/EBV receptor) are two C3 receptors expressed on B lymphocytes. CR1 and CR2 have structural similarities and their cross-linking at the B cell surface by antibodies or specific ligands in multimeric forms induce B cell activation. However, activation of human B cells through cell surface interactions or by intracellular protein kinase C activators leads to phosphorylation of CR2 but not CR1. CR2 is phosphorylated on serine and tyrosine residues. Analysis of post-membrane events associated with CR2 revealed intracellular interactions of CR2 with p53, a plasma membrane anti-oncogene-encoded phosphoprotein, and with p120, a nuclear phosphoribonucleoprotein. These intracellular interactions probably represent important steps in the signalling functions of CR2.

  17. Engineering of PDMS Surfaces for use in Microsystems for Capture and Isolation of Complex and Biomedically Important Proteins: Epidermal Growth Factor Receptor as a Model System

    PubMed Central

    Lowe, Aaron M.; Ozer, Byram H.; Wiepz, Gregory J.; Bertics, Paul J.; Abbott, Nicholas L.

    2009-01-01

    Elastomers based on poly(dimethylsiloxane) (PDMS) are promising materials for fabrication of a wide range of microanalytical systems due to their mechanical and optical properties and ease of processing. To date, however, quantitative studies that demonstrate reliable and reproducible methods for attachment of binding groups that capture complex receptor proteins of relevance to biomedical applications of PDMS microsystems have not been reported. Herein we describe methods that lead to the reproducible capture of a transmembrane protein, the human epidermal growth factor (EGF) receptor, onto PDMS surfaces presenting covalently immobilized antibodies for EGF receptor, and subsequent isolation of the captured receptor by mechanical transfer of the receptor onto a chemically functionalized surface of a gold film for detection. This result is particularly significant because the physical properties of transmembrane proteins make this class of proteins a difficult one to analyze. We benchmark the performance of antibodies to the human EGF receptor covalently immobilized on PDMS against the performance of the same antibodies physisorbed to conventional surfaces utilized in ELISA assays through the use of EGF receptor that was 32P-radiolabeled in its autophosphorylation domain. These results reveal that two pan-reactive antibodies for the EGF receptor (H11 and 111.6) and one phosphospecific EGF receptor antibody (pY1068) capture the receptor on both PDMS and ELISA plates. When using H11 antibody to capture EGF receptor and subsequent treatment with a stripping buffer (NaOH and sodium dodecylsulfate) to isolate the receptor, the signal-to-background obtained using the PDMS surface was 82:1, exceeding the signal-to-background measured on the ELISA plate (<48:1). We also characterized the isolation of captured EGF receptor by mechanical contact of the PDMS surface with a chemically functionalized gold film. The efficiency of mechanical transfer of the transmembrane protein from the PDMS surface was found to be 75–81%. However, the transfer of non-specifically bound protein was substantially less than 75%, thus leading to the important finding that mechanical transfer of the EGF receptor leads to an approximately four-fold increase in signal-to-background from 20:1 to 88:1. The signal-to-background obtained following mechanical transfer is also better than that obtained using ELISA plates and stripping buffer (<48:1). The EGF receptor is a clinically important protein and the target of numerous anticancer agents and thus these results, when combined, provide guidance for the design of PDMS-based microanalytical systems for the capture and isolation of complex and clinically important transmembrane proteins. PMID:18651079

  18. Engineering of PDMS surfaces for use in microsystems for capture and isolation of complex and biomedically important proteins: epidermal growth factor receptor as a model system.

    PubMed

    Lowe, Aaron M; Ozer, Byram H; Wiepz, Gregory J; Bertics, Paul J; Abbott, Nicholas L

    2008-08-01

    Elastomers based on poly(dimethylsiloxane) (PDMS) are promising materials for fabrication of a wide range of microanalytical systems due to their mechanical and optical properties and ease of processing. To date, however, quantitative studies that demonstrate reliable and reproducible methods for attachment of binding groups that capture complex receptor proteins of relevance to biomedical applications of PDMS microsystems have not been reported. Herein we describe methods that lead to the reproducible capture of a transmembrane protein, the human epidermal growth factor (EGF) receptor, onto PDMS surfaces presenting covalently immobilized antibodies for EGF receptor, and subsequent isolation of the captured receptor by mechanical transfer of the receptor onto a chemically functionalized surface of a gold film for detection. This result is particularly significant because the physical properties of transmembrane proteins make this class of proteins a difficult one to analyze. We benchmark the performance of antibodies to the human EGF receptor covalently immobilized on PDMS against the performance of the same antibodies physisorbed to conventional surfaces utilized in ELISA assays through the use of EGF receptor that was (32)P-radiolabeled in its autophosphorylation domain. These results reveal that two pan-reactive antibodies for the EGF receptor (clones H11 and 111.6) and one phosphospecific EGF receptor antibody (clone pY1068) capture the receptor on both PDMS and ELISA plates. When using H11 antibody to capture EGF receptor and subsequent treatment with a stripping buffer (NaOH and sodium dodecylsulfate) to isolate the receptor, the signal-to-background obtained using the PDMS surface was 82 : 1, exceeding the signal-to-background measured on the ELISA plate (<48 : 1). We also characterized the isolation of captured EGF receptor by mechanical contact of the PDMS surface with a chemically functionalized gold film. The efficiency of mechanical transfer of the transmembrane protein from the PDMS surface was found to be 75-81%. However, the transfer of non-specifically bound protein was substantially less than 75%, thus leading to the important finding that mechanical transfer of the EGF receptor leads to an approximately four-fold increase in signal-to-background from 20 : 1 to 88 : 1. The signal-to-background obtained following mechanical transfer is also better than that obtained using ELISA plates and stripping buffer (<48 : 1). The EGF receptor is a clinically important protein and the target of numerous anticancer agents and thus these results, when combined, provide guidance for the design of PDMS-based microanalytical systems for the capture and isolation of complex and clinically important transmembrane proteins.

  19. Activation of the novel estrogen receptor G protein-coupled receptor 30 (GPR30) at the plasma membrane.

    PubMed

    Filardo, E; Quinn, J; Pang, Y; Graeber, C; Shaw, S; Dong, J; Thomas, P

    2007-07-01

    G protein-coupled receptor 30 (GPR30), a seven-transmembrane receptor (7TMR), is associated with rapid estrogen-dependent, G protein signaling and specific estrogen binding. At present, the subcellular site of GPR30 action is unclear. Previous studies using antibodies and fluorochrome-labeled estradiol (E2) have failed to detect GPR30 on the cell surface, suggesting that GPR30 may function uniquely among 7TMRs as an intracellular receptor. Here, we show that detectable expression of GPR30 on the surface of transfected HEK-293 cells can be selected by fluorescence-activated cell sorting. Expression of GPR30 on the cell surface was confirmed by confocal microscopy using the lectin concanavalin A as a plasma membrane marker. Stimulation of GPR30-expressing HEK-293 cells with 17beta-E2 caused sequestration of GPR30 from the cell surface and resulted in its codistribution with clathrin and mobilization of intracellular calcium stores. Evidence that GPR30 signals from the cell surface was obtained from experiments demonstrating that the cell-impermeable E2-protein conjugates E2-BSA and E2-horseradish peroxidase promote GPR30-dependent elevation of intracellular cAMP concentrations. Subcellular fractionation studies further support the plasma membrane as a site of GPR30 action with specific [3H]17beta-E2 binding and G protein activation associated with plasma membrane but not microsomal, or other fractions, prepared from HEK-293 or SKBR3 breast cancer cells. These results suggest that GPR30, like other 7TMRs, functions as a plasma membrane receptor.

  20. Novel Yeast-based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR*

    PubMed Central

    Li, Hao; Redinbo, Matthew R.; Venkatesh, Madhukumar; Ekins, Sean; Chaudhry, Anik; Bloch, Nicolin; Negassa, Abdissa; Mukherjee, Paromita; Kalpana, Ganjam; Mani, Sridhar

    2013-01-01

    The pregnane X receptor (PXR) is a master regulator of xenobiotic metabolism, and its activity is critical toward understanding the pathophysiology of several diseases, including inflammation, cancer, and steatosis. Previous studies have demonstrated that ketoconazole binds to ligand-activated PXR and antagonizes receptor control of gene expression. Structure-function as well as computational docking analysis suggested a putative binding region containing critical charge clamp residues Gln-272, and Phe-264 on the AF-2 surface of PXR. To define the antagonist binding surface(s) of PXR, we developed a novel assay to identify key amino acid residues on PXR based on a yeast two-hybrid screen that examined mutant forms of PXR. This screen identified multiple “gain-of-function” mutants that were “resistant” to the PXR antagonist effects of ketoconazole. We then compared our screen results identifying key PXR residues to those predicted by computational methods. Of 15 potential or putative binding residues based on docking, we identified three residues in the yeast screen that were then systematically verified to functionally interact with ketoconazole using mammalian assays. Among the residues confirmed by our study was Ser-208, which is on the opposite side of the protein from the AF-2 region critical for receptor regulation. The identification of new locations for antagonist binding on the surface or buried in PXR indicates novel aspects to the mechanism of receptor antagonism. These results significantly expand our understanding of antagonist binding sites on the surface of PXR and suggest new avenues to regulate this receptor for clinical applications. PMID:23525103

  1. Lidocaine Stimulates the Function of Natural Killer Cells in Different Experimental Settings.

    PubMed

    Cata, Juan P; Ramirez, Maria F; Velasquez, Jose F; Di, A I; Popat, Keyuri U; Gottumukkala, Vijaya; Black, Dahlia M; Lewis, Valerae O; Vauthey, Jean N

    2017-09-01

    One of the functions of natural killer (NK) cells is to eliminate cancer cells. The cytolytic activity of NK cells is tightly regulated by inhibitory and activation receptors located in the surface membrane. Lidocaine stimulates the function of NK cells at clinically relevant concentrations. It remains unknown whether this effect of lidocaine has an impact on the expression of surface receptors of NK cells, can uniformly stimulate across different cancer cell lines, and enhances the function of cells obtained during oncological surgery. NK cells from healthy donors and 43 patients who had undergone surgery for cancer were isolated. The function of NK cells was measured by lactate dehydrogenase release assay. NK cells were incubated with clinically relevant concentrations of lidocaine. By flow cytometry, we determined the impact of lidocaine on the expression of galactosylgalactosylxylosylprotein3-beta-glucuronosytranferase 1, marker of cell maturation (CD57), killer cell lectin like receptor A, inhibitory (NKG2A) receptors and killer cell lectin like receptor D, activation (NKG2D) receptors of NK cells. Differences in expression at p<0.05 were considered statistically significant. Lidocaine increased the expression of NKG2D receptors and stimulated the function of NK cells against ovarian, pancreatic and ovarian cancer cell lines. Lidocaine also increased the cytolytic activity of NK cells from patients who underwent oncological surgery, except for those who had orthopedic procedures. Lidocaine showed an important stimulatory activity on NK cells. Our findings suggest that lidocaine might be used perioperatively to minimize the impact of surgery on NK cells. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  2. Dexmedetomidine Prevents Excessive γ-Aminobutyric Acid Type A Receptor Function after Anesthesia.

    PubMed

    Wang, Dian-Shi; Kaneshwaran, Kirusanthy; Lei, Gang; Mostafa, Fariya; Wang, Junhui; Lecker, Irene; Avramescu, Sinziana; Xie, Yu-Feng; Chan, Nathan K; Fernandez-Escobar, Alejandro; Woo, Junsung; Chan, Darren; Ramsey, Amy J; Sivak, Jeremy M; Lee, C Justin; Bonin, Robert P; Orser, Beverley A

    2018-06-08

    Postoperative delirium is associated with poor long-term outcomes and increased mortality. General anesthetic drugs may contribute to delirium because they increase cell-surface expression and function of α5 subunit-containing γ-aminobutyric acid type A receptors, an effect that persists long after the drugs have been eliminated. Dexmedetomidine, an α2 adrenergic receptor agonist, prevents delirium in patients and reduces cognitive deficits in animals. Thus, it was postulated that dexmedetomidine prevents excessive function of α5 γ-aminobutyric acid type A receptors. Injectable (etomidate) and inhaled (sevoflurane) anesthetic drugs were studied using cultured murine hippocampal neurons, cultured murine and human cortical astrocytes, and ex vivo murine hippocampal slices. γ-Aminobutyric acid type A receptor function and cell-signaling pathways were studied using electrophysiologic and biochemical methods. Memory and problem-solving behaviors were also studied. The etomidate-induced sustained increase in α5 γ-aminobutyric acid type A receptor cell-surface expression was reduced by dexmedetomidine (mean ± SD, etomidate: 146.4 ± 51.6% vs. etomidate + dexmedetomidine: 118.4 ± 39.1% of control, n = 8 each). Dexmedetomidine also reduced the persistent increase in tonic inhibitory current in hippocampal neurons (etomidate: 1.44 ± 0.33 pA/pF, n = 10; etomidate + dexmedetomidine: 1.01 ± 0.45 pA/pF, n = 9). Similarly, dexmedetomidine prevented a sevoflurane-induced increase in the tonic current. Dexmedetomidine stimulated astrocytes to release brain-derived neurotrophic factor, which acted as a paracrine factor to reduce excessive α5 γ-aminobutyric acid type A receptor function in neurons. Finally, dexmedetomidine attenuated memory and problem-solving deficits after anesthesia. Dexmedetomidine prevented excessive α5 γ-aminobutyric acid type A receptor function after anesthesia. This novel α2 adrenergic receptor- and brain-derived neurotrophic factor-dependent pathway may be targeted to prevent delirium.

  3. [GPCRs heterodimerization: a new way towards the discovery of function for the orphan receptors?].

    PubMed

    Levoye, Angélique; Jockers, Ralf

    2007-01-01

    G protein-coupled receptors (GPCRs), also called seven transmembrane domain (7TM) proteins, represent the largest family of cell surface receptors. GPCRs control a variety of physiological processes, are involved in multiple diseases and are major drug targets. Despite a vast effort of academic and industrial research, more than one hundred receptors remain orphans. These orphan GPCRs offer a great potential for drug discovery, as almost 60% of currently prescribed drugs target GPCRs. Deorphenization strategies have concentrated mainly on the identification of the natural ligands of these proteins. Recent advances have shown that orphan GPCRs, similar to orphan nuclear receptors, can regulate the function of non-orphan receptors by heterodimerization. These findings not only help to better understand the extraordinary diversity of GPCRs, but also open new perspectives for the identification of the function of these orphan receptors that hold great therapeutic potential.

  4. Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

    PubMed

    Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

    2017-07-01

    Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.

  5. Autoantibodies to Synaptic Receptors and Neuronal Cell Surface Proteins in Autoimmune Diseases of the Central Nervous System

    PubMed Central

    Geis, Christian; Graus, Francesc

    2017-01-01

    Investigations in the last 10 years have revealed a new category of neurological diseases mediated by antibodies against cell surface and synaptic proteins. There are currently 16 such diseases all characterized by autoantibodies against neuronal proteins involved in synaptic signaling and plasticity. In clinical practice these findings have changed the diagnostic and treatment approach to potentially lethal, but now treatable, neurological and psychiatric syndromes previously considered idiopathic or not even suspected to be immune-mediated. Studies show that patients' antibodies can impair the surface dynamics of the target receptors eliminating them from synapses (e.g., NMDA receptor), block the function of the antigens without changing their synaptic density (e.g., GABAb receptor), interfere with synaptic protein-protein interactions (LGI1, Caspr2), alter synapse formation (e.g., neurexin-3α), or by unclear mechanisms associate to a new form of tauopathy (IgLON5). Here we first trace the process of discovery of these diseases, describing the triggers and symptoms related to each autoantigen, and then review in detail the structural and functional alterations caused by the autoantibodies with special emphasis in those (NMDA receptor, amphiphysin) that have been modeled in animals. PMID:28298428

  6. Structural basis for methylesterase CheB regulation by a phosphorylation-activated domain

    PubMed Central

    Djordjevic, Snezana; Goudreau, Paul N.; Xu, Qingping; Stock, Ann M.; West, Ann H.

    1998-01-01

    We report the x-ray crystal structure of the methylesterase CheB, a phosphorylation-activated response regulator involved in reversible modification of bacterial chemotaxis receptors. Methylesterase CheB and methyltransferase CheR modulate signaling output of the chemotaxis receptors by controlling the level of receptor methylation. The structure of CheB, which consists of an N-terminal regulatory domain and a C-terminal catalytic domain joined by a linker, was solved by molecular replacement methods using independent search models for the two domains. In unphosphorylated CheB, the N-terminal domain packs against the active site of the C-terminal domain and thus inhibits methylesterase activity by directly restricting access to the active site. We propose that phosphorylation of CheB induces a conformational change in the regulatory domain that disrupts the domain interface, resulting in a repositioning of the domains and allowing access to the active site. Structural similarity between the two companion receptor modification enzymes, CheB and CheR, suggests an evolutionary and/or functional relationship. Specifically, the phosphorylated N-terminal domain of CheB may facilitate interaction with the receptors, similar to the postulated role of the N-terminal domain of CheR. Examination of surfaces in the N-terminal regulatory domain of CheB suggests that despite a common fold throughout the response regulator family, surfaces used for protein–protein interactions differ significantly. Comparison between CheB and other response regulators indicates that analogous surfaces are used for different functions and conversely, similar functions are mediated by different molecular surfaces. PMID:9465023

  7. THE AP-2 CLATHRIN ADAPTOR MEDIATES ENDOCYTOSIS OF AN INHIBITORY KILLER CELL Ig-LIKE RECEPTOR (KIR) IN HUMAN NK CELLS1

    PubMed Central

    Purdy, Amanda K.; Alvarez-Arias, Diana A.; Oshinsky, Jennifer; James, Ashley M.; Serebriiskii, Ilya; Campbell, Kerry S.

    2014-01-01

    Stable surface expression of human inhibitory killer cell immunoglobulin-like receptors (KIR) is critical for controlling NK cell function and maintaining NK cell tolerance toward normal MHC-I+ cells. Our recent experiments, however, have found that antibody-bound KIR3DL1 (3DL1) readily leaves the cell surface and undergoes endocytosis to early/recycling endosomes and subsequently to late endosomes. We found that 3DL1 internalization is at least partially mediated by an interaction between the μ2 subunit of the AP-2 clathrin adaptor complex and ITIM tyrosine residues in the cytoplasmic domain of 3DL1. Disruption of the 3DL1/μ2 interaction, either by mutation of the ITIM tyrosines in 3DL1 or mutation of μ2, significantly diminished endocytosis and increased surface expression of 3DL1 in human primary NK cells and cell lines. Furthermore, we found that the 3DL1/AP-2 interaction is diminished upon antibody engagement with the receptor, as compared to untreated cells. Thus, we have identified AP-2-mediated endocytosis as a mechanism regulating the surface levels of inhibitory KIR though their ITIM domains. Based upon our results, we propose a model in which non-engaged KIR are internalized by this mechanism, whereas engagement with MHC-I ligand would diminish AP-2 binding, thereby prolonging stable receptor surface expression and promoting inhibitory function. Furthermore, this ITIM-mediated mechanism may similarly regulate the surface expression of other inhibitory immune receptors. PMID:25238755

  8. Metal oxide nanosensors using polymeric membranes, enzymes and antibody receptors as ion and molecular recognition elements.

    PubMed

    Willander, Magnus; Khun, Kimleang; Ibupoto, Zafar Hussain

    2014-05-16

    The concept of recognition and biofunctionality has attracted increasing interest in the fields of chemistry and material sciences. Advances in the field of nanotechnology for the synthesis of desired metal oxide nanostructures have provided a solid platform for the integration of nanoelectronic devices. These nanoelectronics-based devices have the ability to recognize molecular species of living organisms, and they have created the possibility for advanced chemical sensing functionalities with low limits of detection in the nanomolar range. In this review, various metal oxides, such as ZnO-, CuO-, and NiO-based nanosensors, are described using different methods (receptors) of functionalization for molecular and ion recognition. These functionalized metal oxide surfaces with a specific receptor involve either a complex formation between the receptor and the analyte or an electrostatic interaction during the chemical sensing of analytes. Metal oxide nanostructures are considered revolutionary nanomaterials that have a specific surface for the immobilization of biomolecules with much needed orientation, good conformation and enhanced biological activity which further improve the sensing properties of nanosensors. Metal oxide nanostructures are associated with certain unique optical, electrical and molecular characteristics in addition to unique functionalities and surface charge features which shows attractive platforms for interfacing biorecognition elements with effective transducing properties for signal amplification. There is a great opportunity in the near future for metal oxide nanostructure-based miniaturization and the development of engineering sensor devices.

  9. Identification and functional analysis of tomato BRI1 and BAK1 receptor kinase phosphorylation sites

    USDA-ARS?s Scientific Manuscript database

    Brassinosteroids (BRs) are essential plant hormones that are perceived at the cell surface by a membrane bound receptor kinase, BRASSINOSTEROID INSENSITIVE 1 (BRI1). BRI1 interacts with BRI1-ASSOCIATED RECEPTOR KINASE 1 (BAK1) to initiate a signal transduction pathway in which autophosphorylation an...

  10. Characterizing Spatial Organization of Cell Surface Receptors in Human Breast Cancer with STORM

    NASA Astrophysics Data System (ADS)

    Lyall, Evan; Chapman, Matthew R.; Sohn, Lydia L.

    2012-02-01

    Regulation and control of complex biological functions are dependent upon spatial organization of biological structures at many different length scales. For instance Eph receptors and their ephrin ligands bind when opposing cells come into contact during development, resulting in spatial organizational changes on the nanometer scale that lead to changes on the macro scale, in a process known as organ morphogenesis. One technique able to probe this important spatial organization at both the nanometer and micrometer length scales, including at cell-cell junctions, is stochastic optical reconstruction microscopy (STORM). STORM is a technique that localizes individual fluorophores based on the centroids of their point spread functions and then reconstructs a composite image to produce super resolved structure. We have applied STORM to study spatial organization of the cell surface of human breast cancer cells, specifically the organization of tyrosine kinase receptors and chemokine receptors. A better characterization of spatial organization of breast cancer cell surface proteins is necessary to fully understand the tumorigenisis pathways in the most common malignancy in United States women.

  11. Regulation of AMPA receptor localization in lipid rafts

    PubMed Central

    Hou, Qingming; Huang, Yunfei; Amato, Stephen; Snyder, Solomon H.; Huganir, Richard L.; Man, Heng-Ye

    2009-01-01

    Lipid rafts are special microdomains enriched in cholesterol, sphingolipids and certain proteins, and play important roles in a variety of cellular functions including signal transduction and protein trafficking. We report that in cultured cortical and hippocampal neurons the distribution of lipid rafts is development-dependent. Lipid rafts in mature neurons exist on the entire cell-surface and display a high degree of mobility. AMPA receptors co-localize and associate with lipid rafts in the plasma membrane. The association of AMPARs with rafts is under regulation; through the NOS–NO pathway, NMDA receptor activity increases AMPAR localization in rafts. During membrane targeting, AMPARs insert into or at close proximity of the surface raft domains. Perturbation of lipid rafts dramatically suppresses AMPA receptor exocytosis, resulting in significant reduction in AMPAR cell-surface expression. PMID:18411055

  12. Pathophysiological consequences of receptor mistraffic: Tales from the platelet P2Y12 receptor.

    PubMed

    Cunningham, Margaret R; Aungraheeta, Riyaad; Mundell, Stuart J

    2017-07-05

    Genetic variations in G protein-coupled receptor (GPCR) genes can disrupt receptor function in a wide variety of human genetic diseases, including platelet bleeding disorders. Platelets are critical for haemostasis with inappropriate platelet activation leading to the development of arterial thrombosis, which can result in heart attack and stroke whilst decreased platelet activity is associated with an increased risk of bleeding. GPCRs expressed on the surface of platelets play key roles in regulating platelet activity and therefore function. Receptors include purinergic receptors (P2Y 1 and P2Y 12 ), proteinase-activated receptor (PAR1 and PAR4) and thromboxane receptors (TPα), among others. Pharmacological blockade of these receptors forms a powerful therapeutic tool in the treatment and prevention of arterial thrombosis. With the advance of genomic technologies, there has been a substantial increase in the identification of naturally occurring rare and common GPCR variants. These variants include single-nucleotide polymorphisms (SNPs) and insertion or deletions that have the potential to alter GPCR expression or function. A number of defects in platelet GPCRs that disrupt receptor function have now been characterized in patients with mild bleeding disorders. This review will focus on rare, function-disrupting variants of platelet GPCRs with particular emphasis upon mutations in the P2Y 12 receptor gene that affect receptor traffic to modulate platelet function. Further this review will outline how the identification and characterization of function-disrupting GPCR mutations provides an essential link in translating our detailed understanding of receptor traffic and function in cell line studies into relevant human biological systems. Copyright © 2017. Published by Elsevier B.V.

  13. Rapid surface accumulation of NMDA receptors increases glutamatergic excitation during status epilepticus.

    PubMed

    Naylor, David E; Liu, Hantao; Niquet, Jerome; Wasterlain, Claude G

    2013-06-01

    After 1h of lithium-pilocarpine status epilepticus (SE), immunocytochemical labeling of NMDA receptor NR1 subunits reveals relocation of subunits from the interior to the cell surface of dentate gyrus granule cells and CA3 pyramidal cells. Simultaneously, an increase in NMDA-miniature excitatory postsynaptic currents (mEPSC) as well as an increase in NMDA receptor-mediated tonic currents is observed in hippocampal slices after SE. Mean-variance analysis of NMDA-mEPSCs estimates that the number of functional postsynaptic NMDA receptors per synapse increases 38% during SE, and antagonism by ifenprodil suggests that an increase in the surface representation of NR2B-containing NMDA receptors is responsible for the augmentation of both the phasic and tonic excitatory currents with SE. These results provide a potential mechanism for an enhancement of glutamatergic excitation that maintains SE and may contribute to excitotoxic injury during SE. Therapies that directly antagonize NMDA receptors may be a useful therapeutic strategy during refractory SE. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Rapid surface accumulation of NMDA receptors increases glutamatergic excitation during status epilepticus

    PubMed Central

    Naylor, David E.; Liu, Hantao; Niquet, Jerome; Wasterlain, Claude G.

    2017-01-01

    After 1 h of lithium-pilocarpine status epilepticus (SE), immunocytochemical labeling of NMDA receptor NR1 subunits reveals relocation of subunits from the interior to the cell surface of dentate gyrus granule cells and CA3 pyramidal cells. Simultaneously, an increase in NMDA-miniature excitatory postsynaptic currents (mEPSC) as well as an increase in NMDA receptor-mediated tonic currents is observed in hippocampal slices after SE. Mean-variance analysis of NMDA-mEPSCs estimates that the number of functional postsynaptic NMDA receptors per synapse increases 38% during SE, and antagonism by ifenprodil suggests that an increase in the surface representation of NR2B-containing NMDA receptors is responsible for the augmentation of both the phasic and tonic excitatory currents with SE. These results provide a potential mechanism for an enhancement of glutamatergic excitation that maintains SE and may contribute to excitotoxic injury during SE. Therapies that directly antagonize NMDA receptors may be a useful therapeutic strategy during refractory SE. PMID:23313318

  15. Early expression of triggering receptors and regulatory role of 2B4 in human natural killer cell precursors undergoing in vitro differentiation

    PubMed Central

    Sivori, Simona; Falco, Michela; Marcenaro, Emanuela; Parolini, Silvia; Biassoni, Roberto; Bottino, Cristina; Moretta, Lorenzo; Moretta, Alessandro

    2002-01-01

    In this study we analyzed the progression of cell surface receptor expression during the in vitro-induced human natural killer (NK) cell maturation from CD34+ Lin− cell precursors. NKp46 and NKp30, two major triggering receptors that play a central role in natural cytotoxicity, were expressed before the HLA class I-specific inhibitory receptors. Moreover, their appearance at the cell surface correlated with the acquisition of cytolytic activity by developing NK cells. Although the early expression of triggering receptors may provide activating signals required for inducing further cell differentiation, it may also affect the self-tolerance of developing NK cells. Our data show that a fail-safe mechanism preventing killing of normal autologous cells may be provided by the 2B4 surface molecule, which, at early stages of NK cell differentiation, functions as an inhibitory rather than as an activating receptor. PMID:11917118

  16. Biomimetic approaches to modulate cellular adhesion in biomaterials: A review.

    PubMed

    Rahmany, Maria B; Van Dyke, Mark

    2013-03-01

    Natural extracellular matrix (ECM) proteins possess critical biological characteristics that provide a platform for cellular adhesion and activation of highly regulated signaling pathways. However, ECM-based biomaterials can have several limitations, including poor mechanical properties and risk of immunogenicity. Synthetic biomaterials alleviate the risks associated with natural biomaterials but often lack the robust biological activity necessary to direct cell function beyond initial adhesion. A thorough understanding of receptor-mediated cellular adhesion to the ECM and subsequent signaling activation has facilitated development of techniques that functionalize inert biomaterials to provide a biologically active surface. Here we review a range of approaches used to modify biomaterial surfaces for optimal receptor-mediated cell interactions, as well as provide insights into specific mechanisms of downstream signaling activation. In addition to a brief overview of integrin receptor-mediated cell function, so-called "biomimetic" techniques reviewed here include (i) surface modification of biomaterials with bioadhesive ECM macromolecules or specific binding motifs, (ii) nanoscale patterning of the materials and (iii) the use of "natural-like" biomaterials. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  17. Differential effects of BDNF and neurotrophin 4 (NT4) on endocytic sorting of TrkB receptors.

    PubMed

    Proenca, Catia C; Song, Minseok; Lee, Francis S

    2016-08-01

    Neurotrophins are a family of growth factors playing key roles in the survival, development, and function of neurons. The neurotrophins brain-derived neurotrophic factor (BDNF) and NT4 both bind to and activate TrkB receptors, however, they mediate distinct neuronal functions. The molecular mechanism of how TrkB activation by BDNF and NT4 leads to diverse outcomes is unknown. Here, we report that BDNF and NT4 lead to differential endocytic sorting of TrkB receptors resulting in diverse biological functions in cultured cortical neurons. Fluorescent microscopy and surface biotinylation experiments showed that both neurotrophins stimulate internalization of TrkB with similar kinetics. Exposure to BDNF for 2-3 h reduced the surface pool of TrkB receptors to half, whereas a longer treatment (4-5 h) with NT4 was necessary to achieve a similar level of down-regulation. Although BDNF and NT4 induced TrkB phosphorylation with similar intensities, BDNF induced more rapid ubiquitination and degradation of TrkB than NT4. Interestingly, TrkB receptor ubiquitination by these ligands have substantially different pH sensitivities, resulting in varying degrees of receptor ubiquitination at lower pH levels. Consequently, NT4 was capable of maintaining longer sustained downstream signaling activation that correlated with reduced TrkB ubiquitination at endosomal pH. Thus, by leading to altered endocytic trafficking itineraries for TrkB receptors, BDNF and NT4 elicit differential TrkB signaling in terms of duration, intensity, and specificity, which may contribute to their functional differences in vivo. The neurotrophins, brain-derived neurotrophic factor (BDNF) and neurotrophin-4 (NT4), both bind to and activate TrkB receptors, however, they mediate distinct neuronal functions. Here, we propose that BDNF and NT4 lead to differential endocytic sorting of TrkB receptors resulting in diverse biological functions. BDNF induces more rapid ubiquitination and degradation of TrkB than NT4. Consequently, NT4 is capable of maintaining more sustained signaling downstream of TrkB receptors. © 2016 International Society for Neurochemistry.

  18. Function of OPG as a traffic regulator for RANKL is crucial for controlled osteoclastogenesis.

    PubMed

    Aoki, Shigeki; Honma, Masashi; Kariya, Yoshiaki; Nakamichi, Yuko; Ninomiya, Tadashi; Takahashi, Naoyuki; Udagawa, Nobuyuki; Suzuki, Hiroshi

    2010-09-01

    The amount of the receptor activator of NF-κB ligand (RANKL) on the osteoblastic cell surface is considered to determine the magnitude of the signal input to osteoclast precursors and the degree of osteoclastogenesis. Previously, we have shown that RANKL is localized predominantly in lysosomal organelles, but little is found on the osteoblastic cell surface, and consequently, the regulated subcellular trafficking of RANKL in osteoblastic cells is important for controlled osteoclastogenesis. Here we have examined the involvement of osteoprotegerin (OPG), which is currently recognized as a decoy receptor for RANKL, in the regulation of RANKL behavior. It was suggested that OPG already makes a complex with RANKL in the Golgi apparatus and that the complex formation is necessary for RANKL sorting to the secretory lysosomes. It was also shown that each structural domain of OPG is indispensable for exerting OPG function as a traffic regulator. In particular, the latter domains of OPG, whose physiologic functions have been unclear, were indicated to sort RANKL molecules to lysosomes from the Golgi apparatus. In addition, the overexpression of RANK-OPG chimeric protein, which retained OPG function as a decoy receptor but lost the function as a traffic regulator, inhibited endogenous OPG function as a traffic regulator selectively in osteoblastic cells and resulted in the upregulation of osteoclastogenic ability despite the increased number of decoy receptor molecules. Conclusively, OPG function as a traffic regulator for RANKL is crucial for regulating osteoclastogenesis at least as well as that as a decoy receptor. © 2010 American Society for Bone and Mineral Research.

  19. High throughput mutagenesis for identification of residues regulating human prostacyclin (hIP) receptor expression and function.

    PubMed

    Bill, Anke; Rosethorne, Elizabeth M; Kent, Toby C; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P; Renaud, Nicole A; Charlton, Steven J; Gosling, Martin; Gaither, L Alex; Groot-Kormelink, Paul J

    2014-01-01

    The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs.

  20. High Throughput Mutagenesis for Identification of Residues Regulating Human Prostacyclin (hIP) Receptor Expression and Function

    PubMed Central

    Kent, Toby C.; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T.; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P.; Renaud, Nicole A.; Charlton, Steven J.; Gosling, Martin; Gaither, L. Alex; Groot-Kormelink, Paul J.

    2014-01-01

    The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs. PMID:24886841

  1. Detection of p75NTR Trimers: Implications for Receptor Stoichiometry and Activation

    PubMed Central

    Barker, Phillip A.; Chao, Moses V.

    2015-01-01

    The p75 neurotrophin receptor (p75NTR) is a multifunctional receptor that participates in many critical processes in the nervous system, ranging from apoptosis to synaptic plasticity and morphological events. It is a member of the tumor necrosis factor receptor (TNFR) superfamily, whose members undergo trimeric oligomerization. Interestingly, p75NTR interacts with dimeric ligands (i.e., proneurotrophins or mature neurotrophins), but several of the intracellular adaptors that mediate p75NTR signaling are trimeric (i.e., TNFR-associated factor 6 or TRAF6). Consequently, the active receptor signaling unit remains uncertain. To identify the functional receptor complex, we evaluated its oligomerization in vitro and in mice brain tissues using a combination of biochemical techniques. We found that the most abundant homotypic arrangement for p75NTR is a trimer and that monomers and trimers coexist at the cell surface. Interestingly, trimers are not required for ligand-independent or ligand-dependent p75NTR activation in a growth cone retraction functional assay. However, monomers are capable of inducing acute morphological effects in neurons. We propose that p75NTR activation is regulated by its oligomerization status and its levels of expression. These results indicate that the oligomeric state of p75NTR confers differential responses and offers an explanation for the diverse and contradictory actions of this receptor in the nervous system. SIGNIFICANCE STATEMENT The p75 neurotrophin receptor (p75NTR) regulates a wide range of cellular functions, including apoptosis, neuronal processes remodeling, and synaptic plasticity. The goal of our work was to inquire whether oligomers of the receptor are required for function. Here we report that p75NTR predominantly assembles as a trimer, similar to other tumor necrosis factor receptors. Interestingly, monomers and trimers coexist at the cell surface, but trimers are not required for p75NTR activation in a functional assay. However, monomers are capable of inducing acute morphological effects in neurons. Identification of the oligomerization state of p75NTR begins to provide insights to the mechanisms of signal initiation of this noncatalytic receptor, as well as to develop therapeutic interventions to diminish its activity. PMID:26311773

  2. Detection of p75NTR Trimers: Implications for Receptor Stoichiometry and Activation.

    PubMed

    Anastasia, Agustin; Barker, Phillip A; Chao, Moses V; Hempstead, Barbara L

    2015-08-26

    The p75 neurotrophin receptor (p75(NTR)) is a multifunctional receptor that participates in many critical processes in the nervous system, ranging from apoptosis to synaptic plasticity and morphological events. It is a member of the tumor necrosis factor receptor (TNFR) superfamily, whose members undergo trimeric oligomerization. Interestingly, p75(NTR) interacts with dimeric ligands (i.e., proneurotrophins or mature neurotrophins), but several of the intracellular adaptors that mediate p75(NTR) signaling are trimeric (i.e., TNFR-associated factor 6 or TRAF6). Consequently, the active receptor signaling unit remains uncertain. To identify the functional receptor complex, we evaluated its oligomerization in vitro and in mice brain tissues using a combination of biochemical techniques. We found that the most abundant homotypic arrangement for p75(NTR) is a trimer and that monomers and trimers coexist at the cell surface. Interestingly, trimers are not required for ligand-independent or ligand-dependent p75(NTR) activation in a growth cone retraction functional assay. However, monomers are capable of inducing acute morphological effects in neurons. We propose that p75(NTR) activation is regulated by its oligomerization status and its levels of expression. These results indicate that the oligomeric state of p75(NTR) confers differential responses and offers an explanation for the diverse and contradictory actions of this receptor in the nervous system. The p75 neurotrophin receptor (p75(NTR)) regulates a wide range of cellular functions, including apoptosis, neuronal processes remodeling, and synaptic plasticity. The goal of our work was to inquire whether oligomers of the receptor are required for function. Here we report that p75(NTR) predominantly assembles as a trimer, similar to other tumor necrosis factor receptors. Interestingly, monomers and trimers coexist at the cell surface, but trimers are not required for p75(NTR) activation in a functional assay. However, monomers are capable of inducing acute morphological effects in neurons. Identification of the oligomerization state of p75(NTR) begins to provide insights to the mechanisms of signal initiation of this noncatalytic receptor, as well as to develop therapeutic interventions to diminish its activity. Copyright © 2015 the authors 0270-6474/15/3511911-10$15.00/0.

  3. Phospholipids as an alternative to direct covalent coupling: surface functionalization of nanoporous alumina for protein recognition and purification.

    PubMed

    Lazzara, Thomas D; Behn, Daniela; Kliesch, Torben-Tobias; Janshoff, Andreas; Steinem, Claudia

    2012-01-15

    Anodic aluminum oxide (AAO) substrates with aligned, cylindrical, non-intersecting pores with diameters of 75 nm and depths of 3.5 or 10 μm were functionalized with lipid monolayers harboring different receptor lipids. AAO was first functionalized with dodecyl-trichlorosilane, followed by fusion of small unilamellar vesicles (SUVs) forming a lipid monolayer. The SUVs' lipid composition was transferred onto the AAO surface, allowing us to control the surface receptor density. Owing to the optical transparency of the AAO, the overall vesicle spreading process and subsequent protein binding to the receptor-doped lipid monolayers could be investigated in situ by optical waveguide spectroscopy (OWS). SUV spreading occurred at the pore-rim interface, followed by lateral diffusion of lipids within the pore-interior surface until homogeneous coverage was achieved with a lipid monolayer. The functionality of the system was demonstrated through streptavidin binding onto a biotin-DOPE containing POPC membrane, showing maximum protein coverage at 10 mol% of biotin-DOPE. The system enabled us to monitor in real-time the selective extraction of two histidine-tagged proteins, PIGEA14 (14 kDa) and ezrin (70 kDa), directly from cell lysate solutions using a DOGS-NTA(Ni)/DOPC (1:9) membrane. The purification process including protein binding and elution was monitored by OWS and confirmed by SDS-PAGE. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. α-Helical element at the hormone-binding surface of the insulin receptor functions as a signaling element to activate its tyrosine kinase

    PubMed Central

    Whittaker, Jonathan; Whittaker, Linda J.; Roberts, Charles T.; Phillips, Nelson B.; Ismail-Beigi, Faramarz; Lawrence, Michael C.; Weiss, Michael A.

    2012-01-01

    The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo–cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation. PMID:22736795

  5. α-Helical element at the hormone-binding surface of the insulin receptor functions as a signaling element to activate its tyrosine kinase.

    PubMed

    Whittaker, Jonathan; Whittaker, Linda J; Roberts, Charles T; Phillips, Nelson B; Ismail-Beigi, Faramarz; Lawrence, Michael C; Weiss, Michael A

    2012-07-10

    The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo-cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation.

  6. Biotin-transfer from a trifunctional crosslinker for identification of cell surface receptors of soluble protein ligands

    PubMed Central

    Tremblay, Tammy-Lynn; Hill, Jennifer J.

    2017-01-01

    Here we describe a novel crosslinker and its application as a biotin-transfer reagent to identify cell surface receptors of soluble protein ligands on live cells. This crosslinker contains three functional groups: an aldehyde-reactive aminooxy group, a sulfhydryl, and a biotin (ASB). It is readily synthesized via a 3-step addition reaction using standard solid-phase peptide synthesis methods and commercially available intermediates, allowing access to laboratories without specialized synthetic chemistry capabilities. For the biotin-transfer method, ASB is linked to a protein ligand through the sulfhydryl group in a two-step process that allows the introduction of a disulfide bond between the ligand and the crosslinker. Incubation of the labelled ligand with oxidized live cells leads to the formation of crosslinks with aldehyde-containing glycans on the cell surface receptor. Subsequent reduction of the disulfide bond results in biotin transfer from the ligand to the cell surface receptor. Protein biotinylation that is mediated by ligand binding to its receptor is differentiated from background biotinylation events by comparison with a similarly labelled control protein using comparative proteomic mass spectrometry to quantify streptavidin-bound proteins. Using this method, we successfully identified the cell surface receptors of a peptide hormone, a monoclonal antibody, and a single-domain antibody-Fc fusion construct. PMID:28422167

  7. Differential expression of the P2X7 receptor in ovarian surface epithelium during the oestrous cycle in the mouse.

    PubMed

    Vázquez-Cuevas, F G; Cruz-Rico, A; Garay, E; García-Carrancá, A; Pérez-Montiel, D; Juárez, B; Arellano, R O

    2013-01-01

    Purinergic signalling has been proposed as an intraovarian regulatory mechanism. Of the receptors responsible for purinergic transmission, the P2X7 receptor is an ATP-gated cationic channel that displays a broad spectrum of cellular functions ranging from apoptosis to cell proliferation and tumourigenesis. In the present study, we investigated the functional expression of P2X7 receptors in ovarian surface epithelium (OSE). P2X7 protein was detected in the OSE layer of the mouse, both in situ and in primary cultures. In cultures, 2'(3')-O-(4-Benzoylbenzoyl)adenosine-5'-triphosphate (BzATP) activation of P2X7 receptors increased [Ca(2+)]i and induced apoptosis. The functionality of the P2X7 receptor was investigated in situ by intrabursal injection of BzATP on each day of the oestrous cycle and evaluation of apoptosis 24h using the terminal deoxyribonucleotidyl transferase-mediated dUTP-fluorescein nick end-labelling (TUNEL) assay. Maximum effects of BzATP were observed during pro-oestrus, with the effects being blocked by A438079, a specific P2X7 receptor antagonist. Immunofluorescence staining for P2X7 protein revealed more robust expression during pro-oestrus and in OSE regions behind the antral follicles, strongly supporting the notion that the differences in apoptosis can be explained by increased receptor expression, which is regulated during the oestrous cycle. Finally, P2X7 receptor expression was detected in the OSE layer of human ovaries, with receptor expression maintained in human ovaries diagnosed with cancer, as well as in the human ovarian carcinoma SKOV3 cell line.

  8. Functional rescue of the constitutively internalized V2 vasopressin receptor mutant R137H by the pharmacological chaperone action of SR49059.

    PubMed

    Bernier, Virginie; Lagacé, Monique; Lonergan, Michèle; Arthus, Marie-Françoise; Bichet, Daniel G; Bouvier, Michel

    2004-08-01

    In most cases, nephrogenic diabetes insipidus results from mutations in the V2 vasopressin receptor (V2R) gene that cause intracellular retention of improperly folded receptors. We previously reported that cell permeable V2R antagonists act as pharmacological chaperones that rescue folding, trafficking, and function of several V2R mutants. More recently, the vasopressin antagonist, SR49059, was found to be therapeutically active in nephrogenic diabetes insipidus patients. Three of the patients with positive responses harbored the mutation R137H, previously reported to lead to constitutive endocytosis. This raises the possibility that, instead of acting as a pharmacological chaperone by favoring proper maturation of the receptors, SR49059 could mediate its action on R137H V2R by preventing its endocytosis. Here we report that the beta-arrestin-mediated constitutive endocytosis of R137H V2R is not affected by SR49059, indicating that the functional rescue observed does not result from a stabilization of the receptor at the cell surface. Moreover, metabolic labeling revealed that R137H V2R is also poorly processed to the mature form. SR49059 treatment significantly improved its maturation and cell surface targeting, indicating that the functional rescue of R137H V2Rs results from the pharmacological chaperone action of the antagonist.

  9. Metal Oxide Nanosensors Using Polymeric Membranes, Enzymes and Antibody Receptors as Ion and Molecular Recognition Elements

    PubMed Central

    Willander, Magnus; Khun, Kimleang; Ibupoto, Zafar Hussain

    2014-01-01

    The concept of recognition and biofunctionality has attracted increasing interest in the fields of chemistry and material sciences. Advances in the field of nanotechnology for the synthesis of desired metal oxide nanostructures have provided a solid platform for the integration of nanoelectronic devices. These nanoelectronics-based devices have the ability to recognize molecular species of living organisms, and they have created the possibility for advanced chemical sensing functionalities with low limits of detection in the nanomolar range. In this review, various metal oxides, such as ZnO-, CuO-, and NiO-based nanosensors, are described using different methods (receptors) of functionalization for molecular and ion recognition. These functionalized metal oxide surfaces with a specific receptor involve either a complex formation between the receptor and the analyte or an electrostatic interaction during the chemical sensing of analytes. Metal oxide nanostructures are considered revolutionary nanomaterials that have a specific surface for the immobilization of biomolecules with much needed orientation, good conformation and enhanced biological activity which further improve the sensing properties of nanosensors. Metal oxide nanostructures are associated with certain unique optical, electrical and molecular characteristics in addition to unique functionalities and surface charge features which shows attractive platforms for interfacing biorecognition elements with effective transducing properties for signal amplification. There is a great opportunity in the near future for metal oxide nanostructure-based miniaturization and the development of engineering sensor devices. PMID:24841244

  10. Opioid Receptor Function Is Regulated by Post-endocytic Peptide Processing*

    PubMed Central

    Gupta, Achla; Gomes, Ivone; Wardman, Jonathan; Devi, Lakshmi A.

    2014-01-01

    Most neuroendocrine peptides are generated in the secretory compartment by proteolysis of the precursors at classical cleavage sites consisting of basic residues by well studied endopeptidases belonging to the subtilisin superfamily. In contrast, a subset of bioactive peptides is generated by processing at non-classical cleavage sites that do not contain basic residues. Neither the peptidases responsible for non-classical cleavages nor the compartment involved in such processing has been well established. Members of the endothelin-converting enzyme (ECE) family are considered good candidate enzymes because they exhibit functional properties that are consistent with such a role. In this study we have explored a role for ECE2 in endocytic processing of δ opioid peptides and its effect on modulating δ opioid receptor function by using selective inhibitors of ECE2 that we had identified previously by homology modeling and virtual screening of a library of small molecules. We found that agonist treatment led to intracellular co-localization of ECE2 with δ opioid receptors. Furthermore, selective inhibitors of ECE2 and reagents that increase the pH of the acidic compartment impaired receptor recycling by protecting the endocytosed peptide from degradation. This, in turn, led to a substantial decrease in surface receptor signaling. Finally, we showed that treatment of primary neurons with the ECE2 inhibitor during recycling led to increased intracellular co-localization of the receptors and ECE2, which in turn led to decreased receptor recycling and signaling by the surface receptors. Together, these results support a role for differential modulation of opioid receptor signaling by post-endocytic processing of peptide agonists by ECE2. PMID:24847082

  11. Receptor density balances signal stimulation and attenuation in membrane-assembled complexes of bacterial chemotaxis signaling proteins

    PubMed Central

    Besschetnova, Tatiana Y.; Montefusco, David J.; Asinas, Abdalin E.; Shrout, Anthony L.; Antommattei, Frances M.; Weis, Robert M.

    2008-01-01

    All cells possess transmembrane signaling systems that function in the environment of the lipid bilayer. In the Escherichia coli chemotaxis pathway, the binding of attractants to a two-dimensional array of receptors and signaling proteins simultaneously inhibits an associated kinase and stimulates receptor methylation—a slower process that restores kinase activity. These two opposing effects lead to robust adaptation toward stimuli through a physical mechanism that is not understood. Here, we provide evidence of a counterbalancing influence exerted by receptor density on kinase stimulation and receptor methylation. Receptor signaling complexes were reconstituted over a range of defined surface concentrations by using a template-directed assembly method, and the kinase and receptor methylation activities were measured. Kinase activity and methylation rates were both found to vary significantly with surface concentration—yet in opposite ways: samples prepared at high surface densities stimulated kinase activity more effectively than low-density samples, whereas lower surface densities produced greater methylation rates than higher densities. FRET experiments demonstrated that the cooperative change in kinase activity coincided with a change in the arrangement of the membrane-associated receptor domains. The counterbalancing influence of density on receptor methylation and kinase stimulation leads naturally to a model for signal regulation that is compatible with the known logic of the E. coli pathway. Density-dependent mechanisms are likely to be general and may operate when two or more membrane-related processes are influenced differently by the two-dimensional concentration of pathway elements. PMID:18711126

  12. The deubiquitinases USP33 and USP20 coordinate beta2 adrenergic receptor recycling and resensitization.

    PubMed

    Berthouze, Magali; Venkataramanan, Vidya; Li, Yi; Shenoy, Sudha K

    2009-06-17

    Agonist-induced ubiquitination of the beta(2) adrenergic receptor (beta(2)AR) functions as an important post-translational modification to sort internalized receptors to the lysosomes for degradation. We now show that this ubiquitination is reversed by two deubiquitinating enzymes, ubiquitin-specific proteases (USPs) 20 and 33, thus, inhibiting lysosomal trafficking when concomitantly promoting receptor recycling from the late-endosomal compartments as well as resensitization of recycled receptors at the cell surface. Dissociation of constitutively bound endogenously expressed USPs 20 and 33 from the beta(2)AR immediately after agonist stimulation and reassociation on prolonged agonist treatment allows receptors to first become ubiquitinated and then deubiquitinated, thus, providing a 'trip switch' between degradative and recycling pathways at the late-endosomal compartments. Thus, USPs 20 and 33 serve as novel regulators that dictate both post-endocytic sorting as well as the intensity and extent of beta(2)AR signalling from the cell surface.

  13. Unconventional secretory processing diversifies neuronal ion channel properties

    PubMed Central

    Hanus, Cyril; Geptin, Helene; Tushev, Georgi; Garg, Sakshi; Alvarez-Castelao, Beatriz; Sambandan, Sivakumar; Kochen, Lisa; Hafner, Anne-Sophie; Langer, Julian D; Schuman, Erin M

    2016-01-01

    N-glycosylation – the sequential addition of complex sugars to adhesion proteins, neurotransmitter receptors, ion channels and secreted trophic factors as they progress through the endoplasmic reticulum and the Golgi apparatus – is one of the most frequent protein modifications. In mammals, most organ-specific N-glycosylation events occur in the brain. Yet, little is known about the nature, function and regulation of N-glycosylation in neurons. Using imaging, quantitative immunoblotting and mass spectrometry, we show that hundreds of neuronal surface membrane proteins are core-glycosylated, resulting in the neuronal membrane displaying surprisingly high levels of glycosylation profiles that are classically associated with immature intracellular proteins. We report that while N-glycosylation is generally required for dendritic development and glutamate receptor surface expression, core-glycosylated proteins are sufficient to sustain these processes, and are thus functional. This atypical glycosylation of surface neuronal proteins can be attributed to a bypass or a hypo-function of the Golgi apparatus. Core-glycosylation is regulated by synaptic activity, modulates synaptic signaling and accelerates the turnover of GluA2-containing glutamate receptors, revealing a novel mechanism that controls the composition and sensing properties of the neuronal membrane. DOI: http://dx.doi.org/10.7554/eLife.20609.001 PMID:27677849

  14. Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

    2008-04-11

    Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

  15. Distinct Conformations of Ly49 Natural Killer Cell Receptors Mediate MHC Class I Recognition in Trans and Cis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Back, J.; Malchiodi, E; Cho, S

    2009-01-01

    Certain cell-surface receptors engage ligands expressed on juxtaposed cells and ligands on the same cell. The structural basis for trans versus cis binding is not known. Here, we showed that Ly49 natural killer (NK) cell receptors bound two MHC class I (MHC-I) molecules in trans when the two ligand-binding domains were backfolded onto the long stalk region. In contrast, dissociation of the ligand-binding domains from the stalk and their reorientation relative to the NK cell membrane allowed monovalent binding of MHC-I in cis. The distinct conformations (backfolded and extended) define the structural basis for cis-trans binding by Ly49 receptors andmore » explain the divergent functional consequences of cis versus trans interactions. Further analyses identified specific stalk segments that were not required for MHC-I binding in trans but were essential for inhibitory receptor function. These data identify multiple distinct roles of stalk regions for receptor function.« less

  16. Elucidating the Functional Roles of Spatial Organization in Cross-Membrane Signal Transduction by a Hybrid Simulation Method.

    PubMed

    Chen, Jiawen; Xie, Zhong-Ru; Wu, Yinghao

    2016-07-01

    The ligand-binding of membrane receptors on cell surfaces initiates the dynamic process of cross-membrane signal transduction. It is an indispensable part of the signaling network for cells to communicate with external environments. Recent experiments revealed that molecular components in signal transduction are not randomly mixed, but spatially organized into distinctive patterns. These patterns, such as receptor clustering and ligand oligomerization, lead to very different gene expression profiles. However, little is understood about the molecular mechanisms and functional impacts of this spatial-temporal regulation in cross-membrane signal transduction. In order to tackle this problem, we developed a hybrid computational method that decomposes a model of signaling network into two simulation modules. The physical process of binding between receptors and ligands on cell surfaces are simulated by a diffusion-reaction algorithm, while the downstream biochemical reactions are modeled by stochastic simulation of Gillespie algorithm. These two processes are coupled together by a synchronization framework. Using this method, we tested the dynamics of a simple signaling network in which the ligand binding of cell surface receptors triggers the phosphorylation of protein kinases, and in turn regulates the expression of target genes. We found that spatial aggregation of membrane receptors at cellular interfaces is able to either amplify or inhibit downstream signaling outputs, depending on the details of clustering mechanism. Moreover, by providing higher binding avidity, the co-localization of ligands into multi-valence complex modulates signaling in very different ways that are closely related to the binding affinity between ligand and receptor. We also found that the temporal oscillation of the signaling pathway that is derived from genetic feedback loops can be modified by the spatial clustering of membrane receptors. In summary, our method demonstrates the functional importance of spatial organization in cross-membrane signal transduction. The method can be applied to any specific signaling pathway in cells.

  17. Phospho-selective mechanisms of arrestin conformations and functions revealed by unnatural amino acid incorporation and 19F-NMR

    PubMed Central

    Yang, Fan; Yu, Xiao; Liu, Chuan; Qu, Chang-Xiu; Gong, Zheng; Liu, Hong-Da; Li, Fa-Hui; Wang, Hong-Mei; He, Dong-Fang; Yi, Fan; Song, Chen; Tian, Chang-Lin; Xiao, Kun-Hong; Wang, Jiang-Yun; Sun, Jin-Peng

    2015-01-01

    Specific arrestin conformations are coupled to distinct downstream effectors, which underlie the functions of many G-protein-coupled receptors (GPCRs). Here, using unnatural amino acid incorporation and fluorine-19 nuclear magnetic resonance (19F-NMR) spectroscopy, we demonstrate that distinct receptor phospho-barcodes are translated to specific β-arrestin-1 conformations and direct selective signalling. With its phosphate-binding concave surface, β-arrestin-1 ‘reads' the message in the receptor phospho-C-tails and distinct phospho-interaction patterns are revealed by 19F-NMR. Whereas all functional phosphopeptides interact with a common phosphate binding site and induce the movements of finger and middle loops, different phospho-interaction patterns induce distinct structural states of β-arrestin-1 that are coupled to distinct arrestin functions. Only clathrin recognizes and stabilizes GRK2-specific β-arrestin-1 conformations. The identified receptor-phospho-selective mechanism for arrestin conformation and the spacing of the multiple phosphate-binding sites in the arrestin enable arrestin to recognize plethora phosphorylation states of numerous GPCRs, contributing to the functional diversity of receptors. PMID:26347956

  18. Macrophage Biochemistry, Activation and Function

    DTIC Science & Technology

    1981-01-01

    vacuolar apparatus become more abundant. Functional capabilities, including phagocytic activity, protein synthesis and surface receptors, also increase...properties of cell components of other tissues has led to the following assignment of marker enzymes to specific macrophage components. This assessment is...subfractions. The surface area of each histogram bar then gives the frac- tional amount of constituent present within each normalized fraction. Distribution

  19. Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

    DTIC Science & Technology

    2002-01-01

    the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

  20. Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.

    G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the nativemore » ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.« less

  1. Identification of Novel 14-3-3 Residues That Are Critical for Isoform-specific Interaction with GluN2C to Regulate N-Methyl-d-aspartate (NMDA) Receptor Trafficking*

    PubMed Central

    Chung, Connie; Wu, Wei-Hua; Chen, Bo-Shiun

    2015-01-01

    The 14-3-3 family of proteins is widely distributed in the CNS where they are major regulators of essential neuronal functions. There are seven known mammalian 14-3-3 isoforms (ζ,, τ, ϵ, η, β, and σ), which generally function as adaptor proteins. Previously, we have demonstrated that 14-3-3ϵ isoform dynamically regulates forward trafficking of GluN2C-containing NMDA receptors (NMDARs) in cerebellar granule neurons, that when expressed on the surface, promotes neuronal survival following NMDA-induced excitotoxicity. Here, we report 14-3-3 isoform-specific binding and functional regulation of GluN2C. In particular, we show that GluN2C C-terminal domain (CTD) binds to all 14-3-3 isoforms except 14-3-3σ, and binding is dependent on GluN2C serine 1096 phosphorylation. Co-expression of 14-3-3 (ζ and ϵ) and GluN1/GluN2C promotes the forward delivery of receptors to the cell surface. We further identify novel residues serine 145, tyrosine 178, and cysteine 189 on α-helices 6, 7, and 8, respectively, within ζ-isoform as part of the GluN2C binding motif and independent of the canonical peptide binding groove. Mutation of these conserved residues abolishes GluN2C binding and has no functional effect on GluN2C trafficking. Reciprocal mutation of alanine 145, histidine 180, and isoleucine 191 on 14-3-3σ isoform promotes GluN2C binding and surface expression. Moreover, inhibiting endogenous 14-3-3 using a high-affinity peptide inhibitor, difopein, greatly diminishes GluN2C surface expression. Together, these findings highlight the isoform-specific structural and functional differences within the 14-3-3 family of proteins, which determine GluN2C binding and its essential role in targeting the receptor to the cell surface to facilitate glutamatergic neurotransmission. PMID:26229101

  2. Virions at the gates: receptors and the host-virus arms race.

    PubMed

    Coffin, John M

    2013-01-01

    All viruses need to bind to specific receptor molecules on the surface of target cells to initiate infection. Virus-receptor binding is highly specific, and this specificity determines both the species and the cell type that can be infected by a given virus. In some well-studied cases, the virus-binding region on the receptor has been found to be unrelated to the receptor's normal cellular function. Resistance to virus infection can thus evolve by selection of mutations that alter amino acids in the binding region with minimal effect on normal function. This sort of positive selection can be used to infer the history of the host-virus "arms race" during their coevolution. In a new study, Demogines et al. use a combination of phylogenetic, structural, and virological analysis to infer the history and significance of positive selection on the transferrin receptor TfR1, a housekeeping protein required for iron uptake and the cell surface receptor for at least three different types of virus. The authors show that only two parts of the rodent TfR1 molecule have been subject to positive selection and that these correspond to the binding sites for two of these viruses-the mouse mammary tumor virus (a retrovirus) and Machupo virus (an arenavirus). They confirmed this result by introducing the inferred binding site mutations into the wild-type protein and testing for receptor function. Related arenaviruses are beginning to spread in human populations in South America as the cause of often fatal hemorrhagic fevers, and, although Demogines et al. could find no evidence of TfR1 mutations in this region that might have been selected as a consequence of human infection, the authors identified one such mutation in Asian populations that affects infection with these viruses.

  3. Contribution of extracellular ATP on the cell-surface F1F0-ATP synthase-mediated intracellular triacylglycerol accumulation.

    PubMed

    Kita, Toshiyuki; Arakaki, Naokatu

    2015-01-01

    Cell-surface F1F0-ATP synthase was involved in the cell signaling mediating various biological functions. Recently, we found that cell-surface F1F0-ATP synthase plays a role on intracellular triacylglycerol accumulation in adipocytes, and yet, the underlying mechanisms remained largely unknown. In this study, we investigated the role of extracellular ATP on the intracellular triacylglycerol accumulation. We demonstrated that significant amounts of ATP were produced extracellularly by cultured 3T3-L1 adipocytes and that the antibodies against α and β subunits of F1F0-ATP synthase inhibited the extracellular ATP production. Piceatannol, a F1F0-ATP synthase inhibitor, and apyrase, an enzyme which degrades extracellular ATP, suppressed triacylglycerol accumulation. The selective P2Y1 receptor antagonist MRS2500 significantly inhibited triacylglycerol accumulation, whereas the selective P2X receptor antagonist NF279 has less effect. The present results indicate that cell-surface F1F0-ATP synthase on adipocytes is functional in extracellular ATP production and that the extracellular ATP produced contributes, at least in part, to the cell-surface F1F0-ATP synthase-mediated intracellular triacylglycerol accumulation in adipocytes through P2Y1 receptor.

  4. The Macrophage Galactose-Type Lectin Can Function as an Attachment and Entry Receptor for Influenza Virus

    PubMed Central

    Ng, Wy Ching; Liong, Stella; Tate, Michelle D.; Irimura, Tatsuro; Denda-Nagai, Kaori; Brooks, Andrew G.; Londrigan, Sarah L.

    2014-01-01

    Specific protein receptors that mediate internalization and entry of influenza A virus (IAV) have not been identified for any cell type. Sialic acid (SIA), the primary attachment factor for IAV hemagglutinin, is expressed by numerous cell surface glycoproteins and glycolipids, confounding efforts to identify specific receptors involved in virus infection. Lec1 Chinese hamster ovary (CHO) epithelial cells express cell surface SIA and bind IAV yet are largely resistant to infection. Here, we demonstrate that expression of the murine macrophage galactose-type lectin 1 (MGL1) by Lec1 cells enhanced Ca2+-dependent IAV binding and restored permissivity to infection. Lec1 cells expressing MGL1 were infected in the presence or absence of cell surface SIA, indicating that MGL1 can act as a primary receptor or as a coreceptor with SIA. Lec1 cells expressing endocytosis-deficient MGL1 mediated Ca2+-dependent IAV binding but were less sensitive to IAV infection, indicating that direct internalization via MGL1 can result in cellular infection. Together, these studies identify MGL1 as a cell surface glycoprotein that can act as an authentic receptor for both attachment and infectious entry of IAV. PMID:24257596

  5. How chimeric antigen receptor design affects adoptive T cell therapy

    PubMed Central

    Gacerez, Albert T.; Arellano, Benjamine; Sentman, Charles L.

    2016-01-01

    Chimeric antigen receptor (CAR) T cells have been developed to treat tumors and have shown great success against B cell malignancies. Exploiting modular designs and swappable domains, CARs can target an array of cell surface antigens and, upon receptor-ligand interactions, direct signaling cascades, thereby driving T cell effector functions. CARs have been designed using receptors, ligands, or scFv binding domains. Different regions of a CAR have each been found to play a role in determining the overall efficacy of CAR T cells. Therefore, this review provides an overview of CAR construction and common designs. Each CAR region is discussed in the context of its importance to a CAR’s function. Additionally, the review explores how various engineering strategies have been applied to CAR T cells in order to regulate CAR T cell function and activity. PMID:27163336

  6. Agonist-dependent consequences of proline to alanine substitution in the transmembrane helices of the calcitonin receptor

    PubMed Central

    Bailey, R J; Hay, D L

    2007-01-01

    Background and purpose: Transmembrane proline (P) residues in family A G protein-coupled receptors (GPCRs) form functionally important kinks in their helices. These residues are little studied in family B GPCRs but experiments with the VPAC1 receptor and calcitonin receptor-like receptor (CL) show parallels with family A receptors. We sought to determine the function of these residues in the insert negative form of the human calcitonin receptor, a close relative of CL. Experimental approach: Proline residues within the transmembrane domains of the calcitonin receptor (P246, P249, P280, P326, P336) were individually mutated to alanine (A) using site-directed mutagenesis. Receptors were transiently transfected into Cos-7 cells using polyethylenimine and salmon and human calcitonin-induced cAMP responses measured. Salmon and human calcitonin competition binding experiments were also performed and receptor cell-surface expression assessed by whole cell ELISA. Key results: P246A, P249A and P280A were wild-type in terms of human calcitonin-induced cAMP activation. P326A and P336A had reduced function (165 and 12-fold, respectively). In membranes, human calcitonin binding was not detectable for any mutant receptor but in whole cells, binding was detected for all mutants apart from P326A. Salmon calcitonin activated mutant and wild-type receptors equally, although Bmax values were reduced for all mutants apart from P326A. Conclusions and Implications: P326 and P336 are important for the function of human calcitonin receptors and are likely to be involved in generating receptor conformations appropriate for agonist binding and receptor activation. However, agonist-specific effects were observed , implying distinct conformations of the human calcitonin receptor. PMID:17486143

  7. Specific olfactory receptor populations projecting to identified glomeruli in the rat olfactory bulb.

    PubMed

    Jastreboff, P J; Pedersen, P E; Greer, C A; Stewart, W B; Kauer, J S; Benson, T E; Shepherd, G M

    1984-08-01

    A critical gap exists in our knowledge of the topographical relationship between the olfactory epithelium and olfactory bulb. The present report describes the application to this problem of a method involving horseradish peroxidase conjugated to wheat germ agglutinin. This material was iontophoretically delivered to circumscribed glomeruli in the olfactory bulb and the characteristics and distribution of retrogradely labeled receptor cells were assessed. After discrete injections into small glomerular groups in the caudomedial bulb, topographically defined populations of receptor cells were labeled. Labeled receptor cell somata appeared at several levels within the epithelium. The receptor cell apical dendrites followed a tight helical course towards the surface of the epithelium. The data thus far demonstrate that functional units within the olfactory system may include not only glomeruli as previously suggested but, in addition, a corresponding matrix of receptor cells possessing functional and topographical specificity.

  8. Specific olfactory receptor populations projecting to identified glomeruli in the rat olfactory bulb.

    PubMed Central

    Jastreboff, P J; Pedersen, P E; Greer, C A; Stewart, W B; Kauer, J S; Benson, T E; Shepherd, G M

    1984-01-01

    A critical gap exists in our knowledge of the topographical relationship between the olfactory epithelium and olfactory bulb. The present report describes the application to this problem of a method involving horseradish peroxidase conjugated to wheat germ agglutinin. This material was iontophoretically delivered to circumscribed glomeruli in the olfactory bulb and the characteristics and distribution of retrogradely labeled receptor cells were assessed. After discrete injections into small glomerular groups in the caudomedial bulb, topographically defined populations of receptor cells were labeled. Labeled receptor cell somata appeared at several levels within the epithelium. The receptor cell apical dendrites followed a tight helical course towards the surface of the epithelium. The data thus far demonstrate that functional units within the olfactory system may include not only glomeruli as previously suggested but, in addition, a corresponding matrix of receptor cells possessing functional and topographical specificity. Images PMID:6206495

  9. The effect of aspartate-lysine-isoleucine and aspartate-arginine-tyrosine mutations on the expression and activity of vasopressin V2 receptor gene.

    PubMed

    Najafzadeh, Hossein; Safaeian, Leila; Mirmohammad Sadeghi, Hamid; Rabbani, Mohammad; Jafarian, Abbas

    2010-01-01

    Vasopressin type 2 receptor (V2R) plays an important role in the water reabsorption in the kidney collecting ducts. V2R is a G protein coupled receptor (GPCR) and the triplet of amino acids aspartate-arginine-histidine (DRH) in this receptor might significantly influence its activity similar to other GPCR. However, the role of this motif has not been fully confirmed. Therefore, the present study attempted to shed some more light on the role of DRH motif in G protein coupling and V2R function with the use of site-directed mutagenesis. Nested PCR using specific primers was used to produce DNA fragments containing aspartate-lysine-isoleucine and aspartate-arginine-tyrosine mutations with replacements of the arginine to lysine and histidine to tyrosine, respectively. After digestion, these inserts were ligated into the pcDNA3 vector and transformation into E. coli HB101 was performed using heat shock method. The obtained colonies were analyzed for the presence and orientation of the inserts using proper restriction enzymes. After transient transfection of COS-7 cells using diethylaminoethyl-dextran method, the adenylyl cyclase activity assay was performed for functional study. The cell surface expression was analyzed by indirect ELISA method. The functional assay indicated that none of these mutations significantly altered cAMP production and cell surface expression of V2R in these cells. Since some substitutions in arginine residue have shown to lead to the inactive V2 receptor, further studies are required to define the role of this residue more precisely. However, it seems that the role of the histidine residue is not critical in the V2 receptor function.

  10. Rapid Steroid Hormone Actions Initiated at the Cell Surface and the Receptors that Mediate Them with an Emphasis on Recent Progress in Fish Models

    PubMed Central

    Thomas, Peter

    2011-01-01

    In addition to the classic genomic mechanism of steroid action mediated by activation of intracellular nuclear receptors, there is now extensive evidence that steroids also activate receptors on the cell surface to initiate rapid intracellular signaling and biological responses that are often nongenomic. Recent progress in our understanding of rapid, cell surface-initiated actions of estrogens, progestins, androgens and corticosteroids and the identities of the membrane receptors that act as their intermediaries is briefly reviewed with a special emphasis on studies in teleost fish. Two recently discovered novel proteins with seven-transmembrane domains, G protein-coupled receptor 30 (GPR30), and membrane progestin receptors (mPRs) have the ligand binding and signaling characteristics of estrogen and progestin membrane receptors, respectively, but their functional significance is disputed by some researchers. GPR30 is expressed on the cell surface of fish oocytes and mediates estrogen inhibition of oocyte maturation. mPRα is also expressed on the oocyte cell surface and is the intermediary in progestin induction of oocyte maturation in fish. Recent results suggest there is cross-talk between these two hormonal pathways and that there is reciprocal down-regulation of GPR30 and mPRα expression by estrogens and progestins at different phases of oocyte development to regulate the onset of oocyte maturation. There is also evidence in fish that mPRs are involved in progestin induction of sperm hypermotility and anti-apoptotic actions in ovarian follicle cells. Nonclassical androgen and corticosteroid actions have also been described in fish models but the membrane receptors mediating these actions have not been identified. PMID:22154643

  11. Role of Receptor Activity Modifying Protein 1 in Function of the Calcium Sensing Receptor in the Human TT Thyroid Carcinoma Cell Line

    PubMed Central

    Desai, Aditya J.; Roberts, David J.

    2014-01-01

    The Calcium Sensing Receptor (CaSR) plays a role in calcium homeostasis by sensing minute changes in serum Ca2+ and modulating secretion of calciotropic hormones. It has been shown in transfected cells that accessory proteins known as Receptor Activity Modifying Proteins (RAMPs), specifically RAMPs 1 and 3, are required for cell-surface trafficking of the CaSR. These effects have only been demonstrated in transfected cells, so their physiological relevance is unclear. Here we explored CaSR/RAMP interactions in detail, and showed that in thyroid human carcinoma cells, RAMP1 is required for trafficking of the CaSR. Furthermore, we show that normal RAMP1 function is required for intracellular responses to ligands. Specifically, to confirm earlier studies with tagged constructs, and to provide the additional benefit of quantitative stoichiometric analysis, we used fluorescence resonance energy transfer to show equal abilities of RAMP1 and 3 to chaperone CaSR to the cell surface, though RAMP3 interacted more efficiently with the receptor. Furthermore, a higher fraction of RAMP3 than RAMP1 was observed in CaSR-complexes on the cell-surface, suggesting different ratios of RAMPs to CaSR. In order to determine relevance of these findings in an endogenous expression system we assessed the effect of RAMP1 siRNA knock-down in medullary thyroid carcinoma TT cells, (which express RAMP1, but not RAMP3 constitutively) and measured a significant 50% attenuation of signalling in response to CaSR ligands Cinacalcet and neomycin. Blockade of RAMP1 using specific antibodies induced a concentration-dependent reduction in CaSR-mediated signalling in response to Cinacalcet in TT cells, suggesting a novel functional role for RAMP1 in regulation of CaSR signalling in addition to its known role in receptor trafficking. These data provide evidence that RAMPs traffic the CaSR as higher-level oligomers and play a role in CaSR signalling even after cell surface localisation has occurred. PMID:24454825

  12. Role of receptor activity modifying protein 1 in function of the calcium sensing receptor in the human TT thyroid carcinoma cell line.

    PubMed

    Desai, Aditya J; Roberts, David J; Richards, Gareth O; Skerry, Timothy M

    2014-01-01

    The Calcium Sensing Receptor (CaSR) plays a role in calcium homeostasis by sensing minute changes in serum Ca(2+) and modulating secretion of calciotropic hormones. It has been shown in transfected cells that accessory proteins known as Receptor Activity Modifying Proteins (RAMPs), specifically RAMPs 1 and 3, are required for cell-surface trafficking of the CaSR. These effects have only been demonstrated in transfected cells, so their physiological relevance is unclear. Here we explored CaSR/RAMP interactions in detail, and showed that in thyroid human carcinoma cells, RAMP1 is required for trafficking of the CaSR. Furthermore, we show that normal RAMP1 function is required for intracellular responses to ligands. Specifically, to confirm earlier studies with tagged constructs, and to provide the additional benefit of quantitative stoichiometric analysis, we used fluorescence resonance energy transfer to show equal abilities of RAMP1 and 3 to chaperone CaSR to the cell surface, though RAMP3 interacted more efficiently with the receptor. Furthermore, a higher fraction of RAMP3 than RAMP1 was observed in CaSR-complexes on the cell-surface, suggesting different ratios of RAMPs to CaSR. In order to determine relevance of these findings in an endogenous expression system we assessed the effect of RAMP1 siRNA knock-down in medullary thyroid carcinoma TT cells, (which express RAMP1, but not RAMP3 constitutively) and measured a significant 50% attenuation of signalling in response to CaSR ligands Cinacalcet and neomycin. Blockade of RAMP1 using specific antibodies induced a concentration-dependent reduction in CaSR-mediated signalling in response to Cinacalcet in TT cells, suggesting a novel functional role for RAMP1 in regulation of CaSR signalling in addition to its known role in receptor trafficking. These data provide evidence that RAMPs traffic the CaSR as higher-level oligomers and play a role in CaSR signalling even after cell surface localisation has occurred.

  13. Reciprocal regulation of two G protein-coupled receptors sensing extracellular concentrations of Ca2+ and H+

    PubMed Central

    Wei, Wei-Chun; Jacobs, Benjamin; Becker, Esther B. E.; Glitsch, Maike D.

    2015-01-01

    G protein-coupled receptors (GPCRs) are cell surface receptors that detect a wide range of extracellular messengers and convey this information to the inside of cells. Extracellular calcium-sensing receptor (CaSR) and ovarian cancer gene receptor 1 (OGR1) are two GPCRs that sense extracellular Ca2+ and H+, respectively. These two ions are key components of the interstitial fluid, and their concentrations change in an activity-dependent manner. Importantly, the interstitial fluid forms part of the microenvironment that influences cell function in health and disease; however, the exact mechanisms through which changes in the microenvironment influence cell function remain largely unknown. We show that CaSR and OGR1 reciprocally inhibit signaling through each other in central neurons, and that this is lost in their transformed counterparts. Furthermore, strong intracellular acidification impairs CaSR function, but potentiates OGR1 function. Thus, CaSR and OGR1 activities can be regulated in a seesaw manner, whereby conditions promoting signaling through one receptor simultaneously inhibit signaling through the other receptor, potentiating the difference in their relative signaling activity. Our results provide insight into how small but consistent changes in the ionic microenvironment of cells can significantly alter the balance between two signaling pathways, which may contribute to disease progression. PMID:26261299

  14. Fractal binding and dissociation kinetics of lecithin cholesterol acyl transferase (LCAT), a heart-related compound, on biosensor surfaces

    NASA Astrophysics Data System (ADS)

    Doke, Atul M.; Sadana, Ajit

    2006-05-01

    A fractal analysis is presented for the binding and dissociation of different heart-related compounds in solution to receptors immobilized on biosensor surfaces. The data analyzed include LCAT (lecithin cholesterol acyl transferase) concentrations in solution to egg-white apoA-I rHDL immobilized on a biosensor chip surface.1 Single- and dual- fractal models were employed to fit the data. Values of the binding and the dissociation rate coefficient(s), affinity values, and the fractal dimensions were obtained from the regression analysis provided by Corel Quattro Pro 8.0 (Corel Corporation Limited).2 The binding rate coefficients are quite sensitive to the degree of heterogeneity on the sensor chip surface. Predictive equations are developed for the binding rate coefficient as a function of the degree of heterogeneity present on the sensor chip surface and on the LCAT concentration in solution, and for the affinity as a function of the ratio of fractal dimensions present in the binding and the dissociation phases. The analysis presented provided physical insights into these analyte-receptor reactions occurring on different biosensor surfaces.

  15. Surface expression of NMDA receptor changes during memory consolidation in the crab Neohelice granulata

    PubMed Central

    Hepp, Yanil; Salles, Angeles; Carbo-Tano, Martin

    2016-01-01

    The aim of the present study was to analyze the surface expression of the NMDA-like receptors during the consolidation of contextual learning in the crab Neohelice granulata. Memory storage is based on alterations in the strength of synaptic connections between neurons. The glutamatergic synapses undergo various forms of N-methyl-D aspartate receptor (NMDAR)-dependent changes in strength, a process that affects the abundance of other receptors at the synapse and underlies some forms of learning and memory. Here we propose a direct regulation of the NMDAR. Changes in NMDAR's functionality might be induced by the modification of the subunit's expression or cellular trafficking. This trafficking does not only include NMDAR's movement between synaptic and extra-synaptic localizations but also the cycling between intracellular compartments and the plasma membrane, a process called surface expression. Consolidation of contextual learning affects the surface expression of the receptor without affecting its general expression. The surface expression of the GluN1 subunit of the NMDAR is down-regulated immediately after training, up-regulated 3 h after training and returns to naïve and control levels 24 h after training. The changes in NMDAR surface expression observed in the central brain are not seen in the thoracic ganglion. A similar increment in surface expression of GluN1 in the central brain is observed 3 h after administration of the competitive GABAA receptor antagonist, bicuculline. These consolidation changes are part of a plasticity event that first, during the down-regulation, stabilizes the trace and later, at 3-h post-training, changes the threshold for synapse activation. PMID:27421895

  16. Klotho converts canonical FGF receptor into a specific receptor for FGF23.

    PubMed

    Urakawa, Itaru; Yamazaki, Yuji; Shimada, Takashi; Iijima, Kousuke; Hasegawa, Hisashi; Okawa, Katsuya; Fujita, Toshiro; Fukumoto, Seiji; Yamashita, Takeyoshi

    2006-12-07

    FGF23 is a unique member of the fibroblast growth factor (FGF) family because it acts as a hormone that derives from bone and regulates kidney functions, whereas most other family members are thought to regulate various cell functions at a local level. The renotropic activity of circulating FGF23 indicates the possible presence of an FGF23-specific receptor in the kidney. Here we show that a previously undescribed receptor conversion by Klotho, a senescence-related molecule, generates the FGF23 receptor. Using a renal homogenate, we found that Klotho binds to FGF23. Forced expression of Klotho enabled the high-affinity binding of FGF23 to the cell surface and restored the ability of a renal cell line to respond to FGF23 treatment. Moreover, FGF23 incompetence was induced by injecting wild-type mice with an anti-Klotho monoclonal antibody. Thus, Klotho is essential for endogenous FGF23 function. Because Klotho alone seemed to be incapable of intracellular signalling, we searched for other components of the FGF23 receptor and found FGFR1(IIIc), which was directly converted by Klotho into the FGF23 receptor. Thus, the concerted action of Klotho and FGFR1(IIIc) reconstitutes the FGF23 receptor. These findings provide insights into the diversity and specificity of interactions between FGF and FGF receptors.

