Sample records for t-cell-dependent protective immunity

  1. CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

    PubMed Central

    Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

    1999-01-01

    Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

  2. Antigen-Specific CD8+ T Cells and Protective Immunity to Tuberculosis

    PubMed Central

    2017-01-01

    The continuing HIV/AIDS epidemic and the spread of multi-drug resistant Mycobacterium tuberculosis has led to the perpetuation of the worldwide tuberculosis epidemic. While M. bovis BCG is widely used as a vaccine, it lacks efficacy in preventing pulmonary tuberculosis in adults [1]. To combat this ongoing scourge, vaccine development for tuberculosis is a global priority. Most infected individuals develop long-lived protective immunity, which controls and contains M. tuberculosis in a T cell-dependent manner. An effective T cells response determines whether the infection resolves or develops into clinically evident disease. Consequently, there is great interest in determining which T cells subsets mediate anti-mycobacterial immunity, delineating their effector functions, and evaluating whether vaccination can elicit these T cells subsets and induce protective immunity. CD4+ T cells are critical for resistance to M. tuberculosis in both humans and rodent models. CD4+ T cells are required to control the initial infection as well as to prevent recrudescence in both humans and mice [2]. While it is generally accepted that class II MHC-restricted CD4+ T cells are essential for immunity to tuberculosis, M. tuberculosis infection elicits CD8+ T cells responses in both people and in experimental animals. CD8+ T cells are also recruited to the lung during M. tuberculosis infection and are found in the granulomas of infected people. Thus, how CD8+ T cells contribute to overall immunity to tuberculosis and whether antigens recognized by CD8+ T cells would enhance the efficacy of vaccine strategies continue to be important questions. PMID:23468108

  3. Immune signatures of protective spleen memory CD8 T cells.

    PubMed

    Brinza, Lilia; Djebali, Sophia; Tomkowiak, Martine; Mafille, Julien; Loiseau, Céline; Jouve, Pierre-Emmanuel; de Bernard, Simon; Buffat, Laurent; Lina, Bruno; Ottmann, Michèle; Rosa-Calatrava, Manuel; Schicklin, Stéphane; Bonnefoy, Nathalie; Lauvau, Grégoire; Grau, Morgan; Wencker, Mélanie; Arpin, Christophe; Walzer, Thierry; Leverrier, Yann; Marvel, Jacqueline

    2016-11-24

    Memory CD8 T lymphocyte populations are remarkably heterogeneous and differ in their ability to protect the host. In order to identify the whole range of qualities uniquely associated with protective memory cells we compared the gene expression signatures of two qualities of memory CD8 T cells sharing the same antigenic-specificity: protective (Influenza-induced, Flu-TM) and non-protective (peptide-induced, TIM) spleen memory CD8 T cells. Although Flu-TM and TIM express classical phenotypic memory markers and are polyfunctional, only Flu-TM protects against a lethal viral challenge. Protective memory CD8 T cells express a unique set of genes involved in migration and survival that correlate with their unique capacity to rapidly migrate within the infected lung parenchyma in response to influenza infection. We also enlighten a new set of poised genes expressed by protective cells that is strongly enriched in cytokines and chemokines such as Ccl1, Ccl9 and Gm-csf. CCL1 and GM-CSF genes are also poised in human memory CD8 T cells. These immune signatures are also induced by two other pathogens (vaccinia virus and Listeria monocytogenes). The immune signatures associated with immune protection were identified on circulating cells, i.e. those that are easily accessible for immuno-monitoring and could help predict vaccines efficacy.

  4. Discovering naturally processed antigenic determinants that confer protective T cell immunity

    PubMed Central

    Gilchuk, Pavlo; Spencer, Charles T.; Conant, Stephanie B.; Hill, Timothy; Gray, Jennifer J.; Niu, Xinnan; Zheng, Mu; Erickson, John J.; Boyd, Kelli L.; McAfee, K. Jill; Oseroff, Carla; Hadrup, Sine R.; Bennink, Jack R.; Hildebrand, William; Edwards, Kathryn M.; Crowe, James E.; Williams, John V.; Buus, Søren; Sette, Alessandro; Schumacher, Ton N.M.; Link, Andrew J.; Joyce, Sebastian

    2013-01-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection — information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I–transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences. PMID:23543059

  5. Discovering naturally processed antigenic determinants that confer protective T cell immunity.

    PubMed

    Gilchuk, Pavlo; Spencer, Charles T; Conant, Stephanie B; Hill, Timothy; Gray, Jennifer J; Niu, Xinnan; Zheng, Mu; Erickson, John J; Boyd, Kelli L; McAfee, K Jill; Oseroff, Carla; Hadrup, Sine R; Bennink, Jack R; Hildebrand, William; Edwards, Kathryn M; Crowe, James E; Williams, John V; Buus, Søren; Sette, Alessandro; Schumacher, Ton N M; Link, Andrew J; Joyce, Sebastian

    2013-05-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection - information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I-transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences.

  6. Differential Requirements for T Cells in Viruslike Particle- and Rotavirus-Induced Protective Immunity▿

    PubMed Central

    Blutt, Sarah E.; Warfield, Kelly L.; Estes, Mary K.; Conner, Margaret E.

    2008-01-01

    Correlates of protection from rotavirus infection are controversial. We compared the roles of B and T lymphocytes in protective immunity induced either by intranasally administered nonreplicating viruslike particles or inactivated virus or by orally administered murine rotavirus. We found that protection induced by nonreplicating vaccines requires CD4+ T cells and CD40/CD40L. In contrast, T cells were not required for short-term protective immunity induced by infection, but both T-cell-dependent and -independent mechanisms contributed to long-term maintenance of protection. Our findings indicate that more than one marker of protective immunity exists and that these markers depend on the vaccine that is administered. PMID:18184712

  7. Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

    PubMed Central

    Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

    1999-01-01

    Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

  8. Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection

    PubMed Central

    Duan, Susu; Thomas, Paul G.

    2016-01-01

    Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022

  9. CD70 encoded by modified vaccinia virus Ankara enhances CD8 T-cell-dependent protective immunity in MHC class II-deficient mice.

    PubMed

    Bathke, Barbara; Pätzold, Juliane; Kassub, Ronny; Giessel, Raphael; Lämmermann, Kerstin; Hinterberger, Maria; Brinkmann, Kay; Chaplin, Paul; Suter, Mark; Hochrein, Hubertus; Lauterbach, Henning

    2017-12-27

    The immunological outcome of infections and vaccinations is largely determined during the initial first days in which antigen-presenting cells instruct T cells to expand and differentiate into effector and memory cells. Besides the essential stimulation of the T-cell receptor complex a plethora of co-stimulatory signals not only ensures a proper T-cell activation but also instils phenotypic and functional characteristics in the T cells appropriate to fight off the invading pathogen. The tumour necrosis factor receptor/ligand pair CD27/CD70 gained a lot of attention because of its key role in regulating T-cell activation, survival, differentiation and maintenance, especially in the course of viral infections and cancer. We sought to investigate the role of CD70 co-stimulation for immune responses induced by the vaccine vector modified vaccinia virus Ankara-Bavarian Nordic ® (MVA-BN ® ). Short-term blockade of CD70 diminished systemic CD8 T-cell effector and memory responses in mice. The dependence on CD70 became even more apparent in the lungs of MHC class II-deficient mice. Importantly, genetically encoded CD70 in MVA-BN ® not only increased CD8 T-cell responses in wild-type mice but also substituted for CD4 T-cell help. MHC class II-deficient mice that were immunized with recombinant MVA-CD70 were fully protected against a lethal virus infection, whereas MVA-BN ® -immunized mice failed to control the virus. These data are in line with CD70 playing an important role for vaccine-induced CD8 T-cell responses and prove the potency of integrating co-stimulatory molecules into the MVA-BN ® backbone. © 2017 The Authors. Immunology Published by John Wiley & Sons Ltd.

  10. Memory CD8+ T Cells Protect Dendritic Cells from CTL Killing1

    PubMed Central

    Watchmaker, Payal B.; Urban, Julie A.; Berk, Erik; Nakamura, Yutaro; Mailliard, Robbie B.; Watkins, Simon C.; van Ham, S. Marieke; Kalinski, Pawel

    2010-01-01

    CD8+ T cells have been shown to be capable of either suppressing or promoting immune responses. To reconcile these contrasting regulatory functions, we compared the ability of human effector and memory CD8+ T cells to regulate survival and functions of dendritic cells (DC). We report that, in sharp contrast to the effector cells (CTLs) that kill DCs in a granzyme B- and perforin-dependent mechanism, memory CD8+ T cells enhance the ability of DCs to produce IL-12 and to induce functional Th1 and CTL responses in naive CD4+ and CD8+ T cell populations. Moreover, memory CD8+ T cells that release the DC-activating factor TNF-α before the release of cytotoxic granules induce DC expression of an endogenous granzyme B inhibitor PI-9 and protect DCs from CTL killing with similar efficacy as CD4+ Th cells. The currently identified DC-protective function of memory CD8+ T cells helps to explain the phenomenon of CD8+ T cell memory, reduced dependence of recall responses on CD4+ T cell help, and the importance of delayed administration of booster doses of vaccines for the optimal outcome of immunization. PMID:18322193

  11. Transcutaneous immunization with a novel imiquimod nanoemulsion induces superior T cell responses and virus protection.

    PubMed

    Lopez, Pamela Aranda; Denny, Mark; Hartmann, Ann-Kathrin; Alflen, Astrid; Probst, Hans Christian; von Stebut, Esther; Tenzer, Stefan; Schild, Hansjörg; Stassen, Michael; Langguth, Peter; Radsak, Markus P

    2017-09-01

    Transcutaneous immunization (TCI) is a novel vaccination strategy utilizing the skin associated lymphatic tissue to induce immune responses. TCI using a cytotoxic T lymphocyte (CTL) epitope and the Toll-like receptor 7 (TLR7) agonist imiquimod mounts strong CTL responses by activation and maturation of skin-derived dendritic cells (DCs) and their migration to lymph nodes. However, TCI based on the commercial formulation Aldara only induces transient CTL responses that needs further improvement for the induction of durable therapeutic immune responses. Therefore we aimed to develop a novel imiquimod solid nanoemulsion (IMI-Sol) for TCI with superior vaccination properties suited to induce high quality T cell responses for enhanced protection against infections. TCI was performed by applying a MHC class I or II restricted epitope along with IMI-Sol or Aldara (each containing 5% Imiquimod) on the shaved dorsum of C57BL/6, IL-1R, Myd88, Tlr7 or Ccr7 deficient mice. T cell responses as well as DC migration upon TCI were subsequently analyzed by flow cytometry. To determine in vivo efficacy of TCI induced immune responses, CTL responses and frequency of peptide specific T cells were evaluated on day 8 or 35 post vaccination and protection in a lymphocytic choriomeningitis virus (LCMV) infection model was assessed. TCI with the imiquimod formulation IMI-Sol displayed equal skin penetration of imiquimod compared to Aldara, but elicited superior CD8 + as well as CD4 + T cell responses. The induction of T-cell responses induced by IMI-Sol TCI was dependent on the TLR7/MyD88 pathway and independent of IL-1R. IMI-Sol TCI activated skin-derived DCs in skin-draining lymph nodes more efficiently compared to Aldara leading to enhanced protection in a LCMV infection model. Our data demonstrate that IMI-Sol TCI can overcome current limitations of previous imiquimod based TCI approaches opening new perspectives for transcutaneous vaccination strategies and allowing the use of this

  12. Costimulatory Effects of an Immunodominant Parasite Antigen Paradoxically Prevent Induction of Optimal CD8 T Cell Protective Immunity.

    PubMed

    Eickhoff, Christopher S; Zhang, Xiuli; Vasconcelos, Jose R; Motz, R Geoffrey; Sullivan, Nicole L; O'Shea, Kelly; Pozzi, Nicola; Gohara, David W; Blase, Jennifer R; Di Cera, Enrico; Hoft, Daniel F

    2016-09-01

    Trypanosoma cruzi infection is controlled but not eliminated by host immunity. The T. cruzi trans-sialidase (TS) gene superfamily encodes immunodominant protective antigens, but expression of altered peptide ligands by different TS genes has been hypothesized to promote immunoevasion. We molecularly defined TS epitopes to determine their importance for protection versus parasite persistence. Peptide-pulsed dendritic cell vaccination experiments demonstrated that one pair of immunodominant CD4+ and CD8+ TS peptides alone can induce protective immunity (100% survival post-lethal parasite challenge). TS DNA vaccines have been shown by us (and others) to protect BALB/c mice against T. cruzi challenge. We generated a new TS vaccine in which the immunodominant TS CD8+ epitope MHC anchoring positions were mutated, rendering the mutant TS vaccine incapable of inducing immunity to the immunodominant CD8 epitope. Immunization of mice with wild type (WT) and mutant TS vaccines demonstrated that vaccines encoding enzymatically active protein and the immunodominant CD8+ T cell epitope enhance subdominant pathogen-specific CD8+ T cell responses. More specifically, CD8+ T cells from WT TS DNA vaccinated mice were responsive to 14 predicted CD8+ TS epitopes, while T cells from mutant TS DNA vaccinated mice were responsive to just one of these 14 predicted TS epitopes. Molecular and structural biology studies revealed that this novel costimulatory mechanism involves CD45 signaling triggered by enzymatically active TS. This enhancing effect on subdominant T cells negatively regulates protective immunity. Using peptide-pulsed DC vaccination experiments, we have shown that vaccines inducing both immunodominant and subdominant epitope responses were significantly less protective than vaccines inducing only immunodominant-specific responses. These results have important implications for T. cruzi vaccine development. Of broader significance, we demonstrate that increasing breadth of T

  13. CD8+ memory T-cell inflation renders compromised CD4+ T-cell-dependent CD8+ T-cell immunity via naïve T-cell anergy.

    PubMed

    Xu, Aizhang; Freywald, Andrew; Xie, Yufeng; Li, Zejun; Xiang, Jim

    2017-01-01

    Whether inflation of CD8 + memory T (mT) cells, which is often derived from repeated prime-boost vaccinations or chronic viral infections in the elderly, would affect late CD8 + T-cell immunity is a long-standing paradox. We have previously established an animal model with mT-cell inflation by transferring ConA-stimulated monoclonal CD8 + T cells derived from Ova-specific T-cell-receptor transgenic OTI mice into irradiation-induced lymphopenic B6 mice. In this study, we also established another two animal models with mT-cell inflation by transferring, 1) ConA-stimulated monoclonal CD8 + T cells derived from lymphocytic choriomeningitis virus glycoprotein-specific T-cell-receptor transgenic P14 mice, and 2) ConA-stimulated polyclonal CD8 + T cells derived from B6.1 mice into B6 mice with irradiation-induced lymphopenia. We vaccinated these mice with recombinant Ova-expressing Listeria monocytogenes and Ova-pulsed dendritic cells, which stimulated CD4 + T cell-independent and CD4 + T-cell-dependent CD8 + T-cell responses, respectively, and assessed Ova-specific CD8 + T-cell responses by flow cytometry. We found that Ova-specific CD8 + T-cell responses derived from the latter but not the former vaccination were significantly reduced in mice with CD8 + mT-cell inflation compared to wild-type B6 mice. We determined that naïve CD8 + T cells purified from splenocytes of mice with mT-cell inflation had defects in cell proliferation upon stimulation in vitro and in vivo and upregulated T-cell anergy-associated Itch and GRAIL molecules. Taken together, our data reveal that CD8 + mT-cell inflation renders compromised CD4 + T-cell-dependent CD8 + T-cell immunity via naïve T-cell anergy, and thus show promise for the design of efficient vaccines for elderly patients with CD8 + mT-cell inflation.

  14. Knockdown of HMGB1 in tumor cells attenuates their ability to induce regulatory T cells and uncovers naturally acquired CD8 T cell-dependent antitumor immunity.

    PubMed

    Liu, Zuqiang; Falo, Louis D; You, Zhaoyang

    2011-07-01

    Although high mobility group box 1 (HMGB1) in tumor cells is involved in many aspects of tumor progression, its role in tumor immune suppression remains elusive. Host cell-derived IL-10 suppressed a naturally acquired CD8 T cell-dependent antitumor response. The suppressive activity of tumor-associated Foxp3(+)CD4(+)CD25(+) regulatory T cells (Treg) was IL-10 dependent. Neutralizing HMGB1 impaired tumor cell-promoted IL-10 production by Treg. Short hairpin RNA-mediated knockdown of HMGB1 (HMGB1 KD) in tumor cells did not affect tumor cell growth but uncovered naturally acquired long-lasting tumor-specific IFN-γ- or TNF-α-producing CD8 T cell responses and attenuated their ability to induce Treg, leading to naturally acquired CD8 T cell- or IFN-γ-dependent tumor rejection. The data suggest that tumor cell-derived HMGB1 may suppress naturally acquired CD8 T cell-dependent antitumor immunity via enhancing Treg to produce IL-10, which is necessary for Treg-mediated immune suppression.

  15. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection

    PubMed Central

    Aranyos, Alek M.; Roff, Shannon R.; Pu, Riuyu; Owen, Jennifer L.; Coleman, James K.; Yamamoto, Janet K.

    2016-01-01

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A–T) conferred a protection rate of 87% (13 of 15, p<0.001) against FIVPet using FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers >13×106 cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4+ and CD8+ T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1

  16. Toxoplasma gondii Antigen-Pulsed-Dendritic Cell-Derived Exosomes Induce a Protective Immune Response against T. gondii Infection

    PubMed Central

    Aline, Fleur; Bout, Daniel; Amigorena, Sébastian; Roingeard, Philippe; Dimier-Poisson, Isabelle

    2004-01-01

    It was previously demonstrated that immunizing mice with spleen dendritic cells (DCs) that had been pulsed ex vivo with Toxoplasma gondii antigens triggers a systemic Th1-biased specific immune response and induces protection against infection. T. gondii can cause severe sequelae in the fetuses of mothers who acquire the infection during pregnancy, as well as life-threatening neuropathy in immunocompromised patients, in particular those with AIDS. Here, we investigate the efficacy of a novel cell-free vaccine composed of DC exosomes, which are secreted antigen-presenting vesicles that express functional major histocompatibility complex class I and II and T-cell-costimulatory molecules. They have already been shown to induce potent antitumor immune responses. We investigated the potential of DC2.4 cell line-derived exosomes to induce protective immunity against toxoplasmosis. Our data show that most adoptively transferred T. gondii-pulsed DC-derived exosomes were transferred to the spleen, elicited a strong systemic Th1-modulated Toxoplasma-specific immune response in vivo, and conferred good protection against infection. These findings support the possibility that DC-derived exosomes can be used for T. gondii immunoprophylaxis and for immunoprophylaxis against many other pathogens. PMID:15213158

  17. Skin-resident memory CD4+ T cells enhance protection against Leishmania major infection.

    PubMed

    Glennie, Nelson D; Yeramilli, Venkata A; Beiting, Daniel P; Volk, Susan W; Weaver, Casey T; Scott, Phillip

    2015-08-24

    Leishmaniasis causes a significant disease burden worldwide. Although Leishmania-infected patients become refractory to reinfection after disease resolution, effective immune protection has not yet been achieved by human vaccines. Although circulating Leishmania-specific T cells are known to play a critical role in immunity, the role of memory T cells present in peripheral tissues has not been explored. Here, we identify a population of skin-resident Leishmania-specific memory CD4+ T cells. These cells produce IFN-γ and remain resident in the skin when transplanted by skin graft onto naive mice. They function to recruit circulating T cells to the skin in a CXCR3-dependent manner, resulting in better control of the parasites. Our findings are the first to demonstrate that CD4+ TRM cells form in response to a parasitic infection, and indicate that optimal protective immunity to Leishmania, and thus the success of a vaccine, may depend on generating both circulating and skin-resident memory T cells. © 2015 Glennie et al.

  18. Skin-resident memory CD4+ T cells enhance protection against Leishmania major infection

    PubMed Central

    Glennie, Nelson D.; Yeramilli, Venkata A.; Beiting, Daniel P.; Volk, Susan W.; Weaver, Casey T.

    2015-01-01

    Leishmaniasis causes a significant disease burden worldwide. Although Leishmania-infected patients become refractory to reinfection after disease resolution, effective immune protection has not yet been achieved by human vaccines. Although circulating Leishmania-specific T cells are known to play a critical role in immunity, the role of memory T cells present in peripheral tissues has not been explored. Here, we identify a population of skin-resident Leishmania-specific memory CD4+ T cells. These cells produce IFN-γ and remain resident in the skin when transplanted by skin graft onto naive mice. They function to recruit circulating T cells to the skin in a CXCR3-dependent manner, resulting in better control of the parasites. Our findings are the first to demonstrate that CD4+ TRM cells form in response to a parasitic infection, and indicate that optimal protective immunity to Leishmania, and thus the success of a vaccine, may depend on generating both circulating and skin-resident memory T cells. PMID:26216123

  19. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection.

    PubMed

    Aranyos, Alek M; Roff, Shannon R; Pu, Ruiyu; Owen, Jennifer L; Coleman, James K; Yamamoto, Janet K

    2016-03-14

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A-T) conferred a protection rate of 87% (13 of 15, p < 0.001) against FIVPet using the FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers > 13 × 10(6) cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4(+) and CD8(+) T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and

  20. Role of CD4+ T cells in a protective immune response against Cryptococcus neoformans in the central nervous system.

    PubMed

    Uicker, William C; McCracken, James P; Buchanan, Kent L

    2006-02-01

    Cryptococcosis is a life-threatening disease caused by the encapsulated yeast, Cryptococcus neoformans. Although infection with C. neoformans is initiated in the lungs, morbidity and mortality is mostly associated with infections of the central nervous system (CNS). Individuals with deficiencies in cell-mediated immunity, such as patients with AIDS, are more susceptible to disseminated cryptococcosis, highlighting the importance of cell-mediated immunity and CD4+ T cells in host resistance against C. neoformans. Using a mouse model of cryptococcal meningoencephalitis, we have shown that immunization of mice with a cryptococcal antigen induced a protective immune response that crossed the blood-brain barrier and initiated an immune response directly in the CNS if C. neoformans was present. The regional protective response was characteristic of a Type-1 (Th1) response in the types of cells present at the site of infection and in the cytokines and chemokines expressed. Here, we extend those findings and report that CD4+ T cells are required for survival of immune mice infected directly in the brain with C. neoformans and sensitized CD4 + T cells can transfer partial protection to naive mice infected intracerebrally with C. neoformans. Furthermore, CD4 + T cells were also important for optimal infiltration of inflammatory cells at the site of infection and in the expression of cytokines and chemokines associated with protection in the brain. Lastly, CD4+ T cells were required for optimal regional production and secretion of IFNgamma and in the significantly increased expression of iNOS in C. neoformans-infected brains of immune mice.

  1. CD4+ T Cells Mediate Aspergillosis Vaccine Protection.

    PubMed

    Diaz-Arevalo, Diana; Kalkum, Markus

    2017-01-01

    Adaptive effector CD4 + T cells play essential roles in the defense against fungal infections, especially against invasive aspergillosis (IA). Such protective CD4 + T cells can be generated through immunization with specialized antifungal vaccines, as has been demonstrated for pulmonary Aspergillus fumigatus infections in mouse experiments. Adaptive transfer of fungal antigen-specific CD4 + T cells conferred protection onto non-immunized naive mice, an experimental approach that could potentially become a future treatment option for immunosuppressed IA patients, focusing on the ultimate goal to improve their otherwise dim chances for survival. Here, we describe the different techniques to analyze CD4 + T cell immune responses after immunization with a recombinant fungal protein. We present three major methods that are used to analyze the role of CD4 + T cells in protection against A. fumigatus challenge. They include (1) transplantation of CD4 + T cells from vaccinated mice into immunosuppressed naive mice, observing increasing protection of the cell recipients, (2) depletion of CD4 + T cells from vaccinated mice, which abolishes vaccine protection, and (3) T cell proliferation studies following stimulation with overlapping synthetic peptides or an intact protein vaccine. The latter can be used to validate immunization status and to identify protective T cell epitopes in vaccine antigens. In the methods detailed here, we used versions of the well-studied Asp f3 protein expressed in a bacterial host, either as the intact full length protein or its N-terminally truncated version, comprised of residues 15-168. However, these methods are generally applicable and can well be adapted to study other protein-based subunit vaccines.

  2. Natural killer cells regulate T cell immune responses in primary biliary cirrhosis.

    PubMed

    Shimoda, Shinji; Hisamoto, Satomi; Harada, Kenichi; Iwasaka, Sho; Chong, Yong; Nakamura, Minoru; Bekki, Yuki; Yoshizumi, Tomoharu; Shirabe, Ken; Ikegami, Toru; Maehara, Yoshihiko; He, Xiao-Song; Gershwin, M Eric; Akashi, Koichi

    2015-12-01

    The hallmark of primary biliary cirrhosis (PBC) is the presence of autoreactive T- and B-cell responses that target biliary epithelial cells (BECs). Biliary cell cytotoxicity is dependent upon initiation of innate immune responses followed by chronic adaptive, as well as bystander, mechanisms. Critical to these mechanisms are interactions between natural killer (NK) cells and BECs. We have taken advantage of the ability to isolate relatively pure viable preparations of liver-derived NK cells, BECs, and endothelial cells, and studied interactions between NK cells and BECs and focused on the mechanisms that activate autoreactive T cells, their dependence on interferon (IFN)-γ, and expression of BEC major histocompatibility complex (MHC) class I and II molecules. Here we show that at a high NK/BEC ratio, NK cells are cytotoxic for autologous BECs, but are not dependent on autoantigen, yet still activate autoreactive CD4(+) T cells in the presence of antigen presenting cells. In contrast, at a low NK/BEC ratio, BECs are not lysed, but IFN-γ production is induced, which facilitates expression of MHC class I and II molecules on BEC and protects them from lysis upon subsequent exposure to autoreactive NK cells. Furthermore, IFN-γ secreted from NK cells after exposure to autologous BECs is essential for this protective function and enables autoreactive CD4(+) T cells to become cytopathic. NK cell-mediated innate immune responses are likely critical at the initial stage of PBC, but also facilitate and maintain the chronic cytopathic effect of autoantigen-specific T cells, essential for progression of disease. © 2015 by the American Association for the Study of Liver Diseases.

  3. Involvement of CD8+ T cell-mediated immune responses in LcrV DNA vaccine induced protection against lethal Yersinia pestis challenge.

    PubMed

    Wang, Shixia; Goguen, Jon D; Li, Fusheng; Lu, Shan

    2011-09-09

    Yersinia pestis (Y. pestis) is the causative pathogen of plague, a highly fatal disease for which an effective vaccine, especially against mucosal transmission, is still not available. Like many bacterial infections, antigen-specific antibody responses have been traditionally considered critical, if not solely responsible, for vaccine-induced protection against Y. pestis. Studies in recent years have suggested the importance of T cell immune responses against Y. pestis infection but information is still limited about the details of Y. pestis antigen-specific T cell immune responses. In current report, studies are conducted to identify the presence of CD8+ T cell epitopes in LcrV protein, the leading antigen of plague vaccine development. Furthermore, depletion of CD8+ T cells in LcrV DNA vaccinated Balb/C mice led to reduced protection against lethal intranasal challenge of Y. pestis. These findings establish that an LcrV DNA vaccine is able to elicit CD8+ T cell immune responses against specific epitopes of this key plague antigen and that a CD8+ T cell immune response is involved in LcrV DNA vaccine-elicited protection. Future studies in plague vaccine development will need to examine if the presence of detectable T cell immune responses, in particular CD8+ T-cell immune responses, will enhance the protection against Y. pestis in higher animal species or humans. Copyright © 2010 Elsevier Ltd. All rights reserved.

  4. Tailored immune responses: novel effector helper T cell subsets in protective immunity.

    PubMed

    Kara, Ervin E; Comerford, Iain; Fenix, Kevin A; Bastow, Cameron R; Gregor, Carly E; McKenzie, Duncan R; McColl, Shaun R

    2014-02-01

    Differentiation of naïve CD4⁺ cells into functionally distinct effector helper T cell subsets, characterised by distinct "cytokine signatures," is a cardinal strategy employed by the mammalian immune system to efficiently deal with the rapidly evolving array of pathogenic microorganisms encountered by the host. Since the T(H)1/T(H)2 paradigm was first described by Mosmann and Coffman, research in the field of helper T cell biology has grown exponentially with seven functionally unique subsets having now been described. In this review, recent insights into the molecular mechanisms that govern differentiation and function of effector helper T cell subsets will be discussed in the context of microbial infections, with a focus on how these different helper T cell subsets orchestrate immune responses tailored to combat the nature of the pathogenic threat encountered.

  5. CD4(+) T-cell help amplifies innate signals for primary CD8(+) T-cell immunity.

    PubMed

    Bedoui, Sammy; Heath, William R; Mueller, Scott N

    2016-07-01

    CD8(+) T cells provide an important component of protection against intracellular infections and cancer. Immune responses by these T cells involve a primary phase of effector expansion and differentiation, followed by a contraction phase leading to memory formation and, if antigen is re-encountered, a secondary expansion phase with more rapid differentiation. Both primary and secondary phases of CD8(+) T-cell immunity have been shown to depend on CD4(+) T-cell help, although during certain infections the primary phase is variable in this requirement. One explanation for such variability relates to the strength of associated inflammatory signals, with weak signals requiring help. Here, we focus on our studies that have dissected the requirements for help in the primary phase of the CTL response to herpes simplex virus, elucidating intricate interactions and communications between CD4(+) T cells, various dendritic cell subsets, and CD8(+) T cells. We place our studies in the context of others and describe a simple model of help where CD40 signaling amplifies innate signals to enable efficient CD8(+) T-cell expansion and differentiation. This model facilitates CTL induction to various different agents, without altering the qualitative innate signals that direct other important arms of immunity. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Formalin-Inactivated Coxiella burnetii Phase I Vaccine-Induced Protection Depends on B Cells To Produce Protective IgM and IgG

    PubMed Central

    Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan

    2013-01-01

    To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296

  7. Critical role of SAP in progression and reactivation but not maintenance of T cell-dependent humoral immunity.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-03-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (T(FH)) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway.

  8. Critical Role of SAP in Progression and Reactivation but Not Maintenance of T Cell-Dependent Humoral Immunity

    PubMed Central

    2013-01-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (TFH) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway. PMID:23319045

  9. Unique IL-13Rα2-based HIV-1 vaccine strategy to enhance mucosal immunity, CD8(+) T-cell avidity and protective immunity.

    PubMed

    Ranasinghe, C; Trivedi, S; Stambas, J; Jackson, R J

    2013-11-01

    We have established that mucosal immunization can generate high-avidity human immunodeficiency virus (HIV)-specific CD8(+) T cells compared with systemic immunization, and interleukin (IL)-13 is detrimental to the functional avidity of these T cells. We have now constructed two unique recombinant HIV-1 vaccines that co-express soluble or membrane-bound forms of the IL-13 receptor α2 (IL-13Rα2), which can "transiently" block IL-13 activity at the vaccination site causing wild-type animals to behave similar to an IL-13 KO animal. Following intranasal/intramuscular prime-boost immunization, these IL-13Rα2-adjuvanted vaccines have shown to induce (i) enhanced HIV-specific CD8(+) T cells with higher functional avidity, with broader cytokine/chemokine profiles and greater protective immunity using a surrogate mucosal HIV-1 challenge, and also (ii) excellent multifunctional mucosal CD8(+) T-cell responses, in the lung, genito-rectal nodes (GN), and Peyer's patch (PP). Data revealed that intranasal delivery of these IL-13Rα2-adjuvanted HIV vaccines recruited large numbers of unique antigen-presenting cell subsets to the lung mucosae, ultimately promoting the induction of high-avidity CD8(+) T cells. We believe our novel IL-13R cytokine trap vaccine strategy offers great promise for not only HIV-1, but also as a platform technology against range of chronic infections that require strong sustained high-avidity mucosal/systemic immunity for protection.

  10. Memory T cells maintain protracted protection against malaria.

    PubMed

    Krzych, Urszula; Zarling, Stasya; Pichugin, Alexander

    2014-10-01

    Immunologic memory is one of the cardinal features of antigen-specific immune responses, and the persistence of memory cells contributes to prophylactic immunizations against infectious agents. Adequately maintained memory T and B cell pools assure a fast, effective and specific response against re-infections. However, many aspects of immunologic memory are still poorly understood, particularly immunologic memory inducible by parasites, for example, Plasmodium spp., the causative agents of malaria. For example, memory responses to Plasmodium antigens amongst residents of malaria endemic areas appear to be either inadequately developed or maintained, because persons who survive episodes of childhood malaria remain vulnerable to intermittent malaria infections. By contrast, multiple exposures of humans and laboratory rodents to radiation-attenuated Plasmodium sporozoites (γ-spz) induce sterile and long-lasting protection against experimental sporozoite challenge. Multifactorial immune mechanisms maintain this protracted and sterile protection. While the presence of memory CD4 T cell subsets has been associated with lasting protection in humans exposed to multiple bites from Anopheles mosquitoes infected with attenuated Plasmodium falciparum, memory CD8 T cells maintain protection induced with Plasmodium yoelii and Plasmodium berghei γ-spz in murine models. In this review, we discuss our observations that show memory CD8 T cells specific for antigens expressed by P. berghei liver stage parasites as an indispensable component for the maintenance of protracted protective immunity against experimental malaria infection; moreover, the provision of an Ag-depot assures a quick recall of memory T cells as IFN-γ-producing effector CD8 T cells and IL-4- producing CD4 T cells that collaborate with B cells for an effective antibody response. Published by Elsevier B.V.

  11. Long term protection after immunization with P. berghei sporozoites correlates with sustained IFNγ responses of hepatic CD8+ memory T cells.

    PubMed

    Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W

    2012-01-01

    Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, p<0.0001). The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.

  12. Defective B cell response to T-dependent immunization in lupus-prone mice

    PubMed Central

    Niu, Haitao; Sobel, Eric S.; Morel, Laurence

    2009-01-01

    Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209

  13. Enhanced anti-tumour immunity requires the interplay between resident and circulating memory CD8+ T cells

    PubMed Central

    Enamorado, Michel; Iborra, Salvador; Priego, Elena; Cueto, Francisco J.; Quintana, Juan A.; Martínez-Cano, Sarai; Mejías-Pérez, Ernesto; Esteban, Mariano; Melero, Ignacio; Hidalgo, Andrés; Sancho, David

    2017-01-01

    The goal of successful anti-tumoural immunity is the development of long-term protective immunity to prevent relapse. Infiltration of tumours with CD8+ T cells with a resident memory (Trm) phenotype correlates with improved survival. However, the interplay of circulating CD8+ T cells and Trm cells remains poorly explored in tumour immunity. Using different vaccination strategies that fine-tune the generation of Trm cells or circulating memory T cells, here we show that, while both subsets are sufficient for anti-tumour immunity, the presence of Trm cells improves anti-tumour efficacy. Transferred central memory T cells (Tcm) generate Trm cells following viral infection or tumour challenge. Anti-PD-1 treatment promotes infiltration of transferred Tcm cells within tumours, improving anti-tumour immunity. Moreover, Batf3-dependent dendritic cells are essential for reactivation of circulating memory anti-tumour response. Our findings show the plasticity, collaboration and requirements for reactivation of memory CD8+ T cells subsets needed for optimal tumour vaccination and immunotherapy. PMID:28714465

  14. T-cell-mediated cross-strain protective immunity elicited by prime-boost vaccination with a live attenuated influenza vaccine.

    PubMed

    Li, Junwei; Arévalo, Maria T; Chen, Yanping; Chen, Shan; Zeng, Mingtao

    2014-10-01

    Antigenic drift and shift of influenza viruses require frequent reformulation of influenza vaccines. In addition, seasonal influenza vaccines are often mismatched to the epidemic influenza strains. This stresses the need for a universal influenza vaccine. BALB/c mice were vaccinated with the trivalent live attenuated (LAIV; FluMist) or inactivated (TIV; FluZone) influenza vaccines and challenged with PR8 (H1N1), FM/47 (H1N1), or HK/68 (H3N2) influenza virus. Cytokines and antibody responses were tested by ELISA. Furthermore, different LAIV dosages were applied in BALB/c mice. LAIV vaccinated mice were also depleted of T-cells and challenged with PR8 virus. LAIV induced significant protection against challenge with the non-vaccine strain PR8 influenza virus. Furthermore, protective immunity against PR8 was dose-dependent. Of note, interleukin 2 and interferon gamma cytokine secretion in the lung alveolar fluid were significantly elevated in mice vaccinated with LAIV. Moreover, T-cell depletion of LAIV vaccinated mice compromised protection, indicating that T-cell-mediated immunity is required. In contrast, passive transfer of sera from mice vaccinated with LAIV into naïve mice failed to protect against PR8 challenge. Neutralization assays in vitro confirmed that LAIV did not induce cross-strain neutralizing antibodies against PR8 virus. Finally, we showed that three doses of LAIV also provided protection against challenge with two additional heterologous viruses, FM/47 and HK/68. These results support the potential use of the LAIV as a universal influenza vaccine under a prime-boost vaccination regimen. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Disruption of IL-21 Signaling Affects T Cell-B Cell Interactions and Abrogates Protective Humoral Immunity to Malaria

    PubMed Central

    Pérez-Mazliah, Damián; Ng, Dorothy Hui Lin; Freitas do Rosário, Ana Paula; McLaughlin, Sarah; Mastelic-Gavillet, Béatris; Sodenkamp, Jan; Kushinga, Garikai; Langhorne, Jean

    2015-01-01

    Interleukin-21 signaling is important for germinal center B-cell responses, isotype switching and generation of memory B cells. However, a role for IL-21 in antibody-mediated protection against pathogens has not been demonstrated. Here we show that IL-21 is produced by T follicular helper cells and co-expressed with IFN-γ during an erythrocytic-stage malaria infection of Plasmodium chabaudi in mice. Mice deficient either in IL-21 or the IL-21 receptor fail to resolve the chronic phase of P. chabaudi infection and P. yoelii infection resulting in sustained high parasitemias, and are not immune to re-infection. This is associated with abrogated P. chabaudi-specific IgG responses, including memory B cells. Mixed bone marrow chimeric mice, with T cells carrying a targeted disruption of the Il21 gene, or B cells with a targeted disruption of the Il21r gene, demonstrate that IL-21 from T cells signaling through the IL-21 receptor on B cells is necessary to control chronic P. chabaudi infection. Our data uncover a mechanism by which CD4+ T cells and B cells control parasitemia during chronic erythrocytic-stage malaria through a single gene, Il21, and demonstrate the importance of this cytokine in the control of pathogens by humoral immune responses. These data are highly pertinent for designing malaria vaccines requiring long-lasting protective B-cell responses. PMID:25763578

  16. Skin effector memory T cells do not recirculate and provide immune protection in alemtuzumab-treated CTCL patients.

    PubMed

    Clark, Rachael A; Watanabe, Rei; Teague, Jessica E; Schlapbach, Christoph; Tawa, Marianne C; Adams, Natalie; Dorosario, Andrew A; Chaney, Keri S; Cutler, Corey S; Leboeuf, Nicole R; Carter, Joi B; Fisher, David C; Kupper, Thomas S

    2012-01-18

    Cutaneous T cell lymphoma (CTCL) is a cancer of skin-homing T cells with variants that include leukemic CTCL (L-CTCL), a malignancy of central memory T cells (T(CM)), and mycosis fungoides (MF), a malignancy of skin resident effector memory T cells (T(EM)). We report that low-dose alemtuzumab (αCD52) effectively treated patients with refractory L-CTCL but not MF. Alemtuzumab depleted all T cells in blood and depleted both benign and malignant T(CM) from skin, but a diverse population of skin resident T(EM) remained in skin after therapy. T cell depletion with alemtuzumab required the presence of neutrophils, a cell type frequent in blood but rare in normal skin. These data suggest that T(CM) were depleted because they recirculate between the blood and the skin, whereas skin resident T(EM) were spared because they are sessile and non-recirculating. After alemtuzumab treatment, skin T cells produced lower amounts of interleukin-4 and higher amounts of interferon-γ. Moreover, there was a marked lack of infections in alemtuzumab-treated L-CTCL patients despite the complete absence of T cells in the blood, suggesting that skin resident T(EM) can protect the skin from pathogens even in the absence of T cell recruitment from the circulation. Together, these data suggest that alemtuzumab may treat refractory L-CTCL without severely compromising the immune response to infection by depleting circulating T(CM) but sparing the skin resident T(EM) that provide local immune protection of the skin.

  17. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  18. Synthetic RORγt Agonists Enhance Protective Immunity

    PubMed Central

    Chang, Mi Ra; Dharmarajan, Venkatasubramanian; Doebelin, Christelle; Garcia-Ordonez, Ruben D.; Novick, Scott J.; Kuruvilla, Dana S.; Kamenecka, Theodore M.; Griffin, Patrick R.

    2016-01-01

    The T cell specific RORγ isoform RORγt has been shown to be the key lineage-defining transcription factor to initiate the differentiation program of TH17 and Tc17 cells, cells that have demonstrated anti-tumor efficacy. RORγt controls gene networks that enhance immunity including increased IL17 production and decreased immune suppression. Both synthetic and putative endogenous agonists of RORγt have been shown to increase the basal activity of RORγt enhancing TH17 cell proliferation. Here we show that activation of RORγt using synthetic agonists drives proliferation of TH17 cells while decreasing levels of the immune checkpoint protein PD-1, a mechanism that should enhance anti-tumor immunity while blunting tumor associated adaptive immune resistance. Interestingly, putative endogenous agonists drive proliferation of TH17 cells but do not repress PD-1. These findings suggest that synthetic agonists of RORγt should activate TC17/TH17 cells (with concomitant reduction in the Tregs population), repress PD-1, and produce IL17 in situ (a factor associated with good prognosis in cancer). Enhanced immunity and blockage of immune checkpoints has transformed cancer treatment, thus such a molecule would provide a unique approach for the treatment of cancer. PMID:26785144

  19. Breaking Hepatitis B Virus Tolerance and Inducing Protective Immunity Based on Mimicking T Cell-Independent Antigen.

    PubMed

    Li, Xiaoyan; Ni, Runzhou

    2016-11-01

    There are over 350 million chronic carriers of hepatitis B virus (HBV) in the world, of whom about a third eventually develop severe HBV-related complications. HBV contributes to liver cirrhosis and hepatocellular carcinoma development. Remarkable progress has been made in selective inhibition of HBV replication by nucleoside analogs. However, how to generate protective antibody of HBsAb in HBV-infected patients after HBV-DNA becomes negative still remains a challenge for scientists. In this study, we show that OmpC-HBsAg 'a' epitope chimeric protein vaccine can break HBV tolerance and induce protective immunity in HBV transgenic mice based on mimicking T cell-independent antigen to bypass T cells from the adaptive immune system. The antibodies induced by the vaccine have the ability to prevent HBV virion infection of human hepatocytes.

  20. Skin effector memory T cells do not recirculate and provide immune protection in alemtuzumab-treated CTCL patients

    PubMed Central

    Clark, Rachael A.; Watanabe, Rei; Teague, Jessica E.; Schlapbach, Christoph; Tawa, Marianne C.; Adams, Natalie; Dorosario, Andrew A.; Chaney, Keri S.; Cutler, Corey S.; LeBoeuf, Nicole R.; Carter, Joi B.; Fisher, David C.; Kupper, Thomas S.

    2012-01-01

    CTCL is a cancer of skin homing T cells with variants that include leukemic CTCL (L-CTCL), a malignancy of central memory T cells (TCM), and mycosis fungoides (MF), a malignancy of skin resident effector memory T cells (TEM). We report that low-dose alemtuzumab (αCD52) effectively treated patients with refractory L-CTCL but not MF. Alemtuzumab depleted all T cells in blood and depleted both benign and malignant TCM from skin, but a diverse population of skin resident TEM remained in skin after therapy. T-cell depletion with alemtuzumab required the presence of neutrophils, a cell type frequent in blood but rare in normal skin. These data suggest that TCM were depleted because they recirculate between the blood and skin whereas skin resident TEM were spared because they are sessile and non-recirculating. After alemtuzumab treatment, skin T cells produced lower amounts of IL-4 and higher amounts of IFNγ. Moreover, there was a marked lack of infections in alemtuzumab-treated L-CTCL patients despite the complete absence of T cells in blood, suggesting that skin resident TEM can protect the skin from pathogens even in the absence of T cell recruitment from the circulation. Together, these data suggest that alemtuzumab may treat refractory L-CTCL without severely compromising the immune response to infection by depleting circulating TCM but sparing the skin resident TEM that provide local immune protection of the skin. PMID:22261031

  1. Persistent Low-Level Replication of SIVΔnef Drives Maturation of Antibody and CD8 T Cell Responses to Induce Protective Immunity against Vaginal SIV Infection.

    PubMed

    Adnan, Sama; Reeves, R Keith; Gillis, Jacqueline; Wong, Fay E; Yu, Yi; Camp, Jeremy V; Li, Qingsheng; Connole, Michelle; Li, Yuan; Piatak, Michael; Lifson, Jeffrey D; Li, Wenjun; Keele, Brandon F; Kozlowski, Pamela A; Desrosiers, Ronald C; Haase, Ashley T; Johnson, R Paul

    2016-12-01

    Defining the correlates of immune protection conferred by SIVΔnef, the most effective vaccine against SIV challenge, could enable the design of a protective vaccine against HIV infection. Here we provide a comprehensive assessment of immune responses that protect against SIV infection through detailed analyses of cellular and humoral immune responses in the blood and tissues of rhesus macaques vaccinated with SIVΔnef and then vaginally challenged with wild-type SIV. Despite the presence of robust cellular immune responses, animals at 5 weeks after vaccination displayed only transient viral suppression of challenge virus, whereas all macaques challenged at weeks 20 and 40 post-SIVΔnef vaccination were protected, as defined by either apparent sterile protection or significant suppression of viremia in infected animals. Multiple parameters of CD8 T cell function temporally correlated with maturation of protection, including polyfunctionality, phenotypic differentiation, and redistribution to gut and lymphoid tissues. Importantly, we also demonstrate the induction of a tissue-resident memory population of SIV-specific CD8 T cells in the vaginal mucosa, which was dependent on ongoing low-level antigenic stimulation. Moreover, we show that vaginal and serum antibody titers inversely correlated with post-challenge peak viral load, and we correlate the accumulation and affinity maturation of the antibody response to the duration of the vaccination period as well as to the SIVΔnef antigenic load. In conclusion, maturation of SIVΔnef-induced CD8 T cell and antibody responses, both propelled by viral persistence in the gut mucosa and secondary lymphoid tissues, results in protective immune responses that are able to interrupt viral transmission at mucosal portals of entry as well as potential sites of viral dissemination.

  2. Special regulatory T-cell review: T-cell dependent suppression revisited.

    PubMed

    Basten, Antony; Fazekas de St Groth, Barbara

    2008-01-01

    The concept of T-cell dependent regulation of immune responses has been a central tenet of immunological thinking since the delineation of the two cell system in the 1960s. Indeed T-cell dependent suppression was discovered before MHC restriction. When reviewing the data from the original wave of suppression, it is intriguing to reflect not just on the decline and fall of suppressor T cells in the 1980s, but on their equally dramatic return to respectability over the past decade. Hopefully their resurgence will be supported by solid mechanistic data that will underpin their central place in our current and future understanding of the immune system. Cannon to right of them, Cannon to left of them, Cannon in front of them Volley'd and thunder'd Storm'd at with shot and shell, Boldly they rode and well, Into the jaws of Death, Into the mouth of Hell, Rode the six hundred (suppressionists). (Adapted from The Charge of the Light Brigade, Alfred, Lord Tennyson)

  3. Dengue vaccine-induced CD8+ T cell immunity confers protection in the context of enhancing, interfering maternal antibodies.

    PubMed

    Lam, Jian Hang; Chua, Yen Leong; Lee, Pei Xuan; Martínez Gómez, Julia María; Ooi, Eng Eong; Alonso, Sylvie

    2017-12-21

    Declining levels of maternal antibodies were shown to sensitize infants born to dengue-immune mothers to severe disease during primary infection, through the process of antibody-dependent enhancement of infection (ADE). With the recent approval for human use of Sanofi-Pasteur's chimeric dengue vaccine CYD-TDV and several vaccine candidates in clinical development, the scenario of infants born to vaccinated mothers has become a reality. This raises 2 questions: will declining levels of maternal vaccine-induced antibodies cause ADE; and, will maternal antibodies interfere with vaccination efficacy in the infant? To address these questions, the above scenario was modeled in mice. Type I IFN-deficient female mice were immunized with live attenuated DENV2 PDK53, the core component of the tetravalent DENVax candidate currently under clinical development. Pups born to PDK53-immunized dams acquired maternal antibodies that strongly neutralized parental strain 16681, but not the heterologous DENV2 strain D2Y98P-PP1, and instead caused ADE during primary infection with this strain. Furthermore, pups failed to seroconvert after PDK53 vaccination, owing to maternal antibody interference. However, a cross-protective multifunctional CD8+ T cell response did develop. Thus, our work advocates for the development of dengue vaccine candidates that induce protective CD8+ T cells despite the presence of enhancing, interfering maternal antibodies.

  4. Perforin and gamma interferon expression are required for CD4+ and CD8+ T-cell-dependent protective immunity against a human parasite, Trypanosoma cruzi, elicited by heterologous plasmid DNA prime-recombinant adenovirus 5 boost vaccination.

    PubMed

    de Alencar, Bruna C G; Persechini, Pedro M; Haolla, Filipe A; de Oliveira, Gabriel; Silverio, Jaline C; Lannes-Vieira, Joseli; Machado, Alexandre V; Gazzinelli, Ricardo T; Bruna-Romero, Oscar; Rodrigues, Mauricio M

    2009-10-01

    A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4(+) and CD8(+) T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4(+) and CD8(+) T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-gamma) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8(+) T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-gamma or IFN-gamma/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-gamma in the presence of highly cytotoxic T cells. Vaccinated IFN-gamma-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-gamma in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy.

  5. Perforin and Gamma Interferon Expression Are Required for CD4+ and CD8+ T-Cell-Dependent Protective Immunity against a Human Parasite, Trypanosoma cruzi, Elicited by Heterologous Plasmid DNA Prime-Recombinant Adenovirus 5 Boost Vaccination▿

    PubMed Central

    de Alencar, Bruna C. G.; Persechini, Pedro M.; Haolla, Filipe A.; de Oliveira, Gabriel; Silverio, Jaline C.; Lannes-Vieira, Joseli; Machado, Alexandre V.; Gazzinelli, Ricardo T.; Bruna-Romero, Oscar; Rodrigues, Mauricio M.

    2009-01-01

    A heterologous prime-boost strategy using plasmid DNA, followed by replication-defective recombinant adenovirus 5, is being proposed as a powerful way to elicit CD4+ and CD8+ T-cell-mediated protective immunity against intracellular pathogens. We confirmed this concept and furthered existing research by providing evidence that the heterologous prime-boost regimen using the gene encoding amastigote surface protein 2 elicited CD4+ and CD8+ T-cell-mediated protective immunity (reduction of acute parasitemia and prolonged survival) against experimental infection with Trypanosoma cruzi. Protective immunity correlated with the presence of in vivo antigen-specific cytotoxic activity prior to challenge. Based on this, our second goal was to determine the outcome of infection after heterologous prime-boost immunization of perforin-deficient mice. These mice were highly susceptible to infection. A detailed analysis of the cell-mediated immune responses in immunized perforin-deficient mice showed an impaired gamma interferon (IFN-γ) secretion by immune spleen cells upon restimulation in vitro with soluble recombinant antigen. In spite of a normal numeric expansion, specific CD8+ T cells presented several functional defects detected in vivo (cytotoxicity) and in vitro (simultaneous expression of CD107a/IFN-γ or IFN-γ/tumor necrosis factor alpha) paralleled by a decreased expression of CD44 and KLRG-1. Our final goal was to determine the importance of IFN-γ in the presence of highly cytotoxic T cells. Vaccinated IFN-γ-deficient mice developed highly cytotoxic cells but failed to develop any protective immunity. Our study thus demonstrated a role for perforin and IFN-γ in a number of T-cell-mediated effector functions and in the antiparasitic immunity generated by a heterologous plasmid DNA prime-adenovirus boost vaccination strategy. PMID:19651871

  6. Peptide-Induced Antiviral Protection by Cytotoxic T Cells

    NASA Astrophysics Data System (ADS)

    Schulz, Manfred; Zinkernagel, Rolf M.; Hengartner, Hans

    1991-02-01

    A specific antiviral cytotoxic immune response in vivo could be induced by the subcutaneous injection of the T-cell epitope of the lymphocytic choriomeningitis virus (LCMV) nucleoprotein as an unmodified free synthetic peptide (Arg-Pro-Gln-Ala-Ser-Gly-Val-Tyr-Met-Gly-Asn-Leu-Thr-Ala-Gln) emulsified in incomplete Freund's adjuvant. This immunization rendered mice into a LCMV-specific protective state as shown by the inhibition of LCMV replication in spleens of such mice. The protection level of these mice correlated with the ability to respond to the peptide challenge by CD8^+ virus-specific cytotoxic T cells. This is a direct demonstration that peptide vaccines can be antivirally protective in vivo, thus encouraging further search for appropriate mixtures of stable peptides that may be used as T-cell vaccines.

  7. Cellular Factors Targeting APCs to Modulate Adaptive T Cell Immunity

    PubMed Central

    Do, Jeongsu; Min, Booki

    2014-01-01

    The fate of adaptive T cell immunity is determined by multiple cellular and molecular factors, among which the cytokine milieu plays the most important role in this process. Depending on the cytokines present during the initial T cell activation, T cells become effector cells that produce different effector molecules and execute adaptive immune functions. Studies thus far have primarily focused on defining how these factors control T cell differentiation by targeting T cells themselves. However, other non-T cells, particularly APCs, also express receptors for the factors and are capable of responding to them. In this review, we will discuss how APCs, by responding to those cytokines, influence T cell differentiation and adaptive immunity. PMID:25126585

  8. T cell-depleted splenocytes from mice pre-immunized with neuroantigen in incomplete Freund's adjuvant involved in protection from experimental autoimmune encephalomyelitis.

    PubMed

    Zheng, Hui; Zhang, Han; Liu, Feng; Qi, Yuanyuan; Jiang, Hong

    2014-01-01

    Mice immunized with neuroantigens in incomplete Freund's adjuvant (IFA) are resistant to subsequent induction of experimental autoimmune encephalomyelitis (EAE). The mechanisms involved in this protection are complex. Studies on relevant CD4(+) or CD8(+) T cells, including effective and regulatory T cells, have been performed by others. In this work, the effects of CD4(-)-, CD8(-)- splenocytes on protection from EAE in C57BL/6 mice which were immunized with myelin oligodendrocyte glycoprotein 35-55 (MOG)35-55 in IFA were evaluated. We observed that MOG-reactive CD4(+) T cells failed to be activated and proliferate when CD4(-)-, CD8(-)- splenocytes from MOG/IFA-immunized mice were regarded as antigen-presenting cells (APC). It was shown that these APC expressed lower levels of major histocompatibility complex class II (MHC-II), CD80, and CD86 than naïve cells. In addition, CD4(-)-, CD8(-)- splenocytes from MOG/IFA-immunized mice showed significantly higher levels of IL-10 mRNA expression. When the immunized-mice were induced to develop EAE, these cells secreted significantly higher levels of IL-10 and produced lower levels of IL-6, leading to decreased secretion of IL-17 and IFN-γ from MOG-specific CD4(+) T cells. The transfer of CD4(-)-, CD8(-)- splenocytes from MOG/IFA-immunized mice was able to ameliorate the subsequent induction of EAE in recipient mice. Thus, MOG/IFA immunization can modulate CD4(-)-, CD8(-)- splenocytes by reducing the expression of antigen-presenting molecules and altering the levels of secreted cytokines. Our study reveals an additional mechanism involved in the protective effects of MOG/IFA pre-immunization in an EAE model. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Roles of Alum and Monophosphoryl Lipid A Adjuvants in Overcoming CD4+ T Cell Deficiency to Induce Isotype-Switched IgG Antibody Responses and Protection by T-Dependent Influenza Vaccine

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Kim, Ki-Hye; Lee, Youri; Jung, Yu-Jin; Kim, Min-Chul; Lee, Yu-Na; Kang, Taeuk; Kang, Sang-Moo

    2016-01-01

    Vaccine adjuvant effects in CD4 deficient condition largely remain unknown. We investigated the roles of combined monophosphoryl lipid A (MPL) and Alum adjuvant (MPL+Alum) in inducing immunity after immunization of CD4-knockout (CD4KO) and wild-type (WT) mice with T-dependent influenza vaccine. MPL+Alum adjuvant mediated IgG isotype-switched antibodies, IgG secreting cell responses, and protection in CD4KO mice, which were comparable to those in WT mice. In contrast, Alum adjuvant effects were dependent on CD4+ T cells. MPL+Alum adjuvant was effective in recruiting monocytes and neutrophils as well as in protecting macrophages from alum-mediated cell loss at the injection site in CD4KO mice. MPL+Alum appeared to attenuate MPL-induced inflammatory responses in WT mice, likely improving the safety. Additional studies in CD4-depleted WT mice and MHCII KO mice suggest that MHCII positive antigen presenting cells contribute to providing alternative B cell help in CD4 deficient condition in the context of MPL+Alum adjuvanted vaccination. PMID:27881702

  10. Cytotoxic activities of CD8+ T cells collaborate with macrophages to protect against blood-stage murine malaria

    PubMed Central

    Imai, Takashi; Ishida, Hidekazu; Suzue, Kazutomo; Taniguchi, Tomoyo; Okada, Hiroko; Shimokawa, Chikako; Hisaeda, Hajime

    2015-01-01

    The protective immunity afforded by CD8+ T cells against blood-stage malaria remains controversial because no MHC class I molecules are displayed on parasite-infected human erythrocytes. We recently reported that rodent malaria parasites infect erythroblasts that express major histocompatibility complex (MHC) class I antigens, which are recognized by CD8+ T cells. In this study, we demonstrate that the cytotoxic activity of CD8+ T cells contributes to the protection of mice against blood-stage malaria in a Fas ligand (FasL)-dependent manner. Erythroblasts infected with malarial parasites express the death receptor Fas. CD8+ T cells induce the externalization of phosphatidylserine (PS) on the infected erythroblasts in a cell-to-cell contact-dependent manner. PS enhances the engulfment of the infected erythroid cells by phagocytes. As a PS receptor, T-cell immunoglobulin-domain and mucin-domain-containing molecule 4 (Tim-4) contributes to the phagocytosis of malaria-parasite-infected cells. Our findings provide insight into the molecular mechanisms underlying the protective immunity exerted by CD8+ T cells in collaboration with phagocytes. DOI: http://dx.doi.org/10.7554/eLife.04232.001 PMID:25760084

  11. Regulatory T cells control HIV replication in activated T cells through a cAMP-dependent mechanism

    PubMed Central

    Moreno-Fernandez, Maria E.; Rueda, Cesar Mauricio; Rusie, Laura K.

    2011-01-01

    We hypothesized that regulatory T cells (Tregs) could play a beneficial role during HIV infection by controlling HIV replication in conventional T cells (Tcons). Purified Tregs and Tcons from healthy donors were activated separately. Tcons were infected with the X4 or R5 HIV strains and cultured with or without autologous Tregs. Coculture of Tcons and Tregs resulted in a dose-dependent inhibition of Tcon infection, which was significant when a 1:1 Treg:Tcon ratio was used. Treg suppression of HIV infection was largely mediated by contact-dependent mechanisms. Blockage of cytotoxic T-lymphocyte–associated antigen-4 did not significantly reduce Treg function. In contrast, Tregs acted through cAMP-dependent mechanisms, because the decrease of cAMP levels in Tregs, the blockade of gap junction formation between Tregs and Tcons, the blockage of CD39 activity, and the blockage of protein kinase A in Tcons all abolished Treg-mediated suppression of HIV replication. Our data suggest a complex role for Tregs during HIV infection. Although Tregs inhibit specific immune responses, their inhibition of HIV replication in Tcons may play a beneficial role, particularly during early HIV infection, when the effector immune cells are not yet activated. Such a protective role of Tregs could have a profound impact on infection outcome. PMID:21436067

  12. Generation of cellular immune memory and B-cell immunity is impaired by natural killer cells.

    PubMed

    Rydyznski, Carolyn; Daniels, Keith A; Karmele, Erik P; Brooks, Taylor R; Mahl, Sarah E; Moran, Michael T; Li, Caimei; Sutiwisesak, Rujapak; Welsh, Raymond M; Waggoner, Stephen N

    2015-02-27

    The goal of most vaccines is the induction of long-lived memory T and B cells capable of protecting the host from infection by cytotoxic mechanisms, cytokines and high-affinity antibodies. However, efforts to develop vaccines against major human pathogens such as HIV and HCV have not been successful, thereby highlighting the need for novel approaches to circumvent immunoregulatory mechanisms that limit the induction of protective immunity. Here, we show that mouse natural killer (NK) cells inhibit generation of long-lived virus-specific memory T- and B cells as well as virus-specific antibody production after acute infection. Mechanistically, NK cells suppressed CD4 T cells and follicular helper T cells (T(FH)) in a perforin-dependent manner during the first few days of infection, resulting in a weaker germinal centre (GC) response and diminished immune memory. We anticipate that innovative strategies to relieve NK cell-mediated suppression of immunity should facilitate development of efficacious new vaccines targeting difficult-to-prevent infections.

  13. γδ T cell and other immune cells crosstalk in cellular immunity.

    PubMed

    He, Ying; Wu, Kangni; Hu, Yongxian; Sheng, Lixia; Tie, Ruxiu; Wang, Binsheng; Huang, He

    2014-01-01

    γδ T cells have been recognized as effectors with immunomodulatory functions in cellular immunity. These abilities enable them to interact with other immune cells, thus having the potential for treatment of various immune-mediated diseases with adoptive cell therapy. So far, the interactions between γδ T cell and other immune cells have not been well defined. Here we will discuss the interactivities among them and the perspective on γδ T cells for their use in immunotherapy could be imagined. The understanding of the crosstalk among the immune cells in immunopathology might be beneficial for the clinical application of γδ T cell.

  14. Recombinant Yellow Fever Viruses Elicit CD8+ T Cell Responses and Protective Immunity against Trypanosoma cruzi

    PubMed Central

    Nogueira, Raquel Tayar; Nogueira, Alanderson Rocha; Pereira, Mirian Claudia Souza; Rodrigues, Maurício Martins; Neves, Patrícia Cristina da Costa; Galler, Ricardo; Bonaldo, Myrna Cristina

    2013-01-01

    Chagas’ disease is a major public health problem affecting nearly 10 million in Latin America. Despite several experimental vaccines have shown to be immunogenic and protective in mouse models, there is not a current vaccine being licensed for humans or in clinical trial against T. cruzi infection. Towards this goal, we used the backbone of Yellow Fever (YF) 17D virus, one of the most effective and well-established human vaccines, to express an immunogenic fragment derived from T. cruzi Amastigote Surface Protein 2 (ASP-2). The cDNA sequence of an ASP-2 fragment was inserted between E and NS1 genes of YF 17D virus through the construction of a recombinant heterologous cassette. The replication ability and genetic stability of recombinant YF virus (YF17D/ENS1/Tc) was confirmed for at least six passages in Vero cells. Immunogenicity studies showed that YF17D/ENS1/Tc virus elicited neutralizing antibodies and gamma interferon (IFN-γ) producing-cells against the YF virus. Also, it was able to prime a CD8+ T cell directed against the transgenic T. cruzi epitope (TEWETGQI) which expanded significantly as measured by T cell-specific production of IFN-γ before and after T. cruzi challenge. However, most important for the purposes of vaccine development was the fact that a more efficient protective response could be seen in mice challenged after vaccination with the YF viral formulation consisting of YF17D/ENS1/Tc and a YF17D recombinant virus expressing the TEWETGQI epitope at the NS2B-3 junction. The superior protective immunity observed might be due to an earlier priming of epitope-specific IFN-γ-producing T CD8+ cells induced by vaccination with this viral formulation. Our results suggest that the use of viral formulations consisting of a mixture of recombinant YF 17D viruses may be a promising strategy to elicit protective immune responses against pathogens, in general. PMID:23527169

  15. Recombinant yellow fever viruses elicit CD8+ T cell responses and protective immunity against Trypanosoma cruzi.

    PubMed

    Nogueira, Raquel Tayar; Nogueira, Alanderson Rocha; Pereira, Mirian Claudia Souza; Rodrigues, Maurício Martins; Neves, Patrícia Cristina da Costa; Galler, Ricardo; Bonaldo, Myrna Cristina

    2013-01-01

    Chagas' disease is a major public health problem affecting nearly 10 million in Latin America. Despite several experimental vaccines have shown to be immunogenic and protective in mouse models, there is not a current vaccine being licensed for humans or in clinical trial against T. cruzi infection. Towards this goal, we used the backbone of Yellow Fever (YF) 17D virus, one of the most effective and well-established human vaccines, to express an immunogenic fragment derived from T. cruzi Amastigote Surface Protein 2 (ASP-2). The cDNA sequence of an ASP-2 fragment was inserted between E and NS1 genes of YF 17D virus through the construction of a recombinant heterologous cassette. The replication ability and genetic stability of recombinant YF virus (YF17D/ENS1/Tc) was confirmed for at least six passages in Vero cells. Immunogenicity studies showed that YF17D/ENS1/Tc virus elicited neutralizing antibodies and gamma interferon (IFN-γ) producing-cells against the YF virus. Also, it was able to prime a CD8(+) T cell directed against the transgenic T. cruzi epitope (TEWETGQI) which expanded significantly as measured by T cell-specific production of IFN-γ before and after T. cruzi challenge. However, most important for the purposes of vaccine development was the fact that a more efficient protective response could be seen in mice challenged after vaccination with the YF viral formulation consisting of YF17D/ENS1/Tc and a YF17D recombinant virus expressing the TEWETGQI epitope at the NS2B-3 junction. The superior protective immunity observed might be due to an earlier priming of epitope-specific IFN-γ-producing T CD8(+) cells induced by vaccination with this viral formulation. Our results suggest that the use of viral formulations consisting of a mixture of recombinant YF 17D viruses may be a promising strategy to elicit protective immune responses against pathogens, in general.

  16. Hydrodynamic immunization leads to poor CD8 T-cell expansion, low frequency of memory CTLs and ineffective antiviral protection.