  17. A Cleavable N-Terminal Signal Peptide Promotes Widespread Olfactory Receptor Surface Expression in HEK293T Cells

    PubMed Central

    Shepard, Blythe D.; Natarajan, Niranjana; Protzko, Ryan J.; Acres, Omar W.; Pluznick, Jennifer L.

    2013-01-01

    Olfactory receptors (ORs) are G protein-coupled receptors that detect odorants in the olfactory epithelium, and comprise the largest gene family in the genome. Identification of OR ligands typically requires OR surface expression in heterologous cells; however, ORs rarely traffic to the cell surface when exogenously expressed. Therefore, most ORs are orphan receptors with no known ligands. To date, studies have utilized non-cleavable rhodopsin (Rho) tags and/or chaperones (i.e. Receptor Transporting Protein, RTP1S, Ric8b and Gαolf) to improve surface expression. However, even with these tools, many ORs still fail to reach the cell surface. We used a test set of fifteen ORs to examine the effect of a cleavable leucine-rich signal peptide sequence (Lucy tag) on OR surface expression in HEK293T cells. We report here that the addition of the Lucy tag to the N-terminus increases the number of ORs reaching the cell surface to 7 of the 15 ORs (as compared to 3/15 without Rho or Lucy tags). Moreover, when ORs tagged with both Lucy and Rho were co-expressed with previously reported chaperones (RTP1S, Ric8b and Gαolf), we observed surface expression for all 15 receptors examined. In fact, two-thirds of Lucy-tagged ORs are able to reach the cell surface synergistically with chaperones even when the Rho tag is removed (10/15 ORs), allowing for the potential assessment of OR function with only an 8-amino acid Flag tag on the mature protein. As expected for a signal peptide, the Lucy tag was cleaved from the mature protein and did not alter OR-ligand binding and signaling. Our studies demonstrate that widespread surface expression of ORs can be achieved in HEK293T cells, providing promise for future large-scale deorphanization studies. PMID:23840901

  18. Functional characterization of c-Mpl ectodomain mutations that underlie congenital amegakaryocytic thrombocytopenia.

    PubMed

    Varghese, Leila N; Zhang, Jian-Guo; Young, Samuel N; Willson, Tracy A; Alexander, Warren S; Nicola, Nicos A; Babon, Jeffrey J; Murphy, James M

    2014-02-01

    Activation of the cell surface receptor, c-Mpl, by the cytokine, thrombopoietin (TPO), underpins megakaryocyte and platelet production in mammals. In humans, mutations in c-Mpl have been identified as the molecular basis of Congenital Amegakaryocytic Thrombocytopenia (CAMT). Here, we show that CAMT-associated mutations in c-Mpl principally lead to defective receptor presentation on the cell surface. In contrast, one CAMT mutant c-Mpl, F104S, was expressed on the cell surface, but showed defective TPO binding and receptor activation. Using mutational analyses, we examined which residues adjacent to F104 within the membrane-distal cytokine receptor homology module (CRM) of c-Mpl comprise the TPO-binding epitope, revealing residues within the predicted Domain 1 E-F and A-B loops and Domain 2 F'-G' loop as key TPO-binding determinants. These studies underscore the importance of the c-Mpl membrane-distal CRM to TPO-binding and suggest that mutations within this CRM that perturb TPO binding could give rise to CAMT.

  19. CD4-CCR5 interaction in intracellular compartments contributes to receptor expression at the cell surface

    PubMed Central

    Achour, Lamia; Scott, Mark G.H.; Shirvani, Hamasseh; Thuret, Alain; Bismuth, Georges; Labbé-Jullié, Catherine; Marullo, Stefano

    2009-01-01

    The association of CD4, a glycoprotein involved in T cell development and antigen recognition, and CCR5, a chemotactic G protein-coupled receptor, which regulates trafficking and effector functions of immune cells, forms the main receptor for the human immunodeficiency virus HIV. We observed that the vast majority of CCR5 is maintained within the intracellular compartments of primary T lymphocytes and in a monocytic cell line, contrasting with its relative low density at the cell surface. The CCR5-CD4 association, which occurs in the endoplasmic reticulum, enhanced CCR5 export to the plasma membrane in a concentration–dependent manner, whereas inhibition of endogenous CD4 with small interfering RNAs decreased cell surface expression of endogenous CCR5. This effect was specific for CCR5, as CD4 did not affect cell distribution of CXCR4, the other HIV co-receptor. These results reveal a previously unappreciated role of CD4, which contributes to regulate CCR5 export to the plasma membrane. PMID:19064722

  20. How Chimeric Antigen Receptor Design Affects Adoptive T Cell Therapy.

    PubMed

    Gacerez, Albert T; Arellano, Benjamine; Sentman, Charles L

    2016-12-01

    Chimeric antigen receptor (CAR) T cells have been developed to treat tumors and have shown great success against B cell malignancies. Exploiting modular designs and swappable domains, CARs can target an array of cell surface antigens and, upon receptor-ligand interactions, direct signaling cascades, thereby driving T cell effector functions. CARs have been designed using receptors, ligands, or scFv binding domains. Different regions of a CAR have each been found to play a role in determining the overall efficacy of CAR T cells. Therefore, this review provides an overview of CAR construction and common designs. Each CAR region is discussed in the context of its importance to a CAR's function. Additionally, the review explores how various engineering strategies have been applied to CAR T cells in order to regulate CAR T cell function and activity. J. Cell. Physiol. 231: 2590-2598, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. The low density lipoprotein receptor-related protein 1B retains beta-amyloid precursor protein at the cell surface and reduces amyloid-beta peptide production.

    PubMed

    Cam, Judy A; Zerbinatti, Celina V; Knisely, Jane M; Hecimovic, Silva; Li, Yonghe; Bu, Guojun

    2004-07-09

    The low density lipoprotein (LDL) receptor-related protein 1B (LRP1B) is a newly identified member of the LDL receptor family that shares high homology with the LDL receptor-related protein (LRP). LRP1B was originally described as a putative tumor suppressor in lung cancer cells; however, its expression profile in several regions of adult human brain suggests it may have additional functions in the central nervous system. Since LRP1B has overlapping ligand binding properties with LRP, we investigated whether LRP1B, like LRP, could interact with the beta-amyloid precursor protein (APP) and modulate its processing to amyloid-beta peptides (Abetas). Using an LRP1B minireceptor (mLRP1B4) generated to study the trafficking of LRP1B, we found that mLRP1B4 and APP form an immunoprecipitable complex. Furthermore mLRP1B4 bound and facilitated the degradation of a soluble isoform of APP containing a Kunitz proteinase inhibitor domain but not soluble APP lacking a Kunitz proteinase inhibitor domain. A functional consequence of mLRP1B4 expression was a significant accumulation of APP at the cell surface, which is likely related to the slow endocytosis rate of LRP1B. More importantly, mLRP1B4-expressing cells that accumulated cell surface APP produced less Abeta and secreted more soluble APP. These findings reveal that LRP1B is a novel binding partner of APP that functions to decrease APP processing to Abeta. Consequently LRP1B expression could function to protect against the pathogenesis of Alzheimer's disease.

  2. [Structural and functional organization of the vestibular apparatus in rats maintained under weightless conditions for 19.5 days aboard the satellite "Cosmos-782"].

    PubMed

    Vinnikov, Ia A; Gazenko, O G; Titova, L K; Bronshteĭn, A A; Govardovskiĭ, V I

    1978-01-01

    Vestibular apparatus was investigated in rats subjected to weightlessness for 19.5 days in the satelite "Cosmos-782" and experienced acceleration on launching and landing. Some structural and functional changes were noted. They were seen in otolith clinging to the utricular receptor surface and in the peripheral arrangement of the nucleolus in the nuclei of the receptor cells. It is also possible that increased edema of the vestibular tissue resulted in destruction of some receptor cells, and within the otolith--changes in the form and structure of otoconia. In the horizontal crista the cupula was separated.

  3. Synthesis, characterization, and in vitro evaluation of curcumin-loaded albumin nanoparticles surface-functionalized with glycyrrhetinic acid

    PubMed Central

    Li, Jingjing; Chen, Tong; Deng, Feng; Wan, Jingyuan; Tang, Yalan; Yuan, Pei; Zhang, Liangke

    2015-01-01

    We have designed and developed curcumin (Ccn)-loaded albumin nanoparticles (BNPs) surface-functionalized with glycyrrhetinic acid (Ccn-BNP-GA) for GA receptor-mediated targeting. Ccn-BNP-GA was prepared by conjugating GA as a hepatoma cell-specific binding molecule onto the surface of BNPs. Ccn-BNP-GA showed a narrow distribution with an average size of 258.8±6.4 nm, a regularly spherical shape, an entrapment efficiency of 88.55%±5.54%, and drug loading of 25.30%±1.58%. The density of GA as the ligand conjugated to BNPs was 140.48±2.784 μg/g bovine serum albumin. Cytotoxicity assay results indicated that Ccn-BNP-GA was significantly more cytotoxic to HepG2 cells and in a concentration-dependent manner. Ccn-BNP-GA also appeared to be taken up to a greater extent by HepG2 cells than undecorated groups, which might be due to the high affinity of GA for GA receptors on the HepG2 cell surface. These cytotoxicity assay results were corroborated by analysis of cell apoptosis and the cell cycle. Further, Ccn-BNP-GA showed an approximately twofold higher rate of cell apoptosis than the other groups. Moreover, proliferation of HepG2 cells was arrested in G2/M phase based on cell cycle analysis. These results, which were supported by the GA receptor-mediated endocytosis mechanism, indicate that BNPs surface-functionalized with GA could be used in targeted cancer treatment with high efficacy, sufficient targeting, and reduced toxicity. PMID:26346750

  4. Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.

    PubMed

    Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik

    2018-06-01

    Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.

  5. Differential Regulation of Two-Tiered Plant Immunity and Sexual Reproduction by ANXUR Receptor-Like Kinases.

    PubMed

    Mang, Hyunggon; Feng, Baomin; Hu, Zhangjian; Boisson-Dernier, Aurélien; Franck, Christina M; Meng, Xiangzong; Huang, Yanyan; Zhou, Jinggeng; Xu, Guangyuan; Wang, Taotao; Shan, Libo; He, Ping

    2017-12-01

    Plants have evolved two tiers of immune receptors to detect infections: cell surface-resident pattern recognition receptors (PRRs) that sense microbial signatures and intracellular nucleotide binding domain leucine-rich repeat (NLR) proteins that recognize pathogen effectors. How PRRs and NLRs interconnect and activate the specific and overlapping plant immune responses remains elusive. A genetic screen for components controlling plant immunity identified ANXUR1 (ANX1), a malectin-like domain-containing receptor-like kinase, together with its homolog ANX2, as important negative regulators of both PRR- and NLR-mediated immunity in Arabidopsis thaliana ANX1 constitutively associates with the bacterial flagellin receptor FLAGELLIN-SENSING2 (FLS2) and its coreceptor BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1). Perception of flagellin by FLS2 promotes ANX1 association with BAK1, thereby interfering with FLS2-BAK1 complex formation to attenuate PRR signaling. In addition, ANX1 complexes with the NLR proteins RESISTANT TO PSEUDOMONAS SYRINGAE2 (RPS2) and RESISTANCE TO P. SYRINGAE PV MACULICOLA1. ANX1 promotes RPS2 degradation and attenuates RPS2-mediated cell death. Surprisingly, a mutation that affects ANX1 function in plant immunity does not disrupt its function in controlling pollen tube growth during fertilization. Our study thus reveals a molecular link between PRR and NLR protein complexes that both associate with cell surface-resident ANX1 and uncovers uncoupled functions of ANX1 and ANX2 during plant immunity and sexual reproduction. © 2017 American Society of Plant Biologists. All rights reserved.

  6. Altered Agonist Sensitivity of a Mutant V2 Receptor Suggests a Novel Therapeutic Strategy for Nephrogenic Diabetes Insipidus

    PubMed Central

    Erdélyi, László Sándor; Balla, András; Patócs, Attila; Tóth, Miklós; Várnai, Péter

    2014-01-01

    Loss-of-function mutations of the type 2 vasopressin receptor (V2R) in kidney can lead to nephrogenic diabetes insipidus (NDI). We studied a previously described, but uncharacterized, mutation of the V2R (N321K missense mutation) of a patient with NDI. The properties of the mutant receptor were evaluated. We constructed a highly sensitive Epac-based bioluminescence resonance energy transfer biosensor to perform real-time cAMP measurements after agonist stimulation of transiently transfected HEK293 cells with V2Rs. β-Arrestin binding of the activated receptors was examined with luciferase-tagged β-arrestin and mVenus-tagged V2Rs using the bioluminescence resonance energy transfer technique. Cell surface expression levels of hemagglutinin-tagged receptors were determined with flow cytometry using anti-hemagglutinin-Alexa 488 antibodies. Cellular localization examinations were implemented with fluorescent tagged receptors visualized with confocal laser scanning microscopy. The effect of various vasopressin analogs on the type 1 vasopressin receptor (V1R) was tested on mouse arteries by wire myography. The N321K mutant V2R showed normal cell surface expression, but the potency of arginine vasopressin for cAMP generation was low, whereas the clinically used desmopressin was not efficient. The β-arrestin binding and internalization properties of the mutant receptor were also different than those for the wild type. The function of the mutant receptor can be rescued with administration of the V2R agonist Val4-desmopressin, which had no detectable side effects on V1R in the effective cAMP generating concentrations. Based on these findings we propose a therapeutic strategy for patients with NDI carrying the N321K mutation, as our in vivo experiments suggest that Val4-desmopressin could rescue the function of the N321K-V2R without significant side effects on the V1R. PMID:24628417

  7. Altered agonist sensitivity of a mutant v2 receptor suggests a novel therapeutic strategy for nephrogenic diabetes insipidus.

    PubMed

    Erdélyi, László Sándor; Balla, András; Patócs, Attila; Tóth, Miklós; Várnai, Péter; Hunyady, László

    2014-05-01

    Loss-of-function mutations of the type 2 vasopressin receptor (V2R) in kidney can lead to nephrogenic diabetes insipidus (NDI). We studied a previously described, but uncharacterized, mutation of the V2R (N321K missense mutation) of a patient with NDI. The properties of the mutant receptor were evaluated. We constructed a highly sensitive Epac-based bioluminescence resonance energy transfer biosensor to perform real-time cAMP measurements after agonist stimulation of transiently transfected HEK293 cells with V2Rs. β-Arrestin binding of the activated receptors was examined with luciferase-tagged β-arrestin and mVenus-tagged V2Rs using the bioluminescence resonance energy transfer technique. Cell surface expression levels of hemagglutinin-tagged receptors were determined with flow cytometry using anti-hemagglutinin-Alexa 488 antibodies. Cellular localization examinations were implemented with fluorescent tagged receptors visualized with confocal laser scanning microscopy. The effect of various vasopressin analogs on the type 1 vasopressin receptor (V1R) was tested on mouse arteries by wire myography. The N321K mutant V2R showed normal cell surface expression, but the potency of arginine vasopressin for cAMP generation was low, whereas the clinically used desmopressin was not efficient. The β-arrestin binding and internalization properties of the mutant receptor were also different than those for the wild type. The function of the mutant receptor can be rescued with administration of the V2R agonist Val(4)-desmopressin, which had no detectable side effects on V1R in the effective cAMP generating concentrations. Based on these findings we propose a therapeutic strategy for patients with NDI carrying the N321K mutation, as our in vivo experiments suggest that Val(4)-desmopressin could rescue the function of the N321K-V2R without significant side effects on the V1R.

  8. An intact PDZ motif is essential for correct P2Y12 purinoceptor traffic in human platelets.

    PubMed

    Nisar, Shaista; Daly, Martina E; Federici, Augusto B; Artoni, Andrea; Mumford, Andrew D; Watson, Stephen P; Mundell, Stuart J

    2011-11-17

    The platelet P2Y(12) purinoceptor (P2Y(12)R), which plays a crucial role in hemostasis, undergoes internalization and subsequent recycling to maintain receptor responsiveness, processes that are essential for normal platelet function. Here, we observe that P2Y(12)R function is compromised after deletion or mutation of the 4 amino acids at the extreme C-terminus of this receptor (ETPM), a putative postsynaptic density 95/disc large/zonula occludens-1 (PDZ)-binding motif. In cell line models, removal of this sequence or mutation of one of its core residues (P341A), attenuates receptor internalization and receptor recycling back to the membrane, thereby blocking receptor resensitization. The physiologic significance of these findings in the regulation of platelet function is shown by identification of a patient with a heterozygous mutation in the PDZ binding sequence of their P2Y(12)R (P341A) that is associated with reduced expression of the P2Y(12)R on the cell surface. Importantly, platelets from this subject showed significantly compromised P2Y(12)R recycling, emphasizing the importance of the extreme C-terminus of this receptor to ensure correct receptor traffic.

  9. Distinctive receptor binding properties of the surface glycoprotein of a natural feline leukemia virus isolate with unusual disease spectrum.

    PubMed

    Bolin, Lisa L; Chandhasin, Chandtip; Lobelle-Rich, Patricia A; Albritton, Lorraine M; Levy, Laura S

    2011-05-13

    Feline leukemia virus (FeLV)-945, a member of the FeLV-A subgroup, was previously isolated from a cohort of naturally infected cats. An unusual multicentric lymphoma of non-T-cell origin was observed in natural and experimental infection with FeLV-945. Previous studies implicated the FeLV-945 surface glycoprotein (SU) as a determinant of disease outcome by an as yet unknown mechanism. The present studies demonstrate that FeLV-945 SU confers distinctive properties of binding to the cell surface receptor. Virions bearing the FeLV-945 Env protein were observed to bind the cell surface receptor with significantly increased efficiency, as was soluble FeLV-945 SU protein, as compared to the corresponding virions or soluble protein from a prototype FeLV-A isolate. SU proteins cloned from other cohort isolates exhibited increased binding efficiency comparable to or greater than FeLV-945 SU. Mutational analysis implicated a domain containing variable region B (VRB) to be the major determinant of increased receptor binding, and identified a single residue, valine 186, to be responsible for the effect. The FeLV-945 SU protein binds its cell surface receptor, feTHTR1, with significantly greater efficiency than does that of prototype FeLV-A (FeLV-A/61E) when present on the surface of virus particles or in soluble form, demonstrating a 2-fold difference in the relative dissociation constant. The results implicate a single residue, valine 186, as the major determinant of increased binding affinity. Computational modeling suggests a molecular mechanism by which residue 186 interacts with the receptor-binding domain through residue glutamine 110 to effect increased binding affinity. Through its increased receptor binding affinity, FeLV-945 SU might function in pathogenesis by increasing the rate of virus entry and spread in vivo, or by facilitating entry into a novel target cell with a low receptor density.

  10. Molecular recognition of human ephrinB2 cell surface receptor by an emergent African henipavirus

    PubMed Central

    Lee, Benhur; Pernet, Olivier; Ahmed, Asim A.; Zeltina, Antra; Beaty, Shannon M.; Bowden, Thomas A.

    2015-01-01

    The discovery of African henipaviruses (HNVs) related to pathogenic Hendra virus (HeV) and Nipah virus (NiV) from Southeast Asia and Australia presents an open-ended health risk. Cell receptor use by emerging African HNVs at the stage of host-cell entry is a key parameter when considering the potential for spillover and infection of human populations. The attachment glycoprotein from a Ghanaian bat isolate (GhV-G) exhibits <30% sequence identity with Asiatic NiV-G/HeV-G. Here, through functional and structural analysis of GhV-G, we show how this African HNV targets the same human cell-surface receptor (ephrinB2) as the Asiatic HNVs. We first characterized this virus−receptor interaction crystallographically. Compared with extant HNV-G–ephrinB2 structures, there was significant structural variation in the six-bladed β-propeller scaffold of the GhV-G receptor-binding domain, but not the Greek key fold of the bound ephrinB2. Analysis revealed a surprisingly conserved mode of ephrinB2 interaction that reflects an ongoing evolutionary constraint among geographically distal and phylogenetically divergent HNVs to maintain the functionality of ephrinB2 recognition during virus–host entry. Interestingly, unlike NiV-G/HeV-G, we could not detect binding of GhV-G to ephrinB3. Comparative structure–function analysis further revealed several distinguishing features of HNV-G function: a secondary ephrinB2 interaction site that contributes to more efficient ephrinB2-mediated entry in NiV-G relative to GhV-G and cognate residues at the very C terminus of GhV-G (absent in Asiatic HNV-Gs) that are vital for efficient receptor-induced fusion, but not receptor binding per se. These data provide molecular-level details for evaluating the likelihood of African HNVs to spill over into human populations. PMID:25825759

  11. The glucagon-like peptide-2 receptor C terminus modulates beta-arrestin-2 association but is dispensable for ligand-induced desensitization, endocytosis, and G-protein-dependent effector activation.

    PubMed

    Estall, Jennifer L; Koehler, Jacqueline A; Yusta, Bernardo; Drucker, Daniel J

    2005-06-10

    Classic models of receptor desensitization and internalization have been largely based on the behavior of Family A G-protein-coupled receptors (GPCRs). The glucagon-like peptide-2 receptor (GLP-2R) is a member of the Family B glucagon-secretin GPCR family, which exhibit significant sequence and structural differences from the Family A receptors in their intracellular and extracellular domains. To identify structural motifs that regulate GLP-2R signaling and cell surface receptor expression, we analyzed the functional properties of a series of mutant GLP-2Rs. The majority of the C-terminal receptor tail was dispensable for GLP-2-induced cAMP accumulation, ERK1/2 activation, and endocytosis in transfected cells. However, progressive truncation of the C terminus reduced cell surface receptor expression, altered agonist-induced GLP-2R trafficking, and abrogated protein kinase A-mediated heterologous receptor desensitization. Elimination of the distal 21 amino acids of the receptor was sufficient to promote constitutive receptor internalization and prevent agonist-induced recruitment of beta-arrestin-2. Site-directed mutagenesis identified specific amino acid residues within the distal GLP-2R C terminus that mediate the stable association with beta-arrestin-2. Surprisingly, although the truncated mutant receptors failed to interact with beta-arrestin-2, they underwent homologous desensitization and subsequent resensitization with kinetics similar to that observed with the wild-type GLP-2R. Our data suggest that, although the GLP-2R C terminus is not required for coupling to cellular machinery regulating signaling or desensitization, it may serve as a sorting signal for intracellular trafficking. Taken together with the previously demonstrated clathrin and dynamin-independent, lipid-raft-dependent pathways for internalization, our data suggest that GLP-2 receptor signaling has evolved unique structural and functional mechanisms for control of receptor trafficking, desensitization, and resensitization.

  12. Asialoglycoprotein receptor 1 is a specific cell-surface marker for isolating hepatocytes derived from human pluripotent stem cells

    PubMed Central

    Peters, Derek T.; Henderson, Christopher A.; Warren, Curtis R.; Friesen, Max; Xia, Fang; Becker, Caroline E.; Musunuru, Kiran; Cowan, Chad A.

    2016-01-01

    ABSTRACT Hepatocyte-like cells (HLCs) are derived from human pluripotent stem cells (hPSCs) in vitro, but differentiation protocols commonly give rise to a heterogeneous mixture of cells. This variability confounds the evaluation of in vitro functional assays performed using HLCs. Increased differentiation efficiency and more accurate approximation of the in vivo hepatocyte gene expression profile would improve the utility of hPSCs. Towards this goal, we demonstrate the purification of a subpopulation of functional HLCs using the hepatocyte surface marker asialoglycoprotein receptor 1 (ASGR1). We analyzed the expression profile of ASGR1-positive cells by microarray, and tested their ability to perform mature hepatocyte functions (albumin and urea secretion, cytochrome activity). By these measures, ASGR1-positive HLCs are enriched for the gene expression profile and functional characteristics of primary hepatocytes compared with unsorted HLCs. We have demonstrated that ASGR1-positive sorting isolates a functional subpopulation of HLCs from among the heterogeneous cellular population produced by directed differentiation. PMID:27143754

  13. Mannose phosphate isomerase regulates fibroblast growth factor receptor family signaling and glioma radiosensitivity.

    PubMed

    Cazet, Aurélie; Charest, Jonathan; Bennett, Daniel C; Sambrooks, Cecilia Lopez; Contessa, Joseph N

    2014-01-01

    Asparagine-linked glycosylation is an endoplasmic reticulum co- and post-translational modification that enables the transit and function of receptor tyrosine kinase (RTK) glycoproteins. To gain insight into the regulatory role of glycosylation enzymes on RTK function, we investigated shRNA and siRNA knockdown of mannose phosphate isomerase (MPI), an enzyme required for mature glycan precursor biosynthesis. Loss of MPI activity reduced phosphorylation of FGFR family receptors in U-251 and SKMG-3 malignant glioma cell lines and also resulted in significant decreases in FRS2, Akt, and MAPK signaling. However, MPI knockdown did not affect ligand-induced activation or signaling of EGFR or MET RTKs, suggesting that FGFRs are more susceptible to MPI inhibition. The reductions in FGFR signaling were not caused by loss of FGF ligands or receptors, but instead were caused by interference with receptor dimerization. Investigations into the cellular consequences of MPI knockdown showed that cellular programs driven by FGFR signaling, and integral to the clinical progression of malignant glioma, were impaired. In addition to a blockade of cellular migration, MPI knockdown also significantly reduced glioma cell clonogenic survival following ionizing radiation. Therefore our results suggest that targeted inhibition of enzymes required for cell surface receptor glycosylation can be manipulated to produce discrete and limited consequences for critical client glycoproteins expressed by tumor cells. Furthermore, this work identifies MPI as a potential enzymatic target for disrupting cell surface receptor-dependent survival signaling and as a novel approach for therapeutic radiosensitization.

  14. EphrinA2 Receptor (EphA2) Is an Invasion and Intracellular Signaling Receptor for Chlamydia trachomatis

    PubMed Central

    Subbarayal, Prema; Karunakaran, Karthika; Winkler, Ann-Cathrin; Rother, Marion; Gonzalez, Erik; Meyer, Thomas F.; Rudel, Thomas

    2015-01-01

    The obligate intracellular bacterium Chlamydia trachomatis invades into host cells to replicate inside a membrane-bound vacuole called inclusion. Multiple different host proteins are recruited to the inclusion and are functionally modulated to support chlamydial development. Invaded and replicating Chlamydia induces a long-lasting activation of the PI3 kinase signaling pathway that is required for efficient replication. We identified the cell surface tyrosine kinase EphrinA2 receptor (EphA2) as a chlamydial adherence and invasion receptor that induces PI3 kinase (PI3K) activation, promoting chlamydial replication. Interfering with binding of C. trachomatis serovar L2 (Ctr) to EphA2, downregulation of EphA2 expression or inhibition of EphA2 activity significantly reduced Ctr infection. Ctr interacts with and activates EphA2 on the cell surface resulting in Ctr and receptor internalization. During chlamydial replication, EphA2 remains active accumulating around the inclusion and interacts with the p85 regulatory subunit of PI3K to support the activation of the PI3K/Akt signaling pathway that is required for normal chlamydial development. Overexpression of full length EphA2, but not the mutant form lacking the intracellular cytoplasmic domain, enhanced PI3K activation and Ctr infection. Despite the depletion of EphA2 from the cell surface, Ctr infection induces upregulation of EphA2 through the activation of the ERK pathway, which keeps the infected cell in an apoptosis-resistant state. The significance of EphA2 as an entry and intracellular signaling receptor was also observed with the urogenital C. trachomatis-serovar D. Our findings provide the first evidence for a host cell surface receptor that is exploited for invasion as well as for receptor-mediated intracellular signaling to facilitate chlamydial replication. In addition, the engagement of a cell surface receptor at the inclusion membrane is a new mechanism by which Chlamydia subverts the host cell and induces apoptosis resistance. PMID:25906164

  15. EphrinA2 receptor (EphA2) is an invasion and intracellular signaling receptor for Chlamydia trachomatis.

    PubMed

    Subbarayal, Prema; Karunakaran, Karthika; Winkler, Ann-Cathrin; Rother, Marion; Gonzalez, Erik; Meyer, Thomas F; Rudel, Thomas

    2015-04-01

    The obligate intracellular bacterium Chlamydia trachomatis invades into host cells to replicate inside a membrane-bound vacuole called inclusion. Multiple different host proteins are recruited to the inclusion and are functionally modulated to support chlamydial development. Invaded and replicating Chlamydia induces a long-lasting activation of the PI3 kinase signaling pathway that is required for efficient replication. We identified the cell surface tyrosine kinase EphrinA2 receptor (EphA2) as a chlamydial adherence and invasion receptor that induces PI3 kinase (PI3K) activation, promoting chlamydial replication. Interfering with binding of C. trachomatis serovar L2 (Ctr) to EphA2, downregulation of EphA2 expression or inhibition of EphA2 activity significantly reduced Ctr infection. Ctr interacts with and activates EphA2 on the cell surface resulting in Ctr and receptor internalization. During chlamydial replication, EphA2 remains active accumulating around the inclusion and interacts with the p85 regulatory subunit of PI3K to support the activation of the PI3K/Akt signaling pathway that is required for normal chlamydial development. Overexpression of full length EphA2, but not the mutant form lacking the intracellular cytoplasmic domain, enhanced PI3K activation and Ctr infection. Despite the depletion of EphA2 from the cell surface, Ctr infection induces upregulation of EphA2 through the activation of the ERK pathway, which keeps the infected cell in an apoptosis-resistant state. The significance of EphA2 as an entry and intracellular signaling receptor was also observed with the urogenital C. trachomatis-serovar D. Our findings provide the first evidence for a host cell surface receptor that is exploited for invasion as well as for receptor-mediated intracellular signaling to facilitate chlamydial replication. In addition, the engagement of a cell surface receptor at the inclusion membrane is a new mechanism by which Chlamydia subverts the host cell and induces apoptosis resistance.

  16. T-Cell Surface Antigens and sCD30 as Biomarkers of the Risk of Rejection in Solid Organ Transplantation.

    PubMed

    Wieland, Eberhard; Shipkova, Maria

    2016-04-01

    T-cell activation is a characteristic of organ rejection. T cells, located in the draining lymph nodes of the transplant recipient, are faced with non-self-molecules presented by antigen presenting cells and become activated. Activated T cells are characterized by up-regulated surface antigens, such as costimulatory molecules, adhesion molecules, chemokine receptors, and major histocompatibility complex class II molecules. Surface antigen expression can be followed by flow cytometry using monoclonal antibodies in either cell function assays using donor-specific or nonspecific stimulation of isolated cells or whole blood and without stimulation on circulating lymphocytes. Molecules such as CD30 can be proteolytically cleaved off the surface of activated cells in vivo, and the determination of the soluble protein (sCD30) in serum or plasma is performed by immunoassays. As promising biomarkers for rejection and long-term transplant outcome, CD28 (costimulatory receptor for CD80 and CD86), CD154 (CD40 ligand), and sCD30 (tumor necrosis factor receptor superfamily, member 8) have been identified. Whereas cell function assays are time-consuming laboratory-developed tests which are difficult to standardize, commercial assays are frequently available for soluble proteins. Therefore, more data from clinical trials have been published for sCD30 compared with the surface antigens on activated T cells. This short review summarizes the association between selected surface antigens and immunosuppression, and rejection in solid organ transplantation.

  17. Formation of functional asialoglycoprotein receptor after transfection with cDNAs encoding the receptor proteins.

    PubMed Central

    McPhaul, M; Berg, P

    1986-01-01

    The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162

  18. LRP1 influences trafficking of N-type calcium channels via interaction with the auxiliary α2δ-1 subunit

    PubMed Central

    Kadurin, Ivan; Rothwell, Simon W.; Lana, Beatrice; Nieto-Rostro, Manuela; Dolphin, Annette C.

    2017-01-01

    Voltage-gated Ca2+ (CaV) channels consist of a pore-forming α1 subunit, which determines the main functional and pharmacological attributes of the channel. The CaV1 and CaV2 channels are associated with auxiliary β- and α2δ-subunits. The molecular mechanisms involved in α2δ subunit trafficking, and the effect of α2δ subunits on trafficking calcium channel complexes remain poorly understood. Here we show that α2δ-1 is a ligand for the Low Density Lipoprotein (LDL) Receptor-related Protein-1 (LRP1), a multifunctional receptor which mediates trafficking of cargoes. This interaction with LRP1 is direct, and is modulated by the LRP chaperone, Receptor-Associated Protein (RAP). LRP1 regulates α2δ binding to gabapentin, and influences calcium channel trafficking and function. Whereas LRP1 alone reduces α2δ-1 trafficking to the cell-surface, the LRP1/RAP combination enhances mature glycosylation, proteolytic processing and cell-surface expression of α2δ-1, and also increase plasma-membrane expression and function of CaV2.2 when co-expressed with α2δ-1. Furthermore RAP alone produced a small increase in cell-surface expression of CaV2.2, α2δ-1 and the associated calcium currents. It is likely to be interacting with an endogenous member of the LDL receptor family to have these effects. Our findings now provide a key insight and new tools to investigate the trafficking of calcium channel α2δ subunits. PMID:28256585

  19. Structure and Dynamics of the Liver Receptor Homolog 1-PGC1α Complex.

    PubMed

    Mays, Suzanne G; Okafor, C Denise; Tuntland, Micheal L; Whitby, Richard J; Dharmarajan, Venkatasubramanian; Stec, Józef; Griffin, Patrick R; Ortlund, Eric A

    2017-07-01

    Peroxisome proliferator-activated gamma coactivator 1- α (PGC1 α ) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1 α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1 α is known to bind and activate LRH-1, mechanisms through which PGC1 α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1-PGC1 α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1 α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), in coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1-PGC1 α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1 α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1 α but promoted allosteric signaling from the helix 6/ β -sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1-PGC1 α interaction and may illuminate strategies for selective therapeutic targeting of PGC1 α -dependent LRH-1 signaling pathways. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  20. Src regulates sequence-dependent beta-2 adrenergic receptor recycling via cortactin phosphorylation*

    PubMed Central

    Vistein, Rachel; Puthenveedu, Manojkumar A.

    2014-01-01

    The recycling of internalized signaling receptors, which has direct functional consequences, is subject to multiple sequence and biochemical requirements. Why signaling receptors recycle via a specialized pathway, unlike many other proteins that recycle by bulk, is a fundamental unanswered question. Here we show that these specialized pathways allow selective control of signaling receptor recycling by heterologous signaling. Using assays to visualize receptor recycling in living cells, we show that the recycling of the beta-2 adrenergic receptor (B2AR), a prototypic signaling receptor, is regulated by Src family kinases. The target of Src is cortactin, an essential factor for B2AR sorting into specialized recycling microdomains on the endosome. Phosphorylation of a single cortactin residue, Y466, regulates the rate of fission of B2AR recycling vesicles from these microdomains, and, therefore, the rate of delivery of B2AR to the cell surface. Together, our results indicate that actin-stabilized microdomains that mediate signaling receptor recycling can serve as a functional point of convergence for crosstalk between signaling pathways. PMID:25077552

  1. Receptor-mediated binding of IgE-sensitized rat basophilic leukemia cells to antigen-coated substrates under hydrodynamic flow.

    PubMed Central

    Tempelman, L A; Hammer, D A

    1994-01-01

    The physiological function of many cells is dependent on their ability to adhere via receptors to ligand-coated surfaces under fluid flow. We have developed a model experimental system to measure cell adhesion as a function of cell and surface chemistry and fluid flow. Using a parallel-plate flow chamber, we measured the binding of rat basophilic leukemia cells preincubated with anti-dinitrophenol IgE antibody to polyacrylamide gels covalently derivatized with 2,4-dinitrophenol. The rat basophilic leukemia cells' binding behavior is binary: cells are either adherent or continue to travel at their hydrodynamic velocity, and the transition between these two states is abrupt. The spatial location of adherent cells shows cells can adhere many cell diameters down the length of the gel, suggesting that adhesion is a probabilistic process. The majority of experiments were performed in the excess ligand limit in which adhesion depends strongly on the number of receptors but weakly on ligand density. Only 5-fold changes in IgE surface density or in shear rate were necessary to change adhesion from complete to indistinguishable from negative control. Adhesion showed a hyperbolic dependence on shear rate. By performing experiments with two IgE-antigen configurations in which the kinetic rates of receptor-ligand binding are different, we demonstrate that the forward rate of reaction of the receptor-ligand pair is more important than its thermodynamic affinity in the regulation of binding under hydrodynamic flow. In fact, adhesion increases with increasing receptor-ligand reaction rate or decreasing shear rate, and scales with a single dimensionless parameter which compares the relative rates of reaction to fluid shear. Images FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 8 FIGURE 10 PMID:8038394

  2. Retrograde transport of the transmembrane estrogen receptor, G-protein-coupled-receptor-30 (GPR30/GPER) from the plasma membrane towards the nucleus.

    PubMed

    Cheng, Shi-Bin; Graeber, Carl T; Quinn, Jeffrey A; Filardo, Edward J

    2011-08-01

    G-protein-coupled receptor 30 (GPR30/GPER) belongs to the seven transmembrane receptor (7TMR) superfamily, the most common class of surface receptor with approximately 800 known members. GPER promotes estrogen binding and rapid signaling via membrane-associated enzymes resulting in increased cAMP and release of heparan bound epidermal growth factor (proHB-EGF) from breast cancer cells. However, GPER is predominately localized intracellularly in breast cancer cells with minor amounts of receptor on the cell surface, an observation that has caused some controversy regarding its potential role as a plasma membrane estrogen receptor. Using the widely employed approach of tracking recombinant 7TMRs by surface labeling live cells, we have begun to characterize and compare the endocytic fate of GPER to other similarly labeled 7TMRs. Upon ectopic expression in human embryonic kidney HEK-293 cells, functional GPER is generated as these cells acquire the capacity to stimulate cAMP and activate cyclic AMP responsive binding protein in response to estradiol-17 beta stimulation. GPER is detectable on the cell surface by immunofluorescent analysis using HA-specific antibodies, albeit the bulk of the receptor is located intracellularly. Like β1AR (beta 1 adrenergic receptor) and CXCR4 (C-X-C chemokine receptor 4), GPER exits the plasma membrane via clathrin-coated pits and enters early endosomes. Interestingly, GPER has a destination that is uncommon among 7TMRs, as it accumulates in a perinuclear compartment. Like many 7TMRs (approximately one-third), GPER trafficking from the plasma membrane is constitutive (occurs in the absence of agonist). However, its route of intracellular trafficking is highly unusual, as 7TMRs typically recycle to the plasma membrane (e.g. β1AR) or are degraded in lysosomes (e.g. CXCR4). The accumulation of GPER in the perinuclear space and its possible significance for attenuating estrogen action via this newly recognized membrane estrogen receptor is discussed herein. Published by Elsevier Inc.

  3. Biological Functionalization of Drug Delivery Carriers to Bypass Size Restrictions of Receptor-Mediated Endocytosis Independently from Receptor Targeting

    PubMed Central

    Ansar, Maria; Serrano, Daniel; Papademetriou, Iason; Bhowmick, Tridib Kumar; Muro, Silvia

    2014-01-01

    Targeting of drug carriers to cell-surface receptors involved in endocytosis is commonly used for intracellular drug delivery. However, most endocytic receptors mediate uptake via clathrin or caveolar pathways associated with ≤200-nm vesicles, restricting carrier design. We recently showed that endocytosis mediated by intercellular adhesion molecule 1 (ICAM-1), which differs from clathrin- and caveolar-mediated pathways, allows uptake of nano- and micro-carriers in cell culture and in vivo due to recruitment of cellular sphingomyelinases to the plasmalemma. This leads to ceramide generation at carrier binding sites and formation of actin stress-fibers, enabling engulfment and uptake of a wide size-range of carriers. Here we adapted this paradigm to enhance uptake of drug carriers targeted to receptors associated with size-restricted pathways. We coated sphingomyelinase onto model (polystyrene) submicro- and micro-carriers targeted to clathrin-associated mannose-6-phosphate receptor. In endothelial cells, this provided ceramide enrichment at the cell surface and actin stress-fiber formation, modifying the uptake pathway and enhancing carrier endocytosis without affecting targeting, endosomal transport, cell-associated degradation, or cell viability. This improvement depended on the carrier size and enzyme dose, and similar results were observed for other receptors (transferrin receptor) and cell types (epithelial cells). This phenomenon also enhanced tissue accumulation of carriers after intravenous injection in mice. Hence, it is possible to maintain targeting toward a selected receptor while bypassing natural size-restrictions of its associated endocytic route by functionalization of drug carriers with biological elements mimicking the ICAM-1 pathway. This strategy holds considerable promise to enhance flexibility of design of targeted drug delivery systems. PMID:24237309

  4. Biological functionalization of drug delivery carriers to bypass size restrictions of receptor-mediated endocytosis independently from receptor targeting.

    PubMed

    Ansar, Maria; Serrano, Daniel; Papademetriou, Iason; Bhowmick, Tridib Kumar; Muro, Silvia

    2013-12-23

    Targeting of drug carriers to cell-surface receptors involved in endocytosis is commonly used for intracellular drug delivery. However, most endocytic receptors mediate uptake via clathrin or caveolar pathways associated with ≤200-nm vesicles, restricting carrier design. We recently showed that endocytosis mediated by intercellular adhesion molecule 1 (ICAM-1), which differs from clathrin- and caveolae-mediated pathways, allows uptake of nano- and microcarriers in cell culture and in vivo due to recruitment of cellular sphingomyelinases to the plasmalemma. This leads to ceramide generation at carrier binding sites and formation of actin stress-fibers, enabling engulfment and uptake of a wide size-range of carriers. Here we adapted this paradigm to enhance uptake of drug carriers targeted to receptors associated with size-restricted pathways. We coated sphingomyelinase onto model (polystyrene) submicro- and microcarriers targeted to clathrin-associated mannose-6-phosphate receptor. In endothelial cells, this provided ceramide enrichment at the cell surface and actin stress-fiber formation, modifying the uptake pathway and enhancing carrier endocytosis without affecting targeting, endosomal transport, cell-associated degradation, or cell viability. This improvement depended on the carrier size and enzyme dose, and similar results were observed for other receptors (transferrin receptor) and cell types (epithelial cells). This phenomenon also enhanced tissue accumulation of carriers after intravenous injection in mice. Hence, it is possible to maintain targeting toward a selected receptor while bypassing natural size restrictions of its associated endocytic route by functionalization of drug carriers with biological elements mimicking the ICAM-1 pathway. This strategy holds considerable promise to enhance flexibility of design of targeted drug delivery systems.

  5. The Thrombopoietin Receptor: Structural Basis of Traffic and Activation by Ligand, Mutations, Agonists, and Mutated Calreticulin.

    PubMed

    Varghese, Leila N; Defour, Jean-Philippe; Pecquet, Christian; Constantinescu, Stefan N

    2017-01-01

    A well-functioning hematopoietic system requires a certain robustness and flexibility to maintain appropriate quantities of functional mature blood cells, such as red blood cells and platelets. This review focuses on the cytokine receptor that plays a significant role in thrombopoiesis: the receptor for thrombopoietin (TPO-R; also known as MPL). Here, we survey the work to date to understand how this receptor functions at a molecular level throughout its lifecycle, from traffic to the cell surface, dimerization and binding cognate cytokine via its extracellular domain, through to its subsequent activation of associated Janus kinases and initiation of downstream signaling pathways, as well as the regulation of these processes. Atomic level resolution structures of TPO-R have remained elusive. The identification of disease-causing mutations in the receptor has, however, offered some insight into structure and function relationships, as has artificial means of receptor activation, through TPO mimetics, transmembrane-targeting receptor agonists, and engineering in dimerization domains. More recently, a novel activation mechanism was identified whereby mutated forms of calreticulin form complexes with TPO-R via its extracellular N-glycosylated domain. Such complexes traffic pathologically in the cell and persistently activate JAK2, downstream signal transducers and activators of transcription (STATs), and other pathways. This pathologic TPO-R activation is associated with a large fraction of human myeloproliferative neoplasms.

  6. Internalization of G-protein-coupled receptors: Implication in receptor function, physiology and diseases.

    PubMed

    Calebiro, Davide; Godbole, Amod

    2018-04-01

    G protein-coupled receptors (GPCRs) are the largest family of membrane receptors and mediate the effects of numerous hormones and neurotransmitters. The nearly 1000 GPCRs encoded by the human genome regulate virtually all physiological functions and are implicated in the pathogenesis of prevalent human diseases such as thyroid disorders, hypertension or Parkinson's disease. As a result, 30-50% of all currently prescribed drugs are targeting these receptors. Once activated, GPCRs induce signals at the cell surface. This is often followed by internalization, a process that results in the transfer of receptors from the plasma membrane to membranes of the endosomal compartment. Internalization was initially thought to be mainly implicated in signal desensitization, a mechanism of adaptation to prolonged receptor stimulation. However, several unexpected functions have subsequently emerged. Most notably, accumulating evidence indicates that internalization can induce prolonged receptor signaling on intracellular membranes, which is apparently required for at least some biological effects of hormones like TSH, LH and adrenaline. These findings reveal an even stronger connection between receptor internalization and signaling than previously thought. Whereas new studies are just beginning to reveal an important physiological role for GPCR signaling after internalization and ways to exploit it for therapeutic purposes, future investigations will be required to explore its involvement in human disease. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. IL-4 function can be transferred to the IL-2 receptor by tyrosine containing sequences found in the IL-4 receptor alpha chain.

    PubMed

    Wang, H Y; Paul, W E; Keegan, A D

    1996-02-01

    IL-4 binds to a cell surface receptor complex that consists of the IL-4 binding protein (IL-4R alpha) and the gamma chain of the IL-2 receptor complex (gamma c). The receptors for IL-4 and IL-2 have several features in common; both use the gamma c as a receptor component, and both activate the Janus kinases JAK-1 and JAK-3. In spite of these similarities, IL-4 evokes specific responses, including the tyrosine phosphorylation of 4PS/IRS-2 and the induction of CD23. To determine whether sequences within the cytoplasmic domain of the IL-4R alpha specify these IL-4-specific responses, we transplanted the insulin IL-4 receptor motif (I4R motif) of the huIL-4R alpha to the cytoplasmic domain of a truncated IL-2R beta. In addition, we transplanted a region that contains peptide sequences shown to block Stat6 binding to DNA. We analyzed the ability of cells expressing these IL-2R-IL-4R chimeric constructs to respond to IL-2. We found that IL-4 function could be transplanted to the IL-2 receptor by these regions and that proliferative and differentiative functions can be induced by different receptor sequences.

  8. Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes.

    PubMed

    Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S; Taube, Ran; Engel, Stanislav

    2015-01-01

    Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential.

  9. Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes

    PubMed Central

    Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S.; Taube, Ran

    2015-01-01

    Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential. PMID:26629902

  10. Thioredoxin Inhibitors Attenuate Platelet Function and Thrombus Formation

    PubMed Central

    Metcalfe, Clive; Ramasubramoni, Anjana; Pula, Giordano; Harper, Matthew T.; Mundell, Stuart J.; Coxon, Carmen H.

    2016-01-01

    Thioredoxin (Trx) is an oxidoreductase with important physiological function. Imbalances in the NADPH/thioredoxin reductase/thioredoxin system are associated with a number of pathologies, particularly cancer, and a number of clinical trials for thioredoxin and thioredoxin reductase inhibitors have been carried out or are underway. Due to the emerging role and importance of oxidoreductases for haemostasis and the current interest in developing inhibitors for clinical use, we thought it pertinent to assess whether inhibition of the NADPH/thioredoxin reductase/thioredoxin system affects platelet function and thrombosis. We used small molecule inhibitors of Trx (PMX 464 and PX-12) to determine whether Trx activity influences platelet function, as well as an unbiased proteomics approach to identify potential Trx substrates on the surface of platelets that might contribute to platelet reactivity and function. Using LC-MS/MS we found that PMX 464 and PX-12 affected the oxidation state of thiols in a number of cell surface proteins. Key surface receptors for platelet adhesion and activation were affected, including the collagen receptor GPVI and the von Willebrand factor receptor, GPIb. To experimentally validate these findings we assessed platelet function in the presence of PMX 464, PX-12, and rutin (a selective inhibitor of the related protein disulphide isomerase). In agreement with the proteomics data, small molecule inhibitors of thioredoxin selectively inhibited GPVI-mediated platelet activation, and attenuated ristocetin-induced GPIb-vWF-mediated platelet agglutination, thus validating the findings of the proteomics study. These data reveal a novel role for thioredoxin in regulating platelet reactivity via proteins required for early platelet responses at sites of vessel injury (GPVI and GPIb). This work also highlights a potential opportunity for repurposing of PMX 464 and PX-12 as antiplatelet agents. PMID:27716777

  11. Thioredoxin Inhibitors Attenuate Platelet Function and Thrombus Formation.

    PubMed

    Metcalfe, Clive; Ramasubramoni, Anjana; Pula, Giordano; Harper, Matthew T; Mundell, Stuart J; Coxon, Carmen H

    2016-01-01

    Thioredoxin (Trx) is an oxidoreductase with important physiological function. Imbalances in the NADPH/thioredoxin reductase/thioredoxin system are associated with a number of pathologies, particularly cancer, and a number of clinical trials for thioredoxin and thioredoxin reductase inhibitors have been carried out or are underway. Due to the emerging role and importance of oxidoreductases for haemostasis and the current interest in developing inhibitors for clinical use, we thought it pertinent to assess whether inhibition of the NADPH/thioredoxin reductase/thioredoxin system affects platelet function and thrombosis. We used small molecule inhibitors of Trx (PMX 464 and PX-12) to determine whether Trx activity influences platelet function, as well as an unbiased proteomics approach to identify potential Trx substrates on the surface of platelets that might contribute to platelet reactivity and function. Using LC-MS/MS we found that PMX 464 and PX-12 affected the oxidation state of thiols in a number of cell surface proteins. Key surface receptors for platelet adhesion and activation were affected, including the collagen receptor GPVI and the von Willebrand factor receptor, GPIb. To experimentally validate these findings we assessed platelet function in the presence of PMX 464, PX-12, and rutin (a selective inhibitor of the related protein disulphide isomerase). In agreement with the proteomics data, small molecule inhibitors of thioredoxin selectively inhibited GPVI-mediated platelet activation, and attenuated ristocetin-induced GPIb-vWF-mediated platelet agglutination, thus validating the findings of the proteomics study. These data reveal a novel role for thioredoxin in regulating platelet reactivity via proteins required for early platelet responses at sites of vessel injury (GPVI and GPIb). This work also highlights a potential opportunity for repurposing of PMX 464 and PX-12 as antiplatelet agents.

  12. The structural and functional organization of the vestibular apparatus of rats exposed to weightlessness for 20 days on board the Sputnik "Kosmos-782".

    PubMed

    Vinnikov, Y A; Gazenko, O G; Titova, L K; Bronstein, A A; Govardovskii, V I; Gribakin, F G; Pevzner, R A; Aronova, M Z; Kharkeevich, T A; Tsirulis, T P; Pyatkina, G A; Lichakov, D V; Pal'mbach, L P; Anichin, V F

    1979-01-01

    This investigation of the vestibular apparatus of rats exposed for 20 days to weightlessness on board an earth satellite and to acceleration during take-off and landing has revealed a set of changes in the structural and functional organization, such as adjoinment of the otolith to the utricle receptor surface and peripheral localization of the nucleoli inside the receptor cells' nuclei. Destruction of some receptor cells, apparently due to increased swelling of the vestibular apparatus tissue and alteration of the shape and structure of the otoconia were observed. In the horizontal crista, detachment of the cupula took place.

  13. LOCALIZATION OF CALCITONIN RECEPTOR-LIKE RECEPTOR (CLR) AND RECEPTOR ACTIVITY-MODIFYING PROTEIN 1 (RAMP1) IN HUMAN GASTROINTESTINAL TRACT

    PubMed Central

    Cottrell, Graeme S.; Alemi, Farzad; Kirkland, Jacob G.; Grady, Eileen F.; Corvera, Carlos U.; Bhargava, Aditi

    2012-01-01

    Calcitonin gene-related peptide (CGRP) exerts its diverse effects on vasodilation, nociception, secretion, and motor function through a heterodimeric receptor comprising of calcitonin receptor-like receptor (CLR) and receptor activity-modifying protein 1 (RAMP1). Despite the importance of CLR•RAMP1 in human disease, little is known about its distribution in the human gastrointestinal (GI) tract, where it participates in inflammation and pain. In this study, we determined that CLR and RAMP1 mRNAs are expressed in normal human stomach, ileum and colon by RT-PCR. We next characterized antibodies that we generated to rat CLR and RAMP1 in transfected HEK cells. Having characterized these antibodies in vitro, we then localized CLR-, RAMP1-, CGRP- and intermedin-immunoreactivity (IMD-IR) in various human GI segments. In the stomach, nerve bundles in the myenteric plexus and nerve fibers throughout the circular and longitudinal muscle had prominent CLR-IR. In the proximal colon and ileum, CLR was found in nerve varicosities of the myenteric plexus and surrounding submucosal neurons. Interestingly, CGRP expressing fibers did not co-localize, but were in close proximity to CLR. However, CLR and RAMP1, the two subunits of a functional CGRP receptor were clearly localized in myenteric plexus, where they may form functional cell-surface receptors. IMD, another member of calcitonin peptide family was also found in close proximity to CLR, and like CGRP, did not co-localize with either CLR or RAMP1 receptors. Thus, CGRP and IMD appear to be released locally, where they can mediate their effect on their receptors regulating diverse functions such as inflammation, pain and motility. PMID:22484227

  14. G-Protein Coupled Receptors: Surface Display and Biosensor Technology

    NASA Astrophysics Data System (ADS)

    McMurchie, Edward; Leifert, Wayne

    Signal transduction by G-protein coupled receptors (GPCRs) underpins a multitude of physiological processes. Ligand recognition by the receptor leads to the activation of a generic molecular switch involving heterotrimeric G-proteins and guanine nucleotides. With growing interest and commercial investment in GPCRs in areas such as drug targets, orphan receptors, high-throughput screening of drugs and biosensors, greater attention will focus on assay development to allow for miniaturization, ultrahigh-throughput and, eventually, microarray/biochip assay formats that will require nanotechnology-based approaches. Stable, robust, cell-free signaling assemblies comprising receptor and appropriate molecular switching components will form the basis of future GPCR/G-protein platforms, which should be able to be adapted to such applications as microarrays and biosensors. This chapter focuses on cell-free GPCR assay nanotechnologies and describes some molecular biological approaches for the construction of more sophisticated, surface-immobilized, homogeneous, functional GPCR sensors. The latter points should greatly extend the range of applications to which technologies based on GPCRs could be applied.

  15. α4α6β2* nicotinic acetylcholine receptor activation on ventral tegmental area dopamine neurons is sufficient to stimulate a depolarizing conductance and enhance surface AMPA receptor function.

    PubMed

    Engle, Staci E; Shih, Pei-Yu; McIntosh, J Michael; Drenan, Ryan M

    2013-09-01

    Tobacco addiction is a serious threat to public health in the United States and abroad, and development of new therapeutic approaches is a major priority. Nicotine activates and/or desensitizes nicotinic acetylcholine receptors (nAChRs) throughout the brain. nAChRs in ventral tegmental area (VTA) dopamine (DA) neurons are crucial for the rewarding and reinforcing properties of nicotine in rodents, suggesting that they may be key mediators of nicotine's action in humans. However, it is unknown which nAChR subtypes are sufficient to activate these neurons. To test the hypothesis that nAChRs containing α6 subunits are sufficient to activate VTA DA neurons, we studied mice expressing hypersensitive, gain-of-function α6 nAChRs (α6L9'S mice). In voltage-clamp recordings in brain slices from adult mice, 100 nM nicotine was sufficient to elicit inward currents in VTA DA neurons via α6β2* nAChRs. In addition, we found that low concentrations of nicotine could act selectively through α6β2* nAChRs to enhance the function of 2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid (AMPA) receptors on the surface of these cells. In contrast, α6β2* activation did not enhance N-methyl-D-aspartic acid receptor function. Finally, AMPA receptor (AMPAR) function was not similarly enhanced in brain slices from α6L9'S mice lacking α4 nAChR subunits, suggesting that α4α6β2* nAChRs are important for enhancing AMPAR function in VTA DA neurons. Together, these data suggest that activation of α4α6β2* nAChRs in VTA DA neurons is sufficient to support the initiation of cellular changes that play a role in addiction to nicotine. α4α6β2* nAChRs may be a promising target for future smoking cessation pharmacotherapy.

  16. A T-Cell Receptor Breaks the Rules | Center for Cancer Research

    Cancer.gov

    Most mature T cells function immunologically when a T-cell receptor (TCR) located on the cell surface encounters and engages its ligand, a major histocompatability complex (MHC), which displays a specific part of a target protein called an antigen. This antigen-presenting complex is assembled from one of the dozen or so MHC molecules that every person inherits from their

  17. Neurobeachin and the Kinesin KIF21B Are Critical for Endocytic Recycling of NMDA Receptors and Regulate Social Behavior.

    PubMed

    Gromova, Kira V; Muhia, Mary; Rothammer, Nicola; Gee, Christine E; Thies, Edda; Schaefer, Irina; Kress, Sabrina; Kilimann, Manfred W; Shevchuk, Olga; Oertner, Thomas G; Kneussel, Matthias

    2018-05-29

    Autism spectrum disorders (ASDs) are associated with mutations affecting synaptic components, including GluN2B-NMDA receptors (NMDARs) and neurobeachin (NBEA). NBEA participates in biosynthetic pathways to regulate synapse receptor targeting, synaptic function, cognition, and social behavior. However, the role of NBEA-mediated transport in specific trafficking routes is unclear. Here, we highlight an additional function for NBEA in the local delivery and surface re-insertion of synaptic receptors in mouse neurons. NBEA dynamically interacts with Rab4-positive recycling endosomes, transiently enters spines in an activity-dependent manner, and regulates GluN2B-NMDAR recycling. Furthermore, we show that the microtubule growth inhibitor kinesin KIF21B constrains NBEA dynamics and is present in the NBEA-recycling endosome-NMDAR complex. Notably, Kif21b knockout decreases NMDAR surface expression and alters social behavior in mice, consistent with reported social deficits in Nbea mutants. The influence of NBEA-KIF21B interactions on GluN2B-NMDAR local recycling may be relevant to mechanisms underlying ASD etiology. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Chemokine interactome mapping enables tailored intervention in acute and chronic inflammation.

    PubMed

    von Hundelshausen, Philipp; Agten, Stijn M; Eckardt, Veit; Blanchet, Xavier; Schmitt, Martin M; Ippel, Hans; Neideck, Carlos; Bidzhekov, Kiril; Leberzammer, Julian; Wichapong, Kanin; Faussner, Alexander; Drechsler, Maik; Grommes, Jochen; van Geffen, Johanna P; Li, He; Ortega-Gomez, Almudena; Megens, Remco T A; Naumann, Ronald; Dijkgraaf, Ingrid; Nicolaes, Gerry A F; Döring, Yvonne; Soehnlein, Oliver; Lutgens, Esther; Heemskerk, Johan W M; Koenen, Rory R; Mayo, Kevin H; Hackeng, Tilman M; Weber, Christian

    2017-04-05

    Chemokines orchestrate leukocyte trafficking and function in health and disease. Heterophilic interactions between chemokines in a given microenvironment may amplify, inhibit, or modulate their activity; however, a systematic evaluation of the chemokine interactome has not been performed. We used immunoligand blotting and surface plasmon resonance to obtain a comprehensive map of chemokine-chemokine interactions and to confirm their specificity. Structure-function analyses revealed that chemokine activity can be enhanced by CC-type heterodimers but inhibited by CXC-type heterodimers. Functional synergism was achieved through receptor heteromerization induced by CCL5-CCL17 or receptor retention at the cell surface via auxiliary proteoglycan binding of CCL5-CXCL4. In contrast, inhibitory activity relied on conformational changes (in CXCL12), affecting receptor signaling. Obligate CC-type heterodimers showed high efficacy and potency and drove acute lung injury and atherosclerosis, processes abrogated by specific CCL5-derived peptide inhibitors or knock-in of an interaction-deficient CXCL4 variant. Atheroprotective effects of CCL17 deficiency were phenocopied by a CCL5-derived peptide disrupting CCL5-CCL17 heterodimers, whereas a CCL5 α-helix peptide mimicked inhibitory effects on CXCL12-driven platelet aggregation. Thus, formation of specific chemokine heterodimers differentially dictates functional activity and can be exploited for therapeutic targeting. Copyright © 2017, American Association for the Advancement of Science.

  19. Cellular localization of the activated EGFR determines its effect on cell growth in MDA-MB-468 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hyatt, Dustin C.; Ceresa, Brian P.

    2008-11-01

    The epidermal growth factor (EGF) receptor (EGFR) is a ubiquitously expressed receptor tyrosine kinase that regulates diverse cell functions that are dependent upon cell type, the presence of downstream effectors, and receptor density. In addition to activating biochemical pathways, ligand stimulation causes the EGFR to enter the cell via clathrin-coated pits. Endocytic trafficking influences receptor signaling by controlling the duration of EGFR phosphorylation and coordinating the receptor's association with downstream effectors. To better understand the individual contributions of cell surface and cytosolic EGFRs on cell physiology, we used EGF that was conjugated to 900 nm polystyrene beads (EGF-beads). EGF-beads canmore » stimulate the EGFR and retain the activated receptor at the plasma membrane. In MDA-MB-468 cells, a breast cancer cell line that over-expresses the EGFR, only internalized, activated EGFRs stimulate caspase-3 and induce cell death. Conversely, signaling cascades triggered from activated EGFR retained at the cell surface inhibit caspase-3 and promote cell proliferation. Thus, through endocytosis, the activated EGFR can differentially regulate cell growth in MDA-MB-468 cells.« less

  20. The Phosphorylation of Vascular Endothelial Growth Factor Receptor-2 (VEGFR-2) by Engineered Surfaces with Electrostatically or Covalently Immobilized VEGF

    PubMed Central

    Anderson, Sean M.; Chen, Tom T.; Iruela-Arispe, M. Luisa; Segura, Tatiana

    2010-01-01

    Growth factors are a class of signaling proteins that direct cell fate through interaction with cell surface receptors. Although a myriad of possible cell fates stem from a growth factor binding to its receptor, the signaling cascades that result in one fate over another are still being elucidated. One possible mechanism by which nature modulates growth factor signaling is through the method of presentation of the growth factor – soluble or immobilized (matrix bound). Here we present the methodology to study signaling of soluble versus immobilized VEGF through VEGFR-2. We have designed a strategy to covalently immobilize VEGF using its heparin-binding domain to orient the molecule (bind) and a secondary functional group to mediate covalent binding (lock). This bind-and-lock approach aims to allow VEGF to assume a bioactive orientation before covalent immobilization. Surface plasmon resonance (SPR) demonstrated heparin and VEGF binding with surface densities of 60 ng/cm2 and 100 pg/cm2, respectively. ELISA experiments confirmed VEGF surface density and showed that electrostatically bound VEGF releases in cell medium and heparin solutions while covalently bound VEGF remains immobilized. Electrostatically bound VEGF and covalently bound VEGF phosphorylate VEGFR-2 in both VEGFR-2 transfected cells and VEGFR-2 endogenously producing cells. HUVECs plated on VEGF functionalized surfaces showed different morphologies between surface-bound VEGF and soluble VEGF. The surfaces synthesized in these studies allow for the study of VEGF/VEGFR-2 signaling induced by covalently bound, electrostatically bound, and soluble VEGF and may provide further insight into the design of materials for the generation of a mature and stable vasculature. PMID:19540581

  1. The C-type Lectin Langerin Functions as a Receptor for Attachment and Infectious Entry of Influenza A Virus

    PubMed Central

    Ng, Wy Ching; Londrigan, Sarah L.; Nasr, Najla; Cunningham, Anthony L.; Turville, Stuart; Brooks, Andrew G.

    2015-01-01

    ABSTRACT It is well established that influenza A virus (IAV) attachment to and infection of epithelial cells is dependent on sialic acid (SIA) at the cell surface, although the specific receptors that mediate IAV entry have not been defined and multiple receptors may exist. Lec2 Chinese hamster ovary (CHO) cells are SIA deficient and resistant to IAV infection. Here we demonstrate that the expression of the C-type lectin receptor langerin in Lec2 cells (Lec2-Lg) rendered them permissive to IAV infection, as measured by replication of the viral genome, transcription of viral mRNA, and synthesis of viral proteins. Unlike SIA-dependent infection of parental CHO cells, IAV attachment and infection of Lec2-Lg cells was mediated via lectin-mediated recognition of mannose-rich glycans expressed by the viral hemagglutinin glycoprotein. Lec2 cells expressing endocytosis-defective langerin bound IAV efficiently but remained resistant to IAV infection, confirming that internalization via langerin was essential for infectious entry. Langerin-mediated infection of Lec2-Lg cells was pH and dynamin dependent, occurred via clathrin- and caveolin-mediated endocytic pathways, and utilized early (Rab5+) but not late (Rab7+) endosomes. This study is the first to demonstrate that langerin represents an authentic receptor that binds and internalizes IAV to facilitate infection. Moreover, it describes a unique experimental system to probe specific pathways and compartments involved in infectious entry following recognition of IAV by a single cell surface receptor. IMPORTANCE On the surface of host cells, sialic acid (SIA) functions as the major attachment factor for influenza A viruses (IAV). However, few studies have identified specific transmembrane receptors that bind and internalize IAV to facilitate infection. Here we identify human langerin as a transmembrane glycoprotein that can act as an attachment factor and a bone fide endocytic receptor for IAV infection. Expression of langerin by an SIA-deficient cell line resistant to IAV rendered cells permissive to infection. As langerin represented the sole receptor for IAV infection in this system, we have defined the pathways and compartments involved in infectious entry of IAV into cells following recognition by langerin. PMID:26468543

  2. Modular Activating Receptors in Innate and Adaptive Immunity.

    PubMed

    Berry, Richard; Call, Matthew E

    2017-03-14

    Triggering of cell-mediated immunity is largely dependent on the recognition of foreign or abnormal molecules by a myriad of cell surface-bound receptors. Many activating immune receptors do not possess any intrinsic signaling capacity but instead form noncovalent complexes with one or more dimeric signaling modules that communicate with a common set of kinases to initiate intracellular information-transfer pathways. This modular architecture, where the ligand binding and signaling functions are detached from one another, is a common theme that is widely employed throughout the innate and adaptive arms of immune systems. The evolutionary advantages of this highly adaptable platform for molecular recognition are visible in the variety of ligand-receptor interactions that can be linked to common signaling pathways, the diversification of receptor modules in response to pathogen challenges, and the amplification of cellular responses through incorporation of multiple signaling motifs. Here we provide an overview of the major classes of modular activating immune receptors and outline the current state of knowledge regarding how these receptors assemble, recognize their ligands, and ultimately trigger intracellular signal transduction pathways that activate immune cell effector functions.

  3. Artificial receptor-functionalized nanoshell: facile preparation, fast separation and specific protein recognition

    NASA Astrophysics Data System (ADS)

    Ouyang, Ruizhuo; Lei, Jianping; Ju, Huangxian

    2010-05-01

    This work combined molecular imprinting technology with superparamagnetic nanospheres as the core to prepare artificial receptor-functionalized magnetic nanoparticles for separation of homologous proteins. Using dopamine as a functional monomer, novel surface protein-imprinted superparamagnetic polydopamine (PDA) core-shell nanoparticles were successfully prepared in physiological conditions, which could maintain the natural structure of a protein template and achieved the development of molecularly imprinted polymers (MIPs) from one dimension to zero dimension for efficient recognition towards large biomolecules. The resultant nanoparticles could be used for convenient magnetic separation of homologous proteins with high specificity. The nanoparticles possessed good monodispersibility, uniform surface morphology and high saturation magnetization value. The bound amounts of template proteins measured by both indirect and direct methods were in good agreement. The maximum number of imprinted cavities on the surface of the bovine hemoglobin (Hb)-imprinted nanoshell was 2.21 × 1018 g - 1, which well matched their maximum binding capacity toward bovine Hb. Both the simple method for preparation of MIPs and the magnetic nanospheres showed good application potential in fast separation, effective concentration and selective biosensing of large protein molecules.

  4. An intact PDZ motif is essential for correct P2Y12 purinoceptor traffic in human platelets

    PubMed Central

    Nisar, Shaista; Daly, Martina E.; Federici, Augusto B.; Artoni, Andrea; Mumford, Andrew D.; Watson, Stephen P.

    2011-01-01

    The platelet P2Y12 purinoceptor (P2Y12R), which plays a crucial role in hemostasis, undergoes internalization and subsequent recycling to maintain receptor responsiveness, processes that are essential for normal platelet function. Here, we observe that P2Y12R function is compromised after deletion or mutation of the 4 amino acids at the extreme C-terminus of this receptor (ETPM), a putative postsynaptic density 95/disc large/zonula occludens-1 (PDZ)–binding motif. In cell line models, removal of this sequence or mutation of one of its core residues (P341A), attenuates receptor internalization and receptor recycling back to the membrane, thereby blocking receptor resensitization. The physiologic significance of these findings in the regulation of platelet function is shown by identification of a patient with a heterozygous mutation in the PDZ binding sequence of their P2Y12R (P341A) that is associated with reduced expression of the P2Y12R on the cell surface. Importantly, platelets from this subject showed significantly compromised P2Y12R recycling, emphasizing the importance of the extreme C-terminus of this receptor to ensure correct receptor traffic. PMID:21937696

  5. Non-IgE mediated mast cell activation.

    PubMed

    Redegeld, Frank A; Yu, Yingxin; Kumari, Sangeeta; Charles, Nicolas; Blank, Ulrich

    2018-03-01

    Mast cells (MCs) are innate immune cells that are scattered in tissues throughout the organism being particularly abundant at sites exposed to the environment such as the skin and mucosal surfaces. Generally known for their role in IgE-mediated allergies, they have also important functions in the maintenance of tissue integrity by constantly sensing their microenvironment for signals by inflammatory triggers that can comprise infectious agents, toxins, hormones, alarmins, metabolic states, etc. When triggered their main function is to release a whole set of inflammatory mediators, cytokines, chemokines, and lipid products. This allows them to organize the ensuing innate immune and inflammatory response in tight coordination with resident tissue cells, other rapidly recruited immune effector cells as well as the endocrine and exocrine systems of the body. To complete these tasks, MCs are endowed with a large repertoire of receptors allowing them to respond to multiple stimuli or directly interact with other cells. Here we review some of the receptors expressed on MCs (ie, receptors for Immunoglobulins, pattern recognition receptors, nuclear receptors, receptors for alarmins, and a variety of other receptors) and discuss their functional implication in the immune and inflammatory response focusing on non-IgE-mediated activation mechanisms. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Evaluation of different strategies for magnetic particle functionalization with DNA aptamers.

    PubMed

    Pérez-Ruiz, Elena; Lammertyn, Jeroen; Spasic, Dragana

    2016-12-25

    The optimal bio-functionalization of magnetic particles is essential for developing magnetic particle-based bioassays. Whereas functionalization with antibodies is generally well established, immobilization of DNA probes, such as aptamers, is not yet fully explored. In this work, four different types of commercially available magnetic particles, coated with streptavidin, maleimide or carboxyl groups, were evaluated for their surface coverage with aptamer bioreceptors, efficiency in capturing target protein and non-specific protein adsorption on their surface. A recently developed aptamer against the peanut allergen, Ara h 1 protein, was used as a model system. Conjugation of biotinylated Ara h 1 aptamer to the streptavidin particles led to the highest surface coverage, whereas the coverage of maleimide particles was 25% lower. Carboxylated particles appeared to be inadequate for DNA functionalization. Streptavidin particles also showed the greatest target capturing efficiency, comparable to the one of particles functionalized with anti-Ara h 1 antibody. The performance of streptavidin particles was additionally tested in a sandwich assay with the aptamer as a capture receptor on the particle surface. While the limit of detection obtained was comparable to the same assay system with antibody as capture receptor, it was superior to previously reported values using the same aptamer in similar assay schemes with different detection platforms. These results point to the promising application of the Ara h 1 aptamer-functionalized particles in bioassay development. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. A functional role for CD28 costimulation in tumor recognition by single-chain receptor-modified T cells.

    PubMed

    Moeller, Maria; Haynes, Nicole M; Trapani, Joseph A; Teng, Michele W L; Jackson, Jacob T; Tanner, Jane E; Cerutti, Loretta; Jane, Stephen M; Kershaw, Michael H; Smyth, Mark J; Darcy, Phillip K

    2004-05-01

    T cells engineered to express single-chain antibody receptors that incorporate TCR-zeta and cluster designation (CD)28 signaling domains (scFv-alpha-erbB2-CD28-zeta) can be redirected in vivo to cancer cells that lack triggering costimulatory molecules. To assess the contribution of CD28 signaling to the function of the scFv-CD28-zeta receptor, we expressed a series of mutated scFv-CD28-zeta receptors directed against erbB2. Residues known to be critical for CD28 signaling were mutated from tyrosine to phenylalanine at position 170 or proline to alanine at positions 187 and 190. Primary mouse T cells expressing either of the mutant receptors demonstrated impaired cytokine (IFN-gamma and GM-CSF) production and decreased proliferation after antigen ligation in vitro and decreased antitumor efficacy in vivo compared with T cells expressing the wild-type scFv-CD28-zeta receptor, suggesting a key signaling role for the CD28 component of the scFv-CD28-zeta receptor. Importantly, cell surface expression, binding capacity and cytolytic activity mediated by the scFv-CD28-zeta receptor were not diminished by either mutation. Overall, this study has definitively demonstrated a functional role for the CD28 component of the scFv-CD28-zeta receptor and has shown that incorporation of costimulatory activity in chimeric scFv receptors is a powerful approach for improving adoptive cancer immunotherapy.

  8. Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

    PubMed

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

    2012-12-04

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

  9. Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

    PubMed Central

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

    2014-01-01

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

  10. Sialylated multivalent antigens engage CD22 in trans and inhibit B cell activation.

    PubMed

    Courtney, Adam H; Puffer, Erik B; Pontrello, Jason K; Yang, Zhi-Qiang; Kiessling, Laura L

    2009-02-24

    CD22 is an inhibitory coreceptor on the surface of B cells that attenuates B cell antigen receptor (BCR) signaling and, therefore, B cell activation. Elucidating the molecular mechanisms underlying the inhibitory activity of CD22 is complicated by the ubiquity of CD22 ligands. Although antigens can display CD22 ligands, the receptor is known to bind to sialylated glycoproteins on the cell surface. The propinquity of CD22 and cell-surface glycoprotein ligands has led to the conclusion that the inhibitory properties of the receptor are due to cis interactions. Here, we examine the functional consequences of trans interactions by employing sialylated multivalent antigens that can engage both CD22 and the BCR. Exposure of B cells to sialylated antigens results in the inhibition of key steps in BCR signaling. These results reveal that antigens bearing CD22 ligands are powerful suppressors of B cell activation. The ability of sialylated antigens to inhibit BCR signaling through trans CD22 interactions reveals a previously unrecognized role for the Siglec-family of receptors as modulators of immune signaling.

  11. Functional properties of internalization-deficient P2X4 receptors reveal a novel mechanism of ligand-gated channel facilitation by ivermectin.

    PubMed

    Toulmé, Estelle; Soto, Florentina; Garret, Maurice; Boué-Grabot, Eric

    2006-02-01

    Although P2X receptors within the central nervous system mediate excitatory ATP synaptic transmission, the identity of central ATP-gated channels has not yet been elucidated. P2X(4), the most widely expressed subunit in the brain, was previously shown to undergo clathrin-dependent constitutive internalization by direct interaction between activator protein (AP)2 adaptors and a tyrosine-based sorting signal specifically present in the cytosolic C-terminal tail of mammalian P2X(4) sequences. In this study, we first used internalization-deficient P2X(4) receptor mutants to show that suppression of the endocytosis motif significantly increased the apparent sensitivity to ATP and the ionic permeability of P2X(4) channels. These unique properties, observed at low channel density, suggest that interactions with AP2 complexes may modulate the function of P2X(4) receptors. In addition, ivermectin, an allosteric modulator of several receptor channels, including mammalian P2X(4), did not potentiate the maximal current of internalization-deficient rat or human P2X(4) receptors. We demonstrated that binding of ivermectin onto wild-type P2X(4) channels increased the fraction of plasma membrane P2X(4) receptors, whereas surface expression of internalization-deficient P2X(4) receptors remained unchanged. Disruption of the clathrin-mediated endocytosis with the dominant-negative mutants Eps15 or AP-50 abolished the ivermectin potentiation of wild-type P2X(4) channel currents. Likewise, ivermectin increased the membrane fraction of nicotinic alpha7 acetylcholine (nalpha7ACh) receptors and the potentiation of acetylcholine current by ivermectin was suppressed when the same dominant-negative mutants were expressed. These data showed that potentiation by ivermectin of both P2X(4) and nalpha7ACh receptors was primarily caused by an increase in the number of cell surface receptors resulting from a mechanism dependent on clathrin/AP2-mediated endocytosis.

  12. P2 receptor subtypes in the cardiovascular system.

    PubMed Central

    Kunapuli, S P; Daniel, J L

    1998-01-01

    Extracellular nucleotides have been implicated in a number of physiological functions. Nucleotides act on cell-surface receptors known as P2 receptors, of which several subtypes have been cloned. Both ATP and ADP are stored in platelets and are released upon platelet activation. Furthermore, nucleotides are also released from damaged or broken cells. Thus during vascular injury nucleotides play an important role in haemostasis through activation of platelets, modulation of vascular tone, recruitment of neutrophils and monocytes to the site of injury, and facilitation of adhesion of leucocytes to the endothelium. Nucleotides also moderate these functions by generating nitric oxide and prostaglandin I2 through activation of endothelial cells, and by activating different receptor subtypes on vascular smooth muscle cells. In the heart, P2 receptors regulate contractility through modulation of L-type Ca2+ channels, although the molecular mechanisms involved are still under investigation. Classical pharmacological studies have identified several P2 receptor subtypes in the cardiovascular system. Molecular pharmacological studies have clarified the nature of some of these receptors, but have complicated the picture with others. In platelets, the classical P2T receptor has now been resolved into three P2 receptor subtypes: the P2Y1, P2X1 and P2TAC receptors (the last of these, which is coupled to the inhibition of adenylate cyclase, is yet to be cloned). In peripheral blood leucocytes, endothelial cells, vascular smooth muscle cells and cardiomyocytes, the effects of classical P2X, P2Y and P2U receptors have been found to be mediated by more than one P2 receptor subtype. However, the exact functions of these multiple receptor subtypes remain to be understood, as P2-receptor-selective agonists and antagonists are still under development. PMID:9841859

  13. The lipid habitats of neurotransmitter receptors in brain.

    PubMed

    Borroni, María Virginia; Vallés, Ana Sofía; Barrantes, Francisco J

    2016-11-01

    Neurotransmitter receptors, the macromolecules specialized in decoding the chemical signals encrypted in the chemical signaling mechanism in the nervous system, occur either at the somatic cell surface of chemically excitable cells or at specialized subcellular structures, the synapses. Synapses have lipid compositions distinct from the rest of the cell membrane, suggesting that neurotransmitter receptors and their scaffolding and adaptor protein partners require specific lipid habitats for optimal operation. In this review we discuss some paradigmatic cases of neurotransmitter receptor-lipid interactions, highlighting the chemical nature of the intervening lipid species and providing examples of the receptor mechanisms affected by interaction with lipids. The focus is on the effects of cholesterol, glycerophospholipids and covalent fatty acid acylation on neurotransmitter receptors. We also briefly discuss the role of lipid phase states involving lateral heterogeneities of the host membrane known to modulate membrane transport, protein sorting and signaling. Modulation of neurotransmitter receptors by lipids occurs at multiple levels, affecting a wide span of activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, and recycling, among other important functional properties at the synapse. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Regulation of B cell functions by the sialic acid-binding receptors siglec-G and CD22.

    PubMed

    Jellusova, Julia; Nitschke, Lars

    2011-01-01

    B cell antigen receptor (BCR) engagement can lead to many different physiologic outcomes. To achieve an appropriate response, the BCR signal is interpreted in the context of other stimuli and several additional receptors on the B cell surface participate in the modulation of the signal. Two members of the Siglec (sialic acid-binding immunoglobulin-like lectin) family, CD22 and Siglec-G have been shown to inhibit the BCR signal. Recent findings indicate that the ability of these two receptors to bind sialic acids might be important to induce tolerance to self-antigens. Sialylated glycans are usually absent on microbes but abundant in higher vertebrates and might therefore provide an important tolerogenic signal. Since the expression of the specific ligands for Siglec-G and CD22 is tightly regulated and since Siglecs are not only able to bind their ligands in trans but also on the same cell surface this might provide additional mechanisms to control the BCR signal. Although both Siglec-G and CD22 are expressed on B cells and are able to inhibit BCR mediated signaling, they also show unique biological functions. While CD22 is the dominant regulator of calcium signaling on conventional B2 cells and also seems to play a role on marginal zone B cells, Siglec-G exerts its function mainly on B1 cells and influences their lifespan and antibody production. Both Siglec-G and CD22 have also recently been linked to toll-like receptor signaling and may provide a link in the regulation of the adaptive and innate immune response of B cells.