    PubMed

    Obeng-Adjei, N; Choo, D K; Weiner, D B

    2013-10-01

    Hepatotropic pathogens, such as hepatitis B (HBV) and hepatitis C (HCV), often escape cellular immune clearance resulting in chronic infection. As HBV and HCV infections are the most common causes of hepatocellular carcinoma (HCC), prevention of these infections is believed to be key to the prevention of HCC. It is believed that an effective immune therapy must induce strong cytotonic T lymphocytes (CTLs) that can migrate into the liver, where they can clear infected hepatocytes. Here, we compared the induction of CD8 T cells by two different DNA immunization methods for T-cell differentiation, function, memory programming and their distribution within relevant tissues in a highly controlled fashion. We used hydrodynamic tail vein injection of plasmid to establish liver-specific LCMV-gp antigen (Ag) transient expression, and studied CD8 T cells induced using the P14 transgenic mouse model. CD8 T cells from this group exhibited unique and limited expansion, memory differentiation, polyfunctionality and cytotoxicity compared with T cells generated in intramuscularly immunized mice. This difference in liver-generated expansion resulted in lower memory CD8 T-cell frequency, leading to reduced protection against lethal viral challenge. These data show an unusual induction of naive CD8 T cells contributed to the lower frequency of Ag-specific CTLs observed after immunization in the liver, suggesting that limited priming in liver compared with peripheral tissues is responsible for this outcome.

  17. Follicular helper T cells in immunity and systemic autoimmunity.

    PubMed

    Craft, Joseph E

    2012-05-01

    Follicular helper T (T(FH)) cells are essential for B-cell maturation and immunoglobulin production after immunization with thymus-dependent antigens. Nevertheless, the development and function of T(FH) cells have been less clearly defined than classic CD4(+) effector T-cell subsets, including T-helper-1 (T(H)1), T(H)2 and T(H)17 cells. As such, our understanding of the genesis of T(FH) cells in humans and their role in the development of autoimmunity remains incomplete. However, evidence from animal models of systemic lupus erythematosus (SLE) and patients with systemic autoimmune diseases suggests that these cells are necessary for pathogenic autoantibody production, in a manner analogous to their role in promotion of B-cell maturation during normal immune responses. In this Review, I discuss the findings that have increased our knowledge of T(FH)-cell development and function in normal and aberrant immune responses. Such information might improve our understanding of autoimmune diseases, such as SLE, and highlights the potential of T(FH) cells as therapeutic targets in these diseases.

  18. T-cell-dependent immunity and thrombocytopenia in rats infected with Plasmodium chabaudi.

    PubMed Central

    Watier, H; Verwaerde, C; Landau, I; Werner, E; Fontaine, J; Capron, A; Auriault, C

    1992-01-01

    Normal, splenectomized, and athymic Fischer rats were infected with Plasmodium chabaudi. In normal rat infections, acute-phase infection resolved rapidly and completely. In splenectomized rats, infection resulted in high parasitemia and ultimately death. In nude rats, parasite growth was reduced compared with normal rats, and a persistent parasitemia (between 20 and 45%) was observed for several months. Complete resolution of the infection was achieved after adoptive transfer of T lymphocytes, even when transfer occurred during the course of infection. These results indicated that an acquired, T-lymphocyte-dependent immunity was necessary for the complete recovery observed in normal rats. In normal rats, thrombocytopenia and splenomegaly occurred during infection. By contrast, in nude rats, both of these pathological manifestations were only observed after thymus grafting. Thrombocytopenia was also absent in the splenectomized animals. Despite an increase in platelet-associated immunoglobulin levels during the infection, thrombocytopenia was not transferred by injection of infected rat serum to normal recipients. It has been concluded that the nude rat infection can be regarded as a novel and useful model for studying the T-cell-dependent effector and pathological mechanisms and to investigate the anti-P. chabaudi immune response. PMID:1729178

  19. The 17D-204 Vaccine Strain-Induced Protection against Virulent Yellow Fever Virus Is Mediated by Humoral Immunity and CD4+ but not CD8+ T Cells.

    PubMed

    Watson, Alan M; Lam, L K Metthew; Klimstra, William B; Ryman, Kate D

    2016-07-01

    A gold standard of antiviral vaccination has been the safe and effective live-attenuated 17D-based yellow fever virus (YFV) vaccines. Among more than 500 million vaccinees, only a handful of cases have been reported in which vaccinees developed a virulent wild type YFV infection. This efficacy is presumed to be the result of both neutralizing antibodies and a robust T cell response. However, the particular immune components required for protection against YFV have never been evaluated. An understanding of the immune mechanisms that underlie 17D-based vaccine efficacy is critical to the development of next-generation vaccines against flaviviruses and other pathogens. Here we have addressed this question for the first time using a murine model of disease. Similar to humans, vaccination elicited long-term protection against challenge, characterized by high neutralizing antibody titers and a robust T cell response that formed long-lived memory. Both CD4+ and CD8+ T cells were polyfunctional and cytolytic. Adoptive transfer of immune sera or CD4+ T cells provided partial protection against YFV, but complete protection was achieved by transfer of both immune sera and CD4+ T cells. Thus, robust CD4+ T cell activity may be a critical contributor to protective immunity elicited by highly effective live attenuated vaccines.

  20. The 17D-204 Vaccine Strain-Induced Protection against Virulent Yellow Fever Virus Is Mediated by Humoral Immunity and CD4+ but not CD8+ T Cells

    PubMed Central

    Lam, L. K. Metthew; Klimstra, William B.

    2016-01-01

    A gold standard of antiviral vaccination has been the safe and effective live-attenuated 17D-based yellow fever virus (YFV) vaccines. Among more than 500 million vaccinees, only a handful of cases have been reported in which vaccinees developed a virulent wild type YFV infection. This efficacy is presumed to be the result of both neutralizing antibodies and a robust T cell response. However, the particular immune components required for protection against YFV have never been evaluated. An understanding of the immune mechanisms that underlie 17D-based vaccine efficacy is critical to the development of next-generation vaccines against flaviviruses and other pathogens. Here we have addressed this question for the first time using a murine model of disease. Similar to humans, vaccination elicited long-term protection against challenge, characterized by high neutralizing antibody titers and a robust T cell response that formed long-lived memory. Both CD4+ and CD8+ T cells were polyfunctional and cytolytic. Adoptive transfer of immune sera or CD4+ T cells provided partial protection against YFV, but complete protection was achieved by transfer of both immune sera and CD4+ T cells. Thus, robust CD4+ T cell activity may be a critical contributor to protective immunity elicited by highly effective live attenuated vaccines. PMID:27463517

  1. Vaccine of engineered tumor cells secreting stromal cell-derived factor-1 induces T-cell dependent antitumor responses.

    PubMed

    Shi, Meiqing; Hao, Siguo; Su, Liping; Zhang, Xueshu; Yuan, Jinying; Guo, Xuling; Zheng, Changyu; Xiang, Jim

    2005-08-01

    The CXC chemokine SDF-1 has been characterized as a T-cell chemoattractant both in vitro and in vivo. To determine whether SDF-1 expression within tumors can influence tumor growth, we transfected an expression vector pCI-SDF-1 for SDF-1 into J558 myeloma cells and tested their ability to form tumors in BALB/c. Production of biologically active SDF-1 (1.2 ng/mL) was detected in the culture supernatants of cells transfected with the expression vector pCI-SDF-1. J558 cells gave rise to a 100% tumor incidence, whereas SDF-1-expressing J558/SDF-1 tumors invariably regressed in BALB/c mice and became infiltrated with CD4(+) and CD8(+) T cells. Regression of the J558/SDF-1 tumors was dependent on both CD4(+) and CD8(+) T-cells. Our data also indicate that TIT cells containing both CD4(+) and CD8(+) T-cells within J558/SDF-1 tumors express the SDF-1 receptor CXCR4, and that SDF-1 specifically chemoattracts these cells in vitro. Furthermore, immunization of mice with engineered J558/SDF-1 cells elicited the most potent protective immunity against 0.5 x 10(6) cells J558 tumor challenge in vivo, compared to immunization with the J558 alone, and this antitumor immunity mediated by J558/SDF-1 tumor cell vaccination in vivo appeared to be dependent on CD8(+) CTL. Thus, SDF-1 has natural adjuvant activities that may augment antitumor responses through their effects on T-cells and thereby could be important in gene transfer immunotherapies for some cancers.

  2. Immunity to sporozoite-induced malaria infection in mice. I. The effect of immunization of T and B cell-deficient mice. [X Radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, D.H.; Tigelaar, R.E.; Weinbaum, F.I.

    1977-04-01

    The cellular basis of immunity to sporozoites was investigated by examining the effect of immunization of T and B cell-deficient C57BL/6N x BALB/c AnN F/sub 1/ (BLCF/sub 1/) mice compared to immunocompetent controls. Immunization of T cell-deficient (ATX-BM-ATS) BLCF/sub 1/ mice with x-irradiated sporozoites did not result in the generation of protective immunity. The same immunization protocols protected all immunocompetent controls. In contrast, B cell-deficient (..mu..-suppressed) BLCF/sub 1/ mice were protected by immunization in the majority of cases. The absence of detectable serum circumsporozoite precipitins or sporozoite neutralizing activity in the ..mu..-suppressed mice that resisted a sporozoite challenge suggests amore » minor role for these humoral factors in protection. These data demonstrate a preeminent role for T cells in the induction of protective immunity in BLCF/sub 1/ mice against a P. berghei sporozoite infection.« less

  3. Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.

    PubMed

    Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia

    2017-01-01

    During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.

  4. Immune Privilege and Eye-Derived T-Regulatory Cells.

    PubMed

    Keino, Hiroshi; Horie, Shintaro; Sugita, Sunao

    2018-01-01

    Certain cellular components of the eye, such as neural retina, are unable to regenerate and replicate after destructive inflammation. Ocular immune privilege provides the eye with immune protection against intraocular inflammation in order to minimize the risk to vision integrity. The eye and immune system use strategies to maintain the ocular immune privilege by regulating the innate and adaptive immune response, which includes immunological ignorance, peripheral tolerance to eye-derived antigens, and intraocular immunosuppressive microenvironment. In this review, we summarize current knowledge regarding the molecular mechanism responsible for the development and maintenance of ocular immune privilege via regulatory T cells (Tregs), which are generated by the anterior chamber-associated immune deviation (ACAID), and ocular resident cells including corneal endothelial (CE) cells, ocular pigment epithelial (PE) cells, and aqueous humor. Furthermore, we examined the therapeutic potential of Tregs generated by RPE cells that express transforming growth factor beta (TGF- β ), cytotoxic T lymphocyte-associated antigen-2 alpha (CTLA-2 α ), and retinoic acid for autoimmune uveoretinitis and evaluated a new strategy using human RPE-induced Tregs for clinical application in inflammatory ocular disease. We believe that a better understanding of the ocular immune privilege associated with Tregs might offer a new approach with regard to therapeutic interventions for ocular autoimmunity.

  5. Skin-resident CD4+ T cells protect against Leishmania major by recruiting and activating inflammatory monocytes

    PubMed Central

    Glennie, Nelson D.; Volk, Susan W.

    2017-01-01

    Tissue-resident memory T cells are required for establishing protective immunity against a variety of different pathogens, although the mechanisms mediating protection by CD4+ resident memory T cells are still being defined. In this study we addressed this issue with a population of protective skin-resident, IFNγ-producing CD4+ memory T cells generated following Leishmania major infection. We previously found that resident memory T cells recruit circulating effector T cells to enhance immunity. Here we show that resident memory CD4+ T cells mediate the delayed-hypersensitivity response observed in immune mice and provide protection without circulating T cells. This protection occurs rapidly after challenge, and requires the recruitment and activation of inflammatory monocytes, which limit parasites by production of both reactive oxygen species and nitric oxide. Overall, these data highlight a novel role for tissue-resident memory cells in recruiting and activating inflammatory monocytes, and underscore the central role that skin-resident T cells play in immunity to cutaneous leishmaniasis. PMID:28419151

  6. A Two-Component DNA-Prime/Protein-Boost Vaccination Strategy for Eliciting Long-Term, Protective T Cell Immunity against Trypanosoma cruzi

    PubMed Central

    Gupta, Shivali; Garg, Nisha J.

    2015-01-01

    In this study, we evaluated the long-term efficacy of a two-component subunit vaccine against Trypanosoma cruzi infection. C57BL/6 mice were immunized with TcG2/TcG4 vaccine delivered by a DNA-prime/Protein-boost (D/P) approach and challenged with T. cruzi at 120 or 180 days post-vaccination (dpv). We examined whether vaccine-primed T cell immunity was capable of rapid expansion and intercepting the infecting T. cruzi. Our data showed that D/P vaccine elicited CD4+ (30-38%) and CD8+ (22-42%) T cells maintained an effector phenotype up to 180 dpv, and were capable of responding to antigenic stimulus or challenge infection by a rapid expansion (CD8>CD4) with type 1 cytokine (IFNγ+ and TFNα+) production and cytolytic T lymphocyte (CTL) activity. Subsequently, challenge infection at 120 or 180 dpv, resulted in 2-3-fold lower parasite burden in vaccinated mice than was noted in unvaccinated/infected mice. Co-delivery of IL-12- and GMCSF-encoding expression plasmids provided no significant benefits in enhancing the anti-parasite efficacy of the vaccine-induced T cell immunity. Booster immunization (bi) with recombinant TcG2/TcG4 proteins 3-months after primary vaccine enhanced the protective efficacy, evidenced by an enhanced expansion (1.2-2.8-fold increase) of parasite-specific, type 1 CD4+ and CD8+ T cells and a potent CTL response capable of providing significantly improved (3-4.5-fold) control of infecting T. cruzi. Further, CD8+T cells in vaccinated/bi mice were predominantly of central memory phenotype, and capable of responding to challenge infection 4-6-months post bi by a rapid expansion to a poly-functional effector phenotype, and providing a 1.5-2.3-fold reduction in tissue parasite replication. We conclude that the TcG2/TcG4 D/P vaccine provided long-term anti-T. cruzi T cell immunity, and bi would be an effective strategy to maintain or enhance the vaccine-induced protective immunity against T. cruzi infection and Chagas disease. PMID:25951312

  7. T Cell-Mediated Immunity towards Yellow Fever Virus and Useful Animal Models.

    PubMed

    Watson, Alan M; Klimstra, William B

    2017-04-11

    The 17D line of yellow fever virus vaccines is among the most effective vaccines ever created. The humoral and cellular immunity elicited by 17D has been well characterized in humans. Neutralizing antibodies have long been known to provide protection against challenge with a wild-type virus. However, a well characterized T cell immune response that is robust, long-lived and polyfunctional is also elicited by 17D. It remains unclear whether this arm of immunity is protective following challenge with a wild-type virus. Here we introduce the 17D line of yellow fever virus vaccines, describe the current state of knowledge regarding the immunity directed towards the vaccines in humans and conclude with a discussion of animal models that are useful for evaluating T cell-mediated immune protection to yellow fever virus.

  8. Studies on B-cell memory. III. T-dependent aspect of B memory generation in mice immunized with T-independent type-2(TI-2) antigen.

    PubMed

    Hosokawa, T; Tanaka, Y; Aoike, A; Kawai, K; Muramatsu, S

    1984-09-01

    The time course of B-cell memory development to a dinitrophenyl (DNP) T-independent type-2 (TI-2) antigen was investigated by adoptive cell transfer. Strong IgM and IgG memory developed in BALB/c mice after immunization with DNP-dextran, to be recalled by challenge with either T-dependent (TD) antigen or TI-2 antigen. However, only weak IgM memory and very feeble IgG memory were detected in athymic nude mice receiving the same immunization as euthymic mice. Once memory was established under probable T cell influence, its recall by TI-2 antigen challenge seemed independent of T cell help and did not require sharing of carriers between priming and challenge antigens. The following may be concluded. (i) Long-term IgM and IgG memory is induced by TI-2 antigen priming in the presence of functional T cells. (ii) The class switch from IgM to IgG in the memory B cell pool is driven effectively by TI-2 antigen and is probably T cell-dependent.

  9. Prophylactic immunization against experimental leishmaniasis. III. Protection against fatal Leishmania tropica infection induced by irradiated promastigotes involves Lyt-1/sup +/2/sup -/ T cells that do not mediate cutaneous DTH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liew, F.Y.; Howard, J.G.; Hale, C.

    1984-01-01

    Protective immunity against fatal L. tropica infection in genetically vulnerable BALB/c mice can be induced by prophylactic immunization with irradiated promastigotes even when heat-killed. Such immunity is adoptively transferable transiently into intact or durably into sub-lethally irradiated (200 or 550 rad) syngeneic recipients by splenic T but not B cells. The effector T cells are of the Lyt-1/sup +/2/sup -/ phenotype, devoid of demonstrable cytotoxic activity. The immune splenic T cell population expresses specific helper activity for antibody synthesis. A causal role for helper T cells in this capacity, however, seems unlikely, because it was shown that antibody does notmore » determine the protective immunity against L. tropica. The immunized donors show no detectable cutaneous DTH or its early memory recall in response to live or killed promastigotes or a soluble L. tropica antigen preparation. Spleen, lymph node, and peritoneal exudate cells from protectively immunized donors similarly fail to transfer DTH locally or systemically. These cells also lack demonstrable suppressive activity against the expression or induction of DTH to L. tropica. Thus, protection against L. tropica induced by prophylactic i.v. immunization with irradiated promastigotes appears to be conferred by Lyt-1/sup +/2/sup -/ T cells that are distinguishable from T cells mediating either both DTH and T help, or cytotoxicity.« less

  10. Immune Cell-Mediated Protection against Vaginal Candidiasis: Evidence for a Major Role of Vaginal CD4+ T Cells and Possible Participation of Other Local Lymphocyte Effectors

    PubMed Central

    Santoni, Giorgio; Boccanera, Maria; Adriani, Daniela; Lucciarini, Roberta; Amantini, Consuelo; Morrone, Stefania; Cassone, Antonio; De Bernardis, Flavia

    2002-01-01

    The protective roles of different lymphocyte subsets were investigated in a rat vaginal candidiasis model by adoptive transfer of vaginal lymphocytes (VL) or sorted, purified CD3+ T cells, CD4+ or CD8+ T cells, or CD3− CD5+ B cells from the vaginas of naïve or immune rats following three rounds of Candida albicans infection. The adoptive transfer of total VL from nonimmune animals did not alter the course of vaginal candidiasis of the recipient rats. In contrast, the animals receiving total VL or CD3+ T cells from immune rats showed a highly significant acceleration of fungus clearance compared with animals which received nonimmune VL. The animals with vaginal CD3− CD5+ B cells transferred from immune rats also had fewer Candida CFU than the controls, but fungal clearance was significantly retarded with respect to the animals administered immune T cells. Sorted, purified CD4+ and CD8+ vaginal T cells from immune rats were also adoptively transferred to naïve animals. Although both populations were seen to accelerate the clearance of the fungus from the vagina, CD4+ T cells were much more effective than CD8+ T cells. Overall, there was no difference between the antifungal effects of immune vaginal CD4+ T cells and those achievable with the transfer of whole, immune VL. Histological observations of the vaginal tissues of rats with adoptively transferred immune T cells demonstrated a remarkable accumulation of lymphocytes in the subepithelial lamina propria and also infiltrating the mucosal epithelium. These results strongly suggest that distinct vaginal lymphocyte subsets participate in the adaptive anti-Candida immunity at the vaginal level, with the vaginal CD4+ T cells probably playing a major role. PMID:12183521

  11. NKp46+ Innate Lymphoid Cells Dampen Vaginal CD8 T Cell Responses following Local Immunization with a Cholera Toxin-Based Vaccine

    PubMed Central

    Luci, Carmelo; Bekri, Selma; Bihl, Franck; Pini, Jonathan; Bourdely, Pierre; Nouhen, Kelly; Malgogne, Angélique; Walzer, Thierry; Braud, Véronique M.; Anjuère, Fabienne

    2015-01-01

    Innate and adaptive immune cells work in concert to generate efficient protection at mucosal surface. Vaginal mucosa is an epithelial tissue that contains innate and adaptive immune effector cells. Our previous studies demonstrated that vaginal administration of Cholera toxin -based vaccines generate antigen-specific CD8 T cells through the stimulation of local dendritic cells (DC). Innate lymphoid cells (ILC) are a group of lymphocytes localized in epithelial tissues that have important immune functions against pathogens and in tissue homeostasis. Their contribution to vaccine-induced mucosal T cell responses is an important issue for the design of protective vaccines. We report here that the vaginal mucosa contains a heterogeneous population of NKp46+ ILC that includes conventional NK cells and ILC1-like cells. We show that vaginal NKp46+ ILC dampen vaccine-induced CD8 T cell responses generated after local immunization. Indeed, in vivo depletion of NKp46+ ILC with anti-NK1.1 antibody or NKG2D blockade increases the magnitude of vaginal OVA-specific CD8 T cells. Furthermore, such treatments also increase the number of DC in the vagina. NKG2D ligands being expressed by vaginal DC but not by CD8 T cells, these results support that NKp46+ ILC limit mucosal CD8 T cell responses indirectly through the NKG2D-dependent elimination of vaginal DC. Our data reveal an unappreciated role of NKp46+ ILC in the regulation of mucosal CD8 T cell responses. PMID:26630176

  12. T Cell-Mediated Immunity towards Yellow Fever Virus and Useful Animal Models

    PubMed Central

    Watson, Alan M.; Klimstra, William B.

    2017-01-01

    The 17D line of yellow fever virus vaccines is among the most effective vaccines ever created. The humoral and cellular immunity elicited by 17D has been well characterized in humans. Neutralizing antibodies have long been known to provide protection against challenge with a wild-type virus. However, a well characterized T cell immune response that is robust, long-lived and polyfunctional is also elicited by 17D. It remains unclear whether this arm of immunity is protective following challenge with a wild-type virus. Here we introduce the 17D line of yellow fever virus vaccines, describe the current state of knowledge regarding the immunity directed towards the vaccines in humans and conclude with a discussion of animal models that are useful for evaluating T cell-mediated immune protection to yellow fever virus. PMID:28398253

  13. Differential protective effects of immune lymphoid cells against transplanted line Ib leukemia and immune polioencephalomyelitis. [X radiation, mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duffey, P.S.; Lukasewycz, O.A.; Olson, D.S.

    1978-12-01

    The capacity of immune cells obtained from the major lymphoid compartments to protect C58 mice from transplanted line Ib leukemia, and from an age-dependent autoimmune CNS disease (immune polioencephalomyelitis = IPE) elicited by immunizing old C58 mice with inactivated Ib cells was quantified. Cells used for comparative adoptive protection tests were harvested from the major lymphoid compartments 14 to 15 days after young C58 mice were immunized with inactivated Ib cell preparations. Regression curves were plotted from survival data and the log/sub 10/PD/sub 50/ values were determined. Immune spleen (ISC) and peritoneal cells (IPEC) were significantly more protective against transplantedmore » Ib cells than immune lymph node (ILNC), thymic (ITC), and marrow cells (IMC). In contrast, IPEC and IMC were not protective against IPE and ITC were only marginally protective. ILNC afforded significant protection to transplantable leukemia but were only marginally protective to IPE. When ISC were treated with anti-thy 1.2 serum and complement, protection against transplanted leukemia and IPE was reduced > 99%. When donors of immune lymphoid cells were treated with 12.5 mg of cortisone acetate daily for 2 days before lymphoid cells were harvested, protection against transplanted Ib cells by ISC was reduced by approximately 90% whereas protection against IPE was totally eliminated. Considered together, these results indicate that the protective mechanisms to transplantable leukemia and IPE differ significantly in the same indicator mouse strain.« less

  14. Chemoprophylaxis with sporozoite immunization in P. knowlesi rhesus monkeys confers protection and elicits sporozoite-specific memory T cells in the liver

    PubMed Central

    Spring, Michele D.; Yongvanitchit, Kosol; Kum-Arb, Utaiwan; Limsalakpetch, Amporn; Im-Erbsin, Rawiwan; Ubalee, Ratawan; Vanachayangkul, Pattaraporn; Remarque, Edmond J.; Angov, Evelina; Smith, Philip L.; Saunders, David L.

    2017-01-01

    Whole malaria sporozoite vaccine regimens are promising new strategies, and some candidates have demonstrated high rates of durable clinical protection associated with memory T cell responses. Little is known about the anatomical distribution of memory T cells following whole sporozoite vaccines, and immunization of nonhuman primates can be used as a relevant model for humans. We conducted a chemoprophylaxis with sporozoite (CPS) immunization in P. knowlesi rhesus monkeys and challenged via mosquito bites. Half of CPS immunized animals developed complete protection, with a marked delay in parasitemia demonstrated in the other half. Antibody responses to whole sporozoites, CSP, and AMA1, but not CelTOS were detected. Peripheral blood T cell responses to whole sporozoites, but not CSP and AMA1 peptides were observed. Unlike peripheral blood, there was a high frequency of sporozoite-specific memory T cells observed in the liver and bone marrow. Interestingly, sporozoite-specific CD4+ and CD8+ memory T cells in the liver highly expressed chemokine receptors CCR5 and CXCR6, both of which are known for liver sinusoid homing. The majority of liver sporozoite-specific memory T cells expressed CD69, a phenotypic marker of tissue-resident memory (TRM) cells, which are well positioned to rapidly control liver-stage infection. Vaccine strategies that aim to elicit large number of liver TRM cells may efficiently increase the efficacy and durability of response against pre-erythrocytic parasites. PMID:28182750

  15. Cooperativity Between CD8+ T Cells, Non-Neutralizing Antibodies, and Alveolar Macrophages Is Important for Heterosubtypic Influenza Virus Immunity

    PubMed Central

    Laidlaw, Brian J.; Decman, Vilma; Ali, Mohammed-Alkhatim A.; Abt, Michael C.; Wolf, Amaya I.; Monticelli, Laurel A.; Mozdzanowska, Krystyna; Angelosanto, Jill M.; Artis, David; Erikson, Jan; Wherry, E. John

    2013-01-01

    Seasonal epidemics of influenza virus result in ∼36,000 deaths annually in the United States. Current vaccines against influenza virus elicit an antibody response specific for the envelope glycoproteins. However, high mutation rates result in the emergence of new viral serotypes, which elude neutralization by preexisting antibodies. T lymphocytes have been reported to be capable of mediating heterosubtypic protection through recognition of internal, more conserved, influenza virus proteins. Here, we demonstrate using a recombinant influenza virus expressing the LCMV GP33-41 epitope that influenza virus-specific CD8+ T cells and virus-specific non-neutralizing antibodies each are relatively ineffective at conferring heterosubtypic protective immunity alone. However, when combined virus-specific CD8 T cells and non-neutralizing antibodies cooperatively elicit robust protective immunity. This synergistic improvement in protective immunity is dependent, at least in part, on alveolar macrophages and/or other lung phagocytes. Overall, our studies suggest that an influenza vaccine capable of eliciting both CD8+ T cells and antibodies specific for highly conserved influenza proteins may be able to provide heterosubtypic protection in humans, and act as the basis for a potential “universal” vaccine. PMID:23516357

  16. A subset of IL-10-producing gammadelta T cells protect the liver from Listeria-elicited, CD8(+) T cell-mediated injury.

    PubMed

    Rhodes, Katherine A; Andrew, Elizabeth M; Newton, Darren J; Tramonti, Daniela; Carding, Simon R

    2008-08-01

    Although gammadelta T cells play a role in protecting tissues from pathogen-elicited damage to bacterial, viral and parasitic pathogens, the mechanisms involved in the damage and in the protection have not been clearly elucidated. This has been addressed using a murine model of listeriosis, which in mice lacking gammadelta T cells (TCRdelta(-/-)) is characterised by severe and extensive immune-mediated hepatic necrosis. We show that these hepatic lesions are caused by Listeria-elicited CD8(+) T cells secreting high levels of TNF-alpha that accumulate in the liver of Listeria-infected TCRdelta(-/-) mice. Using isolated populations of gammadelta T cells from wild-type and cytokine-deficient strains of mice to reconstitute TCRdelta(-/-) mice, the TCR variable gene 4 (Vgamma4)(+) subset of gammadelta T cells was shown to protect against liver injury. Hepatoprotection was dependent upon their ability to produce IL-10 after TCR-mediated interactions with Listeria-elicited macrophages and CD8(+) T cells. IL-10-producing Vgamma4(+) T cells also contribute to controlling CD8(+) T cell expansion and to regulating and reducing TNF-alpha secretion by activated CD8(+) T cells. This effect on TNF-alpha production was directly attributed to IL-10. These findings identify a novel mechanism by which pathogen-elicited CD8(+) T cells are regulated via interactions with, and activation of, IL-10-producing hepatoprotective gammadelta T cells.

  17. Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression

    PubMed Central

    Wang, Yu; Sun, Sheng-Nan; Liu, Qing; Yu, Yang-Yang; Guo, Jian; Wang, Kun; Xing, Bao-Cai; Zheng, Qing-Feng; Campa, Michael J.; Patz, Edward F.; Li, Shi-You; He, You-Wen

    2016-01-01

    In contrast to its inhibitory effects on many cells, IL-10 activates CD8+ tumor infiltrating lymphocytes (TILs) and enhances their antitumor activity. However, CD8+ TILs do not routinely express IL-10 as autocrine complement C3 inhibits IL-10 production through complement receptors C3aR and C5aR. CD8+ TILs from C3-deficient mice, however, express IL-10 and exhibit enhanced effector function. C3-deficient mice are resistant to tumor development in a T cell- and IL-10-dependent manner; human TILs expanded with IL-2 plus IL-10 increase the killing of primary tumors in vitro compared to IL-2 treated TILs. Complement-mediated inhibition of antitumor immunity is independent of the PD-1/PD-L1 immune checkpoint pathway. Our findings suggest that complement receptors C3aR and C5aR expressed on CD8+ TILs represent a novel class of immune checkpoints that could be targeted for tumor immunotherapy. Moreover, incorporation of IL-10 in the expansion of TILs and in gene-engineered T cells for adoptive cell therapy enhances their antitumor efficacy. PMID:27297552

  18. EBOV Protection Is Supported by T Cell-Dependent Humoral Responses But Is Not Requisite for Survival

    DTIC Science & Technology

    2016-06-03

    EBOV protection is supported by T cell- dependent humoral responses but is not requisite for survival. 1 Christopher L. Cooper, Karen A. Martins...platforms of a requisite role for antibody-5 dependent protection and extensive efforts in development of antibody therapy against lethal EBOV 6... dependent 12 mechanisms. We show that Hiltonol both augmented and sustained eVLP-mediated GC B cell formation 13 and increased antigen-specific B cell

  19. T lymphocytes from mice immunized with irradiated sporozoites eliminated malaria from hepatocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoffman, S.L.; Isenbarger, D.; Long, G.W.

    When mice are immunized with radiation-attenuated sporozoites they are solidly protected against sporozoite challenge by an immune response that has been shown to require CD8+ lymphocytes in several strains of mice. The target of this CD8+ T-cell-dependent immunity has not been established. Immune BALB/c mice were shown to develop malaria-specific. CD8+ T-cell-dependent inflammatory infiltrates in their livers after challenge with Plasmodium berghei sporozoites. Spleen cells from immune BALB/c and C57BL/6 mice eliminated hepatocytes infected with the liver stage of P. berghei in vitro. The activity against infected hepatocytes is not inhibited by antibodies to interferon-y and is not present inmore » culture supernatants. It is generally restricted, an indication that malaria antigens on the hepatocyte surface are recognized by immune T-effector cells.« less

  20. Protection by universal influenza vaccine is mediated by memory CD4 T cells.

    PubMed

    Valkenburg, Sophie A; Li, Olive T W; Li, Athena; Bull, Maireid; Waldmann, Thomas A; Perera, Liyanage P; Peiris, Malik; Poon, Leo L M

    2018-07-05

    There is a diverse array of influenza viruses which circulate between different species, reassort and drift over time. Current seasonal influenza vaccines are ineffective in controlling these viruses. We have developed a novel universal vaccine which elicits robust T cell responses and protection against diverse influenza viruses in mouse and human models. Vaccine mediated protection was dependent on influenza-specific CD4 + T cells, whereby depletion of CD4 + T cells at either vaccination or challenge time points significantly reduced survival in mice. Vaccine memory CD4 + T cells were needed for early antibody production and CD8 + T cell recall responses. Furthermore, influenza-specific CD4 + T cells from vaccination manifested primarily Tfh and Th1 profiles with anti-viral cytokine production. The vaccine boosted H5-specific T cells from human PBMCs, specifically CD4 + and CD8 + T effector memory type, ensuring the vaccine was truly universal for its future application. These findings have implications for the development and optimization of T cell activating vaccines for universal immunity against influenza. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Orchestration of pulmonary T cell immunity during Mycobacterium tuberculosis infection: immunity interruptus

    PubMed Central

    Behar, Samuel M.; Carpenter, Stephen M.; Booty, Matthew G.; Barber, Daniel L.; Jayaraman, Pushpa

    2014-01-01

    Despite the introduction almost a century ago of Mycobacterium bovis BCG (BCG), an attenuated form of M. bovis that is used as a vaccine against Mycobacterium tuberculosis, tuberculosis remains a global health threat and kills more than 1.5 million people each year. This is mostly because BCG fails to prevent pulmonary disease – the contagious form of tuberculosis. Although there have been significant advances in understanding how the immune system responds to infection, the qualities that define protective immunity against M. tuberculosis remain poorly characterized. The ability to predict who will maintain control over the infection and who will succumb to clinical disease would revolutionize our approach to surveillance, control, and treatment. Here we review the current understanding of pulmonary T cell responses following M. tuberculosis infection. While infection elicits a strong immune response that contains infection, M. tuberculosis evades eradication. Traditionally, its intracellular lifestyle and alteration of macrophage function are viewed as the dominant mechanisms of evasion. Now we appreciate that chronic inflammation leads to T cell dysfunction. While this may arise as the host balances the goals of bacterial sterilization and avoidance of tissue damage, it is becoming clear that T cell dysfunction impairs host resistance. Defining the mechanisms that lead to T cell dysfunction is crucial as memory T cell responses are likely to be subject to the same subject to the same pressures. Thus, success of T cell based vaccines is predicated on memory T cells avoiding exhaustion while at the same time not promoting overt tissue damage. PMID:25311810

  2. Orchestration of pulmonary T cell immunity during Mycobacterium tuberculosis infection: immunity interruptus.

    PubMed

    Behar, Samuel M; Carpenter, Stephen M; Booty, Matthew G; Barber, Daniel L; Jayaraman, Pushpa

    2014-12-01

    Despite the introduction almost a century ago of Mycobacterium bovis BCG (BCG), an attenuated form of M. bovis that is used as a vaccine against Mycobacterium tuberculosis, tuberculosis remains a global health threat and kills more than 1.5 million people each year. This is mostly because BCG fails to prevent pulmonary disease--the contagious form of tuberculosis. Although there have been significant advances in understanding how the immune system responds to infection, the qualities that define protective immunity against M. tuberculosis remain poorly characterized. The ability to predict who will maintain control over the infection and who will succumb to clinical disease would revolutionize our approach to surveillance, control, and treatment. Here we review the current understanding of pulmonary T cell responses following M. tuberculosis infection. While infection elicits a strong immune response that contains infection, M. tuberculosis evades eradication. Traditionally, its intracellular lifestyle and alteration of macrophage function are viewed as the dominant mechanisms of evasion. Now we appreciate that chronic inflammation leads to T cell dysfunction. While this may arise as the host balances the goals of bacterial sterilization and avoidance of tissue damage, it is becoming clear that T cell dysfunction impairs host resistance. Defining the mechanisms that lead to T cell dysfunction is crucial as memory T cell responses are likely to be subject to the same subject to the same pressures. Thus, success of T cell based vaccines is predicated on memory T cells avoiding exhaustion while at the same time not promoting overt tissue damage. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Akt signaling is critical for memory CD8+ T-cell development and tumor immune surveillance.

    PubMed

    Rogel, Anne; Willoughby, Jane E; Buchan, Sarah L; Leonard, Henry J; Thirdborough, Stephen M; Al-Shamkhani, Aymen

    2017-02-14

    Memory CD8 + T cells confer long-term immunity against tumors, and anticancer vaccines therefore should maximize their generation. Multiple memory CD8 + T-cell subsets with distinct functional and homing characteristics exist, but the signaling pathways that regulate their development are ill defined. Here we examined the role of the serine/threonine kinase Akt in the generation of protective immunity by CD8 + T cells. Akt is known to be activated by the T-cell antigen receptor and the cytokine IL-2, but its role in T-cell immunity in vivo has not been explored. Using CD8 + T cells from pdk1 K465E/K465E knockin mice, we found that decreased Akt activity inhibited the survival of T cells during the effector-to-memory cell transition and abolished their differentiation into C-X-C chemokine receptor 3 (CXCR3) lo CD43 lo effector-like memory cells. Consequently, antitumor immunity by CD8 + T cells that display defective Akt signaling was substantially diminished during the memory phase. Reduced memory T-cell survival and altered memory cell differentiation were associated with up-regulation of the proapoptotic protein Bim and the T-box transcription factor eomesodermin, respectively. These findings suggest an important role for effector-like memory CD8 + T cells in tumor immune surveillance and identify Akt as a key signaling node in the development of protective memory CD8 + T-cell responses.

  4. Akt signaling is critical for memory CD8+ T-cell development and tumor immune surveillance

    PubMed Central

    Rogel, Anne; Willoughby, Jane E.; Buchan, Sarah L.; Leonard, Henry J.; Thirdborough, Stephen M.; Al-Shamkhani, Aymen

    2017-01-01

    Memory CD8+ T cells confer long-term immunity against tumors, and anticancer vaccines therefore should maximize their generation. Multiple memory CD8+ T-cell subsets with distinct functional and homing characteristics exist, but the signaling pathways that regulate their development are ill defined. Here we examined the role of the serine/threonine kinase Akt in the generation of protective immunity by CD8+ T cells. Akt is known to be activated by the T-cell antigen receptor and the cytokine IL-2, but its role in T-cell immunity in vivo has not been explored. Using CD8+ T cells from pdk1K465E/K465E knockin mice, we found that decreased Akt activity inhibited the survival of T cells during the effector-to-memory cell transition and abolished their differentiation into C-X-C chemokine receptor 3 (CXCR3)loCD43lo effector-like memory cells. Consequently, antitumor immunity by CD8+ T cells that display defective Akt signaling was substantially diminished during the memory phase. Reduced memory T-cell survival and altered memory cell differentiation were associated with up-regulation of the proapoptotic protein Bim and the T-box transcription factor eomesodermin, respectively. These findings suggest an important role for effector-like memory CD8+ T cells in tumor immune surveillance and identify Akt as a key signaling node in the development of protective memory CD8+ T-cell responses. PMID:28137869

  5. Innate lymphoid cells and natural killer T cells in the gastrointestinal tract immune system.

    PubMed

    Montalvillo, Enrique; Garrote, José Antonio; Bernardo, David; Arranz, Eduardo

    2014-05-01

    The gastrointestinal tract is equipped with a highly specialized intrinsic immune system. However, the intestine is exposed to a high antigenic burden that requires a fast, nonspecific response -so-called innate immunity- to maintain homeostasis and protect the body from incoming pathogens. In the last decade multiple studies helped to unravel the particular developmental requirements and specific functions of the cells that play a role in innate immunity. In this review we shall focus on innate lymphoid cells, a newly discovered, heterogeneous set of cells that derive from an Id2-dependent lymphoid progenitor cell population. These cells have been categorized on the basis of the pattern of cytokines that they secrete, and the transcription factors that regulate their development and functions. Innate lymphoid cells play a role in the early response to pathogens, the anatomical contention of the commensal flora, and the maintenance of epithelial integrity.Amongst the various innate lymphoid cells we shall lay emphasis on a subpopulation with several peculiarities, namely that of natural killer T cells, a subset of T lymphocytes that express both T-cell and NK-cell receptors. The most numerous fraction of the NKT population are the so-called invariant NKT or iNKT cells. These iNKT cells have an invariant TCR and recognize the glycolipidic structures presented by the CD1d molecule, a homolog of class-I MHC molecules. Following activation they rapidly acquire cytotoxic activity and secrete both Th1 and Th2 cytokines, including IL-17. While their specific role is not yet established, iNKT cells take part in a great variety of intestinal immune responses ranging from oral tolerance to involvement in a number of gastrointestinal conditions.

  6. Lung dendritic cells imprint T cell lung homing and promote lung immunity through the chemokine receptor CCR4

    PubMed Central

    Strassner, James P.

    2013-01-01

    T cell trafficking into the lung is critical for lung immunity, but the mechanisms that mediate T cell lung homing are not well understood. Here, we show that lung dendritic cells (DCs) imprint T cell lung homing, as lung DC–activated T cells traffic more efficiently into the lung in response to inhaled antigen and at homeostasis compared with T cells activated by DCs from other tissues. Consequently, lung DC–imprinted T cells protect against influenza more effectively than do gut and skin DC–imprinted T cells. Lung DCs imprint the expression of CCR4 on T cells, and CCR4 contributes to T cell lung imprinting. Lung DC–activated, CCR4-deficient T cells fail to traffic into the lung as efficiently and to protect against influenza as effectively as lung DC–activated, CCR4-sufficient T cells. Thus, lung DCs imprint T cell lung homing and promote lung immunity in part through CCR4. PMID:23960189

  7. Immunization with M2e-Displaying T7 Bacteriophage Nanoparticles Protects against Influenza A Virus Challenge

    PubMed Central

    Hashemi, Hamidreza; Pouyanfard, Somayeh; Bandehpour, Mojgan; Noroozbabaei, Zahra; Kazemi, Bahram; Saelens, Xavier; Mokhtari-Azad, Talat

    2012-01-01

    Considering the emergence of highly pathogenic influenza viruses and threat of worldwide pandemics, there is an urgent need to develop broadly-protective influenza vaccines. In this study, we demonstrate the potential of T7 bacteriophage-based nanoparticles with genetically fused ectodomain of influenza A virus M2 protein (T7-M2e) as a candidate universal flu vaccine. Immunization of mice with non-adjuvanted T7-M2e elicited M2e-specific serum antibody responses that were similar in magnitude to those elicited by M2e peptide administered in Freund’s adjuvant. Comparable IgG responses directed against T7 phage capsomers were induced following vaccination with wild type T7 or T7-M2e. T7-M2e immunization induced balanced amounts of IgG1 and IgG2a antibodies and these antibodies specifically recognized native M2 on the surface of influenza A virus-infected mammalian cells. The frequency of IFN-γ-secreting T cells induced by T7-M2e nanoparticles was comparable to those elicited by M2e peptide emulsified in Freund’s adjuvant. Emulsification of T7-M2e nanoparticles in Freund’s adjuvant, however, induced a significantly stronger T cell response. Furthermore, T7-M2e-immunized mice were protected against lethal challenge with an H1N1 or an H3N2 virus, implying the induction of hetero-subtypic immunity in our mouse model. T7-M2e-immunized mice displayed considerable weight loss and had significantly reduced viral load in their lungs compared to controls. We conclude that display of M2e on the surface of T7 phage nanoparticles offers an efficient and economical opportunity to induce cross-protective M2e-based immunity against influenza A. PMID:23029232

  8. Protective CD8 Memory T Cell Responses to Mouse Melanoma Are Generated in the Absence of CD4 T Cell Help

    PubMed Central

    Steinberg, Shannon M.; Zhang, Peisheng; Turk, Mary Jo

    2011-01-01

    Background We have previously demonstrated that temporary depletion of CD4 T cells in mice with progressive B16 melanoma, followed by surgical tumor excision, induces protective memory CD8 T cell responses to melanoma/melanocyte antigens. We also showed that persistence of these CD8 T cells is supported, in an antigen-dependent fashion, by concurrent autoimmune melanocyte destruction. Herein we explore the requirement of CD4 T cell help in priming and maintaining this protective CD8 T cell response to melanoma. Methodology and Principal Findings To induce melanoma/melanocyte antigen-specific CD8 T cells, B16 tumor bearing mice were depleted of regulatory T cells (Treg) by either temporary, or long-term continuous treatment with anti-CD4 (mAb clone GK1.5). Total depletion of CD4 T cells led to significant priming of IFN-γ-producing CD8 T cell responses to TRP-2 and gp100. Surprisingly, treatment with anti-CD25 (mAb clone PC61), to specifically deplete Treg cells while leaving help intact, was ineffective at priming CD8 T cells. Thirty to sixty days after primary tumors were surgically excised, mice completely lacking CD4 T cell help developed autoimmune vitiligo, and maintained antigen-specific memory CD8 T cell responses that were highly effective at producing cytokines (IFN-γ, TNF-α, and IL-2). Mice lacking total CD4 T cell help also mounted protection against re-challenge with B16 melanoma sixty days after primary tumor excision. Conclusions and Significance This work establishes that CD4 T cell help is dispensable for the generation of protective memory T cell responses to melanoma. Our findings support further use of CD4 T cell depletion therapy for inducing long-lived immunity to cancer. PMID:22046294

  9. Curcumin reverses T cell-mediated adaptive immune dysfunctions in tumor-bearing hosts.

    PubMed

    Bhattacharyya, Sankar; Md Sakib Hossain, Dewan; Mohanty, Suchismita; Sankar Sen, Gouri; Chattopadhyay, Sreya; Banerjee, Shuvomoy; Chakraborty, Juni; Das, Kaushik; Sarkar, Diptendra; Das, Tanya; Sa, Gaurisankar

    2010-07-01

    Immune dysfunction is well documented during tumor progression and likely contributes to tumor immune evasion. CD8(+) cytotoxic T lymphocytes (CTLs) are involved in antigen-specific tumor destruction and CD4(+) T cells are essential for helping this CD8(+) T cell-dependent tumor eradication. Tumors often target and inhibit T-cell function to escape from immune surveillance. This dysfunction includes loss of effector and memory T cells, bias towards type 2 cytokines and expansion of T regulatory (Treg) cells. Curcumin has previously been shown to have antitumor activity and some research has addressed the immunoprotective potential of this plant-derived polyphenol in tumor-bearing hosts. Here we examined the role of curcumin in the prevention of tumor-induced dysfunction of T cell-based immune responses. We observed severe loss of both effector and memory T-cell populations, downregulation of type 1 and upregulation of type 2 immune responses and decreased proliferation of effector T cells in the presence of tumors. Curcumin, in turn, prevented this loss of T cells, expanded central memory T cell (T(CM))/effector memory T cell (T(EM)) populations, reversed the type 2 immune bias and attenuated the tumor-induced inhibition of T-cell proliferation in tumor-bearing hosts. Further investigation revealed that tumor burden upregulated Treg cell populations and stimulated the production of the immunosuppressive cytokines transforming growth factor (TGF)-beta and IL-10 in these cells. Curcumin, however, inhibited the suppressive activity of Treg cells by downregulating the production of TGF-beta and IL-10 in these cells. More importantly, curcumin treatment enhanced the ability of effector T cells to kill cancer cells. Overall, our observations suggest that the unique properties of curcumin may be exploited for successful attenuation of tumor-induced suppression of cell-mediated immune responses.

  10. [Protective immunity against Mycobacterium tuberculosis].

    PubMed

    Kawamura, Ikuo

    2006-11-01

    Mycobacterium tuberculosis (MTB) is a facultative intracellular pathogen with which over a billion people have been infected and 3 million people die annually. The bacterium induces vigorous immune responses, yet evades host immunity, persisting within phagosomes of the infected macrophages. Thus, it is necessary to delineate that the virulence-related intracellular survival mechanism and the host immune responses to eradicate M. tuberculosis on the molecular basis. In this regard, recent findings clearly indicated that Toll-like receptors (TLRs) play an essential role in the recognition of MTB components by macrophages and dendritic cells, resulting in not only activation of innate immunity but also development of antigen-specific adaptive immunity. It has been also reported that induction of early death of the infected cells may be one of the strategy of host defense against MTB because macrophages go into apoptosis upon infection with MTB, resulting in suppression of the intracellular replication. Furthermore, recent report has shown that autophagy is induced by IFN-gamma and suppress intracellular survival of mycobacteria, suggesting that activation of autophagy pathway is required to overcome phagosome maturation arrest induced by MTB. In addition, it is known that IFN-gamma plays an important role in protection. The cytokine that is produced from NK cells and dendritic cells at the early period of infection strongly induces not only macrophage activation but also development of antigen-specific IFN-gamma-producing CD4+T cells. Since antigen-specific CD8+ T cells and CD1-restricted T cells are also reported to contribute to the protective immunity, cooperation of these T cells is essential for the host resistance. In this paper, I am going to summarize the recent progress of the understanding of protective immunity against MTB.

  11. Inducible nitric oxide synthase in T cells regulates T cell death and immune memory

    PubMed Central

    Vig, Monika; Srivastava, Smita; Kandpal, Usha; Sade, Hadassah; Lewis, Virginia; Sarin, Apurva; George, Anna; Bal, Vineeta; Durdik, Jeannine M.; Rath, Satyajit

    2004-01-01

    The progeny of T lymphocytes responding to immunization mostly die rapidly, leaving a few long-lived survivors functioning as immune memory. Thus, control of this choice of death versus survival is critical for immune memory. There are indications that reactive radicals may be involved in this death pathway. We now show that, in mice lacking inducible nitric oxide synthase (iNOS), higher frequencies of both CD4 and CD8 memory T cells persist in response to immunization, even when iNOS+/+ APCs are used for immunization. Postactivation T cell death by neglect is reduced in iNOS–/– T cells, and levels of the antiapoptotic proteins Bcl-2 and Bcl-xL are increased. Inhibitors of the iNOS-peroxynitrite pathway also enhance memory responses and block postactivation death by neglect in both mouse and human T cells. However, early primary immune responses are not enhanced, which suggests that altered survival, rather than enhanced activation, is responsible for the persistent immunity observed. Thus, in primary immune responses, iNOS in activated T cells autocrinely controls their susceptibility to death by neglect to determine the level of persisting CD4 and CD8 T cell memory, and modulation of this pathway can enhance the persistence of immune memory in response to vaccination. PMID:15199408

  12. L-selectin Is Essential for Delivery of Activated CD8+ T Cells to Virus-Infected Organs for Protective Immunity

    PubMed Central

    Mohammed, Rebar N.; Watson, H. Angharad; Vigar, Miriam; Ohme, Julia; Thomson, Amanda; Humphreys, Ian R.; Ager, Ann

    2016-01-01

    Summary Cytotoxic CD8+ T lymphocytes play a critical role in the host response to infection by viruses. The ability to secrete cytotoxic chemicals and cytokines is considered pivotal for eliminating virus. Of equal importance is how effector CD8+ T cells home to virus-infected tissues. L-selectin has not been considered important for effector T cell homing, because levels are low on activated T cells. We report here that, although L-selectin expression is downregulated following T cell priming in lymph nodes, L-selectin is re-expressed on activated CD8+ T cells entering the bloodstream, and recruitment of activated CD8+ T cells from the bloodstream into virus-infected tissues is L-selectin dependent. Furthermore, L-selectin on effector CD8+ T cells confers protective immunity to two evolutionally distinct viruses, vaccinia and influenza, which infect mucosal and visceral organs, respectively. These results connect homing and a function of virus-specific CD8+ T cells to a single molecule, L-selectin. PMID:26804910

  13. Persistence of Protective Immunity to Malaria Induced by DNA Priming and Poxvirus Boosting: Characterization of Effector and Memory CD8+-T-Cell Populations

    PubMed Central

    Sedegah, Martha; Brice, Gary T.; Rogers, William O.; Doolan, Denise L.; Charoenvit, Yupin; Jones, Trevor R.; Majam, Victoria F.; Belmonte, Arnel; Lu, Minh; Belmonte, Maria; Carucci, Daniel J.; Hoffman, Stephen L.

    2002-01-01

    The persistence of immunity to malaria induced in mice by a heterologous DNA priming and poxvirus boosting regimen was characterized. Mice were immunized by priming with DNA vaccine plasmids encoding the Plasmodium yoelii circumsporozoite protein (PyCSP) and murine granulocyte-macrophage colony-stimulating factor and boosting with recombinant vaccinia encoding PyCSP. BALB/c mice immunized with either high-dose (100 μg of p PyCSP plus 30 μg of pGM-CSF) or low-dose (1 μg of p PyCSP plus 1 μg of pGM-CSF DNA) priming were protected against challenge with 50 P. yoelii sporozoites. Protection 2 weeks after immunization was 70 to 100%, persisted at this level for at least 20 weeks, and declined to 30 to 40% by 28 weeks. Eight of eight mice protected at 20 weeks were still protected when rechallenged at 40 weeks. The antigen (Ag)-specific effector CD8+-T-cell population present 2 weeks after boosting had ex vivo Ag-specific cytolytic activity, expressed both gamma interferon (IFN-γ) and tumor necrosis factor alpha, and constituted 12 to 20% of splenic CD8+ T cells. In contrast, the memory CD8+-Ag-specific-cell population at 28 weeks lacked cytolytic activity and constituted only 6% of splenic CD8+ T cells, but at the single-cell level it produced significantly higher levels of IFN-γ than the effectors. High levels of Ag- or parasite-specific antibodies present 2 weeks after boosting had declined three- to sevenfold by 28 weeks. Low-dose priming was similarly immunogenic and as protective as high-dose priming against a 50-, but not a 250-, sporozoite challenge. These results demonstrate that a heterologous priming and boosting vaccination can provide lasting protection against malaria in this model system. PMID:12065488

  14. Regionally compartmentalized resident memory T cells mediate naturally acquired protection against pneumococcal pneumonia.

    PubMed

    Smith, N Ms; Wasserman, G A; Coleman, F T; Hilliard, K L; Yamamoto, K; Lipsitz, E; Malley, R; Dooms, H; Jones, M R; Quinton, L J; Mizgerd, J P

    2018-01-01

    As children age, they become less susceptible to the diverse microbes causing pneumonia. These microbes are pathobionts that infect the respiratory tract multiple times during childhood, generating immunological memory. To elucidate mechanisms of such naturally acquired immune protection against pneumonia, we modeled a relevant immunological history in mice by infecting their airways with mismatched serotypes of Streptococcus pneumoniae (pneumococcus). Previous pneumococcal infections provided protection against a heterotypic, highly virulent pneumococcus, as evidenced by reduced bacterial burdens and long-term sterilizing immunity. This protection was diminished by depletion of CD4 + cells prior to the final infection. The resolution of previous pneumococcal infections seeded the lungs with CD4 + resident memory T (T RM ) cells, which responded to heterotypic pneumococcus stimulation by producing multiple effector cytokines, particularly interleukin (IL)-17A. Following lobar pneumonias, IL-17-producing CD4 + T RM cells were confined to the previously infected lobe, rather than dispersed throughout the lower respiratory tract. Importantly, pneumonia protection also was confined to that immunologically experienced lobe. Thus regionally localized memory cells provide superior local tissue protection to that mediated by systemic or central memory immune defenses. We conclude that respiratory bacterial infections elicit CD4 + T RM cells that fill a local niche to optimize heterotypic protection of the affected tissue, preventing pneumonia.

  15. The ΔfbpA attenuated candidate vaccine from Mycobacterium tuberculosis, H37Rv primes for a stronger T-bet dependent Th1 immunity in mice.

    PubMed

    Roche, Cherie M; Smith, Amanda; Lindsey, Devin R; Meher, Akshay; Schluns, Kimberly; Arora, Ashish; Armitige, Lisa Y; Jagannath, Chinnaswamy

    2011-12-01

    The ΔfbpA candidate vaccine derived from Mycobacterium tuberculosis (H37Rv) (Mtb) protects mice better than BCG against tuberculosis, and we investigated the hypothesis that ΔfbpA may induce a stronger Th1 immunity. Since T-bet transcription factor regulates Th1 immunity, mice infected with ΔfbpA, BCG vaccine and related mycobacteria were analyzed for T-bet positive T cells. Mouse dendritic cells (DCs) or macrophages were also pulsed with excretory-secreted antigens (ES; Antigen-85B, ESAT-6 and CFP10) and cocultured with T cells from immunized or naïve mice and tested for in vitro induction of T-bet and IFN-γ. In both models, ΔfbpA mutant induced a stronger response of T-bet(+)CD4 T cells, which correlated with an increased expansion of IFN-γ(+)CD4 T cells in vivo and in vitro. When DCs pulsed with ES antigens were allowed to stimulate T cells, ESAT-6 and CFP-10 failed to induce a recall expansion of T-bet(+)IFN-γ(+)CD4 T cells from BCG vaccinated mice. Thus, deletion of RD1 in BCG seems to reduce its ability to induce T-bet and induce stronger Th1 immunity. Finally, mice were vaccinated with ΔfbpA and BCG and challenged with virulent Mtb for evaluation of protection and T cell expansion. ΔfbpA vaccinated mice showed a rapid and stronger expansion of CD4(+)CXCR3(+) IFN-γ(+) T cells in the lungs of Mtb challenged mice, compared to those which had BCG vaccine. ΔfbpA immunized mice also showed a better decline of the Mtb bacterial counts of the lungs. Mtb derived ΔfbpA candidate vaccine therefore induces qualitatively better T-bet dependent Th1 immunity than BCG vaccine. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Friends and foes of tuberculosis: modulation of protective immunity.

    PubMed

    Brighenti, Susanna; Joosten, Simone A

    2018-05-27

    Protective immunity in tuberculosis (TB) is subject of debate in the TB research community, as this is key to fully understand TB pathogenesis and to develop new promising tools for TB diagnosis and prognosis as well as a more efficient TB vaccine. IFN-γ producing CD4 + T cells are key in TB control, but may not be sufficient to provide protection. Additional subsets have been identified that contribute to protection such as multifunctional and cytolytic T cell subsets, including classical and non-classical T cells as well as novel innate immune cell subsets resulting from trained immunity. However, to define protective immune responses against TB, the complexity of balancing TB immunity also has to be considered. In this review, insights in effector cell immunity and how this is modulated by regulatory cells, associated comorbidities and the host microbiome is discussed. We systematically map how different suppressive immune cell subsets may affect effector cell responses at the local site of infection. We also dissect how common co-morbidities such as HIV, helminthes and diabetes may bias protective TB immunity towards pathogenic and regulatory responses. Finally, also the composition and diversity of the microbiome in the lung and gut could affect host TB immunity. Understanding these various aspects of the immunological balance in the human host is fundamental to prevent TB infection and disease. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. γδ T cells exhibit multifunctional and protective memory in intestinal tissues

    PubMed Central

    Sheridan, Brian S.; Romagnoli, Pablo A.; Pham, Quynh-Mai; Fu, Han-Hsuan; Alonzo, Francis; Schubert, Wolf-Dieter; Freitag, Nancy E.; Lefrançois, Leo

    2013-01-01

    Summary The study of T cell memory and the target of vaccine design has focused on memory subsumed by T cells bearing the αβ T cell receptor. Alternatively, γδ T cells are thought to provide rapid immunity particularly at mucosal borders. Here we have shown that a distinct subset of mucosal γδ T cells mounts an immune response to oral Listeria monocytogenes (Lm) infection leading to the development of multifunctional memory T cells in the murine intestinal mucosa that is capable of simultaneously producing interferon-γ and interleukin-17A. Challenge infection with oral Lm, but not oral Salmonella or intravenous Lm, induced rapid expansion of memory γδ T cells suggesting contextual specificity to the priming pathogen. Importantly, memory γδ T cells were able to provide enhanced protection against infection. These findings illustrate a previously unrecognized role for γδ T cells with hallmarks of adaptive immunity in the intestinal mucosa. PMID:23890071

  18. Leptin Metabolically Licenses T Cells for Activation to Link Nutrition and Immunity

    PubMed Central

    Saucillo, Donte C.; Gerriets, Valerie A.; Sheng, John; Rathmell, Jeffrey C.; MacIver, Nancie J.

    2013-01-01

    Immune responses are highly energy dependent processes. Activated T cells increase glucose uptake and aerobic glycolysis to survive and function. Malnutrition and starvation limit nutrients and are associated with immune deficiency and increased susceptibility to infection. While it is clear that immunity is suppressed in times of nutrient stress, mechanisms that link systemic nutrition to T cell function are poorly understood. We show here that fasting leads to persistent defects in T cell activation and metabolism, as T cells from fasted animals had low glucose uptake and decreased ability to produce inflammatory cytokines, even when stimulated in nutrient-rich media. To explore the mechanism of this long-lasting T cell metabolic defect, we examined leptin, an adipokine reduced in fasting that regulates systemic metabolism and promotes effector T cell function. We show leptin is essential for activated T cells to upregulate glucose uptake and metabolism. This effect was cell-intrinsic and specific to activated effector T cells, as naïve T cells and Treg did not require leptin for metabolic regulation. Importantly, either leptin addition to cultured T cells from fasted animals or leptin injections to fasting animals was sufficient to rescue both T cell metabolic and functional defects. Leptin-mediated metabolic regulation was critical, as transgenic expression of the glucose transporter Glut1 rescued cytokine production of T cells from fasted mice. Together, these data demonstrate that induction of T cell metabolism upon activation is dependent on systemic nutritional status, and leptin links adipocytes to metabolically license activated T cells in states of nutritional sufficiency. PMID:24273001

  19. A novel differentiation pathway from CD4+ T cells to CD4− T cells for maintaining immune system homeostasis

    PubMed Central

    Zhao, X; Sun, G; Sun, X; Tian, D; Liu, K; Liu, T; Cong, M; Xu, H; Li, X; Shi, W; Tian, Y; Yao, J; Guo, H; Zhang, D

    2016-01-01

    CD4+ T lymphocytes are key players in the adaptive immune system and can differentiate into a variety of effector and regulatory T cells. Here, we provide evidence that a novel differentiation pathway of CD4+ T cells shifts the balance from a destructive T-cell response to one that favors regulation in an immune-mediated liver injury model. Peripheral CD4−CD8−NK1.1− double-negative T cells (DNT) was increased following Concanavalin A administration in mice. Adoptive transfer of DNT led to significant protection from hepatocyte necrosis by direct inhibition on the activation of lymphocytes, a process that occurred primarily through the perforin-granzyme B route. These DNT converted from CD4+ rather than CD8+ T cells, a process primarily regulated by OX40. DNT migrated to the liver through the CXCR3-CXCL9/CXCL10 interaction. In conclusion, we elucidated a novel differentiation pathway from activated CD4+ T cells to regulatory DNT cells for maintaining homeostasis of the immune system in vivo, and provided key evidence that utilizing this novel differentiation pathway has potential application in the prevention and treatment of autoimmune diseases. PMID:27077809

  20. T cell-dependent antibody production by Ly-1 B cells.

    PubMed

    Taki, S; Schmitt, M; Tarlinton, D; Förster, I; Rajewsky, K

    1992-05-04

    Through the use of a SCID transfer system, we have demonstrated that under certain conditions, the production of Ig by Ly-1 B cells can be modulated by T cells. This modulation can take the form of enhanced isotype production or isotype-switch induction and to some extent appears to be dependent on the activation state of the T cells. Furthermore we have shown that Ly-1 B cells can mount an idiotypically restricted T cell-dependent immune response to the antigen PC-KLH. This result suggests that the previous failure to observe T cell-dependent responses by Ly-1 B cells has been due to these B cells being "blind" to the antigens used and is not due to some inherent property of these B cells. When one considers the previous reports of the substantial contribution of Ly-1 B cells to the natural serum immunoglobulin levels and the ability of T cells to affect Ig production by Ly-1 B cells documented in this report, it is clear that the interaction of T cells with the Ly-1 B-cell population is important in determining the "natural" serum Ig repertoire of the mouse.

  1. Regulatory T-cell activity but not conventional HIV-specific T-cell responses are associated with protection from HIV-1 infection

    PubMed Central

    Pattacini, Laura; Baeten, Jared M.; Thomas, Katherine K.; Fluharty, Tayler R.; Murnane, Pamela M.; Donnell, Deborah; Bukusi, Elizabeth; Ronald, Allan; Mugo, Nelly; Lingappa, Jairam R.; Celum, Connie; McElrath, M. Juliana; Lund, Jennifer M.

    2015-01-01

    Objective Two distinct hypotheses have been proposed for T-cell involvement in protection from HIV-1 acquisition. First, HIV-1-specific memory T-cell responses generated upon HIV-1 exposure could mount an efficient response to HIV-1 and inhibit the establishment of an infection. Second, a lower level of immune activation could reduce the numbers of activated, HIV-1-susceptible CD4+ T-cells, thereby diminishing the likelihood of infection. Methods To test these hypotheses, we conducted a prospective study among high-risk heterosexual men and women, and tested peripheral blood samples from individuals who subsequently acquired HIV-1 during follow-up (cases) and from a subset of those who remained HIV-1 uninfected (controls). Results We found no difference in HIV-1-specific immune responses between cases and controls, but Treg frequency was higher in controls as compared to cases and was negatively associated with frequency of effector memory CD4+ T-cells. Conclusions Our findings support the hypothesis that low immune activation assists in protection from HIV-1 infection. PMID:26656786

  2. CD8+ T cells complement antibodies in protecting against yellow fever virus.

    PubMed

    Bassi, Maria R; Kongsgaard, Michael; Steffensen, Maria A; Fenger, Christina; Rasmussen, Michael; Skjødt, Karsten; Finsen, Bente; Stryhn, Anette; Buus, Søren; Christensen, Jan P; Thomsen, Allan R

    2015-02-01

    The attenuated yellow fever (YF) vaccine (YF-17D) was developed in the 1930s, yet little is known about the protective mechanisms underlying its efficiency. In this study, we analyzed the relative contribution of cell-mediated and humoral immunity to the vaccine-induced protection in a murine model of YF-17D infection. Using different strains of knockout mice, we found that CD4(+) T cells, B cells, and Abs are required for full clinical protection of vaccinated mice, whereas CD8(+) T cells are dispensable for long-term survival after intracerebral challenge. However, by analyzing the immune response inside the infected CNS, we observed an accelerated T cell influx into the brain after intracerebral challenge of vaccinated mice, and this T cell recruitment correlated with improved virus control in the brain. Using mice deficient in B cells we found that, in the absence of Abs, YF vaccination can still induce some antiviral protection, and in vivo depletion of CD8(+) T cells from these animals revealed a pivotal role for CD8(+) T cells in controlling virus replication in the absence of a humoral response. Finally, we demonstrated that effector CD8(+) T cells also contribute to viral control in the presence of circulating YF-specific Abs. To our knowledge, this is the first time that YF-specific CD8(+) T cells have been demonstrated to possess antiviral activity in vivo. Copyright © 2015 by The American Association of Immunologists, Inc.

  3. The biological and practical significance of antigenic variability in protective T cell responses against Theileria parva.