  15. Asialoglycoprotein receptor 1 is a specific cell-surface marker for isolating hepatocytes derived from human pluripotent stem cells.

    PubMed

    Peters, Derek T; Henderson, Christopher A; Warren, Curtis R; Friesen, Max; Xia, Fang; Becker, Caroline E; Musunuru, Kiran; Cowan, Chad A

    2016-05-01

    Hepatocyte-like cells (HLCs) are derived from human pluripotent stem cells (hPSCs) in vitro, but differentiation protocols commonly give rise to a heterogeneous mixture of cells. This variability confounds the evaluation of in vitro functional assays performed using HLCs. Increased differentiation efficiency and more accurate approximation of the in vivo hepatocyte gene expression profile would improve the utility of hPSCs. Towards this goal, we demonstrate the purification of a subpopulation of functional HLCs using the hepatocyte surface marker asialoglycoprotein receptor 1 (ASGR1). We analyzed the expression profile of ASGR1-positive cells by microarray, and tested their ability to perform mature hepatocyte functions (albumin and urea secretion, cytochrome activity). By these measures, ASGR1-positive HLCs are enriched for the gene expression profile and functional characteristics of primary hepatocytes compared with unsorted HLCs. We have demonstrated that ASGR1-positive sorting isolates a functional subpopulation of HLCs from among the heterogeneous cellular population produced by directed differentiation. © 2016. Published by The Company of Biologists Ltd.

  16. Visualizing High-Efficiency HIV Transfer | Center for Cancer Research

    Cancer.gov

    The Human Immunodeficiency Virus (HIV), the causative agent of Acquired Immunodeficiency Syndrome (AIDS), infects and eventually kills CD4 receptor-expressing T cells, which are critical for proper immune system function. The gp120 protein on the surface of HIV particles is known to bind CD4 and a co-receptor, either CCR5 or CXCR4, leading to fusion of the virus and T cell

  17. Immunostimulatory CpG-oligonucleotides induce functional high affinity IL-2 receptors on B-CLL cells: costimulation with IL-2 results in a highly immunogenic phenotype.

    PubMed

    Decker, T; Schneller, F; Kronschnabl, M; Dechow, T; Lipford, G B; Wagner, H; Peschel, C

    2000-05-01

    CpG-oligodeoxynucleotides (CpG-ODN) have been shown to induce proliferation, cytokine production, and surface molecule regulation in normal and malignant human B cells. In the present study, we investigated the potential of CpG-ODN to induce functional high-affinity receptors in leukemic and normal B cells and the effects of costimulation with IL-2 on proliferation, cytokine secretion, and surface molecule regulation. Highly purified B cells from B-CLL patients and normal controls were stimulated with CpG-ODN with or without IL-2. Expression of CD25 was determined using FACS, and the presence of high-affinity IL-2 receptors was determined by scatchard analysis. Costimulatory effects of IL-2 and CpG-ODN were investigated using proliferation assays, ELISA (IL-6, TNF-alpha), and FACS analysis (CD80, CD86 expression). Reactivity of autologous and allogeneic T cells toward activated B-CLL cells was determined in mixed lymphocyte reactions and Interferon-gamma Elispot assays. The CpG-ODN DSP30 caused a significantly stronger induction of the IL-2 receptor alpha chain in malignant as compared with normal B cells (p = 0.03). This resulted in the expression of functional high-affinity IL-2 receptors in B-CLL cells, but fewer numbers of receptors with less affinity were expressed in normal B cells. Although addition of IL-2 to CpG-ODN-stimulated cells augmented proliferation in both normal B cells and B-CLL cells, no costimulatory effect on cytokine production or surface molecule expression could be observed in normal B cells. In contrast, TNF-alpha and IL-6 production was increased in B-CLL cells, and the expression of CD80 and CD86 was further enhanced when IL-2 was used as a costimulus. Autologous and allogeneic immune recognition of B-CLL cells stimulated with CpG-ODN and IL-2 was increased compared with B-CLL cells stimulated with CpG-ODN alone. Stimulation of B-CLL cells with CpG-ODN and IL-2 might be an attractive strategy for potential immunotherapies for B-CLL patients.

  18. Sialylated Receptor Setting Influences Mycoplasma pneumoniae Attachment and Gliding Motility.

    PubMed

    Williams, Caitlin R; Chen, Li; Driver, Ashley D; Arnold, Edward A; Sheppard, Edward S; Locklin, Jason; Krause, Duncan C

    2018-06-08

    Mycoplasma pneumoniae is a common cause of human respiratory tract infections, including bronchitis and atypical pneumonia. M. pneumoniae binds glycoprotein receptors having terminal sialic acid residues via the P1 adhesin protein. Here we explored the impact of sialic acid presentation on M. pneumoniae adherence and gliding on surfaces coated with sialylated glycoproteins, or chemically functionalized with α-2,3- and α-2,6-sialyllactose ligated individually or in combination to a polymer scaffold in precisely controlled densities. In both models, gliding required a higher receptor density threshold than adherence, and receptor density influenced gliding frequency but not gliding speed. However, very high densities of α-2,3-sialyllactose actually reduced gliding frequency over peak levels observed at lower densities. Both α-2,3- and α-2,6-sialyllactose supported M. pneumoniae adherence, but gliding was only observed on the former. Finally, gliding on α-2,3-sialyllactose was inhibited on surfaces also conjugated with α-2,6-sialyllactose, suggesting that both moieties bind P1 despite the inability of the latter to support gliding. Our results indicate that the nature and density of host receptor moieties profoundly influences M. pneumoniae gliding, which could affect pathogenesis and infection outcome. Furthermore, precise functionalization of polymer scaffolds shows great promise for further analysis of sialic acid presentation and M. pneumoniae adherence and gliding. This article is protected by copyright. All rights reserved. © 2018 John Wiley & Sons Ltd.

  19. Structural and Functional Organization of the Vestibular Apparatus in Rats Subjected to Weightlessness for 19.5 Days Aboard the Kosmos-782 Satellite

    NASA Technical Reports Server (NTRS)

    Vinnikov, Y. A.; Gazenko, O. G.; Titova, L. K.; Bronshteyn, A. A.; Govardovskiy, V. I.; Pevzner, R. A.; Gribakin, G. G.; Aronova, M. Z.; Kharkeyevich, T. A.; Tsirulis, T. P.

    1978-01-01

    The vestibular apparatus was investigated in rats subjected to weightlessness for 19.5 days. The vestibular apparatus was removed and its sections were fixed in a glutaraldehyde solution for investigation by light and electron microscopes. Structural and functional charges were noted in the otolith portions of the ear, with the otolith particles clinging to the utricular receptor surface and with the peripheral arrangement of the nucleolus in the nuclei of the receptor cells. It is possible that increased edema of the vestibular tissue resulted in the destruction of some receptor cells and in changes in the form and structure of the otolith. In the horizontal crista, the capula was separated.

  20. T Cells Engineered With Chimeric Antigen Receptors Targeting NKG2D Ligands Display Lethal Toxicity in Mice

    PubMed Central

    VanSeggelen, Heather; Hammill, Joanne A; Dvorkin-Gheva, Anna; Tantalo, Daniela GM; Kwiecien, Jacek M; Denisova, Galina F; Rabinovich, Brian; Wan, Yonghong; Bramson, Jonathan L

    2015-01-01

    Ligands for the NKG2D receptor are overexpressed on tumors, making them interesting immunotherapy targets. To assess the tumoricidal properties of T cells directed to attack NKG2D ligands, we engineered murine T cells with two distinct NKG2D-based chimeric antigen receptors (CARs): (i) a fusion between the NKG2D receptor and the CD3ζ chain and (ii) a conventional second-generation CAR, where the extracellular domain of NKG2D was fused to CD28 and CD3ζ. To enhance the CAR surface expression, we also engineered T cells to coexpress DAP10. In vitro functionality and surface expression levels of all three CARs was greater in BALB/c T cells than C57BL/6 T cells, indicating strain-specific differences. Upon adoptive transfer of NKG2D-CAR-T cells into syngeneic animals, we observed significant clinical toxicity resulting in morbidity and mortality. The severity of these toxicities varied between the CAR configurations and paralleled their in vitro NKG2D surface expression. BALB/c mice were more sensitive to these toxicities than C57BL/6 mice, consistent with the higher in vitro functionality of BALB/c T cells. Treatment with cyclophosphamide prior to adoptive transfer exacerbated the toxicity. We conclude that while NKG2D ligands may be useful targets for immunotherapy, the pursuit of NKG2D-based CAR-T cell therapies should be undertaken with caution. PMID:26122933

  1. Identification of pathway-biased and deleterious melatonin receptor mutants in autism spectrum disorders and in the general population.

    PubMed

    Chaste, Pauline; Clement, Nathalie; Mercati, Oriane; Guillaume, Jean-Luc; Delorme, Richard; Botros, Hany Goubran; Pagan, Cécile; Périvier, Samuel; Scheid, Isabelle; Nygren, Gudrun; Anckarsäter, Henrik; Rastam, Maria; Ståhlberg, Ola; Gillberg, Carina; Serrano, Emilie; Lemière, Nathalie; Launay, Jean Marie; Mouren-Simeoni, Marie Christine; Leboyer, Marion; Gillberg, Christopher; Jockers, Ralf; Bourgeron, Thomas

    2010-07-15

    Melatonin is a powerful antioxidant and a synchronizer of many physiological processes. Alteration of the melatonin pathway has been reported in circadian disorders, diabetes and autism spectrum disorders (ASD). However, very little is known about the genetic variability of melatonin receptors in humans. Here, we sequenced the melatonin receptor MTNR1A and MTNR1B, genes coding for MT1 and MT2 receptors, respectively, in a large panel of 941 individuals including 295 patients with ASD, 362 controls and 284 individuals from different ethnic backgrounds. We also sequenced GPR50, coding for the orphan melatonin-related receptor GPR50 in patients and controls. We identified six non-synonymous mutations for MTNR1A and ten for MTNR1B. The majority of these variations altered receptor function. Particularly interesting mutants are MT1-I49N, which is devoid of any melatonin binding and cell surface expression, and MT1-G166E and MT1-I212T, which showed severely impaired cell surface expression. Of note, several mutants possessed pathway-selective signaling properties, some preferentially inhibiting the adenylyl cyclase pathway, others preferentially activating the MAPK pathway. The prevalence of these deleterious mutations in cases and controls indicates that they do not represent major risk factor for ASD (MTNR1A case 3.6% vs controls 4.4%; MTNR1B case 4.7% vs 3% controls). Concerning GPR50, we detected a significant association between ASD and two variations, Delta502-505 and T532A, in affected males, but it did not hold up after Bonferonni correction for multiple testing. Our results represent the first functional ascertainment of melatonin receptors in humans and constitute a basis for future structure-function studies and for interpreting genetic data on the melatonin pathway in patients.

  2. The G-protein coupled estrogen receptor, GPER: The inside and inside-out story.

    PubMed

    Gaudet, H M; Cheng, S B; Christensen, E M; Filardo, E J

    2015-12-15

    GPER possesses structural and functional characteristics shared by members of the G-protein-coupled receptor (GPCR) superfamily, the largest class of plasma membrane receptors. This newly appreciated estrogen receptor is localized predominately within intracellular membranes in most, but not all, cell types and its surface expression is modulated by steroid hormones and during tissue injury. An intracellular staining pattern is not unique among GPCRs, which employ a diverse array of molecular mechanisms that restrict cell surface expression and effectively regulating receptor binding and activation. The finding that GPER displays an intracellular predisposition has created some confusion as the estrogen-inducible transcription factors, ERα and ERβ, also reside intracellularly, and has led to complex suggestions of receptor interaction. GPER undergoes constitutive retrograde trafficking from the plasma membrane to the endoplasmic reticulum and recent studies indicate its interaction with PDZ binding proteins that sort transmembrane receptors to synaptosomes and endosomes. Genetic targeting and selective ligand approaches as well as cell models that express GPER in the absence of ERs clearly supports GPER as a bonafide "stand alone" receptor. Here, the molecular details that regulate GPER action, its cell biological activities and its implicated roles in physiological and pathological processes are reviewed. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. SPRi-based biosensing platforms for detection of specific DNA sequences using thiolate and dithiocarbamate assemblies

    NASA Astrophysics Data System (ADS)

    Drozd, Marcin; Pietrzak, Mariusz D.; Malinowska, Elżbieta

    2018-05-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0,66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 ·1012 molecules • cm-2 (with the calculated area occupied by single nanoparticle label of 132.7 nm2), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  4. SPRi-Based Biosensing Platforms for Detection of Specific DNA Sequences Using Thiolate and Dithiocarbamate Assemblies.

    PubMed

    Drozd, Marcin; Pietrzak, Mariusz D; Malinowska, Elżbieta

    2018-01-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0.66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 · 10 12 molecules · cm -2 (with the calculated area occupied by single nanoparticle label of ~132.7 nm 2 ), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  5. Both host and parasite MIF molecules bind to chicken macrophages via CD74 surface receptor

    USDA-ARS?s Scientific Manuscript database

    Macrophage migration inhibitory factor (MIF) is recognized as a soluble factor that inhibits the random migration of macrophages and plays a pivotal immunoregulatory function in innate and adaptive immunity. Our group has identified both chicken and Eimeria MIFs, and characterized their function in...

  6. Receptor homodimerization plays a critical role in a novel dominant negative P2RY12 variant identified in a family with severe bleeding.

    PubMed

    Mundell, S J; Rabbolini, D; Gabrielli, S; Chen, Q; Aungraheeta, R; Hutchinson, J L; Kilo, T; Mackay, J; Ward, C M; Stevenson, W; Morel-Kopp, M-C

    2018-01-01

    Essentials Three dominant variants for the autosomal recessive bleeding disorder type-8 have been described. To date, there has been no phenotype/genotype correlation explaining their dominant transmission. Proline plays an important role in P2Y12R ligand binding and signaling defects. P2Y12R homodimer formation is critical for the receptor function and signaling. Background Although inherited platelet disorders are still underdiagnosed worldwide, advances in molecular techniques are improving disease diagnosis and patient management. Objective To identify and characterize the mechanism underlying the bleeding phenotype in a Caucasian family with an autosomal dominant P2RY12 variant. Methods Full blood counts, platelet aggregometry, flow cytometry and western blotting were performed before next-generation sequencing (NGS). Detailed molecular analysis of the identified variant of the P2Y12 receptor (P2Y12R) was subsequently performed in mammalian cells overexpressing receptor constructs. Results All three referred individuals had markedly impaired ADP-induced platelet aggregation with primary wave only, despite normal total and surface P2Y12R expression. By NGS, a single P2RY12:c.G794C substitution (p.R265P) was identified in all affected individuals, and this was confirmed by Sanger sequencing. Mammalian cell experiments with the R265P-P2Y12R variant showed normal receptor surface expression versus wild-type (WT) P2Y12R. Agonist-stimulated R265P-P2Y12R function (both signaling and surface receptor loss) was reduced versus WT P2Y12R. Critically, R265P-P2Y12R acted in a dominant negative manner, with agonist-stimulated WT P2Y12R activity being reduced by variant coexpression, suggesting dramatic loss of WT homodimers. Importantly, platelet P2RY12 cDNA cloning and sequencing in two affected individuals also revealed three-fold mutant mRNA overexpression, decreasing even further the likelihood of WT homodimer formation. R265 located within extracellular loop 3 (EL3) is one of four residues that are important for receptor functional integrity, maintaining the binding pocket conformation and allowing rotation following ligand binding. Conclusion This novel dominant negative variant confirms the important role of R265 in EL3 in the functional integrity of P2Y12R, and suggests that pathologic heterodimer formation may underlie this family bleeding phenotype. © 2017 International Society on Thrombosis and Haemostasis.

  7. Formation of the long range Dpp morphogen gradient.

    PubMed

    Schwank, Gerald; Dalessi, Sascha; Yang, Schu-Fee; Yagi, Ryohei; de Lachapelle, Aitana Morton; Affolter, Markus; Bergmann, Sven; Basler, Konrad

    2011-07-01

    The TGF-β homolog Decapentaplegic (Dpp) acts as a secreted morphogen in the Drosophila wing disc, and spreads through the target tissue in order to form a long range concentration gradient. Despite extensive studies, the mechanism by which the Dpp gradient is formed remains controversial. Two opposing mechanisms have been proposed: receptor-mediated transcytosis (RMT) and restricted extracellular diffusion (RED). In these scenarios the receptor for Dpp plays different roles. In the RMT model it is essential for endocytosis, re-secretion, and thus transport of Dpp, whereas in the RED model it merely modulates Dpp distribution by binding it at the cell surface for internalization and subsequent degradation. Here we analyzed the effect of receptor mutant clones on the Dpp profile in quantitative mathematical models representing transport by either RMT or RED. We then, using novel genetic tools, experimentally monitored the actual Dpp gradient in wing discs containing receptor gain-of-function and loss-of-function clones. Gain-of-function clones reveal that Dpp binds in vivo strongly to the type I receptor Thick veins, but not to the type II receptor Punt. Importantly, results with the loss-of-function clones then refute the RMT model for Dpp gradient formation, while supporting the RED model in which the majority of Dpp is not bound to Thick veins. Together our results show that receptor-mediated transcytosis cannot account for Dpp gradient formation, and support restricted extracellular diffusion as the main mechanism for Dpp dispersal. The properties of this mechanism, in which only a minority of Dpp is receptor-bound, may facilitate long-range distribution.

  8. A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons.

    PubMed

    Li, Shu-Jing; Vaughan, Alexander; Sturgill, James Fitzhugh; Kepecs, Adam

    2018-06-06

    Retrogradely transported neurotropic viruses enable genetic access to neurons based on their long-range projections and have become indispensable tools for linking neural connectivity with function. A major limitation of viral techniques is that they rely on cell-type-specific molecules for uptake and transport. Consequently, viruses fail to infect variable subsets of neurons depending on the complement of surface receptors expressed (viral tropism). We report a receptor complementation strategy to overcome this by potentiating neurons for the infection of the virus of interest-in this case, canine adenovirus type-2 (CAV-2). We designed AAV vectors for expressing the coxsackievirus and adenovirus receptor (CAR) throughout candidate projection neurons. CAR expression greatly increased retrograde-labeling rates, which we demonstrate for several long-range projections, including some resistant to other retrograde-labeling techniques. Our results demonstrate a receptor complementation strategy to abrogate endogenous viral tropism and thereby facilitate efficient retrograde targeting for functional analysis of neural circuits. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Responses to Microbial Challenges by SLAMF Receptors

    PubMed Central

    van Driel, Boaz Job; Liao, Gongxian; Engel, Pablo; Terhorst, Cox

    2016-01-01

    The SLAMF family (SLAMF) of cell surface glycoproteins is comprised of nine glycoproteins and while SLAMF1, 3, 5, 6, 7, 8, and 9 are self-ligand receptors, SLAMF2 and SLAMF4 interact with each other. Their interactions induce signal transduction networks in trans, thereby shaping immune cell–cell communications. Collectively, these receptors modulate a wide range of functions, such as myeloid cell and lymphocyte development, and T and B cell responses to microbes and parasites. In addition, several SLAMF receptors serve as microbial sensors, which either positively or negatively modulate the function of macrophages, dendritic cells, neutrophils, and NK cells in response to microbial challenges. The SLAMF receptor–microbe interactions contribute both to intracellular microbicidal activity as well as to migration of phagocytes to the site of inflammation. In this review, we describe the current knowledge on how the SLAMF receptors and their specific adapters SLAM-associated protein and EAT-2 regulate innate and adaptive immune responses to microbes. PMID:26834746

  10. Endocytic function is critical for influenza A virus infection via DC-SIGN and L-SIGN

    PubMed Central

    Gillespie, Leah; Roosendahl, Paula; Ng, Wy Ching; Brooks, Andrew G.; Reading, Patrick C.; Londrigan, Sarah L.

    2016-01-01

    The ubiquitous presence of cell-surface sialic acid (SIA) has complicated efforts to identify specific transmembrane glycoproteins that function as bone fide entry receptors for influenza A virus (IAV) infection. The C-type lectin receptors (CLRs) DC-SIGN (CD209) and L-SIGN (CD209L) enhance IAV infection however it is not known if they act as attachment factors, passing virions to other unknown receptors for virus entry, or as authentic entry receptors for CLR-mediated virus uptake and infection. Sialic acid-deficient Lec2 Chinese Hamster Ovary (CHO) cell lines were resistant to IAV infection whereas expression of DC-SIGN/L-SIGN restored susceptibility of Lec2 cells to pH- and dynamin-dependent infection. Moreover, Lec2 cells expressing endocytosis-defective DC-SIGN/L-SIGN retained capacity to bind IAV but showed reduced susceptibility to infection. These studies confirm that DC-SIGN and L-SIGN are authentic endocytic receptors for IAV entry and infection. PMID:26763587

  11. REEPs Are Membrane Shaping Adapter Proteins That Modulate Specific G Protein-Coupled Receptor Trafficking by Affecting ER Cargo Capacity

    PubMed Central

    Ho, Vincent K.; Angelotti, Timothy

    2013-01-01

    Receptor expression enhancing proteins (REEPs) were identified by their ability to enhance cell surface expression of a subset of G protein-coupled receptors (GPCRs), specifically GPCRs that have proven difficult to express in heterologous cell systems. Further analysis revealed that they belong to the Yip (Ypt-interacting protein) family and that some REEP subtypes affect ER structure. Yip family comparisons have established other potential roles for REEPs, including regulation of ER-Golgi transport and processing/neuronal localization of cargo proteins. However, these other potential REEP functions and the mechanism by which they selectively enhance GPCR cell surface expression have not been clarified. By utilizing several REEP family members (REEP1, REEP2, and REEP6) and model GPCRs (α2A and α2C adrenergic receptors), we examined REEP regulation of GPCR plasma membrane expression, intracellular processing, and trafficking. Using a combination of immunolocalization and biochemical methods, we demonstrated that this REEP subset is localized primarily to ER, but not plasma membranes. Single cell analysis demonstrated that these REEPs do not specifically enhance surface expression of all GPCRs, but affect ER cargo capacity of specific GPCRs and thus their surface expression. REEP co-expression with α2 adrenergic receptors (ARs) revealed that this REEP subset interacts with and alter glycosidic processing of α2C, but not α2A ARs, demonstrating selective interaction with cargo proteins. Specifically, these REEPs enhanced expression of and interacted with minimally/non-glycosylated forms of α2C ARs. Most importantly, expression of a mutant REEP1 allele (hereditary spastic paraplegia SPG31) lacking the carboxyl terminus led to loss of this interaction. Thus specific REEP isoforms have additional intracellular functions besides altering ER structure, such as enhancing ER cargo capacity, regulating ER-Golgi processing, and interacting with select cargo proteins. Therefore, some REEPs can be further described as ER membrane shaping adapter proteins. PMID:24098485

  12. Rescue of dopamine transporter function in hypoinsulinemic rats by a D2 receptor-ERK-dependent mechanism.

    PubMed

    Owens, W Anthony; Williams, Jason M; Saunders, Christine; Avison, Malcolm J; Galli, Aurelio; Daws, Lynette C

    2012-02-22

    The dopamine (DA) transporter (DAT) is a major target for abused drugs and a key regulator of extracellular DA. A rapidly growing literature implicates insulin as an important regulator of DAT function. We showed previously that amphetamine (AMPH)-evoked DA release is markedly impaired in rats depleted of insulin with the diabetogenic agent streptozotocin (STZ). Similarly, functional magnetic resonance imaging experiments revealed that the blood oxygenation level-dependent signal following acute AMPH administration in STZ-treated rats is reduced. Here, we report that these deficits are restored by repeated, systemic administration of AMPH (1.78 mg/kg, every other day for 8 d). AMPH stimulates DA D(2) receptors indirectly by increasing extracellular DA. Supporting a role for D(2) receptors in mediating this "rescue," the effect was completely blocked by pre-treatment of STZ-treated rats with the D(2) receptor antagonist raclopride before systemic AMPH. D(2) receptors regulate DAT cell surface expression through ERK1/2 signaling. In ex vivo striatal preparations, repeated AMPH injections increased immunoreactivity of phosphorylated ERK1/2 (p-ERK1/2) in STZ-treated but not control rats. These data suggest that repeated exposure to AMPH can rescue, by activating D(2) receptors and p-ERK signaling, deficits in DAT function that result from hypoinsulinemia. Our data confirm the idea that disorders influencing insulin levels and/or signaling, such as diabetes and anorexia, can degrade DAT function and that insulin-independent pathways are present that may be exploited as potential therapeutic targets to restore normal DAT function.

  13. Characterization and extraction of the synaptic apposition surface for synaptic geometry analysis

    PubMed Central

    Morales, Juan; Rodríguez, Angel; Rodríguez, José-Rodrigo; DeFelipe, Javier; Merchán-Pérez, Angel

    2013-01-01

    Geometrical features of chemical synapses are relevant to their function. Two critical components of the synaptic junction are the active zone (AZ) and the postsynaptic density (PSD), as they are related to the probability of synaptic release and the number of postsynaptic receptors, respectively. Morphological studies of these structures are greatly facilitated by the use of recent electron microscopy techniques, such as combined focused ion beam milling and scanning electron microscopy (FIB/SEM), and software tools that permit reconstruction of large numbers of synapses in three dimensions. Since the AZ and the PSD are in close apposition and have a similar surface area, they can be represented by a single surface—the synaptic apposition surface (SAS). We have developed an efficient computational technique to automatically extract this surface from synaptic junctions that have previously been three-dimensionally reconstructed from actual tissue samples imaged by automated FIB/SEM. Given its relationship with the release probability and the number of postsynaptic receptors, the surface area of the SAS is a functionally relevant measure of the size of a synapse that can complement other geometrical features like the volume of the reconstructed synaptic junction, the equivalent ellipsoid size and the Feret's diameter. PMID:23847474

  14. Inhibitors for Androgen Receptor Activation Surfaces

    DTIC Science & Technology

    2008-09-01

    such as FKBP52 or HSP90 bind in vivo, and started a collaboration with Marc Cox at UT El Paso to test these possibilities. Our assays of mutated amino...will complete testing the compounds in full length AR constructs and publish the results. We have begun two collaborations, one with Marc Cox on...Prof. Marc Cox and Dr. Paul Rennie to identify proteins that bind to BF3 so that we may form crystals of the receptor with these proteins and learn more about function of the human androgen receptor.

  15. Parkin Deficiency Reduces Hippocampal Glutamatergic Neurotransmission by Impairing AMPA Receptor Endocytosis.

    PubMed

    Cortese, Giuseppe P; Zhu, Mei; Williams, Damian; Heath, Sarah; Waites, Clarissa L

    2016-11-30

    Mutations in the gene encoding Parkin, an E3 ubiquitin ligase, lead to juvenile-onset Parkinson's disease by inducing the selective death of midbrain dopaminergic neurons. Accumulating evidence indicates that Parkin also has an important role in excitatory glutamatergic neurotransmission, although its precise mechanism of action remains unclear. Here, we investigate Parkin's role at glutamatergic synapses of rat hippocampal neurons. We find that Parkin-deficient neurons exhibit significantly reduced AMPA receptor (AMPAR)-mediated currents and cell-surface expression, and that these phenotypes result from decreased postsynaptic expression of the adaptor protein Homer1, which is necessary for coupling AMPAR endocytic zones with the postsynaptic density. Accordingly, Parkin loss of function leads to the reduced density of postsynaptic endocytic zones and to impaired AMPAR internalization. These findings demonstrate a novel and essential role for Parkin in glutamatergic neurotransmission, as a stabilizer of postsynaptic Homer1 and the Homer1-linked endocytic machinery necessary for maintaining normal cell-surface AMPAR levels. Mutations in Parkin, a ubiquitinating enzyme, lead to the selective loss of midbrain dopaminergic neurons and juvenile-onset Parkinson's disease (PD). Parkin loss of function has also been shown to alter hippocampal glutamatergic neurotransmission, providing a potential explanation for PD-associated cognitive impairment. However, very little is known about Parkin's specific sites or mechanisms of action at glutamatergic synapses. Here, we show that Parkin deficiency leads to decreased AMPA receptor-mediated activity due to disruption of the postsynaptic endocytic zones required for maintaining proper cell-surface AMPA receptor levels. These findings demonstrate a novel role for Parkin in synaptic AMPA receptor internalization and suggest a Parkin-dependent mechanism for hippocampal dysfunction that may explain cognitive deficits associated with some forms of PD. Copyright © 2016 the authors 0270-6474/16/3612243-16$15.00/0.

  16. Na, K-ATPase activity regulates AMPA receptor turnover through proteasome-mediated proteolysis

    PubMed Central

    Zhang, Dawei; Hou, Qingming; Wang, Min; Lin, Amy; Jarzylo, Larissa; Navis, Allison; Raissi, Aram; Liu, Fang; Man, Heng-Ye

    2009-01-01

    Neuronal activity largely depends on two key components on the membrane: the Na, K-ATPase (NKA) that maintains the ion gradients and sets the foundation of excitability, and the ionotropic glutamatergic AMPA receptors (AMPARs) through which sodium influx forms the driving force for excitation. Because the frequent sodium transients from glutamate receptor activity need to be efficiently extruded, a functional coupling between NKA and AMPARs should be a necessary cellular device for synapse physiology. We show that NKA is enriched at synapses and associates with AMPARs. NKA dysfunction induces a rapid reduction in AMPAR cell-surface expression as well as total protein abundance, leading to a long-lasting depression in synaptic transmission. AMPAR proteolysis requires sodium influx, proteasomal activity and receptor internalization. These data elucidate a novel mechanism by which NKA regulates AMPAR turnover and thereby synaptic strength and brain function. PMID:19357275

  17. Hippocampal LTP and contextual learning require surface diffusion of AMPA receptors.

    PubMed

    Penn, A C; Zhang, C L; Georges, F; Royer, L; Breillat, C; Hosy, E; Petersen, J D; Humeau, Y; Choquet, D

    2017-09-21

    Long-term potentiation (LTP) of excitatory synaptic transmission has long been considered a cellular correlate for learning and memory. Early LTP (less than 1 h) had initially been explained either by presynaptic increases in glutamate release or by direct modification of postsynaptic AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptor function. Compelling models have more recently proposed that synaptic potentiation can occur by the recruitment of additional postsynaptic AMPA receptors (AMPARs), sourced either from an intracellular reserve pool by exocytosis or from nearby extra-synaptic receptors pre-existing on the neuronal surface. However, the exact mechanism through which synapses can rapidly recruit new AMPARs during early LTP remains unknown. In particular, direct evidence for a pivotal role of AMPAR surface diffusion as a trafficking mechanism in synaptic plasticity is still lacking. Here, using AMPAR immobilization approaches, we show that interfering with AMPAR surface diffusion markedly impairs synaptic potentiation of Schaffer collaterals and commissural inputs to the CA1 area of the mouse hippocampus in cultured slices, acute slices and in vivo. Our data also identify distinct contributions of various AMPAR trafficking routes to the temporal profile of synaptic potentiation. In addition, AMPAR immobilization in vivo in the dorsal hippocampus inhibited fear conditioning, indicating that AMPAR diffusion is important for the early phase of contextual learning. Therefore, our results provide a direct demonstration that the recruitment of new receptors to synapses by surface diffusion is a critical mechanism for the expression of LTP and hippocampal learning. Since AMPAR surface diffusion is dictated by weak Brownian forces that are readily perturbed by protein-protein interactions, we anticipate that this fundamental trafficking mechanism will be a key target for modulating synaptic potentiation and learning.

  18. Large-scale production and study of a synthetic G protein-coupled receptor: Human olfactory receptor 17-4

    PubMed Central

    Cook, Brian L.; Steuerwald, Dirk; Kaiser, Liselotte; Graveland-Bikker, Johanna; Vanberghem, Melanie; Berke, Allison P.; Herlihy, Kara; Pick, Horst; Vogel, Horst; Zhang, Shuguang

    2009-01-01

    Although understanding of the olfactory system has progressed at the level of downstream receptor signaling and the wiring of olfactory neurons, the system remains poorly understood at the molecular level of the receptors and their interaction with and recognition of odorant ligands. The structure and functional mechanisms of these receptors still remain a tantalizing enigma, because numerous previous attempts at the large-scale production of functional olfactory receptors (ORs) have not been successful to date. To investigate the elusive biochemistry and molecular mechanisms of olfaction, we have developed a mammalian expression system for the large-scale production and purification of a functional OR protein in milligram quantities. Here, we report the study of human OR17-4 (hOR17-4) purified from a HEK293S tetracycline-inducible system. Scale-up of production yield was achieved through suspension culture in a bioreactor, which enabled the preparation of >10 mg of monomeric hOR17-4 receptor after immunoaffinity and size exclusion chromatography, with expression yields reaching 3 mg/L of culture medium. Several key post-translational modifications were identified using MS, and CD spectroscopy showed the receptor to be ≈50% α-helix, similar to other recently determined G protein-coupled receptor structures. Detergent-solubilized hOR17-4 specifically bound its known activating odorants lilial and floralozone in vitro, as measured by surface plasmon resonance. The hOR17-4 also recognized specific odorants in heterologous cells as determined by calcium ion mobilization. Our system is feasible for the production of large quantities of OR necessary for structural and functional analyses and research into OR biosensor devices. PMID:19581598

  19. Large-scale production and study of a synthetic G protein-coupled receptor: human olfactory receptor 17-4.

    PubMed

    Cook, Brian L; Steuerwald, Dirk; Kaiser, Liselotte; Graveland-Bikker, Johanna; Vanberghem, Melanie; Berke, Allison P; Herlihy, Kara; Pick, Horst; Vogel, Horst; Zhang, Shuguang

    2009-07-21

    Although understanding of the olfactory system has progressed at the level of downstream receptor signaling and the wiring of olfactory neurons, the system remains poorly understood at the molecular level of the receptors and their interaction with and recognition of odorant ligands. The structure and functional mechanisms of these receptors still remain a tantalizing enigma, because numerous previous attempts at the large-scale production of functional olfactory receptors (ORs) have not been successful to date. To investigate the elusive biochemistry and molecular mechanisms of olfaction, we have developed a mammalian expression system for the large-scale production and purification of a functional OR protein in milligram quantities. Here, we report the study of human OR17-4 (hOR17-4) purified from a HEK293S tetracycline-inducible system. Scale-up of production yield was achieved through suspension culture in a bioreactor, which enabled the preparation of >10 mg of monomeric hOR17-4 receptor after immunoaffinity and size exclusion chromatography, with expression yields reaching 3 mg/L of culture medium. Several key post-translational modifications were identified using MS, and CD spectroscopy showed the receptor to be approximately 50% alpha-helix, similar to other recently determined G protein-coupled receptor structures. Detergent-solubilized hOR17-4 specifically bound its known activating odorants lilial and floralozone in vitro, as measured by surface plasmon resonance. The hOR17-4 also recognized specific odorants in heterologous cells as determined by calcium ion mobilization. Our system is feasible for the production of large quantities of OR necessary for structural and functional analyses and research into OR biosensor devices.

  20. Surface functions during mitosis. III. Quantitative analysis of ligand- receptor movement into the cleavage furrow: diffusion vs. flow

    PubMed Central

    1982-01-01

    The surface distribution of concanavalin A (Con A) bound to cell membrane receptors varies dramatically as a function of mitotic phase. The lectin is distributed diffusely on cells labeled and observed between mid-prophase and early anaphase, whereas cells observed in late anaphase or telophase demonstrate a marked accumulation of Con A- receptor complexes over the developing cleavage furrow (Berlin, Oliver, and Walter. 1978. Cell. 15:327-341). In this report, we first use a system based on video intensification fluorescence microscopy to describe the simultaneous changes in cell shape and in lectin-receptor complex topography during progression of single cells through the mitotic cycle. The video analysis establishes that fluorescein succinyl Con A (F-S Con A)-receptor complex redistribution begins coincident with the first appearance of the cleavage furrow and is essentially complete within 2-3 min. This remarkable redistribution of surface fluorescence occurs during only a modest change in cell shape from a sphere to a belted cylinder. It reflects the translocation of complexes and not the accumulation of excess labeled membrane in the cleavage furrow: first, bound fluorescent cholera toxin which faithfully outlines the plasma membrane is not accumulated in the cleavage furrow, and, second, electron microscopy of peroxidase-Con A labeled cells undergoing cleavage shows that there is a high linear density of lectin within the furrow while Con A is virtually eliminated from the poles. The rate of surface movement of F-S Con A was quantitated by photon counting during a repetitive series of laser-excited fluorescence scans across dividing cells. Results were analyzed in terms of two alternative models of movement: a flow model in which complexes moved unidirectionally at constant velocity, and a diffusion model in which complexes could diffuse freely but were trapped at the cleavage furrow. According to these models, the observed rates of accumulation were attainable at either an effective flow velocity of approximately 1 micron/min, or an effective diffusion coefficient of approximately 10(- 9) cm2/s. However, in separate experiments the lectin-receptor diffusion rate measured directly by the method of fluorescence recovery after photobleaching (FRAP) on metaphase cells was only approximately 10(-10) cm2/s. Most importantly, photobleaching experiments during the actual period of F-S Con A accumulation showed that lectin-receptor movement during cleavage occurs unidirectionally. These results rule out diffusion and make a process of oriented flow of ligand-receptor complexes the most likely mechanism for ligand-receptor accumulation in the cleavage furrow. PMID:7119007

  1. Steroid receptors and their ligands: Effects on male gamete functions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aquila, Saveria; De Amicis, Francesca, E-mail: francesca.deamicis@unical.it

    In recent years a new picture of human sperm biology is emerging. It is now widely recognized that sperm contain nuclear encoded mRNA, mitochondrial encoded RNA and different transcription factors including steroid receptors, while in the past sperm were considered incapable of transcription and translation. One of the main targets of steroid hormones and their receptors is reproductive function. Expression studies on Progesterone Receptor, estrogen receptor, androgen receptor and their specific ligands, demonstrate the presence of these systems in mature spermatozoa as surface but also as nuclear conventional receptors, suggesting that both systemic and local steroid hormones, through sperm receptors,more » may influence male reproduction. However, the relationship between the signaling events modulated by steroid hormones and sperm fertilization potential as well as the possible involvement of the specific receptors are still controversial issues. The main line of this review highlights the current research in human sperm biology examining new molecular systems of response to the hormones as well as specific regulatory pathways controlling sperm cell fate and biological functions. Most significant studies regarding the identification of steroid receptors are reported and the mechanistic insights relative to signaling pathways, together with the change in sperm metabolism energy influenced by steroid hormones are discussed.The reviewed evidences suggest important effects of Progesterone, Estrogen and Testosterone and their receptors on spermatozoa and implicate the involvement of both systemic and local steroid action in the regulation of male fertility potential. - Highlights: • One of the main targets of steroid hormones and their receptors is reproductive function. • Pg/PR co-work to stimulate enzymatic activities to sustain a capacitation process. • E2/ERs regulate sperm motility, capacitation and acrosome reaction and act as survival factors. • Androgens/AR mediate sperm death which is a novel field of investigation in sperm biology.« less

  2. Chemokines and their receptors: insights from molecular modeling and crystallography.

    PubMed

    Kufareva, Irina

    2016-10-01

    Chemokines are small secreted proteins that direct cell migration in development, immunity, inflammation, and cancer. They do so by binding and activating specific G protein coupled receptors on the surface of migrating cells. Despite the importance of receptor:chemokine interactions, their structural basis remained unclear for a long time. In 2015, the first atomic resolution insights were obtained with the publication of X-ray structures for two distantly related receptors bound to chemokines. In conjunction with experiment-guided molecular modeling, the structures suggest a conserved receptor:chemokine complex architecture, while highlighting the diverse details and functional roles of individual interaction epitopes. Novel findings promote the development and detailed structural interpretation of the canonical two-site hypothesis of receptor:chemokine recognition, and suggest new avenues for pharmacological modulation of chemokine receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mays, Suzanne G.; Okafor, C. Denise; Tuntland, Micheal L.

    Peroxisome proliferator-activated gamma coactivator 1-α (PGC1α) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1α is known to bind and activate LRH-1, mechanisms through which PGC1α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1–PGC1α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), inmore » coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1–PGC1α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1α but promoted allosteric signaling from the helix 6/β-sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1–PGC1α interaction and may illuminate strategies for selective therapeutic targeting of PGC1α-dependent LRH-1 signaling pathways.« less

  4. The melanocortin receptor agonist NDP-MSH impairs the allostimulatory function of dendritic cells.

    PubMed

    Rennalls, La'Verne P; Seidl, Thomas; Larkin, James M G; Wellbrock, Claudia; Gore, Martin E; Eisen, Tim; Bruno, Ludovica

    2010-04-01

    As alpha-melanocyte-stimulating hormone (alpha-MSH) is released by immunocompetent cells and has potent immunosuppressive properties, it was determined whether human dendritic cells (DCs) express the receptor for this hormone. Reverse transcription-polymerase chain reaction detected messenger RNA specific for all of the known melanocortin receptors in DCs. Mixed lymphocyte reactions also revealed that treatment with [Nle(4), DPhe(7)]-alpha-MSH (NDP-MSH), a potent alpha-MSH analogue, significantly reduced the ability of DCs to stimulate allogeneic T cells. The expression of various cell surface adhesion, maturation and costimulatory molecules on DCs was also investigated. Although treatment with NDP-MSH did not alter the expression of CD83 and major histocompatibility complex class I and II, the surface expression of CD86 (B7.2), intercellular adhesion molecule (ICAM-1/CD54) and CD1a was reduced. In summary, our data indicate that NDP-MSH inhibits the functional activity of DCs, possibly by down-regulating antigen-presenting and adhesion molecules and that these events may be mediated via the extracellular signal-regulated kinase 1 and 2 pathway.

  5. Molecular targeting of growth factor receptor-bound 2 (Grb2) as an anti-cancer strategy.

    PubMed

    Dharmawardana, Pathirage G; Peruzzi, Benedetta; Giubellino, Alessio; Burke, Terrence R; Bottaro, Donald P

    2006-01-01

    Growth factor receptor-bound 2 (Grb2) is a ubiquitously expressed adapter protein that provides a critical link between cell surface growth factor receptors and the Ras signaling pathway. As such, it has been implicated in the oncogenesis of several important human malignancies. In addition to this function, research over the last decade has revealed other fundamental roles for Grb2 in cell motility and angiogenesis--processes that also contribute to tumor growth, invasiveness and metastasis. This functional profile makes Grb2 a high priority target for anti-cancer drug development. Knowledge of Grb2 protein structure, its component Src homology domains and their respective structure-function relationships has facilitated the rapid development of sophisticated drug candidates that can penetrate cells, bind Grb2 with high affinity and potently antagonize Grb2 signaling. These novel compounds offer considerable promise in our growing arsenal of rationally designed anti-cancer therapeutics.

  6. Functional analysis of glyco-molecules that bind with influenza virus.

    PubMed

    Takahashi, Tadanobu

    2016-01-01

    Influenza A virus (IAV) recognizes terminal sialic acid of sialoglyco-conjugates on host cells through the viral envelope glycoprotein hemagglutinin (HA), followed by initiation of entry into the cells. Molecular species of sialic acid are largely divided into two moieties: N-acetylneuraminic acid (Neu5Ac) and N-glycolylneuraminic acid (Neu5Gc). A receptor for IAV infection generally means Neu5Ac. Almost all equine IAVs and some human, swine, and duck IAVs bind not only to Neu5Ac but also to Neu5Gc. In nonhuman animals, Neu5Gc has been detected in swine and equine tracheas and the duck colon, which are the main replication sites of mammalian and avian IAVs. Therefore, Neu5Gc in these sites has been suggested to be a functional receptor for IAV infection. Humans cannot synthesize Neu5Gc due to a genetic defect of the Neu5Gc-synthesizing enzyme. We evaluated the receptor function of Neu5Gc in IAV infection in human cells. Our results indicated that Neu5Gc expression on the surface of human cells is not a functional receptor for IAV infection and that it has a negative effect on infectivity of IAV possessing Neu5Gc binding ability. IAV also binds to non-sialo 3-O-sulfated galactosylceramide (sulfatide). Sulfatide has been suggested to be a functional receptor for IAV infection. However, we have shown that sulfatide is not a functional receptor for IAV infection and that the binding of HA with sulfatide enhances progeny virus production. It is expected that functions of these glyco-molecules can be used in prevention and development of new drugs against IAV.

  7. GnRH receptor activation competes at a low level with growth signaling in stably transfected human breast cell lines

    PubMed Central

    2011-01-01

    Background Gonadotrophin releasing hormone (GnRH) analogs lower estrogen levels in pre-menopausal breast cancer patients. GnRH receptor (GnRH-R) activation also directly inhibits the growth of certain cells. The applicability of GnRH anti-proliferation to breast cancer was therefore analyzed. Methods GnRH-R expression in 298 primary breast cancer samples was measured by quantitative immunofluorescence. Levels of functional GnRH-R in breast-derived cell lines were assessed using 125I-ligand binding and stimulation of 3H-inositol phosphate production. Elevated levels of GnRH-R were stably expressed in cells by transfection. Effects of receptor activation on in vitro cell growth were investigated in comparison with IGF-I and EGF receptor inhibition, and correlated with intracellular signaling using western blotting. Results GnRH-R immunoscoring was highest in hormone receptor (triple) negative and grade 3 breast tumors. However prior to transfection, functional endogenous GnRH-R were undetectable in four commonly studied breast cancer cell lines (MCF-7, ZR-75-1, T47D and MDA-MB-231). After transfection with GnRH-R, high levels of cell surface GnRH-R were detected in SVCT and MDA-MB-231 clones while low-moderate levels of GnRH-R occurred in MCF-7 clones and ZR-75-1 clones. MCF-7 sub-clones with high levels of GnRH-R were isolated following hygromycin phosphotransferase transfection. High level cell surface GnRH-R enabled induction of high levels of 3H-inositol phosphate and modest growth-inhibition in SVCT cells. In contrast, growth of MCF-7, ZR-75-1 or MDA-MB-231 clones was unaffected by GnRH-R activation. Cell growth was inhibited by IGF-I or EGF receptor inhibitors. IGF-I receptor inhibitor lowered levels of p-ERK1/2 in MCF-7 clones. Washout of IGF-I receptor inhibitor resulted in transient hyper-elevation of p-ERK1/2, but co-addition of GnRH-R agonist did not alter the dynamics of ERK1/2 re-phosphorylation. Conclusions Breast cancers exhibit a range of GnRH-R immunostaining, with higher levels of expression found in triple-negative and grade 3 cancers. However, functional cell surface receptors are rare in cultured cells. Intense GnRH-R signaling in transfected breast cancer cells did not markedly inhibit growth, in contrast to transfected HEK 293 cells indicating the importance of intracellular context. GnRH-R signaling could not counteract IGF-I receptor-tyrosine kinase addiction in MCF-7 cells. These results suggest that combinatorial strategies with growth factor inhibitors will be needed to enhance GnRH anti-proliferative effects in breast cancer PMID:22051164

  8. Theranostic Gold Nanoantennas for Simultaneous Multiplexed Raman Imaging of Immunomarkers and Photothermal Therapy.

    PubMed

    Webb, Joseph A; Ou, Yu-Chuan; Faley, Shannon; Paul, Eden P; Hittinger, Joseph P; Cutright, Camden C; Lin, Eugene C; Bellan, Leon M; Bardhan, Rizia

    2017-07-31

    In this study, we demonstrate the theranostic capability of actively targeted, site-specific multibranched gold nanoantennas (MGNs) in triple-negative breast cancer (TNBC) cells in vitro. By utilizing multiplexed surface-enhanced Raman scattering (SERS) imaging, enabled by the narrow peak widths of Raman signatures, we simultaneously targeted immune checkpoint receptor programmed death ligand 1 (PDL1) and the epidermal growth factor receptor (EGFR) overexpressed in TNBC cells. A 1:1 mixture of MGNs functionalized with anti-PDL1 antibodies and Raman tag 5,5-dithio-bis-(2-nitrobenzoic acid) (DTNB) and MGNs functionalized with anti-EGFR antibodies and Raman tag para -mercaptobenzoic acid ( p MBA) were incubated with the cells. SERS imaging revealed a cellular traffic map of MGN localization by surface binding and receptor-mediated endocytosis, enabling targeted diagnosis of both biomarkers. Furthermore, cells incubated with anti-EGFR- p MBA-MGNs and illuminated with an 808 nm laser for 15 min at 4.7 W/cm 2 exhibited photothermal cell death only within the laser spot (indicated by live/dead cell fluorescence assay). Therefore, this study not only provides an optical imaging platform that can track immunomarkers with spatiotemporal control but also demonstrates an externally controlled light-triggered therapeutic approach enabling receptor-specific treatment with biocompatible theranostic nanoprobes.

  9. Theranostic Gold Nanoantennas for Simultaneous Multiplexed Raman Imaging of Immunomarkers and Photothermal Therapy

    PubMed Central

    2017-01-01

    In this study, we demonstrate the theranostic capability of actively targeted, site-specific multibranched gold nanoantennas (MGNs) in triple-negative breast cancer (TNBC) cells in vitro. By utilizing multiplexed surface-enhanced Raman scattering (SERS) imaging, enabled by the narrow peak widths of Raman signatures, we simultaneously targeted immune checkpoint receptor programmed death ligand 1 (PDL1) and the epidermal growth factor receptor (EGFR) overexpressed in TNBC cells. A 1:1 mixture of MGNs functionalized with anti-PDL1 antibodies and Raman tag 5,5-dithio-bis-(2-nitrobenzoic acid) (DTNB) and MGNs functionalized with anti-EGFR antibodies and Raman tag para-mercaptobenzoic acid (pMBA) were incubated with the cells. SERS imaging revealed a cellular traffic map of MGN localization by surface binding and receptor-mediated endocytosis, enabling targeted diagnosis of both biomarkers. Furthermore, cells incubated with anti-EGFR–pMBA–MGNs and illuminated with an 808 nm laser for 15 min at 4.7 W/cm2 exhibited photothermal cell death only within the laser spot (indicated by live/dead cell fluorescence assay). Therefore, this study not only provides an optical imaging platform that can track immunomarkers with spatiotemporal control but also demonstrates an externally controlled light-triggered therapeutic approach enabling receptor-specific treatment with biocompatible theranostic nanoprobes. PMID:28782050

  10. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function[OPEN

    PubMed Central

    2018-01-01

    Plants have many, highly variable resistance (R) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize (Zea mays) Hm1, was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. PMID:29382771

  11. Endocytosis as a mechanism of regulating natural killer cell function: unique endocytic and trafficking pathway for CD94/NKG2A.

    PubMed

    Peruzzi, Giovanna; Masilamani, Madhan; Borrego, Francisco; Coligan, John E

    2009-01-01

    Natural killer (NK) cells are lymphocytes generally recognized as sentinels of the innate immune system due to their inherent capacity to deal with diseased (stressed) cells, including malignant and infected. This ability to recognize many potentially pathogenic situations is due to the expression of a diverse panel of activation receptors. Because NK cell activation triggers an aggressive inflammatory response, it is important to have a means of throttling this response. Hence, NK cells also express a panel of inhibitory receptors that recognize ligands expressed by "normal" cells. Little or nothing is known about the endocytosis and trafficking of NK cell receptors, which are of great relevance to understanding how NK cells maintain the appropriate balance of activating and inhibitory receptors on their cell surface. In this review, we focus on the ITIM-containing inhibitory receptor CD94/NKG2A showing that it is endocytosed by a previously undescribed macropinocytic-like process that may be related to the maintenance of its surface expression.

  12. Biology and clinical relevance of chemokines and chemokine receptors CXCR4 and CCR5 in human diseases

    PubMed Central

    Choi, Won-Tak; An, Jing

    2014-01-01

    Chemokines and their receptors are implicated in a wide range of human diseases, including acquired immune deficiency syndrome (AIDS). The entry of human immunodeficiency virus type 1 (HIV-1) into a cell is initiated by the interaction of the virus’s surface envelope proteins with two cell surface components of the target cell, namely CD4 and a chemokine co-receptor, usually CXCR4 or CCR5. Typical anti-HIV-1 agents include protease and reverse transcriptase inhibitors, but the targets of these agents tend to show rapid mutation rates. As such, strategies based on HIV-1 co-receptors have appeal because they target invariant host determinants. Chemokines and their receptors are also of general interest since they play important roles in numerous physiological and pathological processes in addition to AIDS. Therefore, intensive basic and translational research is ongoing for the dissection of their structure – function relationships in an effort to understand the molecular mechanism of chemokine – receptor interactions and signal transductions across cellular membranes. This paper reviews and discusses recent advances and the translation of new knowledge and discoveries into novel interventional strategies for clinical application. PMID:21565895

  13. Quaternary structure of a G-protein-coupled receptor heterotetramer in complex with Gi and Gs.

    PubMed

    Navarro, Gemma; Cordomí, Arnau; Zelman-Femiak, Monika; Brugarolas, Marc; Moreno, Estefania; Aguinaga, David; Perez-Benito, Laura; Cortés, Antoni; Casadó, Vicent; Mallol, Josefa; Canela, Enric I; Lluís, Carme; Pardo, Leonardo; García-Sáez, Ana J; McCormick, Peter J; Franco, Rafael

    2016-04-05

    G-protein-coupled receptors (GPCRs), in the form of monomers or homodimers that bind heterotrimeric G proteins, are fundamental in the transfer of extracellular stimuli to intracellular signaling pathways. Different GPCRs may also interact to form heteromers that are novel signaling units. Despite the exponential growth in the number of solved GPCR crystal structures, the structural properties of heteromers remain unknown. We used single-particle tracking experiments in cells expressing functional adenosine A1-A2A receptors fused to fluorescent proteins to show the loss of Brownian movement of the A1 receptor in the presence of the A2A receptor, and a preponderance of cell surface 2:2 receptor heteromers (dimer of dimers). Using computer modeling, aided by bioluminescence resonance energy transfer assays to monitor receptor homomerization and heteromerization and G-protein coupling, we predict the interacting interfaces and propose a quaternary structure of the GPCR tetramer in complex with two G proteins. The combination of results points to a molecular architecture formed by a rhombus-shaped heterotetramer, which is bound to two different interacting heterotrimeric G proteins (Gi and Gs). These novel results constitute an important advance in understanding the molecular intricacies involved in GPCR function.

  14. Purification of functional baculovirus particles from silkworm larval hemolymph and their use as nanoparticles for the detection of human prorenin receptor (PRR) binding

    PubMed Central

    2011-01-01

    Background Baculovirus, which has a width of 40 nm and a length of 250-300 nm, can display functional peptides, receptors and antigens on its surface by their fusion with a baculovirus envelop protein, GP64. In addition, some transmembrane proteins can be displayed without GP64 fusion, using the native transmembrane domains of the baculovirus. We used this functionality to display human prorenin receptor fused with GFPuv (GFPuv-hPRR) on the surface of silkworm Bombyx mori nucleopolyhedrovirus (BmNPV) and then tested whether these baculovirus particles could be used to detect protein-protein interactions. Results BmNPV displaying GFPuv-hPRR (BmNPV-GFPuv-hPRR) was purified from hemolymph by using Sephacryl S-1000 column chromatography in the presence of 0.01% Triton X-100. Its recovery was 86% and the final baculovirus particles number was 4.98 × 108 pfu. Based on the results of enzyme-linked immunosorbent assay (ELISA), 3.1% of the total proteins in BmNPV-GFPuv-hPRR were GFPuv-hPRR. This value was similar to that calculated from the result of western blot by a densitometry (2.7%). To determine whether BmNPV-GFPuv-hPRR particles were bound to human prorenin, ELISA results were compared with those from ELISAs using protease negative BmNPV displaying β1,3-N-acetylglucosaminyltransferase 2 fused with the gene encoding GFPuv (GGT2) (BmNPV-CP--GGT2) particles, which do not display hPRR on their surfaces. Conclusion The display of on the surface of the BmNPV particles will be useful for the detection of protein-protein interactions and the screening of inhibitors and drugs in their roles as nanobioparticles. PMID:21635720

  15. Targeted silver nanoparticles for ratiometric cell phenotyping

    NASA Astrophysics Data System (ADS)

    Willmore, Anne-Mari A.; Simón-Gracia, Lorena; Toome, Kadri; Paiste, Päärn; Kotamraju, Venkata Ramana; Mölder, Tarmo; Sugahara, Kazuki N.; Ruoslahti, Erkki; Braun, Gary B.; Teesalu, Tambet

    2016-04-01

    Affinity targeting is used to deliver nanoparticles to cells and tissues. For efficient targeting, it is critical to consider the expression and accessibility of the relevant receptors in the target cells. Here, we describe isotopically barcoded silver nanoparticles (AgNPs) as a tool for auditing affinity ligand receptors in cells. Tumor penetrating peptide RPARPAR (receptor: NRP-1) and tumor homing peptide GKRK (receptor: p32) were used as affinity ligands on the AgNPs. The binding and uptake of the peptide-functionalized AgNPs by cultured PPC-1 prostate cancer and M21 melanoma cells was dependent on the cell surface expression of the cognate peptide receptors. Barcoded peptide-functionalized AgNPs were synthesized from silver and palladium isotopes. The cells were incubated with a cocktail of the barcoded nanoparticles [RPARPAR (R), GKRK (K), and control], and cellular binding and internalization of each type of nanoparticle was assessed by inductively coupled plasma mass spectrometry. The results of isotopic analysis were in agreement with data obtained using optical methods. Using ratiometric measurements, we were able to classify the PPC-1 cell line as mainly NRP-1-positive, with 75 +/- 5% R-AgNP uptake, and the M21 cell line as only p32-positive, with 89 +/- 9% K-AgNP uptake. The isotopically barcoded multiplexed AgNPs are useful as an in vitro ratiometric phenotyping tool and have potential uses in functional evaluation of the expression of accessible homing peptide receptors in vivo.Affinity targeting is used to deliver nanoparticles to cells and tissues. For efficient targeting, it is critical to consider the expression and accessibility of the relevant receptors in the target cells. Here, we describe isotopically barcoded silver nanoparticles (AgNPs) as a tool for auditing affinity ligand receptors in cells. Tumor penetrating peptide RPARPAR (receptor: NRP-1) and tumor homing peptide GKRK (receptor: p32) were used as affinity ligands on the AgNPs. The binding and uptake of the peptide-functionalized AgNPs by cultured PPC-1 prostate cancer and M21 melanoma cells was dependent on the cell surface expression of the cognate peptide receptors. Barcoded peptide-functionalized AgNPs were synthesized from silver and palladium isotopes. The cells were incubated with a cocktail of the barcoded nanoparticles [RPARPAR (R), GKRK (K), and control], and cellular binding and internalization of each type of nanoparticle was assessed by inductively coupled plasma mass spectrometry. The results of isotopic analysis were in agreement with data obtained using optical methods. Using ratiometric measurements, we were able to classify the PPC-1 cell line as mainly NRP-1-positive, with 75 +/- 5% R-AgNP uptake, and the M21 cell line as only p32-positive, with 89 +/- 9% K-AgNP uptake. The isotopically barcoded multiplexed AgNPs are useful as an in vitro ratiometric phenotyping tool and have potential uses in functional evaluation of the expression of accessible homing peptide receptors in vivo. Electronic supplementary information (ESI) available: TEM images of isotopic AgNPs, cell antibody staining, coadministration ICP-MS data, and biotin control particle ICP-MS data. See DOI: 10.1039/C5NR07928D

  16. Regulation of B Cell Functions by the Sialic Acid-Binding Receptors Siglec-G and CD22

    PubMed Central

    Jellusova, Julia; Nitschke, Lars

    2011-01-01

    B cell antigen receptor (BCR) engagement can lead to many different physiologic outcomes. To achieve an appropriate response, the BCR signal is interpreted in the context of other stimuli and several additional receptors on the B cell surface participate in the modulation of the signal. Two members of the Siglec (sialic acid-binding immunoglobulin-like lectin) family, CD22 and Siglec-G have been shown to inhibit the BCR signal. Recent findings indicate that the ability of these two receptors to bind sialic acids might be important to induce tolerance to self-antigens. Sialylated glycans are usually absent on microbes but abundant in higher vertebrates and might therefore provide an important tolerogenic signal. Since the expression of the specific ligands for Siglec-G and CD22 is tightly regulated and since Siglecs are not only able to bind their ligands in trans but also on the same cell surface this might provide additional mechanisms to control the BCR signal. Although both Siglec-G and CD22 are expressed on B cells and are able to inhibit BCR mediated signaling, they also show unique biological functions. While CD22 is the dominant regulator of calcium signaling on conventional B2 cells and also seems to play a role on marginal zone B cells, Siglec-G exerts its function mainly on B1 cells and influences their lifespan and antibody production. Both Siglec-G and CD22 have also recently been linked to toll-like receptor signaling and may provide a link in the regulation of the adaptive and innate immune response of B cells. PMID:22566885

  17. Progranulin: A Proteolytically Processed Protein at the Crossroads of Inflammation and Neurodegeneration*

    PubMed Central

    Cenik, Basar; Sephton, Chantelle F.; Kutluk Cenik, Bercin; Herz, Joachim; Yu, Gang

    2012-01-01

    GRN mutations cause frontotemporal lobar degeneration with TDP-43-positive inclusions. The mechanism of pathogenesis is haploinsufficiency. Recently, homozygous GRN mutations were detected in two patients with neuronal ceroid lipofuscinosis, a lysosomal storage disease. It is unknown whether the pathogenesis of these two conditions is related. Progranulin is cleaved into smaller peptides called granulins. Progranulin and granulins are attributed with roles in cancer, inflammation, and neuronal physiology. Cell surface receptors for progranulin, but not granulin peptides, have been reported. Revealing the cell surface receptors and the intracellular functions of granulins and progranulin is crucial for understanding their contributions to neurodegeneration. PMID:22859297

  18. Modelling the interdependence between the stoichiometry of receptor oligomerization and ligand binding for a coexisting dimer/tetramer receptor system.

    PubMed

    Rovira, X; Vivó, M; Serra, J; Roche, D; Strange, P G; Giraldo, J

    2009-01-01

    Many G protein-coupled receptors have been shown to exist as oligomers, but the oligomerization state and the effects of this on receptor function are unclear. For some G protein-coupled receptors, in ligand binding assays, different radioligands provide different maximal binding capacities. Here we have developed mathematical models for co-expressed dimeric and tetrameric species of receptors. We have considered models where the dimers and tetramers are in equilibrium and where they do not interconvert and we have also considered the potential influence of the ligands on the degree of oligomerization. By analogy with agonist efficacy, we have considered ligands that promote, inhibit or have no effect on oligomerization. Cell surface receptor expression and the intrinsic capacity of receptors to oligomerize are quantitative parameters of the equations. The models can account for differences in the maximal binding capacities of radioligands in different preparations of receptors and provide a conceptual framework for simulation and data fitting in complex oligomeric receptor situations.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Becker, Verena; Sengupta, D; Ketteler, Robin

    The formation of signal-promoting dimeric or oligomeric receptor complexes at the cell surface is modulated by self-interaction of their transmembrane (TM) domains. To address the importance of TM domain packing density for receptor functionality, we examined a set of asparagine mutants in the TM domain of the erythropoietin receptor (EpoR). We identified EpoR-T242N as a receptor variant that is present at the cell surface similar to wild-type EpoR but lacks visible localization in vesicle-like structures and is impaired in efficient activation of specific signaling cascades. Analysis by a molecular modeling approach indicated an increased interhelical distance for the EpoR-T242N TMmore » dimer. By employing the model, we designed additional mutants with increased or decreased packing volume and confirmed a correlation between packing volume and biological responsiveness. These results propose that the packing density of the TM domain provides a novel layer for fine-tuned regulation of signal transduction and cellular decisions.« less

  20. A2A adenosine receptor ligand binding and signalling is allosterically modulated by adenosine deaminase.

    PubMed

    Gracia, Eduard; Pérez-Capote, Kamil; Moreno, Estefanía; Barkešová, Jana; Mallol, Josefa; Lluís, Carme; Franco, Rafael; Cortés, Antoni; Casadó, Vicent; Canela, Enric I

    2011-05-01

    A2ARs (adenosine A2A receptors) are highly enriched in the striatum, which is the main motor control CNS (central nervous system) area. BRET (bioluminescence resonance energy transfer) assays showed that A2AR homomers may act as cell-surface ADA (adenosine deaminase; EC 3.5.4.4)-binding proteins. ADA binding affected the quaternary structure of A2ARs present on the cell surface. ADA binding to adenosine A2ARs increased both agonist and antagonist affinity on ligand binding to striatal membranes where these proteins are co-expressed. ADA also increased receptor-mediated ERK1/2 (extracellular-signal-regulated kinase 1/2) phosphorylation. Collectively, the results of the present study show that ADA, apart from regulating the concentration of extracellular adenosine, may behave as an allosteric modulator that markedly enhances ligand affinity and receptor function. This powerful regulation may have implications for the physiology and pharmacology of neuronal A2ARs.

  1. Highly sensitive graphene biosensor by monomolecular self-assembly of receptors on graphene surface

    NASA Astrophysics Data System (ADS)

    Kim, Ji Eun; No, Young Hyun; Kim, Joo Nam; Shin, Yong Seon; Kang, Won Tae; Kim, Young Rae; Kim, Kun Nyun; Kim, Yong Ho; Yu, Woo Jong

    2017-05-01

    Graphene has attracted a great deal of interest for applications in bio-sensing devices because of its ultra-thin structure, which enables strong electrostatic coupling with target molecules, and its excellent electrical mobility promising for ultra-fast sensing speeds. However, thickly stacked receptors on the graphene's surface interrupts electrostatic coupling between graphene and charged biomolecules, which can reduce the sensitivity of graphene biosensors. Here, we report a highly sensitive graphene biosensor by the monomolecular self-assembly of designed peptide protein receptors. The graphene channel was non-covalently functionalized using peptide protein receptors via the π-π interaction along the graphene's Bravais lattice, allowing ultra-thin monomolecular self-assembly through the graphene lattice. In thickness dependent characterization, a graphene sensor with a monomolecular receptor (thickness less than 3 nm) showed five times higher sensitivity and three times higher voltage shifts than graphene sensors with thick receptor stacks (thicknesses greater than 20 nm), which is attributed to excellent gate coupling between graphene and streptavidin via an ultrathin receptor insulator. In addition to having a fast-inherent response time (less than 0.6 s) based on fast binding speed between biotin and streptavidin, our graphene biosensor is a promising platform for highly sensitive real-time monitoring of biomolecules with high spatiotemporal resolution.

  2. Hyaluronic Acid Surface Modified Liposomes Prepared via Orthogonal Aminoxy Coupling: Synthesis of Nontoxic Aminoxylipids Based on Symmetrically α-Branched Fatty Acids, Preparation of Liposomes by Microfluidic Mixing, and Targeting to Cancer Cells Expressing CD44.

    PubMed

    Bartheldyová, Eliška; Effenberg, Roman; Mašek, Josef; Procházka, Lubomír; Knötigová, Pavlína Turánek; Kulich, Pavel; Hubatka, František; Velínská, Kamila; Zelníčková, Jaroslava; Zouharová, Darina; Fojtíková, Martina; Hrebík, Dominik; Plevka, Pavel; Mikulík, Robert; Miller, Andrew D; Macaulay, Stuart; Zyka, Daniel; Drož, Ladislav; Raška, Milan; Ledvina, Miroslav; Turánek, Jaroslav

    2018-06-25

    New synthetic aminoxy lipids are designed and synthesized as building blocks for the formulation of functionalized nanoliposomes by microfluidization using a NanoAssemblr. Orthogonal binding of hyaluronic acid onto the outer surface of functionalized nanoliposomes via aminoxy coupling ( N-oxy ligation) is achieved at hemiacetal function of hyaluronic acid and the structure of hyaluronic acid-liposomes is visualized by transmission electron microscopy and cryotransmission electron microscopy. Observed structures are in a good correlation with data obtained by dynamic light scattering (size and ζ-potential). In vitro experiments on cell lines expressing CD44 receptors demonstrate selective internalization of fluorochrome-labeled hyaluronic acid-liposomes, while cells with down regulated CD44 receptor levels exhibit very low internalization of hyaluronic acid-liposomes. A method based on microfluidization mixing was developed for preparation of monodispersive unilamellar liposomes containing aminoxy lipids and orthogonal binding of hyaluronic acid onto the liposomal surface was demonstrated. These hyaluronic acid-liposomes represent a potentially new drug delivery platform for CD44-targeted anticancer drugs as well as for immunotherapeutics and vaccines.

  3. Enhancement of the p27Kip1-mediated antiproliferative effect of trastuzumab (Herceptin) on HER2-overexpressing tumor cells.

    PubMed

    Marches, Radu; Uhr, Jonathan W

    2004-11-10

    The oncogenic activity of the overexpressed HER2 tyrosine kinase receptor requires its localization in the plasma membrane. The antitumor effect of anti-HER2 antibodies (Abs) is mainly dependent on receptor downregulation and comprises p27Kip1-mediated G1 cell cycle arrest. However, one major limitation of anti-HER2 therapy is the reversibility of tumor growth inhibition after discontinuation of treatment caused by the mitogenic signaling associated with cell surface receptor re-expression. We found that the level of p27Kip1 upregulation, inhibition of Cdk2 activity and magnitude of G1 arrest induced by the humanized Ab trastuzumab (Herceptin, HCT) on BT474 and SKBr3 HER2-overexpressing breast cancer cells correlates with the level of cell surface receptor. Thus, continuous exposure of cells to HCT for 72 hr results in downregulation of the cell surface receptor and a concurrent increase in the level of p27Kip1 protein. Discontinuation of Ab exposure after the first 8 hr results in failure to upregulate p27Kip1 and arrest of cell cycle progression. We show that the lysosomotropic amine chloroquine (CQ) augments receptor internalization in HER2-overexpressing cells either pretreated or continuously treated with HCT and leads to an increased and sustained inhibitory effect. The enhanced CQ-dependent loss of functional HER2 from the cell surface resulted in sustained inactivation of the serine/threonine kinase Akt, upregulation of p27Kip1 protein and inhibition of cyclin E/Cdk2 activity. Potentiation of the inhibitory effect of HCT by CQ was directly related to loss of HER2 from the plasma membrane since prevention of Ab-mediated receptor endocytosis by engagement of the receptor with immobilized HCT abrogated the effect of CQ.

  4. 'Til Eph do us part': intercellular signaling via Eph receptors and ephrin ligands guides cerebral cortical development from birth through maturation.

    PubMed

    North, Hilary A; Clifford, Meredith A; Donoghue, Maria J

    2013-08-01

    Eph receptors, the largest family of surface-bound receptor tyrosine kinases and their ligands, the ephrins, mediate a wide variety of cellular interactions in most organ systems throughout both development and maturity. In the forming cerebral cortex, Eph family members are broadly and dynamically expressed in particular sets of cortical cells at discrete times. Here, we review the known functions of Eph-mediated intercellular signaling in the generation of progenitors, the migration of maturing cells, the differentiation of neurons, the formation of functional connections, and the choice between life and death during corticogenesis. In synthesizing these results, we posit a signaling paradigm in which cortical cells maintain a life history of Eph-mediated intercellular interactions that guides subsequent cellular decision-making.

  5. The C-type Lectin Langerin Functions as a Receptor for Attachment and Infectious Entry of Influenza A Virus.

    PubMed

    Ng, Wy Ching; Londrigan, Sarah L; Nasr, Najla; Cunningham, Anthony L; Turville, Stuart; Brooks, Andrew G; Reading, Patrick C

    2016-01-01

    It is well established that influenza A virus (IAV) attachment to and infection of epithelial cells is dependent on sialic acid (SIA) at the cell surface, although the specific receptors that mediate IAV entry have not been defined and multiple receptors may exist. Lec2 Chinese hamster ovary (CHO) cells are SIA deficient and resistant to IAV infection. Here we demonstrate that the expression of the C-type lectin receptor langerin in Lec2 cells (Lec2-Lg) rendered them permissive to IAV infection, as measured by replication of the viral genome, transcription of viral mRNA, and synthesis of viral proteins. Unlike SIA-dependent infection of parental CHO cells, IAV attachment and infection of Lec2-Lg cells was mediated via lectin-mediated recognition of mannose-rich glycans expressed by the viral hemagglutinin glycoprotein. Lec2 cells expressing endocytosis-defective langerin bound IAV efficiently but remained resistant to IAV infection, confirming that internalization via langerin was essential for infectious entry. Langerin-mediated infection of Lec2-Lg cells was pH and dynamin dependent, occurred via clathrin- and caveolin-mediated endocytic pathways, and utilized early (Rab5(+)) but not late (Rab7(+)) endosomes. This study is the first to demonstrate that langerin represents an authentic receptor that binds and internalizes IAV to facilitate infection. Moreover, it describes a unique experimental system to probe specific pathways and compartments involved in infectious entry following recognition of IAV by a single cell surface receptor. On the surface of host cells, sialic acid (SIA) functions as the major attachment factor for influenza A viruses (IAV). However, few studies have identified specific transmembrane receptors that bind and internalize IAV to facilitate infection. Here we identify human langerin as a transmembrane glycoprotein that can act as an attachment factor and a bone fide endocytic receptor for IAV infection. Expression of langerin by an SIA-deficient cell line resistant to IAV rendered cells permissive to infection. As langerin represented the sole receptor for IAV infection in this system, we have defined the pathways and compartments involved in infectious entry of IAV into cells following recognition by langerin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Quartz crystal microbalance (QCM) with immobilized protein receptors: comparison of response to ligand binding for direct protein immobilization and protein attachment via disulfide linker.

    PubMed

    Baltus, Ruth E; Carmon, Kendra S; Luck, Linda A

    2007-03-27

    Results from an investigation of the frequency response resulting from ligand binding for a genetically engineered hormone-binding domain of the alpha-estrogen receptor immobilized to a piezoelectric quartz crystal are reported. Two different approaches were used to attach a genetically altered receptor to the gold electrode on the quartz surface: (1) the mutant receptor containing a single solvent-exposed cysteine was directly attached to the crystal via a sulfur to gold covalent bond, forming a self-assembled protein monolayer, and (2) the N-terminal histidine-tagged end was utilized to attach the receptor via a 3,3-dithiobis[N-(5-amino-5-carboxypentyl)propionamide-N',N'-diacetic acid] linker complexed with nickel. Previous studies have shown that these engineered constructs bind 17beta-estradiol and are fully functional. Exposure of the receptor directly attached to the piezoelectric crystal to the known ligand 17beta-estradiol resulted in a measurable frequency response, consistent with a change in conformation of the receptor with ligand binding. However, no response was observed when the receptor immobilized via the linker was exposed to the same ligand. The presence of the linker between the quartz surface and the protein receptor does not allow the crystal to sense the conformational change in the receptor that occurs with ligand binding. These results illustrate that the immobilization strategy used to bind the receptor to the sensor platform is key to eliciting an appropriate response from this biosensor. This study has important implications for the development of QCM-based sensors using protein receptors.

  7. Atomic force microscopy recognition of protein A on Staphylococcus aureus cell surfaces by labelling with IgG-Au conjugates.

    PubMed

    Tatlybaeva, Elena B; Nikiyan, Hike N; Vasilchenko, Alexey S; Deryabin, Dmitri G

    2013-01-01

    The labelling of functional molecules on the surface of bacterial cells is one way to recognize the bacteria. In this work, we have developed a method for the selective labelling of protein A on the cell surfaces of Staphylococcus aureus by using nanosized immunogold conjugates as cell-surface markers for atomic force microscopy (AFM). The use of 30-nm size Au nanoparticles conjugated with immunoglobulin G (IgG) allowed the visualization, localization and distribution of protein A-IgG complexes on the surface of S. aureus. The selectivity of the labelling method was confirmed in mixtures of S. aureus with Bacillus licheniformis cells, which differed by size and shape and had no IgG receptors on the surface. A preferential binding of the IgG-Au conjugates to S. aureus was obtained. Thus, this novel approach allows the identification of protein A and other IgG receptor-bearing bacteria, which is useful for AFM indication of pathogenic microorganisms in poly-component associations.

  8. Gene editing rescue of a novel MPL mutant associated with congenital amegakaryocytic thrombocytopenia.

    PubMed

    Cleyrat, Cédric; Girard, Romain; Choi, Eun H; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S

    2017-09-26

    Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood-derived CD34 + cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients.

  9. Gene editing rescue of a novel MPL mutant associated with congenital amegakaryocytic thrombocytopenia

    PubMed Central

    Girard, Romain; Choi, Eun H.; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S.

    2017-01-01

    Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood–derived CD34+ cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients. PMID:29296828

  10. Evolution and survival of marine carnivores did not require a diversity of KIR or Ly49 NK cell receptors1

    PubMed Central

    Hammond, John A.; Guethlein, Lisbeth A.; Abi-Rached, Laurent; Moesta, Achim K; Parham, Peter

    2009-01-01

    Ly49 lectin-like receptors and killer cell immunoglobulin-like receptors (KIR) are structurally unrelated cell-surface glycoproteins that evolved independently to function as diverse NK cell receptors for MHC class I molecules. Comparison of primates and various domesticated animals has shown that species have either a diverse Ly49 or KIR gene family, but not both. In four pinniped species of wild marine carnivore, three seals and one sea lion, we find that Ly49 and KIR are each represented by single, orthologous genes that exhibit little polymorphism and are transcribed to express cell-surface protein. Pinnipeds are therefore species in which neither Ly49 nor KIR are polygenic but retain the ancestral single-copy state. Whereas pinniped Ly49 has been subject to purifying selection, we find evidence for positive selection on KIR3DL during pinniped evolution. This selection, which focused on the D0 domain and the stem, points to the functionality of the KIR and likely led to the sea lion’s loss of D0. In contrast to the dynamic and rapid evolution of the KIR and Ly49 genes in other species, the pinniped KIR and Ly49 have been remarkably stable during the > 33 million years since the last common ancestor of seals and sea lions. These results demonstrate that long-term survival of placental mammal species need not require a diverse system of either Ly49 or KIR NK-cell receptors. PMID:19265140

  11. Charge heterogeneity: Basic antibody charge variants with increased binding to Fc receptors.

    PubMed

    Hintersteiner, Beate; Lingg, Nico; Zhang, Peiqing; Woen, Susanto; Hoi, Kong Meng; Stranner, Stefan; Wiederkum, Susanne; Mutschlechner, Oliver; Schuster, Manfred; Loibner, Hans; Jungbauer, Alois

    We identified active isoforms of the chimeric anti-GD2 antibody, ch14.18, a recombinant antibody produced in Chinese hamster ovary cells, which is already used in clinical trials. 1,2,3 We separated the antibody by high resolution ion-exchange chromatography with linear pH gradient elution into acidic, main and basic charge variants on a preparative scale yielding enough material for an in-depth study of the sources and the effects of microheterogeneity. The binding affinity of the charge variants toward the antigen and various cell surface receptors was studied by Biacore. Effector functions were evaluated using cellular assays for antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity. Basic charge variants showed increased binding to cell surface receptor FcγRIIIa, which plays a major role in regulating effector functions. Furthermore, increased binding of the basic fractions to the neonatal receptor was observed. As this receptor mediates the prolonged half-life of IgG in human serum, this data may well hint at an increased serum half-life of these basic variants compared to their more acidic counterparts. Different glycoform patterns, C-terminal lysine clipping and N-terminal pyroglutamate formation were identified as the main structural sources for the observed isoform pattern. Potential differences in structural stability between individual charge variant fractions by nano differential scanning calorimetry could not been detected. Our in-vitro data suggests that the connection between microheterogeneity and the biological activity of recombinant antibody therapeutics deserves more attention than commonly accepted.

  12. Probing transmembrane mechanical coupling and cytomechanics using magnetic twisting cytometry

    NASA Technical Reports Server (NTRS)

    Wang, N.; Ingber, D. E.