    PubMed

    Morrison, W I

    2007-08-19

    The evolution of antigenically distinct pathogen strains that fail to cross-protect is well documented for pathogens controlled primarily by humoral immune responses. Unlike antibodies, which recognise native proteins, protective T cells can potentially recognise epitopes in a variety of proteins that are not necessarily displayed on the pathogen surface. Moreover, individual hosts of different MHC genotypes generally respond to different sets of epitopes. It is therefore less easy to envisage how strain restricted immunity can arise for pathogens controlled by T cell responses, particularly in antigenically complex parasites. Nevertheless, strain restricted immunity is clearly a feature of a number of parasitic infections, where immunity is known to be mediated by T cell responses. One such parasite is Theileria parva which induces potent CD8 T cell responses that play an important role in immunity. CD8 T cells specific for parasitized lymphoblasts exhibit strain specificity, which appears to correlate with the ability of parasite strains to cross-protect. Studies using recently identified T. parva antigens recognised by CD8 T cells have shown that the strain restricted nature of immunity is a consequence of the CD8 T cell response in individual animals being focused on a limited number of dominant polymorphic antigenic determinants. Responses in animals of different MHC genotypes are often directed to different parasite antigens, indicating that, at the host population level, a larger number of parasite proteins can serve as targets for the protective T cell response. Nevertheless, the finding that parasite strains show overlapping antigenic profiles, probably as a consequence of sexual recombination, suggests that induction of responses to an extended but limited set of antigens in individual animals may overcome the strain restricted nature of immunity.

  4. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    PubMed

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  5. Surface receptor Toso controls B cell-mediated regulation of T cell immunity.

    PubMed

    Yu, Jinbo; Duong, Vu Huy Hoang; Westphal, Katrin; Westphal, Andreas; Suwandi, Abdulhadi; Grassl, Guntram A; Brand, Korbinian; Chan, Andrew C; Föger, Niko; Lee, Kyeong-Hee

    2018-05-01

    The immune system is tightly controlled by regulatory processes that allow for the elimination of invading pathogens, while limiting immunopathological damage to the host. In the present study, we found that conditional deletion of the cell surface receptor Toso on B cells unexpectedly resulted in impaired proinflammatory T cell responses, which led to impaired immune protection in an acute viral infection model and was associated with reduced immunopathological tissue damage in a chronic inflammatory context. Toso exhibited its B cell-inherent immunoregulatory function by negatively controlling the pool of IL-10-competent B1 and B2 B cells, which were characterized by a high degree of self-reactivity and were shown to mediate immunosuppressive activity on inflammatory T cell responses in vivo. Our results indicate that Toso is involved in the differentiation/maintenance of regulatory B cells by fine-tuning B cell receptor activation thresholds. Furthermore, we showed that during influenza A-induced pulmonary inflammation, the application of Toso-specific antibodies selectively induced IL-10-competent B cells at the site of inflammation and resulted in decreased proinflammatory cytokine production by lung T cells. These findings suggest that Toso may serve as a novel therapeutic target to dampen pathogenic T cell responses via the modulation of IL-10-competent regulatory B cells.

  6. Reproductive Toxicity of T Cells in Early Life: Abnormal Immune Development and Postnatal Diseases.

    PubMed

    Liu, Han-Xiao; Jiang, Aifang; Chen, Ting; Qu, Wen; Yan, Hui-Yi; Ping, Jie

    2017-01-01

    Immunity is a balanced status with adequate biological defenses to recognize and fight "non-self", as well as adequate tolerance to recognize "self". To maintain this immune homeostasis, a well-organized T cell immune network is required, which in part depends on the well-controlled development of alternative effector T cells, with different cytokine repertoires. Recent researches have pointed that developing fetal T cells network is a remarkably sensitive toxicological target for adverse factors in early life. Epidemiological and experimental studies showed an inseparable relationship between T cell developmental toxicity and immune diseases in adults. Considering that the inflammatory and immune disorders have become a growing health problem worldwide, increasing attention is now being paid to the T cell developmental toxicity. We propose that adverse factors may have programming effects on the crucial functions of immune system during early life which is critical for fetal T cell development and the establishment of the distinct T cell repertoires balance. The permanently disturbed intrathymic or peripheral T cell development may in turn lead to the immune disorders in later life. In this manuscript, we reviewed how adverse factors affected T cell development in early-life with the consequence of the immune dysfunction and immune diseases, and further elucidate the mechanisms. These mechanisms will be helpful in prevention and treatment of the increased prevalence of immune diseases by interfering those pathways. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. Sterile Immunity to Malaria after DNA Prime/Adenovirus Boost Immunization Is Associated with Effector Memory CD8+T Cells Targeting AMA1 Class I Epitopes

    PubMed Central

    Sedegah, Martha; Hollingdale, Michael R.; Farooq, Fouzia; Ganeshan, Harini; Belmonte, Maria; Kim, Yohan; Peters, Bjoern; Sette, Alessandro; Huang, Jun; McGrath, Shannon; Abot, Esteban; Limbach, Keith; Shi, Meng; Soisson, Lorraine; Diggs, Carter; Chuang, Ilin; Tamminga, Cindy; Epstein, Judith E.; Villasante, Eileen; Richie, Thomas L.

    2014-01-01

    Background Fifteen volunteers were immunized with three doses of plasmid DNA encoding P. falciparum circumsporozoite protein (CSP) and apical membrane antigen-1 (AMA1) and boosted with human adenovirus-5 (Ad) expressing the same antigens (DNA/Ad). Four volunteers (27%) demonstrated sterile immunity to controlled human malaria infection and, overall, protection was statistically significantly associated with ELISpot and CD8+ T cell IFN-γ activities to AMA1 but not CSP. DNA priming was required for protection, as 18 additional subjects immunized with Ad alone (AdCA) did not develop sterile protection. Methodology/Principal Findings We sought to identify correlates of protection, recognizing that DNA-priming may induce different responses than AdCA alone. Among protected volunteers, two and three had higher ELISpot and CD8+ T cell IFN-γ responses to CSP and AMA1, respectively, than non-protected volunteers. Unexpectedly, non-protected volunteers in the AdCA trial showed ELISpot and CD8+ T cell IFN-γ responses to AMA1 equal to or higher than the protected volunteers. T cell functionality assessed by intracellular cytokine staining for IFN-γ, TNF-α and IL-2 likewise did not distinguish protected from non-protected volunteers across both trials. However, three of the four protected volunteers showed higher effector to central memory CD8+ T cell ratios to AMA1, and one of these to CSP, than non-protected volunteers for both antigens. These responses were focused on discrete regions of CSP and AMA1. Class I epitopes restricted by A*03 or B*58 supertypes within these regions of AMA1 strongly recalled responses in three of four protected volunteers. We hypothesize that vaccine-induced effector memory CD8+ T cells recognizing a single class I epitope can confer sterile immunity to P. falciparum in humans. Conclusions/Significance We suggest that better understanding of which epitopes within malaria antigens can confer sterile immunity and design of vaccine approaches

  8. Neonatal Fc receptor expression in dendritic cells mediates protective immunity against colorectal cancer.

    PubMed

    Baker, Kristi; Rath, Timo; Flak, Magdalena B; Arthur, Janelle C; Chen, Zhangguo; Glickman, Jonathan N; Zlobec, Inti; Karamitopoulou, Eva; Stachler, Matthew D; Odze, Robert D; Lencer, Wayne I; Jobin, Christian; Blumberg, Richard S

    2013-12-12

    Cancers arising in mucosal tissues account for a disproportionately large fraction of malignancies. Immunoglobulin G (IgG) and the neonatal Fc receptor for IgG (FcRn) have an important function in the mucosal immune system that we have now shown extends to the induction of CD8(+) T cell-mediated antitumor immunity. We demonstrate that FcRn within dendritic cells (DCs) was critical for homeostatic activation of mucosal CD8(+) T cells that drove protection against the development of colorectal cancers and lung metastases. FcRn-mediated tumor protection was driven by DCs activation of endogenous tumor-reactive CD8(+) T cells via the cross-presentation of IgG complexed antigens (IgG IC), as well as the induction of cytotoxicity-promoting cytokine secretion, particularly interleukin-12, both of which were independently triggered by the FcRn-IgG IC interaction in murine and human DCs. FcRn thus has a primary role within mucosal tissues in activating local immune responses that are critical for priming efficient anti-tumor immunosurveillance. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Protective antitumor activity through dendritic cell immunization is mediated by NK cell as well as CTL activation.

    PubMed

    Kim, K D; Kim, J K; Kim, S J; Choe, I S; Chung, T H; Choe, Y K; Lim, J S

    1999-08-01

    Dendritic cells (DCs) are potent professional antigen-presenting cells (APC) capable of inducing the primary T cell response to antigen. Although tumor cells express target antigens, they are incapable of stimulating a tumor-specific immune response due to a defect in the costimulatory signal that is required for optimal activation of T cells. In this work, we describe a new approach using tumor-DC coculture to improve the antigen presenting capacity of tumor cells, which does not require a source of tumor-associated antigen. Immunization of a weakly immunogenic and progressive tumor cocultured with bone marrow-derived DCs generated an effective tumor vaccine. Immunization with the cocultured DCs was able to induce complete protective immunity against tumor challenges and was effective for the induction of tumor-specific CTL (cytotoxic T lymphocyte) activity. Furthermore, high NK cell activity was observed in mice in which tumors were rejected. In addition, immunization with tumor-pulsed DCs induced delayed tumor growth, but not tumor eradication in tumor-bearing mice. Our results demonstrate that coculture of DCs with tumors generated antitumor immunity due to the NK cell activation as well as tumor-specific T cell. This approach would be useful for designing tumor vaccines using DCs when the information about tumor antigens is limited.

  10. Pulmonary CCR2+CD4+ T cells are immune regulatory and attenuate lung fibrosis development.

    PubMed

    Milger, Katrin; Yu, Yingyan; Brudy, Eva; Irmler, Martin; Skapenko, Alla; Mayinger, Michael; Lehmann, Mareike; Beckers, Johannes; Reichenberger, Frank; Behr, Jürgen; Eickelberg, Oliver; Königshoff, Melanie; Krauss-Etschmann, Susanne

    2017-11-01

    Animal models have suggested that CCR2-dependent signalling contributes to the pathogenesis of pulmonary fibrosis, but global blockade of CCL2 failed to improve the clinical course of patients with lung fibrosis. However, as levels of CCR2 + CD4 + T cells in paediatric lung fibrosis had previously been found to be increased, correlating with clinical symptoms, we hypothesised that distinct CCR2 + cell populations might either increase or decrease disease pathogenesis depending on their subtype. To investigate the role of CCR2 + CD4 + T cells in experimental lung fibrosis and in patients with idiopathic pulmonary fibrosis and other fibrosis. Pulmonary CCR2 + CD4 + T cells were analysed using flow cytometry and mRNA profiling, followed by in silico pathway analysis, in vitro assays and adoptive transfer experiments. Frequencies of CCR2 + CD4 + T cells were increased in experimental fibrosis-specifically the CD62L - CD44 + effector memory T cell phenotype, displaying a distinct chemokine receptor profile. mRNA profiling of isolated CCR2 + CD4 + T cells from fibrotic lungs suggested immune regulatory functions, a finding that was confirmed in vitro using suppressor assays. Importantly, adoptive transfer of CCR2 + CD4 + T cells attenuated fibrosis development. The results were partly corroborated in patients with lung fibrosis, by showing higher percentages of Foxp3 + CD25 + cells within bronchoalveolar lavage fluid CCR2 + CD4 + T cells as compared with CCR2 - CD4 + T cells. Pulmonary CCR2 + CD4 + T cells are immunosuppressive, and could attenuate lung inflammation and fibrosis. Therapeutic strategies completely abrogating CCR2-dependent signalling will therefore also eliminate cell populations with protective roles in fibrotic lung disease. This emphasises the need for a detailed understanding of the functions of immune cell subsets in fibrotic lung disease. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights

  11. Foxp3+ regulatory T cells, immune stimulation and host defence against infection

    PubMed Central

    Rowe, Jared H; Ertelt, James M; Way, Sing Sing

    2012-01-01

    The immune system is intricately regulated allowing potent effectors to expand and become rapidly mobilized after infection, while simultaneously silencing potentially detrimental responses that averts immune-mediated damage to host tissues. This relies in large part on the delicate interplay between immune suppressive regulatory CD4+ T (Treg) cells and immune effectors that without active suppression by Treg cells cause systemic and organ-specific autoimmunity. Although these beneficial roles have been classically described as counterbalanced by impaired host defence against infection, newfound protective roles for Treg cells against specific viral pathogens (e.g. herpes simplex virus 2, lymphocytic choriomeningitis virus, West Nile virus) have been uncovered using transgenic mice that allow in vivo Treg-cell ablation based on Foxp3 expression. In turn, Foxp3+ Treg cells also provide protection against some parasitic (Plasmodium sp., Toxoplasma gondii) and fungal (Candida albicans) pathogens. By contrast, for bacterial and mycobacterial infections (e.g. Listeria monocytogenes, Salmonella enterica, Mycobacterium tuberculosis), experimental manipulation of Foxp3+ cells continues to indicate detrimental roles for Treg cells in host defence. This variance is probably related to functional plasticity in Treg cell suppression that shifts discordantly following infection with different types of pathogens. Furthermore, the efficiency whereby Treg cells silence immune activation coupled with the plasticity in Foxp3+ cell activity suggest that overriding Treg-mediated suppression represents a prerequisite ‘signal zero’ that together with other stimulation signals [T-cell receptor (signal 1), co-stimulation (signal 2), inflammatory cytokines (signal 3)] are essential for T-cell activation in vivo. Herein, the importance of Foxp3+ Treg cells in host defence against infection, and the significance of infection-induced shifts in Treg-cell suppression are summarized. PMID

  12. Gut Immune Maturation Depends on Colonization with a Host-Specific Microbiota

    PubMed Central

    Chung, Hachung; Pamp, Sünje J.; Hill, Jonathan A.; Surana, Neeraj K.; Edelman, Sanna M.; Troy, Erin B.; Reading, Nicola C.; Villablanca, Eduardo J.; Wang, Sen; Mora, Jorge R.; Umesaki, Yoshinori; Mathis, Diane; Benoist, Christophe; Relman, David A.; Kasper, Dennis L.

    2012-01-01

    SUMMARY Gut microbial induction of host immune maturation exemplifies host-microbe mutualism. We colonized germ-free (GF) mice with mouse microbiota (MMb) or human microbiota (HMb) to determine whether small intestinal immune maturation depends on a coevolved host-specific microbiota. Gut bacterial numbers and phylum abundance were similar in MMb and HMb mice, but bacterial species differed, especially the Firmicutes. HMb mouse intestines had low levels of CD4+ and CD8+ T cells, few proliferating T cells, few dendritic cells, and low antimicrobial peptide expression–all characteristics of GF mice. Rat microbiota also failed to fully expand intestinal T cell numbers in mice. Colonizing GF or HMb mice with mouse-segmented filamentous bacteria (SFB) partially restored T cell numbers, suggesting that SFB and other MMb organisms are required for full immune maturation in mice. Importantly, MMb conferred better protection against Salmonella infection than HMb. A host-specific microbiota appears to be critical for a healthy immune system. PMID:22726443

  13. Adjuvant-enhanced CD4 T Cell Responses are Critical to Durable Vaccine Immunity.

    PubMed

    Martins, Karen A O; Cooper, Christopher L; Stronsky, Sabrina M; Norris, Sarah L W; Kwilas, Steven A; Steffens, Jesse T; Benko, Jacqueline G; van Tongeren, Sean A; Bavari, Sina

    2016-01-01

    Protein-based vaccines offer a safer alternative to live-attenuated or inactivated vaccines but have limited immunogenicity. The identification of adjuvants that augment immunogenicity, specifically in a manner that is durable and antigen-specific, is therefore critical for advanced development. In this study, we use the filovirus virus-like particle (VLP) as a model protein-based vaccine in order to evaluate the impact of four candidate vaccine adjuvants on enhancing long term protection from Ebola virus challenge. Adjuvants tested include poly-ICLC (Hiltonol), MPLA, CpG 2395, and alhydrogel. We compared and contrasted antibody responses, neutralizing antibody responses, effector T cell responses, and T follicular helper (Tfh) cell frequencies with each adjuvant's impact on durable protection. We demonstrate that in this system, the most effective adjuvant elicits a Th1-skewed antibody response and strong CD4 T cell responses, including an increase in Tfh frequency. Using immune-deficient animals and adoptive transfer of serum and cells from vaccinated animals into naïve animals, we further demonstrate that serum and CD4 T cells play a critical role in conferring protection within effective vaccination regimens. These studies inform on the requirements of long term immune protection, which can potentially be used to guide screening of clinical-grade adjuvants for vaccine clinical development.

  14. Protective Cytomegalovirus (CMV)-Specific T-Cell Immunity Is Frequent in Kidney Transplant Patients without Serum Anti-CMV Antibodies

    PubMed Central

    Litjens, Nicolle H. R.; Huang, Ling; Dedeoglu, Burç; Meijers, Ruud W. J.; Kwekkeboom, Jaap; Betjes, Michiel G. H.

    2017-01-01

    The absence of anti-cytomegalovirus (CMV) immunoglobulin G (IgG) is used to classify pretransplant patients as naïve for CMV infection (CMVneg patients). This study assessed whether pretransplant CMV-specific T-cell immunity exists in CMVneg patients and whether it protects against CMV infection after kidney transplantation. The results show that CMV-specific CD137+IFNγ+CD4+ and CD137+IFNγ+CD8+ memory T cells were present in 46 and 39% of CMVneg patients (n = 28) although at much lower frequencies compared to CMVpos patients (median 0.01 versus 0.58% for CD4+ and 0.05 versus 0.64% for CD8+ T cells) with a less differentiated CD28-expressing phenotype. In line with these data, CMV-specific proliferative CD4+ and CD8+ T cells were observed in CMVneg patients, which significantly correlated with the frequency of CMV-specific T cells. CMV-specific IgG antibody-secreting cells (ASC) could be detected at low frequency in 36% of CMVneg patients (1 versus 45 ASC/105 cells in CMVpos patients). CMVneg patients with pretransplant CMV-specific CD137+IFNγ+CD4+ T cells had a lower risk to develop CMV viremia after transplantation with a CMVpos donor kidney (relative risk: 0.43, P = 0.03). In conclusion, a solitary CMV-specific T-cell response without detectable anti-CMV antibodies is frequent and clinically relevant as it is associated with protection to CMV infection following transplantation with a kidney from a CMVpos donor. PMID:28955345

  15. Protective Cytomegalovirus (CMV)-Specific T-Cell Immunity Is Frequent in Kidney Transplant Patients without Serum Anti-CMV Antibodies.

    PubMed

    Litjens, Nicolle H R; Huang, Ling; Dedeoglu, Burç; Meijers, Ruud W J; Kwekkeboom, Jaap; Betjes, Michiel G H

    2017-01-01

    The absence of anti-cytomegalovirus (CMV) immunoglobulin G (IgG) is used to classify pretransplant patients as naïve for CMV infection (CMV neg patients). This study assessed whether pretransplant CMV-specific T-cell immunity exists in CMV neg patients and whether it protects against CMV infection after kidney transplantation. The results show that CMV-specific CD137 + IFNγ + CD4 + and CD137 + IFNγ + CD8 + memory T cells were present in 46 and 39% of CMV neg patients ( n  = 28) although at much lower frequencies compared to CMV pos patients (median 0.01 versus 0.58% for CD4 + and 0.05 versus 0.64% for CD8 + T cells) with a less differentiated CD28-expressing phenotype. In line with these data, CMV-specific proliferative CD4 + and CD8 + T cells were observed in CMV neg patients, which significantly correlated with the frequency of CMV-specific T cells. CMV-specific IgG antibody-secreting cells (ASC) could be detected at low frequency in 36% of CMV neg patients (1 versus 45 ASC/10 5 cells in CMV pos patients). CMV neg patients with pretransplant CMV-specific CD137 + IFNγ + CD4 + T cells had a lower risk to develop CMV viremia after transplantation with a CMV pos donor kidney (relative risk: 0.43, P  = 0.03). In conclusion, a solitary CMV-specific T-cell response without detectable anti-CMV antibodies is frequent and clinically relevant as it is associated with protection to CMV infection following transplantation with a kidney from a CMV pos donor.

  16. Neem leaf glycoprotein enhances carcinoembryonic antigen presentation of dendritic cells to T and B cells for induction of anti-tumor immunity by allowing generation of immune effector/memory response.

    PubMed

    Sarkar, Koustav; Goswami, Shyamal; Roy, Soumyabrata; Mallick, Atanu; Chakraborty, Krishnendu; Bose, Anamika; Baral, Rathindranath

    2010-08-01

    Vaccination with neem leaf glycoprotein matured carcinoembryonic antigen (CEA) pulsed dendritic cells (DCs) enhances antigen-specific humoral and cellular immunity against CEA and restricts the growth of CEA(+) murine tumors. NLGP helps better CEA uptake, processing and presentation to T/B cells. This vaccination (DCNLGPCEA) elicits mitogen induced and CEA specific T cell proliferation, IFN gamma secretion and induces specific cytotoxic reactions to CEA(+) colon tumor cells. In addition to T cell response, DCNLGPCEA vaccine generates anti-CEA antibody response, which is principally IgG2a in nature. This antibody participates in cytotoxicity of CEA(+) cells in antibody-dependent manner. This strong anti-CEA cellular and humoral immunity protects mice from tumor development and these mice remained tumor free following second tumor inoculation, indicating generation of effector memory response. Evaluation of underlying mechanism suggests vaccination generates strong CEA specific CTL and antibody response that can completely prevent the tumor growth following adoptive transfer. In support, significant upregulation of CD44 on the surface of lymphocytes from DCNLGPCEA immunized mice was noticed with a substantial reduction in L-selectin (CD62L). (c) 2010 Elsevier B.V. All rights reserved.

  17. Analysis of adenovirus-induced immunity to infection with Listeria monocytogenes: Fading protection coincides with declining CD8 T cell numbers and phenotypic changes.

    PubMed

    Jahn, Marie Louise; Steffensen, Maria Abildgaard; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup

    2018-05-11

    Defining correlates of T cell mediated protection is important in order to accelerate the development of efficient T cell based vaccines conferring long-term immunity. Extensive studies have provided important insight regarding the characteristics and functional properties of the effector and memory CD8 T cells induced by viral vector based vaccines. However, long-term protection has been difficult to achieve with T cell inducing vaccines, and the determinants underlying this loss in protection over time are still not fully defined. In this study we analyzed different parameters of the CD8 T cell response as a function of time after vaccination with a human serotype 5 adenovector expressing the glycoprotein (GP) of LCMV tethered to the MHC class II-associated invariant chain. Using this vector we have previously found that CD8 T cells mediate protection from challenge with GP-expressing Listeria monocytogenes at 60 days post vaccination, but only little protection after further 60 days, and we now confirm this observation. A comparison of vaccine-primed CD8 T cells early and late after vaccination revealed a minor decline in the overall numbers of antigen specific memory CD8 T cells during this interval. More importantly, we also observed phenotypic changes over time with a distinct decline in the frequency and number of KLRG1 + CD8 T cells, and, notably, adoptive transfer studies confirmed that memory CD8 T cells expressing KLRG1 are central to protection from systemic L. monocytogenes infection. Together these findings imply that multiple factors including changes in memory T cell numbers and phenotypic composition over time influence the longevity of CD8 T-cell mediated protection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Differences in Aspergillus-specific immune recovery between T-cell-replete and T-cell-depleted hematopoietic transplants.

    PubMed

    Perruccio, Katia; Topini, Fabiana; Tosti, Antonella; Gazzola, Maria Vittoria; Messina, Chiara; Martelli, Massimo F; Caniglia, Maurizio; Velardi, Andrea; Cesaro, Simone

    2015-12-01

    After hematopoietic stem cell transplantation, invasive aspergillosis remains one of the most lethal infections. Susceptibility may be due to prophylaxis and treatment of graft-vs.-host disease in T-cell-replete transplants, and delayed immune rebuilding due to T-cell depletion in haploidentical transplantation. We monitored CD4(+) T-cell recovery and anti-Aspergillus immune competence in pediatric recipients of T-cell-replete matched transplants and of prevalently adult recipients of T-cell-depleted matched or haploidentical transplants for hematological malignancies. Although CD4(+) T-cell counts were higher in T-cell-replete transplant recipients at all post-transplant time points, Aspergillus-specific T cells were first detected 15-18 months after T-cell-replete matched, 7-9 months after T-cell-depleted matched, and 9-12 months after haploidentical transplantation, respectively. Incidence of invasive aspergillosis was 22% with 10% mortality after T-cell-replete transplants, 0% after T-cell-depleted matched, and 7% with 4% mortality after haploidentical transplants. Although T-cell counts were significantly higher after T-cell-replete transplants, post-transplant immune suppression/GvHD appeared to impair their function. Specific Aspergillus immune competence recovered faster after T-cell-depleted transplants, whether matched or haploidentical. T-cell-replete transplants were associated with a higher incidence of invasive aspergillosis and Aspergillus-related deaths. These results showed that T-cell depletion without post-transplant immunosuppression is associated to a faster immune recovery than T-cell-replete transplantation. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Live-Attenuated Lentivirus Immunization Modulates Innate Immunity and Inflammation while Protecting Rhesus Macaques from Vaginal Simian Immunodeficiency Virus Challenge

    PubMed Central

    Genescà, Meritxell; Ma, Zhong-Min; Wang, Yichuan; Assaf, Basel; Qureshi, Huma; Fritts, Linda; Huang, Ying; McChesney, Michael B.

    2012-01-01

    Immunization with attenuated lentiviruses is the only reliable method of protecting rhesus macaques (RM) from vaginal challenge with pathogenic simian immunodeficiency virus (SIV). CD8+ lymphocyte depletion prior to SIVmac239 vaginal challenge demonstrated that a modest, Gag-specific CD8+ T cell response induced by immunization with simian-human immunodeficiency virus 89.6 (SHIV89.6) protects RM. Although CD8+ T cells are required for protection, there is no anamnestic expansion of SIV-specific CD8+ T cells in any tissues except the vagina after challenge. Further, SHIV immunization increased the number of viral target cells in the vagina and cervix, suggesting that the ratio of target cells to antiviral CD8+ T cells was not a determinant of protection. We hypothesized that persistent replication of the attenuated vaccine virus modulates inflammatory responses and limits T cell activation and expansion by inducing immunoregulatory T cell populations. We found that attenuated SHIV infection decreased the number of circulating plasmacytoid dendritic cells, suppressed T cell activation, decreased mRNA levels of proinflammatory mediators, and increased mRNA levels of immunoregulatory molecules. Three days after SIV vaginal challenge, SHIV-immunized RM had significantly more T regulatory cells in the vagina than the unimmunized RM. By day 14 postchallenge, immune activation and inflammation were characteristic of unimmunized RM but were minimal in SHIV-immunized RM. Thus, a modest vaccine-induced CD8+ T cell response in the context of immunoregulatory suppression of T cell activation may protect against vaginal HIV transmission. PMID:22696662

  20. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    PubMed

    Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei

    2017-11-01

    Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  1. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation

    PubMed Central

    Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin

    2017-01-01

    Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy. PMID:29155896

  2. Regulatory T cells and the immune pathogenesis of prenatal infection

    PubMed Central

    Rowe, Jared H.; Ertelt, James M.; Xin, Lijun; Way, Sing Sing

    2013-01-01

    Pregnancy in placental mammals offers exceptional comprehensive benefits of in utero protection, nutrition, and elimination of metabolic waste for the developing fetus. However, these advantages also require durable strategies to mitigate maternal rejection of fetal tissue expressing foreign paternal antigens. Since the initial postulate of expanded maternal immune tolerance by Sir Peter Medawar 60 years ago, an amazingly elaborate assortment of molecular and cellular modifications acting both locally at the maternal placental interface and systemically have been shown to silence potentially detrimental maternal immune responses. In turn, simultaneously maintaining host defense against the infinite array of potential pathogens during pregnancy is equally important. Fortunately, resistance against most infections is preserved seamlessly throughout gestation. On the other hand, recent studies on pathogens with unique predisposition for prenatal infection have uncovered distinctive holes in host defense associated with the reproductive process. Using these infections to probe the response during pregnancy, the immune suppressive regulatory subset of maternal CD4 T cells has been increasingly shown to dictate the inter-workings between prenatal infection susceptibility and pathogenesis of ensuing pregnancy complications. Herein, the recent literature suggesting a necessity for maternal regulatory T cells in pregnancy induced immunological shifts that sustain fetal tolerance is reviewed. Additional discussion is focused on how expansion of maternal regulatory T cell suppression may become exploited by pathogens that cause prenatal infection, and the perilous potential of infection induced immune activation that may mitigate fetal tolerance and inadvertently inject hostility into the protective in utero environment. PMID:23929902

  3. Expansions of NK-like αβT cells with chronologic aging: Novel lymphocyte effectors that compensate for functional deficits of conventional NK cells and T cells

    PubMed Central

    Vallejo, Abbe N.; Mueller, Robert G.; Hamel, David L.; Way, Amanda; Dvergsten, Jeffrey A.; Griffin, Patricia; Newman, Anne B.

    2010-01-01

    As the repertoire of αβT cell receptors (TCR) contracts with advancing age, there is an associated age-dependent accumulation of oligoclonal T cells expressing of a variety of receptors (NKR), normally expressed on natural killer (NK) cells. Evidences for differential regulation of expression of particular NKRs between T cells and NK cells suggest that NKR expression on T cells is physiologically programmed rather than a random event of the aging process. Experimental studies show NKRs on aged αβT cells may function either as independent receptors, and/or as costimulatory receptors to the TCR. Considering the reported deficits of conventional αβTCR-driven activation and also functional deficits of classical NK cells, NKR+ αβT cells likely represent novel immune effectors that are capable of combining innate and adaptive functions. Inasmuch as immunity is a determinant of individual fitness, the type and density of NKRs could be important contributing factors to the wide heterogeneity of health characteristics of older adults, ranging from institutionalized frail elders who are unable to mount immune responses to functionally independent community-dwelling elders who exhibit protective immunity. Understanding the biology of NKR+ αβT cells could lead to new avenues for age-specific intervention to improve protective immunity. PMID:20932941

  4. γδ T Cells Shape Pre-Immune Peripheral B Cell Populations

    PubMed Central

    Huang, Yafei; Getahun, Andrew; Heiser, Ryan A.; Detanico, Thiago O.; Aviszus, Katja; Kirchenbaum, Greg A.; Casper, Tamara L.; Huang, Chunjian; Aydintug, M. Kemal; Carding, Simon R.; Ikuta, Koichi; Huang, Hua; Wysocki, Lawrence J.; Cambier, John C.; O’Brien, Rebecca L.; Born, Willi K.

    2015-01-01

    We previously reported that selective ablation of certain γδ T cell subsets rather than removal of all γδ T cells, strongly affects serum antibody levels in non-immunized mice. This type of manipulation also changed T cells including residual γδ T cells, revealing some interdependence of γδ T cell populations. For example, in mice lacking Vγ4+ and Vγ6+ γδ T cells (B6.TCR-Vγ4−/−/6−/−), we observed expanded Vγ1+ cells, which changed in composition and activation and produced more IL-4 upon stimulation in vitro, increased IL-4 production by αβ T cells as well as spontaneous germinal center formation in the spleen, elevated serum Ig and autoantibodies. We therefore examined B cell populations in this and other γδ-deficient mouse strains. Whereas immature bone marrow B cells remained largely unchanged, peripheral B cells underwent several changes. Specifically, transitional and mature B cells in the spleen of B6.TCR-Vγ4−/−/6−/− mice and other peripheral B cell populations were diminished, most of all splenic marginal zone (MZ) B cells. However, relative frequencies and absolute numbers of antibody-producing cells, and serum levels of antibodies, IL-4 and BAFF, were increased. Cell transfers confirmed that these changes are directly dependent on the altered γδ T cells in this strain, and their enhanced potential of producing IL-4. Further evidence suggests the possibility of direct interactions between γδ T cells and B cells in the splenic MZ. Together, these data demonstrate the capability of γδ T cells of modulating size and productivity of pre-immune peripheral B cell populations. PMID:26582947

  5. Natural T Cell-mediated Protection against Seasonal and Pandemic Influenza. Results of the Flu Watch Cohort Study.

    PubMed

    Hayward, Andrew C; Wang, Lili; Goonetilleke, Nilu; Fragaszy, Ellen B; Bermingham, Alison; Copas, Andrew; Dukes, Oliver; Millett, Elizabeth R C; Nazareth, Irwin; Nguyen-Van-Tam, Jonathan S; Watson, John M; Zambon, Maria; Johnson, Anne M; McMichael, Andrew J

    2015-06-15

    A high proportion of influenza infections are asymptomatic. Animal and human challenge studies and observational studies suggest T cells protect against disease among those infected, but the impact of T-cell immunity at the population level is unknown. To investigate whether naturally preexisting T-cell responses targeting highly conserved internal influenza proteins could provide cross-protective immunity against pandemic and seasonal influenza. We quantified influenza A(H3N2) virus-specific T cells in a population cohort during seasonal and pandemic periods between 2006 and 2010. Follow-up included paired serology, symptom reporting, and polymerase chain reaction (PCR) investigation of symptomatic cases. A total of 1,414 unvaccinated individuals had baseline T-cell measurements (1,703 participant observation sets). T-cell responses to A(H3N2) virus nucleoprotein (NP) dominated and strongly cross-reacted with A(H1N1)pdm09 NP (P < 0.001) in participants lacking antibody to A(H1N1)pdm09. Comparison of paired preseason and post-season sera (1,431 sets) showed 205 (14%) had evidence of infection based on fourfold influenza antibody titer rises. The presence of NP-specific T cells before exposure to virus correlated with less symptomatic, PCR-positive influenza A (overall adjusted odds ratio, 0.27; 95% confidence interval, 0.11-0.68; P = 0.005, during pandemic [P = 0.047] and seasonal [P = 0.049] periods). Protection was independent of baseline antibodies. Influenza-specific T-cell responses were detected in 43%, indicating a substantial population impact. Naturally occurring cross-protective T-cell immunity protects against symptomatic PCR-confirmed disease in those with evidence of infection and helps to explain why many infections do not cause symptoms. Vaccines stimulating T cells may provide important cross-protective immunity.

  6. T cell-independent and T cell-dependent immunoglobulin G responses to polyomavirus infection are impaired in complement receptor 2-deficient mice.

    PubMed

    Szomolanyi-Tsuda, Eva; Seedhom, Mina O; Carroll, Michael C; Garcea, Robert L

    2006-08-15

    Polyomavirus (PyV) infection induces protective T cell-independent (TI) IgM and IgG antibody responses in T cell-deficient mice, but these responses are not generated by immunization with viral proteins or virus like particles. We hypothesized that innate signals contribute to the generation of isotype-switched antiviral antibody responses. We studied the role of complement receptor (CR2) engagement in TI and T cell-dependent (TD) antibody responses to PyV using CR2-deficient mice. Antiviral IgG responses were reduced by 80-40% in CR2-/- mice compared to wild type. Adoptive transfer experiments demonstrated the need for CR2 not only in TD, but also in TI IgG responses to PyV. Transfer of CR2-/- B lymphocytes to SCID mice resulted in TI antiviral IgG responses that corresponded to 10% of that seen in wild-type B cell-reconstituted mice. Thus, our studies revealed a profound dependence of TI and TD antiviral antibody responses on CR2-mediated signals in PyV-infected mice, where the viral antigen is abundant and persistent.

  7. T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.

    PubMed

    Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua

    2018-05-09

    B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.

  8. Major role for CD8 T cells in the protection against Toxoplasma gondii following dendritic cell vaccination.

    PubMed

    Guiton, R; Zagani, R; Dimier-Poisson, I

    2009-10-01

    Toxoplasma gondii is the causative agent of toxoplasmosis, a worldwide zoonosis for which an effective vaccine is needed. Vaccination with pulsed dendritic cells is very efficient but their use in a vaccination protocol is unconceivable. Nevertheless, unravelling the induced effector mechanisms is crucial to design new vaccine strategies. We vaccinated CBA/J mice with parasite extract-pulsed dendritic cells, challenged them with T. gondii cysts and carried out in vivo depletion of CD4(+) or CD8(+) T lymphocytes to study the subsequent cellular immune response and protective mechanisms. CD4(+) lymphocytes were poorly implicated either in spleen and mesenteric lymph node (MLN) cytokine secretion or in mice protection. By contrast, the increasing number of intracerebral cysts and depletion of CD8(+) cells were strongly correlated, revealing a prominent role for CD8(+) lymphocytes in the protection of mice. Splenic CD8(+) lymphocytes induce a strong Th1 response controlled by a Th2 response whereas CD8(+) cells from MLNs inhibit both Th1 and Th2 responses. CD8(+) cells are the main effectors following dendritic cell vaccination and Toxoplasma infection while CD4(+) T cells only play a minor role. This contrasts with T. gondii infection which elicits the generation of CD4(+) and CD8(+) T cells that provide protective immunity.

  9. Platelets Subvert T Cell Immunity Against Cancer via GARP-TGFβ Axis

    PubMed Central

    Rachidi, Saleh; Metelli, Alessandra; Riesenberg, Brian; Wu, Bill X; Nelson, Michelle H; Fugle, Caroline W; Paulos, Chrystal M; Rubinstein, Mark P; Garrett-Mayer, Elizabeth; Hennig, Mirko; Bearden, Daniel W; Yang, Yi; Liu, Bei; Li, Zihai

    2017-01-01

    Cancer-associated thrombocytosis has long been linked to poor clinical outcome, but the underlying mechanism is enigmatic. We hypothesized that platelets promote malignancy and resistance to therapy by dampening host immunity. We herein show that genetic targeting of platelets significantly enhances adoptive T cell therapy of cancer. An unbiased biochemical and structural biology approach established transforming growth factor β (TGFβ) and lactate as the major platelet-derived soluble factors to obliterate CD4+ and CD8+ T cell functions. Moreover, we found that platelets are the dominant source of functional TGFβ systemically as well as in the tumor microenvironment through constitutive expression of TGFβ-docking receptor Glycoprotein A Repetitions Predominant (GARP) rather than secretion of TGFβ per se. Indeed, platelet-specific deletion of GARP-encoding gene Lrrc32 blunted TGFβ activity at the tumor site and potentiated protective immunity against both melanoma and colon cancer. Finally, we found that T cell therapy of cancer can be substantially improved by concurrent treatment with readily available anti-platelet agents. We conclude that platelets constrain T cell immunity though a GARP-TGFβ axis and suggest a combination of immunotherapy and platelet inhibitors as a therapeutic strategy against cancer. PMID:28763790

  10. NK T Cells Contribute to Expansion of CD8+ T Cells and Amplification of Antiviral Immune Responses to Respiratory Syncytial Virus

    PubMed Central

    Johnson, Teresa R.; Hong, Seokmann; Van Kaer, Luc; Koezuka, Yasuhiko; Graham, Barney S.

    2002-01-01

    CD1d-deficient mice have normal numbers of T lymphocytes and natural killer cells but lack Vα14+ natural killer T cells. Respiratory syncytial virus (RSV) immunopathogenesis was evaluated in 129×C57BL/6, C57BL/6, and BALB/c CD1d−/− mice. CD8+ T lymphocytes were reduced in CD1d−/− mice of all strains, as shown by cell surface staining and major histocompatibility complex class I tetramer analysis, and resulted in strain-specific alterations in illness, viral clearance, and gamma interferon (IFN-γ) production. Transient activation of NK T cells in CD1d+/+ mice by α-GalCer resulted in reduced illness and delayed viral clearance. These data suggest that early IFN-γ production and efficient induction of CD8+-T-cell responses during primary RSV infection require CD1d-dependent events. We also tested the ability of α-GalCer as an adjuvant to modulate the type 2 immune responses induced by RSV glycoprotein G or formalin-inactivated RSV immunization. However, immunized CD1-deficient or α-GalCer-treated wild-type mice did not exhibit diminished disease following RSV challenge. Rather, some disease parameters, including cytokine production, eosinophilia, and viral clearance, were increased. These findings indicate that CD1d-dependent NK T cells play a role in expansion of CD8+ T cells and amplification of antiviral responses to RSV. PMID:11932395

  11. Estradiol Enhances CD4+ T-Cell Anti-Viral Immunity by Priming Vaginal DCs to Induce Th17 Responses via an IL-1-Dependent Pathway

    PubMed Central

    Anipindi, Varun C.; Dizzell, Sara E.; Nguyen, Philip V.; Shaler, Christopher R.; Chu, Derek K.; Jiménez-Saiz, Rodrigo; Liang, Hong; Swift, Stephanie; Nazli, Aisha; Kafka, Jessica K.; Bramson, Jonathan; Xing, Zhou; Jordana, Manel; Wan, Yonghong; Snider, Denis P.; Stampfli, Martin R.; Kaushic, Charu

    2016-01-01

    Clinical and experimental studies have shown that estradiol (E2) confers protection against HIV and other sexually transmitted infections. Here, we investigated the underlying mechanism. Better protection in E2-treated mice, immunized against genital HSV-2, coincided with earlier recruitment and higher proportions of Th1 and Th17 effector cells in the vagina post-challenge, compared to placebo-treated controls. Vaginal APCs isolated from E2-treated mice induced 10-fold higher Th17 and Th1 responses, compared to APCs from progesterone-treated, placebo-treated, and estradiol-receptor knockout mice in APC-T cell co-cultures. CD11c+ DCs in the vagina were the predominant APC population responsible for priming these Th17 responses, and a potent source of IL-6 and IL-1β, important factors for Th17 differentiation. Th17 responses were abrogated in APC-T cell co-cultures containing IL-1β KO, but not IL-6 KO vaginal DCs, showing that IL-1β is a critical factor for Th17 induction in the genital tract. E2 treatment in vivo directly induced high expression of IL-1β in vaginal DCs, and addition of IL-1β restored Th17 induction by IL-1β KO APCs in co-cultures. Finally, we examined the role of IL-17 in anti-HSV-2 memory T cell responses. IL-17 KO mice were more susceptible to intravaginal HSV-2 challenge, compared to WT controls, and vaginal DCs from these mice were defective at priming efficient Th1 responses in vitro, indicating that IL-17 is important for the generation of efficient anti-viral memory responses. We conclude that the genital mucosa has a unique microenvironment whereby E2 enhances CD4+ T cell anti-viral immunity by priming vaginal DCs to induce Th17 responses through an IL-1-dependent pathway. PMID:27148737

  12. Candida albicans morphology and dendritic cell subsets determine T helper cell differentiation

    PubMed Central

    Gerami-Nejad, Maryam; Kumamoto, Yosuke; Mohammed, Javed A.; Jarrett, Elizabeth; Drummond, Rebecca A.; Zurawski, Sandra M.; Zurawski, Gerard; Berman, Judith; Iwasaki, Akiko; Brown, Gordon D.; Kaplan, Daniel H.

    2015-01-01

    Summary Candida albicans is a dimorphic fungus responsible for chronic mucocutaneous and systemic infections. Mucocutaneous immunity to C. albicans requires T helper-17 (Th17) cell differentiation that is thought to depend on recognition of filamentous C. albicans. Systemic immunity is considered T cell independent. Using a murine skin infection model, we compared T helper cell responses to yeast and filamentous C. albicans, We found that only yeast induced Th17 cell responses through a mechanism that required Dectin-1 mediated expression of interleukin-6 (IL-6) by Langerhans cells. Filamentous forms induced Th1 without Th17 cell responses due to the absence of Dectin-1 ligation. Notably, Th17 cell responses provided protection against cutaneous infection while Th1 cell responses provided protection against systemic infection. Thus, C. albicans morphology drives distinct T helper cell responses that provide tissue specific protection. These findings provide insight into compartmentalization of Th responses, C. albicans pathogenesis and have critical implications for vaccine strategies. PMID:25680275

  13. Bicistronic DNA vaccines simultaneously encoding HIV, HSV and HPV antigens promote CD8⁺ T cell responses and protective immunity.

    PubMed

    Santana, Vinicius C; Diniz, Mariana O; Cariri, Francisco A M O; Ventura, Armando M; Cunha-Neto, Edécio; Almeida, Rafael R; Campos, Marco A; Lima, Graciela K; Ferreira, Luís C S

    2013-01-01

    Millions of people worldwide are currently infected with human papillomavirus (HPV), herpes simplex virus (HSV) or human immunodeficiency virus (HIV). For this enormous contingent of people, the search for preventive and therapeutic immunological approaches represents a hope for the eradication of latent infection and/or virus-associated cancer. To date, attempts to develop vaccines against these viruses have been mainly based on a monovalent concept, in which one or more antigens of a virus are incorporated into a vaccine formulation. In the present report, we designed and tested an immunization strategy based on DNA vaccines that simultaneously encode antigens for HIV, HSV and HPV. With this purpose in mind, we tested two bicistronic DNA vaccines (pIRES I and pIRES II) that encode the HPV-16 oncoprotein E7 and the HIV protein p24 both genetically fused to the HSV-1 gD envelope protein. Mice i.m. immunized with the DNA vaccines mounted antigen-specific CD8⁺ T cell responses, including in vivo cytotoxic responses, against the three antigens. Under experimental conditions, the vaccines conferred protective immunity against challenges with a vaccinia virus expressing the HIV-derived protein Gag, an HSV-1 virus strain and implantation of tumor cells expressing the HPV-16 oncoproteins. Altogether, our results show that the concept of a trivalent HIV, HSV, and HPV vaccine capable to induce CD8⁺ T cell-dependent responses is feasible and may aid in the development of preventive and/or therapeutic approaches for the control of diseases associated with these viruses.

  14. Immunization of mice with baculovirus-derived recombinant SV40 large tumour antigen induces protective tumour immunity to a lethal challenge with SV40-transformed cells.

    PubMed Central

    Shearer, M H; Bright, R K; Lanford, R E; Kennedy, R C

    1993-01-01

    In this study, we examined the humoral immune responses and in vivo tumour immunity induced by baculovirus recombinant simian virus 40 (SV40) large tumour antigen (rSV40 T-ag). BALB/c mice immunized with rSV40 T-ag produced antibody responses that recognized SV40 large tumour antigen (T-ag) by ELISA. Analysis of these anti-SV40 T-ag responses indicated that the antibodies recognized epitopes associated with both the carboxy and amino terminus of SV40 T-ag. This pattern of SV40 T-ag epitope recognition was similar to that observed in anti-SV40 T-ag responses induced by inoculation with irradiated SV40-transformed cells. Mice immunized with either rSV40 T-ag or with the inactivated transformed cells were protected from a subsequent in vivo lethal tumour challenge with live SV40-transformed cells. These studies suggest that humoral immune responses induced by rSV40 T-ag are similar in epitope specificity to that induced by inactivated SV40-transformed cells. In addition, recombinant tumour-specific antigens from papovaviruses, such as SV40, can be used to induce tumour immunity which protects from a subsequent lethal tumour challenge. This study may provide insight into the use of recombinant tumour antigens as putative tumour vaccines and in the development of active immunotherapeutic strategies for treating virus-induced cancers. PMID:7679059

  15. TH9 cells in anti-tumor immunity.

    PubMed

    Rivera Vargas, Thaiz; Humblin, Etienne; Végran, Frédérique; Ghiringhelli, François; Apetoh, Lionel

    2017-01-01

    IL-9 was initially identified as a T cell growth factor with a potential oncogenic activity. Accordingly, IL-9 drives tumor growth in most hematological cancers. However, the links between IL-9 and cancer progression have been recently revisited following the discovery of T H 9 cells. T H 9 cells, which have been characterized in 2008 as a proinflammatory CD4 T cell subset that promotes protection against parasites and drives tissue inflammation in colitis, actually harbor potent IL-9-dependent anti-cancer properties in solid tumors and especially melanoma. While the molecular mechanisms underlying these observations are still being investigated, T H 9 cells were demonstrated to activate both innate and adaptive immune responses, thereby favoring anti-cancer immunity and tumor elimination. Human T H 9 cells have also been identified in cancer tissues, but their functions remain elusive. The present review aims to discuss the anti-cancer potential of T H 9 cells and their possible clinical relevance for cancer immunotherapy.

  16. CD4+/CD25+ regulatory cells inhibit activation of tumor-primed CD4+ T cells with IFN-gamma-dependent antiangiogenic activity, as well as long-lasting tumor immunity elicited by peptide vaccination.

    PubMed

    Casares, Noelia; Arribillaga, Laura; Sarobe, Pablo; Dotor, Javier; Lopez-Diaz de Cerio, Ascensión; Melero, Ignacio; Prieto, Jesús; Borrás-Cuesta, Francisco; Lasarte, Juan J

    2003-12-01

    CD25(+) regulatory T (T reg) cells suppress the activation/proliferation of other CD4(+) or CD8(+) T cells in vitro. Also, down-regulation of CD25(+) T reg cells enhance antitumor immune responses. In this study, we show that depletion of CD25(+) T reg cells allows the host to induce both CD4(+) and CD8(+) antitumoral responses following tumor challenge. Simultaneous depletion of CD25(+) and CD8(+) cells, as well as adoptive transfer experiments, revealed that tumor-specific CD4(+) T cells, which emerged in the absence of CD25(+) T reg cells, were able to reject CT26 colon cancer cells, a MHC class II-negative tumor. The antitumoral effect mediated by CD4(+) T cells was dependent on IFN-gamma production, which exerted a potent antiangiogenic activity. The capacity of the host to mount this antitumor response is lost once the number of CD25(+) T reg cells is restored over time. However, CD25(+) T reg cell depletion before immunization with AH1 (a cytotoxic T cell determinant from CT26 tumor cells) permits the induction of a long-lasting antitumoral immune response, not observed if immunization is conducted in the presence of regulatory cells. A study of the effect of different levels of depletion of CD25(+) T reg cells before immunization with the peptide AH1 alone, or in combination with a Th determinant, unraveled that Th cells play an important role in overcoming the suppressive effect of CD25(+) T reg on the induction of long-lasting cellular immune responses.

  17. CXCR6 is a marker for protective antigen-specific cells in the lungs after intranasal immunization against Mycobacterium tuberculosis.

    PubMed

    Lee, Lian Ni; Ronan, Edward O; de Lara, Catherine; Franken, Kees L M C; Ottenhoff, Tom H M; Tchilian, Elma Z; Beverley, Peter C L

    2011-08-01

    Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT6(1-20) peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment.

  18. CXCR6 Is a Marker for Protective Antigen-Specific Cells in the Lungs after Intranasal Immunization against Mycobacterium tuberculosis▿

    PubMed Central

    Lee, Lian Ni; Ronan, Edward O.; de Lara, Catherine; Franken, Kees L. M. C.; Ottenhoff, Tom H. M.; Tchilian, Elma Z.; Beverley, Peter C. L.

    2011-01-01

    Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT61–20 peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment. PMID:21628524

  19. GVHD prevents NK-cell-dependent leukemia and virus-specific innate immunity.

    PubMed

    Bunting, Mark D; Varelias, Antiopi; Souza-Fonseca-Guimaraes, Fernando; Schuster, Iona S; Lineburg, Katie E; Kuns, Rachel D; Fleming, Peter; Locke, Kelly R; Huntington, Nicholas D; Blazar, Bruce R; Lane, Steven W; Tey, Siok-Keen; MacDonald, Kelli P A; Smyth, Mark J; Degli-Esposti, Mariapia A; Hill, Geoffrey R

    2017-02-02

    Allogeneic bone marrow transplantation (allo-BMT) is a curative therapy for hematological malignancies, but is associated with significant complications, principally graft-versus-host disease (GVHD) and opportunistic infections. Natural killer (NK) cells mediate important innate immunity that provides a temporal bridge until the reconstruction of adaptive immunity. Here, we show that the development of GVHD after allo-BMT prevented NK-cell reconstitution, particularly within the maturing M1 and M2 NK-cell subsets in association with exaggerated activation, apoptosis, and autophagy. Donor T cells were critical in this process by limiting the availability of interleukin 15 (IL-15), and administration of IL-15/IL-15Rα or immune suppression with rapamycin could restore NK-cell reconstitution. Importantly, the NK-cell defect induced by GVHD resulted in the failure of NK-cell-dependent in vivo cytotoxicity and graft-versus-leukemia effects. Control of cytomegalovirus infection after allo-BMT was also impaired during GVHD. Thus, during GVHD, donor T cells compete with NK cells for IL-15 thereby inducing profound defects in NK-cell reconstitution that compromise both leukemia and pathogen-specific immunity. © 2017 by The American Society of Hematology.

  20. Mycobacterium tuberculosis multistage antigens confer comprehensive protection against pre- and post-exposure infections by driving Th1-type T cell immunity

    PubMed Central

    Fan, Xionglin; Yu, Qi; Jing, Yukai; Wang, Weihua; Li, Li; Zhou, Zijie

    2016-01-01

    There is an urgent need for a vaccine against tuberculosis (TB) that is more effective than the current sole licensed option. However, target antigens of Mycobacterium tuberculosis with the vaccine potential remain elusive. Five immunodominant antigens with characteristic expressions at the stages of primary infection (Ag85A), the regulation of nutrition and metabolism when transferring from rapid growth to latency (PhoY2 and Rv3407), latency (Rv2626c), and reactivation (RpfB) were selected to construct the fusion polyprotein WH121, which has better immunogenicity and protection than each multistage antigen. DMT adjuvanted WH121 vaccinated C57BL/6 mice could confer persistent and significant protection against the respiratory challenge with 80 CFU of virulent M. tuberculosis H37Rv at 9 and 18 weeks after immunization, as the BCG vaccine did. Moreover, WH121/DMT could boost the BCG primed mice against post-exposure infection, and more significantly inhibit the growth of M. tuberculosis in the spleen than BCG repeat vaccination. The protection elicited by WH121/DMT is attributed to the WH121-specific Th1-type biased immune responses, characterized by increased antigen-specific IgG2a/IgG1 ratio and high levels of IFN-γ secreted by the splenocytes of vaccinated mice. In particular, high levels of IFN-γ+ TEM cells in the spleen are an effective biomarker for the vaccine-induced early protection, and the persistent protection mainly depends on the increasing IL-2+IFN-γ+CD4+ and CD8+ T cells, especially IL-2+ TCM cells. These findings demonstrate that multistage-specific antigens might be promising targets for the next generation TB vaccine, and a combination of these antigens such as WH121/DMT is required for further preclinical evaluation. PMID:27566581

  1. Downregulation of CD4+CD25+ regulatory T cells may underlie enhanced Th1 immunity caused by immunization with activated autologous T cells.

    PubMed

    Cao, Qi; Wang, Li; Du, Fang; Sheng, Huiming; Zhang, Yan; Wu, Juanjuan; Shen, Baihua; Shen, Tianwei; Zhang, Jingwu; Li, Dangsheng; Li, Ningli

    2007-07-01

    Regulatory T cells (Treg) play important roles in immune system homeostasis, and may also be involved in tumor immunotolerance by suppressing Th1 immune response which is involved in anti-tumor immunity. We have previously reported that immunization with attenuated activated autologous T cells leads to enhanced anti-tumor immunity and upregulated Th1 responses in vivo. However, the underlying molecular mechanisms are not well understood. Here we show that Treg function was significantly downregulated in mice that received immunization of attenuated activated autologous T cells. We found that Foxp3 expression decreased in CD4+CD25+ T cells from the immunized mice. Moreover, CD4+CD25+Foxp3+ Treg obtained from immunized mice exhibited diminished immunosuppression ability compared to those from naïve mice. Further analysis showed that the serum of immunized mice contains a high level of anti-CD25 antibody (about 30 ng/ml, p<0.01 vs controls). Consistent with a role of anti-CD25 response in the downregulation of Treg, adoptive transfer of serum from immunized mice to naïve mice led to a significant decrease in Treg population and function in recipient mice. The triggering of anti-CD25 response in immunized mice can be explained by the fact that CD25 was induced to a high level in the ConA activated autologous T cells used for immunization. Our results demonstrate for the first time that immunization with attenuated activated autologous T cells evokes anti-CD25 antibody production, which leads to impeded CD4+CD25+Foxp3+ Treg expansion and function in vivo. We suggest that dampened Treg function likely contributes to enhanced Th1 response in immunized mice and is at least part of the mechanism underlying the boosted anti-tumor immunity.

  2. IFN-Gamma-Dependent and Independent Mechanisms of CD4⁺ Memory T Cell-Mediated Protection from Listeria Infection.

    PubMed

    Meek, Stephanie M; Williams, Matthew A

    2018-02-13

    While CD8⁺ memory T cells can promote long-lived protection from secondary exposure to intracellular pathogens, less is known regarding the direct protective mechanisms of CD4⁺ T cells. We utilized a prime/boost model in which mice are initially exposed to an acutely infecting strain of lymphocytic choriomeningitis virus (LCMV), followed by a heterologous rechallenge with Listeria monocytogenes recombinantly expressing the MHC Class II-restricted LCMV epitope, GP 61-80 (Lm-gp61). We found that heterologous Lm-gp61 rechallenge resulted in robust activation of CD4⁺ memory T cells and that they were required for rapid bacterial clearance. We further assessed the relative roles of TNF and IFNγ in the direct anti-bacterial function of CD4⁺ memory T cells. We found that disruption of TNF resulted in a complete loss of protection mediated by CD4⁺ memory T cells, whereas disruption of IFNγ signaling to macrophages results in only a partial loss of protection. The protective effect mediated by CD4⁺ T cells corresponded to the rapid accumulation of pro-inflammatory macrophages in the spleen and an altered inflammatory environment in vivo. Overall, we conclude that protection mediated by CD4⁺ memory T cells from heterologous Listeria challenge is most directly dependent on TNF, whereas IFNγ only plays a minor role.

  3. Commensal–dendritic-cell interaction specifies a unique protective skin immune signature

    PubMed Central

    Naik, Shruti; Bouladoux, Nicolas; Linehan, Jonathan L.; Han, Seong-Ji; Harrison, Oliver J.; Wilhelm, Christoph; Conlan, Sean; Himmelfarb, Sarah; Byrd, Allyson L.; Deming, Clayton; Quinones, Mariam; Brenchley, Jason M.; Kong, Heidi H.; Tussiwand, Roxanne; Murphy, Kenneth M.; Merad, Miriam; Segre, Julia A; Belkaid, Yasmine

    2015-01-01

    The skin represents the primary interface between the host and the environment. This organ is also home to trillions of microorganisms that play an important role in tissue homeostasis and local immunity1–4. Skin microbial communities are highly diverse and can be remodelled over time or in response to environmental challenges5–7. How, in the context of this complexity, individual commensal microorganisms may differentially modulate skin immunity and the consequences of these responses for tissue physiology remains unclear. Here we show that defined commensals dominantly affect skin immunity and identify the cellular mediators involved in this specification. In particular, colonization with Staphylococcus epidermidis induces IL-17A+ CD8+ T cells that home to the epidermis, enhance innate barrier immunity and limit pathogen invasion. Commensal-specific T-cell responses result from the coordinated action of skin-resident dendritic cell subsets and are not associated with inflammation, revealing that tissue-resident cells are poised to sense and respond to alterations in microbial communities. This interaction may represent an evolutionary means by which the skin immune system uses fluctuating commensal signals to calibrate barrier immunity and provide heterologous protection against invasive pathogens. These findings reveal that the skin immune landscape is a highly dynamic environment that can be rapidly and specifically remodelled by encounters with defined commensals, findings that have profound implications for our understanding of tissue-specific immunity and pathologies. PMID:25539086

  4. The relative contribution of antibody and CD8+ T cells to vaccine immunity against West Nile encephalitis virus.

    PubMed

    Shrestha, Bimmi; Ng, Terry; Chu, Hsien-Jue; Noll, Michelle; Diamond, Michael S

    2008-04-07

    West Nile virus (WNV) is a mosquito borne, neurotropic flavivirus that causes a severe central nervous system (CNS) infection in humans and animals. Although commercial vaccines are available for horses, none is currently approved for human use. In this study, we evaluated the efficacy and mechanism of immune protection of two candidate WNV vaccines in mice. A formalin-inactivated WNV vaccine induced higher levels of specific and neutralizing antibodies compared to a DNA plasmid vaccine that produces virus-like particles. Accordingly, partial and almost complete protection against a highly stringent lethal intracranial WNV challenge were observed in mice 60 days after single dose immunization with the DNA plasmid and inactivated virus vaccines, respectively. In mice immunized with a single dose of DNA plasmid or inactivated vaccine, antigen-specific CD8(+) T cells were induced and contributed to protective immunity as acquired or genetic deficiencies of CD8(+) T cells lowered the survival rates. In contrast, in boosted animals, WNV-specific antibody titers were higher, survival rates after challenge were greater, and an absence of CD8(+) T cells did not appreciably affect mortality. Overall, our experiments suggest that in mice, both inactivated WNV and DNA plasmid vaccines are protective after two doses, and the specific contribution of antibody and CD8(+) T cells to vaccine immunity against WNV is modulated by the prime-boost strategy.

  5. Platelets subvert T cell immunity against cancer via GARP-TGFβ axis.

    PubMed

    Rachidi, Saleh; Metelli, Alessandra; Riesenberg, Brian; Wu, Bill X; Nelson, Michelle H; Wallace, Caroline; Paulos, Chrystal M; Rubinstein, Mark P; Garrett-Mayer, Elizabeth; Hennig, Mirko; Bearden, Daniel W; Yang, Yi; Liu, Bei; Li, Zihai

    2017-05-05

    Cancer-associated thrombocytosis has long been linked to poor clinical outcome, but the underlying mechanism is enigmatic. We hypothesized that platelets promote malignancy and resistance to therapy by dampening host immunity. We show that genetic targeting of platelets enhances adoptive T cell therapy of cancer. An unbiased biochemical and structural biology approach established transforming growth factor β (TGFβ) and lactate as major platelet-derived soluble factors to obliterate CD4 + and CD8 + T cell functions. Moreover, we found that platelets are the dominant source of functional TGFβ systemically as well as in the tumor microenvironment through constitutive expression of the TGFβ-docking receptor glycoprotein A repetitions predominant (GARP) rather than secretion of TGFβ per se. Platelet-specific deletion of the GARP-encoding gene Lrrc32 blunted TGFβ activity at the tumor site and potentiated protective immunity against both melanoma and colon cancer. Last, this study shows that T cell therapy of cancer can be substantially improved by concurrent treatment with readily available antiplatelet agents. We conclude that platelets constrain T cell immunity through a GARP-TGFβ axis and suggest a combination of immunotherapy and platelet inhibitors as a therapeutic strategy against cancer. Copyright © 2017, American Association for the Advancement of Science.

  6. Adaptive Immunity against Leishmania Nucleoside Hydrolase Maps Its C-Terminal Domain as the Target of the CD4+ T Cell–Driven Protective Response

    PubMed Central

    Nico, Dirlei; Claser, Carla; Borja-Cabrera, Gulnara P.; Travassos, Luiz R.; Palatnik, Marcos; da Silva Soares, Irene; Rodrigues, Mauricio Martins; Palatnik-de-Sousa, Clarisa B.

    2010-01-01

    Nucleoside hydrolases (NHs) show homology among parasite protozoa, fungi and bacteria. They are vital protagonists in the establishment of early infection and, therefore, are excellent candidates for the pathogen recognition by adaptive immune responses. Immune protection against NHs would prevent disease at the early infection of several pathogens. We have identified the domain of the NH of L. donovani (NH36) responsible for its immunogenicity and protective efficacy against murine visceral leishmaniasis (VL). Using recombinant generated peptides covering the whole NH36 sequence and saponin we demonstrate that protection against L. chagasi is related to its C-terminal domain (amino-acids 199–314) and is mediated mainly by a CD4+ T cell driven response with a lower contribution of CD8+ T cells. Immunization with this peptide exceeds in 36.73±12.33% the protective response induced by the cognate NH36 protein. Increases in IgM, IgG2a, IgG1 and IgG2b antibodies, CD4+ T cell proportions, IFN-γ secretion, ratios of IFN-γ/IL-10 producing CD4+ and CD8+ T cells and percents of antibody binding inhibition by synthetic predicted epitopes were detected in F3 vaccinated mice. The increases in DTH and in ratios of TNFα/IL-10 CD4+ producing cells were however the strong correlates of protection which was confirmed by in vivo depletion with monoclonal antibodies, algorithm predicted CD4 and CD8 epitopes and a pronounced decrease in parasite load (90.5–88.23%; p = 0.011) that was long-lasting. No decrease in parasite load was detected after vaccination with the N-domain of NH36, in spite of the induction of IFN-γ/IL-10 expression by CD4+ T cells after challenge. Both peptides reduced the size of footpad lesions, but only the C-domain reduced the parasite load of mice challenged with L. amazonensis. The identification of the target of the immune response to NH36 represents a basis for the rationale development of a bivalent vaccine against leishmaniasis and for

  7. Genetic Adjuvantation of Recombinant MVA with CD40L Potentiates CD8 T Cell Mediated Immunity

    PubMed Central

    Lauterbach, Henning; Pätzold, Juliane; Kassub, Ronny; Bathke, Barbara; Brinkmann, Kay; Chaplin, Paul; Suter, Mark; Hochrein, Hubertus

    2013-01-01

    Modified vaccinia Ankara (MVA) is a safe and promising viral vaccine vector that is currently investigated in several clinical and pre-clinical trials. In contrast to inactivated or sub-unit vaccines, MVA is able to induce strong humoral as well as cellular immune responses. In order to further improve its CD8 T cell inducing capacity, we genetically adjuvanted MVA with the coding sequence of murine CD40L, a member of the tumor necrosis factor superfamily. Immunization of mice with this new vector led to strongly enhanced primary and memory CD8 T cell responses. Concordant with the enhanced CD8 T cell response, we could detect stronger activation of dendritic cells and higher systemic levels of innate cytokines (including IL-12p70) early after immunization. Interestingly, acquisition of memory characteristics (i.e., IL-7R expression) was accelerated after immunization with MVA-CD40L in comparison to non-adjuvanted MVA. Furthermore, the generated cytotoxic T-lymphocytes (CTLs) also showed improved functionality as demonstrated by intracellular cytokine staining and in vivo killing activity. Importantly, the superior CTL response after a single MVA-CD40L immunization was able to protect B cell deficient mice against a fatal infection with ectromelia virus. Taken together, we show that genetic adjuvantation of MVA can change strength, quality, and functionality of innate and adaptive immune responses. These data should facilitate a rational vaccine design with a focus on rapid induction of large numbers of CD8 T cells able to protect against specific diseases. PMID:23986761

  8. TNF-dependent regulation and activation of innate immune cells are essential for host protection against cerebral tuberculosis.