    1995-01-01

    We recently developed a magnetic twisting cytometry technique that allows us to apply controlled mechanical stresses to specific cell surface receptors using ligand-coated ferromagnetic microbeads and to simultaneously measure the mechanical response in living cells. Using this technique, we have previously shown the following: (i) beta 1 integrin receptors mediate mechanical force transfer across the cell surface and to the cytoskeleton, whereas other transmembrane receptors (e.g., scavenger receptors) do not; (ii) cytoskeletal stiffness increases in direct proportion to the level of stress applied to integrins; and (iii) the slope of this linear stiffening response differs depending on the shape of the cell. We now show that different integrins (beta 1, alpha V beta 3, alpha V, alpha 5, alpha 2) and other transmembrane receptors (scavenger receptor, platelet endothelial cell adhesion molecule) differ in their ability to mediate force transfer across the cell surface. In addition, the linear stiffening behavior previously observed in endothelial cells was found to be shared by other cell types. Finally, we demonstrate that dynamic changes in cell shape that occur during both cell spreading and retraction are accompanied by coordinate changes in cytoskeletal stiffness. Taken together, these results suggest that the magnetic twisting cytometry technique may be a powerful and versatile tool for studies analyzing the molecular basis of transmembrane mechanical coupling to the cytoskeleton as well as dynamic relations between changes in cytoskeletal structure and alterations in cell form and function.

  13. The state diagram for cell adhesion under flow: leukocyte rolling and firm adhesion.

    PubMed

    Chang, K C; Tees, D F; Hammer, D A

    2000-10-10

    Leukocyte adhesion under flow in the microvasculature is mediated by binding between cell surface receptors and complementary ligands expressed on the surface of the endothelium. Leukocytes adhere to endothelium in a two-step mechanism: rolling (primarily mediated by selectins) followed by firm adhesion (primarily mediated by integrins). Using a computational method called "Adhesive Dynamics," we have simulated the adhesion of a cell to a surface in flow, and elucidated the relationship between receptor-ligand functional properties and the dynamics of adhesion. We express this relationship in a state diagram, a one-to-one map between the biophysical properties of adhesion molecules and various adhesive behaviors. Behaviors that are observed in simulations include firm adhesion, transient adhesion (rolling), and no adhesion. We varied the dissociative properties, association rate, bond elasticity, and shear rate and found that the unstressed dissociation rate, k(r)(o), and the bond interaction length, gamma, are the most important molecular properties controlling the dynamics of adhesion. Experimental k(r)(o) and gamma values from the literature for molecules that are known to mediate rolling adhesion fall within the rolling region of the state diagram. We explain why L-selectin-mediated rolling, which has faster k(r)(o) than other selectins, is accompanied by a smaller value for gamma. We also show how changes in association rate, shear rate, and bond elasticity alter the dynamics of adhesion. The state diagram (which must be mapped for each receptor-ligand system) presents a concise and comprehensive means of understanding the relationship between bond functional properties and the dynamics of adhesion mediated by receptor-ligand bonds.

  14. Multidisciplinary Analysis of Cyclophilin A Function in Human Breast Cancer

    DTIC Science & Technology

    2010-03-01

    between prolyl isomerases and cell surface receptors. Figure 1. Regulation of the prolactin receptor/Janus kinase 2 (PRLr...334 in the X-box motif of the PRLr; the red circle containing P indicates phosphorylation of JAK2 kinase , PRLr, and signal transducer and activator of...shares seven significant Janus homology domains (JH1-7) (from the C- to the N-terminus) to other members of the Jak kinase family as described below: (1

  15. Binding of a C-type lectin’s coiled-coil domain to the Domeless receptor directly activates the JAK/STAT pathway in the shrimp immune response to bacterial infection

    PubMed Central

    Zhao, Xiao-Fan; Vasta, Gerardo R.

    2017-01-01

    C-type lectins (CTLs) are characterized by the presence of a C-type carbohydrate recognition domain (CTLD) that by recognizing microbial glycans, is responsible for their roles as pattern recognition receptors in the immune response to bacterial infection. In addition to the CTLD, however, some CTLs display additional domains that can carry out effector functions, such as the collagenous domain of the mannose-binding lectin. While in vertebrates, the mechanisms involved in these effector functions have been characterized in considerable detail, in invertebrates they remain poorly understood. In this study, we identified in the kuruma shrimp (Marsupenaeus japonicus) a structurally novel CTL (MjCC-CL) that in addition to the canonical CTLD, contains a coiled-coil domain (CCD) responsible for the effector functions that are key to the shrimp’s antibacterial response mediated by antimicrobial peptides (AMPs). By the use of in vitro and in vivo experimental approaches we elucidated the mechanism by which the recognition of bacterial glycans by the CTLD of MjCC-CL leads to activation of the JAK/STAT pathway via interaction of the CCD with the surface receptor Domeless, and upregulation of AMP expression. Thus, our study of the shrimp MjCC-CL revealed a striking functional difference with vertebrates, in which the JAK/STAT pathway is indirectly activated by cell death and stress signals through cytokines or growth factors. Instead, by cross-linking microbial pathogens with the cell surface receptor Domeless, a lectin directly activates the JAK/STAT pathway, which plays a central role in the shrimp antibacterial immune responses by upregulating expression of selected AMPs. PMID:28931061

  16. Functions of transmembrane domain 3 of human melanocortin-4 receptor.

    PubMed

    Mo, Xiu-Lei; Yang, Rui; Tao, Ya-Xiong

    2012-12-01

    The melanocortin-4 receptor (MC4R) is a G protein-coupled receptor critical for maintaining energy homeostasis. Transmembrane domain 3 (TM3) of MC4R contains residues that were suggested to be essential in ligand binding and signaling. Several MC4R mutations in TM3 are associated with human obesity. To gain a better understanding of the functions of TM3, we analyzed the functions of 26 residues in TM3 using alanine-scanning mutagenesis. We showed that all mutants had normal cell-surface expression. Four mutants were defective in ligand binding and signaling and six mutants had normal ligand binding but impaired cAMP production. L140A had increased basal cAMP level. To further characterize the function of L140, we generated 17 additional L140 mutants. Fifteen L140 mutants had significantly decreased cell-surface expression, with L140R and L140V expressed normally. Ten L140 mutants had increased basal cAMP activities. Four L140 mutants were defective in ligand-stimulated cAMP generation. Interestingly, with the ERK1/2 pathway, we showed that nine constitutively active mutants had similar levels of basal pERK1/2 as that of WT, and two signaling defective mutants had similar levels of pERK1/2 as that of WT upon agonist stimulation, different from their cAMP signaling properties, suggesting biased signaling in these mutant receptors. In summary, we identified 13 residues in TM3 that were essential for ligand binding and/or signaling. Moreover, L140 was critical for locking MC4R in inactive conformation and several mutants showed biased signaling in cAMP and ERK1/2 signaling pathways.

  17. Surface expression of heterogeneous nuclear RNA binding protein M4 on Kupffer cell relates to its function as a carcinoembryonic antigen receptor.

    PubMed

    Bajenova, Olga; Stolper, Eugenia; Gapon, Svetlana; Sundina, Natalia; Zimmer, Regis; Thomas, Peter

    2003-11-15

    Elevated concentrations of carcinoembryonic antigen (CEA) in the blood are associated with the development of hepatic metastases from colorectal cancers. Clearance of circulating CEA occurs through endocytosis by liver macrophages, Kupffer cells. Previously we identified heterogeneous nuclear ribonucleoproteins M4 (hnRNP M4) as a receptor (CEAR) for CEA. HnRNP M4 has two isoform proteins (p80, p76), the full-length hnRNP M4 (CEARL) and a truncated form (CEARS) with a deletion of 39 amino acids between RNA binding domains 1 and 2, generated by alternative splicing. The present study was undertaken to clarify any isoform-specific differences in terms of their function as CEA receptor and localization. We develop anti-CEAR isoform-specific antibodies and show that both CEAR splicing isoforms are expressed on the surface of Kupffer cells and can function as CEA receptor. Alternatively, in P388D1 macrophages CEARS protein has nuclear and CEARL has cytoplasmic localization. In MIP101 colon cancer and HeLa cells the CEARS protein is localized to the nucleus and CEARL to the cytoplasm. These findings imply that different functions are assigned to CEAR isoforms depending on the cell type. The search of 39 amino acids deleted region against the Prosite data base revealed the presence of N-myristylation signal PGGPGMITIP that may be involved in protein targeting to the plasma membrane. Overall, this report demonstrates that the cellular distribution, level of expression, and relative amount of CEARL and CEARS isoforms determine specificity for CEA binding and the expression of alternative spliced forms of CEAR is regulated in a tissue-specific manner.

  18. A fractal analysis of protein to DNA binding kinetics using biosensors.

    PubMed

    Sadana, Ajit

    2003-08-01

    A fractal analysis of a confirmative nature only is presented for the binding of estrogen receptor (ER) in solution to its corresponding DNA (estrogen response element, ERE) immobilized on a sensor chip surface [J. Biol. Chem. 272 (1997) 11384], and for the cooperative binding of human 1,25-dihydroxyvitamin D(3) receptor (VDR) to DNA with the 9-cis-retinoic acid receptor (RXR) [Biochemistry 35 (1996) 3309]. Ligands were also used to modulate the first reaction. Data taken from the literature may be modeled by using a single- or a dual-fractal analysis. Relationships are presented for the binding rate coefficient as a function of either the analyte concentration in solution or the fractal dimension that exists on the biosensor surface. The binding rate expressions developed exhibit a wide range of dependence on the degree of heterogeneity that exists on the surface, ranging from sensitive (order of dependence equal to 1.202) to very sensitive (order of dependence equal to 12.239). In general, the binding rate coefficient increases as the degree of heterogeneity or the fractal dimension of the surface increases. The predictive relationships presented provide further physical insights into the reactions occurring on the biosensor surface. Even though these reactions are occurring on the biosensor surface, the relationships presented should assist in understanding and in possibly manipulating the reactions occurring on cellular surfaces.

  19. Basigin-2 Is a Cell Surface Receptor for Soluble Basigin Ligand*S⃞

    PubMed Central

    Belton, Robert J.; Chen, Li; Mesquita, Fernando S.; Nowak, Romana A.

    2008-01-01

    The metastatic spread of a tumor is dependent upon the ability of the tumor to stimulate surrounding stromal cells to express enzymes required for tissue remodeling. The immunoglobulin superfamily protein basigin (EMMPRIN/CD147) is a cell surface glycoprotein expressed by tumor cells that stimulates matrix metalloproteinase and vascular endothelial growth factor expression in stromal cells. The ability of basigin to stimulate expression of molecules involved in tissue remodeling and angiogenesis makes basigin a potential target for the development of strategies to block metastasis. However, the identity of the cell surface receptor for basigin remains controversial. The goal of this study was to determine the identity of the receptor for basigin. Using a novel recombinant basigin protein (rBSG) corresponding to the extracellular domain of basigin, it was demonstrated that the native, nonglycosylated rBSG protein forms dimers in solution. Furthermore, rBSG binds to the surface of uterine fibroblasts, activates the ERK1/2 signaling pathway, and induces expression of matrix metalloproteinases 1, 2, and 3. Proteins that interact with rBSG were isolated using a biotin label transfer technique and sequenced by matrix-assisted laser desorption ionization tandem mass spectrophotometry. The results demonstrate that rBSG interacts with basigin expressed on the surface of fibroblasts and is subsequently internalized. During internalization, rBSG associates with a novel form of human basigin (basigin-3). It was concluded that cell surface basigin functions as a membrane receptor for soluble basigin and this homophilic interaction is not dependent upon glycosylation of the basigin ligand. PMID:18434307

  20. The Role of Rab Proteins in Neuronal Cells and in the Trafficking of Neurotrophin Receptors

    PubMed Central

    Bucci, Cecilia; Alifano, Pietro; Cogli, Laura

    2014-01-01

    Neurotrophins are a family of proteins that are important for neuronal development, neuronal survival and neuronal functions. Neurotrophins exert their role by binding to their receptors, the Trk family of receptor tyrosine kinases (TrkA, TrkB, and TrkC) and p75NTR, a member of the tumor necrosis factor (TNF) receptor superfamily. Binding of neurotrophins to receptors triggers a complex series of signal transduction events, which are able to induce neuronal differentiation but are also responsible for neuronal maintenance and neuronal functions. Rab proteins are small GTPases localized to the cytosolic surface of specific intracellular compartments and are involved in controlling vesicular transport. Rab proteins, acting as master regulators of the membrane trafficking network, play a central role in both trafficking and signaling pathways of neurotrophin receptors. Axonal transport represents the Achilles' heel of neurons, due to the long-range distance that molecules, organelles and, in particular, neurotrophin-receptor complexes have to cover. Indeed, alterations of axonal transport and, specifically, of axonal trafficking of neurotrophin receptors are responsible for several human neurodegenerative diseases, such as Huntington’s disease, Alzheimer’s disease, amyotrophic lateral sclerosis and some forms of Charcot-Marie-Tooth disease. In this review, we will discuss the link between Rab proteins and neurotrophin receptor trafficking and their influence on downstream signaling pathways. PMID:25295627

  1. Density functional theory and conductivity studies of boron-based anion receptors

    DOE PAGES

    Leung, Kevin; Chaudhari, Mangesh I.; Rempe, Susan B.; ...

    2015-07-10

    Anion receptors that bind strongly to fluoride anions in organic solvents can help dissolve the lithium fluoride discharge products of primary carbon monofluoride (CFx) batteries, thereby preventing the clogging of cathode surfaces and improving ion conductivity. The receptors are also potentially beneficial to rechargeable lithium ion and lithium air batteries. We apply Density Functional Theory (DFT) to show that an oxalate-based pentafluorophenyl-boron anion receptor binds as strongly, or more strongly, to fluoride anions than many phenyl-boron anion receptors proposed in the literature. Experimental data shows marked improvement in electrolyte conductivity when this oxalate anion receptor is present. The receptor ismore » sufficiently electrophilic that organic solvent molecules compete with F – for boron-site binding, and specific solvent effects must be considered when predicting its F – affinity. To further illustrate the last point, we also perform computational studies on a geometrically constrained boron ester that exhibits much stronger gas-phase affinity for both F – and organic solvent molecules. After accounting for specific solvent effects, however, its net F – affinity is about the same as the simple oxalate-based anion receptor. Lastly, we propose that LiF dissolution in cyclic carbonate organic solvents, in the absence of anion receptors, is due mostly to the formation of ionic aggregates, not isolated F – ions.« less

  2. The evolution of the natural killer complex; a comparison between mammals using new high-quality genome assemblies and targeted annotation

    USDA-ARS?s Scientific Manuscript database

    Natural killer (NK) cells are a diverse population of lymphocytes with a range of biological roles including essential immune functions. NK cell diversity is created by the differential expression of cell surface receptors which modulate activation and function, including multiple subfamilies of C-t...

  3. GABA type a receptor trafficking and the architecture of synaptic inhibition.

    PubMed

    Lorenz-Guertin, Joshua M; Jacob, Tija C

    2018-03-01

    Ubiquitous expression of GABA type A receptors (GABA A R) in the central nervous system establishes their central role in coordinating most aspects of neural function and development. Dysregulation of GABAergic neurotransmission manifests in a number of human health disorders and conditions that in certain cases can be alleviated by drugs targeting these receptors. Precise changes in the quantity or activity of GABA A Rs localized at the cell surface and at GABAergic postsynaptic sites directly impact the strength of inhibition. The molecular mechanisms constituting receptor trafficking to and from these compartments therefore dictate the efficacy of GABA A R function. Here we review the current understanding of how GABA A Rs traffic through biogenesis, plasma membrane transport, and degradation. Emphasis is placed on discussing novel GABAergic synaptic proteins, receptor and scaffolding post-translational modifications, activity-dependent changes in GABA A R confinement, and neuropeptide and neurosteroid mediated changes. We further highlight modern techniques currently advancing the knowledge of GABA A R trafficking and clinically relevant neurodevelopmental diseases connected to GABAergic dysfunction. © 2017 Wiley Periodicals, Inc. Develop Neurobiol 78: 238-270, 2018. © 2017 Wiley Periodicals, Inc.

  4. The protease-activated receptor-2 upregulates keratinocyte phagocytosis.

    PubMed

    Sharlow, E R; Paine, C S; Babiarz, L; Eisinger, M; Shapiro, S; Seiberg, M

    2000-09-01

    The protease-activated receptor-2 (PAR-2) belongs to the family of seven transmembrane domain receptors, which are activated by the specific enzymatic cleavage of their extracellular amino termini. Synthetic peptides corresponding to the tethered ligand domain (SLIGRL in mouse, SLIGKV in human) can activate PAR-2 without the need for receptor cleavage. PAR-2 activation is involved in cell growth, differentiation and inflammatory processes, and was shown to affect melanin and melanosome ingestion by human keratinocytes. Data presented here suggest that PAR-2 activation may regulate human keratinocyte phagocytosis. PAR-2 activation by trypsin, SLIGRL or SLIGKV increased the ability of keratinocytes to ingest fluorescently labeled microspheres or E. coli K-12 bioparticles. This PAR-2 mediated increase in keratinocyte phagocytic capability correlated with an increase in actin polymerization and *-actinin reorganization, cell surface morphological changes and increased soluble protease activity. Moreover, addition of serine protease inhibitors downmodulated both the constitutive and the PAR-2 mediated increases in phagocytosis, suggesting that serine proteases mediate this functional activity in keratinocytes. PAR-2 involvement in keratinocyte phagocytosis is a novel function for this receptor.

  5. Control of yeast mating signal transduction by a mammalian. beta. sub 2 -adrenergic receptor and G sub s. alpha. subunit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    King, K.; Caron, M.G.; Lefkowitz, R.J.

    1990-10-05

    To facilitate functional and mechanistic studies of receptor-G protein interactions by expression of the human {beta}{sub 2}-adrenergic receptor (h{beta}-AR) has been expressed in Saccharomyces cerevisiae. This was achieved by placing a modified h{beta}-AR gene under control of the galactose-inducible GAL1 promoter. After induction by galactose, functional h{beta}-AR was expressed at a concentration several hundred times as great as that found in any human tissue. As determined from competitive ligand binding experiments, h{beta}-AR expressed in yeast displayed characteristic affinities, specificity, and stereoselectivity. Partial activation of the yeast pheromone response pathway by {beta}-adrenergic receptor agonists was achieved in cells coexpressing h{beta}-AR andmore » a mammalian G protein (G{sub s}) {alpha} subunit - demonstrating that these components can couple to each other and to downstream effectors when expressed in yeast. This in vivo reconstitution system provides a new approach for examining ligand binding and G protein coupling to cell surface receptors.« less

  6. Proton transfer and protein quake in photoreceptor activation

    NASA Astrophysics Data System (ADS)

    Xie, Aihua

    2002-03-01

    Proteins are able to perform an enormous variety of functions, while using only a limited number of underlying processes. One of these is proton transfer, found in a range of receptors and enzymes. It is conceivable that proton transfer is essential in biological energy transduction, but it is less evident how proton transfer is employed in receptor activation during biological signal transduction. An important question regarding receptor activation is how a localized event of detecting a stimulus at the active site drives global conformational changes involving protein surface for signal relay. We will present structural, kinetic and energetic studies on the activation mechanism of a prototype PAS domain photoreceptor, photoactive yellow protein (PYP). Our data reveal that the putative signaling state of PYP upon absorption of a blue photon is formed during a large-amplitude protein quake triggered by the formation of a new buried charge in a hydrophobic pocket at the active site of PYP via intramolecular proton transfer. This mechanism for protein quakes driven by proton transfer and electrostatic interactions may play roles during the functioning of other receptor proteins and non-receptor proteins that require large conformational changes.

  7. Grp94 Protein Delivers γ-Aminobutyric Acid Type A (GABAA) Receptors to Hrd1 Protein-mediated Endoplasmic Reticulum-associated Degradation.

    PubMed

    Di, Xiao-Jing; Wang, Ya-Juan; Han, Dong-Yun; Fu, Yan-Lin; Duerfeldt, Adam S; Blagg, Brian S J; Mu, Ting-Wei

    2016-04-29

    Proteostasis maintenance of γ-aminobutyric acid type A (GABAA) receptors dictates their function in controlling neuronal inhibition in mammalian central nervous systems. However, as a multisubunit, multispan, integral membrane protein, even wild type subunits of GABAA receptors fold and assemble inefficiently in the endoplasmic reticulum (ER). Unassembled and misfolded subunits undergo ER-associated degradation (ERAD), but this degradation process remains poorly understood for GABAA receptors. Here, using the α1 subunits of GABAA receptors as a model substrate, we demonstrated that Grp94, a metazoan-specific Hsp90 in the ER lumen, uses its middle domain to interact with the α1 subunits and positively regulates their ERAD. OS-9, an ER-resident lectin, acts downstream of Grp94 to further recognize misfolded α1 subunits in a glycan-dependent manner. This delivers misfolded α1 subunits to the Hrd1-mediated ubiquitination and the valosin-containing protein-mediated extraction pathway. Repressing the initial ERAD recognition step by inhibiting Grp94 enhances the functional surface expression of misfolding-prone α1(A322D) subunits, which causes autosomal dominant juvenile myoclonic epilepsy. This study clarifies a Grp94-mediated ERAD pathway for GABAA receptors, which provides a novel way to finely tune their function in physiological and pathophysiological conditions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. A Promising Therapeutic Target for Metabolic Diseases: Neuropeptide Y Receptors in Humans.

    PubMed

    Yi, Min; Li, Hekai; Wu, Zhiye; Yan, Jianyun; Liu, Qicai; Ou, Caiwen; Chen, Minsheng

    2018-01-01

    Human neuropeptide Y (hNPY) is one of the most widely expressed neurotransmitters in the human central and peripheral nervous systems. It consists of 36 highly conserved amino acid residues, and was first isolated from the porcine hypothalamus in 1982. While it is the most recently discovered member of the pancreatic polypeptide family (which includes neuropeptide Y, gut-derived hormone peptide YY, and pancreatic polypeptide), NPY is the most abundant peptide found in the mammalian brain. In order to exert particular functions, NPY needs to bind to the NPY receptor to activate specific signaling pathways. NPY receptors belong to the class A or rhodopsin-like G-protein coupled receptor (GPCR) family and signal via cell-surface receptors. By binding to GPCRs, NPY plays a crucial role in various biological processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. Abnormal regulation of NPY is involved in the development of a wide range of diseases, including obesity, hypertension, atherosclerosis, epilepsy, metabolic disorders, and many cancers. Thus far, five receptors have been cloned from mammals (Y1, Y2, Y4, Y5, and y6), but only four of these (hY1, hY2, hY4, and hY5) are functional in humans. In this review, we summarize the structural characteristics of human NPY receptors and their role in metabolic diseases. © 2018 The Author(s). Published by S. Karger AG, Basel.

  9. Expression of gamma-aminobutyric acid rho 1 and rho 1 Delta 450 as gene fusions with the green fluorescent protein.

    PubMed

    Martinez-Torres, A; Miledi, R

    2001-02-13

    The functional characteristics and cellular localization of the gamma aminobutyric acid (GABA) rho 1 receptor and its nonfunctional isoform rho 1 Delta 450 were investigated by expressing them as gene fusions with the enhanced version of the green fluorescent protein (GFP). Oocytes injected with rho 1-GFP had receptors that gated chloride channels when activated by GABA. The functional characteristics of these receptors were the same as for those of wild-type rho 1 receptors. Fluorescence, because of the chimeric receptors expressed, was over the whole oocyte but was more intense near the cell surface and more abundant in the animal hemisphere. Similar to the wild type, rho 1 Delta 450-GFP did not lead to the expression of functional GABA receptors, and injected oocytes failed to generate currents even after exposure to high concentrations of GABA. Nonetheless, the fluorescence displayed by oocytes expressing rho 1 Delta 450-GFP was distributed similarly to that of rho 1-GFP. Mammalian cells transfected with the rho 1-GFP or rho 1 Delta 450-GFP constructs showed mostly intracellularly distributed fluorescence in confocal microscope images. A sparse localization of fluorescence was observed in the plasma membrane regardless of the cell line used. We conclude that rho 1 Delta 450 is expressed and transported close to, and perhaps incorporated into, the plasma membrane. Thus, rho 1- and rho 1 Delta 450-GFP fusions provide a powerful tool to visualize the traffic of GABA type C receptors.

  10. Unique Directional Motility of Influenza C Virus Controlled by Its Filamentous Morphology and Short-Range Motions.

    PubMed

    Sakai, Tatsuya; Takagi, Hiroaki; Muraki, Yasushi; Saito, Mineki

    2018-01-15

    Influenza virus motility is based on cooperation between two viral spike proteins, hemagglutinin (HA) and neuraminidase (NA), and is a major determinant of virus infectivity. To translocate a virus particle on the cell surface, HA molecules exchange viral receptors and NA molecules accelerate the receptor exchange of HA. This type of virus motility was recently identified in influenza A virus (IAV). To determine if other influenza virus types have a similar receptor exchange mechanism-driven motility, we investigated influenza C virus (ICV) motility on a receptor-fixed glass surface. This system excludes receptor mobility, which makes it more desirable than a cell surface for demonstrating virus motility by receptor exchange. Like IAV, ICV was observed to move across the receptor-fixed surface. However, in contrast to the random movement of IAV, a filamentous ICV strain, Ann Arbor/1/50 (AA), moved in a straight line, in a directed manner, and at a constant rate, whereas a spherical ICV strain, Taylor/1233/47 (Taylor), moved randomly, similar to IAV. The AA and Taylor viruses each moved with a combination of gradual (crawling) and rapid (gliding) motions, but the distances of crawling and gliding for the AA virus were shorter than those of the Taylor virus. Our findings indicate that like IAV, ICV also has a motility that is driven by the receptor exchange mechanism. However, compared with IAV movement, filamentous ICV movement is highly regulated in both direction and speed. Control of ICV movement is based on its specific motility employing short crawling and gliding motions as well as its own filamentous morphology. IMPORTANCE Influenza virus enters into a host cell for infection via cellular endocytosis. Human influenza virus infects epithelial cells of the respiratory tract, the surfaces of which are hidden by abundant cilia that are inactive in endocytosis. An open question is the manner by which the virus migrates to endocytosis-active domains. In analyzing individual virus behaviors through single-virus tracking, we identified a novel function of the hemagglutinin and esterase of influenza C virus (ICV) as the motility machinery. Hemagglutinin iteratively exchanges a viral receptor, causing virus movement. Esterase degrades the receptors along the trajectory traveled by the virus and prevents the virus from moving backward, causing directional movement. We propose that ICV has a unique motile machinery directionally controlled via hemagglutinin sensing the receptor density manipulated by esterase. Copyright © 2018 Sakai et al.

  11. Functional selectivity of GPCR-directed drug action through location bias

    PubMed Central

    Irannejad, Roshanak; Pessino, Veronica; Mika, Delphine; Huang, Bo; Wedegaertner, Philip B.; Conti, Marco; von Zastrow, Mark

    2017-01-01

    G protein-coupled receptors (GPCRs) are increasingly recognized to operate from intracellular membranes as well as the plasma membrane. The β2-adrenergic GPCR can activate Gs-linkedcyclic AMP (cAMP) signaling from endosomes. We show here that the homologous human β1-adrenergic receptor initiates an internal Gs-cAMP signal from the Golgi apparatus. By developing a chemical method to acutely squelch G protein coupling at defined membrane locations, we demonstrate that Golgi activation contributes significantly to the overall cellular cAMP response. Golgi signalling utilizes a pre-existing receptor pool rather than receptors delivered from the cell surface, requiring separate access of extracellular ligands. Epinephrine, a hydrophilic endogenous ligand, accesses the Golgi-localized receptor pool by facilitated transport requiring the organic cation transporter 3 (OCT3) whereas drugs can access the Golgi pool by passive diffusion according to hydrophobicity. We demonstrate marked differences among both agonist and antagonist drugs in Golgi-localized receptor access, and show that β-blocker drugs presently used in the clinic differ markedly in ability to antagonize the Golgi signal. We propose ’location bias’ as a new principle for achieving functional selectivity of GPCR-directed drug action. PMID:28553949

  12. Glycosylation of β2 Subunits Regulates GABAA Receptor Biogenesis and Channel Gating*

    PubMed Central

    Lo, Wen-yi; Lagrange, Andre H.; Hernandez, Ciria C.; Harrison, Rebecca; Dell, Anne; Haslam, Stuart M.; Sheehan, Jonathan H.; Macdonald, Robert L.

    2010-01-01

    γ-Aminobutyric acid type A (GABAA) receptors are heteropentameric glycoproteins. Based on consensus sequences, the GABAA receptor β2 subunit contains three potential N-linked glycosylation sites, Asn-32, Asn-104, and Asn-173. Homology modeling indicates that Asn-32 and Asn-104 are located before the α1 helix and in loop L3, respectively, near the top of the subunit-subunit interface on the minus side, and that Asn-173 is located in the Cys-loop near the bottom of the subunit N-terminal domain. Using site-directed mutagenesis, we demonstrated that all predicted β2 subunit glycosylation sites were glycosylated in transfected HEK293T cells. Glycosylation of each site, however, produced specific changes in α1β2 receptor surface expression and function. Although glycosylation of Asn-173 in the Cys-loop was important for stability of β2 subunits when expressed alone, results obtained with flow cytometry, brefeldin A treatment, and endo-β-N-acetylglucosaminidase H digestion suggested that glycosylation of Asn-104 was required for efficient α1β2 receptor assembly and/or stability in the endoplasmic reticulum. Patch clamp recording revealed that mutation of each site to prevent glycosylation decreased peak α1β2 receptor current amplitudes and altered the gating properties of α1β2 receptor channels by reducing mean open time due to a reduction in the proportion of long open states. In addition to functional heterogeneity, endo-β-N-acetylglucosaminidase H digestion and glycomic profiling revealed that surface β2 subunit N-glycans at Asn-173 were high mannose forms that were different from those of Asn-32 and N104. Using a homology model of the pentameric extracellular domain of α1β2 channel, we propose mechanisms for regulation of GABAA receptors by glycosylation. PMID:20639197

  13. Plant Lectins and Lectin Receptor-Like Kinases: How Do They Sense the Outside?

    PubMed Central

    Bellande, Kevin; Bono, Jean-Jacques; Savelli, Bruno; Jamet, Elisabeth; Canut, Hervé

    2017-01-01

    Lectins are fundamental to plant life and have important roles in cell-to-cell communication; development and defence strategies. At the cell surface; lectins are present both as soluble proteins (LecPs) and as chimeric proteins: lectins are then the extracellular domains of receptor-like kinases (LecRLKs) and receptor-like proteins (LecRLPs). In this review; we first describe the domain architectures of proteins harbouring G-type; L-type; LysM and malectin carbohydrate-binding domains. We then focus on the functions of LecPs; LecRLKs and LecRLPs referring to the biological processes they are involved in and to the ligands they recognize. Together; LecPs; LecRLKs and LecRLPs constitute versatile recognition systems at the cell surface contributing to the detection of symbionts and pathogens; and/or involved in monitoring of the cell wall structure and cell growth. PMID:28561754

  14. Plant Lectins and Lectin Receptor-Like Kinases: How Do They Sense the Outside?

    PubMed

    Bellande, Kevin; Bono, Jean-Jacques; Savelli, Bruno; Jamet, Elisabeth; Canut, Hervé

    2017-05-31

    Lectins are fundamental to plant life and have important roles in cell-to-cell communication; development and defence strategies. At the cell surface; lectins are present both as soluble proteins (LecPs) and as chimeric proteins: lectins are then the extracellular domains of receptor-like kinases (LecRLKs) and receptor-like proteins (LecRLPs). In this review; we first describe the domain architectures of proteins harbouring G-type; L-type; LysM and malectin carbohydrate-binding domains. We then focus on the functions of LecPs; LecRLKs and LecRLPs referring to the biological processes they are involved in and to the ligands they recognize. Together; LecPs; LecRLKs and LecRLPs constitute versatile recognition systems at the cell surface contributing to the detection of symbionts and pathogens; and/or involved in monitoring of the cell wall structure and cell growth.

  15. Specific effects of surface carboxyl groups on anionic polystyrene particles in their interactions with mesenchymal stem cells

    NASA Astrophysics Data System (ADS)

    Jiang, Xiue; Musyanovych, Anna; Röcker, Carlheinz; Landfester, Katharina; Mailänder, Volker; Nienhaus, G. Ulrich

    2011-05-01

    Nanoparticle uptake by living cells is governed by chemical interactions between functional groups on the nanoparticle as well as the receptors on cell surfaces. Here we have investigated the uptake of anionic polystyrene (PS) nanoparticles of ~100 nm diameter by mesenchymal stem cells (MSCs) using spinning-disk confocal optical microscopy combined with a quantitative analysis of the fluorescence images. Two types of anionic PS nanoparticles with essentially identical sizes and ζ-potentials were employed in this study, carboxyl-functionalized nanoparticles (CPS) and plain PS nanoparticles, both coated with anionic detergent for stabilization. CPS nanoparticles were observed to internalize more rapidly and accumulate to a much higher level than plain PS nanoparticles. The relative importance of different uptake mechanisms for the two types of nanoparticles was investigated by using specific inhibitors. CPS nanoparticles were internalized mainly via the clathrin-mediated mechanism, whereas plain PS nanoparticles mainly utilized the macropinocytosis pathway. The pronounced difference in the internalization behavior of CPS and plain PS nanoparticles points to a specific interaction of the carboxyl group with receptors on the cell surface.

  16. The U24 Protein from Human Herpesvirus 6 and 7 Affects Endocytic Recycling▿

    PubMed Central

    Sullivan, Brian M.; Coscoy, Laurent

    2010-01-01

    Modulation of T-cell receptor expression and signaling is essential to the survival of many viruses. The U24 protein expressed by human herpesvirus 6A, a ubiquitous human pathogen, has been previously shown to downregulate the T-cell receptor. Here, we show that U24 also mediates cell surface downregulation of a canonical early endosomal recycling receptor, the transferrin receptor, indicating that this viral protein acts by blocking early endosomal recycling. We present evidence that U24 is a C-tail-anchored protein that is dependent for its function on TRC40/Asna-1, a component of a posttranslational membrane insertion pathway. Finally, we find that U24 proteins from other roseoloviruses have a similar genetic organization and a conserved function that is dependent on a proline-rich motif. Inhibition of a basic cellular process by U24 has interesting implications not only for the pathogenicity of roseoloviruses but also for our understanding of the biology of endosomal transport. PMID:19923186

  17. Structure-function Analysis of Receptor-binding in Adeno-Associated Virus Serotype 6 (AAV-6)

    PubMed Central

    Xie, Qing; Lerch, Thomas F.; Meyer, Nancy L.; Chapman, Michael S.

    2011-01-01

    Crystal structures of the AAV-6 capsid at 3 Å reveal a subunit fold homologous to other parvoviruses with greatest differences in two external loops. The electrostatic potential suggests that receptor-attachment is mediated by four residues: Arg576, Lys493, Lys459 and Lys531, defining a positively charged region curving up from the valley between adjacent spikes. It overlaps only partially with the receptor-binding site of AAV-2, and the residues endowing the electrostatic character are not homologous. Mutational substitution of each residue decreases heparin affinity, particularly Lys531 and Lys459. Neither is conserved among heparin-binding serotypes, indicating that diverse modes of receptor attachment have been selected in different serotypes. Surface topology and charge are also distinct at the shoulder of the spike, where linear epitopes for AAV-2’s neutralizing monoclonal antibody A20 come together. Evolutionarily, selection of changed side-chain charge may have offered a conservative means to evade immune neutralization while preserving other essential functionality. PMID:21917284

  18. Ligand-receptor assay for evaluation of functional activity of human recombinant VEGF and VEGFR-1 extracellular fragment.

    PubMed

    Leopol'd, A V; Baklaushev, V P; Korchagina, A A; Shein, S A; Grinenko, N F; Pavlov, K A; Ryabukhin, I A; Chekhonin, V P

    2012-04-01

    cDNA encoding VEGF and Ig-like extracellular domains 2-4 of VEGFR-1 (sFlt-1(2-4)) were cloned into prokaryotic expression vectors pET32a and pQE60. Recombinant proteins were purified (metal affinity chromatography) and renatured. Chemiluminescent study for the interaction of recombinant VEGF and sFlt-1(2-4) showed that biotinylated VEGF specifically binds to the polystyrene-immobilized receptor extracellular fragment. Biotinylated recombinant sFlt-1 interacts with immobilized VEGF. Analysis of the interaction of immobilized recombinant VEGFR-1 and VEGF with C6 glioma cells labeled with CFDA-SE (vital fluorescent dye) showed that recombinant VEGFR-1 also binds to native membrane-associated VEGF. Recombinant VEGF was shown to bind to specific receptors expressed on the surface of C6 glioma cells. Functional activity of these proteins was confirmed by ligand-receptor assay for VEGF and VEGFR-1 (sFlt-1) and quantitative chemiluminescent detection.

  19. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function.

    PubMed

    Kourelis, Jiorgos; van der Hoorn, Renier A L

    2018-02-01

    Plants have many, highly variable resistance ( R ) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize ( Zea mays ) Hm1 , was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. © 2018 American Society of Plant Biologists. All rights reserved.

  20. A Val85Met Mutation in Melanocortin-1 Receptor Is Associated with Reductions in Eumelanic Pigmentation and Cell Surface Expression in Domestic Rock Pigeons (Columba livia)

    PubMed Central

    Guernsey, Michael W.; Ritscher, Lars; Miller, Matthew A.; Smith, Daniel A.; Schöneberg, Torsten; Shapiro, Michael D.

    2013-01-01

    Variation in the melanocortin-1 receptor (Mc1r) is associated with pigmentation diversity in wild and domesticated populations of vertebrates, including several species of birds. Among domestic bird species, pigmentation variation in the rock pigeon ( Columba livia ) is particularly diverse. To determine the potential contribution of Mc1r variants to pigment diversity in pigeons, we sequenced Mc1r in a wide range of pigeon breeds and identified several single nucleotide polymorphisms, including a variant that codes for an amino acid substitution (Val85Met). In contrast to the association between Val85Met and eumelanism in other avian species, this change was associated with pheomelanism in pigeons. In vitro cAMP accumulation and protein expression assays revealed that Val85Met leads to decreased receptor function and reduced cell surface expression of the mutant protein. The reduced in vitro function is consistent with the observed association with reduced eumelanic pigmentation. Comparative genetic and cellular studies provide important insights about the range of mechanisms underlying diversity among vertebrates, including different phenotypic associations with similar mutations in different species. PMID:23977400

  1. An interactive network of elastase, secretases, and PAR-2 protein regulates CXCR1 receptor surface expression on neutrophils.

    PubMed

    Bakele, Martina; Lotz-Havla, Amelie S; Jakowetz, Anja; Carevic, Melanie; Marcos, Veronica; Muntau, Ania C; Gersting, Soeren W; Hartl, Dominik

    2014-07-25

    CXCL8 (IL-8) recruits and activates neutrophils through the G protein-coupled chemokine receptor CXCR1. We showed previously that elastase cleaves CXCR1 and thereby impairs antibacterial host defense. However, the molecular intracellular machinery involved in this process remained undefined. Here we demonstrate by using flow cytometry, confocal microscopy, subcellular fractionation, co-immunoprecipitation, and bioluminescence resonance energy transfer that combined α- and γ-secretase activities are functionally involved in elastase-mediated regulation of CXCR1 surface expression on human neutrophils, whereas matrix metalloproteases are dispensable. We further demonstrate that PAR-2 is stored in mobilizable compartments in neutrophils. Bioluminescence resonance energy transfer and co-immunoprecipitation studies showed that secretases, PAR-2, and CXCR1 colocalize and physically interact in a novel protease/secretase-chemokine receptor network. PAR-2 blocking experiments provided evidence that elastase increased intracellular presenilin-1 expression through PAR-2 signaling. When viewed in combination, these studies establish a novel functional network of elastase, secretases, and PAR-2 that regulate CXCR1 expression on neutrophils. Interfering with this network could lead to novel therapeutic approaches in neutrophilic diseases, such as cystic fibrosis or rheumatoid arthritis.

  2. Gain-of-function glutamate receptor interacting protein 1 variants alter GluA2 recycling and surface distribution in patients with autism

    PubMed Central

    Mejias, Rebeca; Adamczyk, Abby; Anggono, Victor; Niranjan, Tejasvi; Thomas, Gareth M.; Sharma, Kamal; Skinner, Cindy; Schwartz, Charles E.; Stevenson, Roger E.; Fallin, M. Daniele; Kaufmann, Walter; Pletnikov, Mikhail; Valle, David; Huganir, Richard L.; Wang, Tao

    2011-01-01

    Glutamate receptor interacting protein 1 (GRIP1) is a neuronal scaffolding protein that interacts directly with the C termini of glutamate receptors 2/3 (GluA2/3) via its PDZ domains 4 to 6 (PDZ4–6). We found an association (P < 0.05) of a SNP within the PDZ4-6 genomic region with autism by genotyping autistic patients (n = 480) and matched controls (n = 480). Parallel sequencing identified five rare missense variants within or near PDZ4–6 only in the autism cohort, resulting in a higher cumulative mutation load (P = 0.032). Two variants correlated with a more severe deficit in reciprocal social interaction in affected sibling pairs from proband families. These variants were associated with altered interactions with GluA2/3 and faster recycling and increased surface distribution of GluA2 in neurons, suggesting gain-of-function because GRIP1/2 deficiency showed opposite phenotypes. Grip1/2 knockout mice exhibited increased sociability and impaired prepulse inhibition. These results support a role for GRIP in social behavior and implicate GRIP1 variants in modulating autistic phenotype. PMID:21383172

  3. Monomer–dimer dynamics and distribution of GPI-anchored uPAR are determined by cell surface protein assemblies

    PubMed Central

    Caiolfa, Valeria R.; Zamai, Moreno; Malengo, Gabriele; Andolfo, Annapaola; Madsen, Chris D.; Sutin, Jason; Digman, Michelle A.; Gratton, Enrico; Blasi, Francesco; Sidenius, Nicolai

    2007-01-01

    To search for functional links between glycosylphosphatidylinositol (GPI) protein monomer–oligomer exchange and membrane dynamics and confinement, we studied urokinase plasminogen activator (uPA) receptor (uPAR), a GPI receptor involved in the regulation of cell adhesion, migration, and proliferation. Using a functionally active fluorescent protein–uPAR in live cells, we analyzed the effect that extracellular matrix proteins and uPAR ligands have on uPAR dynamics and dimerization at the cell membrane. Vitronectin directs the recruitment of dimers and slows down the diffusion of the receptors at the basal membrane. The commitment to uPA–plasminogen activator inhibitor type 1–mediated endocytosis and recycling modifies uPAR diffusion and induces an exchange between uPAR monomers and dimers. This exchange is fully reversible. The data demonstrate that cell surface protein assemblies are important in regulating the dynamics and localization of uPAR at the cell membrane and the exchange of monomers and dimers. These results also provide a strong rationale for dynamic studies of GPI-anchored molecules in live cells at steady state and in the absence of cross-linker/clustering agents. PMID:18056417

  4. An Interactive Network of Elastase, Secretases, and PAR-2 Protein Regulates CXCR1 Receptor Surface Expression on Neutrophils*

    PubMed Central

    Bakele, Martina; Lotz-Havla, Amelie S.; Jakowetz, Anja; Carevic, Melanie; Marcos, Veronica; Muntau, Ania C.; Gersting, Soeren W.; Hartl, Dominik

    2014-01-01

    CXCL8 (IL-8) recruits and activates neutrophils through the G protein-coupled chemokine receptor CXCR1. We showed previously that elastase cleaves CXCR1 and thereby impairs antibacterial host defense. However, the molecular intracellular machinery involved in this process remained undefined. Here we demonstrate by using flow cytometry, confocal microscopy, subcellular fractionation, co-immunoprecipitation, and bioluminescence resonance energy transfer that combined α- and γ-secretase activities are functionally involved in elastase-mediated regulation of CXCR1 surface expression on human neutrophils, whereas matrix metalloproteases are dispensable. We further demonstrate that PAR-2 is stored in mobilizable compartments in neutrophils. Bioluminescence resonance energy transfer and co-immunoprecipitation studies showed that secretases, PAR-2, and CXCR1 colocalize and physically interact in a novel protease/secretase-chemokine receptor network. PAR-2 blocking experiments provided evidence that elastase increased intracellular presenilin-1 expression through PAR-2 signaling. When viewed in combination, these studies establish a novel functional network of elastase, secretases, and PAR-2 that regulate CXCR1 expression on neutrophils. Interfering with this network could lead to novel therapeutic approaches in neutrophilic diseases, such as cystic fibrosis or rheumatoid arthritis. PMID:24914212

  5. Fas cell surface death receptor controls hepatic lipid metabolism by regulating mitochondrial function.

    PubMed

    Item, Flurin; Wueest, Stephan; Lemos, Vera; Stein, Sokrates; Lucchini, Fabrizio C; Denzler, Rémy; Fisser, Muriel C; Challa, Tenagne D; Pirinen, Eija; Kim, Youngsoo; Hemmi, Silvio; Gulbins, Erich; Gross, Atan; O'Reilly, Lorraine A; Stoffel, Markus; Auwerx, Johan; Konrad, Daniel

    2017-09-07

    Nonalcoholic fatty liver disease is one of the most prevalent metabolic disorders and it tightly associates with obesity, type 2 diabetes, and cardiovascular disease. Reduced mitochondrial lipid oxidation contributes to hepatic fatty acid accumulation. Here, we show that the Fas cell surface death receptor (Fas/CD95/Apo-1) regulates hepatic mitochondrial metabolism. Hepatic Fas overexpression in chow-fed mice compromises fatty acid oxidation, mitochondrial respiration, and the abundance of mitochondrial respiratory complexes promoting hepatic lipid accumulation and insulin resistance. In line, hepatocyte-specific ablation of Fas improves mitochondrial function and ameliorates high-fat-diet-induced hepatic steatosis, glucose tolerance, and insulin resistance. Mechanistically, Fas impairs fatty acid oxidation via the BH3 interacting-domain death agonist (BID). Mice with genetic or pharmacological inhibition of BID are protected from Fas-mediated impairment of mitochondrial oxidation and hepatic steatosis. We suggest Fas as a potential novel therapeutic target to treat obesity-associated fatty liver and insulin resistance.Hepatic steatosis is a common disease closely associated with metabolic syndrome and insulin resistance. Here Item et al. show that Fas, a member of the TNF receptor superfamily, contributes to mitochondrial dysfunction, steatosis development, and insulin resistance under high fat diet.

  6. CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

    PubMed

    Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

    2017-07-21

    Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

  7. Cell-specific targeting by heterobivalent ligands.

    PubMed

    Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J

    2011-07-20

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.

  8. Cell-Specific Targeting by Heterobivalent Ligands

    PubMed Central

    Josan, Jatinder S.; Handl, Heather L.; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M.; Vagner, Josef; Mash, Eugene A.; Hruby, Victor J.; Gillies, Robert J.

    2012-01-01

    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach—to specifically target combinations of cell-surface receptors using heteromultivalent ligands (“receptor combination approach”). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle4, DPhe7]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20–50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH2. Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging. PMID:21639139

  9. Tie2 and Eph Receptor Tyrosine Kinase Activation and Signaling

    PubMed Central

    Barton, William A.; Dalton, Annamarie C.; Seegar, Tom C.M.; Himanen, Juha P.

    2014-01-01

    The Eph and Tie cell surface receptors mediate a variety of signaling events during development and in the adult organism. As other receptor tyrosine kinases, they are activated on binding of extracellular ligands and their catalytic activity is tightly regulated on multiple levels. The Eph and Tie receptors display some unique characteristics, including the requirement of ligand-induced receptor clustering for efficient signaling. Interestingly, both Ephs and Ties can mediate different, even opposite, biological effects depending on the specific ligand eliciting the response and on the cellular context. Here we discuss the structural features of these receptors, their interactions with various ligands, as well as functional implications for downstream signaling initiation. The Eph/ephrin structures are already well reviewed and we only provide a brief overview on the initial binding events. We go into more detail discussing the Tie-angiopoietin structures and recognition. PMID:24478383

  10. Evidence for Conservation of the Calcitonin Superfamily and Activity-regulating Mechanisms in the Basal Chordate Branchiostoma floridae: INSIGHTS INTO THE MOLECULAR AND FUNCTIONAL EVOLUTION IN CHORDATES.

    PubMed

    Sekiguchi, Toshio; Kuwasako, Kenji; Ogasawara, Michio; Takahashi, Hiroki; Matsubara, Shin; Osugi, Tomohiro; Muramatsu, Ikunobu; Sasayama, Yuichi; Suzuki, Nobuo; Satake, Honoo

    2016-01-29

    The calcitonin (CT)/CT gene-related peptide (CGRP) family is conserved in vertebrates. The activities of this peptide family are regulated by a combination of two receptors, namely the calcitonin receptor (CTR) and the CTR-like receptor (CLR), and three receptor activity-modifying proteins (RAMPs). Furthermore, RAMPs act as escort proteins by translocating CLR to the cell membrane. Recently, CT/CGRP family peptides have been identified or inferred in several invertebrates. However, the molecular characteristics and relevant functions of the CTR/CLR and RAMPs in invertebrates remain unclear. In this study, we identified three CT/CGRP family peptides (Bf-CTFPs), one CTR/CLR-like receptor (Bf-CTFP-R), and three RAMP-like proteins (Bf-RAMP-LPs) in the basal chordate amphioxus (Branchiostoma floridae). The Bf-CTFPs were shown to possess an N-terminal circular region typical of the CT/CGRP family and a C-terminal Pro-NH2. The Bf-CTFP genes were expressed in the central nervous system and in endocrine cells of the midgut, indicating that Bf-CTFPs serve as brain and/or gut peptides. Cell surface expression of the Bf-CTFP-R was enhanced by co-expression with each Bf-RAMP-LP. Furthermore, Bf-CTFPs activated Bf-CTFP-R·Bf-RAMP-LP complexes, resulting in cAMP accumulation. These results confirmed that Bf-RAMP-LPs, like vertebrate RAMPs, are prerequisites for the function and translocation of the Bf-CTFP-R. The relative potencies of the three peptides at each receptor were similar. Bf-CTFP2 was a potent ligand at all receptors in cAMP assays. Bf-RAMP-LP effects on ligand potency order were distinct to vertebrate CGRP/adrenomedullin/amylin receptors. To the best of our knowledge, this is the first molecular and functional characterization of an authentic invertebrate CT/CGRP family receptor and RAMPs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Solitary chemoreceptor cells in the nasal cavity serve as sentinels of respiration

    PubMed Central

    Finger, Thomas E.; Böttger, Bärbel; Hansen, Anne; Anderson, Karl T.; Alimohammadi, Hessamedin; Silver, Wayne L.

    2003-01-01

    Inhalation of irritating substances leads to activation of the trigeminal nerve, triggering protective reflexes that include apnea or sneezing. Receptors for trigeminal irritants are generally assumed to be located exclusively on free nerve endings within the nasal epithelium, requiring that trigeminal irritants diffuse through the junctional barrier at the epithelial surface to activate receptors. We find, in both rats and mice, an extensive population of chemosensory cells that reach the surface of the nasal epithelium and form synaptic contacts with trigeminal afferent nerve fibers. These chemosensory cells express T2R “bitter-taste” receptors and α-gustducin, a G protein involved in chemosensory transduction. Functional studies indicate that bitter substances applied to the nasal epithelium activate the trigeminal nerve and evoke changes in respiratory rate. By extending to the surface of the nasal epithelium, these chemosensory cells serve to expand the repertoire of compounds that can activate trigeminal protective reflexes. The trigeminal chemoreceptor cells are likely to be remnants of the phylogenetically ancient population of solitary chemoreceptor cells found in the epithelium of all anamniote aquatic vertebrates. PMID:12857948

  12. Solitary chemoreceptor cells in the nasal cavity serve as sentinels of respiration.

    PubMed

    Finger, Thomas E; Böttger, Bärbel; Hansen, Anne; Anderson, Karl T; Alimohammadi, Hessamedin; Silver, Wayne L

    2003-07-22

    Inhalation of irritating substances leads to activation of the trigeminal nerve, triggering protective reflexes that include apnea or sneezing. Receptors for trigeminal irritants are generally assumed to be located exclusively on free nerve endings within the nasal epithelium, requiring that trigeminal irritants diffuse through the junctional barrier at the epithelial surface to activate receptors. We find, in both rats and mice, an extensive population of chemosensory cells that reach the surface of the nasal epithelium and form synaptic contacts with trigeminal afferent nerve fibers. These chemosensory cells express T2R "bitter-taste" receptors and alpha-gustducin, a G protein involved in chemosensory transduction. Functional studies indicate that bitter substances applied to the nasal epithelium activate the trigeminal nerve and evoke changes in respiratory rate. By extending to the surface of the nasal epithelium, these chemosensory cells serve to expand the repertoire of compounds that can activate trigeminal protective reflexes. The trigeminal chemoreceptor cells are likely to be remnants of the phylogenetically ancient population of solitary chemoreceptor cells found in the epithelium of all anamniote aquatic vertebrates.

  13. Receptor for advanced glycation end products binds to phosphatidylserine and assists in the clearance of apoptotic cells

    PubMed Central

    He, Mei; Kubo, Hiroshi; Morimoto, Konosuke; Fujino, Naoya; Suzuki, Takaya; Takahasi, Toru; Yamada, Mitsuhiro; Yamaya, Mutsuo; Maekawa, Tomoyuki; Yamamoto, Yasuhiko; Yamamoto, Hiroshi

    2011-01-01

    Clearance of apoptotic cells is necessary for tissue development, homeostasis and resolution of inflammation. The uptake of apoptotic cells is initiated by an ‘eat-me' signal, such as phosphatidylserine, on the cell surface and phagocytes recognize the signal by using specific receptors. In this study, we show that the soluble form of the receptor for advanced glycation end products (RAGE) binds to phosphatidylserine as well as to the apoptotic thymocytes. RAGE-deficient (Rage−/−) alveolar macrophages showed impaired phagocytosis of apoptotic thymocytes and defective clearance of apoptotic neutrophils in Rage−/− mice. Our results indicate that RAGE functions as a phosphatidylserine receptor and assists in the clearance of apoptotic cells. PMID:21399623

  14. Sensing Structures Inspired by Blind Cave Fish

    NASA Astrophysics Data System (ADS)

    McConney, Michael E.; Chen, Nannan; Lu, David; Anderson, Kyle D.; Hu, Huan; Liu, Chang; Tsukruk, Vladimir V.

    2009-03-01

    Blind cave fish, with degenerated non-functioning eyes, have evolved to ``see'' their hydrodynamic environment by using the flow receptors of the lateral line system. The hair-cell receptors are encapsulated in a hydrogel-like material, called a cupula, which increases the sensitivity of the hair-cell receptors by coupling their motion to the surrounding flowing media. We characterized the viscoelastic properties and of blind cave fish cupulae by using colloidal-probe spectroscopy in fluid. A photo-patternable hydrogel with similar properties was developed to mimic the fish receptor coupling structure. Flow-based measurements indicated that the hydrogels enhance drag through increased surface area, but also inherent material properties. These bio-inspired structures endowed micro-fabricated flow sensors with sensitivities rivaling that of fish.

  15. Neurodegenerative disease mutations in TREM2 reveal a functional surface and distinct loss-of-function mechanisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kober, Daniel L.; Alexander-Brett, Jennifer M.; Karch, Celeste M.

    Genetic variations in the myeloid immune receptor TREM2 are linked to several neurodegenerative diseases. To determine how TREM2 variants contribute to these diseases, we performed structural and functional studies of wild-type and variant proteins. Our 3.1 Å TREM2 crystal structure revealed that mutations found in Nasu-Hakola disease are buried whereas Alzheimer’s disease risk variants are found on the surface, suggesting that these mutations have distinct effects on TREM2 function. Biophysical and cellular methods indicate that Nasu-Hakola mutations impact protein stability and decrease folded TREM2 surface expression, whereas Alzheimer’s risk variants impact binding to a TREM2 ligand. Additionally, the Alzheimer’s riskmore » variants appear to epitope map a functional surface on TREM2 that is unique within the larger TREM family. These findings provide a guide to structural and functional differences among genetic variants of TREM2, indicating that therapies targeting the TREM2 pathway should be tailored to these genetic and functional differences with patient-specific medicine approaches for neurodegenerative disorders.« less

  16. Functional analysis of free fatty acid receptor GPR120 in human eosinophils: implications in metabolic homeostasis.

    PubMed

    Konno, Yasunori; Ueki, Shigeharu; Takeda, Masahide; Kobayashi, Yoshiki; Tamaki, Mami; Moritoki, Yuki; Oyamada, Hajime; Itoga, Masamichi; Kayaba, Hiroyuki; Omokawa, Ayumi; Hirokawa, Makoto

    2015-01-01

    Recent evidence has shown that eosinophils play an important role in metabolic homeostasis through Th2 cytokine production. GPR120 (FFA4) is a G protein-coupled receptor (GPCR) for long-chain fatty acids that functions as a regulator of physiological energy metabolism. In the present study, we aimed to investigate whether human eosinophils express GPR120 and, if present, whether it possesses a functional capacity on eosinophils. Eosinophils isolated from peripheral venous blood expressed GPR120 at both the mRNA and protein levels. Stimulation with a synthetic GPR120 agonist, GW9508, induced rapid down-regulation of cell surface expression of GPR120, suggesting ligand-dependent receptor internalization. Although GPR120 activation did not induce eosinophil chemotactic response and degranulation, we found that GW9508 inhibited eosinophil spontaneous apoptosis and Fas receptor expression. The anti-apoptotic effect was attenuated by phosphoinositide 3-kinase (PI3K) inhibitors and was associated with inhibition of caspase-3 activity. Eosinophil response investigated using ELISpot assay indicated that stimulation with a GPR120 agonist induced IL-4 secretion. These findings demonstrate the novel functional properties of fatty acid sensor GPR120 on human eosinophils and indicate the previously unrecognized link between nutrient metabolism and the immune system.

  17. BTK inhibition results in impaired CXCR4 chemokine receptor surface expression, signaling and function in chronic lymphocytic leukemia.

    PubMed

    Chen, S-S; Chang, B Y; Chang, S; Tong, T; Ham, S; Sherry, B; Burger, J A; Rai, K R; Chiorazzi, N

    2016-04-01

    Bruton's tyrosine kinase (BTK) is involved in the regulation of B-cell growth, migration and adhesion. The importance of BTK in cell trafficking is emphasized by the clonal contraction proceeded by lymphocytosis typical for the enzyme inhibitor, ibrutinib, in B-cell malignancies, including chronic lymphocytic leukemia (CLL). Here, we investigated BTK regulation of leukemic B-cell trafficking in a mouse model of aggressive TCL1 CLL-like disease. Inhibiting BTK by ibrutinib reduced surface membrane (sm) levels of CXCR4 but not CXCR5, CD49d and other adhesion/homing receptors. Decreased smCXCR4 levels resulted from blocking receptor signal transduction, which in turn aborted cycling from and to the membrane. This resulted in rapid re-distribution of CLL cells from spleens and lymph nodes into the circulation. CLL cells with impaired smCXCR4 from BTK inhibition failed to home to spleens. These functional changes mainly resulted from inhibition of CXCR4 phosphorylation at Ser339, mediated directly by blocking BTK enzymatic activity and indirectly by affecting the function of downstream targets PLCγ2 and PKCμ, and eventually synthesis of PIM-1 and BTK itself. Our data identify CXCR4 as a key regulator in BTK-mediated CLL-cell retention and have elucidated a complex set of not previously described mechanisms responsible for these effects.

  18. Some properties of human neuronal alpha 7 nicotinic acetylcholine receptors fused to the green fluorescent protein.

    PubMed

    Palma, Eleonora; Mileo, Anna M; Martinez-Torres, Ataulfo; Eusebi, Fabrizio; Miledi, Ricardo

    2002-03-19

    The functional properties and cellular localization of the human neuronal alpha7 nicotinic acetylcholine (AcCho) receptor (alpha7 AcChoR) and its L248T mutated (mut) form were investigated by expressing them alone or as gene fusions with the enhanced version of the green fluorescent protein (GFP). Xenopus oocytes injected with wild-type (wt), mutalpha7, or the chimeric subunit cDNAs expressed receptors that gated membrane currents when exposed to AcCho. As already known, AcCho currents generated by wtalpha7 receptors decay much faster than those elicited by the mutalpha7 receptors. Unexpectedly, the fusion of GFP to the wt and mutated alpha7 receptors led to opposite results: the AcCho-current decay of the wt receptors became slower, whereas that of the mutated receptors was accelerated. Furthermore, repetitive applications of AcCho led to a considerable "run-down" of the AcCho currents generated by mutalpha7-GFP receptors, whereas those of the wtalpha7-GFP receptors remained stable or increased in amplitude. The AcCho-current run-down of mutalpha7-GFP oocytes was accompanied by a marked decrease of alpha-bungarotoxin binding activity. Fluorescence, caused by the chimeric receptors expressed, was seen over the whole oocyte surface but was more intense and abundant in the animal hemisphere, whereas it was much weaker in the vegetal hemisphere. We conclude that fusion of GFP to wtalpha7 and mutalpha7 receptors provides powerful tools to study the distribution and function of alpha7 receptors. We also conclude that fused genes do not necessarily recapitulate all of the properties of the original receptors. This fact must be borne close in mind whenever reporter genes are attached to proteins.

  19. G protein-coupled receptor mutations and human genetic disease.

    PubMed

    Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

    2014-01-01

    Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common pharmacogenetic variants.

  20. The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, H.; Grubb, J.H.; Sly, W.S.

    1990-10-01

    The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human {beta}-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3{percent} of the total functionalmore » receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of {beta}-glucuronidase. At pH 7.5, the rate of endocytosis was only 14{percent} the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized {beta}-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized {beta}-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor.« less

  1. Charge heterogeneity: Basic antibody charge variants with increased binding to Fc receptors

    PubMed Central

    Hintersteiner, Beate; Lingg, Nico; Zhang, Peiqing; Woen, Susanto; Hoi, Kong Meng; Stranner, Stefan; Wiederkum, Susanne; Mutschlechner, Oliver; Schuster, Manfred; Loibner, Hans; Jungbauer, Alois

    2016-01-01

    ABSTRACT We identified active isoforms of the chimeric anti-GD2 antibody, ch14.18, a recombinant antibody produced in Chinese hamster ovary cells, which is already used in clinical trials.1,2,3 We separated the antibody by high resolution ion-exchange chromatography with linear pH gradient elution into acidic, main and basic charge variants on a preparative scale yielding enough material for an in-depth study of the sources and the effects of microheterogeneity. The binding affinity of the charge variants toward the antigen and various cell surface receptors was studied by Biacore. Effector functions were evaluated using cellular assays for antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity. Basic charge variants showed increased binding to cell surface receptor FcγRIIIa, which plays a major role in regulating effector functions. Furthermore, increased binding of the basic fractions to the neonatal receptor was observed. As this receptor mediates the prolonged half-life of IgG in human serum, this data may well hint at an increased serum half-life of these basic variants compared to their more acidic counterparts. Different glycoform patterns, C-terminal lysine clipping and N-terminal pyroglutamate formation were identified as the main structural sources for the observed isoform pattern. Potential differences in structural stability between individual charge variant fractions by nano differential scanning calorimetry could not been detected. Our in-vitro data suggests that the connection between microheterogeneity and the biological activity of recombinant antibody therapeutics deserves more attention than commonly accepted. PMID:27559765

  2. Protease-Activated Receptor 4 Variant p.Tyr157Cys Reduces Platelet Functional Responses and Alters Receptor Trafficking.

    PubMed

    Norman, Jane E; Cunningham, Margaret R; Jones, Matthew L; Walker, Mary E; Westbury, Sarah K; Sessions, Richard B; Mundell, Stuart J; Mumford, Andrew D

    2016-05-01

    Protease-activated receptor 4 (PAR4) is a key regulator of platelet reactivity and is encoded by F2RL3, which has abundant rare missense variants. We aimed to provide proof of principle that rare F2LR3 variants potentially affect platelet reactivity and responsiveness to PAR1 antagonist drugs and to explore underlying molecular mechanisms. We identified 6 rare F2RL3 missense variants in 236 cardiac patients, of which the variant causing a tyrosine 157 to cysteine substitution (Y157C) was predicted computationally to have the greatest effect on PAR4 structure. Y157C platelets from 3 cases showed reduced responses to PAR4-activating peptide and to α-thrombin compared with controls, but no reduction in responses to PAR1-activating peptide. Pretreatment with the PAR1 antagonist vorapaxar caused lower residual α-thrombin responses in Y157C platelets than in controls, indicating greater platelet inhibition. HEK293 cells transfected with a PAR4 Y157C expression construct had reduced PAR4 functional responses, unchanged total PAR4 expression but reduced surface expression. PAR4 Y157C was partially retained in the endoplasmic reticulum and displayed an expression pattern consistent with defective N-glycosylation. Mutagenesis of Y322, which is the putative hydrogen bond partner of Y157, also reduced PAR4 surface expression in HEK293 cells. Reduced PAR4 responses associated with Y157C result from aberrant anterograde surface receptor trafficking, in part, because of disrupted intramolecular hydrogen bonding. Characterization of PAR4 Y157C establishes that rare F2RL3 variants have the potential to markedly alter platelet PAR4 reactivity particularly after exposure to therapeutic PAR1 antagonists. © 2016 American Heart Association, Inc.

  3. Role of Pgrmc1 in estrogen maintenance of meiotic arrest in zebrafish oocytes through Gper/Egfr.

    PubMed

    Aizen, Joseph; Thomas, Peter

    2015-04-01

    The regulation of receptor trafficking to the cell surface and its effect on responses of target cells to growth factors and hormones remain poorly understood. Initial evidence has been recently obtained using cancer cells that surface expression of the epidermal growth factor receptor (EGFR) is dependent on its association with progesterone receptor membrane component 1 (PGRMC1). Estrogen inhibition of oocyte maturation (OM) in zebrafish is mediated through G-protein-coupled estrogen membrane receptor 1 (Gper1) and involves activation of Egfr. Therefore, in this study, the potential roles of Pgrmc1 in the cell surface expression and functions of Egfr in normal cells were investigated in this in vitro OM model of Egfr action using an inhibitor of PGMRC1 signaling, AG205. A single ∼60 kDa protein band, which corresponds to the size of the Pgrmc1 dimer, was detected on plasma membranes of fully grown oocytes by western blotting. Co-treatment with the PGRMC1 inhibitor AG205 (20 μM) blocked the inhibitory effects of 100 nM estradiol-17β and the GPER agonist, G-1, on spontaneous maturation of denuded zebrafish oocytes. Moreover, reversal of these estrogen effects on OM by the EGFR inhibitors AG1478 and AG825 (50 μM) was prevented by co-incubation with the PGRMC1 inhibitor. Inhibition of Pgrmc1 signaling with AG205 also caused a decrease in Egfr-dependent signaling and Egfr expression on oocyte cell membranes. These results indicate that maintenance of Pgrmc1 signaling is required for Egfr expression on zebrafish oocyte cell membranes and for conserving the functions of Egfr in maintaining meiotic arrest through estrogen activation of Gper. © 2015 Society for Endocrinology.

  4. Nested Expression Domains for Odorant Receptors in Zebrafish Olfactory Epithelium

    NASA Astrophysics Data System (ADS)

    Weth, Franco; Nadler, Walter; Korsching, Sigrun

    1996-11-01

    The mapping of high-dimensional olfactory stimuli onto the two-dimensional surface of the nasal sensory epithelium constitutes the first step in the neuronal encoding of olfactory input. We have used zebrafish as a model system to analyze the spatial distribution of odorant receptor molecules in the olfactory epithelium by quantitative in situ hybridization. To this end, we have cloned 10 very divergent zebrafish odorant receptor molecules by PCR. Individual genes are expressed in sparse olfactory receptor neurons. Analysis of the position of labeled cells in a simplified coordinate system revealed three concentric, albeit overlapping, expression domains for the four odorant receptors analyzed in detail. Such regionalized expression should result in a corresponding segregation of functional response properties. This might represent the first step of spatial encoding of olfactory input or be essential for the development of the olfactory system.

  5. Plant peptide hormone signalling.

    PubMed

    Motomitsu, Ayane; Sawa, Shinichiro; Ishida, Takashi

    2015-01-01

    The ligand-receptor-based cell-to-cell communication system is one of the most important molecular bases for the establishment of complex multicellular organisms. Plants have evolved highly complex intercellular communication systems. Historical studies have identified several molecules, designated phytohormones, that function in these processes. Recent advances in molecular biological analyses have identified phytohormone receptors and signalling mediators, and have led to the discovery of numerous peptide-based signalling molecules. Subsequent analyses have revealed the involvement in and contribution of these peptides to multiple aspects of the plant life cycle, including development and environmental responses, similar to the functions of canonical phytohormones. On the basis of this knowledge, the view that these peptide hormones are pivotal regulators in plants is becoming increasingly accepted. Peptide hormones are transcribed from the genome and translated into peptides. However, these peptides generally undergo further post-translational modifications to enable them to exert their function. Peptide hormones are expressed in and secreted from specific cells or tissues. Apoplastic peptides are perceived by specialized receptors that are located at the surface of target cells. Peptide hormone-receptor complexes activate intracellular signalling through downstream molecules, including kinases and transcription factors, which then trigger cellular events. In this chapter we provide a comprehensive summary of the biological functions of peptide hormones, focusing on how they mature and the ways in which they modulate plant functions. © 2015 Authors; published by Portland Press Limited.

  6. A dual positive and negative regulation of monocyte activation by leukocyte Ig-like receptor B4 depends on the position of the tyrosine residues in its ITIMs.

    PubMed

    Park, Mijeong; Liu, Robert W; An, Hongyan; Geczy, Carolyn L; Thomas, Paul S; Tedla, Nicodemus

    2017-05-01

    The leukocyte Ig-like receptor B4 (LILRB4) is an inhibitory cell surface receptor, primarily expressed on mono-myeloid cells. It contains 2 C-type Ig-like extracellular domains and a long cytoplasmic domain that contains three intracellular immunoreceptor tyrosine-based inhibitory motifs (ITIMs). Data suggest that LILRB4 suppresses Fc receptor-dependent monocyte functions via its ITIMs, but relative contributions of the three ITIMs are not characterised. To address this, tyrosine (Tyr) residues at positions 337, 389 and 419 were single, double or triple mutated to phenylalanine and stably transfected into a human monocytic cell line, THP-1. Intact Tyr 389 was sufficient to maximally inhibit FcγRI-mediated TNF-α production in THP-1 cells, but, paradoxically, Tyr 337 significantly enhanced TNF-α production. In contrast, bactericidal activity was significantly enhanced in mutants containing Tyr 419 , while Tyr 337 markedly inhibited bacteria killing. Taken together, these results indicate that LILRB4 might have dual inhibitory and activating functions, depending on the position of the functional tyrosine residues in its ITIMs and/or the nature of the stimuli.

  7. Atomic force microscopy recognition of protein A on Staphylococcus aureus cell surfaces by labelling with IgG–Au conjugates

    PubMed Central

    Tatlybaeva, Elena B; Vasilchenko, Alexey S; Deryabin, Dmitri G

    2013-01-01

    Summary The labelling of functional molecules on the surface of bacterial cells is one way to recognize the bacteria. In this work, we have developed a method for the selective labelling of protein A on the cell surfaces of Staphylococcus aureus by using nanosized immunogold conjugates as cell-surface markers for atomic force microscopy (AFM). The use of 30-nm size Au nanoparticles conjugated with immunoglobulin G (IgG) allowed the visualization, localization and distribution of protein A–IgG complexes on the surface of S. aureus. The selectivity of the labelling method was confirmed in mixtures of S. aureus with Bacillus licheniformis cells, which differed by size and shape and had no IgG receptors on the surface. A preferential binding of the IgG–Au conjugates to S. aureus was obtained. Thus, this novel approach allows the identification of protein A and other IgG receptor-bearing bacteria, which is useful for AFM indication of pathogenic microorganisms in poly-component associations. PMID:24367742

  8. Membrane cholesterol effect on the 5-HT2A receptor: Insights into the lipid-induced modulation of an antipsychotic drug target.

    PubMed

    Ramírez-Anguita, Juan Manuel; Rodríguez-Espigares, Ismael; Guixà-González, Ramon; Bruno, Agostino; Torrens-Fontanals, Mariona; Varela-Rial, Alejandro; Selent, Jana

    2018-01-01

    The serotonin 5-hydroxytryptamine 2A (5-HT 2A ) receptor is a G-protein-coupled receptor (GPCR) relevant for the treatment of CNS disorders. In this regard, neuronal membrane composition in the brain plays a crucial role in the modulation of the receptor functioning. Since cholesterol is an essential component of neuronal membranes, we have studied its effect on the 5-HT 2A receptor dynamics through all-atom MD simulations. We find that the presence of cholesterol in the membrane increases receptor conformational variability in most receptor segments. Importantly, detailed structural analysis indicates that conformational variability goes along with the destabilization of hydrogen bonding networks not only within the receptor but also between receptor and lipids. In addition to increased conformational variability, we also find receptor segments with reduced variability. Our analysis suggests that this increased stabilization is the result of stabilizing effects of tightly bound cholesterol molecules to the receptor surface. Our finding contributes to a better understanding of membrane-induced alterations of receptor dynamics and points to cholesterol-induced stabilizing and destabilizing effects on the conformational variability of GPCRs. © 2017 International Union of Biochemistry and Molecular Biology, Inc.

  9. Genetically encoded pH sensor for tracking surface proteins through endocytosis.

    PubMed

    Grover, Anmol; Schmidt, Brigitte F; Salter, Russell D; Watkins, Simon C; Waggoner, Alan S; Bruchez, Marcel P

    2012-05-14

    Traffic cam: a tandem dye prepared from a FRET acceptor and a fluorogenic donor functions as a cell surface ratiometric pH indicator, which upon internalization serves to follow protein trafficking during endocytosis. This sensor was used to analyze agonist-dependent internalization of β(2)-adrenergic receptors. It was also used as a surrogate antigen to reveal direct surface-to-endosome antigen transfer between dendritic cells (not shown). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Functional mapping of cell surface proteins with localized stimulation of single cells

    NASA Astrophysics Data System (ADS)

    Sun, Bingyun; Chiu, Daniel T.

    2003-11-01

    This paper describes the development of using individual micro and nano meter-sized vesicles as delivery vessels to functionally map the distribution of cell surface proteins at the level of single cells. The formation of different sizes of vesicles from tens of nanometers to a few micrometers in diameter that contain the desired molecules is addressed. An optical trap is used to manipulate the loaded vesicle to specific cell morphology of interest, and a pulsed UV laser is used to photo-release the stimuli onto the cell membrane. Carbachol activated cellular calcium flux, upon binding to muscarinic acetylcholine receptors, is studied by this method, and the potential of using this method for the functional mapping of localized proteins on the cell surface membrane is discussed.

  11. GRB2 Interaction with the Ecotropic Murine Leukemia Virus Receptor, mCAT-1, Controls Virus Entry and Is Stimulated by Virus Binding

    PubMed Central

    Chen, Zeming; Kolokoltsov, Andrey A.; Wang, Jia; Adhikary, Shramika; Lorinczi, Marta; Elferink, Lisa A.

    2012-01-01

    For retroviruses such as HIV-1 and murine leukemia virus (MLV), active receptor recruitment and trafficking occur during viral entry. However, the underlying mechanisms and cellular factors involved in the process are largely uncharacterized. The viral receptor for ecotropic MLV (eMLV), a classical model for retrovirus infection mechanisms and pathogenesis, is mouse cationic amino acid transporter 1 (mCAT-1). Growth factor receptor-bound protein 2 (GRB2) is an adaptor protein that has been shown to couple cell surface receptors, such as epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor, to intracellular signaling events. Here we examined if GRB2 could also play a role in controlling infection by retroviruses by affecting receptor function. The GRB2 RNA interference (RNAi)-mediated suppression of endogenous GRB2 resulted in a consistent and significant reduction of virus binding and membrane fusion. The binding between eMLV and cells promoted increased GRB2–mCAT-1 interactions, as detected by immunoprecipitation. Consistently, the increased colocalization of GRB2 and mCAT-1 signals was detected by confocal microscopy. This association was time dependent and paralleled the kinetics of cell-virus membrane fusion. Interestingly, unlike the canonical binding pattern seen for GRB2 and growth factor receptors, GRB2–mCAT-1 binding does not depend on the GRB2-SH2 domain-mediated recognition of tyrosine phosphorylation on the receptor. The inhibition of endogenous GRB2 led to a reduction in surface levels of mCAT-1, which was detected by immunoprecipitation and by a direct binding assay using a recombinant MLV envelope protein receptor binding domain (RBD). Consistent with this observation, the expression of a dominant negative GRB2 mutant (R86K) resulted in the sequestration of mCAT-1 from the cell surface into intracellular vesicles. Taken together, these findings suggest a novel role for GRB2 in ecotropic MLV entry and infection by facilitating mCAT-1 trafficking. PMID:22090132

  12. GRB2 interaction with the ecotropic murine leukemia virus receptor, mCAT-1, controls virus entry and is stimulated by virus binding.

    PubMed

    Chen, Zeming; Kolokoltsov, Andrey A; Wang, Jia; Adhikary, Shramika; Lorinczi, Marta; Elferink, Lisa A; Davey, Robert A

    2012-02-01

    For retroviruses such as HIV-1 and murine leukemia virus (MLV), active receptor recruitment and trafficking occur during viral entry. However, the underlying mechanisms and cellular factors involved in the process are largely uncharacterized. The viral receptor for ecotropic MLV (eMLV), a classical model for retrovirus infection mechanisms and pathogenesis, is mouse cationic amino acid transporter 1 (mCAT-1). Growth factor receptor-bound protein 2 (GRB2) is an adaptor protein that has been shown to couple cell surface receptors, such as epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor, to intracellular signaling events. Here we examined if GRB2 could also play a role in controlling infection by retroviruses by affecting receptor function. The GRB2 RNA interference (RNAi)-mediated suppression of endogenous GRB2 resulted in a consistent and significant reduction of virus binding and membrane fusion. The binding between eMLV and cells promoted increased GRB2-mCAT-1 interactions, as detected by immunoprecipitation. Consistently, the increased colocalization of GRB2 and mCAT-1 signals was detected by confocal microscopy. This association was time dependent and paralleled the kinetics of cell-virus membrane fusion. Interestingly, unlike the canonical binding pattern seen for GRB2 and growth factor receptors, GRB2-mCAT-1 binding does not depend on the GRB2-SH2 domain-mediated recognition of tyrosine phosphorylation on the receptor. The inhibition of endogenous GRB2 led to a reduction in surface levels of mCAT-1, which was detected by immunoprecipitation and by a direct binding assay using a recombinant MLV envelope protein receptor binding domain (RBD). Consistent with this observation, the expression of a dominant negative GRB2 mutant (R86K) resulted in the sequestration of mCAT-1 from the cell surface into intracellular vesicles. Taken together, these findings suggest a novel role for GRB2 in ecotropic MLV entry and infection by facilitating mCAT-1 trafficking.

  13. FMRP acts as a key messenger for dopamine modulation in the forebrain.

    PubMed

    Wang, Hansen; Wu, Long-Jun; Kim, Susan S; Lee, Frank J S; Gong, Bo; Toyoda, Hiroki; Ren, Ming; Shang, Yu-Ze; Xu, Hui; Liu, Fang; Zhao, Ming-Gao; Zhuo, Min

    2008-08-28

    The fragile X mental retardation protein (FMRP) is an RNA-binding protein that controls translational efficiency and regulates synaptic plasticity. Here, we report that FMRP is involved in dopamine (DA) modulation of synaptic potentiation. AMPA glutamate receptor subtype 1 (GluR1) surface expression and phosphorylation in response to D1 receptor stimulation were reduced in cultured Fmr1(-/-) prefrontal cortex (PFC) neurons. Furthermore, D1 receptor signaling was impaired, accompanied by D1 receptor hyperphosphorylation at serine sites and subcellular redistribution of G protein-coupled receptor kinase 2 (GRK2) in both PFC and striatum of Fmr1(-/-) mice. FMRP interacted with GRK2, and pharmacological inhibition of GRK2 rescued D1 receptor signaling in Fmr1(-/-) neurons. Finally, D1 receptor agonist partially rescued hyperactivity and enhanced the motor function of Fmr1(-/-) mice. Our study has identified FMRP as a key messenger for DA modulation in the forebrain and may provide insights into the cellular and molecular mechanisms underlying fragile X syndrome.