    PubMed

    Francisco, Ngiambudulu M; Hsu, Nai-Jen; Keeton, Roanne; Randall, Philippa; Sebesho, Boipelo; Allie, Nasiema; Govender, Dhirendra; Quesniaux, Valerie; Ryffel, Bernhard; Kellaway, Lauriston; Jacobs, Muazzam

    2015-06-26

    Tuberculosis (TB) affects one third of the global population, and TB of the central nervous system (CNS-TB) is the most severe form of tuberculosis which often associates with high mortality. The pro-inflammatory cytokine tumour necrosis factor (TNF) plays a critical role in the initial and long-term host immune protection against Mycobacterium tuberculosis (M. tuberculosis) which involves the activation of innate immune cells and structure maintenance of granulomas. However, the contribution of TNF, in particular neuron-derived TNF, in the control of cerebral M. tuberculosis infection and its protective immune responses in the CNS were not clear. We generated neuron-specific TNF-deficient (NsTNF(-/-)) mice and compared outcomes of disease against TNF(f/f) control and global TNF(-/-) mice. Mycobacterial burden in brains, lungs and spleens were compared, and cerebral pathology and cellular contributions analysed by microscopy and flow cytometry after M. tuberculosis infection. Activation of innate immune cells was measured by flow cytometry and cell function assessed by cytokine and chemokine quantification using enzyme-linked immunosorbent assay (ELISA). Intracerebral M. tuberculosis infection of TNF(-/-) mice rendered animals highly susceptible, accompanied by uncontrolled bacilli replication and eventual mortality. In contrast, NsTNF(-/-) mice were resistant to infection and presented with a phenotype similar to that in TNF(f/f) control mice. Impaired immunity in TNF(-/-) mice was associated with altered cytokine and chemokine synthesis in the brain and characterised by a reduced number of activated innate immune cells. Brain pathology reflected enhanced inflammation dominated by neutrophil influx. Our data show that neuron-derived TNF has a limited role in immune responses, but overall TNF production is necessary for protective immunity against CNS-TB.

  9. Autocrine Complement Inhibits IL10-Dependent T-cell-Mediated Antitumor Immunity to Promote Tumor Progression.

    PubMed

    Wang, Yu; Sun, Sheng-Nan; Liu, Qing; Yu, Yang-Yang; Guo, Jian; Wang, Kun; Xing, Bao-Cai; Zheng, Qing-Feng; Campa, Michael J; Patz, Edward F; Li, Shi-You; He, You-Wen

    2016-09-01

    In contrast to its inhibitory effects on many cells, IL10 activates CD8(+) tumor-infiltrating lymphocytes (TIL) and enhances their antitumor activity. However, CD8(+) TILs do not routinely express IL10, as autocrine complement C3 inhibits IL10 production through complement receptors C3aR and C5aR. CD8(+) TILs from C3-deficient mice, however, express IL10 and exhibit enhanced effector function. C3-deficient mice are resistant to tumor development in a T-cell- and IL10-dependent manner; human TILs expanded with IL2 plus IL10 increase the killing of primary tumors in vitro compared with IL2-treated TILs. Complement-mediated inhibition of antitumor immunity is independent of the programmed death 1/programmed death ligand 1 (PD-1/PD-L1) immune checkpoint pathway. Our findings suggest that complement receptors C3aR and C5aR expressed on CD8(+) TILs represent a novel class of immune checkpoints that could be targeted for tumor immunotherapy. Moreover, incorporation of IL10 in the expansion of TILs and in gene-engineered T cells for adoptive cell therapy enhances their antitumor efficacy. Our data suggest novel strategies to enhance immunotherapies: a combined blockade of complement signaling by antagonists to C3aR, C5aR, and anti-PD-1 to enhance anti-PD-1 efficacy; a targeted IL10 delivery to CD8(+) TILs using anti-PD-1-IL10 or anti-CTLA4-IL10 fusion proteins; and the addition of IL10 in TIL expansion for adoptive cellular therapy. Cancer Discov; 6(9); 1022-35. ©2016 AACR.See related commentary by Peng et al., p. 953This article is highlighted in the In This Issue feature, p. 932. ©2016 American Association for Cancer Research.

  10. Peptide Processing Is Critical for T-Cell Memory Inflation and May Be Optimized to Improve Immune Protection by CMV-Based Vaccine Vectors.

    PubMed

    Dekhtiarenko, Iryna; Ratts, Robert B; Blatnik, Renata; Lee, Lian N; Fischer, Sonja; Borkner, Lisa; Oduro, Jennifer D; Marandu, Thomas F; Hoppe, Stephanie; Ruzsics, Zsolt; Sonnemann, Julia K; Mansouri, Mandana; Meyer, Christine; Lemmermann, Niels A W; Holtappels, Rafaela; Arens, Ramon; Klenerman, Paul; Früh, Klaus; Reddehase, Matthias J; Riemer, Angelika B; Cicin-Sain, Luka

    2016-12-01

    Cytomegalovirus (CMV) elicits long-term T-cell immunity of unparalleled strength, which has allowed the development of highly protective CMV-based vaccine vectors. Counterintuitively, experimental vaccines encoding a single MHC-I restricted epitope offered better immune protection than those expressing entire proteins, including the same epitope. To clarify this conundrum, we generated recombinant murine CMVs (MCMVs) encoding well-characterized MHC-I epitopes at different positions within viral genes and observed strong immune responses and protection against viruses and tumor growth when the epitopes were expressed at the protein C-terminus. We used the M45-encoded conventional epitope HGIRNASFI to dissect this phenomenon at the molecular level. A recombinant MCMV expressing HGIRNASFI on the C-terminus of M45, in contrast to wild-type MCMV, enabled peptide processing by the constitutive proteasome, direct antigen presentation, and an inflation of antigen-specific effector memory cells. Consequently, our results indicate that constitutive proteasome processing of antigenic epitopes in latently infected cells is required for robust inflationary responses. This insight allows utilizing the epitope positioning in the design of CMV-based vectors as a novel strategy for enhancing their efficacy.

  11. Peptide Processing Is Critical for T-Cell Memory Inflation and May Be Optimized to Improve Immune Protection by CMV-Based Vaccine Vectors

    PubMed Central

    Blatnik, Renata; Lee, Lian N.; Fischer, Sonja; Borkner, Lisa; Oduro, Jennifer D.; Marandu, Thomas F.; Hoppe, Stephanie; Ruzsics, Zsolt; Sonnemann, Julia K.; Meyer, Christine; Holtappels, Rafaela; Arens, Ramon; Früh, Klaus; Reddehase, Matthias J.; Riemer, Angelika B.; Cicin-Sain, Luka

    2016-01-01

    Cytomegalovirus (CMV) elicits long-term T-cell immunity of unparalleled strength, which has allowed the development of highly protective CMV-based vaccine vectors. Counterintuitively, experimental vaccines encoding a single MHC-I restricted epitope offered better immune protection than those expressing entire proteins, including the same epitope. To clarify this conundrum, we generated recombinant murine CMVs (MCMVs) encoding well-characterized MHC-I epitopes at different positions within viral genes and observed strong immune responses and protection against viruses and tumor growth when the epitopes were expressed at the protein C-terminus. We used the M45-encoded conventional epitope HGIRNASFI to dissect this phenomenon at the molecular level. A recombinant MCMV expressing HGIRNASFI on the C-terminus of M45, in contrast to wild-type MCMV, enabled peptide processing by the constitutive proteasome, direct antigen presentation, and an inflation of antigen-specific effector memory cells. Consequently, our results indicate that constitutive proteasome processing of antigenic epitopes in latently infected cells is required for robust inflationary responses. This insight allows utilizing the epitope positioning in the design of CMV-based vectors as a novel strategy for enhancing their efficacy. PMID:27977791

  12. Immune responses and protection after DNA vaccination against Toxoplasma gondii calcium-dependent protein kinase 2 (TgCDPK2)

    PubMed Central

    Chen, Kai; Wang, Jin-Lei; Huang, Si-Yang; Yang, Wen-Bin; Zhu, Wei-Ning; Zhu, Xing-Quan

    2017-01-01

    Toxoplasma gondii, an intracellular zoonotic protozoan parasite, is possibly the most widespread parasite of warm-blooded animals and can cause serious public health problems and economic losses worldwide. TgCDPK2, a member of the T. gondii calcium-dependent protein kinase family, was recently identified as an essential regulator for viable cyst development in T. gondii. In the present study, we evaluated the protective immunity induced by DNA vaccination based on a recombinant eukaryotic plasmid, pVAX-TgCDPK2, against acute toxoplasmosis in mice. BALB/c mice were intramuscularly immunized with pVAX-TgCDPK2 plasmid and then challenged by infection with the highly virulent RH strain of T. gondii. The specific immune responses and protective efficacy against T. gondii were analyzed by cytokine and serum antibody measurements, lymphocyte proliferation assays, flow cytometric on lymphocytes and the survival time of mice after challenge. Our results showed that mice immunized with pVAX-TgCDPK2 could elicit special humoral and cellular responses, with higher levels of IgG antibody, and increased levels of Th1-type cytokines IFN-γ, IL-12(p70), and CD3 + CD4 + CD8 − and CD3 + CD8 + CD4 − T cells, and had a prolonged survival time (14.0 ± 2.32 days) compared to control mice. These results demonstrate that pVAX-TgCDPK2 is a potential vaccine candidate against acute toxoplasmosis. PMID:29119944

  13. Visualization of T Cell-Regulated Monocyte Clusters Mediating Keratinocyte Death in Acquired Cutaneous Immunity.

    PubMed

    Liu, Zheng; Yang, Fei; Zheng, Hao; Fan, Zhan; Qiao, Sha; Liu, Lei; Tao, Juan; Luo, Qingming; Zhang, Zhihong

    2018-06-01

    It remains unclear how monocytes are mobilized to amplify inflammatory reactions in T cell-mediated adaptive immunity. Here, we investigate dynamic cellular events in the cascade of inflammatory responses through intravital imaging of a multicolor-labeled murine contact hypersensitivity model. We found that monocytes formed clusters around hair follicles in the contact hypersensitivity model. In this process, effector T cells encountered dendritic cells under regions of monocyte clusters and secreted IFN-γ, which mobilizes CCR2-dependent monocyte interstitial migration and CXCR2-dependent monocyte cluster formation. We showed that hair follicles shaped the inflammatory microenvironment for communication among the monocytes, keratinocytes, and effector T cells. After disrupting the T cell-mobilized monocyte clusters through CXCR2 antagonization, monocyte activation and keratinocyte apoptosis were significantly inhibited. Our study provides a new perspective on effector T cell-regulated monocyte behavior, which amplifies the inflammatory reaction in acquired cutaneous immunity. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Changes in T Cell and Dendritic Cell Phenotype from Mid to Late Pregnancy Are Indicative of a Shift from Immune Tolerance to Immune Activation

    PubMed Central

    Shah, Nishel Mohan; Herasimtschuk, Anna A.; Boasso, Adriano; Benlahrech, Adel; Fuchs, Dietmar; Imami, Nesrina; Johnson, Mark R.

    2017-01-01

    During pregnancy, the mother allows the immunologically distinct fetoplacental unit to develop and grow. Opinions are divided as to whether this represents a state of fetal-specific tolerance or of a generalized suppression of the maternal immune system. We hypothesized that antigen-specific T cell responses are modulated by an inhibitory T cell phenotype and modified dendritic cell (DC) phenotype in a gestation-dependent manner. We analyzed changes in surface markers of peripheral blood T cells, ex vivo antigen-specific T cell responses, indoleamine 2,3-dioxygenase (IDO) activity (kynurenine/tryptophan ratio, KTR), plasma neopterin concentration, and the in vitro expression of progesterone-induced blocking factor (PIBF) in response to peripheral blood mononuclear cell culture with progesterone. We found that mid gestation is characterized by reduced antigen-specific T cell responses associated with (1) predominance of effector memory over other T cell subsets; (2) upregulation of inhibitory markers (programmed death ligand 1); (3) heightened response to progesterone (PIBF); and (4) reduced proportions of myeloid DC and concurrent IDO activity (KTR). Conversely, antigen-specific T cell responses normalized in late pregnancy and were associated with increased markers of T cell activation (CD38, neopterin). However, these changes occur with a simultaneous upregulation of immune suppressive mechanisms including apoptosis (CD95), coinhibition (TIM-3), and immune regulation (IL-10) through the course of pregnancy. Together, our data suggest that immune tolerance dominates in the second trimester and that it is gradually reversed in the third trimester in association with immune activation as the end of pregnancy approaches. PMID:28966619

  15. CD8 T cells protect adult naive mice from JEV-induced morbidity via lytic function

    PubMed Central

    Chawla, Amanpreet Singh; Agrawal, Tanvi; Biswas, Moanaro; Vrati, Sudhanshu; Rath, Satyajit; George, Anna; Medigeshi, Guruprasad R.

    2017-01-01

    Following Japanese encephalitis virus (JEV) infection neutralizing antibodies are shown to provide protection in a significant proportion of cases, but not all, suggesting additional components of immune system might also contribute to elicit protective immune response. Here we have characterized the role of T cells in offering protection in adult mice infected with JEV. Mice lacking α/β–T cells (TCRβ–null) are highly susceptible and die over 10–18 day period as compared to the wild-type (WT) mice which are resistant. This is associated with high viral load, higher mRNA levels of proinflammatory cytokines and breach in the blood-brain-barrier (BBB). Infected WT mice do not show a breach in BBB; however, in contrast to TCRβ-null, they show the presence of T cells in the brain. Using adoptive transfer of cells with specific genetic deficiencies we see that neither the presence of CD4 T cells nor cytokines such as IL-4, IL-10 or interferon-gamma have any significant role in offering protection from primary infection. In contrast, we show that CD8 T cell deficiency is more critical as absence of CD8 T cells alone increases mortality in mice infected with JEV. Further, transfer of T cells from beige mice with defects in granular lytic function into TCRβ-null mice shows poor protection implicating granule-mediated target cell lysis as an essential component for survival. In addition, for the first time we report that γ/δ-T cells also make significant contribution to confer protection from JEV infection. Our data show that effector CD8 T cells play a protective role during primary infection possibly by preventing the breach in BBB and neuronal damage. PMID:28151989

  16. CD8 T cells protect adult naive mice from JEV-induced morbidity via lytic function.

    PubMed

    Jain, Nidhi; Oswal, Neelam; Chawla, Amanpreet Singh; Agrawal, Tanvi; Biswas, Moanaro; Vrati, Sudhanshu; Rath, Satyajit; George, Anna; Bal, Vineeta; Medigeshi, Guruprasad R

    2017-02-01

    Following Japanese encephalitis virus (JEV) infection neutralizing antibodies are shown to provide protection in a significant proportion of cases, but not all, suggesting additional components of immune system might also contribute to elicit protective immune response. Here we have characterized the role of T cells in offering protection in adult mice infected with JEV. Mice lacking α/β-T cells (TCRβ-null) are highly susceptible and die over 10-18 day period as compared to the wild-type (WT) mice which are resistant. This is associated with high viral load, higher mRNA levels of proinflammatory cytokines and breach in the blood-brain-barrier (BBB). Infected WT mice do not show a breach in BBB; however, in contrast to TCRβ-null, they show the presence of T cells in the brain. Using adoptive transfer of cells with specific genetic deficiencies we see that neither the presence of CD4 T cells nor cytokines such as IL-4, IL-10 or interferon-gamma have any significant role in offering protection from primary infection. In contrast, we show that CD8 T cell deficiency is more critical as absence of CD8 T cells alone increases mortality in mice infected with JEV. Further, transfer of T cells from beige mice with defects in granular lytic function into TCRβ-null mice shows poor protection implicating granule-mediated target cell lysis as an essential component for survival. In addition, for the first time we report that γ/δ-T cells also make significant contribution to confer protection from JEV infection. Our data show that effector CD8 T cells play a protective role during primary infection possibly by preventing the breach in BBB and neuronal damage.

  17. Protective Role of γδ T Cells in Cigarette Smoke and Influenza Infection

    PubMed Central

    Hong, M. J.; Gu, B. H.; Madison, M.; Landers, C.; Tung, H. Y.; Kim, M.; Yuan, X.; You, R.; MacHado, A. A.; Gilbert, B. E.; Soroosh, P.; Elloso, M.; Song, L.; Chen, M.; Corry, D. B.; Diehl, G.; Kheradmand, F.

    2017-01-01

    Airborne pathogens commonly trigger severe respiratory failure or death in smokers with lung disease. Cigarette smoking compromises the effectiveness of innate immunity against infections but the underlying mechanisms responsible for defective acquired immune responses in smokers remains less clear. We found that mice exposed to chronic cigarette smoke recovered poorly from primary Influenza A pneumonia with reduced type I and II interferons (IFNs) and viral-specific immunoglobulins, but recruited gamma delta (γδ) T cells to the lungs that predominantly expressed interleukin 17A (IL-17A). Il-17a-/- mice exposed to smoke and infected with Influenza A also recruited γδ T cells to the lungs, but in contrast to wild type mice, expressed increased IFNs, made protective influenza specific antibodies, and recovered from infection. Depletion of IL-17A with blocking antibodies significantly increased T-bet expression in γδ T cells and improved recovery from acute Influenza A infection in air, but not smoke exposed mice. In contrast, when exposed to smoke, γδ T cell deficient mice failed to mount an effective immune response to Influenza A and showed increased mortality. Our findings demonstrate a protective role for γδ T cells in smokers and suggest that smoke-induced increase in IL-17A inhibits the transcriptional programs required for their optimal anti-viral responses. PMID:29091081

  18. [Exosomes and Immune Cells].

    PubMed

    Seo, Naohiro

    2017-05-01

    In addition to the cytokines and cytotoxic granules, exosomes have been known as the intercellular communicator and cytotoxic missile of immune cells for the past decade. It has been well known that mature dendritic cell(DC)-derived exosomes participate in the T cell and natural killer(NK)cell activation, while immature DCs secrete tolerogenic exosomes for regulatory T(Treg)cell generation. Treg cell-derived EVs act as a suppressor against pathogenic type-1 T helper(Th1)cell responses. CD8+ T cells produce tumoricidal exosomes for preventing tumor invasion and metastasis transiently after T cell receptor(TCR)-mediated stimulation. Thus, immune cells produce functional exosomes in the activation state- and/or differentiation stage-dependent manner. In this review, the role of immune cell-derived exosomes will be introduced, focusing mainly on immune reaction against tumor.

  19. Prolonged intervals during Mycobacterium tuberculosis subunit vaccine boosting contributes to eliciting immunity mediated by central memory-like T cells.

    PubMed

    Bai, Chunxiang; He, Juanjuan; Niu, Hongxia; Hu, Lina; Luo, Yanping; Liu, Xun; Peng, Liang; Zhu, Bingdong

    2018-05-01

    It is believed that central memory T cells (T CM ) provide long-term protection against tuberculosis (TB). However, the effects of TB subunit vaccine immunization schedule, especially the vaccination intervals, on T cell immune memory is still unclear. In this study, mice were immunized with fusion protein ESAT6-Ag85B-MPT64 (190-198)-Mtb8.4-Rv2626c (LT70) based subunit vaccine three times according to the following schedules: ① 0, 3rd and 6th week respectively (0-3-6w), ② 0, 4th and 12th week (0-4-12w), and ③ 0, 4th and 24th week (0-4-24w). We found that both schedules of 0-4-12w and 0-4-24w induced higher level of antigen specific IL-2, IFN-γ and TNF-α than 0-3-6w immunization. Among them, 0-4-12w induced the highest level of IL-2, which is a key cytokine mainly produced by T CM . Moreover, by cultured IFN-γ ELISPOT and cell proliferation assay etc., we found that the vaccination schedule of 0-4-12w elicited higher numbers of T CM like cells, stronger T CM - mediated immune responses and higher protective efficacy against M. bovis BCG challenge than 0-3-6w did. It suggests that prolonging the vaccination interval of TB subunit vaccine to some extent contributes to inducing more abundant T CM like cells and providing stronger immune protection against mycobacteria infection. Copyright © 2018. Published by Elsevier Ltd.

  20. Targeting the genital tract mucosa with a lipopeptide/recombinant adenovirus prime/boost vaccine induces potent and long-lasting CD8+ T cell immunity against herpes: importance of MyD88.

    PubMed

    Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; Benmohamed, Lbachir

    2012-11-01

    Targeting of the mucosal immune system of the genital tract with subunit vaccines has failed to induce potent and durable local CD8(+) T cell immunity, which is crucial for protection against many sexually transmitted viral pathogens, including HSV type 2 (HSV-2), which causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8(+) T cell immunity to protect the female genital tract from herpes. The lipopeptide vaccine and the rAdv5 vaccine express the immunodominant HSV-2 CD8(+) T cell epitope (gB(498-505)), and both were delivered intravaginally in the progesterone-induced B6 mouse model of genital herpes. Compared with mice immunized with the homologous lipopeptide/lipopeptide (Lipo/Lipo) vaccine, the Lipo/rAdv5 prime/boost immunized mice 1) developed potent and sustained HSV-specific CD8(+) T cells, detected in both the genital tract draining nodes and in the vaginal mucosa; 2) had significantly lower virus titers; 3) had decreased overt signs of genital herpes disease; and 4) did not succumb to lethal infection (p < 0.005) after intravaginal HSV-2 challenge. Polyfunctional CD8(+) T cells, producing IFN-γ, TNF-α, and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8(+) T cell response was significantly compromised in the absence of the adapter MyD88 (p = 0.0001). Taken together, these findings indicate that targeting of the vaginal mucosa with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8(+) T cell protective immunity against sexually transmitted herpes infection and disease.

  1. T lymphocyte-mediated protection against Pseudomonas aeruginosa infection in granulocytopenic mice.

    PubMed Central

    Powderly, W G; Pier, G B; Markham, R B

    1986-01-01

    BALB/c mice immunized with Pseudomonas aeruginosa immunotype 1 polysaccharide develop protective T cell immunity to bacterial challenge. In vitro, T cells from immunized mice kill P. aeruginosa by production of a bactericidal lymphokine. The present study demonstrates that adoptive transfer of T cells from immunized BALB/c mice to granulocytopenic mice resulted in 97% survival on challenge with P. aeruginosa, compared with 17% survival with adoptive transfer of T cells from nonimmune BALB/c mice. This protection is specifically elicited by reexposure to the original immunizing antigen; adoptive recipients cannot withstand challenge with immunotype 3 P. aeruginosa. However, the adoptive recipients do survive simultaneous infection with both P. aeruginosa immunotypes 1 and 3. Adoptive transfer of T cells from the congenic CB.20 mice, which are unable to kill P. aeruginosa in vitro, provides only 20% protection to granulocytopenic mice. These studies indicate that transfer of specific immune T lymphocytes can significantly enhance the resistance to P. aeruginosa infection in granulocytopenic mice. PMID:2426306

  2. Potent Cell-Intrinsic Immune Responses in Dendritic Cells Facilitate HIV-1-Specific T Cell Immunity in HIV-1 Elite Controllers.

    PubMed

    Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G

    2015-06-01

    The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.

  3. Role of the 2B4 Receptor in CD8+ T-Cell-Dependent Immune Control of Epstein-Barr Virus Infection in Mice With Reconstituted Human Immune System Components.

    PubMed

    Chijioke, Obinna; Marcenaro, Emanuela; Moretta, Alessandro; Capaul, Riccarda; Münz, Christian

    2015-09-01

    Patients with X-linked lymphoproliferative (XLP) disease due to deficiency in the adaptor molecule signaling lymphocytic activation molecule-associated protein (SAP) are highly susceptible to one specific viral pathogen, the Epstein-Barr virus (EBV). This susceptibility might result from impaired CD8(+) T-cell and natural killer cell responses to EBV infection in these patients. We demonstrate that antibody blocking of the SAP-dependent 2B4 receptor is sufficient to induce XLP-like aggravation of EBV disease in mice with reconstituted human immune system components. CD8(+) T cells require 2B4 for EBV-specific immune control, because 2B4 blockade after CD8(+) T-cell depletion did not further aggravate symptoms of EBV infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. alpha(4)beta(7) independent pathway for CD8(+) T cell-mediated intestinal immunity to rotavirus.

    PubMed

    Kuklin, N A; Rott, L; Darling, J; Campbell, J J; Franco, M; Feng, N; Müller, W; Wagner, N; Altman, J; Butcher, E C; Greenberg, H B

    2000-12-01

    Rotavirus (RV), which replicates exclusively in cells of the small intestine, is the most important cause of severe diarrhea in young children worldwide. Using a mouse model, we show that expression of the intestinal homing integrin alpha(4)ss(7) is not essential for CD8(+) T cells to migrate to the intestine or provide immunity to RV. Mice deficient in ss7 expression (ss7(-/-)) and unable to express alpha(4)ss(7) integrin were found to clear RV as quickly as wild-type (wt) animals. Depletion of CD8(+) T cells in ss7(-/-) animals prolonged viral shedding, and transfer of immune ss7(-/-) CD8(+) T cells into chronically infected Rag-2-deficient mice resolved RV infection as efficiently as wt CD8(+) T cells. Paradoxically, alpha(4)ss(7)(hi) memory CD8(+) T cells purified from wt mice that had been orally immunized cleared RV more efficiently than alpha(4)ss(7)(low) CD8(+) T cells. We explained this apparent contradiction by demonstrating that expression of alpha(4)ss(7) on effector CD8(+) T cells depends upon the site of initial antigen exposure: oral immunization generates RV-specific CD8(+) T cells primarily of an alpha(4)ss(7)(hi) phenotype, but subcutaneous immunization yields both alpha(4)ss(7)(hi) and alpha(4)ss(7)(low) immune CD8(+) T cells with anti-RV effector capabilities. Thus, alpha(4)ss(7) facilitates normal intestinal immune trafficking to the gut, but it is not required for effective CD8(+) T cell immunity.

  5. Live Attenuated Leishmania donovani Centrin Gene-Deleted Parasites Induce IL-23-Dependent IL-17-Protective Immune Response against Visceral Leishmaniasis in a Murine Model.

    PubMed

    Banerjee, Antara; Bhattacharya, Parna; Dagur, Pradeep K; Karmakar, Subir; Ismail, Nevien; Joshi, Amritanshu B; Akue, Adovi D; KuKuruga, Mark; McCoy, John Philip; Dey, Ranadhir; Nakhasi, Hira L

    2018-01-01

    No vaccine exists against visceral leishmaniasis. To develop effective vaccines, we have previously reported protective role of live attenuated centrin gene-deleted Leishmania donovani ( LdCen -/- ) parasites through induction of Th1 type immune response in mice, hamsters, and dogs. In this study, we specifically explored the role of Th17 cells in LdCen -/- -induced host protection in mice. Our results showed that compared with wild-type L. donovani infection, LdCen -/- parasites induce significantly higher expression of Th17 differentiation cytokines in splenic dendritic cells. There was also induction of IL-17 and its promoting cytokines in total splenocytes and in both CD4 and CD8 T cells following immunization with LdCen -/- Upon challenge with wild-type parasites, IL-17 and its differentiating cytokines were significantly higher in LdCen -/- -immunized mice compared with nonimmunized mice that resulted in parasite control. Alongside IL-17 induction, we observed induction of IFN-γ-producing Th1 cells as reported earlier. However, Th17 cells are generated before Th1 cells. Neutralization of either IL-17 or IFN-γ abrogated LdCen -/- -induced host protection further confirming the essential role of Th17 along with Th1 cytokines in host protection. Treatment with recombinant IL-23, which is required for stabilization and maintenance of IL-17, heightened Th17, and Tc17 responses in immunized mice splenocytes. In contrast, Th17 response was absent in immunized IL-23R -/- mice that failed to induce protection upon virulent Leishmania challenge suggesting that IL-23 plays an essential role in IL-17-mediated protection by LdCen -/- parasites. This study unveiled the role of IL-23-dependent IL-17 induction in LdCen -/- parasite-induced immunity and subsequent protection against visceral leishmaniasis.

  6. Vaginal Immunization to Elicit Primary T-Cell Activation and Dissemination

    PubMed Central

    Pettini, Elena; Prota, Gennaro; Ciabattini, Annalisa; Boianelli, Alessandro; Fiorino, Fabio; Pozzi, Gianni; Vicino, Antonio; Medaglini, Donata

    2013-01-01

    Primary T-cell activation at mucosal sites is of utmost importance for the development of vaccination strategies. T-cell priming after vaginal immunization, with ovalbumin and CpG oligodeoxynucleotide adjuvant as model vaccine formulation, was studied in vivo in hormone-synchronized mice and compared to the one induced by the nasal route. Twenty-four hours after both vaginal or nasal immunization, antigen-loaded dendritic cells were detected within the respective draining lymph nodes. Vaginal immunization elicited a strong recruitment of antigen-specific CD4+ T cells into draining lymph nodes that was more rapid than the one observed following nasal immunization. T-cell clonal expansion was first detected in iliac lymph nodes, draining the genital tract, and proliferated T cells disseminated towards distal lymph nodes and spleen similarly to what observed following nasal immunization. T cells were indeed activated by the antigen encounter and acquired homing molecules essential to disseminate towards distal lymphoid organs as confirmed by the modulation of CD45RB, CD69, CD44 and CD62L marker expression. A multi-type Galton Watson branching process, previously used for in vitro analysis of T-cell proliferation, was applied to model in vivo CFSE proliferation data in draining lymph nodes 57 hours following immunization, in order to calculate the probabilistic decision of a cell to enter in division, rest in quiescence or migrate/die. The modelling analysis indicated that the probability of a cell to proliferate was higher following vaginal than nasal immunization. All together these data show that vaginal immunization, despite the absence of an organized mucosal associated inductive site in the genital tract, is very efficient in priming antigen-specific CD4+ T cells and inducing their dissemination from draining lymph nodes towards distal lymphoid organs. PMID:24349003

  7. Molecular mechanisms of programmed cell death-1 dependent T cell suppression: relevance for immunotherapy

    PubMed Central

    Zuazo, Miren; Gato-Cañas, Maria; Llorente, Noelia; Ibañez-Vea, María; Arasanz, Hugo

    2017-01-01

    Programmed cell death-1 (PD1) has become a significant target for cancer immunotherapy. PD1 and its receptor programmed cell death 1 ligand 1 (PDL1) are key regulatory physiological immune checkpoints that maintain self-tolerance in the organism by regulating the degree of activation of T and B cells amongst other immune cell types. However, cancer cells take advantage of these immunosuppressive regulatory mechanisms to escape T and B cell-mediated immunity. PD1 engagement on T cells by PDL1 on the surface of cancer cells dramatically interferes with T cell activation and the acquisition of effector capacities. Interestingly, PD1-targeted therapies have demonstrated to be highly effective in rescuing T cell anti-tumor effector functions. Amongst these the use of anti-PD1/PDL1 monoclonal antibodies are particularly efficacious in human therapies. Furthermore, clinical findings with PD1/PDL1 blockers over several cancer types demonstrate clinical benefit. Despite the successful results, the molecular mechanisms by which PD1-targeted therapies rescue T cell functions still remain elusive. Therefore, it is a key issue to uncover the molecular pathways by which these therapies exert its function in T cells. A profound knowledge of PDL1/PD1 mechanisms will surely uncover a new array of targets susceptible of therapeutic intervention. Here, we provide an overview of the molecular events underlying PD1-dependent T cell suppression in cancer. PMID:29114543

  8. Antigen-specific T-cell lines transfer protective immunity against Trichinella spiralis in vivo.

    PubMed Central

    Riedlinger, J; Grencis, R K; Wakelin, D

    1986-01-01

    T-cell lines specific for infective muscle larvae antigens of the intestinal nematode Trichinella spiralis have been generated in vitro. These antigen-specific T-cell lines express the L3T4+ Ly2- phenotype and secrete the lymphokines IL-2, IL-3 and gamma-IFN. They are stable in culture for up to 15 weeks and are protective when adoptively transferred into naive recipients. As few as 2 x 10(5) T. spiralis-specific tract. In addition, intestinal mastocytosis and peripheral blood eosinophilia were accelerated after adoptive transfer of T. spiralis-specific T-cell lines. PMID:2423438

  9. Natural Killer Dendritic Cells Enhance Immune Responses Elicited by α -Galactosylceramide-Stimulated Natural Killer T Cells.

    PubMed

    Lee, Sung Won; Park, Hyun Jung; Kim, Nayoung; Hong, Seokmann

    2013-01-01

    Natural killer dendritic cells (NKDCs) possess potent anti-tumor activity, but the cellular effect of NKDC interactions with other innate immune cells is unclear. In this study, we demonstrate that the interaction of NKDCs and natural killer T (NKT) cells is required for the anti-tumor immune responses that are elicited by α -galactosylceramide ( α -GC) in mice. The rapid and strong expression of interferon- γ by NKDCs after α -GC stimulation was dependent on NKT cells. Various NK and DC molecular markers and cytotoxic molecules were up-regulated following α -GC administration. This up-regulation could improve NKDC presentation of tumor antigens and increase cytotoxicity against tumor cells. NKDCs were required for the stimulation of DCs, NK cells, and NKT cells. The strong anti-tumor immune responses elicited by α -GC may be due to the down-regulation of regulatory T cells. Furthermore, the depletion of NKDCs dampened the tumor clearance mediated by α -GC-stimulated NKT cells in vivo. Taken together, these results indicate that complex interactions of innate immune cells might be required to achieve optimal anti-tumor immune responses during the early stages of tumorigenesis.