  14. Crystal Structure of the Frizzled-Like Cysteine-Rich Domain of the Receptor Tyrosine Kinase MuSK

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stiegler, A.; Burden, S; Hubbard, S

    Muscle-specific kinase (MuSK) is an essential receptor tyrosine kinase for the establishment and maintenance of the neuromuscular junction (NMJ). Activation of MuSK by agrin, a neuronally derived heparan-sulfate proteoglycan, and LRP4 (low-density lipoprotein receptor-related protein-4), the agrin receptor, leads to clustering of acetylcholine receptors on the postsynaptic side of the NMJ. The ectodomain of MuSK comprises three immunoglobulin-like domains and a cysteine-rich domain (Fz-CRD) related to those in Frizzled proteins, the receptors for Wnts. Here, we report the crystal structure of the MuSK Fz-CRD at 2.1 {angstrom} resolution. The structure reveals a five-disulfide-bridged domain similar to CRDs of Frizzled proteinsmore » but with a divergent C-terminal region. An asymmetric dimer present in the crystal structure implicates surface hydrophobic residues that may function in homotypic or heterotypic interactions to mediate co-clustering of MuSK, rapsyn, and acetylcholine receptors at the NMJ.« less

  15. The Extracellular Surface of the GLP-1 Receptor Is a Molecular Trigger for Biased Agonism.

    PubMed

    Wootten, Denise; Reynolds, Christopher A; Smith, Kevin J; Mobarec, Juan C; Koole, Cassandra; Savage, Emilia E; Pabreja, Kavita; Simms, John; Sridhar, Rohan; Furness, Sebastian G B; Liu, Mengjie; Thompson, Philip E; Miller, Laurence J; Christopoulos, Arthur; Sexton, Patrick M

    2016-06-16

    Ligand-directed signal bias offers opportunities for sculpting molecular events, with the promise of better, safer therapeutics. Critical to the exploitation of signal bias is an understanding of the molecular events coupling ligand binding to intracellular signaling. Activation of class B G protein-coupled receptors is driven by interaction of the peptide N terminus with the receptor core. To understand how this drives signaling, we have used advanced analytical methods that enable separation of effects on pathway-specific signaling from those that modify agonist affinity and mapped the functional consequence of receptor modification onto three-dimensional models of a receptor-ligand complex. This yields molecular insights into the initiation of receptor activation and the mechanistic basis for biased agonism. Our data reveal that peptide agonists can engage different elements of the receptor extracellular face to achieve effector coupling and biased signaling providing a foundation for rational design of biased agonists. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Phenotypic regulation of the sphingosine 1-phosphate receptor miles apart by G protein-coupled receptor kinase 2.

    PubMed

    Burczyk, Martina; Burkhalter, Martin D; Blätte, Tamara; Matysik, Sabrina; Caron, Marc G; Barak, Lawrence S; Philipp, Melanie

    2015-01-27

    The evolutionarily conserved DRY motif at the end of the third helix of rhodopsin-like, class-A G protein-coupled receptors (GPCRs) is a major regulator of receptor stability, signaling activity, and β-arrestin-mediated internalization. Substitution of the DRY arginine with histidine in the human vasopressin receptor results in a loss-of-function phenotype associated with diabetes insipidus. The analogous R150H substitution of the DRY motif in zebrafish sphingosine-1 phosphate receptor 2 (S1p2) produces a mutation, miles apart m(93) (mil(m93)), that not only disrupts signaling but also impairs heart field migration. We hypothesized that constitutive S1p2 desensitization is the underlying cause of this strong zebrafish developmental defect. We observed in cell assays that the wild-type S1p2 receptor is at the cell surface whereas in distinct contrast the S1p2 R150H receptor is found in intracellular vesicles, blocking G protein but not arrestin signaling activity. Surface S1p2 R150H expression could be restored by inhibition of G protein-coupled receptor kinase 2 (GRK2). Moreover, we observed that β-arrestin 2 and GRK2 colocalize with S1p2 in developing zebrafish embryos and depletion of GRK2 in the S1p2 R150H miles apart zebrafish partially rescued cardia bifida. The ability of reduced GRK2 activity to reverse a developmental phenotype associated with constitutive desensitization supports efforts to genetically or pharmacologically target this kinase in diseases involving biased GPCR signaling.

  17. Phenotypic Regulation of the Sphingosine 1-Phosphate Receptor Miles Apart by G Protein-Coupled Receptor Kinase 2

    PubMed Central

    2016-01-01

    The evolutionarily conserved DRY motif at the end of the third helix of rhodopsin-like, class-A G protein-coupled receptors (GPCRs) is a major regulator of receptor stability, signaling activity, and β-arrestin-mediated internalization. Substitution of the DRY arginine with histidine in the human vasopressin receptor results in a loss-of-function phenotype associated with diabetes insipidus. The analogous R150H substitution of the DRY motif in zebrafish sphingosine-1 phosphate receptor 2 (S1p2) produces a mutation, miles apart m93 (milm93), that not only disrupts signaling but also impairs heart field migration. We hypothesized that constitutive S1p2 desensitization is the underlying cause of this strong zebrafish developmental defect. We observed in cell assays that the wild-type S1p2 receptor is at the cell surface whereas in distinct contrast the S1p2 R150H receptor is found in intracellular vesicles, blocking G protein but not arrestin signaling activity. Surface S1p2 R150H expression could be restored by inhibition of G protein-coupled receptor kinase 2 (GRK2). Moreover, we observed that β-arrestin 2 and GRK2 colocalize with S1p2 in developing zebrafish embryos and depletion of GRK2 in the S1p2 R150H miles apart zebrafish partially rescued cardia bifida. The ability of reduced GRK2 activity to reverse a developmental phenotype associated with constitutive desensitization supports efforts to genetically or pharmacologically target this kinase in diseases involving biased GPCR signaling. PMID:25555130

  18. Opioid receptor trafficking and interaction in nociceptors

    PubMed Central

    Zhang, X; Bao, L; Li, S

    2015-01-01

    Opiate analgesics such as morphine are often used for pain therapy. However, antinociceptive tolerance and dependence may develop with long-term use of these drugs. It was found that μ-opioid receptors can interact with δ-opioid receptors, and morphine antinociceptive tolerance can be reduced by blocking δ-opioid receptors. Recent studies have shown that μ- and δ-opioid receptors are co-expressed in a considerable number of small neurons in the dorsal root ganglion. The interaction of μ-opioid receptors with δ-opioid receptors in the nociceptive afferents is facilitated by the stimulus-induced cell-surface expression of δ-opioid receptors, and contributes to morphine tolerance. Further analysis of the molecular, cellular and neural circuit mechanisms that regulate the trafficking and interaction of opioid receptors and related signalling molecules in the pain pathway would help to elucidate the mechanism of opiate analgesia and improve pain therapy. LINKED ARTICLES This article is part of a themed section on Opioids: New Pathways to Functional Selectivity. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2015.172.issue-2 PMID:24611685

  19. Receptor clustering affects signal transduction at the membrane level in the reaction-limited regime

    NASA Astrophysics Data System (ADS)

    Caré, Bertrand R.; Soula, Hédi A.

    2013-01-01

    Many types of membrane receptors are found to be organized as clusters on the cell surface. We investigate the potential effect of such receptor clustering on the intracellular signal transduction stage. We consider a canonical pathway with a membrane receptor (R) activating a membrane-bound intracellular relay protein (G). We use Monte Carlo simulations to recreate biochemical reactions using different receptor spatial distributions and explore the dynamics of the signal transduction. Results show that activation of G by R is severely impaired by R clustering, leading to an apparent blunted biological effect compared to control. Paradoxically, this clustering decreases the half maximal effective dose (ED50) of the transduction stage, increasing the apparent affinity. We study an example of inter-receptor interaction in order to account for possible compensatory effects of clustering and observe the parameter range in which such interactions slightly counterbalance the loss of activation of G. The membrane receptors’ spatial distribution affects the internal stages of signal amplification, suggesting a functional role for membrane domains and receptor clustering independently of proximity-induced receptor-receptor interactions.

  20. β-Arrestin1 and Distinct CXCR4 Structures Are Required for Stromal Derived Factor-1 to Downregulate CXCR4 Cell-Surface Levels in Neuroblastoma

    PubMed Central

    Clift, Ian C.; Bamidele, Adebowale O.; Rodriguez-Ramirez, Christie; Kremer, Kimberly N.

    2014-01-01

    CXC chemokine receptor 4 (CXCR4) is a G protein–coupled receptor (GPCR) located on the cell surface that signals upon binding the chemokine stromal derived factor-1 (SDF-1; also called CXCL 12). CXCR4 promotes neuroblastoma proliferation and chemotaxis. CXCR4 expression negatively correlates with prognosis and drives neuroblastoma growth and metastasis in mouse models. All functions of CXCR4 require its expression on the cell surface, yet the molecular mechanisms that regulate CXCR4 cell-surface levels in neuroblastoma are poorly understood. We characterized CXCR4 cell-surface regulation in the related SH-SY5Y and SK-N-SH human neuroblastoma cell lines. SDF-1 treatment caused rapid down-modulation of CXCR4 in SH-SY5Y cells. Pharmacologic activation of protein kinase C similarly reduced CXCR4, but via a distinct mechanism. Analysis of CXCR4 mutants delineated two CXCR4 regions required for SDF-1 treatment to decrease cell-surface CXCR4 in neuroblastoma cells: the isoleucine-leucine motif at residues 328 and 329 and residues 343–352. In contrast, and unlike CXCR4 regulation in other cell types, serines 324, 325, 338, and 339 were not required. Arrestin proteins can bind and regulate GPCR cell-surface expression, often functioning together with kinases such as G protein–coupled receptor kinase 2 (GRK2). Using SK-N-SH cells which are naturally deficient in β-arrestin1, we showed that β-arrestin1 is required for the CXCR4 343–352 region to modulate CXCR4 cell-surface expression following treatment with SDF-1. Moreover, GRK2 overexpression enhanced CXCR4 internalization, via a mechanism requiring both β-arrestin1 expression and the 343–352 region. Together, these results characterize CXCR4 structural domains and β-arrestin1 as critical regulators of CXCR4 cell-surface expression in neuroblastoma. β-Arrestin1 levels may therefore influence the CXCR4-driven metastasis of neuroblastoma as well as prognosis. PMID:24452472

  1. Expression of γ-aminobutyric acid ρ1 and ρ1Δ450 as gene fusions with the green fluorescent protein

    PubMed Central

    Martínez-Torres, Ataúlfo; Miledi, Ricardo

    2001-01-01

    The functional characteristics and cellular localization of the γaminobutyric acid (GABA) ρ1 receptor and its nonfunctional isoform ρ1Δ450 were investigated by expressing them as gene fusions with the enhanced version of the green fluorescent protein (GFP). Oocytes injected with ρ1-GFP had receptors that gated chloride channels when activated by GABA. The functional characteristics of these receptors were the same as for those of wild-type ρ1 receptors. Fluorescence, because of the chimeric receptors expressed, was over the whole oocyte but was more intense near the cell surface and more abundant in the animal hemisphere. Similar to the wild type, ρ1Δ450-GFP did not lead to the expression of functional GABA receptors, and injected oocytes failed to generate currents even after exposure to high concentrations of GABA. Nonetheless, the fluorescence displayed by oocytes expressing ρ1Δ450-GFP was distributed similarly to that of ρ1-GFP. Mammalian cells transfected with the ρ1-GFP or ρ1Δ450-GFP constructs showed mostly intracellularly distributed fluorescence in confocal microscope images. A sparse localization of fluorescence was observed in the plasma membrane regardless of the cell line used. We conclude that ρ1Δ450 is expressed and transported close to, and perhaps incorporated into, the plasma membrane. Thus, ρ1- and ρ1Δ450-GFP fusions provide a powerful tool to visualize the traffic of GABA type C receptors. PMID:11172056

  2. New insights into the roles of megalin/LRP2 and the regulation of its functional expression.

    PubMed

    Marzolo, María-Paz; Farfán, Pamela

    2011-01-01

    Since the discovery of the low-density lipoprotein receptor (LDLR) and its association with familial hypercholesterolemia in the early 1980s, a family of structurally related proteins has been discovered that has apolipoprotein E as a common ligand, and the broad functions of its members have been described. LRP2, or megalin, is a member of the LDLR family and was initially called gp330. Megalin is an endocytic receptor expressed on the apical surface of several epithelial cells that internalizes a variety of ligands including nutrients, hormones and their carrier proteins, signaling molecules, morphogens, and extracellular matrix proteins. Once internalized, these ligands are directed to the lysosomal degradation pathway or transported by transcytosis from one side of the cell to the opposite membrane. The availability of megalin at the cell surface is controlled by several regulatory mechanisms, including the phosphorylation of its cytoplasmic domain by GSK3, the proteolysis of the extracellular domain at the cell surface (shedding), the subsequent intramembrane proteolysis of the transmembrane domain by the gamma-secretase complex, and exosome secretion. Based on the important roles of its ligands and its tissue expression pattern, megalin has been recognized as an important component of many pathological conditions, including diabetic nephropathy, Lowe syndrome, Dent disease, Alzheimer's disease (AD) and gallstone disease. In addition, the expression of megalin and some of its ligands in the central and peripheral nervous system suggests a role for this receptor in neural regeneration processes. Despite its obvious importance, the regulation of megalin expression is poorly understood. In this review, we describe the functions of megalin and its association with certain pathological conditions as well as the current understanding of the mechanisms that underlie the control of megalin expression.

  3. Disturbed neuronal ER-Golgi sorting of unassembled glycine receptors suggests altered subcellular processing is a cause of human hyperekplexia.

    PubMed

    Schaefer, Natascha; Kluck, Christoph J; Price, Kerry L; Meiselbach, Heike; Vornberger, Nadine; Schwarzinger, Stephan; Hartmann, Stephanie; Langlhofer, Georg; Schulz, Solveig; Schlegel, Nadja; Brockmann, Knut; Lynch, Bryan; Becker, Cord-Michael; Lummis, Sarah C R; Villmann, Carmen

    2015-01-07

    Recent studies on the pathogenic mechanisms of recessive hyperekplexia indicate disturbances in glycine receptor (GlyR) α1 biogenesis. Here, we examine the properties of a range of novel glycine receptor mutants identified in human hyperekplexia patients using expression in transfected cell lines and primary neurons. All of the novel mutants localized in the large extracellular domain of the GlyR α1 have reduced cell surface expression with a high proportion of receptors being retained in the ER, although there is forward trafficking of glycosylated subpopulations into the ER-Golgi intermediate compartment and cis-Golgi compartment. CD spectroscopy revealed that the mutant receptors have proportions of secondary structural elements similar to wild-type receptors. Two mutants in loop B (G160R, T162M) were functional, but none of those in loop D/β2-3 were. One nonfunctional truncated mutant (R316X) could be rescued by coexpression with the lacking C-terminal domain. We conclude that a proportion of GlyR α1 mutants can be transported to the plasma membrane but do not necessarily form functional ion channels. We suggest that loop D/β2-3 is an important determinant for GlyR trafficking and functionality, whereas alterations to loop B alter agonist potencies, indicating that residues here are critical elements in ligand binding. Copyright © 2015 the authors 0270-6474/15/350422-16$15.00/0.

  4. Surface heat shock protein 90 serves as a potential receptor for calcium oxalate crystal on apical membrane of renal tubular epithelial cells.

    PubMed

    Fong-Ngern, Kedsarin; Sueksakit, Kanyarat; Thongboonkerd, Visith

    2016-07-01

    Adhesion of calcium oxalate monohydrate (COM) crystals on renal tubular epithelial cells is a crucial step in kidney stone formation. Finding potential crystal receptors on the apical membrane of the cells may lead to a novel approach to prevent kidney stone disease. Our previous study identified a large number of crystal-binding proteins on the apical membrane of MDCK cells. However, their functional role as potential crystal receptors had not been validated. The present study aimed to address the potential role of heat shock protein 90 (HSP90) as a COM crystal receptor. The apical membrane was isolated from polarized MDCK cells by the peeling method and recovered proteins were incubated with COM crystals. Western blot analysis confirmed the presence of HSP90 in the apical membrane and the crystal-bound fraction. Immunofluorescence staining without permeabilization and laser-scanning confocal microscopy confirmed the surface HSP90 expression on the apical membrane of the intact cells. Crystal adhesion assay showed that blocking surface HSP90 by specific anti-HSP90 antibody and knockdown of HSP90 by small interfering RNA (siRNA) dramatically reduced crystal binding on the apical surface of MDCK cells (by approximately 1/2 and 2/3, respectively). Additionally, crystal internalization assay revealed the presence of HSP90 on the membrane of endocytic vesicle containing the internalized COM crystal. Moreover, pretreatment of MDCK cells with anti-HSP90 antibody significantly reduced crystal internalization (by approximately 1/3). Taken together, our data indicate that HSP90 serves as a potential receptor for COM crystals on the apical membrane of renal tubular epithelial cells and is involved in endocytosis/internalization of the crystals into the cells.

  5. Differential targeting of Gbetagamma-subunit signaling with small molecules.

    PubMed

    Bonacci, Tabetha M; Mathews, Jennifer L; Yuan, Chujun; Lehmann, David M; Malik, Sundeep; Wu, Dianqing; Font, Jose L; Bidlack, Jean M; Smrcka, Alan V

    2006-04-21

    G protein betagamma subunits have potential as a target for therapeutic treatment of a number of diseases. We performed virtual docking of a small-molecule library to a site on Gbetagamma subunits that mediates protein interactions. We hypothesized that differential targeting of this surface could allow for selective modulation of Gbetagamma subunit functions. Several compounds bound to Gbetagamma subunits with affinities from 0.1 to 60 muM and selectively modulated functional Gbetagamma-protein-protein interactions in vitro, chemotactic peptide signaling pathways in HL-60 leukocytes, and opioid receptor-dependent analgesia in vivo. These data demonstrate an approach for modulation of G protein-coupled receptor signaling that may represent an important therapeutic strategy.

  6. A novel mutation in the P2Y12 receptor and a function-reducing polymorphism in protease-activated receptor 1 in a patient with chronic bleeding.

    PubMed

    Patel, Y M; Lordkipanidzé, M; Lowe, G C; Nisar, S P; Garner, K; Stockley, J; Daly, M E; Mitchell, M; Watson, S P; Austin, S K; Mundell, S J

    2014-05-01

    The study of patients with bleeding problems is a powerful approach in determining the function and regulation of important proteins in human platelets. We have identified a patient with a chronic bleeding disorder expressing a homozygous P2RY(12) mutation, predicting an arginine to cysteine (R122C) substitution in the G-protein-coupled P2Y(12) receptor. This mutation is found within the DRY motif, which is a highly conserved region in G-protein-coupled receptors (GPCRs) that is speculated to play a critical role in regulating receptor conformational states. To determine the functional consequences of the R122C substitution for P2Y(12) function. We performed a detailed phenotypic analysis of an index case and affected family members. An analysis of the variant R122C P2Y(12) stably expressed in cells was also performed. ADP-stimulated platelet aggregation was reduced as a result of a significant impairment of P2Y(12) activity in the patient and family members. Cell surface R122C P2Y(12) expression was reduced both in cell lines and in platelets; in cell lines, this was as a consequence of agonist-independent internalization followed by subsequent receptor trafficking to lysosomes. Strikingly, members of this family also showed reduced thrombin-induced platelet activation, owing to an intronic polymorphism in the F2R gene, which encodes protease-activated receptor 1 (PAR-1), that has been shown to be associated with reduced PAR-1 receptor activity. Our study is the first to demonstrate a patient with deficits in two stimulatory GPCR pathways that regulate platelet activity, further indicating that bleeding disorders constitute a complex trait. © 2014 International Society on Thrombosis and Haemostasis.

  7. Dendritic Cells: A Spot on Sialic Acid

    PubMed Central

    Crespo, Hélio J.; Lau, Joseph T. Y.; Videira, Paula A.

    2013-01-01

    Glycans decorating cell surface and secreted proteins and lipids occupy the juncture where critical host–host and host-pathogen interactions occur. The role of glycan epitopes in cell–cell and cell-pathogen adhesive events is already well-established, and cell surface glycan structures change rapidly in response to stimulus and inflammatory cues. Despite the wide acceptance that glycans are centrally implicated in immunity, exactly how glycans and their changes contribute to the overall immune response remains poorly defined. Sialic acids are unique sugars that usually occupy the terminal position of the glycan chains and may be modified by external factors, such as pathogens, or upon specific physiological cellular events. At cell surface, sialic acid-modified structures form the key fundamental determinants for a number of receptors with known involvement in cellular adhesiveness and cell trafficking, such as the Selectins and the Siglec families of carbohydrate recognizing receptors. Dendritic cells (DCs) preside over the transition from innate to the adaptive immune repertoires, and no other cell has such relevant role in antigen screening, uptake, and its presentation to lymphocytes, ultimately triggering the adaptive immune response. Interestingly, sialic acid-modified structures are involved in all DC functions, such as antigen uptake, DC migration, and capacity to prime T cell responses. Sialic acid content changes along DC differentiation and activation and, while, not yet fully understood, these changes have important implications in DC functions. This review focuses on the developmental regulation of DC surface sialic acids and how manipulation of DC surface sialic acids can affect immune-critical DC functions by altering antigen endocytosis, pathogen and tumor cell recognition, cell recruitment, and capacity for T cell priming. The existing evidence points to a potential of DC surface sialylation as a therapeutic target to improve and diversify DC-based therapies. PMID:24409183

  8. Increased Accuracy of Ligand Sensing by Receptor Internalization and Lateral Receptor Diffusion

    NASA Astrophysics Data System (ADS)

    Aquino, Gerardo; Endres, Robert

    2010-03-01

    Many types of cells can sense external ligand concentrations with cell-surface receptors at extremely high accuracy. Interestingly, ligand-bound receptors are often internalized, a process also known as receptor-mediated endocytosis. While internalization is involved in a vast number of important functions for the life of a cell, it was recently also suggested to increase the accuracy of sensing ligand as overcounting of the same ligand molecules is reduced. A similar role may be played by receptor diffusion om the cell membrane. Fast, lateral receptor diffusion is known to be relevant in neurotransmission initiated by release of neurotransmitter glutamate in the synaptic cleft between neurons. By binding ligand and removal by diffusion from the region of release of the neurotransmitter, diffusing receptors can be reasonably expected to reduce the local overcounting of the same ligand molecules in the region of signaling. By extending simple ligand-receptor models to out-of-equilibrium thermodynamics, we show that both receptor internalization and lateral diffusion increase the accuracy with which cells can measure ligand concentrations in the external environment. We confirm this with our model and give quantitative predictions for experimental parameters values. We give quantitative predictions, which compare favorably to experimental data of real receptors.

  9. Ligand-targeted theranostic nanomedicines against cancer

    DOE PAGES

    Yao, Virginia J.; D'Angelo, Sara; Butler, Kimberly S.; ...

    2016-01-06

    Nanomedicines have significant potential for cancer treatment. Although the majority of nanomedicines currently tested in clinical trials utilize simple, biocompatible liposome-based nanocarriers, their widespread use is limited by non-specificity and low target site concentration and thus, do not provide a substantial clinical advantage over conventional, systemic chemotherapy. In the past 20 years, we have identified specific receptors expressed on the surfaces of tumor endothelial and perivascular cells, tumor cells, the extracellular matrix and stromal cells using combinatorial peptide libraries displayed on bacteriophage. These studies corroborate the notion that unique receptor proteins such as IL-11Rα, GRP78, EphA5, among others, are differentiallymore » overexpressed in tumors and present opportunities to deliver tumor-specific therapeutic drugs. By using peptides that bind to tumor-specific cell-surface receptors, therapeutic agents such as apoptotic peptides, suicide genes, imaging dyes or chemotherapeutics can be precisely and systemically delivered to reduce tumor growth in vivo, without harming healthy cells. Given the clinical applicability of peptide-based therapeutics, targeted delivery of nanocarriers loaded with therapeutic cargos seems plausible. We propose a modular design of a functionalized protocell in which a tumor-targeting moiety, such as a peptide or recombinant human antibody single chain variable fragment (scFv), is conjugated to a lipid bilayer surrounding a silica-based nanocarrier core containing a protected therapeutic cargo. The functionalized protocell can be tailored to a specific cancer subtype and treatment regimen by exchanging the tumor-targeting moiety and/or therapeutic cargo or used in combination to create unique, theranostic agents. In this review, we summarize the identification of tumor-specific receptors through combinatorial phage display technology and the use of antibody display selection to identify recombinant human scFvs against these tumor-specific receptors. We compare the characteristics of different types of simple and complex nanocarriers, and discuss potential types of therapeutic cargos and conjugation strategies. As a result, the modular design of functionalized protocells may improve the efficacy and safety of nanomedicines for future cancer therapy.« less

  10. Ligand-targeted theranostic nanomedicines against cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Virginia J.; D'Angelo, Sara; Butler, Kimberly S.

    Nanomedicines have significant potential for cancer treatment. Although the majority of nanomedicines currently tested in clinical trials utilize simple, biocompatible liposome-based nanocarriers, their widespread use is limited by non-specificity and low target site concentration and thus, do not provide a substantial clinical advantage over conventional, systemic chemotherapy. In the past 20 years, we have identified specific receptors expressed on the surfaces of tumor endothelial and perivascular cells, tumor cells, the extracellular matrix and stromal cells using combinatorial peptide libraries displayed on bacteriophage. These studies corroborate the notion that unique receptor proteins such as IL-11Rα, GRP78, EphA5, among others, are differentiallymore » overexpressed in tumors and present opportunities to deliver tumor-specific therapeutic drugs. By using peptides that bind to tumor-specific cell-surface receptors, therapeutic agents such as apoptotic peptides, suicide genes, imaging dyes or chemotherapeutics can be precisely and systemically delivered to reduce tumor growth in vivo, without harming healthy cells. Given the clinical applicability of peptide-based therapeutics, targeted delivery of nanocarriers loaded with therapeutic cargos seems plausible. We propose a modular design of a functionalized protocell in which a tumor-targeting moiety, such as a peptide or recombinant human antibody single chain variable fragment (scFv), is conjugated to a lipid bilayer surrounding a silica-based nanocarrier core containing a protected therapeutic cargo. The functionalized protocell can be tailored to a specific cancer subtype and treatment regimen by exchanging the tumor-targeting moiety and/or therapeutic cargo or used in combination to create unique, theranostic agents. In this review, we summarize the identification of tumor-specific receptors through combinatorial phage display technology and the use of antibody display selection to identify recombinant human scFvs against these tumor-specific receptors. We compare the characteristics of different types of simple and complex nanocarriers, and discuss potential types of therapeutic cargos and conjugation strategies. As a result, the modular design of functionalized protocells may improve the efficacy and safety of nanomedicines for future cancer therapy.« less

  11. A protein crosslinking assay for measuring cell surface expression of glutamate receptor subunits in the rodent brain after in vivo treatments

    PubMed Central

    Boudreau, Amy C.; Milovanovic, Mike; Conrad, Kelly L.; Nelson, Christopher; Ferrario, Carrie R.; Wolf, Marina E.

    2012-01-01

    Trafficking of neurotransmitter receptors between intracellular and cell surface compartments is important for regulating neurotransmission. We developed a method for determining if an in vivo treatment has altered receptor distribution in a particular region of rodent brain. After the treatment, brain slices are rapidly prepared from the region of interest. Then cell surface-expressed receptors are covalently crosslinked to nearby proteins using the membrane-impermeable, bifunctional crosslinker bis(sulfosuccinimidyl)suberate (BS3). This increases the apparent molecular weight of surface receptors, while intracellular receptors are not modified. Thus, surface and intracellular receptor pools can be separated and quantified using SDS-PAGE and immunoblotting. This method is particularly useful for analyzing AMPA receptor subunits, offering advantages in accuracy, efficiency and cost compared to biotinylation. A disadvantage is that some antibodies no longer recognize their target protein after crosslinking. We have used this method to quantify changes in receptor distribution after acute and chronic exposure to psychomotor stimulants. PMID:22470150

  12. IgA Fc receptors.

    PubMed

    Monteiro, Renato C; Van De Winkel, Jan G J

    2003-01-01

    The IgA receptor family comprises a number of surface receptors including the polymeric Ig receptor involved in epithelial transport of IgA/IgM, the myeloid specific IgA Fc receptor (FcalphaRI or CD89), the Fcalpha/muR, and at least two alternative IgA receptors. These are the asialoglycoprotein receptor and the transferrin receptor, which have been implicated in IgA catabolism, and tissue IgA deposition. In this review we focus on the biology of FcalphaRI (CD89). FcalphaRI is expressed on neutrophils, eosinophils, monocytes/macrophages, dendritic cells, and Kupffer cells. This receptor represents a heterogeneously glycosylated transmembrane protein that binds both IgA subclasses with low affinity. A single gene encoding FcalphaRI has been isolated, which is located within the leukocyte receptor cluster on chromosome 19. The FcalphaRI alpha chain lacks canonical signal transduction domains but can associate with the FcR gamma-chain that bears an activation motif (ITAM) in the cytoplasmic domain, allowing activatory functions. FcalphaRI expressed alone mediates endocytosis and recyling of IgA. No FcalphaRI homologue has been defined in the mouse, and progress in defining the in vivo role of FcalphaRI has been made using human FcalphaRI transgenic (Tg) mice. FcalphaRI-Tg mice demonstrated FcalphaRI expression on Kupffer cells and so defined a key role for the receptor in mucosal defense. The receptor functions as a second line of antibacterial defense involving serum IgA rather than secretory IgA. Studies in FcalphaRI-Tg mice, furthermore, defined an essential role for soluble FcalphaRI in the development of IgA nephropathy by formation of circulating IgA-FcalphaRI complexes. Finally, recent work points out a role for human IgA in treatment of infectious and neoplastic diseases.

  13. Ligand binding induces a sharp decrease in hydrophobicity of folate binding protein assessed by 1-anilinonaphthalene-8-sulphonate which suppresses self-association of the hydrophobic apo-protein.

    PubMed

    Holm, Jan; Lawaetz, Anders J; Hansen, Steen I

    2012-08-17

    High affinity folate binding protein (FBP) regulates as a soluble protein and as a cellular receptor intracellular trafficking of folic acid, a vitamin of great importance to cell growth and division. We addressed two issues of potential importance to the biological function of FBP, a possible decrease of the surface hydrophobicity associated with the ligand-induced conformation change of FBP, and protein-inter-protein interactions involved in self-association of hydrophobic apo-FBP. The extrinsic fluorescent apolar dye 1-anilinonaphthalene-8-sulphonate (ANS) exhibited enhanced fluorescence intensity and a blueshift of emission maximum from 510-520 nm to 460-470 nm upon addition of apo-FBP indicating binding to a strongly hydrophobic environment. Neither enhancement of fluorescence nor blueshift of ANS emission maximum occurred when folate-ligated holo-FBP replaced apo-FBP. The drastic decrease in surface hydrophobicity of holo-FBP could have bearings on the biological function of FBP since changes in surface hydrophobicity have critical effects on the biological function of receptors and transport proteins. ANS interacts with exposed hydrophobic surfaces on proteins and may thereby block and prevent aggregation of proteins (chaperone-like effect). Hence, hydrophobic interactions seemed to participate in the concentration-dependent self-association of apo-FBP which was suppressed by high ANS concentrations in light scatter measurements. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Synergistic inhibition of natural killer cells by the nonsignaling molecule CD94.

    PubMed

    Cheent, Kuldeep S; Jamil, Khaleel M; Cassidy, Sorcha; Liu, Mengya; Mbiribindi, Berenice; Mulder, Arend; Claas, Frans H J; Purbhoo, Marco A; Khakoo, Salim I

    2013-10-15

    Peptide selectivity is a feature of inhibitory receptors for MHC class I expressed by natural killer (NK) cells. CD94-NKG2A operates in tandem with the polymorphic killer cell Ig-like receptors (KIR) and Ly49 systems to inhibit NK cells. However, the benefits of having two distinct inhibitory receptor-ligand systems are not clear. We show that noninhibitory peptides presented by HLA-E can augment the inhibition of NKG2A(+) NK cells mediated by MHC class I signal peptides through the engagement of CD94 without a signaling partner. Thus, CD94 is a peptide-selective NK cell receptor, and NK cells can be regulated by nonsignaling interactions. We also show that KIR(+) and NKG2A(+) NK cells respond with differing stoichiometries to MHC class I down-regulation. MHC-I-bound peptide functions as a molecular rheostat controlling NK cell function. Selected peptides which in isolation do not inhibit NK cells can have different effects on KIR and NKG2A receptors. Thus, these two inhibitory systems may complement each other by having distinct responses to bound peptide and surface levels of MHC class I.

  15. The 3D Structure of the Binding Pocket of the Human Oxytocin Receptor for Benzoxazine Antagonists, Determined by Molecular Docking, Scoring Functions and 3D-QSAR Methods

    NASA Astrophysics Data System (ADS)

    Jójárt, Balázs; Martinek, Tamás A.; Márki, Árpád

    2005-05-01

    Molecular docking and 3D-QSAR studies were performed to determine the binding mode for a series of benzoxazine oxytocin antagonists taken from the literature. Structural hypotheses were generated by docking the most active molecule to the rigid receptor by means of AutoDock 3.05. The cluster analysis yielded seven possible binding conformations. These structures were refined by using constrained simulated annealing, and the further ligands were aligned in the refined receptor by molecular docking. A good correlation was found between the estimated Δ G bind and the p K i values for complex F. The Connolly-surface analysis, CoMFA and CoMSIA models q CoMFA 2 = 0.653, q CoMSA 2 = 0.630 and r pred,CoMFA 2 = 0.852 , r pred,CoMSIA 2 = 0.815) confirmed the scoring function results. The structural features of the receptor-ligand complex and the CoMFA and CoMSIA fields are in closely connected. These results suggest that receptor-ligand complex F is the most likely binding hypothesis for the studied benzoxazine analogs.

  16. Functioning of the dimeric GABAB receptor extracellular domain revealed by glycan wedge scanning

    PubMed Central

    Rondard, Philippe; Huang, Siluo; Monnier, Carine; Tu, Haijun; Blanchard, Bertrand; Oueslati, Nadia; Malhaire, Fanny; Li, Ying; Trinquet, Eric; Labesse, Gilles; Pin, Jean-Philippe; Liu, Jianfeng

    2008-01-01

    The G-protein-coupled receptor (GPCR) activated by the neurotransmitter GABA is made up of two subunits, GABAB1 and GABAB2. GABAB1 binds agonists, whereas GABAB2 is required for trafficking GABAB1 to the cell surface, increasing agonist affinity to GABAB1, and activating associated G proteins. These subunits each comprise two domains, a Venus flytrap domain (VFT) and a heptahelical transmembrane domain (7TM). How agonist binding to the GABAB1 VFT leads to GABAB2 7TM activation remains unknown. Here, we used a glycan wedge scanning approach to investigate how the GABAB VFT dimer controls receptor activity. We first identified the dimerization interface using a bioinformatics approach and then showed that introducing an N-glycan at this interface prevents the association of the two subunits and abolishes all activities of GABAB2, including agonist activation of the G protein. We also identified a second region in the VFT where insertion of an N-glycan does not prevent dimerization, but blocks agonist activation of the receptor. These data provide new insight into the function of this prototypical GPCR and demonstrate that a change in the dimerization interface is required for receptor activation. PMID:18388862

  17. Astrocytes Specifically Remove Surface-Adsorbed Fibrinogen and Locally Express Chondroitin Sulfate Proteoglycans

    PubMed Central

    Hsiao, Tony W.; Swarup, Vimal P.; Kuberan, Balagurunathan; Tresco, Patrick A.; Hlady, Vladimir

    2013-01-01

    Surface-adsorbed fibrinogen (FBG) was recognized by adhering astrocytes and removed from the substrates in vitro by a two-phase removal process. The cells removed adsorbed FBG from binary proteins surface patterns (FBG + laminin, or FBG + albumin) while leaving the other protein behind. Astrocytes preferentially expressed chondroitin sulfate proteoglycan (CSPG) at the loci of fibrinogen stimuli; however no differences in overall CSPG production as a function of FBG surface coverage were identified. Removal of FBG by astrocytes was also found to be independent of transforming growth factor type β (TGF-β) receptor based signaling as cells maintained CSPG production in the presence of TGF-β receptor kinase inhibitor, SB 431542. The inhibitor decreased CSPG expression, but did not abolicsh it entirely. Because blood contact and subsequent FBG adsorption are unavoidable in neural implantations, the results indicate that implant-adsorbed FBG may contribute to reactive astrogliosis around the implant as astrocytes specifically recognize adsorbed FBG. PMID:23499985

  18. The signaling phospholipid PIP 3 creates a new interaction surface on the nuclear receptor SF-1

    DOE PAGES

    Blind, Raymond D.; Sablin, Elena P.; Kuchenbecker, Kristopher M.; ...

    2014-10-06

    We previously reported that lipids PI(4,5)P 2 (PIP 2) and PI(3,4,5)P 3 (PIP 3) bind NR5A nuclear receptors to regulate their activity. Here, the crystal structures of PIP 2 and PIP 3 bound to NR5A1 (SF-1) define a new interaction surface that is organized by the solvent-exposed PIPn headgroups. We find that stabilization by the PIP 3 ligand propagates a signal that increases coactivator recruitment to SF-1, consistent with our earlier work showing that PIP 3 increases SF-1 activity. This newly created surface harbors a cluster of human mutations that lead to endocrine disorders, thus explaining how these puzzling mutationsmore » cripple SF-1 activity. Finally, we propose that this new surface acts as a PIP 3-regulated interface between SF-1 and coregulatory proteins, analogous to the function of membrane-bound phosphoinositides.« less

  19. Killer Cell Immunoglobulin-Like Receptor Gene Associations with Autoimmune and Allergic Diseases, Recurrent Spontaneous Abortion, and Neoplasms

    PubMed Central

    Kuśnierczyk, Piotr

    2013-01-01

    Killer cell immunoglobulin-like receptors (KIRs) are a family of cell surface inhibitory or activating receptors expressed on natural killer cells and some subpopulations of T lymphocytes. KIR genes are clustered in the 19q13.4 region and are characterized by both allelic (high numbers of variants) and haplotypic (different numbers of genes for inhibitory and activating receptors on individual chromosomes) polymorphism. This contributes to diverse susceptibility to diseases and other clinical situations. Associations of KIR genes, as well as of genes for their ligands, with selected diseases such as psoriasis vulgaris and atopic dermatitis, rheumatoid arthritis, recurrent spontaneous abortion, and non-small cell lung cancer are discussed in the context of NK and T cell functions. PMID:23372569

  20. Building tolerance by dismantling synapses: inhibitory receptor signaling in natural killer cells.

    PubMed

    Huse, Morgan; Catherine Milanoski, S; Abeyweera, Thushara P

    2013-01-01

    Cell surface receptors bearing immunotyrosine-based inhibitory motifs (ITIMs) maintain natural killer (NK) cell tolerance to normal host tissues. These receptors are difficult to analyze mechanistically because they block activating responses in a rapid and comprehensive manner. The advent of high-resolution single cell imaging techniques has enabled investigators to explore the cell biological basis of the inhibitory response. Recent studies using these approaches indicate that ITIM-containing receptors function at least in part by structurally undermining the immunological synapse between the NK cell and its target. In this review, we discuss these new advances and how they might relate to what is known about the biochemistry of inhibitory signaling in NK cells and other cell types. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  1. Functional Properties of Five Dictyostelium discoideum P2X Receptors*

    PubMed Central

    Baines, Abigail; Parkinson, Katie; Sim, Joan A.; Bragg, Laricia; Thompson, Christopher R. L.; North, R. Alan

    2013-01-01

    The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors. PMID:23740252

  2. Functional properties of five Dictyostelium discoideum P2X receptors.

    PubMed

    Baines, Abigail; Parkinson, Katie; Sim, Joan A; Bragg, Laricia; Thompson, Christopher R L; North, R Alan

    2013-07-19

    The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors.

  3. Dysregulation of chemokine receptor expression and function in leukocytes from ALS patients.

    PubMed

    Perner, Caroline; Perner, Florian; Stubendorff, Beatrice; Förster, Martin; Witte, Otto W; Heidel, Florian H; Prell, Tino; Grosskreutz, Julian

    2018-03-28

    Amyotrophic lateral sclerosis (ALS) is rapidly progressive adult-onset motor neuron disease characterized by the neurodegeneration of both upper and lower motor neurons in the cortex and the spinal cord; the majority of patients succumb to respiratory failure. Although the etiology is not yet fully understood, there is compelling evidence that ALS is a multi-systemic disorder, with peripheral inflammation critically contributing to the disease process. However, the full extent and nature of this immunological dysregulation remains to be established, particularly within circulating blood cells. Therefore, the aim of the present study was to identify dysregulated inflammatory molecules in peripheral blood cells of ALS patients and analyze for functional consequences of the observed findings. To this end, we employed flow cytometry-based screening to quantify the surface expression of major chemokine receptors and integrins. A significantly increased expression of CXCR3, CXCR4, CCL2, and CCL5 was observed on T cells in ALS patients compared to healthy controls. Intriguingly, the expression was even more pronounced in patients with a slow progressive phenotype. To further investigate the functional consequences of this altered surface expression, we used a modified Boyden chamber assay to measure chemotaxis in ALS patient-derived lymphocytes. Interestingly, chemoattraction with the CXCR3-Ligand IP10 led to upregulated migratory behavior of ALS lymphocytes compared to healthy controls. Taken together, our data provides evidence for a functional dysregulation of IP10-directed chemotaxis in peripheral blood cells in ALS patients. However, whether the chemokine itself or its receptor CXCR3, or both, could serve as potential therapeutic targets in ALS requires further investigations.

  4. Novel Mechanism for Regulation of Epidermal Growth Factor Receptor Endocytosis Revealed by Protein Kinase A Inhibition

    PubMed Central

    Salazar, Gloria; González, Alfonso

    2002-01-01

    Current models put forward that the epidermal growth factor receptor (EGFR) is efficiently internalized via clathrin-coated pits only in response to ligand-induced activation of its intrinsic tyrosine kinase and is subsequently directed into a lysosomal-proteasomal degradation pathway by mechanisms that include receptor tyrosine phosphorylation and ubiquitylation. Herein, we report a novel mechanism of EGFR internalization that does not require ligand binding, receptor kinase activity, or ubiquitylation and does not direct the receptor into a degradative pathway. Inhibition of basal protein kinase A (PKA) activity by H89 and the cell-permeable substrate peptide Myr-PKI induced internalization of 40–60% unoccupied, inactive EGFR, and its accumulation into early endosomes without affecting endocytosis of transferrin and μ-opioid receptors. This effect was abrogated by interfering with clathrin function. Thus, the predominant distribution of inactive EGFR at the plasma membrane is not simply by default but involves a PKA-dependent restrictive condition resulting in receptor avoidance of endocytosis until it is stimulated by ligand. Furthermore, PKA inhibition may contribute to ligand-induced EGFR endocytosis because epidermal growth factor inhibited 26% of PKA basal activity. On the other hand, H89 did not alter ligand-induced internalization of EGFR but doubled its half-time of down-regulation by retarding its segregation into degradative compartments, seemingly due to a delay in the receptor tyrosine phosphorylation and ubiquitylation. Our results reveal that PKA basal activity controls EGFR function at two levels: 1) residence time of inactive EGFR at the cell surface by a process of “endocytic evasion,” modulating the accessibility of receptors to stimuli; and 2) sorting events leading to the down-regulation pathway of ligand-activated EGFR, determining the length of its intracellular signaling. They add a new dimension to the fine-tuning of EGFR function in response to cellular demands and cross talk with other signaling receptors. PMID:12006662

  5. Morphine-induced internalization of the L83I mutant of the rat μ-opioid receptor

    PubMed Central

    Cooke, A E; Oldfield, S; Krasel, C; Mundell, S J; Henderson, G; Kelly, E

    2015-01-01

    BACKGROUND AND PURPOSE Naturally occurring single-nucleotide polymorphisms (SNPs) within GPCRs can result in alterations in various pharmacological parameters. Understanding the regulation and function of endocytic trafficking of the μ-opioid receptor (MOP receptor) is of great importance given its implication in the development of opioid tolerance. This study has compared the agonist-dependent trafficking and signalling of L83I, the rat orthologue of a naturally occurring variant of the MOP receptor. EXPERIMENTAL APPROACH Cell surface elisa, confocal microscopy and immunoprecipitation assays were used to characterize the trafficking properties of the MOP-L83I variant in comparison with the wild-type receptor in HEK 293 cells. Functional assays were used to compare the ability of the L83I variant to signal to several downstream pathways. KEY RESULTS Morphine-induced internalization of the L83I MOP receptor was markedly increased in comparison with the wild-type receptor. The altered trafficking of this variant was found to be specific to morphine and was both G-protein receptor kinase- and dynamin-dependent. The enhanced internalization of L83I variant in response to morphine was not due to increased phosphorylation of serine 375, arrestin association or an increased ability to signal. CONCLUSIONS AND IMPLICATIONS These results suggest that morphine promotes a specific conformation of the L83I variant that makes it more liable to internalize in response to morphine, unlike the wild-type receptor that undergoes significantly less morphine-stimulated internalization, providing an example of a ligand-selective biased receptor. The presence of this SNP within an individual may consequently affect the development of tolerance and analgesic responses. LINKED ARTICLES This article is part of a themed section on Opioids: New Pathways to Functional Selectivity. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2015.172.issue-2 PMID:24697554

  6. Morphine-induced internalization of the L83I mutant of the rat μ-opioid receptor.

    PubMed

    Cooke, A E; Oldfield, S; Krasel, C; Mundell, S J; Henderson, G; Kelly, E

    2015-01-01

    Naturally occurring single-nucleotide polymorphisms (SNPs) within GPCRs can result in alterations in various pharmacological parameters. Understanding the regulation and function of endocytic trafficking of the μ-opioid receptor (MOP receptor) is of great importance given its implication in the development of opioid tolerance. This study has compared the agonist-dependent trafficking and signalling of L83I, the rat orthologue of a naturally occurring variant of the MOP receptor. Cell surface elisa, confocal microscopy and immunoprecipitation assays were used to characterize the trafficking properties of the MOP-L83I variant in comparison with the wild-type receptor in HEK 293 cells. Functional assays were used to compare the ability of the L83I variant to signal to several downstream pathways. Morphine-induced internalization of the L83I MOP receptor was markedly increased in comparison with the wild-type receptor. The altered trafficking of this variant was found to be specific to morphine and was both G-protein receptor kinase- and dynamin-dependent. The enhanced internalization of L83I variant in response to morphine was not due to increased phosphorylation of serine 375, arrestin association or an increased ability to signal. These results suggest that morphine promotes a specific conformation of the L83I variant that makes it more liable to internalize in response to morphine, unlike the wild-type receptor that undergoes significantly less morphine-stimulated internalization, providing an example of a ligand-selective biased receptor. The presence of this SNP within an individual may consequently affect the development of tolerance and analgesic responses. This article is part of a themed section on Opioids: New Pathways to Functional Selectivity. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2015.172.issue-2. © 2014 The British Pharmacological Society.

  7. Targeting neurotransmitter receptors with nanoparticles in vivo allows single-molecule tracking in acute brain slices

    NASA Astrophysics Data System (ADS)

    Varela, Juan A.; Dupuis, Julien P.; Etchepare, Laetitia; Espana, Agnès; Cognet, Laurent; Groc, Laurent

    2016-03-01

    Single-molecule imaging has changed the way we understand many biological mechanisms, particularly in neurobiology, by shedding light on intricate molecular events down to the nanoscale. However, current single-molecule studies in neuroscience have been limited to cultured neurons or organotypic slices, leaving as an open question the existence of fast receptor diffusion in intact brain tissue. Here, for the first time, we targeted dopamine receptors in vivo with functionalized quantum dots and were able to perform single-molecule tracking in acute rat brain slices. We propose a novel delocalized and non-inflammatory way of delivering nanoparticles (NPs) in vivo to the brain, which allowed us to label and track genetically engineered surface dopamine receptors in neocortical neurons, revealing inherent behaviour and receptor activity regulations. We thus propose a NP-based platform for single-molecule studies in the living brain, opening new avenues of research in physiological and pathological animal models.

  8. Neurotrophin receptor structure and interactions.

    PubMed

    Yano, H; Chao, M V

    2000-03-01

    Although ligand-induced dimerization or oligomerization of receptors is a well established mechanism of growth factor signaling, increasing evidence indicates that biological responses are often mediated by receptor trans-signaling mechanisms involving two or more receptor systems. These include G protein-coupled receptors, cytokine, growth factor and trophic factor receptors. Greater flexibility is provided when different signaling pathways are merged through multiple receptor signaling systems. Trophic factors exemplified by NGF and its family members, ciliary neurotrophic factor (CNTF) and glial derived neurotrophic factor (GDNF) all utilize increased tyrosine phosphorylation of cellular substrates to mediate neuronal cell survival. Actions of the NGF family of neurotrophins are not only dictated by ras activation through the Trk family of receptor tyrosine kinases, but also a survival pathway defined by phosphatidylinositol-3-kinase activity (Yao and Cooper, 1995), which gives rise to phosphoinositide intermediates that activate the serine/threonine kinase Akt/PKB (Dudek et al., 1997). Induction of the serine-threonine kinase activity is critical for cell survival, as well as cell proliferation. Hence, for many trophic factors, multiple proteins constitute a functional multisubunit receptor complex that activates ras-dependent and ras-independent intracellular signaling. The NGF receptors provide an example of bidirectional crosstalk. In the presence of TrkA receptors, p75 can participate in the formation of high affinity binding sites and enhanced neurotrophin responsiveness leading to a survival or differentiation signal. In the absence of TrkA receptors, p75 can generate, in only specific cell populations, a death signal. These activities include the induction of NF kappa B (Carter et al., 1996); the hydrolysis of sphingomyelin to ceramide (Dobrowsky et al., 1995); and the pro-apoptotic functions attributed to p75. Receptors are generally drawn and viewed as isolated integral membrane proteins which span the lipid bilayer, with signal transduction proceeding in a linear step-wise fashion. There are now numerous examples which indicate that each receptor acts not only in a linear, independent manner, but can also influence the activity of other cell surface receptors, either directly or through signaling intermediates. Which step and which intermediates are utilized for crosstalk between the receptors is a critical question. For neurotrophins, their primary function in sustaining the viability of neurons is counterbalanced by a receptor mechanism to eliminate cells by an apoptotic mechanism. It is conceivable that this bidirectional system may be utilized selectively during development and in neurodegenerative diseases.

  9. Structural reorganization of the interleukin-7 signaling complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McElroy, Craig A.; Holland, Paul J.; Zhao, Peng

    2012-06-29

    We report here an unliganded receptor structure in the common gamma-chain ({gamma}{sub c}) family of receptors and cytokines. The crystal structure of the unliganded form of the interleukin-7 alpha receptor (IL-7R{alpha}) extracellular domain (ECD) at 2.15 {angstrom} resolution reveals a homodimer forming an 'X' geometry looking down onto the cell surface with the C termini of the two chains separated by 110 {angstrom} and the dimer interface comprising residues critical for IL-7 binding. Further biophysical studies indicate a weak association of the IL-7R{alpha} ECDs but a stronger association between the {gamma}{sub c}/IL-7R{alpha} ECDs, similar to previous studies of the full-lengthmore » receptors on CD4{sup +} T cells. Based on these and previous results, we propose a molecular mechanism detailing the progression from the inactive IL-7R{alpha} homodimer and IL-7R{alpha}-{gamma}{sub c} heterodimer to the active IL-7-IL-7R{alpha}-{gamma}{sub c} ternary complex whereby the two receptors undergo at least a 90{sup o} rotation away from the cell surface, moving the C termini of IL-7R{alpha} and {gamma}{sub c} from a distance of 110 {angstrom} to less than 30 {angstrom} at the cell surface. This molecular mechanism can be used to explain recently discovered IL-7- and {gamma}{sub c}-independent gain-of-function mutations in IL-7R{alpha} from B- and T-cell acute lymphoblastic leukemia patients. The mechanism may also be applicable to other {gamma}{sub c} receptors that form inactive homodimers and heterodimers independent of their cytokines.« less

  10. Hyaluronan functionalizing QDs as turn-on fluorescent probe for targeted recognition CD44 receptor

    NASA Astrophysics Data System (ADS)

    Zhou, Shang; Huo, Danqun; Hou, Changjun; Yang, Mei; Fa, Huanbao

    2017-09-01

    The recognition of tumor markers in living cancer cells has attracted increasing interest. In the present study, the turn-on fluorescence probe was designed based on the fluorescence of thiolated chitosan-coated CdTe QDs (CdTe/TCS QDs) quenched by hyaluronan, which could provide the low background signal for sensitive cellular imaging. This system is expected to offer specific recognition of CD44 receptor over other substances owing to the specific affinity of hyaluronan and CD44 receptor ( 8-9 kcal/mol). The probe is stable in aqueous and has little toxicity to living cells; thus, it can be utilized for targeted cancer cell imaging. The living lung cancer cell imaging experiments further demonstrate its value in recognizing cell-surface CD44 receptor with turn-on mode. In addition, the probe can be used to recognize and differentiate the subtypes of lung cancer cells based on the difference of CD44 expression on the surface of lung cancer cells. And, the western blot test further confirmed that the expression level of the CD44 receptor in lung cancer cells is different. Therefore, this probe may be potentially applied in recognizing lung cancer cells with higher contrast and sensitivity and provide new tools for cancer prognosis and therapy. [Figure not available: see fulltext.

  11. The roles played by highly truncated splice variants of G protein-coupled receptors

    PubMed Central

    2012-01-01

    Alternative splicing of G protein-coupled receptor (GPCR) genes greatly increases the total number of receptor isoforms which may be expressed in a cell-dependent and time-dependent manner. This increased diversity of cell signaling options caused by the generation of splice variants is further enhanced by receptor dimerization. When alternative splicing generates highly truncated GPCRs with less than seven transmembrane (TM) domains, the predominant effect in vitro is that of a dominant-negative mutation associated with the retention of the wild-type receptor in the endoplasmic reticulum (ER). For constitutively active (agonist-independent) GPCRs, their attenuated expression on the cell surface, and consequent decreased basal activity due to the dominant-negative effect of truncated splice variants, has pathological consequences. Truncated splice variants may conversely offer protection from disease when expression of co-receptors for binding of infectious agents to cells is attenuated due to ER retention of the wild-type co-receptor. In this review, we will see that GPCRs retained in the ER can still be functionally active but also that highly truncated GPCRs may also be functionally active. Although rare, some truncated splice variants still bind ligand and activate cell signaling responses. More importantly, by forming heterodimers with full-length GPCRs, some truncated splice variants also provide opportunities to generate receptor complexes with unique pharmacological properties. So, instead of assuming that highly truncated GPCRs are associated with faulty transcription processes, it is time to reassess their potential benefit to the host organism. PMID:22938630

  12. Tetraspanin-3 is an organizer of the multi-subunit Nogo-A signaling complex.

    PubMed

    Thiede-Stan, Nina K; Tews, Björn; Albrecht, David; Ristic, Zorica; Ewers, Helge; Schwab, Martin E

    2015-10-01

    To ensure precision and specificity of ligand-receptor-induced signaling, co-receptors and modulatory factors play important roles. The membrane-bound ligand Nogo-A (an isoform encoded by RTN4) induces inhibition of neurite outgrowth, cell spreading, adhesion and migration through multi-subunit receptor complexes. Here, we identified the four-transmembrane-spanning protein tetraspanin-3 (TSPAN3) as a new modulatory co-receptor for the Nogo-A inhibitory domain Nogo-A-Δ20. Single-molecule tracking showed that TSPAN3 molecules in the cell membrane reacted to binding of Nogo-A with elevated mobility, which was followed by association with the signal-transducing Nogo-A receptor sphingosine-1-phosphate receptor 2 (S1PR2). Subsequently, TSPAN3 was co-internalized as part of the Nogo-A-ligand-receptor complex into early endosomes, where it subsequently separated from Nogo-A and S1PR2 to be recycled to the cell surface. The functional importance of the Nogo-A-TSPAN3 interaction is shown by the fact that knockdown of TSPAN3 strongly reduced the Nogo-A-induced S1PR2 clustering, RhoA activation, cell spreading and neurite outgrowth inhibition. In addition to the modulatory functions of TSPAN3 on Nogo-A-S1PR2 signaling, these results illustrate the very dynamic spatiotemporal reorganizations of membrane proteins during ligand-induced receptor complex organization. © 2015. Published by The Company of Biologists Ltd.

  13. Bidirectional Homeostatic Regulation of a Depression-Related Brain State by Gamma-Aminobutyric Acidergic Deficits and Ketamine Treatment.

    PubMed

    Ren, Zhen; Pribiag, Horia; Jefferson, Sarah J; Shorey, Matthew; Fuchs, Thomas; Stellwagen, David; Luscher, Bernhard

    2016-09-15

    Major depressive disorder is increasingly recognized to involve functional deficits in both gamma-aminobutyric acid (GABA)ergic and glutamatergic synaptic transmission. To elucidate the relationship between these phenotypes, we used GABAA receptor γ2 subunit heterozygous (γ2(+/-)) mice, which we previously characterized as a model animal with construct, face, and predictive validity for major depressive disorder. To assess possible consequences of GABAergic deficits on glutamatergic transmission, we quantitated the cell surface expression of N-methyl-D-aspartate (NMDA)-type and alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA)-type glutamate receptors and the function of synapses in the hippocampus and medial prefrontal cortex of γ2(+/-) mice. We also analyzed the effects of an acute dose of the experimental antidepressant ketamine on all these parameters in γ2(+/-) versus wild-type mice. Modest defects in GABAergic synaptic transmission of γ2(+/-) mice resulted in a strikingly prominent homeostatic-like reduction in the cell surface expression of NMDA-type and AMPA-type glutamate receptors, along with prominent functional impairment of glutamatergic synapses in the hippocampus and medial prefrontal cortex. A single subanesthetic dose of ketamine normalized glutamate receptor expression and synaptic function of γ2(+/-) mice to wild-type levels for a prolonged period, along with antidepressant-like behavioral consequences selectively in γ2(+/-) mice. The GABAergic synapses of γ2(+/-) mice were potentiated by ketamine in parallel but only in the medial prefrontal cortex. Depressive-like brain states that are caused by GABAergic deficits involve a homeostatic-like reduction of glutamatergic transmission that is reversible by an acute, subanesthetic dose of ketamine, along with regionally selective potentiation of GABAergic synapses. The data merge the GABAergic and glutamatergic deficit hypotheses of major depressive disorder. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  14. Heterogeneity of chemokine cell-surface receptor expression in triple-negative breast cancer

    PubMed Central

    Norton, Kerri-Ann; Popel, Aleksander S; Pandey, Niranjan B

    2015-01-01

    Introduction: Tumor heterogeneity is a well-established concept in cancer research. In this paper, we examine an additional type of tumor cell heterogeneity - tumor cell-surface receptor heterogeneity. Methods: We use flow cytometry to measure the frequency and numbers of cell-surface receptors on triple negative breast cancer cell lines. Results: We find two distinct populations of human triple-negative breast cancer cells MDA-MB-231 when they are grown in culture, one with low surface levels of various chemokine receptors and a second with much higher levels. The population with high surface levels of these receptors is increased in the more metastatic MDA-MB-231-luc-d3h2ln cell line. Conclusion: We hypothesize that this high cell-surface receptor population is involved in metastasis. We find that the receptor high populations can be modulated by tumor conditioned media and IL6 treatment indicating that the tumor microenvironment is important for the maintenance and sizes of these populations. PMID:26101698

  15. Virus-resembling nano-structures for near infrared fluorescence imaging of ovarian cancer HER2 receptors

    NASA Astrophysics Data System (ADS)

    Guerrero, Yadir A.; Bahmani, Baharak; Singh, Sheela P.; Vullev, Valentine I.; Kundra, Vikas; Anvari, Bahman

    2015-10-01

    Ovarian cancer remains the dominant cause of death due to malignancies of the female reproductive system. The capability to identify and remove all tumors during intraoperative procedures may ultimately reduce cancer recurrence, and lead to increased patient survival. The objective of this study is to investigate the effectiveness of an optical nano-structured system for targeted near infrared (NIR) imaging of ovarian cancer cells that over-express the human epidermal growth factor receptor 2 (HER2), an important biomarker associated with ovarian cancer. The nano-structured system is comprised of genome-depleted plant-infecting brome mosaic virus doped with NIR chromophore, indocyanine green, and functionalized at the surface by covalent attachment of monoclonal antibodies against the HER2 receptor. We use absorption and fluorescence spectroscopy, and dynamic light scattering to characterize the physical properties of the constructs. Using fluorescence imaging and flow cytometry, we demonstrate the effectiveness of these nano-structures for targeted NIR imaging of HER2 receptors in vitro. These functionalized nano-materials may provide a platform for NIR imaging of ovarian cancer.

  16. Simultaneous detection and functional response of testosterone and estradiol receptors in osteoblast plasma membranes.

    PubMed

    Armen, T A; Gay, C V

    2000-09-14

    Osteoblasts derived from the periosteal surfaces of two-three-week-old male broiler chicken tibias were cultured for eight days. The cells were then loaded with fura-2/AM ester to detect surges in intracellular Ca(2+). Treatment with 10(-7) M testosterone (T) or 17beta-estradiol (E) elicited a rapid (within seconds) response that was substantially reduced by introducing the calcium chelating agent EGTA or the calcium-channel blocker verapamil. The hormones were equally effective when covalently linked to bovine serum albumin (BSA), a procedure that ensures the hormone does not enter the cells. The rapid response to surface-bound steroids indicates that the responses were invoked through plasma-membrane receptors. The source of Ca(2+) was shown to be through entry from external sources, as well as from intracellular stores. Flow cytometry of fluorescein-tagged T-BSA and E-BSA revealed that osteoblasts derived from male chickens had similar and substantial levels of both receptors. Copyright 2000 Wiley-Liss, Inc.

  17. Fucosylation and protein glycosylation create functional receptors for cholera toxin

    PubMed Central

    Wands, Amberlyn M; Fujita, Akiko; McCombs, Janet E; Cervin, Jakob; Dedic, Benjamin; Rodriguez, Andrea C; Nischan, Nicole; Bond, Michelle R; Mettlen, Marcel; Trudgian, David C; Lemoff, Andrew; Quiding-Järbrink, Marianne; Gustavsson, Bengt; Steentoft, Catharina; Clausen, Henrik; Mirzaei, Hamid; Teneberg, Susann; Yrlid, Ulf; Kohler, Jennifer J

    2015-01-01

    Cholera toxin (CT) enters and intoxicates host cells after binding cell surface receptors using its B subunit (CTB). The ganglioside (glycolipid) GM1 is thought to be the sole CT receptor; however, the mechanism by which CTB binding to GM1 mediates internalization of CT remains enigmatic. Here we report that CTB binds cell surface glycoproteins. Relative contributions of gangliosides and glycoproteins to CTB binding depend on cell type, and CTB binds primarily to glycoproteins in colonic epithelial cell lines. Using a metabolically incorporated photocrosslinking sugar, we identified one CTB-binding glycoprotein and demonstrated that the glycan portion of the molecule, not the protein, provides the CTB interaction motif. We further show that fucosylated structures promote CTB entry into a colonic epithelial cell line and subsequent host cell intoxication. CTB-binding fucosylated glycoproteins are present in normal human intestinal epithelia and could play a role in cholera. DOI: http://dx.doi.org/10.7554/eLife.09545.001 PMID:26512888

  18. Lipid raft-associated β-adducin is required for PSGL-1-mediated neutrophil rolling on P-selectin.

    PubMed

    Xu, Tingshuang; Liu, Wenai; Yang, Chen; Ba, Xueqing; Wang, Xiaoguang; Jiang, Yong; Zeng, Xianlu

    2015-02-01

    Lipid rafts, a liquid-ordered plasma membrane microdomain, are related to cell-surface receptor function. PSGL-1, a major surface receptor protein for leukocyte, also acts as a signaling receptor in leukocyte rolling. To investigate the role of lipid raft in PSGL-1 signaling in human neutrophils, we quantitatively analyzed lipid raft proteome of human promyelocytic leukemia cell line HL-60 cells and identified a lipid raft-associated protein β-adducin. PSGL-1 ligation induced dissociation of the raft-associated protein β-adducin from lipid rafts and actin, as well as phosphorylation of β-adducin, indicating a transient uncoupling of lipid rafts from the actin cytoskeleton. Knockdown of β-adducin greatly attenuated HL-60 cells rolling on P-selectin. We also showed that Src kinase is crucial for PSGL-1 ligation-induced β-adducin phosphorylation and relocation. Taken together, these results show that β-adducin is a pivotal lipid raft-associated protein in PSGL-1-mediated neutrophil rolling on P-selectin. © Society for Leukocyte Biology.

  19. Vascular effects of advanced glycation endproducts: Clinical effects and molecular mechanisms☆

    PubMed Central

    Stirban, Alin; Gawlowski, Thomas; Roden, Michael

    2013-01-01

    The enhanced generation and accumulation of advanced glycation endproducts (AGEs) have been linked to increased risk for macrovascular and microvascular complications associated with diabetes mellitus. AGEs result from the nonenzymatic reaction of reducing sugars with proteins, lipids, and nucleic acids, potentially altering their function by disrupting molecular conformation, promoting cross-linking, altering enzyme activity, reducing their clearance, and impairing receptor recognition. AGEs may also activate specific receptors, like the receptor for AGEs (RAGE), which is present on the surface of all cells relevant to atherosclerotic processes, triggering oxidative stress, inflammation and apoptosis. Understanding the pathogenic mechanisms of AGEs is paramount to develop strategies against diabetic and cardiovascular complications. PMID:24634815

  20. Ephrinb1 and Ephrinb2 Are Associated with Interleukin-7 Receptor α and Retard Its Internalization from the Cell Surface*

    PubMed Central

    Luo, Hongyu; Wu, Zenghui; Qi, Shijie; Jin, Wei; Han, Bing; Wu, Jiangping

    2011-01-01

    IL-7 plays vital roles in thymocyte development, T cell homeostasis, and the survival of these cells. IL-7 receptor α (IL-7Rα) on thymocytes and T cells is rapidly internalized upon IL-7 ligation. Ephrins (Efns) are cell surface molecules and ligands of the largest receptor kinase family, Eph kinases. We discovered that T cell-specific double gene knock-out (dKO) of Efnb1 and Efnb2 in mice led to reduced IL-7Rα expression in thymocytes and T cells, and that IL-7Rα down-regulation was accelerated in dKO CD4 cells upon IL-7 treatment. On the other hand, Efnb1 and Efnb2 overexpression on T cell lymphoma EL4 cells retarded IL-7Rα down-regulation. dKO T cells manifested compromised STAT5 activation and homeostatic proliferation, an IL-7-dependent process. Fluorescence resonance energy transfer and immunoprecipitation demonstrated that Efnb1 and Efnb2 interacted physically with IL-7Rα. Such interaction likely retarded IL-7Rα internalization, as Efnb1 and Efnb2 were not internalized. Therefore, we revealed a novel function of Efnb1 and Efnb2 in stabilizing IL-7Rα expression at the post-translational level, and a previously unknown modus operandi of Efnbs in the regulation of expression of other vital cell surface receptors. PMID:22069310

  1. Structure-function analysis of amino acid 74 of human RAMP1 and RAMP3 and its role in peptide interactions with adrenomedullin and calcitonin gene-related peptide receptors.

    PubMed

    Qi, Tao; Ly, Kien; Poyner, David R; Christopoulos, George; Sexton, Patrick M; Hay, Debbie L

    2011-05-01

    The receptors for calcitonin gene-related peptide (CGRP) and adrenomedullin (AM) are complexes of the calcitonin receptor-like receptor (CLR) and receptor activity-modifying proteins (RAMP). The CGRP receptor is a CLR/RAMP1 pairing whereas CLR/RAMP2 and CLR/RAMP3 constitute two subtypes of AM receptor: AM(1) and AM(2), respectively. Previous studies identified Glu74 in RAMP3 to be important for AM binding and potency. To further understand the importance of this residue and its equivalent in RAMP1 (Trp74) we substituted the native amino acids with several others. In RAMP3, these were Trp, Phe, Tyr, Ala, Ser, Thr, Arg and Asn; in RAMP1, Glu, Phe, Tyr, Ala and Asn substitutions were made. The mutant RAMPs were co-expressed with CLR in Cos7 cells; receptor function in response to AM, AM(2)/intermedin and CGRP was measured in a cAMP assay and cell surface expression was determined by ELISA. Phe reduced AM potency in RAMP3 but had no effect in RAMP1. In contrast, Tyr had no effect in RAMP3 but enhanced AM potency in RAMP1. Most other substitutions had a small effect on AM potency in both receptors whereas there was little impact on CGRP or AM(2) potency. Overall, these data suggest that the geometry and charge of the residue at position 74 contribute to how AM interacts with the AM(2) and CGRP receptors and confirms the role of this position in dictating differential AM pharmacology at the AM(2) and CGRP receptors. Copyright © 2011. Published by Elsevier Inc.

  2. Cell Surface Trafficking of TLR1 Is Differentially Regulated by the Chaperones PRAT4A and PRAT4B*

    PubMed Central

    Hart, Bryan E.; Tapping, Richard I.

    2012-01-01

    The subcellular localization of Toll-like receptors (TLRs) is critical to their ability to function as innate immune sensors of microbial infection. We previously reported that an I602S polymorphism of human TLR1 is associated with aberrant trafficking of the receptor to the cell surface, loss of responses to TLR1 agonists, and differential susceptibility to diseases caused by pathogenic mycobacteria. Through an extensive analysis of receptor deletion and point mutants we have discovered that position 602 resides within a short 6 amino acid cytoplasmic region that is required for TLR1 surface expression. This short trafficking motif, in conjunction with the adjacent transmembrane domain, is sufficient to direct TLR1 to the cell surface. A serine at position 602 interrupts this trafficking motif and prevents cell surface expression of TLR1. Additionally, we have found that ER-resident TLR chaperones, PRAT4A and PRAT4B, act as positive and negative regulators of TLR1 surface trafficking, respectively. Importantly, either over-expression of PRAT4A or knock-down of PRAT4B rescues cell surface expression of the TLR1 602S variant. We also report that IFN-γ treatment of primary human monocytes derived from homozygous 602S individuals rescues TLR1 cell surface trafficking and cellular responses to soluble agonists. This event appears to be mediated by PRAT4A whose expression is strongly induced in human monocytes by IFN-γ. Collectively, these results provide a mechanism for the differential trafficking of TLR1 I602S variants, and highlight the distinct roles for PRAT4A and PRAT4B in the regulation of TLR1 surface expression. PMID:22447933

  3. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling

    PubMed Central

    Corral-Jara, Karla F.; Gómez-Leyva, Juan F.; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia

    2016-01-01

    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1. PMID:27578921

  4. Caspase-8 Binding to Cardiolipin in Giant Unilamellar Vesicles Provides a Functional Docking Platform for Bid

    PubMed Central

    Perry, Mark; Granjon, Thierry; Gonzalvez, François; Gottlieb, Eyal; Ayala-Sanmartin, Jesus; Klösgen, Beate; Schwille, Petra; Petit, Patrice X.

    2013-01-01

    Caspase-8 is involved in death receptor-mediated apoptosis in type II cells, the proapoptotic programme of which is triggered by truncated Bid. Indeed, caspase-8 and Bid are the known intermediates of this signalling pathway. Cardiolipin has been shown to provide an anchor and an essential activating platform for caspase-8 at the mitochondrial membrane surface. Destabilisation of this platform alters receptor-mediated apoptosis in diseases such as Barth Syndrome, which is characterised by the presence of immature cardiolipin which does not allow caspase-8 binding. We used a simplified in vitro system that mimics contact sites and/or cardiolipin-enriched microdomains at the outer mitochondrial surface in which the platform consisting of caspase-8, Bid and cardiolipin was reconstituted in giant unilamellar vesicles. We analysed these vesicles by flow cytometry and confirm previous results that demonstrate the requirement for intact mature cardiolipin for caspase-8 activation and Bid binding and cleavage. We also used confocal microscopy to visualise the rupture of the vesicles and their revesiculation at smaller sizes due to alteration of the curvature following caspase-8 and Bid binding. Biophysical approaches, including Laurdan fluorescence and rupture/tension measurements, were used to determine the ability of these three components (cardiolipin, caspase-8 and Bid) to fulfil the minimal requirements for the formation and function of the platform at the mitochondrial membrane. Our results shed light on the active functional role of cardiolipin, bridging the gap between death receptors and mitochondria. PMID:23418437

  5. Adenosine and adenosine receptors in the pathogenesis and treatment of rheumatic diseases.

    PubMed

    Cronstein, Bruce N; Sitkovsky, Michail

    2017-01-01

    Adenosine, a nucleoside derived primarily from the extracellular hydrolysis of adenine nucleotides, is a potent regulator of inflammation. Adenosine mediates its effects on inflammatory cells by engaging one or more cell-surface receptors. The expression and function of adenosine receptors on different cell types change during the course of rheumatic diseases, such as rheumatoid arthritis (RA). Targeting adenosine receptors directly for the treatment of rheumatic diseases is currently under study; however, indirect targeting of adenosine receptors by enhancing adenosine levels at inflamed sites accounts for most of the anti-inflammatory effects of methotrexate, the anchor drug for the treatment of RA. In this Review, we discuss the regulation of extracellular adenosine levels and the role of adenosine in regulating the inflammatory and immune responses in rheumatic diseases such as RA, psoriasis and other types of inflammatory arthritis. In addition, adenosine and its receptors are involved in promoting fibrous matrix production in the skin and other organs, and the role of adenosine in fibrosis and fibrosing diseases is also discussed.

  6. Sphingosine 1-phosphate receptor modulators in multiple sclerosis.

    PubMed

    Subei, Adnan M; Cohen, Jeffrey A

    2015-07-01

    Sphingosine 1-phosphate (S1P) receptor modulators possess a unique mechanism of action as disease-modifying therapy for multiple sclerosis (MS). Subtype 1 S1P receptors are expressed on the surfaces of lymphocytes and are important in regulating egression from lymph nodes. The S1P receptor modulators indirectly antagonize the receptor's function and sequester lymphocytes in lymph nodes. Fingolimod was the first S1P agent approved in the USA in 2010 for relapsing MS after two phase III trials (FREEDOMS and TRANSFORMS) demonstrated potent efficacy, and good safety and tolerability. Post-marketing experience, as well as a third phase III trial (FREEDOMS II), also showed favorable results. More selective S1P receptor agents-ponesimod (ACT128800), siponimod (BAF312), ozanimod (RPC1063), ceralifimod (ONO-4641), GSK2018682, and MT-1303-are still in relatively early stages of development, but phase I and II trials showed promising efficacy and safety. However, these observations have yet to be reproduced in phase III clinical trials.

  7. The epidermal growth factor receptor (EGFR) promotes uptake of influenza A viruses (IAV) into host cells.

    PubMed

    Eierhoff, Thorsten; Hrincius, Eike R; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

    2010-09-09

    Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake.

  8. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform

    PubMed Central

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-01-01

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329

  9. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform.

    PubMed

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-07-16

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.

  10. CCR5 adopts three homodimeric conformations that control cell surface delivery.

    PubMed

    Jin, Jun; Momboisse, Fanny; Boncompain, Gaelle; Koensgen, Florian; Zhou, Zhicheng; Cordeiro, Nelia; Arenzana-Seisdedos, Fernando; Perez, Franck; Lagane, Bernard; Kellenberger, Esther; Brelot, Anne

    2018-05-08

    Biophysical methods and x-ray crystallography have revealed that class A G protein-coupled receptors (GPCRs) can form homodimers. We combined computational approaches with receptor cross-linking, energy transfer, and a newly developed functional export assay to characterize the residues involved in the dimerization interfaces of the chemokine receptor CCR5, the major co-receptor for HIV-1 entry into cells. We provide evidence of three distinct CCR5 dimeric organizations, involving residues of transmembrane helix 5. Two dimeric states corresponded to unliganded receptors, whereas the binding of the inverse agonist maraviroc stabilized a third state. We found that CCR5 dimerization was required for targeting the receptor to the plasma membrane. These data suggest that dimerization contributes to the conformational diversity of inactive class A GPCRs and may provide new opportunities to investigate the cellular entry of HIV-1 and mechanisms for its inhibition. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  11. The Epidermal Growth Factor Receptor (EGFR) Promotes Uptake of Influenza A Viruses (IAV) into Host Cells

    PubMed Central

    Eierhoff, Thorsten; Hrincius, Eike R.; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

    2010-01-01

    Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake. PMID:20844577

  12. Multidisciplinary Analysis of Cyclophilin A Function in Human Breast Cancer

    DTIC Science & Technology

    2011-03-01

    4 INTRODUCTION The growth and progression of human breast cancer is regulated by several cell surface receptors, including the...substantively to the biology of human breast cancer through its regulation of cell surface signaling, including that of the PRLr. We believe that the knowledge... dynamic structure of CypA in complex with PRLr and its proximal molecule Jak2. We have purified recombinant CypA, the intracellular domain (ICD) of

  13. Pancreatic acini possess endothelin receptors whose internalization is regulated by PLC-activating agents.

    PubMed

    Hildebrand, P; Mrozinski, J E; Mantey, S A; Patto, R J; Jensen, R T

    1993-05-01

    Endothelin-1 (ET-1) and ET-3 mRNA have been found in the pancreas. We investigated the ability of ET-1, ET-2, and ET-3 to interact with and alter dispersed rat pancreatic acinar cell function. Radiolabeled ETs bound in a time- and temperature-dependent fashion, which was specific and saturable. Analysis demonstrated two classes of receptors, one class (ETA receptor) had a high affinity for ET-1 but a low affinity for ET-3, and the other class (ETB receptor) had equally high affinities for ET-1 and ET-3. No specific receptor for ET-2 was identified. Pancreatic secretagogues that activate phospholipase C (PLC) inhibited binding of 125I-labeled ET-1 (125I-ET-1) or 125I-ET-3, whereas agents that act through adenosine 3',5'-cyclic monophosphate (cAMP) did not. A23187 had no effect on 125I-ET-1 or 125I-ET-3 binding, whereas the phorbol ester 12-O-tetradecanoylphorbol 13-acetate reduced binding. The effect of cholecystokinin octapeptide (CCK-8) was mediated through its own receptor. Stripping of surface bound ligand studies demonstrated that both 125I-labeled ET-1 and 125I-labeled ET-3 were rapidly internalized. CCK-8 decreased the internalization but did not change the amount of surface bound ligand. Endothelins neither stimulate nor alter changes in enzyme secretion, intracellular calcium, cAMP, or [3H]inositol trisphosphate (IP3). This study demonstrates the presence of ETA and ETB receptors on rat pancreatic acini; occupation of both receptors resulted in rapid internalization, which is regulated by PLC-activating secretagogues. Occupation of either ET receptor did not alter intracellular calcium, cAMP, IP3, or stimulate amylase release.

  14. Receptor-like kinase SOBIR1/EVR interacts with receptor-like proteins in plant immunity against fungal infection.

    PubMed

    Liebrand, Thomas W H; van den Berg, Grardy C M; Zhang, Zhao; Smit, Patrick; Cordewener, Jan H G; America, Antoine H P; America, Antione H P; Sklenar, Jan; Jones, Alexandra M E; Tameling, Wladimir I L; Robatzek, Silke; Thomma, Bart P H J; Joosten, Matthieu H A J

    2013-06-11

    The plant immune system is activated by microbial patterns that are detected as nonself molecules. Such patterns are recognized by immune receptors that are cytoplasmic or localized at the plasma membrane. Cell surface receptors are represented by receptor-like kinases (RLKs) that frequently contain extracellular leucine-rich repeats and an intracellular kinase domain for activation of downstream signaling, as well as receptor-like proteins (RLPs) that lack this signaling domain. It is therefore hypothesized that RLKs are required for RLPs to activate downstream signaling. The RLPs Cf-4 and Ve1 of tomato (Solanum lycopersicum) mediate resistance to the fungal pathogens Cladosporium fulvum and Verticillium dahliae, respectively. Despite their importance, the mechanism by which these immune receptors mediate downstream signaling upon recognition of their matching ligand, Avr4 and Ave1, remained enigmatic. Here we show that the tomato ortholog of the Arabidopsis thaliana RLK Suppressor Of BIR1-1/Evershed (SOBIR1/EVR) and its close homolog S. lycopersicum (Sl)SOBIR1-like interact in planta with both Cf-4 and Ve1 and are required for the Cf-4- and Ve1-mediated hypersensitive response and immunity. Tomato SOBIR1/EVR interacts with most of the tested RLPs, but not with the RLKs FLS2, SERK1, SERK3a, BAK1, and CLV1. SOBIR1/EVR is required for stability of the Cf-4 and Ve1 receptors, supporting our observation that these RLPs are present in a complex with SOBIR1/EVR in planta. We show that SOBIR1/EVR is essential for RLP-mediated immunity and propose that the protein functions as a regulatory RLK of this type of cell-surface receptors.

  15. The allosteric site regulates the voltage sensitivity of muscarinic receptors.

    PubMed

    Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas

    2018-01-01

    Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Glycoprotein Ibα receptor instability is associated with loss of quality in platelets produced in culture.

    PubMed

    Robert, Amélie; Boyer, Lucie; Pineault, Nicolas

    2011-03-01

    The development of culture processes for hematopoietic progenitors could lead to the development of a complementary source of platelets for therapeutic purposes. However, functional characterization of culture-derived platelets remains limited, which raises some uncertainties about the quality of platelets produced in vitro. The aim of this study was to define the proportion of functional platelets produced in cord blood CD34+ cell cultures. Toward this, the morphological and functional properties of culture-derived platelet-like particles (PLPs) were critically compared to that of blood platelets. Flow cytometry combined with transmission electron microscopy analyses revealed that PLPs formed a more heterogeneous population of platelets at a different stage of maturation than blood platelets. The majority of PLPs harbored the fibrinogen receptor αIIbβ3, but a significant proportion failed to maintain glycoprotein (GP)Ibα surface expression, a component of the vWF receptor essential for platelet functions. Importantly, GPIbα extracellular expression correlated closely with platelet function, as the GPIIb+ GPIbα+ PLP subfraction responded normally to agonist stimulation as evidenced by α-granule release, adhesion, spreading, and aggregation. In contrast, the GPIIb+ GPIbα⁻ subfraction was unresponsive in most functional assays and appeared to be metabolically inactive. The present study confirms that functional platelets can be generated in cord blood CD34+ cell cultures, though these are highly susceptible to ectodomain shedding of receptors associated with loss of function. Optimization of culture conditions to prevent these deleterious effects and to homogenize PLPs is necessary to improve the quality and yields of culture-derived platelets before they can be recognized as a suitable complementary source for therapeutic purposes.

  17. A cleavable signal peptide enhances cell surface delivery and heterodimerization of Cerulean-tagged angiotensin II AT1 and bradykinin B2 receptor.

    PubMed

    Quitterer, Ursula; Pohl, Armin; Langer, Andreas; Koller, Samuel; Abdalla, Said

    2011-06-10

    Heterodimerization of the angiotensin II AT1 receptor with the receptor for the vasodepressor bradykinin, B2R, is known to sensitize the AT1-stimulated response of hypertensive individuals in vivo. To analyze features of that prototypic receptor heterodimer in vitro, we established a new method that uses fluorescence resonance energy transfer (FRET) and applies for the first time AT1-Cerulean as a FRET donor. The Cerulean variant of the green fluorescent protein as donor fluorophore was fused to the C-terminus of AT1, and the enhanced yellow fluorescent protein (EYFP) as acceptor fluorophore was fused to B2R. In contrast to AT1-EGFP, the AT1-Cerulean fusion protein was retained intracellularly. To facilitate cell surface delivery of AT1-Cerulean, a cleavable signal sequence was fused to the receptor's amino terminus. The plasma membrane-localized AT1-Cerulean resembled the native AT1 receptor regarding ligand binding and receptor activation. A high FRET efficiency of 24.7% between membrane-localized AT1-Cerulean and B2R-EYFP was observed with intact, non-stimulated cells. Confocal FRET microscopy further revealed that the AT1/B2 receptor heterodimer was functionally coupled to receptor desensitization mechanisms because activation of the AT1-Cerulean/B2R-EYFP heterodimer with a single agonist triggered the co-internalization of AT1/B2R. Receptor co-internalization was sensitive to inhibition of G protein-coupled receptor kinases, GRKs, as evidenced by a GRK-specific peptide inhibitor. In agreement with efficient AT1/B2R heterodimerization, confocal FRET imaging of co-enriched receptor proteins immobilized on agarose beads also detected a high FRET efficiency of 24.0%. Taken together confocal FRET imaging revealed efficient heterodimerization of co-enriched and cellular AT1/B2R, and GRK-dependent co-internalization of the AT1/B2R heterodimer. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Functional Analysis of CD28/B7 and CD40/CD40L Costimulation During the in vivo Type 2 Immune Response

    DTIC Science & Technology

    1995-10-06

    these activation markers on B cells and changes in B cell size (forward light scatter) were analyzed by flow cytometry (Figure 7). B cell surface B7...activation ofnaive CD4+ Th cells requires two signals delivered from antigen presenting cells (APes). The engagement ofthe T cell surface receptor...shown that T cell surface ii molecule CD28, and its homologue CTLA-4, can provide costimulatory signals to 10 cells when they interact with their ligands

  19. Beyond the Matrix: The Many Non-ECM Ligands for Integrins

    PubMed Central

    LaFoya, Bryce; Munroe, Jordan A.; Miyamoto, Alison; Detweiler, Michael A.; Crow, Jacob J.; Gazdik, Tana

    2018-01-01

    The traditional view of integrins portrays these highly conserved cell surface receptors as mediators of cellular attachment to the extracellular matrix (ECM), and to a lesser degree, as coordinators of leukocyte adhesion to the endothelium. These canonical activities are indispensable; however, there is also a wide variety of integrin functions mediated by non-ECM ligands that transcend the traditional roles of integrins. Some of these unorthodox roles involve cell-cell interactions and are engaged to support immune functions such as leukocyte transmigration, recognition of opsonization factors, and stimulation of neutrophil extracellular traps. Other cell-cell interactions mediated by integrins include hematopoietic stem cell and tumor cell homing to target tissues. Integrins also serve as cell-surface receptors for various growth factors, hormones, and small molecules. Interestingly, integrins have also been exploited by a wide variety of organisms including viruses and bacteria to support infectious activities such as cellular adhesion and/or cellular internalization. Additionally, the disruption of integrin function through the use of soluble integrin ligands is a common strategy adopted by several parasites in order to inhibit blood clotting during hematophagy, or by venomous snakes to kill prey. In this review, we strive to go beyond the matrix and summarize non-ECM ligands that interact with integrins in order to highlight these non-traditional functions of integrins. PMID:29393909

  20. Multivalent ligands control stem cell behaviour in vitro and in vivo

    NASA Astrophysics Data System (ADS)

    Conway, Anthony; Vazin, Tandis; Spelke, Dawn P.; Rode, Nikhil A.; Healy, Kevin E.; Kane, Ravi S.; Schaffer, David V.

    2013-11-01

    There is broad interest in designing nanostructured materials that can interact with cells and regulate key downstream functions. In particular, materials with nanoscale features may enable control over multivalent interactions, which involve the simultaneous binding of multiple ligands on one entity to multiple receptors on another and are ubiquitous throughout biology. Cellular signal transduction of growth factor and morphogen cues (which have critical roles in regulating cell function and fate) often begins with such multivalent binding of ligands, either secreted or cell-surface-tethered to target cell receptors, leading to receptor clustering. Cellular mechanisms that orchestrate ligand-receptor oligomerization are complex, however, so the capacity to control multivalent interactions and thereby modulate key signalling events within living systems is currently very limited. Here, we demonstrate the design of potent multivalent conjugates that can organize stem cell receptors into nanoscale clusters and control stem cell behaviour in vitro and in vivo. The ectodomain of ephrin-B2, normally an integral membrane protein ligand, was conjugated to a soluble biopolymer to yield multivalent nanoscale conjugates that potently induce signalling in neural stem cells and promote their neuronal differentiation both in culture and within the brain. Super-resolution microscopy analysis yielded insights into the organization of the receptor-ligand clusters at the nanoscale. We also found that synthetic multivalent conjugates of ephrin-B1 strongly enhance human embryonic and induced pluripotent stem cell differentiation into functional dopaminergic neurons. Multivalent bioconjugates are therefore powerful tools and potential nanoscale therapeutics for controlling the behaviour of target stem cells in vitro and in vivo.

  1. Urokinase Receptor Counteracts Vascular Smooth Muscle Cell Functional Changes Induced by Surface Topography

    PubMed Central

    Kiyan, Yulia; Kurselis, Kestutis; Kiyan, Roman; Haller, Hermann; Chichkov, Boris N.; Dumler, Inna

    2013-01-01

    Current treatments for human coronary artery disease necessitate the development of the next generations of vascular bioimplants. Recent reports provide evidence that controlling cell orientation and morphology through topographical patterning might be beneficial for bioimplants and tissue engineering scaffolds. However, a concise understanding of cellular events underlying cell-biomaterial interaction remains missing. In this study, applying methods of laser material processing, we aimed to obtain useful markers to guide in the choice of better vascular biomaterials. Our data show that topographically treated human primary vascular smooth muscle cells (VSMC) have a distinct differentiation profile. In particular, cultivation of VSMC on the microgrooved biocompatible polymer E-shell induces VSMC modulation from synthetic to contractile phenotype and directs formation and maintaining of cell-cell communication and adhesion structures. We show that the urokinase receptor (uPAR) interferes with VSMC behavior on microstructured surfaces and serves as a critical regulator of VSMC functional fate. Our findings suggest that microtopography of the E-shell polymer could be important in determining VSMC phenotype and cytoskeleton organization. They further suggest uPAR as a useful target in the development of predictive models for clinical VSMC phenotyping on functional advanced biomaterials. PMID:23843899

  2. Dystroglycan loss disrupts polarity and beta-casein induction inmammary epithelial cells by perturbing laminin anchoring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weir, M. Lynn; Oppizzi, Maria Luisa; Henry, Michael D.

    2006-02-17

    Precise contact between epithelial cells and their underlying basement membrane is critical to the maintenance of tissue architecture and function. To understand the role that the laminin receptor dystroglycan (DG) plays in these processes, we assayed cell responses to laminin-111 following conditional ablation of DG expression in cultured mammary epithelial cells (MECs). Strikingly, DG loss disrupted laminin-111-induced polarity and {beta}-casein production, and abolished laminin assembly at the step of laminin binding to the cell surface. DG re-expression restored these deficiencies. Investigations of mechanism revealed that DG cytoplasmic sequences were not necessary for laminin assembly and signaling, and only when themore » entire mucin domain of extracellular DG was deleted did laminin assembly not occur. These results demonstrate that DG is essential as a laminin-111 co-receptor in MECs that functions by mediating laminin anchoring to the cell surface, a process that allows laminin polymerization, tissue polarity, and {beta}-casein induction. The observed loss of laminin-111 assembly and signaling in DG-/-MECs provides insights into the signaling changes occurring in breast carcinomas and other cancers, where DG's laminin-binding function is frequently defective.« less

  3. THE SHARK RECTAL GLAND MODEL: A CHAMPION OF RECEPTOR MEDIATED CHLORIDE SECRETION THROUGH CFTR

    PubMed Central

    FORREST, JOHN N.

    2016-01-01

    The dogfish shark salt gland was predicted by Smith and discovered by Burger at the Mount Desert Island Biological Laboratory in Salisbury Cove, Maine. It is an epithelial organ in the intestine composed of tubules that serve a single function: the secretion of hypertonic NaCl. Many G protein receptors are present on the basolateral surface of these tubules, including stimulatory receptors for vasoactive intestinal peptide, adenosine A2, growth hormone releasing hormone, and inhibitory receptors for somatostatin and adenosine A1. An entirely different class of stimulatory receptors is present as C-type natriuretic peptide receptors. Each stimulatory receptor evokes powerful NaCl secretion. G protein receptors bind to Gαs to activate the catalytic unit of adenylate cyclase to form cyclic adenosine monophosphate (cAMP) and protein kinase A that phosphorylates the regulatory domain of cystic fibrosis transmembrane conductance regulator, opening the channel. The C-type natriuretic peptide receptor stimulates by activating guanylate cyclase and endogenous cyclic guanosine monophosphate which inhibits type 3 phosphodiesterase, the enzyme that breaks down cAMP, thereby elevating cAMP and activating the protein kinase A pathway. PMID:28066051

  4. Vasopressin Receptor Signaling and Cycling of Water Channels in Renal Epithelia.

    DTIC Science & Technology

    1994-08-31

    functional similarities to the renal cortical collecting tubule (Bentley, 1958; DiBona , 1981 and others). Recently, we demonstrated that the apical...changes in the toad urinary bladder epithelial surface. J. Cell Biol., 61, 544-547. 27 DiBona , D. R. 1981. Vasopressin action of the conformational state

  5. Structural Insights into the Functional Role of the Hcn Sub-domain of the Receptor-Binding Domain of the Botulinum Neurotoxin Mosaic Serotype C/D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanfeng; Gardberg, Anna; Edwards, Tom E.

    Botulinum neurotoxin (BoNT), the causative agent of the deadly neuroparalytic disease botulism, is the most poisonous protein known for humans. Produced by different strains of the anaerobic bacterium Clostridium botulinum, BoNT effects cellular intoxication via a multistep mechanism executed by the three modules of the activated protein. Endocytosis, the first step of cellular intoxication, is triggered by the ~50 kDa, heavy-chain receptor-binding module (HCR) that is specific for a ganglioside and a protein receptor on neuronal cell surfaces. This dual receptor recognition mechanism between BoNT and the host cell’s membrane is well documented and occurs via specific intermolecular interactions withmore » the C-terminal sub-domain, Hcc, of BoNT-HCR. The N-terminal sub-domain of BoNT-HCR, Hcn, comprises ~50% of BoNT-HCR and adopts a B-sheet jelly roll fold. While suspected in assisting cell surface recognition, no unambiguous function for the Hcn sub-domain in BoNT has been indentified. To obtain insights into the potential function of the Hcn sub-domain in BoNT, the first crystal structure of a BoNT with an organic ligand bound to the Hcn sub-domain has been obtained. Here, we describe the crystal structure of BoNT/CD-HCR determined at 1.70 Å resolution with a tetraethylene glycol (PG4) molecule bound in an hydrophobic cleft between B-strands in the B-sheet jelly fold roll of the Hcn sub-domain. The molecule is completely engulfed in the cleft, making numerous hydrophobic (Y932, S959, W966, and D1042) and hydrophilic (S935, W977, L979, N1013, and I1066) contacts with the protein’s side chain and backbone that may mimic in vivo interactions with the phospholipid membranes on neuronal cell surfaces. A sulfate ion was also observed bound to residues T1176, D1177, K1196, and R1243 in the Hcc sub-domain of BoNT/CD-HCR. In the crystal structure of a similar protein, BoNT/D-HCR, a sialic acid« less

  6. Differential Targeting of Gβγ-Subunit Signaling with Small Molecules

    NASA Astrophysics Data System (ADS)

    Bonacci, Tabetha M.; Mathews, Jennifer L.; Yuan, Chujun; Lehmann, David M.; Malik, Sundeep; Wu, Dianqing; Font, Jose L.; Bidlack, Jean M.; Smrcka, Alan V.

    2006-04-01

    G protein βγ subunits have potential as a target for therapeutic treatment of a number of diseases. We performed virtual docking of a small-molecule library to a site on Gβγ subunits that mediates protein interactions. We hypothesized that differential targeting of this surface could allow for selective modulation of Gβγ subunit functions. Several compounds bound to Gβγ subunits with affinities from 0.1 to 60 μM and selectively modulated functional Gβγ-protein-protein interactions in vitro, chemotactic peptide signaling pathways in HL-60 leukocytes, and opioid receptor-dependent analgesia in vivo. These data demonstrate an approach for modulation of G protein-coupled receptor signaling that may represent an important therapeutic strategy.

  7. Antibodies and Their Receptors: Different Potential Roles in Mucosal Defense

    PubMed Central

    Horton, Rachel E.; Vidarsson, Gestur

    2013-01-01

    Over recent years it has become increasingly apparent that mucosal antibodies are not only restricted to the IgM and IgA isotypes, but that also other isotypes and particularly IgG can be found in significant quantities at some mucosal surfaces, such as in the genital tract. Their role is more complex than traditionally believed with, among other things, the discovery of novel function of mucosal immunoglobulin receptors. A thorough knowledge in the source and function and mucosal immunoglobulins is particularly important in development of vaccines providing mucosal immunity, and also in the current climate of microbicide development, to combat major world health issues such as HIV. We present here a comprehensive review of human antibody mediated mucosal immunity. PMID:23882268

  8. A human-specific, truncated α7 nicotinic receptor subunit assembles with full-length α7 and forms functional receptors with different stoichiometries.

    PubMed

    Lasala, Matías; Corradi, Jeremías; Bruzzone, Ariana; Esandi, María Del Carmen; Bouzat, Cecilia

    2018-05-21

    The cholinergic α7 nicotinic receptor gene, CHRNA7, encodes a subunit that forms the homopentameric α7 receptor, involved in learning and memory. In humans, exons 5-10 in CHRNA7 are duplicated and fused to the FAM7A genetic element, giving rise to the hybrid gene CHRFAM7A. Its product, dupα7, is a truncated subunit lacking part of the N-terminal extracellular ligand-binding domain and is associated with neurological disorders, including schizophrenia, and immunomodulation.We combined dupα7 expression on mammalian cells with patch clamp recordings to understand its functional role. Transfected cells expressed dupα7 protein, but they exhibited neither surface binding of the α7 antagonist α-bungarotoxin nor responses to acetylcholine (ACh) or to an allosteric agonist that binds to the conserved transmembrane region. To determine if dupα7 assembles with α7, we generated receptors comprising α7 and dupα7 subunits, one of which was tagged with conductance substitutions that report subunit stoichiometry and monitored ACh-elicited channel openings elicited by ACh in the presence of a positive allosteric α7 modulator. We found that α7 and dupα7 subunits co-assemble into functional heteromeric receptors, that at least two α7 subunits are required for channel opening, and that dupα7's presence in the pentameric arrangement does not affect the duration of the potentiated events compare with that of α7. Using an α7 subunit mutant, we found that activation of (α7)2(dupα7)3 receptors occurs through ACh binding at the α7/α7 interfacial binding site. Our study contributes to the understanding of the modulation of α7 function by the human specific, duplicated subunit, associated with human disorders. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Receptor type I and type II binding regions and the peptidyl-prolyl isomerase site of cyclophilin B are required for enhancement of T-lymphocyte adhesion to fibronectin.

    PubMed

    Carpentier, Mathieu; Allain, Fabrice; Slomianny, Marie-Christine; Durieux, Sandrine; Vanpouille, Christophe; Haendler, Bernard; Spik, Geneviève

    2002-04-23

    Cyclophilin B (CyPB), a cyclosporin A (CsA) binding protein, interacts with two types of binding sites at the surface of T-lymphocytes. The type I sites correspond to functional receptors involved in endocytosis and the type II sites to sulfated glycosaminoglycans (GAGs). Mutational analysis of CyPB has revealed that W128, which is part of the CsA-binding pocket, is implicated in the binding to the functional type I receptors and that two amino acid clusters located in the N-terminus ensure the binding to GAGs. The peptidyl-prolyl isomerase activity of CyPB is not required for receptor binding. We have recently demonstrated that CyPB enhances adhesion of peripheral blood T-lymphocytes to fibronectin, a component of the extracellular matrix. We intended to identify additional amino acids involved in the binding of CyPB to its functional type I receptor and to determine regions responsible for the stimulation of peripheral blood T-lymphocyte adhesion. We determined that residues R76, G77, K132, D155, and D158 of the calcineurin (CN) interacting region were implicated in the recognition of type I receptor but not of GAGs. We also found that two different changes in the N-terminal extension that abated binding to GAGs prevented adhesion of peripheral blood T-lymphocytes to coated CyPB, whereas abbrogation of the PPIase activity had no effect. On the other hand, the adhesion of peripheral blood T-lymphocytes to coated fibronectin was not stimulated by CyPB mutants devoid of either type I receptor or GAGs binding activity or by mutants of the PPIase site. Altogether, the results demonstrate that different regions of CyPB are involved in peripheral blood T-lymphocyte activation and imply a novel important physiological function for peptidyl-prolyl isomerase activity.

  10. One motif to bind them: A small-XXX-small motif affects transmembrane domain 1 oligomerization, function, localization, and cross-talk between two yeast GPCRs.

    PubMed

    Lock, Antonia; Forfar, Rachel; Weston, Cathryn; Bowsher, Leo; Upton, Graham J G; Reynolds, Christopher A; Ladds, Graham; Dixon, Ann M

    2014-12-01

    G protein-coupled receptors (GPCRs) are the largest family of cell-surface receptors in mammals and facilitate a range of physiological responses triggered by a variety of ligands. GPCRs were thought to function as monomers, however it is now accepted that GPCR homo- and hetero-oligomers also exist and influence receptor properties. The Schizosaccharomyces pombe GPCR Mam2 is a pheromone-sensing receptor involved in mating and has previously been shown to form oligomers in vivo. The first transmembrane domain (TMD) of Mam2 contains a small-XXX-small motif, overrepresented in membrane proteins and well-known for promoting helix-helix interactions. An ortholog of Mam2 in Saccharomyces cerevisiae, Ste2, contains an analogous small-XXX-small motif which has been shown to contribute to receptor homo-oligomerization, localization and function. Here we have used experimental and computational techniques to characterize the role of the small-XXX-small motif in function and assembly of Mam2 for the first time. We find that disruption of the motif via mutagenesis leads to reduction of Mam2 TMD1 homo-oligomerization and pheromone-responsive cellular signaling of the full-length protein. It also impairs correct targeting to the plasma membrane. Mutation of the analogous motif in Ste2 yielded similar results, suggesting a conserved mechanism for assembly. Using co-expression of the two fungal receptors in conjunction with computational models, we demonstrate a functional change in G protein specificity and propose that this is brought about through hetero-dimeric interactions of Mam2 with Ste2 via the complementary small-XXX-small motifs. This highlights the potential of these motifs to affect a range of properties that can be investigated in other GPCRs. Copyright © 2014. Published by Elsevier B.V.

  11. Pharmacoperone drugs: targeting misfolded proteins causing lysosomal storage-, ion channels-, and G protein-coupled receptors-associated conformational disorders.

    PubMed

    Hou, Zhi-Shuai; Ulloa-Aguirre, Alfredo; Tao, Ya-Xiong

    2018-06-01

    Conformational diseases are caused by structurally abnormal proteins that cannot fold properly and achieve their native conformation. Misfolded proteins frequently originate from genetic mutations that may lead to loss-of-function diseases involving a variety of structurally diverse proteins including enzymes, ion channels, and membrane receptors. Pharmacoperones are small molecules that cross the cell surface plasma membrane and reach their target proteins within the cell, serving as molecular scaffolds to stabilize the native conformation of misfolded or well-folded but destabilized proteins, to prevent their degradation and promote correct trafficking to their functional site of action. Because of their high specificity toward the target protein, pharmacoperones are currently the focus of intense investigation as therapy for several conformational diseases. Areas covered: This review summarizes data on the mechanisms leading to protein misfolding and the use of pharmacoperone drugs as an experimental approach to rescue function of distinct misfolded/misrouted proteins associated with a variety of diseases, such as lysosomal storage diseases, channelopathies, and G protein-coupled receptor misfolding diseases. Expert commentary: The fact that many misfolded proteins may retain function, offers a unique therapeutic opportunity to cure disease by directly correcting misrouting through administering pharmacoperone drugs thereby rescuing function of disease-causing, conformationally abnormal proteins.

  12. A look at plant immunity through the window of the multitasking coreceptor BAK1.

    PubMed

    Yasuda, Shigetaka; Okada, Kentaro; Saijo, Yusuke

    2017-08-01

    Recognition of microbe- and danger-associated molecular patterns (MAMPs and DAMPs, respectively) by pattern recognition receptors (PRRs) is central to innate immunity in both plants and animals. The plant PRRs described to date are all cell surface-localized receptors. According to their ligand-binding ectodomains, each PRR engages a specific coreceptor or adaptor kinase in its signaling complexes to regulate defense signaling. With a focus on the coreceptor RLK BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1) and related SOMATIC EMBRYOGENESIS RECEPTOR KINASEs (SERKs), here we review the increasing inventory of BAK1 partners and their functions in plant immunity. We also discuss the significance of autoimmunity triggered by BAK1/SERK4 disintegration in shaping the strategies for attenuation of PRR signaling by infectious microbes and host plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Some properties of human neuronal α7 nicotinic acetylcholine receptors fused to the green fluorescent protein

    PubMed Central

    Palma, Eleonora; Mileo, Anna M.; Martínez-Torres, Ataúlfo; Eusebi, Fabrizio; Miledi, Ricardo

    2002-01-01

    The functional properties and cellular localization of the human neuronal α7 nicotinic acetylcholine (AcCho) receptor (α7 AcChoR) and its L248T mutated (mut) form were investigated by expressing them alone or as gene fusions with the enhanced version of the green fluorescent protein (GFP). Xenopus oocytes injected with wild-type (wt), mutα7, or the chimeric subunit cDNAs expressed receptors that gated membrane currents when exposed to AcCho. As already known, AcCho currents generated by wtα7 receptors decay much faster than those elicited by the mutα7 receptors. Unexpectedly, the fusion of GFP to the wt and mutated α7 receptors led to opposite results: the AcCho-current decay of the wt receptors became slower, whereas that of the mutated receptors was accelerated. Furthermore, repetitive applications of AcCho led to a considerable “run-down” of the AcCho currents generated by mutα7-GFP receptors, whereas those of the wtα7-GFP receptors remained stable or increased in amplitude. The AcCho-current run-down of mutα7-GFP oocytes was accompanied by a marked decrease of α-bungarotoxin binding activity. Fluorescence, caused by the chimeric receptors expressed, was seen over the whole oocyte surface but was more intense and abundant in the animal hemisphere, whereas it was much weaker in the vegetal hemisphere. We conclude that fusion of GFP to wtα7 and mutα7 receptors provides powerful tools to study the distribution and function of α7 receptors. We also conclude that fused genes do not necessarily recapitulate all of the properties of the original receptors. This fact must be borne close in mind whenever reporter genes are attached to proteins. PMID:11891308

  14. Functional Analysis of the Tomato Immune Receptor Ve1 through Domain Swaps with Its Non-Functional Homolog Ve2

    PubMed Central

    Rovenich, Hanna; Song, Yin; Liebrand, Thomas W. H.; Masini, Laura; van den Berg, Grardy C. M.; Joosten, Matthieu H. A. J.; Thomma, Bart P. H. J.

    2014-01-01

    Resistance in tomato against race 1 strains of the fungal vascular wilt pathogens Verticillium dahliae and V. albo-atrum is mediated by the Ve locus. This locus comprises two closely linked inversely oriented genes, Ve1 and Ve2, which encode cell surface receptors of the extracellular leucine-rich repeat receptor-like protein (eLRR-RLP) type. While Ve1 mediates Verticillium resistance through monitoring the presence of the recently identified V. dahliae Ave1 effector, no functionality for Ve2 has been demonstrated in tomato. Ve1 and Ve2 contain 37 eLRRs and share 84% amino acid identity, facilitating investigation of Ve protein functionality through domain swapping. In this study it is shown that Ve chimeras in which the first thirty eLRRs of Ve1 were replaced by those of Ve2 remain able to induce HR and activate Verticillium resistance, and that deletion of these thirty eLRRs from Ve1 resulted in loss of functionality. Also the region between eLRR30 and eLRR35 is required for Ve1-mediated resistance, and cannot be replaced by the region between eLRR30 and eLRR35 of Ve2. We furthermore show that the cytoplasmic tail of Ve1 is required for functionality, as truncation of this tail results in loss of functionality. Moreover, the C-terminus of Ve2 fails to activate immune signaling as chimeras containing the C-terminus of Ve2 do not provide Verticillium resistance. Furthermore, Ve1 was found to interact through its C-terminus with the eLRR-containing receptor-like kinase (eLRR-RLK) interactor SOBIR1 that was recently identified as an interactor of eLRR-RLP (immune) receptors. Intriguingly, also Ve2 was found to interact with SOBIR1. PMID:24505431

  15. Bicaudal-D1 regulates the intracellular sorting and signalling of neurotrophin receptors

    PubMed Central

    Terenzio, Marco; Golding, Matthew; Russell, Matthew R G; Wicher, Krzysztof B; Rosewell, Ian; Spencer-Dene, Bradley; Ish-Horowicz, David; Schiavo, Giampietro

    2014-01-01

    We have identified a new function for the dynein adaptor Bicaudal D homolog 1 (BICD1) by screening a siRNA library for genes affecting the dynamics of neurotrophin receptor-containing endosomes in motor neurons (MNs). Depleting BICD1 increased the intracellular accumulation of brain-derived neurotrophic factor (BDNF)-activated TrkB and p75 neurotrophin receptor (p75NTR) by disrupting the endosomal sorting, reducing lysosomal degradation and increasing the co-localisation of these neurotrophin receptors with retromer-associated sorting nexin 1. The resulting re-routing of active receptors increased their recycling to the plasma membrane and altered the repertoire of signalling-competent TrkB isoforms and p75NTR available for ligand binding on the neuronal surface. This resulted in attenuated, but more sustained, AKT activation in response to BDNF stimulation. These data, together with our observation that Bicd1 expression is restricted to the developing nervous system when neurotrophin receptor expression peaks, indicate that BICD1 regulates neurotrophin signalling by modulating the endosomal sorting of internalised ligand-activated receptors. PMID:24920579

  16. Bicaudal-D1 regulates the intracellular sorting and signalling of neurotrophin receptors.

    PubMed

    Terenzio, Marco; Golding, Matthew; Russell, Matthew R G; Wicher, Krzysztof B; Rosewell, Ian; Spencer-Dene, Bradley; Ish-Horowicz, David; Schiavo, Giampietro

    2014-07-17

    We have identified a new function for the dynein adaptor Bicaudal D homolog 1 (BICD1) by screening a siRNA library for genes affecting the dynamics of neurotrophin receptor-containing endosomes in motor neurons (MNs). Depleting BICD1 increased the intracellular accumulation of brain-derived neurotrophic factor (BDNF)-activated TrkB and p75 neurotrophin receptor (p75(NTR)) by disrupting the endosomal sorting, reducing lysosomal degradation and increasing the co-localisation of these neurotrophin receptors with retromer-associated sorting nexin 1. The resulting re-routing of active receptors increased their recycling to the plasma membrane and altered the repertoire of signalling-competent TrkB isoforms and p75(NTR) available for ligand binding on the neuronal surface. This resulted in attenuated, but more sustained, AKT activation in response to BDNF stimulation. These data, together with our observation that Bicd1 expression is restricted to the developing nervous system when neurotrophin receptor expression peaks, indicate that BICD1 regulates neurotrophin signalling by modulating the endosomal sorting of internalised ligand-activated receptors. © 2014 The Authors.

  17. Developmentally Regulated Expression of the Nerve Growth Factor Receptor Gene in the Periphery and Brain

    NASA Astrophysics Data System (ADS)

    Buck, C. R.; Martinez, Humberto J.; Black, Ira B.; Chao, Moses V.

    1987-05-01

    Nerve growth factor (NGF) regulates development and maintenance of function of peripheral sympathetic and sensory neurons. A potential role for the trophic factor in brain has been detected only recently. The ability of a cell to respond to NGF is due, in part, to expression of specific receptors on the cell surface. To study tissue-specific expression of the NGF receptor gene, we have used sensitive cRNA probes for detection of NGF receptor mRNA. Our studies indicate that the receptor gene is selectively and specifically expressed in sympathetic (superior cervical) and sensory (dorsal root) ganglia in the periphery, and by the septum-basal forebrain centrally, in the neonatal rat in vivo. Moreover, examination of tissues from neonatal and adult rats reveals a marked reduction in steady-state NGF receptor mRNA levels in sensory ganglia. In contrast, a 2- to 4-fold increase was observed in the basal forebrain and in the sympathetic ganglia over the same time period. Our observations suggest that NGF receptor mRNA expression is developmentally regulated in specific areas of the nervous system in a differential fashion.

  18. PGRP-SD, an Extracellular Pattern-Recognition Receptor, Enhances Peptidoglycan-Mediated Activation of the Drosophila Imd Pathway.

    PubMed

    Iatsenko, Igor; Kondo, Shu; Mengin-Lecreulx, Dominique; Lemaitre, Bruno

    2016-11-15

    Activation of the innate immune response in Metazoans is initiated through the recognition of microbes by host pattern-recognition receptors. In Drosophila, diaminopimelic acid (DAP)-containing peptidoglycan from Gram-negative bacteria is detected by the transmembrane receptor PGRP-LC and by the intracellular receptor PGRP-LE. Here, we show that PGRP-SD acted upstream of PGRP-LC as an extracellular receptor to enhance peptidoglycan-mediated activation of Imd signaling. Consistent with this, PGRP-SD mutants exhibited impaired activation of the Imd pathway and increased susceptibility to DAP-type bacteria. PGRP-SD enhanced the localization of peptidoglycans to the cell surface and hence promoted signaling. Moreover, PGRP-SD antagonized the action of PGRP-LB, an extracellular negative regulator, to fine-tune the intensity of the immune response. These data reveal that Drosophila PGRP-SD functions as an extracellular receptor similar to mammalian CD14 and demonstrate that, comparable to lipopolysaccharide sensing in mammals, Drosophila relies on both intra- and extracellular receptors for the detection of bacteria. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant

    PubMed Central

    Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li

    2012-01-01

    GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429

  20. Label-Free LSPR Detection of Trace Lead(II) Ions in Drinking Water by Synthetic Poly(mPD-co-ASA) Nanoparticles on Gold Nanoislands.

    PubMed

    Qiu, Guangyu; Ng, Siu Pang; Liang, Xiongyi; Ding, Ning; Chen, Xiangfeng; Wu, Chi-Man Lawrence

    2017-02-07

    Using self-assembly gold nanoislands (SAM-AuNIs) functionalized by poly(m-phenylenediamine-co-aniline-2-sulfonic acid) (poly(mPD-co-ASA)) copolymer nanoparticles as specific receptors, a highly sensitive localized surface plasmon resonance (LSPR) optochemical sensor is demonstrated for detection of trace lead cation (Pb(II)) in drinking water. The copolymer receptor is optimized in three aspects: (1) mole ratio of mPD:ASA monomers, (2) size of copolymer nanoparticles, and (3) surface density of the copolymer. It is shown that the 95:5 (mPD:ASA mole ratio) copolymer with size less than 100 nm exhibits the best Pb(II)-sensing performance, and the 200 times diluted standard copolymer solution contributes to the most effective functionalization protocol. The resulting poly(mPD-co-ASA)-functionalized LSPR sensor attains the detection limit to 0.011 ppb toward Pb(II) in drinking water, and the linear dynamic range covers 0.011 to 5000 ppb (i.e., 6 orders of magnitude). In addition, the sensing system exhibits robust selectivity to Pb(II) in the presence of other metallic cations as well as common anions. The proposed functional copolymer functionalized on AuNIs is found to provide excellent Pb(II)-sensing performance using simple LSPR instrumentation for rapid drinking-water inspection.

  1. A single amino acid residue controls Ca2+ signaling by an octopamine receptor from Drosophila melanogaster.

    PubMed

    Hoff, Max; Balfanz, Sabine; Ehling, Petra; Gensch, Thomas; Baumann, Arnd

    2011-07-01

    Rhythmic activity of cells and cellular networks plays an important role in physiology. In the nervous system oscillations of electrical activity and/or second messenger concentrations are important to synchronize neuronal activity. At the molecular level, rhythmic activity can be initiated by different routes. We have recently shown that an octopamine-activated G-protein-coupled receptor (GPCR; DmOctα1Rb, CG3856) from Drosophila initiates Ca(2+) oscillations. Here, we have unraveled the molecular basis of cellular Ca(2+) signaling controlled by the DmOctα1Rb receptor using a combination of pharmacological intervention, site-directed mutagenesis, and functional cellular Ca(2+) imaging on heterologously expressed receptors. Phosphorylation of a single amino acid residue in the third intracellular loop of the GPCR by PKC is necessary and sufficient to desensitize the receptor. From its desensitized state, DmOctα1Rb is resensitized by dephosphorylation, and a new Ca(2+) signal occurs on octopamine stimulation. Our findings show that transient changes of the receptor's surface profile have a strong effect on its physiological signaling properties. We expect that the detailed knowledge of DmOctα1Rb-dependent signal transduction fosters the identification of specific drugs that can be used for GPCR-mediated pest control, since octopamine serves important physiological and behavioral functions in arthropods.

  2. A single amino acid residue controls Ca2+ signaling by an octopamine receptor from Drosophila melanogaster

    PubMed Central

    Hoff, Max; Balfanz, Sabine; Ehling, Petra; Gensch, Thomas; Baumann, Arnd

    2011-01-01

    Rhythmic activity of cells and cellular networks plays an important role in physiology. In the nervous system oscillations of electrical activity and/or second messenger concentrations are important to synchronize neuronal activity. At the molecular level, rhythmic activity can be initiated by different routes. We have recently shown that an octopamine-activated G-protein-coupled receptor (GPCR; DmOctα1Rb, CG3856) from Drosophila initiates Ca2+ oscillations. Here, we have unraveled the molecular basis of cellular Ca2+ signaling controlled by the DmOctα1Rb receptor using a combination of pharmacological intervention, site-directed mutagenesis, and functional cellular Ca2+ imaging on heterologously expressed receptors. Phosphorylation of a single amino acid residue in the third intracellular loop of the GPCR by PKC is necessary and sufficient to desensitize the receptor. From its desensitized state, DmOctα1Rb is resensitized by dephosphorylation, and a new Ca2+ signal occurs on octopamine stimulation. Our findings show that transient changes of the receptor's surface profile have a strong effect on its physiological signaling properties. We expect that the detailed knowledge of DmOctα1Rb-dependent signal transduction fosters the identification of specific drugs that can be used for GPCR-mediated pest control, since octopamine serves important physiological and behavioral functions in arthropods.—Hoff M., Balfanz, S., Ehling, P., Gensch, T., Baumann, A. A single amino acid residue controls Ca2+ signaling by an octopamine receptor from Drosophila melanogaster. PMID:21478261

  3. Infection of Polarized MDCK Cells with Herpes Simplex Virus 1: Two Asymmetrically Distributed Cell Receptors Interact with Different Viral Proteins

    NASA Astrophysics Data System (ADS)

    Sears, Amy E.; McGwire, Bradford S.; Roizman, Bernard

    1991-06-01

    Herpes simplex virus 1 attaches to at least two cell surface receptors. In polarized epithelial (Madin-Darby canine kidney; MDCK) cells one receptor is located in the apical surface and attachment to the cells requires the presence of glycoprotein C in the virus. The second receptor is located in the basal surface and does not require the presence of glycoprotein C. Exposure of MDCK cells at either the apical or basal surface to wild-type virus yields plaques and viral products whereas infection by a glycoprotein C-negative mutant yields identical results only after exposure of MDCK cells to virus at the basal surface. Multiple receptors for viral entry into cells expand the host range of the virus. The observation that glycoprotein C-negative mutants are infectious in many nonpolarized cell lines suggests that cells in culture may express more than one receptor and explains why genes that specify the viral proteins that recognize redundant receptors, like glycoprotein C, are expendable.

  4. Self-identity reprogrammed by a single residue switch in a cell surface receptor of a social bacterium.

    PubMed

    Cao, Pengbo; Wall, Daniel

    2017-04-04

    The ability to recognize close kin confers survival benefits on single-celled microbes that live in complex and changing environments. Microbial kinship detection relies on perceptible cues that reflect relatedness between individuals, although the mechanisms underlying recognition in natural populations remain poorly understood. In myxobacteria, cells identify related individuals through a polymorphic cell surface receptor, TraA. Recognition of compatible receptors leads to outer membrane exchange among clonemates and fitness consequences. Here, we investigated how a single receptor creates a diversity in recognition across myxobacterial populations. We first show that TraA requires its partner protein TraB to function in cell-cell adhesion. Recognition is shown to be traA allele-specific, where polymorphisms within TraA dictate binding selectivity. We reveal the malleability of TraA recognition, and seemingly minor changes to its variable region reprogram recognition outcomes. Strikingly, we identify a single residue (A/P205) as a molecular switch for TraA recognition. Substitutions at this position change the specificity of a diverse panel of environmental TraA receptors. In addition, we engineered a receptor with unique specificity by simply creating an A205P substitution, suggesting that modest changes in TraA can lead to diversification of new recognition groups in nature. We hypothesize that the malleable property of TraA has allowed it to evolve and create social barriers between myxobacterial populations and in turn avoid adverse interactions with relatives.

  5. Solution Structure of the Soluble Receptor for Advanced Glycation End Products (sRAGE)*

    PubMed Central

    Sárkány, Zsuzsa; Ikonen, Teemu P.; Ferreira-da-Silva, Frederico; Saraiva, Maria João; Svergun, Dmitri; Damas, Ana Margarida

    2011-01-01

    The receptor for advanced glycation end products (RAGE) is a multiligand cell surface receptor involved in various human diseases, as it binds to numerous molecules and proteins that modulate the activity of other proteins. Elucidating the three-dimensional structure of this receptor is therefore most important for understanding its function during activation and cellular signaling. The major alternative splice product of RAGE comprises its extracellular region that occurs as a soluble protein (sRAGE). Although the structures of sRAGE domains were available, their assembly into the functional full-length protein remained unknown. We observed that the protein has concentration-dependent oligomerization behavior, and this is also mediated by the presence of Ca2+ ions. Moreover, using synchrotron small angle x-ray scattering, the solution structure of human sRAGE was determined in the monomeric and dimeric forms. The model for the monomer displays a J-like shape, whereas the dimer is formed through the association of the two N-terminal domains and has an elongated structure. These results provide insights into the assembly of the RAGE homodimer, which is essential for signal transduction, and the sRAGE:RAGE heterodimer that leads to blockage of the receptor signaling, paving the way for the design of therapeutic strategies for a large number of different pathologies. PMID:21865159

  6. The SAM domain inhibits EphA2 interactions in the plasma membrane.

    PubMed

    Singh, Deo R; Ahmed, Fozia; Paul, Michael D; Gedam, Manasee; Pasquale, Elena B; Hristova, Kalina

    2017-01-01

    All members of the Eph receptor family of tyrosine kinases contain a SAM domain near the C terminus, which has been proposed to play a role in receptor homotypic interactions and/or interactions with binding partners. The SAM domain of EphA2 is known to be important for receptor function, but its contribution to EphA2 lateral interactions in the plasma membrane has not been determined. Here we use a FRET-based approach to directly measure the effect of the SAM domain on the stability of EphA2 dimers on the cell surface in the absence of ligand binding. We also investigate the functional consequences of EphA2 SAM domain deletion. Surprisingly, we find that the EphA2 SAM domain inhibits receptor dimerization and decreases EphA2 tyrosine phosphorylation. This role is dramatically different from the role of the SAM domain of the related EphA3 receptor, which we previously found to stabilize EphA3 dimers and increase EphA3 tyrosine phosphorylation in cells in the absence of ligand. Thus, the EphA2 SAM domain likely contributes to a unique mode of EphA2 interaction that leads to distinct signaling outputs. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Bypassing Protein Corona Issue on Active Targeting: Zwitterionic Coatings Dictate Specific Interactions of Targeting Moieties and Cell Receptors.

    PubMed

    Safavi-Sohi, Reihaneh; Maghari, Shokoofeh; Raoufi, Mohammad; Jalali, Seyed Amir; Hajipour, Mohammad J; Ghassempour, Alireza; Mahmoudi, Morteza

    2016-09-07

    Surface functionalization strategies for targeting nanoparticles (NP) to specific organs, cells, or organelles, is the foundation for new applications of nanomedicine to drug delivery and biomedical imaging. Interaction of NPs with biological media leads to the formation of a biomolecular layer at the surface of NPs so-called as "protein corona". This corona layer can shield active molecules at the surface of NPs and cause mistargeting or unintended scavenging by the liver, kidney, or spleen. To overcome this corona issue, we have designed biotin-cysteine conjugated silica NPs (biotin was employed as a targeting molecule and cysteine was used as a zwitterionic ligand) to inhibit corona-induced mistargeting and thus significantly enhance the active targeting capability of NPs in complex biological media. To probe the targeting yield of our engineered NPs, we employed both modified silicon wafer substrates with streptavidin (i.e., biotin receptor) to simulate a target and a cell-based model platform using tumor cell lines that overexpress biotin receptors. In both cases, after incubation with human plasma (thus forming a protein corona), cellular uptake/substrate attachment of the targeted NPs with zwitterionic coatings were significantly higher than the same NPs without zwitterionic coating. Our results demonstrated that NPs with a zwitterionic surface can considerably facilitate targeting yield of NPs and provide a promising new type of nanocarriers in biological applications.

  8. The Structure of the Statocyst of the Freshwater Snail Biomphalaria Glabrata (Pulmonata, Basommatophora)

    NASA Technical Reports Server (NTRS)

    Gao, Wenyuan; Wiederhold, Michael L.

    1997-01-01

    The structure of the statocyst of the freshwater snail Biomphalaria glabrata has been examined by light and electron microscopy. The two statocysts are located on the dorsal-lateral side of the left and right pedal ganglion. The statocysts are spherical, fluid-filled capsules with a diameter of approximately 60 microns for young and 110 microns for adult snails. The wall of the cyst is composed of large receptor cells and many smaller supporting cells. The receptor cells bear cilia which are evenly distributed on the apical surface. The cilia have the typical 9+2 internal tubule configuration. Striate rootlets originate from the base of the basal body and run downward into the cytoplasm. Side-roots arise from one side of the basal body and a basal foot from the other. For each receptor cell, the basal foot always points to the periphery of the surface, indicating that the receptor cell is non-polarized. The receptor cells contain cytoplasmic organelles such as mitochondria, ribosomes, rough and smooth endoplasmic reticulum, compact Golgi bodies and multivesicular bodies. Supporting cells bearing microvilli are interposed between the receptor cells. The junction complex between the supporting cells and the receptor cells is composed of adherens and septate junctions, while between supporting cells only the adherens junctions are present. The static nerve arises from the lateral side of the cyst and contains axons in which parallel neurotubules and mitochondria are found. The axons arise directly from the base of the receptor cells without synapse. In the cyst lumen there are unattached statoconia. The statoconia have a plate-like or concentric membranous ring structure. Based on the morphology, the function of the statocyst in Biomphalaria is discussed.

  9. Generation of herpesvirus entry mediator (HVEM)-restricted herpes simplex virus type 1 mutant viruses: resistance of HVEM-expressing cells and identification of mutations that rescue nectin-1 recognition.

    PubMed

    Uchida, Hiroaki; Shah, Waris A; Ozuer, Ali; Frampton, Arthur R; Goins, William F; Grandi, Paola; Cohen, Justus B; Glorioso, Joseph C

    2009-04-01

    Both initial infection and cell-to-cell spread by herpes simplex virus type 1 (HSV-1) require the interaction of the viral glycoprotein D (gD) with an entry receptor on the cell surface. The two major HSV entry receptors, herpesvirus entry mediator (HVEM) and nectin-1, mediate infection independently but are coexpressed on a variety of cells. To determine if both receptors are active in these instances, we have established mutant viruses that are selectively impaired for recognition of one or the other receptor. In plaque assays, these viruses showed approximately 1,000-fold selectivity for the matched receptor over the mismatched receptor. Separate assays showed that each virus is impaired for both infection and spread through the mismatched receptor. We tested several human tumor cell lines for susceptibility to these viruses and observed that HT29 colon carcinoma cells are susceptible to infection by nectin-1-restricted virus but are highly resistant to HVEM-restricted virus infection, despite readily detectable HVEM expression on the cell surface. HVEM cDNA isolated from HT29 cells rendered HSV-resistant cells permissive for infection by the HVEM-restricted virus, suggesting that HT29 cells lack a cofactor for HVEM-mediated infection or express an HVEM-specific inhibitory factor. Passaging of HVEM-restricted virus on nectin-1-expressing cells yielded a set of gD missense mutations that each restored functional recognition of nectin-1. These mutations identify residues that likely play a role in shaping the nectin-1 binding site of gD. Our findings illustrate the utility of these receptor-restricted viruses in studying the early events in HSV infection.

  10. Transferrin receptors and the targeted delivery of therapeutic agents against cancer

    PubMed Central

    Daniels, Tracy R.; Bernabeu, Ezequiel; Rodríguez, José A.; Patel, Shabnum; Kozman, Maggie; Chiappetta, Diego A.; Holler, Eggehard; Ljubimova, Julia Y.; Helguera, Gustavo; Penichet, Manuel L.

    2012-01-01

    Background Traditional cancer therapy can be successful in destroying tumors, but can also cause dangerous side effects. Therefore, many targeted therapies are in development. The transferrin receptor (TfR) functions in cellular iron uptake through its interaction with transferrin. This receptor is an attractive molecule for the targeted therapy of cancer since it is upregulated on the surface of many cancer types and is efficiently internalized. This receptor can be targeted in two ways: 1) for the delivery of therapeutic molecules into malignant cells or 2) to block the natural function of the receptor leading directly to cancer cell death. Scope of review In the present article we discuss the strategies used to target the TfR for the delivery of therapeutic agents into cancer cells. We provide a summary of the vast types of anti-cancer drugs that have been delivered into cancer cells employing a variety of receptor binding molecules including Tf, anti-TfR antibodies, or TfR-binding peptides alone or in combination with carrier molecules including nanoparticles and viruses. Major conclusions Targeting the TfR has been shown to be effective in delivering many different therapeutic agents and causing cytotoxic effects in cancer cells in vitro and in vivo. General significance The extensive use of TfR for targeted therapy attests to the versatility of targeting this receptor for therapeutic purposes against malignant cells. More advances in this area are expected to further improve the therapeutic potential of targeting the TfR for cancer therapy leading to an increase in the number of clinical trials of molecules targeting this receptor. PMID:21851850

  11. A Family of G Protein βγ Subunits Translocate Reversibly from the Plasma Membrane to Endomembranes on Receptor Activation*S

    PubMed Central

    Saini, Deepak Kumar; Kalyanaraman, Vani; Chisari, Mariangela; Gautam, Narasimhan

    2008-01-01

    The present model of G protein activation by G protein-coupled receptors exclusively localizes their activation and function to the plasma membrane (PM). Observation of the spatiotemporal response of G protein subunits in a living cell to receptor activation showed that 6 of the 12 members of the G protein γ subunit family translocate specifically from the PM to endomembranes. The γ subunits translocate as βγ complexes, whereas the α subunit is retained on the PM. Depending on the γ subunit, translocation occurs predominantly to the Golgi complex or the endoplasmic reticulum. The rate of translocation also varies with the γ subunit type. Different γ subunits, thus, confer distinct spatiotemporal properties to translocation. A striking relationship exists between the amino acid sequences of various γ subunits and their translocation properties. γ subunits with similar translocation properties are more closely related to each other. Consistent with this relationship, introducing residues conserved in translocating subunits into a non-translocating subunit results in a gain of function. Inhibitors of vesicle-mediated trafficking and palmitoylation suggest that translocation is diffusion-mediated and controlled by acylation similar to the shuttling of G protein subunits (Chisari, M., Saini, D. K., Kalyanaraman, V., and Gautam, N. (2007) J. Biol. Chem. 282, 24092–24098). These results suggest that the continual testing of cytosolic surfaces of cell membranes by G protein subunits facilitates an activated cell surface receptor to direct potentially active G protein βγ subunits to intracellular membranes. PMID:17581822

  12. Leukocyte Cell Surface Proteinases: Regulation of Expression, Functions, and Mechanisms of Surface Localization

    PubMed Central

    Owen, Caroline A.

    2008-01-01

    A number of proteinases are expressed on the surface of leukocytes including members of the serine, metallo-, and cysteine proteinase superfamilies. Some proteinases are anchored to the plasma membrane of leukocytes by a transmembrane domain or a glycosyl phosphatidyl inositol (GPI) anchor. Other proteinases bind with high affinity to classical receptors, or with lower affinity to integrins, proteoglycans, or other leukocyte surface molecules. Leukocyte surface levels of proteinases are regulated by: 1) cytokines, chemokines, bacterial products, and growth factors which stimulate synthesis and/or release of proteinase by cells; 2) the availability of surface binding sites for proteinases; and/or 3) internalization or shedding of surface-bound proteinases. The binding of proteinases to leukocyte surfaces serves many functions including: 1) concentrating the activity of proteinases to the immediate pericellular environment; 2) facilitating pro-enzyme activation; 3) increasing proteinase stability and retention in the extracellular space; 4) regulating leukocyte function by proteinases signaling through cell surface binding sites or other surface proteins; and 5) protecting proteinases from inhibition by extracellular proteinase inhibitors. There is strong evidence that membrane-associated proteinases on leukocytes play critical roles in wound healing, inflammation, extracellular matrix remodeling, fibrinolysis, and coagulation. This review will outline the biology of membrane-associated proteinases expressed by leukocytes and their roles in physiologic and pathologic processes. PMID:18329945

  13. Expression and functional studies of the GDNF family receptor-alpha3 (GFRα3) in the pancreas

    PubMed Central

    Nivlet, Laure; Herrmann, Joel; Martin, Delia Esteban; Meunier, Aline; Orvain, Christophe; Gradwohl, Gérard

    2018-01-01

    The generation of therapeutic β-cells from human pluripotent stem cells relies on the identification of growth factors that faithfully mimic pancreatic β-cell development in vitro. In this context, the aim of the study was to determine the expression and function of the Glial cell line derived neurotrophic factor receptor α 3 (GFRα3) and its ligand Artemin in islet cell development and function. GFRα3 and Artn expression were characterized by in situ hybridization, immunochemistry and qRT-PCR. We used GFRα3-deficient mice to study GFRα3 function and generated a transgenic mice overexpressing Artn in the embryonic pancreas to study Artn function. We found that GFRα3 is expressed at the surface of a subset of Ngn3-positive endocrine progenitors as well as of embryonic α- and β-cells, while Artn is found in the pancreatic mesenchyme. Adult β-cells lack GFRα3 but α-cells express the receptor. GFRα3 was also found in parasympathetic and sympathetic intra islets neurons as well as in glial cells in the embryonic and adult pancreas. The loss of GFRα3 or overexpression of Artn has no impact on Ngn3- and islet- cells formation and maintenance in the embryo. Islet organisation and innervation as well as glucose homeostasis is normal in GFRα3-deficient mice suggesting functional redundancy. PMID:26576643

  14. Quantitative analysis reveals how EGFR activation and downregulation are coupled in normal but not in cancer cells

    PubMed Central

    Capuani, Fabrizio; Conte, Alexia; Argenzio, Elisabetta; Marchetti, Luca; Priami, Corrado; Polo, Simona; Di Fiore, Pier Paolo; Sigismund, Sara; Ciliberto, Andrea

    2015-01-01

    Ubiquitination of the epidermal growth factor receptor (EGFR) that occurs when Cbl and Grb2 bind to three phosphotyrosine residues (pY1045, pY1068 and pY1086) on the receptor displays a sharp threshold effect as a function of EGF concentration. Here we use a simple modelling approach together with experiments to show that the establishment of the threshold requires both the multiplicity of binding sites and cooperative binding of Cbl and Grb2 to the EGFR. While the threshold is remarkably robust, a more sophisticated model predicted that it could be modulated as a function of EGFR levels on the cell surface. We confirmed experimentally that the system has evolved to perform optimally at physiological levels of EGFR. As a consequence, this system displays an intrinsic weakness that causes—at the supraphysiological levels of receptor and/or ligand associated with cancer—uncoupling of the mechanisms leading to signalling through phosphorylation and attenuation through ubiquitination. PMID:26264748

  15. [Production, specificity and structure of immunoglobulins].

    PubMed

    Goujard, C; Delfraissy, J F

    1991-03-21

    Immunoglobulin is a key factor of the immune response resulting from B-cell activation and associated with T-cell stimulation. Because of its structure, this antibody has a dual function: it specifically recognizes the inducer antigen in the variable region and eliminates it by a constant portion which is responsible for effector properties. Surface immunoglobulin, therefore, is the B-cell antigen receptor; it differs from the T-cell receptor in that it recognizes the antigen unbound to the major istocompatibility complex; binding the antigen results in direct signal transduction first in the cytoplasm, then in the nucleus. This receptor can be secreted in the body: it is made up of circulating immunoglobulins. Human immunoglobulins are divided into 5 classes, each of them with its own response kinetics, distribution and functions. The variability of the antibody response accounts for a genetic organization involving numerous genes which may be associated with each other, or mutate, or recombine during maturation of the lymphocytes. Altogether, this system has a theoretical capacity of response to three hundred million different antigens.

  16. Growth factor pleiotropy is controlled by a receptor Tyr/Ser motif that acts as a binary switch

    PubMed Central

    Guthridge, Mark A; Powell, Jason A; Barry, Emma F; Stomski, Frank C; McClure, Barbara J; Ramshaw, Hayley; Felquer, Fernando A; Dottore, Mara; Thomas, Daniel T; To, Bik; Begley, C Glenn; Lopez, Angel F

    2006-01-01

    Pleiotropism is a hallmark of cytokines and growth factors; yet, the underlying mechanisms are not clearly understood. We have identified a motif in the granulocyte macrophage-colony-stimulating factor receptor composed of a tyrosine and a serine residue that functions as a binary switch for the independent regulation of multiple biological activities. Signalling occurs either through Ser585 at lower cytokine concentrations, leading to cell survival only, or through Tyr577 at higher cytokine concentrations, leading to cell survival as well as proliferation, differentiation or functional activation. The phosphorylation of Ser585 and Tyr577 is mutually exclusive and occurs via a unidirectional mechanism that involves protein kinase A and tyrosine kinases, respectively, and is deregulated in at least some leukemias. We have identified similar Tyr/Ser motifs in other cell surface receptors, suggesting that such signalling switches may play important roles in generating specificity and pleiotropy in other biological systems. PMID:16437163

  17. Surface receptors on human haematopoietic cell lines.

    PubMed Central

    Huber, C; Sundström, C; Nilsson, K; Wigzell, H

    1976-01-01

    The expression of complement receptors, of Fc receptors, of SRBC receptors and of S-Ig was investigated on human haematopoietic cell lines of proved malignant derivation. According to their origin and to a panel of phenotypic markers these lines have been classified into lymphoma lines, myeloma lines and leukemia lines. Results were compared with those obtained on non-malignant EBV carrying lymphoblastoid cell lines (LCL). Among the lymphoid cell lines the LCL showed a pattern of B-lymphocyte surface markers, i.e. surface immunoglobulins, C3 receptors but low density of Fc receptors. The non-Burkitt lymphoma lines bore in varying degree these B-lymphocyte markers. The lines U-698 M and DG-75 were exceptional in having only surface immunoglobulin. The Burkitt lymphoma lines had all B-lymphocyte markers. The myeloma lines differed from the lymphoid lines in lacking C3 and Fc receptors and showed only trace amounts of surface immunoglobulins. In contrast to lymphoid and myeloma lines, the leukaemia lines were completely lacking surface immunoglobulins, but showed C3 and Fc receptors in variable densities. On line, the ALL derived line MOLT-3 showed the capacity to spontaneous rosette formation with SRBC. The findings that LCL presented a homogeneous pattern of B-lymphocyte surface markers may be of value in order to discriminate between these lines and lines derived from haematopoietic malignancies other than Burkitt lymphomas. PMID:963908

  18. A lectin receptor kinase as a potential sensor for extracellular nicotinamide adenine dinucleotide in Arabidopsis thaliana

    PubMed Central

    Wang, Chenggang; Zhou, Mingqi; Zhang, Xudong; Yao, Jin; Zhang, Yanping; Mou, Zhonglin

    2017-01-01

    Nicotinamide adenine dinucleotide (NAD+) participates in intracellular and extracellular signaling events unrelated to metabolism. In animals, purinergic receptors are required for extracellular NAD+ (eNAD+) to evoke biological responses, indicating that eNAD+ may be sensed by cell-surface receptors. However, the identity of eNAD+-binding receptors still remains elusive. Here, we identify a lectin receptor kinase (LecRK), LecRK-I.8, as a potential eNAD+ receptor in Arabidopsis. The extracellular lectin domain of LecRK-I.8 binds NAD+ with a dissociation constant of 436.5 ± 104.8 nM, although much higher concentrations are needed to trigger in vivo responses. Mutations in LecRK-I.8 inhibit NAD+-induced immune responses, whereas overexpression of LecRK-I.8 enhances the Arabidopsis response to NAD+. Furthermore, LecRK-I.8 is required for basal resistance against bacterial pathogens, substantiating a role for eNAD+ in plant immunity. Our results demonstrate that lectin receptors can potentially function as eNAD+-binding receptors and provide direct evidence for eNAD+ being an endogenous signaling molecule in plants. DOI: http://dx.doi.org/10.7554/eLife.25474.001 PMID:28722654

  19. Enteric pathogens and gut function: Role of cytokines and STATs.

    PubMed

    Shea-Donohue, Terez; Fasano, Alessio; Smith, Allen; Zhao, Aiping

    2010-09-01

    The gut harbors the largest immune system in the body. The mucosa is considered to be the initial site of interaction with commensal and pathogenic organisms; therefore, it is the first line of defense against the pathogens. In response to the invasion of various pathogens, naïve CD4(+) cells differentiate into subsets of T helper (Th) cells that are characterized by different cytokine profiles. Cytokines bind to cell surface receptors on both immune and non-immune cells leading to activation of JAK-STAT signaling pathway and influence gut function by upregulating the expression of specific target genes. This review considers the roles of cytokines and receptor-mediated activation of STATs on pathogen-induced changes in gut function. The focus on STAT4 and STAT6 is because of their requirement for the full development of Th1 and Th2 cytokine profiles.

  20. Enteric pathogens and gut function: Role of cytokines and STATs

    PubMed Central

    Fasano, Alessio; Smith, Allen; Zhao, Aiping

    2010-01-01

    The gut harbors the largest immune system in the body. The mucosa is considered to be the initial site of interaction with commensal and pathogenic organisms; therefore, it is the first line of defense against the pathogens. In response to the invasion of various pathogens, naïve CD4+ cells differentiate into subsets of T helper (Th) cells that are characterized by different cytokine profiles. Cytokines bind to cell surface receptors on both immune and non-immune cells leading to activation of JAK-STAT signaling pathway and influence gut function by upregulating the expression of specific target genes. This review considers the roles of cytokines and receptor-mediated activation of STATs on pathogen-induced changes in gut function. The focus on STAT4 and STAT6 is because of their requirement for the full development of Th1 and Th2 cytokine profiles. PMID:21327040

  1. Variable ligand- and receptor-binding hot spots in key strains of influenza neuraminidase

    PubMed Central

    Votapka, Lane; Demir, Özlem; Swift, Robert V; Walker, Ross C; Amaro, Rommie E

    2012-01-01

    Influenza A continues to be a major public health concern due to its ability to cause epidemic and pandemic disease outbreaks in humans. Computational investigations of structural dynamics of the major influenza glycoproteins, especially the neuraminidase (NA) enzyme, are able to provide key insights beyond what is currently accessible with standard experimental techniques. In particular, all-atom molecular dynamics simulations reveal the varying degrees of flexibility for such enzymes. Here we present an analysis of the relative flexibility of the ligand- and receptor-binding area of three key strains of influenza A: highly pathogenic H5N1, the 2009 pandemic H1N1, and a human N2 strain. Through computational solvent mapping, we investigate the various ligand- and receptor-binding “hot spots” that exist on the surface of NA which interacts with both sialic acid receptors on the host cells and antiviral drugs. This analysis suggests that the variable cavities found in the different strains and their corresponding capacities to bind ligand functional groups may play an important role in the ability of NA to form competent reaction encounter complexes with other species of interest, including antiviral drugs, sialic acid receptors on the host cell surface, and the hemagglutinin protein. Such considerations may be especially useful for the prediction of how such complexes form and with what binding capacity. PMID:22872804

  2. The distribution of IL-13 receptor alpha1 expression on B cells, T cells and monocytes and its regulation by IL-13 and IL-4.

    PubMed

    Graber, P; Gretener, D; Herren, S; Aubry, J P; Elson, G; Poudrier, J; Lecoanet-Henchoz, S; Alouani, S; Losberger, C; Bonnefoy, J Y; Kosco-Vilbois, M H; Gauchat, J F

    1998-12-01

    To study the expression of IL-13 receptor alpha1 (IL-13Ralpha1), specific monoclonal antibodies (mAb) were generated. Surface expression of the IL-13Ralpha1 on B cells, monocytes and T cells was assessed by flow cytometry using these specific mAb. Among tonsillar B cells, the expression was the highest on the IgD+ CD38- B cell subpopulation which is believed to represent naive B cells. Expression was also detectable on a large fraction of the IgD-CD38- B cells but not on CD38+ B cells. Activation under conditions which promote B cell Ig class switching up-regulated the expression of the receptor. However, the same stimuli had an opposite effect for IL-13Ralpha1 expression levels on monocytes. While IL-13Ralpha1 mRNA was clearly detectable in T cell preparations, no surface expression was detected. However, permeabilization of the T cells showed a clear intracellular expression of the receptor. A soluble form of the receptor was immunoprecipitated from the supernatant of activated peripheral T cells, suggesting that T cell IL-13Ralpha1 might have functions unrelated to the capacity to form a type II IL-4/IL-13R with IL-4Ralpha.

  3. Human natural killer cell receptors for HLA-class I molecules. Evidence that the Kp43 (CD94) molecule functions as receptor for HLA-B alleles

    PubMed Central

    1994-01-01

    GL183 or EB6 (p58) molecules have been shown to function as receptors for different HLA-C alleles and to deliver an inhibitory signal to natural killer (NK) cells, thus preventing lysis of target cells. In this study, we analyzed a subset of NK cells characterized by a p58- negative surface phenotype. We show that p58-negative clones, although specific for class I molecules do not recognize HLA-C alleles. In addition, by the use of appropriate target cells transfected with different HLA-class I alleles we identified HLA-B7 as the protective element recognized by a fraction of p58-negative clones. In an attempt to identify the receptor molecules expressed by HLA-B7-specific clones, monoclonal antibodies (mAbs) were selected after mice immunization with such clones. Two of these mAbs, termed XA-88 and XA-185, and their F(ab')2 fragments, were found to reconstitute lysis of B7+ target cells by B7-specific NK clones. Both mAbs were shown to be directed against the recently clustered Kp43 molecule (CD94). Thus, mAb-mediated masking of Kp43 molecules interferes with recognition of HLA-B7 and results in target cell lysis. Moreover, in a redirected killing assay, the cross- linking of Kp43 molecules mediated by the XA185 mAb strongly inhibited the cytolytic activity of HLA-B7-specific NK clones, thus mimicking the functional effect of B7 molecules. Taken together, these data strongly suggest that Kp43 molecules function as receptors for HLA-B7 and that this receptor/ligand interaction results in inhibition of the NK- mediated cytolytic activity. Indirect immunofluorescence and FACS analysis of a large number of random NK clones showed that Kp43 molecules (a) were brightly expressed on a subset of p58-negative clones, corresponding to those specific for HLA-B7; (b) displayed a medium/low fluorescence in the p58-negative clones that are not B7- specific as well as in most p58+ NK clones; and (c) were brightly expressed as in the p58+ clone ET34 (GL183-/EB6+, Cw4-specific). Functional analysis revealed that Kp43 functioned as an inhibitory receptor only in NK clones displaying bright fluorescence. These studies also indicate that some NK clones (e.g., the ET34) can coexpress two distinct receptors (p58 and Kp43) for different class I alleles (Cw4 and B7). Finally, we show that Kp43 molecules function as receptors only for some HLA-B alleles and that still undefined receptor(s) must exist for other HLA-B alleles including B27. PMID:8046333

  4. Optimized multimodal nanoplatforms for targeting αvβ3 integrins

    NASA Astrophysics Data System (ADS)

    Bolley, Julie; Lalatonne, Yoann; Haddad, Oualid; Letourneur, Didier; Soussan, Michael; Pérard-Viret, Joelle; Motte, Laurence

    2013-11-01

    Magnetic Resonance Imaging (MRI) using contrast agents is a very powerful technique for diagnosis in clinical medicine and biomedical research. The synthesis of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles targeting αvβ3 integrins and acting as new MRI contrast agents seems to be a promising way for cancer diagnosis. Indeed, it is well established that αvβ3 integrin plays a key role in tumor angiogenesis acting like a receptor for the extracellular matrix proteins like vitronectin, fibronectin through the arginine-glycine-aspartic acid (RGD) sequence. Up-regulation of αvβ3 has been found to be associated with a wide range of cancers, making it a broad-spectrum tumor-marker. In this study, USPIO nanocrystals were synthesized and surface passivated with caffeic acid. The large number of the carboxylic acid functions at the outer surface of the nanoplatforms was used for the covalent coupling of Rhodamine123, polyethylene glycol (PEG) and cyclic RGD. Soluble carbodiimide (EDC) and N-hydroxysuccinimide (NHS) were used to crosslink carboxylic acid with the amino group of the ligands. We examined the design of the nanoplatforms with each individual entity and then the combination of two and three of them. Several methods were used to characterize the nanoparticle surface functionalization and the magnetic properties of these contrast agents were studied using a 1.5 T clinical MRI scanner. The affinity towards integrins was evidenced by surface plasmon resonance and solid-phase receptor-binding assay.Magnetic Resonance Imaging (MRI) using contrast agents is a very powerful technique for diagnosis in clinical medicine and biomedical research. The synthesis of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles targeting αvβ3 integrins and acting as new MRI contrast agents seems to be a promising way for cancer diagnosis. Indeed, it is well established that αvβ3 integrin plays a key role in tumor angiogenesis acting like a receptor for the extracellular matrix proteins like vitronectin, fibronectin through the arginine-glycine-aspartic acid (RGD) sequence. Up-regulation of αvβ3 has been found to be associated with a wide range of cancers, making it a broad-spectrum tumor-marker. In this study, USPIO nanocrystals were synthesized and surface passivated with caffeic acid. The large number of the carboxylic acid functions at the outer surface of the nanoplatforms was used for the covalent coupling of Rhodamine123, polyethylene glycol (PEG) and cyclic RGD. Soluble carbodiimide (EDC) and N-hydroxysuccinimide (NHS) were used to crosslink carboxylic acid with the amino group of the ligands. We examined the design of the nanoplatforms with each individual entity and then the combination of two and three of them. Several methods were used to characterize the nanoparticle surface functionalization and the magnetic properties of these contrast agents were studied using a 1.5 T clinical MRI scanner. The affinity towards integrins was evidenced by surface plasmon resonance and solid-phase receptor-binding assay. Electronic supplementary information (ESI) available: TEM image and size distribution of γFe2O3@CA nanoplatforms, determination of CA number per nanoparticle, dye R123, NH2-PEG-COOH and cRGD derivative coupling, biological stability, SPR analysis - theoretical analyte binding capacity, solid phase binding assay - determination of echistatin Kd. See DOI: 10.1039/c3nr03763k

  5. A Rare Variant Identified Within the GluN2B C-Terminus in a Patient with Autism Affects NMDA Receptor Surface Expression and Spine Density.

    PubMed

    Liu, Shuxi; Zhou, Liang; Yuan, Hongjie; Vieira, Marta; Sanz-Clemente, Antonio; Badger, John D; Lu, Wei; Traynelis, Stephen F; Roche, Katherine W

    2017-04-12

    NMDA receptors (NMDARs) are ionotropic glutamate receptors that are crucial for neuronal development and higher cognitive processes. NMDAR dysfunction is involved in a variety of neurological and psychiatric diseases; however, the mechanistic link between the human pathology and NMDAR dysfunction is poorly understood. Rare missense variants within NMDAR subunits have been identified in numerous patients with mental or neurological disorders. We specifically focused on the GluN2B NMDAR subunit, which is highly expressed in the hippocampus and cortex throughout development. We analyzed several variants located in the GluN2B C terminus and found that three variants in patients with autism (S1415L) or schizophrenia (L1424F and S1452F) (S1413L, L1422F, and S1450F in rodents, respectively) displayed impaired binding to membrane-associated guanylate kinase (MAGUK) proteins. In addition, we observed a deficit in surface expression for GluN2B S1413L. Furthermore, there were fewer dendritic spines in GluN2B S1413L-expressing neurons. Importantly, synaptic NMDAR currents in neurons transfected with GluN2B S1413L in GluN2A/B-deficient mouse brain slices revealed only partial rescue of synaptic current amplitude. Functional properties of GluN2B S1413L in recombinant systems revealed no change in receptor properties, consistent with synaptic defects being the result of reduced trafficking and targeting of GluN2B S1413L to the synapse. Therefore, we find that GluN2B S1413L displays deficits in NMDAR trafficking, synaptic currents, and spine density, raising the possibility that this mutation may contribute to the phenotype in this autism patient. More broadly, our research demonstrates that the targeted study of certain residues in NMDARs based on rare variants identified in patients is a powerful approach to studying receptor function. SIGNIFICANCE STATEMENT We have used a "bedside-to-bench" approach to investigate the functional regulation of NMDA receptors (NMDARs). Using information from deep sequencing of patients with neurological or psychiatric disorders, we investigated missense variants identified in the intracellular C-terminal domain of the GluN2B NMDAR subunit. We found several variants that displayed altered properties. In particular, one variant identified in a patient with autism, human GluN2B S1415L, displayed reduced surface expression and binding to PSD-95. Furthermore expression of GluN2B S1415L (S1413L in mouse) showed a deficit in rescue of synaptic NMDAR currents and fewer dendritic spines, consistent with other reports of spine abnormalities being associated with autism. More broadly, we demonstrate that using patient data is an effective approach to probing the structure/function relationship of NMDARs. Copyright © 2017 the authors 0270-6474/17/374094-10$15.00/0.

  6. Ligand-activated epidermal growth factor receptor (EGFR) signaling governs endocytic trafficking of unliganded receptor monomers by non-canonical phosphorylation.

    PubMed

    Tanaka, Tomohiro; Zhou, Yue; Ozawa, Tatsuhiko; Okizono, Ryuya; Banba, Ayako; Yamamura, Tomohiro; Oga, Eiji; Muraguchi, Atsushi; Sakurai, Hiroaki

    2018-02-16

    The canonical description of transmembrane receptor function is initial binding of ligand, followed by initiation of intracellular signaling and then internalization en route to degradation or recycling to the cell surface. It is known that low concentrations of extracellular ligand lead to a higher proportion of receptor that is recycled and that non-canonical mechanisms of receptor activation, including phosphorylation by the kinase p38, can induce internalization and recycling. However, no connections have been made between these pathways; i.e. it has yet to be established what happens to unbound receptors following stimulation with ligand. Here we demonstrate that a minimal level of activation of epidermal growth factor receptor (EGFR) tyrosine kinase by low levels of ligand is sufficient to fully activate downstream mitogen-activated protein kinase (MAPK) pathways, with most of the remaining unbound EGFR molecules being efficiently phosphorylated at intracellular serine/threonine residues by activated mitogen-activated protein kinase. This non-canonical, p38-mediated phosphorylation of the C-tail of EGFR, near Ser-1015, induces the clathrin-mediated endocytosis of the unliganded EGFR monomers, which occurs slightly later than the canonical endocytosis of ligand-bound EGFR dimers via tyrosine autophosphorylation. EGFR endocytosed via the non-canonical pathway is largely recycled back to the plasma membrane as functional receptors, whereas p38-independent populations are mainly sorted for lysosomal degradation. Moreover, ligand concentrations balance these endocytic trafficking pathways. These results demonstrate that ligand-activated EGFR signaling controls unliganded receptors through feedback phosphorylation, identifying a dual-mode regulation of the endocytic trafficking dynamics of EGFR. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. A versatile nanobody-based toolkit to analyze retrograde transport from the cell surface.

    PubMed

    Buser, Dominik P; Schleicher, Kai D; Prescianotto-Baschong, Cristina; Spiess, Martin

    2018-06-18

    Retrograde transport of membranes and proteins from the cell surface to the Golgi and beyond is essential to maintain homeostasis, compartment identity, and physiological functions. To study retrograde traffic biochemically, by live-cell imaging or by electron microscopy, we engineered functionalized anti-GFP nanobodies (camelid VHH antibody domains) to be bacterially expressed and purified. Tyrosine sulfation consensus sequences were fused to the nanobody for biochemical detection of trans -Golgi arrival, fluorophores for fluorescence microscopy and live imaging, and APEX2 (ascorbate peroxidase 2) for electron microscopy and compartment ablation. These functionalized nanobodies are specifically captured by GFP-modified reporter proteins at the cell surface and transported piggyback to the reporters' homing compartments. As an application of this tool, we have used it to determine the contribution of adaptor protein-1/clathrin in retrograde transport kinetics of the mannose-6-phosphate receptors from endosomes back to the trans -Golgi network. Our experiments establish functionalized nanobodies as a powerful tool to demonstrate and quantify retrograde transport pathways.

  8. Label-free detection of 3-nitro-l-tyrosine with nickel-doped graphene localized surface plasmon resonance biosensor.

    PubMed

    Ng, Siu Pang; Qiu, Guangyu; Ding, Ning; Lu, Xiaoqing; Wu, Chi-Man Lawrence

    2017-03-15

    3-nitro-l-tyrosine (3-NT) is believed to be a biomarker of neurodegenerative diseases and metal doped graphene possess exceptionally high binding energy of 3-NT with metal-nitro chemisorption. Here we report a novel label-free detection scheme of 3-NT via nickel-doped graphene (NDG) as the functionalized receptor on our phase detecting localized surface plasmon resonance (LSPR) biosensor. When compared with reported 3-NT immunoassay with enzyme-linked immunosorbent assay (ELISA), our NDG-LSPR platform offers two advantages i.e. 1) label-free and 2) capture of 3-NT by direct chemisorption. Our limit of detection for 3-NT in PBS was found to be 0.13pg/ml and the linear dynamic range of response was from 0.5pg/ml to 1ng/ml, i.e. four orders of magnitude. The specificity of our NDG receptor to 3-NT was also verified with l-tyrosine of equivalent concentrations in PBS and diluted human serum, for which the NDG receptor shows negligible responses. In addition, the adsorption of 3-NT and l-tyrosine to the NDG receptor were also investigated by atomic force microscopy and further verified by surface enhanced Raman spectroscopy. Therefore, our NDG-LSPR biosensor competes favorably against ELISA and we believe it should be an attractive and economical solution to early diagnostic of 3-NT related disorders for clinical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Endocytosis of G protein-coupled receptors is regulated by clathrin light chain phosphorylation.

    PubMed

    Ferreira, Filipe; Foley, Matthew; Cooke, Alex; Cunningham, Margaret; Smith, Gemma; Woolley, Robert; Henderson, Graeme; Kelly, Eamonn; Mundell, Stuart; Smythe, Elizabeth

    2012-08-07

    Signaling by transmembrane receptors such as G protein-coupled receptors (GPCRs) occurs at the cell surface and throughout the endocytic pathway, and signaling from the cell surface may differ in magnitude and downstream output from intracellular signaling. As a result, the rate at which signaling molecules traverse the endocytic pathway makes a significant contribution to downstream output. Modulation of the core endocytic machinery facilitates differential uptake of individual cargoes. Clathrin-coated pits are a major entry portal where assembled clathrin forms a lattice around invaginating buds that have captured endocytic cargo. Clathrin assembles into triskelia composed of three clathrin heavy chains and associated clathrin light chains (CLCs). Despite the identification of clathrin-coated pits at the cell surface over 30 years ago, the functions of CLCs in endocytosis have been elusive. In this work, we identify a novel role for CLCs in the regulated endocytosis of specific cargoes. Small interfering RNA-mediated knockdown of either CLCa or CLCb inhibits the uptake of GPCRs. Moreover, we demonstrate that phosphorylation of Ser204 in CLCb is required for efficient endocytosis of a subset of GPCRs and identify G protein-coupled receptor kinase 2 (GRK2) as a kinase that can phosphorylate CLCb on Ser204. Overexpression of CLCb(S204A) specifically inhibits the endocytosis of those GPCRs whose endocytosis is GRK2-dependent. Together, these results indicate that CLCb phosphorylation acts as a discriminator for the endocytosis of specific GPCRs. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Surface Oxide Net Charge of a Titanium Alloy ; Modulation of Fibronectin-Activated Attachment and Spreading of Osteogenic Cells

    PubMed Central

    Rapuano, Bruce E.; MacDonald, Daniel E.

    2010-01-01

    In the current study, we have altered the surface oxide properties of a Ti6Al4V alloy using heat treatment or radiofrequency glow discharge (RFGD) in order to evaluate the relationship between the physico-chemical and biological properties of the alloy's surface oxide. The effects of surface pretreatments on the attachment of cells from two osteogenic cell lines (MG63 and MC3T3) and a mesenchymal stem cell line (C3H10T1/2) to fibronectin adsorbed to the alloy were measured. Both heat and RFGD pretreatments produced a several-fold increase in the number of cells that attached to fibronectin adsorbed to the alloy (0.001 and 10 nM FN) for each cell line tested. An antibody (HFN7.1) directed against the central integrin binding domain of fibronectin produced a 65-70% inhibition of cell attachment to fibronectin-coated disks, incdicating that cell attachment to the metal discs was dependent on fibronectin binding to cell integrin receptors. Both treatments also accelerated the cell spreading response manifested by extensive flattening and an increase in mean cellular area. The treatment-induced increases in the cell attachment activity of adsorbed fibronectin were correlated with previously demonstrated increases in Ti6Al4V oxide negative net surface charge at physiological pH produced by both heat and RFGD pretreatments. Since neither treatment increased the adsorption mass of fibronectin, these findings suggest that negatively charged surface oxide functional groups in Ti6Al4V can modulate fibronectin's integrin receptor activity by altering the adsorbed protein's conformation. Our results further suggest that negatively charged functional groups in the surface oxide can play a prominent role in the osseointegration of metallic implant materials. PMID:20884181

  11. Selective redox regulation of cytokine receptor signaling by extracellular thioredoxin-1

    PubMed Central

    Schwertassek, Ulla; Balmer, Yves; Gutscher, Marcus; Weingarten, Lars; Preuss, Marc; Engelhard, Johanna; Winkler, Monique; Dick, Tobias P

    2007-01-01

    The thiol-disulfide oxidoreductase thioredoxin-1 (Trx1) is known to be secreted by leukocytes and to exhibit cytokine-like properties. Extracellular effects of Trx1 require a functional active site, suggesting a redox-based mechanism of action. However, specific cell surface proteins and pathways coupling extracellular Trx1 redox activity to cellular responses have not been identified so far. Using a mechanism-based kinetic trapping technique to identify disulfide exchange interactions on the intact surface of living lymphocytes, we found that Trx1 catalytically interacts with a single principal target protein. This target protein was identified as the tumor necrosis factor receptor superfamily member 8 (TNFRSF8/CD30). We demonstrate that the redox interaction is highly specific for both Trx1 and CD30 and that the redox state of CD30 determines its ability to engage the cognate ligand and transduce signals. Furthermore, we confirm that Trx1 affects CD30-dependent changes in lymphocyte effector function. Thus, we conclude that receptor–ligand signaling interactions can be selectively regulated by an extracellular redox catalyst. PMID:17557078

  12. An alternative approach to depigmentation by soybean extracts via inhibition of the PAR-2 pathway.

    PubMed

    Paine, C; Sharlow, E; Liebel, F; Eisinger, M; Shapiro, S; Seiberg, M

    2001-04-01

    The protease-activated receptor 2, expressed on keratinocytes but not on melanocytes, has been ascribed functional importance in the regulation of pigmentation by phagocytosis of melanosomes. Inhibition of protease-activated receptor 2 activation by synthetic serine protease inhibitors requires keratinocyte-melanocyte contact and results in depigmentation of the dark skinned Yucatan swine, suggesting a new class of depigmenting mechanism and agents. We therefore examined natural agents that could exert their effect via the protease-activated receptor 2 pathway. Here we show that soymilk and the soybean-derived serine protease inhibitors soybean trypsin inhibitor and Bowman-Birk inhibitor inhibit protease-activated receptor 2 cleavage, affect cytoskeletal and cell surface organization, and reduce keratinocyte phagocytosis. The depigmenting activity of these agents and their capability to prevent ultraviolet-induced pigmentation are demonstrated both in vitro and in vivo. These results imply that inhibition of the protease-activated receptor 2 pathway by soymilk may be used as a natural alternative to skin lightening.

  13. A 100K well screen for a muscarinic receptor using the Epic label-free system--a reflection on the benefits of the label-free approach to screening seven-transmembrane receptors.

    PubMed

    Dodgson, K; Gedge, L; Murray, D C; Coldwell, M

    2009-01-01

    Seven-transmembrane receptors (7TMRs) are a family of proteins of great interest as therapeutic targets because of their abundance on the cell surface, diverse effects in modulating cell behavior and success as a key class of drugs. We have evaluated the Epic label-free system for the purpose of identifying antagonists of the muscarinic M3 receptor. We compared the data generated from the label-free technology with data for the same compounds in a calcium flux assay. We have shown that this technology can be used for high throughput screening (HTS) of 7TMRs and as an orthogonal approach to enable rapid evaluation of HTS outputs. A number of compounds have been identified which were not found in a functional HTS measuring the output from a single pathway, which may offer new approaches to inhibiting responses through this receptor.

  14. Sphingosine 1-Phosphate Receptor Modulators in Multiple Sclerosis

    PubMed Central

    Subei, Adnan M.

    2015-01-01

    Sphingosine 1-phosphate (S1P) receptor modulators possess a unique mechanism of action as disease modifying therapy for multiple sclerosis (MS). Subtype 1 S1P receptors are expressed on the surfaces of lymphocytes and are important in regulating egression from lymph nodes. The S1P receptor modulators indirectly antagonize the receptor’s function and sequester lymphocytes in lymph nodes. Fingolimod was the first S1P agent approved in the United States in 2010 for relapsing MS after two phase 3 trials (FREEDOMS and TRANSFORMS) demonstrated potent efficacy, and good safety and tolerability. Post-marketing experience as well as a third phase 3 trial (FREEDOMS II) also showed favorable results. More selective S1P receptor agents: ponesimod (ACT128800), siponimod (BAF312), ozanimod (RPC1063), ceralifimod (ONO-4641), GSK2018682, and MT-1303 are still in relatively early stages of development, but phase 1 and 2 trials showed promising efficacy and safety. However, these observations have yet to be reproduced in phase 3 clinical trials. PMID:26239599

  15. LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis

    PubMed Central

    Zhou, Li; Plattner, Florian; Liu, Mingxia; Parks, John S; Hammer, Robert E; Boucher, Philippe; Tsai, Shirling

    2017-01-01

    Low-density lipoprotein receptor-related protein 1 (LRP1) is a multifunctional cell surface receptor with diverse physiological roles, ranging from cellular uptake of lipoproteins and other cargo by endocytosis to sensor of the extracellular environment and integrator of a wide range of signaling mechanisms. As a chylomicron remnant receptor, LRP1 controls systemic lipid metabolism in concert with the LDL receptor in the liver, whereas in smooth muscle cells (SMC) LRP1 functions as a co-receptor for TGFβ and PDGFRβ in reverse cholesterol transport and the maintenance of vascular wall integrity. Here we used a knockin mouse model to uncover a novel atheroprotective role for LRP1 in macrophages where tyrosine phosphorylation of an NPxY motif in its intracellular domain initiates a signaling cascade along an LRP1/SHC1/PI3K/AKT/PPARγ/LXR axis to regulate and integrate cellular cholesterol homeostasis through the expression of the major cholesterol exporter ABCA1 with apoptotic cell removal and inflammatory responses. PMID:29144234

  16. PD-1 mediates functional exhaustion of activated NK cells in patients with Kaposi sarcoma

    PubMed Central

    Beldi-Ferchiou, Asma; Lambert, Marion; Dogniaux, Stéphanie; Vély, Frédéric; Vivier, Eric; Olive, Daniel; Dupuy, Stéphanie; Levasseur, Frank; Zucman, David; Lebbé, Céleste; Sène, Damien; Hivroz, Claire; Caillat-Zucman, Sophie

    2016-01-01

    Programmed Death-1 (PD-1), an inhibitory receptor expressed by activated lymphocytes, is involved in regulating T- and B-cell responses. PD-1 and its ligands are exploited by a variety of cancers to facilitate tumor escape through PD-1-mediated functional exhaustion of effector T cells. Here, we report that PD-1 is upregulated on Natural Killer (NK) cells from patients with Kaposi sarcoma (KS). PD-1 was expressed in a sub-population of activated, mature CD56dimCD16pos NK cells with otherwise normal expression of NK surface receptors. PD-1pos NK cells from KS patients were hyporesponsive ex vivo following direct triggering of NKp30, NKp46 or CD16 activating receptors, or short stimulation with NK cell targets. PD-1pos NK cells failed to degranulate and release IFNγ, but exogenous IL-2 or IL-15 restored this defect. That PD-1 contributed to NK cell functional impairment and was not simply a marker of dysfunctional NK cells was confirmed in PD-1-transduced NKL cells. In vitro, PD-1 was induced at the surface of healthy control NK cells upon prolonged contact with cells expressing activating ligands, i.e. a condition mimicking persistent stimulation by tumor cells. Thus, PD-1 appears to plays a critical role in mediating NK cell exhaustion. The existence of this negative checkpoint fine-tuning NK activation highlights the possibility that manipulation of the PD-1 pathway may be a strategy for circumventing tumor escape not only from the T cell-, but also the NK-cell mediated immune surveillance. PMID:27662664

  17. Molecular receptors in metal oxide sol-gel materials prepared via molecular imprinting

    DOEpatents

    Sasaki, Darryl Y.; Brinker, C. Jeffrey; Ashley, Carol S.; Daitch, Charles E.; Shea, Kenneth J.; Rush, Daniel J.

    2000-01-01

    A method is provided for molecularly imprinting the surface of a sol-gel material, by forming a solution comprised of a sol-gel material, a solvent, an imprinting molecule, and a functionalizing siloxane monomer of the form Si(OR).sub.3-n X.sub.n, wherein n is an integer between zero and three and X is a functional group capable of reacting with the imprinting molecule, evaporating the solvent, and removing the imprinting molecule to form the molecularly imprinted metal oxide sol-gel material. The use of metal oxide sol-gels allows the material porosity, pore size, density, surface area, hardness, electrostatic charge, polarity, optical density, and surface hydrophobicity to be tailored and be employed as sensors and in catalytic and separations operations.

  18. Beta2-adrenergic receptor homodimers: Role of transmembrane domain 1 and helix 8 in dimerization and cell surface expression.

    PubMed

    Parmar, Vikas K; Grinde, Ellinor; Mazurkiewicz, Joseph E; Herrick-Davis, Katharine

    2017-09-01

    Even though there are hundreds of reports in the published literature supporting the hypothesis that G protein-coupled receptors (GPCR) form and function as dimers this remains a highly controversial area of research and mechanisms governing homodimer formation are poorly understood. Crystal structures revealing homodimers have been reported for many different GPCR. For adrenergic receptors, a potential dimer interface involving transmembrane domain 1 (TMD1) and helix 8 (H8) was identified in crystal structures of the beta 1 -adrenergic (β 1 -AR) and β 2 -AR. The purpose of this study was to investigate a potential role for TMD1 and H8 in dimerization and plasma membrane expression of functional β 2 -AR. Charged residues at the base of TMD1 and in the distal portion of H8 were replaced, singly and in combination, with non-polar residues or residues of opposite charge. Wild type and mutant β 2 -AR, tagged with YFP and expressed in HEK293 cells, were evaluated for plasma membrane expression and function. Homodimer formation was evaluated using bioluminescence resonance energy transfer, bimolecular fluorescence complementation, and fluorescence correlation spectroscopy. Amino acid substitutions at the base of TMD1 and in the distal portion of H8 disrupted homodimer formation and caused receptors to be retained in the endoplasmic reticulum. Mutations in the proximal region of H8 did not disrupt dimerization but did interfere with plasma membrane expression. This study provides biophysical evidence linking a potential TMD1/H8 interface with ER export and the expression of functional β 2 -AR on the plasma membrane. This article is part of a Special Issue entitled: Interactions between membrane receptors in cellular membranes edited by Kalina Hristova. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. DISCOIDIN DOMAIN RECEPTOR TYROSINE KINASES: NEW PLAYERS IN CANCER PROGRESSION

    PubMed Central

    Valiathan, Rajeshwari R.; Marco, Marta; Leitinger, Birgit; Kleer, Celina G.; Fridman, Rafael

    2012-01-01

    Almost all human cancers display dysregulated expression and/or function of one or more receptor tyrosine kinases (RTKs). The strong causative association between altered RTK function and cancer progression has translated into novel therapeutic strategies that target these cell surface receptors in the treatment of cancer. Yet, the full spectrum of RTKs that may alter the oncogenic process is not completely understood. Accumulating evidence suggests that a unique set of RTKs known as the Discoidin Domain Receptors (DDRs) play a role in cancer progression by regulating the interactions of tumor cells with their surrounding collagen matrix. The DDRs are the only RTKs that specifically bind to, and are activated by collagen. Hence, the DDRs are part of the signaling networks that translate information from the extracellular matrix thereby acting as key regulators of cell-matrix interactions. Under physiological conditions, DDRs control cell and tissue homeostasis by acting as collagen sensors, transducing signals that regulate cell polarity, tissue morphogenesis, and cell differentiation. In cancer, DDRs are hijacked by tumor cells to disrupt normal cell-matrix communication and initiate pro-migratory and pro-invasive programs. Importantly, several cancer types exhibit DDR mutations, which are thought to alter receptor function and contribute to cancer progression. Other evidence suggests that the actions of DDRs in cancer are complex, either promoting or suppressing tumor cell behavior in a DDR type/isoform specific and context dependent manner. Thus, there is still a considerable gap in our knowledge of DDR actions in cancer tissues. This review summarizes the current knowledge on DDR expression and function in cancer and discusses the potential implications of DDRs in cancer biology. It is hoped that this effort will encourage more research into these poorly understood but unique RTKs, which have the potential of becoming novel therapeutics targets in cancer. PMID:22366781

  20. DYRK1A-mediated phosphorylation of GluN2A at Ser(1048) regulates the surface expression and channel activity of GluN1/GluN2A receptors.

    PubMed

    Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

    2014-01-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser(1048) of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser(1048) hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser(1048) increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons.

  1. DYRK1A-mediated phosphorylation of GluN2A at Ser1048 regulates the surface expression and channel activity of GluN1/GluN2A receptors

    PubMed Central

    Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M.; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

    2014-01-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser1048 of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser1048 hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser1048 increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons. PMID:25368549

  2. L-type Calcium Channel Blockers Enhance Trafficking and Function of Epilepsy-associated α1(D219N) Subunits of GABA(A) Receptors.

    PubMed

    Han, Dong-Yun; Guan, Bo-Jhih; Wang, Ya-Juan; Hatzoglou, Maria; Mu, Ting-Wei

    2015-09-18

    Gamma-aminobutyric acid type A (GABAA) receptors are the primary inhibitory ion channels in the mammalian central nervous system and play an essential role in regulating inhibition-excitation balance in neural circuits. The α1 subunit harboring the D219N mutation of GABAA receptors was reported to be retained in the endoplasmic reticulum (ER) and traffic inefficiently to the plasma membrane, leading to a loss of function of α1(D219N) subunits and thus idiopathic generalized epilepsy (IGE). We present the use of small molecule proteostasis regulators to enhance the forward trafficking of α1(D219N) subunits to restore their function. We showed that treatment with verapamil (4 μM, 24 h), an L-type calcium channel blocker, substantially increases the α1(D219N) subunit cell surface level in both HEK293 cells and neuronal SH-SY5Y cells and remarkably restores the GABA-induced maximal chloride current in HEK293 cells expressing α1(D219N)β2γ2 receptors to a level that is comparable to wild type receptors. Our drug mechanism study revealed that verapamil treatment promotes the ER to Golgi trafficking of the α1(D219N) subunits post-translationally. To achieve that, verapamil treatment enhances the interaction between the α1(D219N) subunit and β2 subunit and prevents the aggregation of the mutant protein by shifting the protein from the detergent-insoluble fractions to detergent-soluble fractions. By combining (35)S pulse-chase labeling and MG-132 inhibition experiments, we demonstrated that verapamil treatment does not inhibit the ER-associated degradation of the α1(D219N) subunit. In addition, its effect does not involve a dynamin-1 dependent endocytosis. To gain further mechanistic insight, we showed that verapamil increases the interaction between the mutant protein and calnexin and calreticulin, two major lectin chaperones in the ER. Moreover, calnexin binding promotes the forward trafficking of the mutant subunit. Taken together, our data indicate that verapamil treatment enhances the calnexin-assisted forward trafficking and subunit assembly, which leads to substantially enhanced functional surface expression of the mutant receptors. Since verapamil is an FDA-approved drug that crosses blood-brain barrier and has been used as an additional medication for some epilepsies, our findings suggest that verapamil holds great promise to be developed to ameliorate IGE resulting from α1(D219N) subunit trafficking deficiency.

  3. Role of Orai1 and store-operated calcium entry in mouse lacrimal gland signalling and function.

    PubMed

    Xing, Juan; Petranka, John G; Davis, Felicity M; Desai, Pooja N; Putney, James W; Bird, Gary S

    2014-03-01

    Lacrimal glands function to produce an aqueous layer, or tear film, that helps to nourish and protect the ocular surface. Lacrimal glands secrete proteins, electrolytes and water, and loss of gland function can result in tear film disorders such as dry eye syndrome, a widely encountered and debilitating disease in ageing populations. To combat these disorders, understanding the underlying molecular signalling processes that control lacrimal gland function will give insight into corrective therapeutic approaches. Previously, in single lacrimal cells isolated from lacrimal glands, we demonstrated that muscarinic receptor activation stimulates a phospholipase C-coupled signalling cascade involving the inositol trisphosphate-dependent mobilization of intracellular calcium and the subsequent activation of store-operated calcium entry (SOCE). Since intracellular calcium stores are finite and readily exhausted, the SOCE pathway is a critical process for sustaining and maintaining receptor-activated signalling. Recent studies have identified the Orai family proteins as critical components of the SOCE channel activity in a wide variety of cell types. In this study we characterize the role of Orai1 in the function of lacrimal glands using a mouse model in which the gene for the calcium entry channel protein, Orai1, has been deleted. Our data demonstrate that lacrimal acinar cells lacking Orai1 do not exhibit SOCE following activation of the muscarinic receptor. In comparison with wild-type and heterozygous littermates, Orai1 knockout mice showed a significant reduction in the stimulated tear production following injection of pilocarpine, a muscarinic receptor agonist. In addition, calcium-dependent, but not calcium-independent exocytotic secretion of peroxidase was eliminated in glands from knockout mice. These studies indicate a critical role for Orai1-mediated SOCE in lacrimal gland signalling and function.

  4. Receptor for advanced glycation end products (RAGE) functions as receptor for specific sulfated glycosaminoglycans, and anti-RAGE antibody or sulfated glycosaminoglycans delivered in vivo inhibit pulmonary metastasis of tumor cells.

    PubMed

    Mizumoto, Shuji; Takahashi, Jun; Sugahara, Kazuyuki

    2012-06-01

    Altered expression of chondroitin sulfate (CS) and heparan sulfate (HS) at the surfaces of tumor cells plays a key role in malignant transformation and tumor metastasis. Previously we demonstrated that a Lewis lung carcinoma (LLC)-derived tumor cell line with high metastatic potential had a higher proportion of E-disaccharide units, GlcUA-GalNAc(4,6-O-disulfate), in CS chains than low metastatic LLC cells and that such CS chains are involved in the metastatic process. The metastasis was markedly inhibited by the pre-administration of CS-E from squid cartilage rich in E units or by preincubation with a phage display antibody specific for CS-E. However, the molecular mechanism of the inhibition remains to be investigated. In this study the receptor molecule for CS chains containing E-disaccharides expressed on LLC cells was revealed to be receptor for advanced glycation end products (RAGE), which is a member of the immunoglobulin superfamily predominantly expressed in the lung. Interestingly, RAGE bound strongly to not only E-disaccharide, but also HS-expressing LLC cells. Furthermore, the colonization of the lungs by LLC cells was effectively inhibited by the blocking of CS or HS chains at the tumor cell surface with an anti-RAGE antibody through intravenous injections in a dose-dependent manner. These results provide the clear evidence that RAGE is at least one of the critical receptors for CS and HS chains expressed at the tumor cell surface and involved in experimental lung metastasis and that CS/HS and RAGE are potential molecular targets in the treatment of pulmonary metastasis.

  5. Monoclonal Antibodies against the MET/HGF Receptor and Its Ligand: Multitask Tools with Applications from Basic Research to Therapy

    PubMed Central

    Prat, Maria; Oltolina, Francesca; Basilico, Cristina

    2014-01-01

    Monoclonal antibodies can be seen as valuable tools for many aspects of basic as well as applied sciences. In the case of MET/HGFR, they allowed the identification of truncated isoforms of the receptor, as well as the dissection of different epitopes, establishing structure–function relationships. Antibodies directed against MET extracellular domain were found to be full or partial receptor agonists or antagonists. The agonists can mimic the effects of the different isoforms of the natural ligand, but with the advantage of being more stable than the latter. Thus, some agonist antibodies promote all the biological responses triggered by MET activation, including motility, proliferation, morphogenesis, and protection from apoptosis, while others can induce only a migratory response. On the other hand, antagonists can inhibit MET-driven biological functions either by competing with the ligand or by removing the receptor from the cell surface. Since MET/HGFR is often over-expressed and/or aberrantly activated in tumors, monoclonal antibodies can be used as probes for MET detection or as “bullets” to target MET-expressing tumor cells, thus pointing to their use in diagnosis and therapy. PMID:28548076

  6. Synergistic inhibition of natural killer cells by the nonsignaling molecule CD94

    PubMed Central

    Cheent, Kuldeep S.; Jamil, Khaleel M.; Cassidy, Sorcha; Liu, Mengya; Mbiribindi, Berenice; Mulder, Arend; Claas, Frans H. J.; Purbhoo, Marco A.; Khakoo, Salim I.

    2013-01-01

    Peptide selectivity is a feature of inhibitory receptors for MHC class I expressed by natural killer (NK) cells. CD94–NKG2A operates in tandem with the polymorphic killer cell Ig-like receptors (KIR) and Ly49 systems to inhibit NK cells. However, the benefits of having two distinct inhibitory receptor–ligand systems are not clear. We show that noninhibitory peptides presented by HLA-E can augment the inhibition of NKG2A+ NK cells mediated by MHC class I signal peptides through the engagement of CD94 without a signaling partner. Thus, CD94 is a peptide-selective NK cell receptor, and NK cells can be regulated by nonsignaling interactions. We also show that KIR+ and NKG2A+ NK cells respond with differing stoichiometries to MHC class I down-regulation. MHC-I–bound peptide functions as a molecular rheostat controlling NK cell function. Selected peptides which in isolation do not inhibit NK cells can have different effects on KIR and NKG2A receptors. Thus, these two inhibitory systems may complement each other by having distinct responses to bound peptide and surface levels of MHC class I. PMID:24082146

  7. Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses

    PubMed Central

    Hendricks, Gabriel L.; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C.; Viswanathan, Karthik; Albers, Leila; Comolli, James C.; Shriver, Zachary; Knipe, David M.; Kurt-Jones, Evelyn A.; Fygenson, Deborah K.; Trevejo, Jose M.

    2016-01-01

    Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as ‘molecular sinks’ and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. PMID:25637710

  8. Chaperokine-induced signal transduction pathways.

    PubMed

    Asea, Alexzander

    2003-01-01

    A turning point in understanding the function of heat shock proteins (HSP) on components of the immune system has now begun. From their original description as intracellular molecular chaperones of naïve, aberrantly folded or mutated proteins and primarily involved in cytoprotection in response to stressful stimuli, in recent years, new functions of HSP have been revealed. Strong evidence now exists demonstrating that the seventy-kDa heat shock protein (HSP70) exits mammalian cells not only following necrotic cell death but also by a process involving its active release in response to stresses including cytokines, acute psychological stress and exercise. The released extracellular HSP70 interacts with cells of the immune system and exerts immunoregulatory effects--known as the chaperokine activity of HSP70. The chaperokine activity of HSP70 is mediated in part by utilizing surface receptors for both Toll-like receptor-2 (TLR2; receptor for Gram-positive bacteria) and TLR4 (receptor for Gram-negative bacteria) in a CD14-dependent fashion. These findings suggest an important role for heat shock proteins in host protection against pathogenic infection. This review will briefly discuss chaperokine-induced signaling and its relevance to infection and exercise.

  9. Chaperokine-Induced Signal Transduction Pathways

    PubMed Central

    Asea, Alexzander

    2007-01-01

    A turning point in understanding the function of heat shock proteins (HSP) on components of the immune system has now begun. From their original description as intracellular molecular chaperones of naïve, aberrantly folded or mutated proteins and primarily involved in cytoprotection in response to stressful stimuli, in recent years, new functions of HSP have been revealed. Strong evidence now exists demonstrating that the seventy-kDa heat shock protein (HSP70) exits mammalian cells not only following necrotic cell death but also by a process involving its active release in response to stresses including cytokines, acute psychological stress and exercise. The released extracellular HSP70 interacts with cells of the immune system and exerts immunoregulatory effects - known as the chaperokine activity of HSP70. The chaperokine activity of HSP70 is mediated in part by utilizing surface receptors for both Toll-like receptor-2 (TLR2; receptor for Gram-positive bacteria) and TLR4 (receptor for Gram-negative bacteria) in a CD14-dependent fashion. These findings suggest an important role for heat shock proteins in host protection against pathogenic infection. This review will briefly discuss chaperokine-induced signaling and its relevance to infection and exercise. PMID:14686091

  10. Carbodiimide versus click chemistry for nanoparticle surface functionalization: a comparative study for the elaboration of multimodal superparamagnetic nanoparticles targeting αvβ3 integrins.

    PubMed

    Bolley, Julie; Guenin, Erwann; Lievre, Nicole; Lecouvey, Marc; Soussan, Michael; Lalatonne, Yoann; Motte, Laurence

    2013-11-26

    Superparamagnetic fluorescent nanoparticles targeting αvβ3 integrins were elaborated using two methodologies: carbodiimide coupling and click chemistries (CuACC and thiol-yne). The nanoparticles are first functionalized with hydroxymethylenebisphonates (HMBP) bearing carboxylic acid or alkyne functions. Then, a large number of these reactives functions were used for the covalent coupling of dyes, poly(ethylene glycol) (PEG), and cyclic RGD. Several methods were used to characterize the nanoparticle surface functionalization, and the magnetic properties of these contrast agents were studied using a 1.5 T clinical MRI. The affinity toward integrins was evidenced by solid-phase receptor-binding assay. In addition to their chemoselective natures, click reactions were shown to be far more efficient than the carbodiimide coupling. The grafting increase was shown to enhance targeting affinity to integrin without imparing MRI and fluorescent properties.

  11. Effects of inhibitors of N-linked oligosaccharide processing on the biosynthesis and function of insulin and insulin-like growth factor-I receptors.

    PubMed

    Duronio, V; Jacobs, S; Romero, P A; Herscovics, A

    1988-04-15

    We have used specific inhibitors of oligosaccharide processing enzymes as probes to determine the involvement of oligosaccharide residues in the biosynthesis and function of insulin and insulin-like growth factor-I receptors. In a previous study (Duronio, V., Jacobs, S., and Cuatrecasas, P. (1986) J. Biol. Chem. 261, 970-975) swainsonine was used to inhibit mannosidase II, resulting in the production of receptors containing only hybrid-type oligosaccharides. These receptors had a slightly lower molecular weight and were much more sensitive to endoglycosidase H, but otherwise behaved identically to normal receptors. In this study, we used two compounds that inhibit oligosaccharide processing at earlier steps: (i) N-methyl-1-deoxynojirimycin (MedJN), which inhibits glucosidases I and II and yields glucosylated, high mannose oligosaccharides, and (ii) manno-1-deoxynojirimycin (MandJN), which inhibits mannosidase I and yields high mannose oligosaccharides. In the presence of MandJN, HepG2 cells synthesized receptors of lower molecular weight, which were cleaved into alpha and beta subunits and were able to bind hormone and autophosphorylate. These receptors were as sensitive to endoglycosidase H as receptors made in the presence of swainsonine. In the presence of MedJN, receptors of only slightly lower molecular weight than normal were synthesized and were shown to contain some glucosylated high mannose oligosaccharides. These receptors were able to bind hormone and retained hormone-sensitive autophosphorylation activity. In both cases, the incompletely processed receptors could be detected at the cell surface by cross-linking of iodinated hormone and susceptibility to trypsin digestion, although less receptor was present in cells treated with MedJN. Studies of receptor synthesis using pulse-chase labeling showed that the receptor precursors synthesized in the presence of MedJN were cleaved into alpha and beta subunits at a slower rate than normal receptors or those made in the presence of MandJN. Inhibition of oligosaccharide processing had no effect on the association of the receptor subunits into disulfide-linked oligomeric complexes.

  12. Ligand-targeted theranostic nanomedicines against cancer.

    PubMed

    Yao, Virginia J; D'Angelo, Sara; Butler, Kimberly S; Theron, Christophe; Smith, Tracey L; Marchiò, Serena; Gelovani, Juri G; Sidman, Richard L; Dobroff, Andrey S; Brinker, C Jeffrey; Bradbury, Andrew R M; Arap, Wadih; Pasqualini, Renata

    2016-10-28

    Nanomedicines have significant potential for cancer treatment. Although the majority of nanomedicines currently tested in clinical trials utilize simple, biocompatible liposome-based nanocarriers, their widespread use is limited by non-specificity and low target site concentration and thus, do not provide a substantial clinical advantage over conventional, systemic chemotherapy. In the past 20years, we have identified specific receptors expressed on the surfaces of tumor endothelial and perivascular cells, tumor cells, the extracellular matrix and stromal cells using combinatorial peptide libraries displayed on bacteriophage. These studies corroborate the notion that unique receptor proteins such as IL-11Rα, GRP78, EphA5, among others, are differentially overexpressed in tumors and present opportunities to deliver tumor-specific therapeutic drugs. By using peptides that bind to tumor-specific cell-surface receptors, therapeutic agents such as apoptotic peptides, suicide genes, imaging dyes or chemotherapeutics can be precisely and systemically delivered to reduce tumor growth in vivo, without harming healthy cells. Given the clinical applicability of peptide-based therapeutics, targeted delivery of nanocarriers loaded with therapeutic cargos seems plausible. We propose a modular design of a functionalized protocell in which a tumor-targeting moiety, such as a peptide or recombinant human antibody single chain variable fragment (scFv), is conjugated to a lipid bilayer surrounding a silica-based nanocarrier core containing a protected therapeutic cargo. The functionalized protocell can be tailored to a specific cancer subtype and treatment regimen by exchanging the tumor-targeting moiety and/or therapeutic cargo or used in combination to create unique, theranostic agents. In this review, we summarize the identification of tumor-specific receptors through combinatorial phage display technology and the use of antibody display selection to identify recombinant human scFvs against these tumor-specific receptors. We compare the characteristics of different types of simple and complex nanocarriers, and discuss potential types of therapeutic cargos and conjugation strategies. The modular design of functionalized protocells may improve the efficacy and safety of nanomedicines for future cancer therapy. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Mesoporous silica nanoparticles functionalized with fluorescent and MRI reporters for the visualization of murine tumors overexpressing αvβ3 receptors

    NASA Astrophysics Data System (ADS)

    Hu, He; Arena, Francesca; Gianolio, Eliana; Boffa, Cinzia; di Gregorio, Enza; Stefania, Rachele; Orio, Laura; Baroni, Simona; Aime, Silvio

    2016-03-01

    A novel fluorescein/Gd-DOTAGA containing nanoprobe for the visualization of tumors by optical and Magnetic Resonance Imaging (MRI) is reported herein. It is based on the functionalization of the surface of small mesoporous silica nanoparticles (MSNs) (~30 nm) with the arginine-glycine-aspartic (RGD) moieties, which are known to target αvβ3 integrin receptors overexpressed in several tumor cells. The obtained nanoprobe (Gd-MSNs-RGD) displays good stability, tolerability and high relaxivity (37.6 mM-1 s-1 at 21.5 MHz). After a preliminary evaluation of their cytotoxicity and targeting capability toward U87MG cells by in vitro fluorescence and MR imaging, the nanoprobes were tested in vivo by T1-weighted MR imaging of xenografted murine tumor models. The obtained results demonstrated that the Gd-MSNs-RGD nanoprobes are good reporters both in vitro and in vivo for the MR-visualization of tumor cells overexpressing αvβ3 integrin receptors.A novel fluorescein/Gd-DOTAGA containing nanoprobe for the visualization of tumors by optical and Magnetic Resonance Imaging (MRI) is reported herein. It is based on the functionalization of the surface of small mesoporous silica nanoparticles (MSNs) (~30 nm) with the arginine-glycine-aspartic (RGD) moieties, which are known to target αvβ3 integrin receptors overexpressed in several tumor cells. The obtained nanoprobe (Gd-MSNs-RGD) displays good stability, tolerability and high relaxivity (37.6 mM-1 s-1 at 21.5 MHz). After a preliminary evaluation of their cytotoxicity and targeting capability toward U87MG cells by in vitro fluorescence and MR imaging, the nanoprobes were tested in vivo by T1-weighted MR imaging of xenografted murine tumor models. The obtained results demonstrated that the Gd-MSNs-RGD nanoprobes are good reporters both in vitro and in vivo for the MR-visualization of tumor cells overexpressing αvβ3 integrin receptors. Electronic supplementary information (ESI) available: Absorption and emission spectra, energy dispersive X-ray analysis (EDXA) and XPS spectra, TGA, zeta-potential and the molecular structures of the Gd-complexes. See DOI: 10.1039/c5nr08878j

  14. UBXD4, a UBX-containing protein, regulates the cell surface number and stability of alpha3-containing nicotinic acetylcholine receptors.

    PubMed

    Rezvani, Khosrow; Teng, Yanfen; Pan, Yaping; Dani, John A; Lindstrom, Jon; García Gras, Eduardo A; McIntosh, J Michael; De Biasi, Mariella

    2009-05-27

    Adaptor proteins are likely to modulate spatially and temporally the trafficking of a number of membrane proteins, including neuronal nicotinic acetylcholine receptors (nAChRs). A yeast two-hybrid screen identified a novel UBX-containing protein, UBXD4, as one of the cytosolic proteins that interact directly with the alpha3 and alpha4 nAChR subunits. The function of UBX-containing proteins is largely unknown. Immunoprecipitation and confocal microscopy confirmed the interaction of UBXD4 with alpha3-containing nAChRs (alpha3* nAChRs) expressed in HEK293 cells, PC12 cells, and rat cortical neurons. Overexpression of UBXD4 in differentiated PC12 cells (dPC12) increased nAChR cell surface expression, especially that of the alpha3beta2 subtype. These findings were corroborated by electrophysiology, immunofluorescent staining, and biotinylation of surface receptors. Silencing of UBXD4 led to a significant reduction of alpha3* nAChRs in rat cortical neurons and dPC12 cells. Biochemical and immunofluorescence studies of endogenous UBXD4 showed that the protein is located in both the ER and cis-Golgi compartments. Our investigations also showed that the alpha3 subunit is ubiquitinated and that UBXD4 can interfere with its ubiquitination and consequent degradation by the proteasome. Our data suggest that UBXD4 modulates the distribution of alpha3* nAChRs between specialized intracellular compartments and the plasma membrane. This effect is achieved by controlling the stability of the alpha3 subunit and, consequently, the number of receptors at the cell surface.

  15. UBXD4, a UBX containing protein, regulates the cell surface number and the stability of α3-containing nicotinic acetylcholine receptors

    PubMed Central

    Rezvani, Khosrow; Teng, Yanfen; Pan, Yaping; Dani, John A.; Lindstrom, Jon.; Gras, Eduardo A. Garcáa; McIntosh, J. Michael; De Biasi, Mariella.

    2010-01-01

    Adaptor proteins are likely to modulate spatially and temporally the trafficking of a number of membrane proteins, including neuronal nicotinic acetylcholine receptors (nAChRs). A yeast two-hybrid screen identified a novel UBX-containing protein, UBXD4, as one of the cytosolic proteins that interact directly with the α3 and α4 nAChR subunits. The function of UBX-containing proteins is largely unknown. Immunoprecipitation and confocal microscopy confirmed the interaction of UBXD4 with α3-containing nAChRs (α3* nAChRs) expressed in HEK293 cells, PC12 cells and rat cortical neurons. Overexpression of UBXD4 in differentiated PC12 cells (dPC12) increased nAChR cell surface expression, especially that of the α3β2 subtype. These findings were corroborated by electrophysiology, immunofluorescent staining and biotinylation of surface receptors. Silencing of UBXD4 led to a significant reduction of α3* nAChRs in rat cortical neurons and dPC12 cells. Biochemical and immunofluorescence studies of endogenous UBXD4 showed that the protein is located in both the ER and cis-Golgi compartments. Our investigations also showed that the α3 subunit is ubiquitinated and that UBXD4 can interfere with its ubiquitination and consequent degradation by the proteasome. Our data suggest that UBXD4 modulates the distribution of α3* nAChRs between specialized intracellular compartments and the plasma membrane. This effect is achieved by controlling the stability of the α3 subunit and, consequently, the number of receptors at the cell surface. PMID:19474315

  16. Oxygen Modulates Human Decidual Natural Killer Cell Surface Receptor Expression and Interactions with Trophoblasts1

    PubMed Central

    Wallace, Alison E.; Goulwara, Sonu S.; Whitley, Guy S.; Cartwright, Judith E.

    2014-01-01

    Decidual natural killer (dNK) cells have been shown to both promote and inhibit trophoblast behavior important for decidual remodeling in pregnancy and have a distinct phenotype compared to peripheral blood NK cells. We investigated whether different levels of oxygen tension, mimicking the physiological conditions of the decidua in early pregnancy, altered cell surface receptor expression and activity of dNK cells and their interactions with trophoblast. dNK cells were isolated from terminated first-trimester pregnancies and cultured in oxygen tensions of 3%, 10%, and 21% for 24 h. Cell surface receptor expression was examined by flow cytometry, and the effects of secreted factors in conditioned medium (CM) on the trophoblast cell line SGHPL-4 were assessed in vitro. SGHPL-4 cells treated with dNK cell CM incubated in oxygen tensions of 10% were significantly more invasive (P < 0.05) and formed endothelial-like networks to a greater extent (P < 0.05) than SGHPL-4 cells treated with dNK cell CM incubated in oxygen tensions of 3% or 21%. After 24 h, a lower percentage of dNK cells expressed CD56 at 21% oxygen (P < 0.05), and an increased percentage of dNK cells expressed NKG2D at 10% oxygen (P < 0.05) compared to other oxygen tensions, with large patient variation. This study demonstrates dNK cell phenotype and secreted factors are modulated by oxygen tension, which induces changes in trophoblast invasion and endovascular-like differentiation. Alterations in dNK cell surface receptor expression and secreted factors at different oxygen tensions may represent regulation of function within the decidua during the first trimester of pregnancy. PMID:25232021

  17. Expression of full-length HER2 protein in Sf9 insect cells and its presentation on the surface of budded virus-like particles.

    PubMed

    Nika, Lisa; Wallner, Jakob; Palmberger, Dieter; Koczka, Krisztina; Vorauer-Uhl, Karola; Grabherr, Reingard

    2017-08-01

    Biomarkers of cancer are often glycosylated membrane receptor proteins present on the cellular surface. In order to develop new antibodies for cancer diagnostics or treatment, it is a main pre-requisite that these target proteins are available in a native conformation. However, membrane receptor proteins are notoriously difficult to produce due to their hydrophobic nature and complex architecture. Here, we used the baculovirus-insect cell expression system to produce budded virus-like particles (VLPs) as the scaffold for the presentation of complex membrane proteins. Since the human epidermal growth factor receptor 2 (HER2) is known to be overexpressed in a number of cancers it was chosen as model for a tumor antigen. VLPs displaying full-length HER2 on the surface were produced in Spodoptera frugiperda 9 (Sf9) insect cells and purified by sucrose gradient ultracentrifugation. The number of secreted particles was quantified by nanoparticle tracking analysis. To confirm the presence of HER2 protein on the surface, VLPs were labeled with gold-conjugated antibodies and analyzed by transmission electron microscopy. Functionality of displayed HER2 was investigated by ELISA and a newly established biolayer interferometry based technique. Detection was accomplished using the specific monoclonal antibody Herceptin and filamentous phages displaying a single-chain variable fragment of an anti-HER2 antibody. Significant stronger binding of Herceptin and anti-HER2 phages to HER2-displaying VLPs as compared to control VLPs was demonstrated. Thus, we suggest that Sf9 insect cells are highly feasible for the fast and easy production of various budded VLPs that serve as a platform for full-length membrane receptor presentation. Copyright © 2017. Published by Elsevier Inc.

  18. Disturbances of Ligand Potency and Enhanced Degradation of the Human Glycine Receptor at Affected Positions G160 and T162 Originally Identified in Patients Suffering from Hyperekplexia

    PubMed Central

    Atak, Sinem; Langlhofer, Georg; Schaefer, Natascha; Kessler, Denise; Meiselbach, Heike; Delto, Carolyn; Schindelin, Hermann; Villmann, Carmen

    2015-01-01

    Ligand-binding of Cys-loop receptors is determined by N-terminal extracellular loop structures from the plus as well as from the minus side of two adjacent subunits in the pentameric receptor complex. An aromatic residue in loop B of the glycine receptor (GlyR) undergoes direct interaction with the incoming ligand via a cation-π interaction. Recently, we showed that mutated residues in loop B identified from human patients suffering from hyperekplexia disturb ligand-binding. Here, we exchanged the affected human residues by amino acids found in related members of the Cys-loop receptor family to determine the effects of side chain volume for ion channel properties. GlyR variants were characterized in vitro following transfection into cell lines in order to analyze protein expression, trafficking, degradation and ion channel function. GlyR α1 G160 mutations significantly decrease glycine potency arguing for a positional effect on neighboring aromatic residues and consequently glycine-binding within the ligand-binding pocket. Disturbed glycinergic inhibition due to T162 α1 mutations is an additive effect of affected biogenesis and structural changes within the ligand-binding site. Protein trafficking from the ER toward the ER-Golgi intermediate compartment, the secretory Golgi pathways and finally the cell surface is largely diminished, but still sufficient to deliver ion channels that are functional at least at high glycine concentrations. The majority of T162 mutant protein accumulates in the ER and is delivered to ER-associated proteasomal degradation. Hence, G160 is an important determinant during glycine binding. In contrast, T162 affects primarily receptor biogenesis whereas exchanges in functionality are secondary effects thereof. PMID:26733802

  19. Structure and Mutagenesis of the Parainfluenza Virus 5 Hemagglutinin-Neuraminidase Stalk Domain Reveals a Four-Helix Bundle and the Role of the Stalk in Fusion Promotion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bose, Sayantan; Welch, Brett D.; Kors, Christopher A.

    2014-10-02

    Paramyxovirus entry into cells requires the fusion protein (F) and a receptor binding protein (hemagglutinin-neuraminidase [HN], H, or G). The multifunctional HN protein of some paramyxoviruses, besides functioning as the receptor (sialic acid) binding protein (hemagglutinin activity) and the receptor-destroying protein (neuraminidase activity), enhances F activity, presumably by lowering the activation energy required for F to mediate fusion of viral and cellular membranes. Before or upon receptor binding by the HN globular head, F is believed to interact with the HN stalk. Unfortunately, until recently none of the receptor binding protein crystal structures have shown electron density for the stalkmore » domain. Parainfluenza virus 5 (PIV5) HN exists as a noncovalent dimer-of-dimers on the surface of cells, linked by a single disulfide bond in the stalk. Here we present the crystal structure of the PIV5-HN stalk domain at a resolution of 2.65 {angstrom}, revealing a four-helix bundle (4HB) with an upper (N-terminal) straight region and a lower (C-terminal) supercoiled part. The hydrophobic core residues are a mix of an 11-mer repeat and a 3- to 4-heptad repeat. To functionally characterize the role of the HN stalk in F interactions and fusion, we designed mutants along the PIV5-HN stalk that are N-glycosylated to physically disrupt F-HN interactions. By extensive study of receptor binding, neuraminidase activity, oligomerization, and fusion-promoting functions of the mutant proteins, we found a correlation between the position of the N-glycosylation mutants on the stalk structure and their neuraminidase activities as well as their abilities to promote fusion.« less

  20. Structure and Mutagenesis of the Parainfluenza Virus 5 Hemagglutinin-Neuraminidase Stalk Domain Reveals a Four-Helix Bundle and the Role of the Stalk in Fusion Promotion▿

    PubMed Central

    Bose, Sayantan; Welch, Brett D.; Kors, Christopher A.; Yuan, Ping; Jardetzky, Theodore S.; Lamb, Robert A.

    2011-01-01

    Paramyxovirus entry into cells requires the fusion protein (F) and a receptor binding protein (hemagglutinin-neuraminidase [HN], H, or G). The multifunctional HN protein of some paramyxoviruses, besides functioning as the receptor (sialic acid) binding protein (hemagglutinin activity) and the receptor-destroying protein (neuraminidase activity), enhances F activity, presumably by lowering the activation energy required for F to mediate fusion of viral and cellular membranes. Before or upon receptor binding by the HN globular head, F is believed to interact with the HN stalk. Unfortunately, until recently none of the receptor binding protein crystal structures have shown electron density for the stalk domain. Parainfluenza virus 5 (PIV5) HN exists as a noncovalent dimer-of-dimers on the surface of cells, linked by a single disulfide bond in the stalk. Here we present the crystal structure of the PIV5-HN stalk domain at a resolution of 2.65 Å, revealing a four-helix bundle (4HB) with an upper (N-terminal) straight region and a lower (C-terminal) supercoiled part. The hydrophobic core residues are a mix of an 11-mer repeat and a 3- to 4-heptad repeat. To functionally characterize the role of the HN stalk in F interactions and fusion, we designed mutants along the PIV5-HN stalk that are N-glycosylated to physically disrupt F-HN interactions. By extensive study of receptor binding, neuraminidase activity, oligomerization, and fusion-promoting functions of the mutant proteins, we found a correlation between the position of the N-glycosylation mutants on the stalk structure and their neuraminidase activities as well as their abilities to promote fusion. PMID:21994464

  1. Chemical Functionalization of Plasmonic Surface Biosensors: A Tutorial Review on Issues, Strategies, and Costs

    PubMed Central

    2017-01-01

    In an ideal plasmonic surface sensor, the bioactive area, where analytes are recognized by specific biomolecules, is surrounded by an area that is generally composed of a different material. The latter, often the surface of the supporting chip, is generally hard to be selectively functionalized, with respect to the active area. As a result, cross talks between the active area and the surrounding one may occur. In designing a plasmonic sensor, various issues must be addressed: the specificity of analyte recognition, the orientation of the immobilized biomolecule that acts as the analyte receptor, and the selectivity of surface coverage. The objective of this tutorial review is to introduce the main rational tools required for a correct and complete approach to chemically functionalize plasmonic surface biosensors. After a short introduction, the review discusses, in detail, the most common strategies for achieving effective surface functionalization. The most important issues, such as the orientation of active molecules and spatial and chemical selectivity, are considered. A list of well-defined protocols is suggested for the most common practical situations. Importantly, for the reported protocols, we also present direct comparisons in term of costs, labor demand, and risk vs benefit balance. In addition, a survey of the most used characterization techniques necessary to validate the chemical protocols is reported. PMID:28796479

  2. Crystal structure of arrestin-3 reveals the basis of the difference in receptor binding between two non-visual subtypes

    PubMed Central

    Zhan, Xuanzhi; Gimenez, Luis E.; Gurevich, Vsevolod V.; Spiller, Benjamin W.

    2011-01-01

    Arrestins are multi-functional proteins that regulate signaling and trafficking of the majority of G protein-coupled receptors (GPCRs), as well as sub-cellular localization and activity of many other signaling proteins. Here we report the first crystal structure of arrestin-3, solved at 3.0Å. Arrestin-3 is an elongated two-domain molecule with the overall fold and key inter-domain interactions that hold free protein in the basal conformation similar to the other subtypes. Arrestin-3 is the least selective member of the family, binding wide variety of GPCRs with high affinity and demonstrating lower preference for active phosphorylated forms of the receptors. In contrast to the other three arrestins, part of the receptor-binding surface in the arrestin-3 C-domain does not form a contiguous β-sheet, consistent with increased flexibility. By swapping the corresponding elements between arrestin-2 and -3 we show that the presence of this loose structure correlates with reduced arrestin selectivity for activated receptor, consistent with a conformational change in this β-sheet upon receptor binding. PMID:21215759

  3. Sch proteins are localized on endoplasmic reticulum membranes and are redistributed after tyrosine kinase receptor activation.

    PubMed Central

    Lotti, L V; Lanfrancone, L; Migliaccio, E; Zompetta, C; Pelicci, G; Salcini, A E; Falini, B; Pelicci, P G; Torrisi, M R

    1996-01-01

    The intracellular localization of Shc proteins was analyzed by immunofluorescence and immunoelectron microscopy in normal cells and cells expressing the epidermal growth factor receptor or the EGFR/erbB2 chimera. In unstimulated cells, the immunolabeling was localized in the central perinuclear area of the cell and mostly associated with the cytosolic side of rough endoplasmic reticulum membranes. Upon epidermal growth factor treatment and receptor tyrosine kinase activation, the immunolabeling became peripheral and was found to be associated with the cytosolic surface of the plasma membrane and endocytic structures, such as coated pits and endosomes, and with the peripheral cytosol. Receptor activation in cells expressing phosphorylation-defective mutants of Shc and erbB-2 kinase showed that receptor autophosphorylation, but not Shc phosphorylation, is required for redistribution of Shc proteins. The rough endoplasmic reticulum localization of Shc proteins in unstimulated cells and their massive recruitment to the plasma membrane, endocytic structures, and peripheral cytosol following receptor tyrosine kinase activation could account for multiple putative functions of the adaptor protein. PMID:8628261

  4. Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells.

    PubMed

    Gilsohn, Eli; Volk, Talila

    2010-01-01

    The formation of complex tissues during embryonic development is often accompanied by directed cellular migration towards a target tissue. Specific mutual recognition between the migrating cell and its target tissue leads to the arrest of the cell migratory behavior and subsequent contact formation between the two interacting cell types. Recent studies implicated a novel family of surface proteins containing a trans-membrane domain and single leucine-rich repeat (LRR) domain in inter-cellular recognition and the arrest of cell migration. Here, we describe the involvement of a novel LRR surface protein, LRT, in targeting migrating muscles towards their corresponding tendon cells in the Drosophila embryo. LRT is specifically expressed by the target tendon cells and is essential for arresting the migratory behavior of the muscle cells. Additional studies in Drosophila S2 cultured cells suggest that LRT forms a protein complex with the Roundabout (Robo) receptor, essential for guiding muscles towards their tendon partners. Genetic analysis supports a model in which LRT performs its activity non-autonomously through its interaction with the Robo receptors expressed on the muscle surfaces. These results suggest a novel mechanism of intercellular recognition through interactions between LRR family members and Robo receptors.

  5. TAM receptors in apoptotic cell clearance, autoimmunity, and cancer.

    PubMed

    Nguyen, Khanh-Quynh; Tsou, Wen-I; Kotenko, Sergei; Birge, Raymond B

    2013-08-01

    Receptor tyrosine kinases, Tyro-3, Axl and Mer, collectively designated as TAM, are involved in the clearance of apoptotic cells. TAM ligands, Gas6 and Protein S, bind to the surfaces of apoptotic cells, and at the same time, interact directly with TAM expressed on phagocytes, impacting the engulfment and clearance of apoptotic cells and debris. The well-tuned and balanced actions of TAM may affect a variety of human pathologies including autoimmunity, retinal degeneration, and cancer. This article emphasizes some of the emerging findings and mechanistic insights into TAM functions that are clinically relevant and possibly therapeutically targeted.

  6. Spontaneous and natural cytotoxicity receptor-mediated cytotoxicity are effector functions of distinct natural killer subsets in hepatitis C virus-infected chimpanzees.

    PubMed

    Verstrepen, B E; Nieuwenhuis, I G; Mooij, P; Bogers, W M; Boonstra, A; Koopman, G

    2016-07-01

    In humans, CD16 and CD56 are used to identify functionally distinct natural killer (NK) subsets. Due to ubiquitous CD56 expression, this marker cannot be used to distinguish between NK cell subsets in chimpanzees. Therefore, functional analysis of distinct NK subsets during hepatitis C virus (HCV) infection has never been performed in these animals. In the present study an alternative strategy was used to identify four distinct NK subsets on the basis of the expression of CD16 and CD94. The expression of activating and inhibiting surface receptors showed that these subsets resemble human NK subsets. CD107 expression was used to determine degranulation of the different subsets in naive and HCV-infected chimpanzees. In HCV-infected chimpanzees increased spontaneous cytotoxicity was observed in CD94(high/dim) CD16(pos) and CD94(low) CD16(pos) subsets. By contrast, increased natural cytotoxicity receptor (NCR)- mediated degranulation after NKp30 and NKp44 triggering was demonstrated in the CD94(dim) CD16(neg) subset. Our findings suggest that spontaneous and NCR-mediated cytotoxicity are effector functions of distinct NK subsets in HCV-infected chimpanzees. © 2016 British Society for Immunology.

  7. Selective androgen receptor modulators as function promoting therapies.

    PubMed

    Bhasin, Shalender; Jasuja, Ravi

    2009-05-01

    The past decade has witnessed an unprecedented discovery effort to develop selective androgen receptor modulators (SARMs) that improve physical function and bone health without adversely affecting the prostate and cardiovascular outcomes. This review describes the historical evolution, the rationale for SARM development, and the mechanisms of testosterone action and SARM selectivity. Although steroidal SARMs have been around since the 1940s, a number of nonsteroidal SARMs that do not serve as substrates for CYP19 aromatase or 5alpha-reductase, act as full agonists in muscle and bone and as partial agonists in prostate are in development. The differing interactions of steroidal and nonsteroidal compounds with androgen receptor (AR) contribute to their unique pharmacologic actions. Ligand binding induces specific conformational changes in the ligand-binding domain, which could modulate surface topology and protein-protein interactions between AR and coregulators, resulting in tissue-specific gene regulation. Preclinical studies have demonstrated the ability of SARMs to increase muscle and bone mass in preclinical rodent models with varying degree of prostate sparing. Phase I trials of SARMs in humans have reported modest increments in fat-free mass. SARMs hold promise as a new class of function promoting anabolic therapies for a number of clinical indications, including functional limitations associated with aging and chronic disease, frailty, cancer cachexia, and osteoporosis.

  8. Gonadotropin-Releasing Hormone (GnRH) Receptor Structure and GnRH Binding

    PubMed Central

    Flanagan, Colleen A.; Manilall, Ashmeetha

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) regulates reproduction. The human GnRH receptor lacks a cytoplasmic carboxy-terminal tail but has amino acid sequence motifs characteristic of rhodopsin-like, class A, G protein-coupled receptors (GPCRs). This review will consider how recent descriptions of X-ray crystallographic structures of GPCRs in inactive and active conformations may contribute to understanding GnRH receptor structure, mechanism of activation and ligand binding. The structures confirmed that ligands bind to variable extracellular surfaces, whereas the seven membrane-spanning α-helices convey the activation signal to the cytoplasmic receptor surface, which binds and activates heterotrimeric G proteins. Forty non-covalent interactions that bridge topologically equivalent residues in different transmembrane (TM) helices are conserved in class A GPCR structures, regardless of activation state. Conformation-independent interhelical contacts account for a conserved receptor protein structure and their importance in the GnRH receptor structure is supported by decreased expression of receptors with mutations of residues in the network. Many of the GnRH receptor mutations associated with congenital hypogonadotropic hypogonadism, including the Glu2.53(90) Lys mutation, involve amino acids that constitute the conserved network. Half of the ~250 intramolecular interactions in GPCRs differ between inactive and active structures. Conformation-specific interhelical contacts depend on amino acids changing partners during activation. Conserved inactive conformation-specific contacts prevent receptor activation by stabilizing proximity of TM helices 3 and 6 and a closed G protein-binding site. Mutations of GnRH receptor residues involved in these interactions, such as Arg3.50(139) of the DRY/S motif or Tyr7.53(323) of the N/DPxxY motif, increase or decrease receptor expression and efficiency of receptor coupling to G protein signaling, consistent with the native residues stabilizing the inactive GnRH receptor structure. Active conformation-specific interhelical contacts stabilize an open G protein-binding site. Progress in defining the GnRH-binding site has recently slowed, with evidence that Tyr6.58(290) contacts Tyr5 of GnRH, whereas other residues affect recognition of Trp3 and Gly10NH2. The surprisingly consistent observations that GnRH receptor mutations that disrupt GnRH binding have less effect on “conformationally constrained” GnRH peptides may now be explained by crystal structures of agonist-bound peptide receptors. Analysis of GPCR structures provides insight into GnRH receptor function. PMID:29123501

  9. Purification, characterization and anticancer activity of a polysaccharide from Panax ginseng.

    PubMed

    Li, Cong; Cai, Jianping; Geng, Jingshu; Li, Yinghong; Wang, Zhenyu; Li, Rui

    2012-12-01

    In this study, we purified a homogeneous polysaccharide (PGPW1) from the root of Panax ginseng. Its molecular weight was estimated to be 3.5×10(5) Da by high performance liquid chromatography (HPLC) and Gas chromatography (GC) analysis identified that PGPW1 contained Glc, Gal, Man and Ara in the molar ratio of 3.3:1.2:0.5:1.1. Furthermore the antitumor potential of PGPW1 on human bladder T24 cells was evaluated in vitro by MTT, lactate dehydrogenase (LDH), wound scratch and transwell motility assays. PGPW1 dose-dependently displayed potent anti-proliferation and anti-metastatic activities. Moreover the modulating effect of PGPW1 on the binding of (3)H-NMS to M3 muscarinic receptors on the surface of T24 cells was evaluated. In muscarinic receptor binding assay, the attenuated expression of M3 muscarinic receptor on the surface of T24 cells by PGPW1 would contribute to its antitumor functions. All the data indicated the potential of its clinical application for the prevention and treatment of bladder cancer metastasis. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Finding a Vulnerable Spot in HIV’s Armor by Investigating the Structure of HIV | Center for Cancer Research

    Cancer.gov

    The Human Immunodeficiency Virus (HIV) infects and eventually kills CD4-expressing T cells, which are essential for the immune system to function appropriately. Loss of significant numbers of T cells leads to Acquired Immunodeficiency Syndrome (AIDS), a disease that kills over two million people around the world every year. HIV infection depends on two proteins expressed on the virus surface: gp41, which sits in the virus membrane, and gp120, which sits on top of gp41. Three copies, or trimers, of each gp41/gp120 pair make up the envelope glycoprotein, Env. Env coats the virus surface and interacts with its receptor, CD4, and a co-receptor, either CCR5 or CXCR4, on the T cell. Binding to the receptors is thought to cause a structural reorganization of Env, which exposes a fusion peptide that inserts into the T cell membrane and actually forces the virus and host membranes together, initiating an infection. However, the structural details of this process are lacking.

  11. Functions of NKG2D in CD8+ T cells: an opportunity for immunotherapy.

    PubMed

    Prajapati, Kushal; Perez, Cynthia; Rojas, Lourdes Beatriz Plaza; Burke, Brianna; Guevara-Patino, Jose A

    2018-02-05

    Natural killer group 2 member D (NKG2D) is a type II transmembrane receptor. NKG2D is present on NK cells in both mice and humans, whereas it is constitutively expressed on CD8 + T cells in humans but only expressed upon T-cell activation in mice. NKG2D is a promiscuous receptor that recognizes stress-induced surface ligands. In NK cells, NKG2D signaling is sufficient to unleash the killing response; in CD8 + T cells, this requires concurrent activation of the T-cell receptor (TCR). In this case, the function of NKG2D is to authenticate the recognition of a stressed target and enhance TCR signaling. CD28 has been established as an archetype provider of costimulation during T-cell priming. It has become apparent, however, that signals from other costimulatory receptors, such as NKG2D, are required for optimal T-cell function outside the priming phase. This review will focus on the similarities and differences between NKG2D and CD28; less well-described characteristics of NKG2D, such as the potential role of NKG2D in CD8 + T-cell memory formation, cancer immunity and autoimmunity; and the opportunities for targeting NKG2D in immunotherapy.Cellular and Molecular Immunology advance online publication, 5 February 2018; doi:10.1038/cmi.2017.161.

  12. Type III Nrg1 back signaling enhances functional TRPV1 along sensory axons contributing to basal and inflammatory thermal pain sensation.

    PubMed

    Canetta, Sarah E; Luca, Edlira; Pertot, Elyse; Role, Lorna W; Talmage, David A

    2011-01-01

    Type III Nrg1, a member of the Nrg1 family of signaling proteins, is expressed in sensory neurons, where it can signal in a bi-directional manner via interactions with the ErbB family of receptor tyrosine kinases (ErbB RTKs). Type III Nrg1 signaling as a receptor (Type III Nrg1 back signaling) can acutely activate phosphatidylinositol-3-kinase (PtdIns3K) signaling, as well as regulate levels of α7* nicotinic acetylcholine receptors, along sensory axons. Transient receptor potential vanilloid 1 (TRPV1) is a cation-permeable ion channel found in primary sensory neurons that is necessary for the detection of thermal pain and for the development of thermal hypersensitivity to pain under inflammatory conditions. Cell surface expression of TRPV1 can be enhanced by activation of PtdIns3K, making it a potential target for regulation by Type III Nrg1. We now show that Type III Nrg1 signaling in sensory neurons affects functional axonal TRPV1 in a PtdIns3K-dependent manner. Furthermore, mice heterozygous for Type III Nrg1 have specific deficits in their ability to respond to noxious thermal stimuli and to develop capsaicin-induced thermal hypersensitivity to pain. Cumulatively, these results implicate Type III Nrg1 as a novel regulator of TRPV1 and a molecular mediator of nociceptive function.

  13. Human erythrocyte band 3 functions as a receptor for the sialic acid-independent invasion of Plasmodium falciparum. Role of the RhopH3-MSP1 complex.

    PubMed

    Baldwin, Michael; Yamodo, Innocent; Ranjan, Ravi; Li, Xuerong; Mines, Gregory; Marinkovic, Marina; Hanada, Toshihiko; Oh, Steven S; Chishti, Athar H

    2014-12-01

    Plasmodium falciparum takes advantage of two broadly defined alternate invasion pathways when infecting human erythrocytes: one that depends on and the other that is independent of host sialic acid residues on the erythrocyte surface. Within the sialic acid-dependent (SAD) and sialic acid-independent (SAID) invasion pathways, several alternate host receptors are used by P. falciparum based on its particular invasion phenotype. Earlier, we reported that two putative extracellular regions of human erythrocyte band 3 termed 5C and 6A function as host invasion receptor segments binding parasite proteins MSP1 and MSP9 via a SAID mechanism. In this study, we developed two mono-specific anti-peptide chicken IgY antibodies to demonstrate that the 5C and 6A regions of band 3 are exposed on the surface of human erythrocytes. These antibodies inhibited erythrocyte invasion by the P. falciparum 3D7 and 7G8 strains (SAID invasion phenotype), and the blocking effect was enhanced in sialic acid-depleted erythrocytes. In contrast, the IgY antibodies had only a marginal inhibitory effect on FCR3 and Dd2 strains (SAD invasion phenotype). A direct biochemical interaction between erythrocyte band 3 epitopes and parasite RhopH3, identified by the yeast two-hybrid screen, was established. RhopH3 formed a complex with MSP119 and the 5ABC region of band 3, and a recombinant segment of RhopH3 inhibited parasite invasion in human erythrocytes. Together, these findings provide evidence that erythrocyte band 3 functions as a major host invasion receptor in the SAID invasion pathway by assembling a multi-protein complex composed of parasite ligands RhopH3 and MSP1. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Rapid constitutive and ligand-activated endocytic trafficking of P2X receptor.

    PubMed

    Vacca, Fabrizio; Giustizieri, Michela; Ciotti, Maria Teresa; Mercuri, Nicola Biagio; Volonté, Cinzia

    2009-05-01

    P2X receptors mediate a variety of physiological actions, including smooth muscle contraction, neuro-endocrine secretion and synaptic transmission. Among P2X receptors, the P2X(3) subtype is expressed in sensory neurons of dorsal root- and trigeminal-ganglia, where it performs a well-recognized role in sensory and pain transmission. Recent evidence indicates that the strength of P2X(3)-mediated responses is modulated in vivo by altering the number of receptors at the plasma membrane. In the present study, we investigate the trafficking properties of P2X(3) receptor in transfected HEK293 cells and in primary cultures of dorsal root ganglion neurons, finding that P2X(3) receptor undergoes rapid constitutive and cholesterol-dependent endocytosis. We also show that endocytosis is accompanied by preferential targeting of the receptor to late endosomes/lysosomes, with subsequent degradation. Furthermore, we observe that at steady state the receptor localizes predominantly in lamp1-positive intracellular structures, with a minor fraction present at the plasma membrane. Finally, the level of functional receptor expressed on the cell surface is rapidly up-regulated in response to agonist stimulation, which also augments receptor endocytosis. The findings presented in this work underscore a very dynamic trafficking behavior of P2X(3) receptor and disclose a possible mechanism for the rapid modulation of ATP-mediated responses potentially relevant during physiological and pathological conditions.

  15. Functional anergy in a subpopulation of naive B cells from healthy humans that express autoreactive immunoglobulin receptors.

    PubMed

    Duty, J Andrew; Szodoray, Peter; Zheng, Nai-Ying; Koelsch, Kristi A; Zhang, Qingzhao; Swiatkowski, Mike; Mathias, Melissa; Garman, Lori; Helms, Christina; Nakken, Britt; Smith, Kenneth; Farris, A Darise; Wilson, Patrick C

    2009-01-16

    Self-reactive B cells not controlled by receptor editing or clonal deletion may become anergic. We report that fully mature human B cells negative for surface IgM and retaining only IgD are autoreactive and functionally attenuated (referred to as naive IgD(+)IgM(-) B cells [B(ND)]). These B(ND) cells typically make up 2.5% of B cells in the peripheral blood, have antibody variable region genes in germline (unmutated) configuration, and, by all current measures, are fully mature. Analysis of 95 recombinant antibodies expressed from the variable genes of single B(ND) cells demonstrated that they are predominantly autoreactive, binding to HEp-2 cell antigens and DNA. Upon B cell receptor cross-linkage, B(ND) cells have a reduced capacity to mobilize intracellular calcium or phosphorylate tyrosines, demonstrating that they are anergic. However, intense stimulation causes B(ND) cells to fully respond, suggesting that these cells could be the precursors of autoantibody secreting plasma cells in autoimmune diseases such as systemic lupus erythematosus or rheumatoid arthritis. This is the first identification of a distinct mature human B cell subset that is naturally autoreactive and controlled by the tolerizing mechanism of functional anergy.

  16. 1,25-Dihydroxyvitamin D3 up-regulates TLR10 while down-regulating TLR2, 4, and 5 in human monocyte THP-1.

    PubMed

    Verma, Rewa; Jung, Jong Hyeok; Kim, Jae Young

    2014-05-01

    In humans, there are ten Toll-like receptors (TLRs), among which TLR10 is the only orphan receptor whose function is unknown. In this study, we examined the effects of IFN-γ, LPS and 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] on TLR10 expression of human monocyte THP-1 and compared them with those of other surface TLRs such as TLR2, 4 and 5 to differentiate TLR10 from other TLRs. Surface TLR10 expression on THP-1 was significantly enhanced by the addition of IFN-γ or LPS in a fashion similar to that of other TLRs. However, TLR10 expression was differentially regulated by 1,25(OH)2D3. Surface TLR10 expression on THP-1 was significantly enhanced at 24h, reaching approximately two times the control level at 48h after treatment with 100nM 1,25(OH)2D3, while that of TLR2, 4 and 5 decreased gradually in response to treatment over time. 1,25(OH)2D3 at concentrations above 1nM markedly enhanced surface TLR10 expression, but concentrations below 1nM did not. TLR10 mRNA expression was also increased by 1,25(OH)2D3. We next screened for putative binding sites of nuclear vitamin D receptor (VDR) and its counterpart RXR-α within promoter of TLR genes using a transcription factor binding site-prediction program. The results revealed that TLR10 is the only receptor among the tested TLRs that has both a VDR and RXR-α binding site within its proximal promoter. To identify possible involvement of VDR/RXR in the 1,25(OH)2D3-induced TLR10 up-regulation, we engaged the VDR synthesis inhibitor, dexamethasone, and the RXR antagonist, 1,8-dihydroxyanthraquinone. We found that TLR10 up-regulation was significantly blocked with pre-treatment of these inhibitors. These findings indicate that surface TLR10 expression is differentially regulated by 1,25(OH)2D3 and mainly regulated at the transcriptional level via VDR/RXR-α. Overall, results presented herein suggest that TLR10 functions differently from other known surface TLRs under certain circumstances. Further study using primary cells is necessary to confirm the results of the present study. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Synthesis, solubilization, and surface functionalization of highly fluorescent quantum dots for cellular targeting through a small molecule

    NASA Astrophysics Data System (ADS)

    Galloway, Justin F.

    To achieve long-term fluorescence imaging with quantum dots (QDs), a CdSe core/shell must first be synthesized. The synthesis of bright CdSe QDs is not trivial and as a consequence, the role of surfactant in nucleation and growth was investigated. It was found that the type of surfactant used, either phosphonic or fatty acid, played a pivotal role in the size of the CdSe core. The study of surfactant on CdSe synthesis, ultimately led to an electrical passivation method that utilized a short-chained phosphonic acid and highly reactive organometallic precursors to achieve high quantum yield (QY) as has been previously described. The synthesis of QDs using organometallic precursors and a phosphonic acid for passivation resulted in 4 out of 9 batches of QDs achieving QYs greater than 50% and 8 out of 9 batches with QYs greater than 35%. The synthesis of CdSe QDs was done in organic solutions rendering the surface of the particle hydrophobic. To perform cell-targeting experiments, QDs must be transferred to water. The transfer of QDs to water was successfully accomplished by using single acyl chain lipids. A systematic study of different lipid combinations and coatings demonstrated that 20-40 mol% single acyl chained lipids were able to transfer QDs to water resulting in monodispersed, stable QDs without adversely affecting the QY. The advantage to water solubilization using single acyl chain lipids is that the QD have a hydrodynamic radius less than 15 nm, QYs that can exceed 50% and additional surface functionalization can be down using the reactive sites incorporated into the lipid bilayer. QDs that are bright and stable in water were studied for the purpose of targeting G protein-coupled Receptors (GPCR). GPCRs are transmembrane receptors that internalize extracellular cues, and thus mediate signal transduction. The cyclic Adenosine Monophosphate Receptor 1 of the model organism Dictyostelium disodium was the receptor of interest. The Halo protein, a genetically modified dehalogenase, was added to the N-terminus of the cAR1 receptor without resulting in a phenotype. The Halo protein fused to cAR1 was then shown to bind an organic fluorophore by the cleavage of a chloroalkane bond. Though QDs functionalized with a chloroalkane were able to bind free Halo protein, no specific binding to the Halo protein fused to cAR1 was observed.

  18. Identification of a regulatory T cell specific cell surface molecule that mediates suppressive signals and induces Foxp3 expression.

    PubMed

    Wang, Rui; Wan, Qi; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya

    2008-07-16

    Regulatory T (T(reg)) cells control immune activation and maintain tolerance. How T(regs) mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32), which within T cells is specifically expressed in T(regs) activated through the T cell receptor (TCR). Ectopic expression of GARP in human naïve T (T(N)) cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N) cells induced expression of T(reg) master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg) cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.

  19. Mathematical model reveals role of nucleotide signaling in airway surface liquid homeostasis and its dysregulation in cystic fibrosis

    PubMed Central

    Sandefur, Conner I.; Boucher, Richard C.; Elston, Timothy C.

    2017-01-01

    Mucociliary clearance is composed of three components (i.e., mucin secretion, airway surface hydration, and ciliary-activity) which function coordinately to clear inhaled microbes and other foreign particles from airway surfaces. Airway surface hydration is maintained by water fluxes driven predominantly by active chloride and sodium ion transport. The ion channels that mediate electrogenic ion transport are regulated by extracellular purinergic signals that signal through G protein-coupled receptors. These purinoreceptors and the signaling pathways they activate have been identified as possible therapeutic targets for treating lung disease. A systems-level description of airway surface liquid (ASL) homeostasis could accelerate development of such therapies. Accordingly, we developed a mathematical model to describe the dynamic coupling of ion and water transport to extracellular purinergic signaling. We trained our model from steady-state and time-dependent experimental measurements made using normal and cystic fibrosis (CF) cultured human airway epithelium. To reproduce CF conditions, reduced chloride secretion, increased potassium secretion, and increased sodium absorption were required. The model accurately predicted ASL height under basal normal and CF conditions and the collapse of surface hydration due to the accelerated nucleotide metabolism associated with CF exacerbations. Finally, the model predicted a therapeutic strategy to deliver nucleotide receptor agonists to effectively rehydrate the ASL of CF airways. PMID:28808008

  20. Conformational Changes in the Capsid of a Calicivirus upon Interaction with Its Functional Receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ossiboff, Robert J.; Zhou, Yi; Lightfoot, Patrick J.

    2010-07-19

    Nonenveloped viral capsids are metastable structures that undergo conformational changes during virus entry that lead to interactions of the capsid or capsid fragments with the cell membrane. For members of the Caliciviridae, neither the nature of these structural changes in the capsid nor the factor(s) responsible for inducing these changes is known. Feline functional adhesion molecule A (fJAM-A) mediates the attachment and infectious viral entry of feline calicivirus (FCV). Here, we show that the infectivity of some FCV isolates is neutralized following incubation with the soluble receptor at 37 C. We used this property to select mutants resistant to preincubationmore » with the soluble receptor. We isolated and sequenced 24 soluble receptor-resistant (srr) mutants and characterized the growth properties and receptor-binding activities of eight mutants. The location of the mutations within the capsid structure of FCV was mapped using a new 3.6-{angstrom} structure of native FCV. The srr mutations mapped to the surface of the P2 domain were buried at the protruding domain dimer interface or were present in inaccessible regions of the capsid protein. Coupled with data showing that both the parental FCV and the srr mutants underwent increases in hydrophobicity upon incubation with the soluble receptor at 37 C, these findings indicate that FCV likely undergoes conformational change upon interaction with its receptor. Changes in FCV capsid conformation following its interaction with fJAM-A may be important for subsequent interactions of the capsid with cellular membranes, membrane penetration, and genome delivery.« less

  1. Somatostatin displayed on filamentous phage as a receptor-specific agonist

    PubMed Central

    Rousch, Mat; Lutgerink, Jan T; Coote, James; de Bruïne, Adriaan; Arends, Jan-Willem; Hoogenboom, Hennie R

    1998-01-01

    In search of methods to identify bio-active ligands specific for G protein-coupled receptors with seven transmembrane spanning regions, we have developed a filamentous phage-based selection and functional screening method. First, methods for panning peptide phage on cells were established, using the hormone somatostatin as a model. Somatostatin was displayed on the surface of filamentous phage by cloning into phage(mid) vectors and fusion to either pIII or pVIII viral coat proteins. Peptide displaying phage bound to a polyclonal anti-somatostatin serum, and, more importantly, to several somatostatin receptor subtypes (Sst) expressed on transfected CHO-K1 cells, in a pattern which was dependent on the used display method. Binding was competed with somatostatin, with an IC50 in the nanomolar range. The phage were specifically enriched by panning on cells, establishing conditions for cell selections of phage libraries. Binding of somatostatin displaying phage to sst2 on a reporter cell line, in which binding of natural ligand reduces secretion of alkaline phosphatase (via a cyclic AMP responsive element sensitive promoter), proved that the phage particles act as receptor-specific agonists. Less than 100 phage particles per cell were required for this activity, which is approximately 1000 fold less than soluble somatostatin, suggesting that phage binding interferes with normal receptor desensitization and/or recycling. The combination of biopanning of phage libraries on cells with functional screening of phage particles for receptor triggering activity, may be used to select novel, bio-active ligands from phage libraries of random peptides, antibody fragments, or libraries based on the natural receptor ligand. PMID:9776337

  2. The GPRC6A receptor displays constitutive internalization and sorting to the slow recycling pathway.

    PubMed

    Jacobsen, Stine Engesgaard; Ammendrup-Johnsen, Ina; Jansen, Anna Mai; Gether, Ulrik; Madsen, Kenneth Lindegaard; Bräuner-Osborne, Hans

    2017-04-28

    The class C G protein-coupled receptor GPRC6A is a putative nutrient-sensing receptor and represents a possible new drug target in metabolic disorders. However, the specific physiological role of this receptor has yet to be identified, and the mechanisms regulating its activity and cell surface availability also remain enigmatic. In the present study, we investigated the trafficking properties of GPRC6A by use of both a classical antibody feeding internalization assay in which cells were visualized using confocal microscopy and a novel internalization assay that is based on real-time measurements of fluorescence resonance energy transfer. Both assays revealed that GPRC6A predominantly undergoes constitutive internalization, whereas the agonist-induced effects were imperceptible. Moreover, postendocytic sorting was investigated by assessing the co-localization of internalized GPRC6A with selected Rab protein markers. Internalized GPRC6A was mainly co-localized with the early endosome marker Rab5 and the long loop recycling endosome marker Rab11 and to a much lesser extent with the late endosome marker Rab7. This suggests that upon agonist-independent internalization, GPRC6A is recycled via the Rab11-positive slow recycling pathway, which may be responsible for ensuring a persistent pool of GPRC6A receptors at the cell surface despite chronic agonist exposure. Distinct trafficking pathways have been reported for several of the class C receptors, and our results thus substantiate that non-canonical trafficking mechanisms are a common feature for the nutrient-sensing class C family that ensure functional receptors in the cell membrane despite prolonged agonist exposure. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The GPRC6A receptor displays constitutive internalization and sorting to the slow recycling pathway

    PubMed Central

    Jacobsen, Stine Engesgaard; Ammendrup-Johnsen, Ina; Jansen, Anna Mai; Gether, Ulrik; Madsen, Kenneth Lindegaard; Bräuner-Osborne, Hans

    2017-01-01

    The class C G protein-coupled receptor GPRC6A is a putative nutrient-sensing receptor and represents a possible new drug target in metabolic disorders. However, the specific physiological role of this receptor has yet to be identified, and the mechanisms regulating its activity and cell surface availability also remain enigmatic. In the present study, we investigated the trafficking properties of GPRC6A by use of both a classical antibody feeding internalization assay in which cells were visualized using confocal microscopy and a novel internalization assay that is based on real-time measurements of fluorescence resonance energy transfer. Both assays revealed that GPRC6A predominantly undergoes constitutive internalization, whereas the agonist-induced effects were imperceptible. Moreover, postendocytic sorting was investigated by assessing the co-localization of internalized GPRC6A with selected Rab protein markers. Internalized GPRC6A was mainly co-localized with the early endosome marker Rab5 and the long loop recycling endosome marker Rab11 and to a much lesser extent with the late endosome marker Rab7. This suggests that upon agonist-independent internalization, GPRC6A is recycled via the Rab11-positive slow recycling pathway, which may be responsible for ensuring a persistent pool of GPRC6A receptors at the cell surface despite chronic agonist exposure. Distinct trafficking pathways have been reported for several of the class C receptors, and our results thus substantiate that non-canonical trafficking mechanisms are a common feature for the nutrient-sensing class C family that ensure functional receptors in the cell membrane despite prolonged agonist exposure. PMID:28280242

  4. Different mechanisms are involved in the antibody mediated inhibition of ligand binding to the urokinase receptor: a study based on biosensor technology.

    PubMed

    List, K; Høyer-Hansen, G; Rønne, E; Danø, K; Behrendt, N

    1999-01-01

    Certain monoclonal antibodies are capable of inhibiting the biological binding reactions of their target proteins. At the molecular level, this type of effect may be brought about by completely different mechanisms, such as competition for common binding determinants, steric hindrance or interference with conformational properties of the receptor critical for ligand binding. This distinction is central when employing the antibodies as tools in the elucidation of the structure-function relationship of the protein in question. We have studied the effect of monoclonal antibodies against the urokinase plasminogen activator receptor (uPAR), a protein located on the surface of various types of malignant and normal cells which is involved in the direction of proteolytic degradation reactions in the extracellular matrix. We show that surface plasmon resonance/biomolecular interaction analysis (BIA) can be employed as a highly useful tool to characterize the inhibitory mechanism of specific antagonist antibodies. Two inhibitory antibodies against uPAR, mAb R3 and mAb R5, were shown to exhibit competitive and non-competitive inhibition, respectively, of ligand binding to the receptor. The former antibody efficiently blocked the receptor against subsequent ligand binding but was unable to promote the dissociation of a preformed receptor-ligand complex. The latter antibody was capable of binding the preformed complex, forming a transient trimolecular assembly, and promoting the dissociation of the uPA/uPAR complex. The continuous recording of binding and dissociation, obtained in BIA, is central in characterizing these phenomena. The identification of a non-competitive inhibitory mechanism against this receptor reveals the presence of a determinant which influences the binding properties of a remote site in the molecular structure and which could be an important target for a putative synthetic antagonist.

  5. Acute Mechanisms Underlying Antibody Effects in Anti–N-Methyl-D-Aspartate Receptor Encephalitis

    PubMed Central

    Moscato, Emilia H; Peng, Xiaoyu; Jain, Ankit; Parsons, Thomas D; Dalmau, Josep; Balice-Gordon, Rita J

    2014-01-01

    Objective A severe but treatable form of immune-mediated encephalitis is associated with antibodies in serum and cerebrospinal fluid (CSF) against the GluN1 subunit of the N-methyl-D-aspartate receptor (NMDAR). Prolonged exposure of hippocampal neurons to antibodies from patients with anti-NMDAR encephalitis caused a reversible decrease in the synaptic localization and function of NMDARs. However, acute effects of the antibodies, fate of the internalized receptors, type of neurons affected, and whether neurons develop compensatory homeostatic mechanisms were unknown and are the focus of this study. Methods Dissociated hippocampal neuron cultures and rodent brain sections were used for immunocytochemical, physiological, and molecular studies. Results Patient antibodies bind to NMDARs throughout the rodent brain, and decrease NMDAR cluster density in both excitatory and inhibitory hippocampal neurons. They rapidly increase the internalization rate of surface NMDAR clusters, independent of receptor activity. This internalization likely accounts for the observed decrease in NMDAR-mediated currents, as no evidence of direct blockade was detected. Once internalized, antibody-bound NMDARs traffic through both recycling endosomes and lysosomes, similar to pharmacologically induced NMDAR endocytosis. The antibodies are responsible for receptor internalization, as their depletion from CSF abrogates these effects in hippocampal neurons. We find that although anti-NMDAR antibodies do not induce compensatory changes in glutamate receptor gene expression, they cause a decrease in inhibitory synapse density onto excitatory hippocampal neurons. Interpretation Our data support an antibody-mediated mechanism of disease pathogenesis driven by immunoglobulin-induced receptor internalization. Antibody-mediated downregulation of surface NMDARs engages homeostatic synaptic plasticity mechanisms, which may inadvertently contribute to disease progression. Ann Neurol 2014;76:108–119 PMID:24916964

  6. A sorting nexin 17-binding domain within the LRP1 cytoplasmic tail mediates receptor recycling through the basolateral sorting endosome

    PubMed Central

    Farfán, Pamela; Lee, Jiyeon; Larios, Jorge; Sotelo, Pablo; Bu, Guojun; Marzolo, María-Paz

    2013-01-01

    Sorting nexin 17 (SNX17) is an adaptor protein present in EEA1-positive sorting endosomes that promotes the efficient recycling of low-density lipoprotein receptor-related protein 1 (LRP1) to the plasma membrane through recognition of the first NPxY motif in the cytoplasmic tail of this receptor. The interaction of LRP1 with SNX17 also regulates the basolateral recycling of the receptor from the basolateral sorting endosome (BSE). In contrast, megalin, which is apically distributed in polarized epithelial cells and localizes poorly to EEA1-positive sorting endosomes, does not interact with SNX17, despite containing three NPxY motifs, indicating that this motif is not sufficient for receptor recognition by SNX17. Here, we identified a cluster of 32 amino acids within the cytoplasmic domain of LRP1 that is both necessary and sufficient for SNX17 binding. To delineate the function of this SNX17-binding domain, we generated chimeric proteins in which the SNX17-binding domain was inserted into the cytoplasmic tail of megalin. This insertion mediated the binding of megalin to SNX17 and modified the cell surface expression and recycling of megalin in non-polarized cells. However, the polarized localization of chimeric megalin was not modified in polarized MDCK cells. These results provide evidence regarding the molecular and cellular mechanisms underlying the specificity of SNX17-binding receptors and the restricted function of SNX17 in the BSE. PMID:23593972

  7. Multisite Phosphorylation Modulates the T Cell Receptor ζ-Chain Potency but not the Switchlike Response.

    PubMed

    Mukhopadhyay, Himadri; de Wet, Ben; Clemens, Lara; Maini, Philip K; Allard, Jun; van der Merwe, P Anton; Dushek, Omer

    2016-04-26

    Multisite phosphorylation is ubiquitous in cellular signaling and is thought to provide signaling proteins with additional regulatory mechanisms. Indeed, mathematical models have revealed a large number of mechanisms by which multisite phosphorylation can produce switchlike responses. The T cell antigen receptor (TCR) is a multisubunit receptor on the surface of T cells that is a prototypical multisite substrate as it contains 20 sites that are distributed on 10 conserved immunoreceptor tyrosine-based activation motifs (ITAMs). The TCR ζ-chain is a homodimer subunit that contains six ITAMs (12 sites) and exhibits a number of properties that are predicted to be sufficient for a switchlike response. We have used cellular reconstitution to systematically study multisite phosphorylation of the TCR ζ-chain. We find that multisite phosphorylation proceeds by a nonsequential random mechanism, and find no evidence that multiple ITAMs modulate a switchlike response but do find that they alter receptor potency and maximum phosphorylation. Modulation of receptor potency can be explained by a reduction in molecular entropy of the disordered ζ-chain upon phosphorylation. We further find that the tyrosine kinase ZAP-70 increases receptor potency but does not modulate the switchlike response. In contrast to other multisite proteins, where phosphorylations act in strong concert to modulate protein function, we suggest that the multiple ITAMs on the TCR function mainly to amplify subsequent signaling. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Regulation of Memory T Cells by Interleukin-23.

    PubMed

    Li, Yanchun; Wang, Hongbo; Lu, Honghua; Hua, Shucheng

    2016-01-01

    Interleukin-23 (IL-23), a member of the IL-12 family of cytokines, is a heterodimeric cytokine. It is composed of subunits p40 (shared with IL-12) and p19 (an IL-12 p35-related subunit) and is secreted by several types of immune cells, such as natural killer cells and dendritic cells. The IL-23 receptor is composed of the subunit IL-12Rβ1 and the IL-23-specific subunit IL-23R. The binding of IL-23 to its specific cell surface receptor regulates a number of functions, including proliferation and differentiation of cells and secretion of cell factors. Memory T cells are a subset of T cells that secrete numerous important cell factors, and they function in the immune response to infection and diseases like cancer, autoimmune disease and bronchial asthma. IL-23R is expressed on the surface of memory T cells, which suggests that it can specifically regulate memory T cell function. IL-23 has been widely used as a clinical indicator in immune-related diseases and shows potential for use in disease treatment. Here we review the current progress in the study of the role of IL-23 in the regulation of memory T cells. © 2016 S. Karger AG, Basel.

  9. NKp44 expression, phylogenesis and function in non-human primate NK cells

    PubMed Central

    De Maria, Andrea; Ugolotti, Elisabetta; Rutjens, Erik; Mazza, Stefania; Radic, Luana; Faravelli, Alessandro; Koopman, Gerrit; Di Marco, Eddi; Costa, Paola; Ensoli, Barbara; Cafaro, Aurelio; Mingari, Maria Cristina; Moretta, Lorenzo; Heeney, Jonathan

    2009-01-01

    Molecular and functional characterization of the natural cytotoxicity receptor (NCR) NKp44 in species other than Homo sapiens has been elusive, so far. Here, we provide complete phenotypic, molecular and functional characterization for NKp44 triggering receptor on Pan troglodytes NK cells, the closest human relative, and the analysis of NKp44-genomic locus and transcription in Macaca fascicularis. Similar to H. sapiens, NKp44 expression is detectable on chimpanzee NK cells only upon activation. However, basal NKp44 transcription is 5-fold higher in chimpanzees with lower differential increases upon cell activation compared with humans. Upon activation, an overall 12-fold lower NKp44 gene expression is observed in P. troglodytes compared with H. sapiens NK cells with only a slight reduction in NKp44 surface expression. Functional analysis of ‘in vitro’ activated purified NK cells confirms the NKp44 triggering potential compared with other major NCRs. These findings suggest the presence of a post-transcriptional regulation that evolved differently in H. sapiens. Analysis of cynomolgus NKp44-genomic sequence and transcription pattern showed very low levels of transcription with occurrence of out-of-frame transcripts and no surface expression. The present comparative analysis suggests that NKp44-genomic organization appears during macaque speciation, with considerable evolution of its transcriptional and post-transcriptional tuning. Thus, NKp44 may represent an NCR being only recently emerged during speciation, acquiring functional relevance only in non-human primates closest to H. sapiens. PMID:19147838

  10. Enhanced and Selective Antiproliferative Activity of Methotrexate-Functionalized-Nanocapsules to Human Breast Cancer Cells (MCF-7).

    PubMed

    de Oliveira, Catiúscia P; Büttenbender, Sabrina L; Prado, Willian A; Beckenkamp, Aline; Asbahr, Ana C; Buffon, Andréia; Guterres, Silvia S; Pohlmann, Adriana R

    2018-01-04

    Methotrexate is a folic acid antagonist and its incorporation into nanoformulations is a promising strategy to increase the drug antiproliferative effect on human breast cancer cells by overexpressing folate receptors. To evaluate the efficiency and selectivity of nanoformulations containing methotrexate and its diethyl ester derivative, using two mechanisms of drug incorporation (encapsulation and surface functionalization) in the in vitro cellular uptake and antiproliferative activity in non-tumoral immortalized human keratinocytes (HaCaT) and in human breast carcinoma cells (MCF-7). Methotrexate and its diethyl ester derivative were incorporated into multiwall lipid-core nanocapsules with hydrodynamic diameters lower than 160 nm and higher drug incorporation efficiency. The nanoformulations were applied to semiconfluent HaCaT or MCF-7 cells. After 24 h, the nanocapsules were internalized into HaCaT and MCF-7 cells; however, no significant difference was observed between the nanoformulations in HaCaT (low expression of folate receptors), while they showed significantly higher cellular uptakes than the blank-nanoformulation in MCF-7, which was the highest uptakes observed for the drug functionalized-nanocapsules. No antiproliferative activity was observed in HaCaT culture, whereas drug-containing nanoformulations showed antiproliferative activity against MCF-7 cells. The effect was higher for drug-surface functionalized nanocapsules. In conclusion, methotrexate-functionalized-nanocapsules showed enhanced and selective antiproliferative activity to human breast cancer cells (MCF-7) being promising products for further in vivo pre-clinical evaluations.

  11. Coengagement of CD16 and CD94 receptors mediates secretion of chemokines and induces apoptotic death of naive natural killer cells.

    PubMed

    Jewett, Anahid; Cacalano, Nicholas A; Head, Christian; Teruel, Antonia

    2006-04-01

    Down-modulation of CD16 (FcgammaRIII) receptors and loss of natural killer (NK) cell function have been observed in oral cancer patients. However, neither the mechanisms nor the significance of the decrease in CD16 receptors have been fully understood. The cytotoxic activity and survival of NK cells are negatively regulated by antibodies directed against CD16 surface receptor. The addition of anti-CD94 antibody in combination with either F(ab')(2) fragment or intact anti-CD16 antibody to NK cells resulted in significant inhibition of NK cell cytotoxic function and induction of apoptosis in resting human peripheral blood NK cells. Addition of interleukin-2 to anti-CD16 and/or anti-CD94 antibody-treated NK cells significantly inhibited apoptosis and increased the function of NK cells. There was a significant increase in tumor necrosis factor-alpha (TNF-alpha) but not IFN-gamma secretion in NK cells treated either with anti-CD16 antibody alone or in combination with anti-CD94 antibodies. Consequently, the addition of anti-TNF-alpha antibody partially inhibited apoptosis of NK cells mediated by the combination of anti-CD94 and anti-CD16 antibodies. Increase in apoptotic death of NK cells also correlated with an increase in type 2 inflammatory cytokines and in the induction of chemokines. Thus, we conclude that binding of antibodies to CD16 and CD94 NK cell receptors induces death of the NK cells and signals for the release of chemokines.

  12. RAGE is a key cellular target for Aβ-induced perturbation in Alzheimer's disease

    PubMed Central

    Yan, Shirley ShiDu; Chen, Doris; Yan, Shiqian; Guo, Lan; Chen, John Xi

    2013-01-01

    RAGE, a receptor for advanced glycation endproducts, is an immunoglobulin-like cell surface receptor that is often described as a pattern recognition receptor due to the structural heterogeneity of its ligand. RAGE is an important cellular cofactor for amyloid β-peptide (Aβ)-mediated cellular perturbation relevant to the pathogenesis of Alzheimer's disease (AD). The interaction of RAGE with Aβ in neurons, microglia, and vascular cells accelerates and amplifies deleterious effects on neuronal and synaptic function. RAGE-dependent signaling contributes to Aβ-mediated amyloid pathology and cognitive dysfunction observed in the AD mouse model. Blockade of RAGE significantly attenuates neuronal and synaptic injury. In this review, we summarize the role of RAGE in the pathogenesis of AD, specifically in Aβ-induced cellular perturbation. PMID:22202057

  13. The solid state environment orchestrates embryonic development and tissue remodeling

    NASA Technical Reports Server (NTRS)

    Damsky, C. H.; Moursi, A.; Zhou, Y.; Fisher, S. J.; Globus, R. K.

    1997-01-01

    Cell interactions with extracellular matrix and with other cells play critical roles in morphogenesis during development and in tissue homeostasis and remodeling throughout life. Extracellular matrix is information-rich, not only because it is comprised of multifunctional structural ligands for cell surface adhesion receptors, but also because it contains peptide signaling factors, and proteinases and their inhibitors. The functions of these groups of molecules are extensively interrelated. In this review, three primary cell culture models are described that focus on adhesion receptors and their roles in complex aspects of morphogenesis and remodeling: the regulation of proteinase expression by fibronectin and integrins in synovial fibroblasts; the regulation of osteoblast differentiation and survival by fibronectin, and the regulation of trophoblast differentiation and invasion by integrins, cadherins and immunoglobulin family adhesion receptors.

  14. Modulation of tumor necrosis factor (TNF) receptor expression during monocytic differentiation by glucocorticoids.

    PubMed

    Goppelt-Struebe, M; Reiser, C O; Schneider, N; Grell, M

    1996-10-01

    Regulation of tumor necrosis factor receptors by glucocorticoids was investigated during phorbol ester-induced monocytic differentiation. As model system the human monocytic cell lines U937 and THP-1, which express both types of TNF receptors (TNF-R60 and TNF-R80), were differentiated with tetradecanoyl phorbol-13-acetate (TPA, 5 x 10(-9) M) in the presence or absence of dexamethasone (10(-9) - 10(-6) M). Expression of TNF receptors was determined at the mRNA level by Northern blot analysis and at the protein level by FACS analysis. During differentiation, TNF-R60 mRNA was down-regulated, whereas TNF-R80 mRNA levels were increased. Dexamethasone had no effect on TNF-R60 mRNA expression but attenuated TNF-R80 mRNA expression in both cell lines. Cell surface expression of TNF-R60 protein remained essentially unchanged during differentiation of THP-1 cells, whereas a rapid down-regulation of TNF-R80 was observed that was followed by a slow recovery. Surface expression of TNF-R80 was not affected by dexamethasone, whereas TNF-R60 expression was reduced by about 25%. These results indicate differential regulation of the two types of TNF receptors at the mRNA and protein level during monocytic differentiation. Glucocorticoids interfered with mRNA expression of TNF-R80 and protein expression of TNF-R60, but the rather limited effect leaves the question of its functional relevance open. In contrast to other cytokine systems, TNF receptors do not appear to be major targets of glucocorticoid action.

  15. Avr4 promotes Cf-4 receptor-like protein association with the BAK1/SERK3 receptor-like kinase to initiate receptor endocytosis and plant immunity.

    PubMed

    Postma, Jelle; Liebrand, Thomas W H; Bi, Guozhi; Evrard, Alexandre; Bye, Ruby R; Mbengue, Malick; Kuhn, Hannah; Joosten, Matthieu H A J; Robatzek, Silke

    2016-04-01

    The first layer of plant immunity is activated by cell surface receptor-like kinases (RLKs) and proteins (RLPs) that detect infectious pathogens. Constitutive interaction with the SUPPRESSOR OF BIR1 (SOBIR1) RLK contributes to RLP stability and kinase activity. As RLK activation requires transphosphorylation with a second associated RLK, it remains elusive how RLPs initiate downstream signaling. We employed live-cell imaging, gene silencing and coimmunoprecipitation to investigate the requirement of associated kinases for functioning and ligand-induced subcellular trafficking of Cf RLPs that mediate immunity of tomato against Cladosporium fulvum. Our research shows that after elicitation with matching effector ligands Avr4 and Avr9, BRI1-ASSOCIATED KINASE 1/SOMATIC EMBRYOGENESIS RECEPTOR KINASE 3 (BAK1/SERK3) associates with Cf-4 and Cf-9. BAK1/SERK3 is required for the effector-triggered hypersensitive response and resistance of tomato against C. fulvum. Furthermore, Cf-4 interacts with SOBIR1 at the plasma membrane and is recruited to late endosomes upon Avr4 trigger, also depending on BAK1/SERK3. These observations indicate that RLP-mediated resistance and endocytosis require ligand-induced recruitment of BAK1/SERK3, reminiscent of BAK1/SERK3 interaction and subcellular fate of the FLAGELLIN SENSING 2 (FLS2) RLK. This reveals that diverse classes of cell surface immune receptors share common requirements for initiation of resistance and endocytosis. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  16. Nanoarchitectured electrochemical cytosensors for selective detection of leukemia cells and quantitative evaluation of death receptor expression on cell surfaces.

    PubMed

    Zheng, Tingting; Fu, Jia-Ju; Hu, Lihui; Qiu, Fan; Hu, Minjin; Zhu, Jun-Jie; Hua, Zi-Chun; Wang, Hui

    2013-06-04

    The variable susceptibility to the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) treatment observed in various types of leukemia cells is related to the difference in the expression levels of death receptors, DR4 and DR5, on the cell surfaces. Quantifying the DR4/DR5 expression status on leukemia cell surfaces is of vital importance to the development of diagnostic tools to guide death receptor-based leukemia treatment. Taking the full advantages of novel nanobiotechnology, we have developed a robust electrochemical cytosensing approach toward ultrasensitive detection of leukemia cells with detection limit as low as ~40 cells and quantitative evaluation of DR4/DR5 expression on leukemia cell surfaces. The optimization of electron transfer and cell capture processes at specifically tailored nanobiointerfaces and the incorporation of multiple functions into rationally designed nanoprobes provide unique opportunities of integrating high specificity and signal amplification on one electrochemical cytosensor. The high sensitivity and selectivity of this electrochemical cytosensing approach also allows us to evaluate the dynamic alteration of DR4/DR5 expression on the surfaces of living cells in response to drug treatments. Using the TRAIL-resistant HL-60 cells and TRAIL-sensitive Jurkat cells as model cells, we have further verified that the TRAIL susceptibility of various types of leukemia cells is directly correlated to the surface expression levels of DR4/DR5. This versatile electrochemical cytosensing platform is believed to be of great clinical value for the early diagnosis of human leukemia and the evaluation of therapeutic effects on leukemia patients after radiation therapy or drug treatment.

  17. Molecular Determinants of the Human α2C-Adrenergic Receptor Temperature-Sensitive Intracellular Traffic

    PubMed Central

    Pullikuth, Ashok K.; Guidry, Jessie J.

    2015-01-01

    The human α2C-adrenergic receptor (α2C-AR) is localized intracellularly at physiologic temperature. Decreasing the environmental temperature strongly stimulates the receptor transport to the cell surface. In contrast, rat and mouse α2C-AR plasma membrane levels are less sensitive to decrease in temperature, whereas the opossum α2C-AR cell surface levels are not changed in these conditions. Structural analysis demonstrated that human α2C-AR has a high number of arginine residues in the third intracellular loop and in the C-terminus, organized as putative RXR motifs. Although these motifs do not affect the receptor subcellular localization at 37°C, deletion of the arginine clusters significantly enhanced receptor plasma membrane levels at reduced temperature. We found that this exaggerated transport of the human receptor is mediated by two functional arginine clusters, one in the third intracellular loop and one in the C-terminus. This effect is mediated by interactions with COPI vesicles, but not by 14-3-3 proteins. In rat α2C-AR, the arginine cluster from the third intracellular loop is shifted to the left due to three missing residues. Reinsertion of these residues in the rat α2C-AR restored the same temperature sensitivity as in the human receptor. Proteomic and coimmunoprecipitation experiments identified pontin as a molecule having stronger interactions with human α2C-AR compared with rat α2C-AR. Inhibition of pontin activity enhanced human receptor plasma membrane levels and signaling at 37°C. Our results demonstrate that human α2C-AR has a unique temperature-sensitive traffic pattern within the G protein–coupled receptor class due to interactions with different molecular chaperones, mediated in part by strict spatial localization of specific arginine residues. PMID:25680754

  18. New approaches for solving old problems in neuronal protein trafficking.

    PubMed

    Bourke, Ashley M; Bowen, Aaron B; Kennedy, Matthew J

    2018-04-10

    Fundamental cellular properties are determined by the repertoire and abundance of proteins displayed on the cell surface. As such, the trafficking mechanisms for establishing and maintaining the surface proteome must be tightly regulated for cells to respond appropriately to extracellular cues, yet plastic enough to adapt to ever-changing environments. Not only are the identity and abundance of surface proteins critical, but in many cases, their regulated spatial positioning within surface nanodomains can greatly impact their function. In the context of neuronal cell biology, surface levels and positioning of ion channels and neurotransmitter receptors play essential roles in establishing important properties, including cellular excitability and synaptic strength. Here we review our current understanding of the trafficking pathways that control the abundance and localization of proteins important for synaptic function and plasticity, as well as recent technological advances that are allowing the field to investigate protein trafficking with increasing spatiotemporal precision. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.

    PubMed

    Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias

    2011-12-23

    Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.

  20. Germinal Center T Follicular Helper Cell IL-4 Production Is Dependent on Signaling Lymphocytic Activation Molecule Receptor (CD150)

    PubMed Central

    Yusuf, Isharat; Kageyama, Robin; Monticelli, Laurel; Johnston, Robert J.; DiToro, Daniel; Hansen, Kyle; Barnett, Burton; Crotty, Shane

    2010-01-01

    CD4 T cell help is critical for the generation and maintenance of germinal centers (GCs), and T follicular helper (TFH) cells are the CD4 T cell subset required for this process. Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP [SH2D1A]) expression in CD4 T cells is essential for GC development. However, SAP-deficient mice have only a moderate defect in TFH differentiation, as defined by common TFH surface markers. CXCR5+ TFH cells are found within the GC, as well as along the boundary regions of T/B cell zones. In this study, we show that GC-associated T follicular helper (GC TFH) cells can be identified by their coexpression of CXCR5 and the GL7 epitope, allowing for phenotypic and functional analysis of TFH and GC TFH populations. GC TFH cells are a functionally discrete subset of further polarized TFH cells, with enhanced B cell help capacity and a specialized ability to produce IL-4 in a TH2-independent manner. Strikingly, SAP-deficient mice have an absence of the GC TFH cell subset and SAP− TFH cells are defective in IL-4 and IL-21 production. We further demonstrate that SLAM (Slamf1, CD150), a surface receptor that uses SAP signaling, is specifically required for IL-4 production by GC TFH cells. GC TFH cells require IL-4 and -21 production for optimal help to B cells. These data illustrate complexities of SAP-dependent SLAM family receptor signaling, revealing a prominent role for SLAM receptor ligation in IL-4 production by GC CD4 T cells but not in TFH cell and GC TFH cell differentiation. PMID:20525889

  1. Kupffer cell complement receptor clearance function and host defense.

    PubMed

    Loegering, D J

    1986-01-01

    Kupffer cells are well known to be important for normal host defense function. The development of methods to evaluate the in vivo function of specific receptors on Kupffer cells has made it possible to assess the role of these receptors in host defense. The rationale for studying complement receptors is based on the proposed important role of these receptors in host defense and on the observation that the hereditary deficiency of a complement receptor is associated with recurrent severe bacterial infections. The studies reviewed here demonstrate that forms of injury that are associated with depressed host defense including thermal injury, hemorrhagic shock, trauma, and surgery also cause a decrease in complement receptor clearance function. This decrease in Kupffer cell receptor clearance function was shown not to be the result of depressed hepatic blood flow or depletion of complement components. Complement receptor function was also depressed following the phagocytosis of particulates that are known to depress Kupffer cell host defense function. Endotoxemia and bacteremia also were associated with a depression of complement receptor function. Complement receptor function was experimentally depressed in uninjured animals by the phagocytosis of IgG-coated erythrocytes. There was a close association between the depression of complement receptor clearance function and increased susceptibility to the lethal effects of endotoxin and bacterial infection. These studies support the hypotheses that complement receptors on Kupffer cells are important for normal host defense and that depression of the function of these receptors impairs host defense.

  2. Molecular adaptation and resilience of the insect’s nuclear receptor USP

    PubMed Central

    2012-01-01

    Background The maintenance of biological systems requires plasticity and robustness. The function of the ecdysone receptor, a heterodimer composed of the nuclear receptors ECR (NR1H1) and USP (NR2B4), was maintained in insects despite a dramatic divergence that occurred during the emergence of Mecopterida. This receptor is therefore a good model to study the evolution of plasticity. We tested the hypothesis that selection has shaped the Ligand-Binding Domain (LBD) of USP during evolution of Mecopterida. Results We isolated usp and cox1 in several species of Drosophilidae, Tenebrionidae and Blattaria and estimated non-synonymous/synonymous rate ratios using maximum-likelihood methods and codon-based substitution models. Although the usp sequences were mainly under negative selection, we detected relaxation at residues located on the surface of the LBD within Mecopterida families. Using branch-site models, we also detected changes in selective constraints along three successive branches of the Mecopterida evolution. Residues located at the bottom of the ligand-binding pocket (LBP) underwent strong positive selection during the emergence of Mecopterida. This change is correlated with the acquisition of a large LBP filled by phospholipids that probably allowed the stabilisation of the new Mecopterida structure. Later, when the two subgroups of Mecopterida (Amphiesmenoptera: Lepidoptera, Trichoptera; Antliophora: Diptera, Mecoptera, Siphonaptera) diverged, the same positions became under purifying selection. Similarly, several positions of the heterodimerisation interface experienced positive selection during the emergence of Mecopterida, rapidly followed by a phase of constrained evolution. An enlargement of the heterodimerisation surface is specific for Mecopterida and was associated with a reinforcement of the obligatory partnership between ECR and USP, at the expense of homodimerisation. Conclusions In order to explain the episodic mode of evolution of USP, we propose a model in which the molecular adaptation of this protein is seen as a process of resilience for the maintenance of the ecdysone receptor functionality. PMID:23039844

  3. The roles of protein disulphide isomerase family A, member 3 (ERp57) and surface thiol/disulphide exchange in human spermatozoa-zona pellucida binding.

    PubMed

    Wong, Chi-Wai; Lam, Kevin K W; Lee, Cheuk-Lun; Yeung, William S B; Zhao, Wei E; Ho, Pak-Chung; Ou, Jian-Ping; Chiu, Philip C N

    2017-04-01

    Are multimeric sperm plasma membrane protein complexes, ERp57 and sperm surface thiol content involved in human spermatozoa-zona pellucida (ZP) interaction? ERp57 is a component of a multimeric spermatozoa-ZP receptor complex involved in regulation of human spermatozoa-ZP binding via up-regulation of sperm surface thiol content. A spermatozoon acquires its fertilization capacity within the female reproductive tract by capacitation. Spermatozoa-ZP receptor is suggested to be a composite structure that is assembled into a functional complex during capacitation. Sperm surface thiol content is elevated during capacitation. ERp57 is a protein disulphide isomerase that modulates the thiol-disulphide status of proteins. The binding ability and components of protein complexes in extracted membrane protein fractions of spermatozoa were studied. The roles of capacitation, thiol-disulphide reagent treatments and ERp57 on sperm functions and sperm surface thiol content were assessed. Spermatozoa were obtained from semen samples from normozoospermic men. Human oocytes were obtained from an assisted reproduction programme. Blue native polyacrylamide gel electrophoresis, western ligand blotting and mass spectrometry were used to identify the components of solubilized ZP/ZP3-binding complexes. The localization and expression of sperm surface thiol and ERp57 were studied by immunostaining and sperm surface protein biotinylation followed by western blotting. Sperm functions were assessed by standard assays. Several ZP-binding complexes were isolated from the cell membrane of capacitated spermatozoa. ERp57 was a component of one of these complexes. Capacitation significantly increased the sperm surface thiol content, acrosomal thiol distribution and ERp57 expression on sperm surface. Sperm surface thiol and ERp57 immunoreactivity were localized to the acrosomal region of spermatozoa, a region responsible for ZP-binding. Up-regulation of the surface thiol content or ERp57 surface expression in vitro stimulated ZP-binding capacity of human spermatozoa. Blocking of ERp57 function by specific antibody or inhibitors against ERp57 reduced the surface thiol content and ZP-binding capacity of human spermatozoa. N/A. The mechanisms by which up-regulation of surface thiol content stimulates spermatozoa-ZP binding have not been depicted. Thiol-disulphide exchange is a crucial event in capacitation. ERp57 modulates the event and the subsequent fertilization process. Modulation of the surface thiol content of the spermatozoa of subfertile men may help to increase fertilization rate in assisted reproduction. This work was supported by The Hong Kong Research Grant Council Grant HKU764611 and HKU764512M to P.C.N.C. The authors have no competing interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  4. Calcium modulates calmodulin/α-actinin 1 interaction with and agonist-dependent internalization of the adenosine A2A receptor.

    PubMed

    Piirainen, Henni; Taura, Jaume; Kursula, Petri; Ciruela, Francisco; Jaakola, Veli-Pekka

    2017-04-01

    Adenosine receptors are G protein-coupled receptors that sense extracellular adenosine to transmit intracellular signals. One of the four adenosine receptor subtypes, the adenosine A 2A receptor (A 2A R), has an exceptionally long intracellular C terminus (A 2A R-ct) that mediates interactions with a large array of proteins, including calmodulin and α-actinin. Here, we aimed to ascertain the α-actinin 1/calmodulin interplay whilst binding to A 2A R and the role of Ca 2+ in this process. First, we studied the A 2A R-α-actinin 1 interaction by means of native polyacrylamide gel electrophoresis, isothermal titration calorimetry, and surface plasmon resonance, using purified recombinant proteins. α-Actinin 1 binds the A 2A R-ct through its distal calmodulin-like domain in a Ca 2+ -independent manner with a dissociation constant of 5-12μM, thus showing an ~100 times lower affinity compared to the A 2A R-calmodulin/Ca 2+ complex. Importantly, calmodulin displaced α-actinin 1 from the A 2A R-ct in a Ca 2+ -dependent fashion, disrupting the A 2A R-α-actinin 1 complex. Finally, we assessed the impact of Ca 2+ on A 2A R internalization in living cells, a function operated by the A 2A R-α-actinin 1 complex. Interestingly, while Ca 2+ influx did not affect constitutive A 2A R endocytosis, it abolished agonist-dependent internalization. In addition, we demonstrated that the A 2A R/α-actinin interaction plays a pivotal role in receptor internalization and function. Overall, our results suggest that the interplay of A 2A R with calmodulin and α-actinin 1 is fine-tuned by Ca 2+ , a fact that might power agonist-mediated receptor internalization and function. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Alzheimer's Therapeutics Targeting Amyloid Beta 1–42 Oligomers I: Abeta 42 Oligomer Binding to Specific Neuronal Receptors Is Displaced by Drug Candidates That Improve Cognitive Deficits

    PubMed Central

    Izzo, Nicholas J.; Staniszewski, Agnes; To, Lillian; Fa, Mauro; Teich, Andrew F.; Saeed, Faisal; Wostein, Harrison; Walko, Thomas; Vaswani, Anisha; Wardius, Meghan; Syed, Zanobia; Ravenscroft, Jessica; Mozzoni, Kelsie; Silky, Colleen; Rehak, Courtney; Yurko, Raymond; Finn, Patricia; Look, Gary; Rishton, Gilbert; Safferstein, Hank; Miller, Miles; Johanson, Conrad; Stopa, Edward; Windisch, Manfred; Hutter-Paier, Birgit; Shamloo, Mehrdad; Arancio, Ottavio; LeVine, Harry; Catalano, Susan M.

    2014-01-01

    Synaptic dysfunction and loss caused by age-dependent accumulation of synaptotoxic beta amyloid (Abeta) 1–42 oligomers is proposed to underlie cognitive decline in Alzheimer's disease (AD). Alterations in membrane trafficking induced by Abeta oligomers mediates reduction in neuronal surface receptor expression that is the basis for inhibition of electrophysiological measures of synaptic plasticity and thus learning and memory. We have utilized phenotypic screens in mature, in vitro cultures of rat brain cells to identify small molecules which block or prevent the binding and effects of Abeta oligomers. Synthetic Abeta oligomers bind saturably to a single site on neuronal synapses and induce deficits in membrane trafficking in neuronal cultures with an EC50 that corresponds to its binding affinity. The therapeutic lead compounds we have found are pharmacological antagonists of Abeta oligomers, reducing the binding of Abeta oligomers to neurons in vitro, preventing spine loss in neurons and preventing and treating oligomer-induced deficits in membrane trafficking. These molecules are highly brain penetrant and prevent and restore cognitive deficits in mouse models of Alzheimer's disease. Counter-screening these compounds against a broad panel of potential CNS targets revealed they are highly potent and specific ligands of the sigma-2/PGRMC1 receptor. Brain concentrations of the compounds corresponding to greater than 80% receptor occupancy at the sigma-2/PGRMC1 receptor restore cognitive function in transgenic hAPP Swe/Ldn mice. These studies demonstrate that synthetic and human-derived Abeta oligomers act as pharmacologically-behaved ligands at neuronal receptors - i.e. they exhibit saturable binding to a target, they exert a functional effect related to their binding and their displacement by small molecule antagonists blocks their functional effect. The first-in-class small molecule receptor antagonists described here restore memory to normal in multiple AD models and sustain improvement long-term, representing a novel mechanism of action for disease-modifying Alzheimer's therapeutics. PMID:25390368

  6. Alzheimer's therapeutics targeting amyloid beta 1-42 oligomers I: Abeta 42 oligomer binding to specific neuronal receptors is displaced by drug candidates that improve cognitive deficits.

    PubMed

    Izzo, Nicholas J; Staniszewski, Agnes; To, Lillian; Fa, Mauro; Teich, Andrew F; Saeed, Faisal; Wostein, Harrison; Walko, Thomas; Vaswani, Anisha; Wardius, Meghan; Syed, Zanobia; Ravenscroft, Jessica; Mozzoni, Kelsie; Silky, Colleen; Rehak, Courtney; Yurko, Raymond; Finn, Patricia; Look, Gary; Rishton, Gilbert; Safferstein, Hank; Miller, Miles; Johanson, Conrad; Stopa, Edward; Windisch, Manfred; Hutter-Paier, Birgit; Shamloo, Mehrdad; Arancio, Ottavio; LeVine, Harry; Catalano, Susan M

    2014-01-01

    Synaptic dysfunction and loss caused by age-dependent accumulation of synaptotoxic beta amyloid (Abeta) 1-42 oligomers is proposed to underlie cognitive decline in Alzheimer's disease (AD). Alterations in membrane trafficking induced by Abeta oligomers mediates reduction in neuronal surface receptor expression that is the basis for inhibition of electrophysiological measures of synaptic plasticity and thus learning and memory. We have utilized phenotypic screens in mature, in vitro cultures of rat brain cells to identify small molecules which block or prevent the binding and effects of Abeta oligomers. Synthetic Abeta oligomers bind saturably to a single site on neuronal synapses and induce deficits in membrane trafficking in neuronal cultures with an EC50 that corresponds to its binding affinity. The therapeutic lead compounds we have found are pharmacological antagonists of Abeta oligomers, reducing the binding of Abeta oligomers to neurons in vitro, preventing spine loss in neurons and preventing and treating oligomer-induced deficits in membrane trafficking. These molecules are highly brain penetrant and prevent and restore cognitive deficits in mouse models of Alzheimer's disease. Counter-screening these compounds against a broad panel of potential CNS targets revealed they are highly potent and specific ligands of the sigma-2/PGRMC1 receptor. Brain concentrations of the compounds corresponding to greater than 80% receptor occupancy at the sigma-2/PGRMC1 receptor restore cognitive function in transgenic hAPP Swe/Ldn mice. These studies demonstrate that synthetic and human-derived Abeta oligomers act as pharmacologically-behaved ligands at neuronal receptors--i.e. they exhibit saturable binding to a target, they exert a functional effect related to their binding and their displacement by small molecule antagonists blocks their functional effect. The first-in-class small molecule receptor antagonists described here restore memory to normal in multiple AD models and sustain improvement long-term, representing a novel mechanism of action for disease-modifying Alzheimer's therapeutics.

  7. Prolonged morphine treatment alters δ opioid receptor post-internalization trafficking

    PubMed Central

    Ong, E W; Xue, L; Olmstead, M C; Cahill, C M

    2015-01-01

    BACKGROUND AND PURPOSE The δ opioid receptor (DOP receptor) undergoes internalization both constitutively and in response to agonists. Previous work has shown that DOP receptors traffic from intracellular compartments to neuronal cell membranes following prolonged morphine treatment. Here, we examined the effects of prolonged morphine treatment on the post-internalization trafficking of DOP receptors. EXPERIMENTAL APPROACH Using primary cultures of dorsal root ganglia neurons, we measured the co-localization of endogenous DOP receptors with post-endocytic compartments following both prolonged and acute agonist treatments. KEY RESULTS A departure from the constitutive trafficking pathway was observed following acute DOP receptor agonist-induced internalization by deltorphin II. That is, the DOP receptor underwent distinct agonist-induced post-endocytic sorting. Following prolonged morphine treatment, constitutive DOP receptor trafficking was augmented. SNC80 following prolonged morphine treatment also caused non-constitutive DOP receptor agonist-induced post-endocytic sorting. The μ opioid receptor (MOP receptor) agonist DAMGO induced DOP receptor internalization and trafficking following prolonged morphine treatment. Finally, all of the alterations to DOP receptor trafficking induced by both DOP and MOP receptor agonists were inhibited or absent when those agonists were co-administered with a DOP receptor antagonist, SDM-25N. CONCLUSIONS AND IMPLICATIONS The results support the hypothesis that prolonged morphine treatment induces the formation of MOP–DOP receptor interactions and subsequent augmentation of the available cell surface DOP receptors, at least some of which are in the form of a MOP/DOP receptor species. The pharmacology and trafficking of this species appear to be unique compared to those of its individual constituents. LINKED ARTICLES This article is part of a themed section on Opioids: New Pathways to Functional Selectivity. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2015.172.issue-2 PMID:24819092

  8. Clustering of adhesion receptors following exposure of insect blood cells to foreign surfaces.

    PubMed

    Nardi, James B; Zhuang, Shufei; Pilas, Barbara; Bee, Charles Mark; Kanost, Michael R

    2005-05-01

    Cell-mediated immune responses of insects involve interactions of two main classes of blood cells (hemocytes) known as granular cells and plasmatocytes. In response to a foreign surface, these hemocytes suddenly transform from circulating, non-adherent cells to cells that interact and adhere to each other and the foreign surface. This report presents evidence that during this adhesive transformation the extracellular matrix (ECM) proteins lacunin and a ligand for peanut agglutinin (PNA) lectin are released by granular cells and bind to surfaces of both granular cells and plasmatocytes. ECM protein co-localizes on cell surfaces with the adhesive receptors integrin and neuroglian, a member of the immunoglobulin superfamily. The ECM protein(s) secreted by granular cells are hypothesized to interact with adhesion receptors such as neuroglian and integrin by cross linking and clustering them on hemocyte surfaces. This clustering of receptors is known to enhance the adhesiveness (avidity) of interacting mammalian immune cells. The formation of ring-shaped clusters of these adhesion receptors on surfaces of insect immune cells represents an evolutionary antecedent of the mammalian immunological synapse.

  9. Neutrophil cell surface receptors and their intracellular signal transduction pathways☆

    PubMed Central

    Futosi, Krisztina; Fodor, Szabina; Mócsai, Attila

    2013-01-01

    Neutrophils play a critical role in the host defense against bacterial and fungal infections, but their inappropriate activation also contributes to tissue damage during autoimmune and inflammatory diseases. Neutrophils express a large number of cell surface receptors for the recognition of pathogen invasion and the inflammatory environment. Those include G-protein-coupled chemokine and chemoattractant receptors, Fc-receptors, adhesion receptors such as selectins/selectin ligands and integrins, various cytokine receptors, as well as innate immune receptors such as Toll-like receptors and C-type lectins. The various cell surface receptors trigger very diverse signal transduction pathways including activation of heterotrimeric and monomeric G-proteins, receptor-induced and store-operated Ca2 + signals, protein and lipid kinases, adapter proteins and cytoskeletal rearrangement. Here we provide an overview of the receptors involved in neutrophil activation and the intracellular signal transduction processes they trigger. This knowledge is crucial for understanding how neutrophils participate in antimicrobial host defense and inflammatory tissue damage and may also point to possible future targets of the pharmacological therapy of neutrophil-mediated autoimmune or inflammatory diseases. PMID:23994464

  10. Myelin Proteolipid Protein Complexes with αv Integrin and AMPA Receptors In Vivo and Regulates AMPA-Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell-Surface GluR2 Expression

    PubMed Central

    Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi

    2015-01-01

    In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into demyelinated areas or OPCs in lesions may not mature into myelinating oligodendrocytes. We have found that the myelin proteolipid protein is critical to regulating OPC migratory responses to the neurotransmitter glutamate through modulation of cell-surface expression of the calcium-impermeable GluR2 subunit of the AMPA glutamate receptor and increased intercellular Ca2+ signaling. Altered glutamate homeostasis has been reported in demyelinated lesions. Therefore, understanding how OPCs respond to glutamate has important implications for treatment after white matter injury and disease. PMID:26311781

  11. Endocytosis and Trafficking of Natriuretic Peptide Receptor-A: Potential Role of Short Sequence Motifs

    PubMed Central

    Pandey, Kailash N.

    2015-01-01

    The targeted endocytosis and redistribution of transmembrane receptors among membrane-bound subcellular organelles are vital for their correct signaling and physiological functions. Membrane receptors committed for internalization and trafficking pathways are sorted into coated vesicles. Cardiac hormones, atrial and brain natriuretic peptides (ANP and BNP) bind to guanylyl cyclase/natriuretic peptide receptor-A (GC-A/NPRA) and elicit the generation of intracellular second messenger cyclic guanosine 3',5'-monophosphate (cGMP), which lowers blood pressure and incidence of heart failure. After ligand binding, the receptor is rapidly internalized, sequestrated, and redistributed into intracellular locations. Thus, NPRA is considered a dynamic cellular macromolecule that traverses different subcellular locations through its lifetime. The utilization of pharmacologic and molecular perturbants has helped in delineating the pathways of endocytosis, trafficking, down-regulation, and degradation of membrane receptors in intact cells. This review describes the investigation of the mechanisms of internalization, trafficking, and redistribution of NPRA compared with other cell surface receptors from the plasma membrane into the cell interior. The roles of different short-signal peptide sequence motifs in the internalization and trafficking of other membrane receptors have been briefly reviewed and their potential significance in the internalization and trafficking of NPRA is discussed. PMID:26151885

  12. Development of B cells expressing surface immunoglobulin molecules that lack V(D)J-encoded determinants in the avian embryo bursa of Fabricius

    PubMed Central

    Sayegh, Camil E.; Demaries, Sandra L.; Iacampo, Sandra; Ratcliffe, Michael J. H.

    1999-01-01

    Immunoglobulin gene rearrangement in avian B cell precursors generates surface Ig receptors of limited diversity. It has been proposed that specificities encoded by these receptors play a critical role in B lineage development by recognizing endogenous ligands within the bursa of Fabricius. To address this issue directly we have introduced a truncated surface IgM, lacking variable region domains, into developing B precursors by retroviral gene transfer in vivo. Cells expressing this truncated receptor lack endogenous surface IgM, and the low level of endogenous Ig rearrangements that have occurred within this population of cells has not been selected for having a productive reading frame. Such cells proliferate rapidly within bursal epithelial buds of normal morphology. In addition, despite reduced levels of endogenous light chain rearrangement, those light chain rearrangements that have occurred have undergone variable region diversification by gene conversion. Therefore, although surface expression of an Ig receptor is required for bursal colonization and the induction of gene conversion, the specificity encoded by the prediversified receptor is irrelevant and, consequently, there is no obligate ligand for V(D)J-encoded determinants of prediversified avian cell surface IgM receptor. PMID:10485907

  13. Structural insights into the functional role of the Hcn sub-domain of the receptor-binding domain of the botulinum neurotoxin mosaic serotype C/D.

    PubMed

    Zhang, Yanfeng; Gardberg, Anna S; Edwards, Thomas E; Sankaran, Banumathi; Robinson, Howard; Varnum, Susan M; Buchko, Garry W

    2013-07-01

    Botulinum neurotoxin (BoNT), the causative agent of the deadly neuroparalytic disease botulism, is the most poisonous protein known for humans. Produced by different strains of the anaerobic bacterium Clostridium botulinum, BoNT effects cellular intoxication via a multistep mechanism executed by the three modules of the activated protein. Endocytosis, the first step of cellular intoxication, is triggered by the ~50 kDa, heavy-chain receptor-binding domain (HCR) that is specific for a ganglioside and a protein receptor on neuronal cell surfaces. This dual receptor recognition mechanism between BoNT and the host cell's membrane is well documented and occurs via specific intermolecular interactions with the C-terminal sub-domain, Hcc, of BoNT-HCR. The N-terminal sub-domain of BoNT-HCR, Hcn, comprises ~50% of BoNT-HCR and adopts a β-sheet jelly roll fold. While suspected in assisting cell surface recognition, no unambiguous function for the Hcn sub-domain in BoNT has been identified. To obtain insights into the potential function of the Hcn sub-domain in BoNT, the first crystal structure of a BoNT with an organic ligand bound to the Hcn sub-domain has been obtained. Here, we describe the crystal structure of BoNT/CD-HCR determined at 1.70 Å resolution with a tetraethylene glycol (PG4) moiety bound in a hydrophobic cleft between β-strands in the β-sheet jelly roll fold of the Hcn sub-domain. The PG4 moiety is completely engulfed in the cleft, making numerous hydrophilic (Y932, S959, W966, and D1042) and hydrophobic (S935, W977, L979, N1013, and I1066) contacts with the protein's side chain and backbone that may mimic in vivo interactions with the phospholipid membranes on neuronal cell surfaces. A sulfate ion was also observed bound to residues T1176, D1177, K1196, and R1243 in the Hcc sub-domain of BoNT/CD-HCR. In the crystal structure of a similar protein, BoNT/D-HCR, a sialic acid molecule was observed bound to the equivalent residues suggesting that residues T1176, D1177, K1196, and R1243 in BoNT/CD may play a role in ganglioside binding. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. Novel calcium-sensing receptor cytoplasmic tail deletion mutation causing autosomal dominant hypocalcemia: molecular and clinical study.

    PubMed

    Obermannova, Barbora; Sumnik, Zdenek; Dusatkova, Petra; Cinek, Ondrej; Grant, Michael; Lebl, Jan; Hendy, Geoffrey N

    2016-04-01

    Autosomal dominant hypocalcemia (ADH) is a rare disorder caused by activating mutations of the calcium-sensing receptor (CASR). The treatment of ADH patients with 1α-hydroxylated vitamin D derivatives can cause hypercalciuria leading to nephrocalcinosis. We studied a girl who presented with hypoparathyroidism and asymptomatic hypocalcemia at age 2.5 years. Mutations of CASR were investigated by DNA sequencing. Functional analyses of mutant and WT CASRs were done in transiently transfected human embryonic kidney (HEK293) cells. The proband and her father are heterozygous for an eight-nucleotide deletion c.2703_2710delCCTTGGAG in the CASR encoding the intracellular domain of the protein. Transient expression of CASR constructs in kidney cells in vitro suggested greater cell surface expression of the mutant receptor with a left-shifted extracellular calcium dose-response curve relative to that of the WT receptor consistent with gain of function. Initial treatment of the patient with calcitriol led to increased urinary calcium excretion. Evaluation for mosaicism in the paternal grandparents of the proband was negative. We describe a novel naturally occurring deletion mutation within the CASR that apparently arose de novo in the father of the ADH proband. Functional analysis suggests that the cytoplasmic tail of the CASR contains determinants that regulate the attenuation of signal transduction. Early molecular analysis of the CASR gene in patients with isolated idiopathic hypoparathyroidism is recommended because of its relevance to clinical outcome and treatment choice. In ADH patients, calcium supplementation and low-dose cholecalciferol avoids hypocalcemic symptoms without compromising renal function. © 2016 European Society of Endocrinology.

  15. Tyrosine phosphorylation of LRP6 by Src and Fer inhibits Wnt/β-catenin signalling

    PubMed Central

    Chen, Qing; Su, Yi; Wesslowski, Janine; Hagemann, Anja I; Ramialison, Mirana; Wittbrodt, Joachim; Scholpp, Steffen; Davidson, Gary

    2014-01-01

    Low-density lipoprotein receptor-related proteins 5 and 6 (LRP5/6) function as transmembrane receptors to transduce Wnt signals. A key mechanism for signalling is Wnt-induced serine/threonine phosphorylation at conserved PPPSPxS motifs in the LRP6 cytoplasmic domain, which promotes pathway activation. Conserved tyrosine residues are positioned close to all PPPSPxS motifs, which suggests they have a functional significance. Using a cell culture-based cDNA expression screen, we identified the non-receptor tyrosine kinases Src and Fer as novel LRP6 modifiers. Both Src and Fer associate with LRP6 and phosphorylate LRP6 directly. In contrast to the known PPPSPxS Ser/Thr kinases, tyrosine phosphorylation by Src and Fer negatively regulates LRP6-Wnt signalling. Epistatically, they function upstream of β-catenin to inhibit signalling and in agreement with a negative role in regulating LRP6, MEF cells lacking these kinases show enhanced Wnt signalling. Wnt3a treatment of cells enhances tyrosine phosphorylation of endogenous LRP6 and, mechanistically, Src reduces cell surface LRP6 levels and disrupts LRP6 signalosome formation. Interestingly, CK1γ inhibits Fer-induced LRP6 phosphorylation, suggesting a mechanism whereby CK1γ acts to de-represses inhibitory LRP6 tyrosine phosphorylation. We propose that LRP6 tyrosine phosphorylation by Src and Fer serves a negative regulatory function to prevent over-activation of Wnt signalling at the level of the Wnt receptor, LRP6. Subject Categories Membrane & Intracellular Transport; Post-translational Modifications, Proteolysis & Proteomics PMID:25391905

  16. Structural complementarity of Toll/interleukin-1 receptor domains in Toll-like receptors and the adaptors Mal and MyD88.

    PubMed

    Dunne, Aisling; Ejdeback, Mikael; Ludidi, Phumzile L; O'Neill, Luke A J; Gay, Nicholas J

    2003-10-17

    The Toll/interleukin 1 receptor (TIR) domain is a region found in the cytoplasmic tails of members of the Toll-like receptor/interleukin-1 receptor superfamily. The domain is essential for signaling and is also found in the adaptor proteins Mal (MyD88 adaptor-like) and MyD88, which function to couple activation of the receptor to downstream signaling components. Experimental structures of two Toll/interleukin 1 receptor domains reveal a alpha-beta-fold similar to that of the bacterial chemotaxis protein CheY, and other evidence suggests that the adaptors can make heterotypic interactions with both the receptors and themselves. Here we show that the purified TIR domains of Mal and MyD88 can form stable heterodimers and also that Mal homodimers and oligomers are dissociated in the presence of ATP. To identify structural features that may contribute to the formation of signaling complexes, we produced models of the TIR domains from human Toll-like receptor 4 (TLR4), Mal, and MyD88. We found that although the overall fold is conserved the electrostatic surface potentials are quite distinct. Docking studies of the models suggest that Mal and MyD88 bind to different regions in TLRs 2 and 4, a finding consistent with a cooperative role of the two adaptors in signaling. Mal and MyD88 are predicted to interact at a third non-overlapping site, suggesting that the receptor and adaptors may form heterotetrameric complexes. The theoretical model of the interactions is supported by experimental data from glutathione S-transferase pull-downs and co-immunoprecipitations. Neither theoretical nor experimental data suggest a direct role for the conserved proline in the BB-loop in the association of TLR4, Mal, and MyD88. Finally we show a sequence relationship between the Drosophila protein Tube and Mal that may indicate a functional equivalence of these two adaptors in the Drosophila and vertebrate Toll pathways.

  17. Infection's Sweet Tooth: How Glycans Mediate Infection and Disease Susceptibility.

    PubMed

    Taylor, Steven L; McGuckin, Michael A; Wesselingh, Steve; Rogers, Geraint B

    2018-02-01

    Glycans form a highly variable constituent of our mucosal surfaces and profoundly affect our susceptibility to infection and disease. The diversity and importance of these surface glycans can be seen in individuals who lack a functional copy of the fucosyltransferase gene, FUT2. Representing around one-fifth of the population, these individuals have an altered susceptibility to many bacterial and viral infections and diseases. The mediation of host-pathogen interactions by mucosal glycans, such as those added by FUT2, is poorly understood. We highlight, with specific examples, important mechanisms by which host glycans influence infection dynamics, including by: acting as pathogen receptors (or receptor-decoys), promoting microbial stability, altering the physical characteristics of mucus, and acting as immunological markers. We argue that the effect glycans have on infection dynamics has profound implications for many aspects of healthcare and policy, including clinical management, outbreak control, and vaccination policy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Immunocytochemical localization of muscarinic, adrenergic and AT1 receptors.

    PubMed

    Schulze, W; Fu, M L

    1996-01-01

    By indirect immunofluorescence and post-embedding EM gold technique, the localization of alpha 1-adrenergic, M2-muscarinic and angiotensin II receptor-I (AT1) were determinated. With antipeptide antibodies directed against the second extracellular loops of all three receptors, these receptors were found to be localized at the sarcolemma of adult rat cardiomyocytes and at the surface membranes of cultivated neonatal heart cells. Additionally, M2 receptors were localized along T-tubule membranes of both rat and human adult cardiomyocytes. alpha 1-Adrenergic receptors were found intracellular near the surface of atrial granules (ANF-granules). By using M2 and alpha 1-adrenergic receptor antibodies the strongest fluorescence was found in the right atrium of the rat. Besides the localization in cardiomyocytes, AT1 receptors were also localized in outer plasma membranes and the endoplasmic reticulum of fibroblasts, and the surface of smooth muscle cells of the major arteries and veins. Likewise, the muscarinic M2 receptors were found along the outer membranes of endothelial cells from capillaries and endocardium.

  19. Adenovirus receptors and their implications in gene delivery

    PubMed Central

    Sharma, Anurag; Li, Xiaoxin; Bangari, Dinesh S.; Mittal, Suresh K.

    2010-01-01

    Adenoviruses (Ads) have gained popularity as gene delivery vectors for therapeutic and prophylactic applications. Ad entry into host cells involves specific interactions between cell surface receptors and viral capsid proteins. Several cell surface molecules have been identified as receptors for Ad attachment and entry. Tissue tropism of Ad vectors is greatly influenced by their receptor usage. A variety of strategies have been investigated to modify Ad vector tropism by manipulating the receptor-interacting moieties. Many such strategies are aimed at targeting and/or detargeting of Ad vectors. In this review, we discuss the various cell surface molecules that are implicated as receptors for virus attachment and internalization. Special emphasis is given to Ad types that are utilized as gene delivery vectors. Various strategies to modify Ad tropism using the knowledge of Ad receptors are also discussed. PMID:19647886

  20. Green fluorescent protein nanopolygons as monodisperse supramolecular assemblies of functional proteins with defined valency

    PubMed Central

    Kim, Young Eun; Kim, Yu-na; Kim, Jung A.; Kim, Ho Min; Jung, Yongwon

    2015-01-01

    Supramolecular protein assemblies offer novel nanoscale architectures with molecular precision and unparalleled functional diversity. A key challenge, however, is to create precise nano-assemblies of functional proteins with both defined structures and a controlled number of protein-building blocks. Here we report a series of supramolecular green fluorescent protein oligomers that are assembled in precise polygonal geometries and prepared in a monodisperse population. Green fluorescent protein is engineered to be self-assembled in cells into oligomeric assemblies that are natively separated in a single-protein resolution by surface charge manipulation, affording monodisperse protein (nano)polygons from dimer to decamer. Several functional proteins are multivalently displayed on the oligomers with controlled orientations. Spatial arrangements of protein oligomers and displayed functional proteins are directly visualized by a transmission electron microscope. By employing our functional protein assemblies, we provide experimental insight into multivalent protein–protein interactions and tools to manipulate receptor clustering on live cell surfaces. PMID:25972078

  1. Molecular interactions between chondroitin-dermatan sulfate and growth factors/receptors/matrix proteins.

    PubMed

    Mizumoto, Shuji; Yamada, Shuhei; Sugahara, Kazuyuki

    2015-10-01

    Recent functional studies on chondroitin sulfate-dermatan sulfate (CS-DS) demonstrated its indispensable roles in various biological events including brain development and cancer. CS-DS proteoglycans exert their physiological activity through interactions with specific proteins including growth factors, cell surface receptors, and matrix proteins. The characterization of these interactions is essential for regulating the biological functions of CS-DS proteoglycans. Although amino acid sequences on the bioactive proteins required for these interactions have already been elucidated, the specific saccharide sequences involved in the binding of CS-DS to target proteins have not yet been sufficiently identified. In this review, recent findings are described on the interaction between CS-DS and some proteins which are especially involved in the central nervous system and cancer development/metastasis. Copyright © 2015. Published by Elsevier Ltd.

  2. SiGe derivatization by spontaneous reduction of aryl diazonium salts

    NASA Astrophysics Data System (ADS)

    Girard, A.; Geneste, F.; Coulon, N.; Cardinaud, C.; Mohammed-Brahim, T.

    2013-10-01

    Germanium semiconductors have interesting properties for FET-based biosensor applications since they possess high surface roughness allowing the immobilization of a high amount of receptors on a small surface area. Since SiGe combined low cost of Si and intrinsic properties of Ge with high mobility carriers, we focused the study on this particularly interesting material. The comparison of the efficiency of a functionalization process involving the spontaneous reduction of diazonium salts is studied on Si(1 0 0), SiGe and Ge semiconductors. XPS analysis of the functionalized surfaces reveals the presence of a covalent grafted layer on all the substrates that was confirmed by AFM. Interestingly, the modified Ge derivatives have still higher surface roughness after derivatization. To support the estimated thickness by XPS, a step measurement of the organic layers is done by AFM or by profilometer technique after a O2 plasma etching of the functionalized layer. This original method is well-adapted to measure the thickness of thin organic films on rough substrates such as germanium. The analyses show a higher chemical grafting on SiGe substrates compared with Si and Ge semiconductors.

  3. Endosomal receptor kinetics determine the stability of intracellular growth factor signalling complexes

    PubMed Central

    Tzafriri, A. Rami; Edelman, Elazer R.

    2006-01-01

    There is an emerging paradigm that growth factor signalling continues in the endosome and that cell response to a growth factor is defined by the integration of cell surface and endosomal events. As activated receptors in the endosome are exposed to a different set of binding partners, they probably elicit differential signals compared with when they are at the cell surface. As such, complete appreciation of growth factor signalling requires understanding of growth factor–receptor binding and trafficking kinetics both at the cell surface and in endosomes. Growth factor binding to surface receptors is well characterized, and endosomal binding is assumed to follow surface kinetics if one accounts for changes in pH. Yet, specific binding kinetics within the endosome has not been examined in detail. To parse the factors governing the binding state of endosomal receptors we analysed a whole-cell mathematical model of epidermal growth factor receptor trafficking and binding. We discovered that the stability of growth factor–receptor complexes within endosomes is governed by three primary independent factors: the endosomal dissociation constant, total endosomal volume and the number of endosomal receptors. These factors were combined into a single dimensionless parameter that determines the endosomal binding state of the growth factor–receptor complex and can distinguish different growth factors from each other and different cell states. Our findings indicate that growth factor binding within endosomal compartments cannot be appreciated solely on the basis of the pH-dependence of the dissociation constant and that the concentration of receptors in the endosomal compartment must also be considered. PMID:17117924

  4. Botulinum neurotoxin: a marvel of protein design.

    PubMed

    Montal, Mauricio

    2010-01-01

    Botulinum neurotoxin (BoNT), the causative agent of botulism, is acknowledged to be the most poisonous protein known. BoNT proteases disable synaptic vesicle exocytosis by cleaving their cytosolic SNARE (soluble NSF attachment protein receptor) substrates. BoNT is a modular nanomachine: an N-terminal Zn(2+)-metalloprotease, which cleaves the SNAREs; a central helical protein-conducting channel, which chaperones the protease across endosomes; and a C-terminal receptor-binding module, consisting of two subdomains that determine target specificity by binding to a ganglioside and a protein receptor on the cell surface and triggering endocytosis. For BoNT, functional complexity emerges from its modular design and the tight interplay between its component modules--a partnership with consequences that surpass the simple sum of the individual component's action. BoNTs exploit this design at each step of the intoxication process, thereby achieving an exquisite toxicity. This review summarizes current knowledge on the structure of individual modules and presents mechanistic insights into how this protein machine evolved to this level of sophistication. Understanding the design principles underpinning the function of such a dynamic modular protein remains a challenging task.

  5. Pleiotrophin and its receptor protein tyrosine phosphatase beta/zeta as regulators of angiogenesis and cancer.

    PubMed

    Papadimitriou, Evangelia; Pantazaka, Evangelia; Castana, Penelope; Tsalios, Thomas; Polyzos, Alexandros; Beis, Dimitris

    2016-12-01

    Pleiotrophin (PTN) is a secreted heparin-binding growth factor that through its receptor protein tyrosine phosphatase beta/zeta (RPTPβ/ζ) has a significant regulatory effect on angiogenesis and cancer. PTN and RPTPβ/ζ are over-expressed in several types of human cancers and regulate important cancer cell functions in vitro and cancer growth in vivo. This review begins with a brief introduction of PTN and the regulation of its expression. PTN receptors are described with special emphasis on RPTPβ/ζ, which also interacts with and/or affects the function of other important targets for cancer therapy, such as vascular endothelial growth factor A, α ν β 3 and cell surface nucleolin. PTN biological activities related to angiogenesis and cancer are extensively discussed. Finally, up to date approaches of targeting PTN or RPTPβ/ζ for cancer treatment are presented. Insights into the regulatory role of PTN/RPTPβ/ζ on angiogenesis will be extremely beneficial for future development of alternative anti-angiogenic approaches in cancer therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Role of ER Export Signals in Controlling Surface Potassium Channel Numbers

    NASA Astrophysics Data System (ADS)

    Ma, Dzwokai; Zerangue, Noa; Lin, Yu-Fung; Collins, Anthony; Yu, Mei; Jan, Yuh Nung; Yeh Jan, Lily

    2001-01-01

    Little is known about the identity of endoplasmic reticulum (ER) export signals and how they are used to regulate the number of proteins on the cell surface. Here, we describe two ER export signals that profoundly altered the steady-state distribution of potassium channels and were required for channel localization to the plasma membrane. When transferred to other potassium channels or a G protein-coupled receptor, these ER export signals increased the number of functional proteins on the cell surface. Thus, ER export of membrane proteins is not necessarily limited by folding or assembly, but may be under the control of specific export signals.

  7. A bio-recognition device developed onto nano-crystals of carbonate apatite for cell-targeted gene delivery.

    PubMed

    Chowdhury, E H; Akaike, Toshihiro

    2005-05-20

    The DNA delivery to mammalian cells is an essential tool for analyzing gene structure, regulation, and function. The approach holds great promise for the further development of gene therapy techniques and DNA vaccination strategies to treat and control diseases. Here, we report on the establishment of a cell-specific gene delivery and expression system by physical adsorption of a cell-recognition molecule on the nano-crystal surface of carbonate apatite. As a model, DNA/nano-particles were successfully coated with asialofetuin to facilitate uptake by hepatocyte-derived cell lines through the asialoglycoprotein receptor (ASGPr) and albumin to prevent non-specific interactions of the particles with cell-surface. The resulting composite particles with dual surface properties could accelerate DNA uptake and enhance expression to a notable extent. Nano-particles coated with transferrin in the same manner dramatically enhanced transgene expression in the corresponding receptor-bearing cells and thus our newly developed strategy represents a universal phenomenon for anchoring a bio-recognition macromolecule on the apatite crystal surface for targeted gene delivery, having immediate applications in basic research laboratories and great promise for gene therapy. (c) 2005 Wiley Periodicals, Inc.

  8. Strategies for leukemic biomarker detection using long-range surface plasmon-polaritons

    NASA Astrophysics Data System (ADS)

    Krupin, O.; Wang, C.; Berini, P.

    2014-09-01

    The suitability and use of long-range surface plasmon-polaritons for leukemic biomarker detection is discussed. A novel optical biosensor comprised of gold straight waveguides embedded in CYTOP with an etched microfluidic channel was tested for detecting leukemia in patient serum. Gold surface functionalization involved the interaction of protein G (PG) with antibodies by first adsorbing PG on bare gold and then antibodies (Immunoglobulin G, IgG). Differentiation between healthy and leukemia patients was based on the difference in ratios of Ig kappa (Igκ) and Ig lambda (Igλ) light chains in both serums. The ratio for a normal patient is ~1.4 - 2, whereas for a leukemia patient this ratio is altered. As a receptor (primary antibodies), goat anti-human anti-IgGκ and anti-IgGλ were used to functionalize the surface. Diluted normal and leukemia patient serums were tested over the aforementioned surfaces. The ratios of mass surface densities of IgGκ:IgGλ for normal serum (NS) and patient serum (PS) were found to be 1.55 and 1.92 respectively.

  9. Retention in the Golgi apparatus and expression on the cell surface of Cfr/Esl-1/Glg-1/MG-160 are regulated by two distinct mechanisms.

    PubMed

    Miyaoka, Yuichiro; Kato, Hidenori; Ebato, Kazuki; Saito, Shigeru; Miyata, Naoko; Imamura, Toru; Miyajima, Atsushi

    2011-11-15

    Cfr (cysteine-rich fibroblast growth factor receptor) is an Fgf (fibroblast growth factor)-binding protein without a tyrosine kinase. We have shown previously that Cfr is involved in Fgf18 signalling via Fgf receptor 3c. However, as Cfr is also known as Glg (Golgi apparatus protein)-1 or MG-160 and occurs in the Golgi apparatus, it remains unknown how the distribution of Cfr is regulated. In the present study, we performed a mutagenic analysis of Cfr to show that two distinct regions contribute to its distribution and stability. First, the C-terminal region retains Cfr in the Golgi apparatus. Secondly, the Cfr repeats in the extracellular juxtamembrane region destabilizes Cfr passed through the Golgi apparatus. This destabilization does not depend on the cleavage and secretion of the extracellular domain of Cfr. Furthermore, we found that Cfr with a GPI (glycosylphosphatidylinositol) anchor was predominantly expressed on the cell surface in Ba/F3 cells and affected Fgf18 signalling in a similar manner to the full-length Cfr, indicating that the interaction of Cfr with Fgfs on the cell surface is important for its function in Fgf signalling. These results suggest that the expression of Cfr in the Golgi apparatus and on the plasma membrane is finely tuned through two distinct mechanisms for exhibiting different functions.

  10. Investigation of Functional Activity of Cells in Granulomatous Inflammatory Lesions from Mice with Latent Tuberculous Infection in the New Ex Vivo Model

    PubMed Central

    2013-01-01

    The new ex vivo model system measuring functional input of individual granuloma cells to formation of granulomatous inflammatory lesions in mice with latent tuberculous infection has been developed and described in the current study. Monolayer cultures of cells that migrated from individual granulomas were established in the proposed culture settings for mouse spleen and lung granulomas induced by in vivo exposure to BCG vaccine. The cellular composition of individual granulomas was analyzed. The expression of the leukocyte surface markers such as phagocytic receptors CD11b, CD11c, CD14, and CD16/CD32 and the expression of the costimulatory molecules CD80, CD83, and CD86 were tested as well as the production of proinflammatory cytokines (IFNγ and IL-1α) and growth factors (GM-CSF and FGFb) for cells of individual granulomas. The colocalization of the phagocytic receptors and costimulatory molecules in the surface microdomains of granuloma cells (with and without acid-fast BCG-mycobacteria) has also been detected. It was found that some part of cytokine macrophage producers have carried acid-fast mycobacteria. Detected modulation in dynamics of production of pro-inflammatory cytokines, growth factors, and leukocyte surface markers by granuloma cells has indicated continued processes of activation and deactivation of granuloma inflammation cells during the latent tuberculous infection progress in mice. PMID:24198843

  11. Targeted drug delivery to circulating tumor cells via platelet membrane-functionalized particles

    PubMed Central

    Li, Jiahe; Ai, Yiwei; Wang, Lihua; Bu, Pengcheng; Sharkey, Charles C.; Wu, Qianhui; Wun, Brittany; Roy, Sweta; Shen, Xiling; King, Michael R.

    2015-01-01

    Circulating tumor cells (CTCs) are responsible for metastases in distant organs via hematogenous dissemination. Fundamental studies in the past decade have suggested that neutralization of CTCs in circulation could represent an effective strategy to prevent metastasis. Current paradigms of targeted drug delivery into a solid tumor largely fall into two main categories: unique cancer markers (e.g. overexpression of surface receptors) and tumor-specific microenvironment (e.g. low pH, hypoxia, etc.). While relying on a surface receptor to target CTCs can be greatly challenged by cancer heterogeneity, targeting of tumor microenvironments has the advantage of recognizing a broader spectrum of cancer cells regardless of genetic differences or tumor types. The blood circulation, however, where CTCs transit through, lacks the same tumor microenvironment as that found in a solid tumor. In this study, a unique “microenvironment” was confirmed upon introduction of cancer cells of different types into circulation where activated platelets and fibrin were physically associated with blood-borne cancer cells. Inspired by this observation, synthetic silica particles were functionalized with activated platelet membrane along with surface conjugation of tumor-specific apoptosis-inducing ligand cytokine, TRAIL. Biomimetic synthetic particles incorporated into CTC-associated micro-thrombi in lung vasculature and dramatically decreased lung metastases in a mouse breast cancer metastasis model. Our results demonstrate a “Trojan Horse” strategy of neutralizing CTCs to attenuate metastasis. PMID:26519648

  12. Selective cell-surface labeling of the molecular motor protein prestin

    PubMed Central

    McGuire, Ryan M.; Silberg, Jonathan J.; Pereira, Fred A.; Raphael, Robert M.

    2011-01-01

    Prestin, a multipass transmembrane protein whose N- an C-termini are localized to the cytoplasm, must be trafficked to the plasma membrane to fulfill its cellular function as a molecular motor. One challenge in studying prestin sequence-function relationships within living cells is separating the effects of amino acid substitutions on prestin trafficking, plasma membrane localization and function. To develop an approach for directly assessing prestin levels at the plasma membrane, we have investigated whether fusion of prestin to a single pass transmembrane protein results in a functional fusion protein with a surface-exposed N-terminal tag that can be detected in living cells. We find that fusion of the biotin-acceptor peptide (BAP) and transmembrane domain of the platelet-derived growth factor receptor (PDGFR) to the N-terminus of prestin-GFP yields a membrane protein that can be metabolically-labeled with biotin, trafficked to the plasma membrane, and selectively detected at the plasma membrane using fluorescently-tagged streptavidin. Furthermore, we show that the addition of a surface detectable tag and a single-pass transmembrane domain to prestin does not disrupt its voltage-sensitive activity. PMID:21651892

  13. Auto-antibodies to Receptor Tyrosine Kinases TrkA, TrkB and TrkC in Patients with Chronic Chagas’ Disease

    PubMed Central

    Lu, B.; Petrola, Z.; Luquetti, A. O.; PereiraPerrin, M.

    2010-01-01

    The Chagas’ disease parasite Trypanosoma cruzi promotes survival and differentiation of neurones by binding and activating nerve growth factor (NGF) receptor TrkA. The functional mimic of NGF in T. cruzi is a surface-bound and shed immunogenic protein [neurotrophic factor/trans-sialidase (TS)], which raised the possibility that immune response to T. cruzi in general and to neurotrophic factor/TS in particular leads to loss of immunological tolerance to host NGF and/or the NGF-binding partner TrkA. In testing this hypothesis, we found that sera of individuals with chronic Chagas’ disease bear unique IgG2 autoantibodies that bind TrkA and TrkA family members TrkB and TrkC (ATA). Binding of ATA to Trk receptors is specific because the autoantibodies did not cross-react with five other growth factor receptors, NGF and other neurotrophins, and T. cruzi. Thus, individuals with chronic Chagas’ disease produce unique antibodies that react with pan-Trk receptors, one of which (TrkA) T. cruzi exploits to inhibit host cell apoptosis and to promote cellular invasion. PMID:18410251

  14. Contribution of TyrB26 to the Function and Stability of Insulin

    PubMed Central

    Pandyarajan, Vijay; Phillips, Nelson B.; Rege, Nischay; Lawrence, Michael C.; Whittaker, Jonathan; Weiss, Michael A.

    2016-01-01

    Crystallographic studies of insulin bound to receptor domains have defined the primary hormone-receptor interface. We investigated the role of TyrB26, a conserved aromatic residue at this interface. To probe the evolutionary basis for such conservation, we constructed 18 variants at B26. Surprisingly, non-aromatic polar or charged side chains (such as Glu, Ser, or ornithine (Orn)) conferred high activity, whereas the weakest-binding analogs contained Val, Ile, and Leu substitutions. Modeling of variant complexes suggested that the B26 side chains pack within a shallow depression at the solvent-exposed periphery of the interface. This interface would disfavor large aliphatic side chains. The analogs with highest activity exhibited reduced thermodynamic stability and heightened susceptibility to fibrillation. Perturbed self-assembly was also demonstrated in studies of the charged variants (Orn and Glu); indeed, the GluB26 analog exhibited aberrant aggregation in either the presence or absence of zinc ions. Thus, although TyrB26 is part of insulin's receptor-binding surface, our results suggest that its conservation has been enjoined by the aromatic ring's contributions to native stability and self-assembly. We envisage that such classical structural relationships reflect the implicit threat of toxic misfolding (rather than hormonal function at the receptor level) as a general evolutionary determinant of extant protein sequences. PMID:27129279

  15. Investigation of Congenital Myasthenia Reveals Functional Asymmetry of Invariant Acetylcholine Receptor (AChR) Cys-loop Aspartates.

    PubMed

    Shen, Xin-Ming; Brengman, Joan; Neubauer, David; Sine, Steven M; Engel, Andrew G

    2016-02-12

    We identify two heteroallelic mutations in the acetylcholine receptor δ-subunit from a patient with severe myasthenic symptoms since birth: a novel δD140N mutation in the signature Cys-loop and a mutation in intron 7 of the δ-subunit gene that disrupts splicing of exon 8. The mutated Asp residue, which determines the disease phenotype, is conserved in all eukaryotic members of the Cys-loop receptor superfamily. Studies of the mutant acetylcholine receptor expressed in HEK 293 cells reveal that δD140N attenuates cell surface expression and apparent channel gating, predicting a reduced magnitude and an accelerated decay of the synaptic response, thus reducing the safety margin for neuromuscular transmission. Substituting Asn for Asp at equivalent positions in the α-, β-, and ϵ-subunits also suppresses apparent channel gating, but the suppression is much greater in the α-subunit. Mutant cycle analysis applied to single and pairwise mutations reveals that αAsp-138 is energetically coupled to αArg-209 in the neighboring pre-M1 domain. Our findings suggest that the conserved αAsp-138 and αArg-209 contribute to a principal pathway that functionally links the ligand binding and pore domains. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Augmented macrophage differentiation and polarization of tumor-associated macrophages towards M1 subtype in listeria-administered tumor-bearing host.

    PubMed

    Rai, Rakesh K; Vishvakarma, Naveen K; Mohapatra, Tribhuban M; Singh, Sukh Mahendra

    2012-09-01

    This study investigates the effect of Listeria administration on differentiation of macrophages from precursor bone marrow cells and functional status of tumor-associated macrophages (TAM). Listeria administration not only resulted in an augmented infiltration of tumor by F4/80 macrophages but also repolarized the functional status of TAM displaying features of some M1 macrophage subtype with upregulated phagocytosis and tumoricidal activity accompanied by altered expression of monocarboxylate transporter-1, toll-like receptor-2, surface markers: CD11c, interleukin-2 receptor, CD62L, and secreted molecules: nitric oxide, interleukin (IL)-1, IL-6, tumor necrosis factor-α, and vascular endothelial growth factor. Declined tumor cell survival and modulated repertoire of cytokines: interferon-γ, IL-6, IL-10, and transforming growth factor-β in tumor microenvironment indicated their role in polarization of TAM towards proinflammatory state. Bone marrow cell of Listeria-administered tumor-bearing mice showed augmented survival, declined expression of p53 upregulated modulator of apoptosis with an upregulated differentiation into activation responsive bone marrow-derived macrophages along with altered expression of macrophage-colony stimulating factor, macrophage-colony stimulating factor receptor, and granulocyte macrophage-colony stimulating factor receptor. These findings indicate that Listeria infection is associated with an augmented differentiation of macrophages accompanied by tumoricidal activation of TAM.

  17. Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses.

    PubMed

    Hendricks, Gabriel L; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C; Viswanathan, Karthik; Albers, Leila; Comolli, James C; Shriver, Zachary; Knipe, David M; Kurt-Jones, Evelyn A; Fygenson, Deborah K; Trevejo, Jose M; Wang, Jennifer P; Finberg, Robert W

    2015-04-01

    Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as 'molecular sinks' and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Magnetically-refreshable receptor platform structures for reusable nano-biosensor chips

    NASA Astrophysics Data System (ADS)

    Yoo, Haneul; Lee, Dong Jun; Cho, Dong-guk; Park, Juhun; Nam, Ki Wan; Tak Cho, Young; Park, Jae Yeol; Chen, Xing; Hong, Seunghun

    2016-01-01

    We developed a magnetically-refreshable receptor platform structure which can be integrated with quite versatile nano-biosensor structures to build reusable nano-biosensor chips. This structure allows one to easily remove used receptor molecules from a biosensor surface and reuse the biosensor for repeated sensing operations. Using this structure, we demonstrated reusable immunofluorescence biosensors. Significantly, since our method allows one to place receptor molecules very close to a nano-biosensor surface, it can be utilized to build reusable carbon nanotube transistor-based biosensors which require receptor molecules within a Debye length from the sensor surface. Furthermore, we also show that a single sensor chip can be utilized to detect two different target molecules simply by replacing receptor molecules using our method. Since this method does not rely on any chemical reaction to refresh sensor chips, it can be utilized for versatile biosensor structures and virtually-general receptor molecular species.

  19. Type III Nrg1 Back Signaling Enhances Functional TRPV1 along Sensory Axons Contributing to Basal and Inflammatory Thermal Pain Sensation

    PubMed Central

    Canetta, Sarah E.; Luca, Edlira; Pertot, Elyse; Role, Lorna W.; Talmage, David A.

    2011-01-01

    Type III Nrg1, a member of the Nrg1 family of signaling proteins, is expressed in sensory neurons, where it can signal in a bi-directional manner via interactions with the ErbB family of receptor tyrosine kinases (ErbB RTKs) [1]. Type III Nrg1 signaling as a receptor (Type III Nrg1 back signaling) can acutely activate phosphatidylinositol-3-kinase (PtdIns3K) signaling, as well as regulate levels of α7* nicotinic acetylcholine receptors, along sensory axons [2]. Transient receptor potential vanilloid 1 (TRPV1) is a cation-permeable ion channel found in primary sensory neurons that is necessary for the detection of thermal pain and for the development of thermal hypersensitivity to pain under inflammatory conditions [3]. Cell surface expression of TRPV1 can be enhanced by activation of PtdIns3K [4], [5], [6], making it a potential target for regulation by Type III Nrg1. We now show that Type III Nrg1 signaling in sensory neurons affects functional axonal TRPV1 in a PtdIns3K-dependent manner. Furthermore, mice heterozygous for Type III Nrg1 have specific deficits in their ability to respond to noxious thermal stimuli and to develop capsaicin-induced thermal hypersensitivity to pain. Cumulatively, these results implicate Type III Nrg1 as a novel regulator of TRPV1 and a molecular mediator of nociceptive function. PMID:21949864

  20. Initiation of the TLR4 signal transduction network : deeper understanding for better therapeutics.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Branda, Steven S.; Hayden, Carl C.; Sherman, Michael Y.

    2010-09-01

    The innate immune system represents our first line of defense against microbial pathogens, and in many cases is activated by recognition of pathogen cellular components (dsRNA, flagella, LPS, etc.) by cell surface membrane proteins known as toll-like receptors (TLRs). As the initial trigger for innate immune response activation, TLRs also represent a means by which we can effectively control or modulate inflammatory responses. This proposal focused on TLR4, which is the cell-surface receptor primarily responsible for initiating the innate immune response to lipopolysaccharide (LPS), a major component of the outer membrane envelope of gram-negative bacteria. The goal was to bettermore » understand TLR4 activation and associated membrane proximal events, in order to enhance the design of small molecule therapeutics to modulate immune activation. Our approach was to reconstitute the receptor in biomimetic systems in-vitro to allow study of the structure and dynamics with biophysical methods. Structural studies were initiated in the first year but were halted after the crystal structure of the dimerized receptor was published early in the second year of the program. Methods were developed to determine the association constant for oligomerization of the soluble receptor. LPS-induced oligomerization was observed to be a strong function of buffer conditions. In 20 mM Tris pH 8.0 with 200 mM NaCl, the onset of receptor oligomerization occurred at 0.2 uM TLR4/MD2 with E coli LPS Ra mutant in excess. However, in the presence of 0.5 uM CD14 and 0.5 uM LBP, the onset of receptor oligomerization was observed to be less than 10 nM TLR4/MD2. Several methods were pursued to study LPS-induced oligomerization of the membrane-bound receptor, including CryoEM, FRET, colocalization and codiffusion followed by TIRF, and fluorescence correlation spectroscopy. However, there approaches met with only limited success.« less

Top