  10. A novel ICOS-independent, but CD28- and SAP-dependent, pathway of T cell-dependent, polysaccharide-specific humoral immunity in response to intact Streptococcus pneumoniae versus pneumococcal conjugate vaccine

    PubMed Central

    Chen, Quanyi; Cannons, Jennifer L.; Paton, James C.; Akiba, Hisaya; Schwartzberg, Pamela L.; Snapper, Clifford M.

    2010-01-01

    Polysaccharide (PS)- and protein-specific murine IgG responses to intact Streptococcus pneumoniae (Pn) are both dependent upon CD4+ T cell help, B7-dependent costimulation, and CD40/CD40-ligand interactions. However, the primary PS-, relative to protein-specific, IgG response terminates more rapidly, requires a shorter period of T cell help and B7-dependent costimulation, and fails to generate memory. In light of the critical role for ICOS/ICOS-ligand interactions in sustaining T cell-dependent Ig responses and promoting germinal center reactions, we hypothesized that this interaction was non-essential for PS-specific IgG responses to Pn. We now demonstrate that ICOS-/-, relative to WT, mice elicit a normal PS-specific IgG isotype response to Pn, despite marked inhibition of both the primary and secondary IgG anti-protein (i.e. PspA, PspC, and PsaA) response. A blocking anti-ICOS-ligand mAb injected during primary Pn immunization inhibits both the primary anti-protein response and the generation of protein-specific memory, but has no effect when injected during secondary immunization. In contrast to Pn, both PS- and protein-specific IgG responses to a pneumococcal conjugate vaccine are inhibited in ICOS-/- mice. ICOS-/- mice immunized with intact Pn or conjugate exhibit nearly complete abrogation in germinal center formation. Finally, although mice that lack the adaptor molecule SAP resemble ICOS-/- mice (and can exhibit decreased ICOS expression), we observe that the PS-, as well as protein-specific IgG responses to both Pn and conjugate are markedly defective in SAP-/- mice. These data define a novel T cell-, SAP-, and B7-dependent, but ICOS-independent, extrafollicular pathway of Ig induction. PMID:19050242

  11. Regulatory role of Vγ1 γδ T cells in tumor immunity through IL-4 production.

    PubMed

    Hao, Jianlei; Dong, Siyuan; Xia, Siyuan; He, Weifeng; Jia, Hao; Zhang, Song; Wei, Jun; O'Brien, Rebecca L; Born, Willi K; Wu, Zhenzhou; Wang, Puyue; Han, Jihong; Hong, Zhangyong; Zhao, Liqing; Yin, Zhinan

    2011-11-15

    It has been demonstrated that the two main subsets of peripheral γδ T cells, Vγ1 and Vγ4, have divergent functions in many diseases models. Recently, we reported that Vγ4 γδ T cells played a protective role in tumor immunity through eomesodermin-controlled mechanisms. However, the precise roles of Vγ1 γδ T cells in tumor immunity, especially whether Vγ1 γδ T cells have any interaction with Vγ4 γδ T cells, remain unknown. We demonstrated in this paper that Vγ1 γδ T cells suppressed Vγ4 γδ T cell-mediated antitumor function both in vitro and in vivo, and this suppression was cell contact independent. Using neutralizing anti-IL-4 Ab or IL-4(-/-) mice, we determined the suppressive factor derived from Vγ1 γδ T cells was IL-4. Indeed, treatment of Vγ4 γδ T cells with rIL-4 significantly reduced expression levels of NKG2D, perforin, and IFN-γ. Finally, Vγ1 γδ T cells produced more IL-4 and expressed significantly higher level of GATA-3 upon Th2 priming in comparison with Vγ4 γδ T cells. Therefore, to our knowledge, our results established for the first time a negative regulatory role of Vγ1 γδ T cells in Vγ4 γδ T cell-mediated antitumor immunity through cell contact-independent and IL-4-mediated mechanisms. Selective depletion of this suppressive subset of γδ T cells may be beneficial for tumor immune therapy.

  12. Tomatine adjuvantation of protective immunity to a major pre-erythrocytic vaccine candidate of malaria is mediated via CD8+ T cell release of IFN-gamma.

    PubMed

    Heal, Karen G; Taylor-Robinson, Andrew W

    2010-01-01

    The glycoalkaloid tomatine, derived from the wild tomato, can act as a powerful adjuvant to elicit an antigen-specific cell-mediated immune response to the circumsporozoite (CS) protein, a major pre-erythrocytic stage malaria vaccine candidate antigen. Using a defined MHC-class-I-restricted CS epitope in a Plasmodium berghei rodent model, antigen-specific cytotoxic T lymphocyte activity and IFN-gamma secretion ex vivo were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunized mice. Further, through lymphocyte depletion it is demonstrated that antigen-specific IFN-gamma is produced exclusively by the CD8(+) T cell subset. We conclude that the processing of the P. berghei CS peptide as an exogenous antigen and its presentation via MHC class I molecules to CD8(+) T cells leads to an immune response that is an in vitro correlate of protection against pre-erythrocytic malaria. Further characterization of tomatine as an adjuvant in malaria vaccine development is indicated.

  13. Mucosal BCG Vaccination Induces Protective Lung-Resident Memory T Cell Populations against Tuberculosis

    PubMed Central

    Perdomo, Carolina; Zedler, Ulrike; Kühl, Anja A.; Lozza, Laura; Saikali, Philippe; Sander, Leif E.; Vogelzang, Alexis; Kupz, Andreas

    2016-01-01

    ABSTRACT Mycobacterium bovis Bacille Calmette-Guérin (BCG) is the only licensed vaccine against tuberculosis (TB), yet its moderate efficacy against pulmonary TB calls for improved vaccination strategies. Mucosal BCG vaccination generates superior protection against TB in animal models; however, the mechanisms of protection remain elusive. Tissue-resident memory T (TRM) cells have been implicated in protective immune responses against viral infections, but the role of TRM cells following mycobacterial infection is unknown. Using a mouse model of TB, we compared protection and lung cellular infiltrates of parenteral and mucosal BCG vaccination. Adoptive transfer and gene expression analyses of lung airway cells were performed to determine the protective capacities and phenotypes of different memory T cell subsets. In comparison to subcutaneous vaccination, intratracheal and intranasal BCG vaccination generated T effector memory and TRM cells in the lung, as defined by surface marker phenotype. Adoptive mucosal transfer of these airway-resident memory T cells into naive mice mediated protection against TB. Whereas airway-resident memory CD4+ T cells displayed a mixture of effector and regulatory phenotype, airway-resident memory CD8+ T cells displayed prototypical TRM features. Our data demonstrate a key role for mucosal vaccination-induced airway-resident T cells in the host defense against pulmonary TB. These results have direct implications for the design of refined vaccination strategies. PMID:27879332

  14. IL-4Rα-Associated Antigen Processing by B Cells Promotes Immunity in Nippostrongylus brasiliensis Infection

    PubMed Central

    Hoving, Jennifer C.; Nieuwenhuizen, Natalie; McSorley, Henry J.; Ndlovu, Hlumani; Bobat, Saeeda; Kimberg, Matti; Kirstein, Frank; Cutler, Anthony J.; DeWals, Benjamin; Cunningham, Adam F.; Brombacher, Frank

    2013-01-01

    In this study, B cell function in protective TH2 immunity against N. brasiliensis infection was investigated. Protection against secondary infection depended on IL-4Rα and IL-13; but not IL-4. Protection did not associate with parasite specific antibody responses. Re-infection of B cell-specific IL-4Rα−/− mice resulted in increased worm burdens compared to control mice, despite their equivalent capacity to control primary infection. Impaired protection correlated with reduced lymphocyte IL-13 production and B cell MHC class II and CD86 surface expression. Adoptive transfer of in vivo N. brasiliensis primed IL-4Rα expressing B cells into naïve BALB/c mice, but not IL-4Rα or IL-13 deficient B cells, conferred protection against primary N. brasiliensis infection. This protection required MHC class II compatibility on B cells suggesting cognate interactions by B cells with CD4+ T cells were important to co-ordinate immunity. Furthermore, the rapid nature of these protective effects by B cells suggested non-BCR mediated mechanisms, such as via Toll Like Receptors, was involved, and this was supported by transfer experiments using antigen pulsed Myd88−/− B cells. These data suggest TLR dependent antigen processing by IL-4Rα-responsive B cells producing IL-13 contribute significantly to CD4+ T cell-mediated protective immunity against N. brasiliensis infection. PMID:24204255

  15. T cells play an essential role in anti-F1 mediated rapid protection against bubonic plague.

    PubMed

    Levy, Yinon; Flashner, Yehuda; Tidhar, Avital; Zauberman, Ayelet; Aftalion, Moshe; Lazar, Shirley; Gur, David; Shafferman, Avigdor; Mamroud, Emanuelle

    2011-09-16

    Plague, which is initiated by Yersinia pestis infection, is a fatal disease that progresses rapidly and leads to high mortality rates if not treated. Antibiotics are an effective plague therapy, but antibiotic-resistant Y. pestis strains have been reported and therefore alternative countermeasures are needed. In the present study, we assessed the potential of an F1 plus LcrV-based vaccine to provide protection shortly pre- or post-exposure to a lethal Y. pestis infection. Mice vaccinated up to one day before or even several hours after subcutaneous challenge were effectively protected. Mice immunized one or three days pre-challenge were protected even though their anti-F1 and anti-LcrV titers were below detection levels at the day of challenge. Moreover, using B-cell deficient μMT mice, we found that rapidly induced protective immunity requires the integrity of the humoral immune system. Analysis of the individual contributions of vaccine components to protection revealed that rF1 is responsible for the observed rapid antibody-mediated immunity. Applying anti-F1 passive therapy in the mouse model of bubonic plague demonstrated that anti-F1 F(ab')(2) can delay mortality, but it cannot provide long-lasting protection, as do intact anti-F1 molecules. Fc-dependent immune components, such as the complement system and (to a lesser extent) neutrophils, were found to contribute to mouse survival. Interestingly, T cells but not B cells were found to be essential for the recovery of infected animals following passive anti-F1 mediated therapy. These data extend our understanding of the immune mechanisms required for the development of a rapid and effective post-exposure therapy against plague. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Retinoic Acid as a Modulator of T Cell Immunity

    PubMed Central

    Bono, Maria Rosa; Tejon, Gabriela; Flores-Santibañez, Felipe; Fernandez, Dominique; Rosemblatt, Mario; Sauma, Daniela

    2016-01-01

    Vitamin A, a generic designation for an array of organic molecules that includes retinal, retinol and retinoic acid, is an essential nutrient needed in a wide array of aspects including the proper functioning of the visual system, maintenance of cell function and differentiation, epithelial surface integrity, erythrocyte production, reproduction, and normal immune function. Vitamin A deficiency is one of the most common micronutrient deficiencies worldwide and is associated with defects in adaptive immunity. Reports from epidemiological studies, clinical trials and experimental studies have clearly demonstrated that vitamin A plays a central role in immunity and that its deficiency is the cause of broad immune alterations including decreased humoral and cellular responses, inadequate immune regulation, weak response to vaccines and poor lymphoid organ development. In this review, we will examine the role of vitamin A in immunity and focus on several aspects of T cell biology such as T helper cell differentiation, function and homing, as well as lymphoid organ development. Further, we will provide an overview of the effects of vitamin A deficiency in the adaptive immune responses and how retinoic acid, through its effect on T cells can fine-tune the balance between tolerance and immunity. PMID:27304965

  17. Public clonotype usage identifies protective Gag-specific CD8+ T cell responses in SIV infection

    PubMed Central

    Asher, Tedi E.; Wilson, Nancy A.; Nason, Martha C.; Brenchley, Jason M.; Metzler, Ian S.; Venturi, Vanessa; Gostick, Emma; Chattopadhyay, Pratip K.; Roederer, Mario; Davenport, Miles P.; Watkins, David I.; Douek, Daniel C.

    2009-01-01

    Despite the pressing need for an AIDS vaccine, the determinants of protective immunity to HIV remain concealed within the complexity of adaptive immune responses. We dissected immunodominant virus-specific CD8+ T cell populations in Mamu-A*01+ rhesus macaques with primary SIV infection to elucidate the hallmarks of effective immunity at the level of individual constituent clonotypes, which were identified according to the expression of distinct T cell receptors (TCRs). The number of public clonotypes, defined as those that expressed identical TCR β-chain amino acid sequences and recurred in multiple individuals, contained within the acute phase CD8+ T cell population specific for the biologically constrained Gag CM9 (CTPYDINQM; residues 181–189) epitope correlated negatively with the virus load set point. This independent molecular signature of protection was confirmed in a prospective vaccine trial, in which clonotype engagement was governed by the nature of the antigen rather than the context of exposure and public clonotype usage was associated with enhanced recognition of epitope variants. Thus, the pattern of antigen-specific clonotype recruitment within a protective CD8+ T cell population is a prognostic indicator of vaccine efficacy and biological outcome in an AIDS virus infection. PMID:19349463

  18. B cells are critical to T-cell-mediated antitumor immunity induced by a combined immune-stimulatory/conditionally cytotoxic therapy for glioblastoma.

    PubMed

    Candolfi, Marianela; Curtin, James F; Yagiz, Kader; Assi, Hikmat; Wibowo, Mia K; Alzadeh, Gabrielle E; Foulad, David; Muhammad, A K M G; Salehi, Sofia; Keech, Naomi; Puntel, Mariana; Liu, Chunyan; Sanderson, Nicholas R; Kroeger, Kurt M; Dunn, Robert; Martins, Gislaine; Lowenstein, Pedro R; Castro, Maria G

    2011-10-01

    We have demonstrated that modifying the tumor microenvironment through intratumoral administration of adenoviral vectors (Ad) encoding the conditional cytotoxic molecule, i.e., HSV1-TK and the immune-stimulatory cytokine, i.e., fms-like tyrosine kinase 3 ligand (Flt3L) leads to T-cell-dependent tumor regression in rodent models of glioblastoma. We investigated the role of B cells during immune-mediated glioblastoma multiforme regression. Although treatment with Ad-TK+Ad-Flt3L induced tumor regression in 60% of wild-type (WT) mice, it completely failed in B-cell-deficient Igh6(-/-) mice. Tumor-specific T-cell precursors were detected in Ad-TK+Ad-Flt3L-treated WT mice but not in Igh6(-/-) mice. The treatment also failed in WT mice depleted of total B cells or marginal zone B cells. Because we could not detect circulating antibodies against tumor cells and the treatment was equally efficient in WT mice and in mice with B-cell-specific deletion of Prdm 1 (encoding Blimp-1), in which B cells are present but unable to fully differentiate into antibody-secreting plasma cells, tumor regression in this model is not dependent on B cells' production of tumor antigen-specific immunoglobulins. Instead, B cells seem to play a role as antigen-presenting cells (APCs). Treatment with Ad-TK+Ad-Flt3L led to an increase in the number of B cells in the cervical lymph nodes, which stimulated the proliferation of syngeneic T cells and induced clonal expansion of antitumor T cells. Our data show that B cells act as APCs, playing a critical role in clonal expansion of tumor antigen-specific T cells and brain tumor regression.

  19. Immune memory: the basics and how to trigger an efficient long-term immune memory.

    PubMed

    Beverley, P C L

    2010-01-01

    Immunological memory consists of expanded clones of T and B lymphocytes that show an increased rate of cell division and shortened telomeres compared with naïve cells. However, exhaustion of clones is delayed by kinetic heterogeneity within clones and altered survival and up-regulation of telomerase. Prolonged maintenance of protective B-cell immunity is T-cell dependent and requires a balance between plasma cells and memory B cells. Protective T-cell immunity also requires correct quality of T cells and that they are located appropriately. Copyright 2009 Elsevier Ltd. All rights reserved.

  20. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  1. Glomerular common gamma chain confers B- and T-cell-independent protection against glomerulonephritis.

    PubMed

    Luque, Yosu; Cathelin, Dominique; Vandermeersch, Sophie; Xu, Xiaoli; Sohier, Julie; Placier, Sandrine; Xu-Dubois, Yi-Chun; Louis, Kevin; Hertig, Alexandre; Bories, Jean-Christophe; Vasseur, Florence; Campagne, Fabien; Di Santo, James P; Vosshenrich, Christian; Rondeau, Eric; Mesnard, Laurent

    2017-05-01

    Crescentic glomerulonephritis is a life-threatening renal disease that has been extensively studied by the experimental anti-glomerular basement membrane glomerulonephritis (anti-GBM-GN) model. Although T cells have a significant role in this model, athymic/nude mice and rats still develop severe renal disease. Here we further explored the contribution of intrinsic renal cells in the development of T-cell-independent GN lesions. Anti-GBM-GN was induced in three strains of immune-deficient mice (Rag2 -/- , Rag2 -/- Il2rg -/- , and Rag2 -/- Il2rb -/- ) that are devoid of either T/B cells or T/B/NK cells. The Rag2 -/- Il2rg -/- or Rag2 -/- Il2rb -/- mice harbor an additional deletion of either the common gamma chain (γC) or the interleukin-2 receptor β subunit (IL-2Rβ), respectively, impairing IL-15 signaling in particular. As expected, all these strains developed severe anti-GBM-GN. Additionally, bone marrow replenishment experiments allowed us to deduce a protective role for the glomerular-expressed γC during anti-GBM-GN. Given that IL-15 has been found highly expressed in nephritic kidneys despite the absence of lymphocytes, we then studied this cytokine in vitro on primary cultured podocytes from immune-deficient mice (Rag2 -/- Il2rg -/- and Rag2 -/- Il2rb -/- ) compared to controls. IL-15 induced downstream activation of JAK1/3 and SYK in primary cultured podocytes. IL-15-dependent JAK/SYK induction was impaired in the absence of γC or IL-2Rβ. We found γC largely induced on podocytes during human glomerulonephritis. Thus, renal lesions are indeed modulated by intrinsic glomerular cells through the γC/IL-2Rβ receptor response, to date classically described only in immune cells. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  2. Targeting the Genital Tract Mucosa with a Lipopeptide/Recombinant Adenovirus Prime/Boost Vaccine Induces Potent and Long-Lasting CD8+ T Cell Immunity Against Herpes: Importance of Myeloid Differentiation Factor 881

    PubMed Central

    Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; BenMohamed, Lbachir

    2012-01-01

    Targeting the mucosal immune system of the genital tract (GT) with subunit vaccines failed to induce potent and durable local CD8+ T cell immunity, crucial for protection against many sexually transmitted viral (STV) pathogens, including herpes simplex virus type 2 (HSV-2) that causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8+ T cell immunity to protect the female genital tract from herpes. The lipopeptide and the rAdv5 vaccine express the immunodominant HSV-2 CD8+ T cell epitope (gB498-505) and both were delivered intravaginally (IVAG) in the progesterone-induced B6 mouse model of genital herpes. Compared to its homologous lipopeptide/lipopeptide (Lipo/Lipo); the Lipo/rAdv5 prime/boost immunized mice: (i) developed potent and sustained HSV-specific CD8+ T cells, detected in both the GT draining nodes (GT-DLN) and in the vaginal mucosa (VM); (ii) had significantly lower virus titers; (iii) had decreased overt signs of genital herpes disease; and (iv) did not succumb to lethal infection (p < 0.005), following intravaginal HSV-2 challenge. Polyfunctional CD8+ T cells, producing IFN-γ, TNF-α and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8+ T cell response was significantly compromised in the absence of the adaptor myeloid differentiation factor 88 (MyD88) (p = 0.0001). Taken together, these findings indicate that targeting the VM with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8+ T cell protective immunity against sexually transmitted herpes infection and disease. PMID:23018456

  3. Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection

    PubMed Central

    Nunes-Alves, Cláudio; Booty, Matthew G.; Carpenter, Stephen M.; Rothchild, Alissa C.; Martin, Constance J.; Desjardins, Danielle; Steblenko, Katherine; Kløverpris, Henrik N.; Madansein, Rajhmun; Ramsuran, Duran; Leslie, Alasdair; Correia-Neves, Margarida; Behar, Samuel M.

    2015-01-01

    The immune system can recognize virtually any antigen, yet T cell responses against several pathogens, including Mycobacterium tuberculosis, are restricted to a limited number of immunodominant epitopes. The host factors that affect immunodominance are incompletely understood. Whether immunodominant epitopes elicit protective CD8+ T cell responses or instead act as decoys to subvert immunity and allow pathogens to establish chronic infection is unknown. Here we show that anatomically distinct human granulomas contain clonally expanded CD8+ T cells with overlapping T cell receptor (TCR) repertoires. Similarly, the murine CD8+ T cell response against M. tuberculosis is dominated by TB10.44-11-specific T cells with extreme TCRβ bias. Using a retrogenic model of TB10.44-11-specific CD8+ T cells, we show that TCR dominance can arise because of competition between clonotypes driven by differences in affinity. Finally, we demonstrate that TB10.4-specific CD8+ T cells mediate protection against tuberculosis, which requires interferon-γ production and TAP1-dependent antigen presentation in vivo. Our study of how immunodominance, biased TCR repertoires, and protection are inter-related, provides a new way to measure the quality of T cell immunity, which if applied to vaccine evaluation, could enhance our understanding of how to elicit protective T cell immunity. PMID:25945999

  4. Liver Restores Immune Homeostasis after Local Inflammation despite the Presence of Autoreactive T Cells

    PubMed Central

    Béland, Kathie; Lapierre, Pascal; Djilali-Saiah, Idriss; Alvarez, Fernando

    2012-01-01

    The liver must keep equilibrium between immune tolerance and immunity in order to protect itself from pathogens while maintaining tolerance to food antigens. An imbalance between these two states could result in an inflammatory liver disease. The aims of this study were to identify factors responsible for a break of tolerance and characterize the subsequent restoration of liver immune homeostasis. A pro-inflammatory environment was created in the liver by the co-administration of TLR ligands CpG and Poly(I:C) in presence or absence of activated liver-specific autoreactive CD8+ T cells. Regardless of autoreactive CD8+ T cells, mice injected with CpG and Poly(I:C) showed elevated serum ALT levels and a transient liver inflammation. Both CpG/Poly(I:C) and autoreactive CD8+T cells induced expression of TLR9 and INF-γ by the liver, and an up-regulation of homing and adhesion molecules CXCL9, CXCL10, CXCL16, ICAM-1 and VCAM-1. Transferred CFSE-labeled autoreactive CD8+ T cells, in presence of TLR3 and 9 ligands, were recruited by the liver and spleen and proliferated. This population then contracted by apoptosis through intrinsic and extrinsic pathways. Up-regulation of FasL and PD-L1 in the liver was observed. In conclusion, TLR-mediated activation of the innate immune system results in a pro-inflammatory environment that promotes the recruitment of lymphocytes resulting in bystander hepatitis. Despite this pro-inflammatory environment, the presence of autoreactive CD8+ T cells is not sufficient to sustain an autoimmune response against the liver and immune homeostasis is rapidly restored through the apoptosis of T cells. PMID:23110209

  5. Biomimetic Antigenic Nanoparticles Elicit Controlled Protective Immune Response to Influenza

    PubMed Central

    Patterson, Dustin P.; Rynda-Apple, Agnieszka; Harmsen, Ann L.; Harmsen, Allen G.; Douglas, Trevor

    2013-01-01

    Here we present a biomimetic strategy towards nanoparticle design for controlled immune response through encapsulation of conserved internal influenza proteins on the interior of virus like particles (VLPs) to direct CD8+ cytotoxic T cell protection. Programmed encapsulation and sequestration of the conserved nucleoprotein (NP) from influenza on the interior of a VLP, derived from the bacteriophage P22, results in a vaccine that provides multi-strain protection against 100 times lethal doses of influenza in an NP specific CD8+ T cell-dependent manner. VLP assembly and encapsulation of the immunogenic NP cargo protein is the result of a genetically programmed self-assembly making this strategy amendable to the quick production of vaccines to rapidly emerging pathogens. Addition of adjuvants or targeting molecules were not required for eliciting the protective response. PMID:23540530

  6. Colorectal cancer cells suppress CD4+ T cells immunity through canonical Wnt signaling.

    PubMed

    Sun, Xuan; Liu, Suoning; Wang, Daguang; Zhang, Yang; Li, Wei; Guo, Yuchen; Zhang, Hua; Suo, Jian

    2017-02-28

    Understanding how colorectal cancer escapes from immunosurveillance and immune attack is important for developing novel immunotherapies for colorectal cancer. In this study we evaluated the role of canonical Wnt signaling in the regulation of T cell function in a mouse colorectal cancer model. We found that colorectal cancer cells expressed abundant Wnt ligands, and intratumoral T cells expressed various Frizzled proteins. Meanwhile, both active β-catenin and total β-catenin were elevated in intratumoral T cells. In vitro study indicated that colorectal cancer cells suppressed IFN-γ expression and increased IL-17a expression in activated CD4+ T cells. However, the cytotoxic activity of CD8+ T cells was not altered by colorectal cancer cells. To further evaluate the importance of Wnt signaling for CD4+ T cell-mediated cancer immunity, β-catenin expression was enforced in CD4+ T cells using lentiviral transduction. In an adoptive transfer model, enforced expression of β-catenin in intratumoral CD4+ T cells increased IL-17a expression, enhanced proliferation and inhibited apoptosis of colorectal cancer cells. Taken together, our study disclosed a new mechanism by which colorectal cancer impairs T cell immunity.

  7. The early cellular signatures of protective immunity induced by live viral vaccination.

    PubMed

    Kohler, Siegfried; Bethke, Nicole; Böthe, Matthias; Sommerick, Sophie; Frentsch, Marco; Romagnani, Chiara; Niedrig, Matthias; Thiel, Andreas

    2012-09-01

    Here, we have used primary vaccination of healthy donors with attenuated live yellow fever virus 17D (YFV-17D) as a model to study the generation of protective immunity. In short intervals after vaccination, we analyzed the induction of YFV-17D specific T- and B-cell immunity, bystander activation, dendritic cell subsets, changes in serum cytokine levels, and YFV-17D-specific antibodies. We show activation of innate immunity and a concomitant decline of numbers of peripheral blood T and B cells. An early peak of antigen-specific T cells at day 2, followed by mobilization of innate immune cells, preceded the development of maximal adaptive immunity against YFV-17D at day 14 after vaccination. Interestingly, potent adaptive immunity as measured by high titers of neutralizing YFV-17D-specific antibodies, correlated with early activation and recruitment of YFV-17D-specific CD4(+) T cells and higher levels of sIL-6R. Thus our data might provide new insights into the interplay of innate and adaptive immunity for the induction of protective immunity. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Compound heterozygosity for Pten and SHIP augments T-dependent humoral immune responses and cytokine production by CD4+ T cells

    PubMed Central

    Moody, J L; Jirik, F R

    2004-01-01

    Tight regulation of the phosphatidylinositiol 3-kinase (PI3K) pathway is essential not only for normal immune system development and responsiveness, but also in the prevention of immunopathology. Indeed, unchecked activation of the PI3K pathway in T cells induces lymphoproliferation and systemic autoimmunity. Evaluating the importance of threshold levels of two key PI3K pathway phosphoinositol phosphatases, we previously reported that mice heterozygous for both Pten and SHIP develop a more rapid progression of a lymphoproliferative autoimmune syndrome than do Pten+\\− mice. Investigating the basis for this difference, we now describe a quantitative and qualitative difference in the antibody responses of C57BL\\6 Pten+\\− SHIP+\\− mice upon challenge with a T-dependent antigen. Suspecting that this phenotypic difference might be the result, at least in part, of a T-helper cell defect, an in vitro analysis of anti-CD3/interleukin (IL)-2-expanded CD4+ T cells was performed. After stimulation with anti-CD3, cells from mice heterozygous for both Pten and SHIP exhibited a striking increase in IL-4 secretion (> 10-fold), without a corresponding increase in T helper 2 (Th2) cell numbers being evident by intracellular staining for this cytokine. Modest increases were also seen for both IL-13 and IFN-γ. Perhaps in keeping with this abnormal in vitro cytokine profile, IgG1 serum levels were significantly elevated in young C57BL\\6 Pten+\\− SHIP+\\− mice. Thus, the relative levels of Pten and SHIP appear to be key variables in CD4+ T-cell function, primarily via their ability to regulate IL-4 production. PMID:15196208

  9. T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4⁺ T cells.

    PubMed

    Arbore, Giuseppina; West, Erin E; Spolski, Rosanne; Robertson, Avril A B; Klos, Andreas; Rheinheimer, Claudia; Dutow, Pavel; Woodruff, Trent M; Yu, Zu Xi; O'Neill, Luke A; Coll, Rebecca C; Sher, Alan; Leonard, Warren J; Köhl, Jörg; Monk, Pete; Cooper, Matthew A; Arno, Matthew; Afzali, Behdad; Lachmann, Helen J; Cope, Andrew P; Mayer-Barber, Katrin D; Kemper, Claudia

    2016-06-17

    The NLRP3 inflammasome controls interleukin-1β maturation in antigen-presenting cells, but a direct role for NLRP3 in human adaptive immune cells has not been described. We found that the NLRP3 inflammasome assembles in human CD4(+) T cells and initiates caspase-1-dependent interleukin-1β secretion, thereby promoting interferon-γ production and T helper 1 (T(H)1) differentiation in an autocrine fashion. NLRP3 assembly requires intracellular C5 activation and stimulation of C5a receptor 1 (C5aR1), which is negatively regulated by surface-expressed C5aR2. Aberrant NLRP3 activity in T cells affects inflammatory responses in human autoinflammatory disease and in mouse models of inflammation and infection. Our results demonstrate that NLRP3 inflammasome activity is not confined to "innate immune cells" but is an integral component of normal adaptive T(H)1 responses. Copyright © 2016, American Association for the Advancement of Science.

  10. Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection.

    PubMed

    Nunes-Alves, Cláudio; Booty, Matthew G; Carpenter, Stephen M; Rothchild, Alissa C; Martin, Constance J; Desjardins, Danielle; Steblenko, Katherine; Kløverpris, Henrik N; Madansein, Rajhmun; Ramsuran, Duran; Leslie, Alasdair; Correia-Neves, Margarida; Behar, Samuel M

    2015-05-01

    The immune system can recognize virtually any antigen, yet T cell responses against several pathogens, including Mycobacterium tuberculosis, are restricted to a limited number of immunodominant epitopes. The host factors that affect immunodominance are incompletely understood. Whether immunodominant epitopes elicit protective CD8+ T cell responses or instead act as decoys to subvert immunity and allow pathogens to establish chronic infection is unknown. Here we show that anatomically distinct human granulomas contain clonally expanded CD8+ T cells with overlapping T cell receptor (TCR) repertoires. Similarly, the murine CD8+ T cell response against M. tuberculosis is dominated by TB10.44-11-specific T cells with extreme TCRβ bias. Using a retro genic model of TB10.44-11-specific CD8+ Tcells, we show that TCR dominance can arise because of competition between clonotypes driven by differences in affinity. Finally, we demonstrate that TB10.4-specific CD8+ T cells mediate protection against tuberculosis, which requires interferon-γ production and TAP1-dependent antigen presentation in vivo. Our study of how immunodominance, biased TCR repertoires, and protection are inter-related, provides a new way to measure the quality of T cell immunity, which if applied to vaccine evaluation, could enhance our understanding of how to elicit protective T cell immunity.

  11. Mucosal priming of newborn mice with S. Typhi Ty21a expressing anthrax protective antigen (PA) followed by parenteral PA-boost induces B and T cell-mediated immunity that protects against infection bypassing maternal antibodies

    PubMed Central

    Ramirez, Karina; Ditamo, Yanina; Galen, James E.; Baillie, Les W. J.; Pasetti, Marcela F.

    2010-01-01

    The currently licensed anthrax vaccine has several limitations and its efficacy has been proven only in adults. Effective immunization of newborns and infants requires adequate stimulation of their immune system, which is competent but not fully activated. We explored the use of the licensed live attenuated S. Typhi vaccine strain Ty21a expressing Bacillus anthracis protective antigen [Ty21a(PA)] followed PA-alum as a strategy for immunizing the pediatric population. Newborn mice primed with a single dose of Ty21a(PA) exhibited high frequencies of mucosal IgA-secreting B cells and IFN-γ-secreting T cells during the neonatal period, none of which was detected in newborns immunized with a single dose of PA-alum. Priming with Ty21a(PA) followed by PA-boost resulted in high levels of PA-specific IgG, toxin-neutralizing and opsonophagocytic antibodies and increased frequency of bone marrow IgG plasma cells and memory B cells compared with repeated immunization with PA-alum alone. Robust B and T cell responses developed even in the presence of maternal antibodies. The prime-boost protected against systemic and respiratory infection. Mucosal priming with a safe and effective S. Typhi-based anthrax vaccine followed by PA-boost could serve as a practical and effective prophylactic approach to prevent anthrax early in life. PMID:20619377

  12. MHCII-mediated dialog between group 2 innate lymphoid cells and CD4(+) T cells potentiates type 2 immunity and promotes parasitic helminth expulsion.

    PubMed

    Oliphant, Christopher J; Hwang, You Yi; Walker, Jennifer A; Salimi, Maryam; Wong, See Heng; Brewer, James M; Englezakis, Alexandros; Barlow, Jillian L; Hams, Emily; Scanlon, Seth T; Ogg, Graham S; Fallon, Padraic G; McKenzie, Andrew N J

    2014-08-21

    Group 2 innate lymphoid cells (ILC2s) release interleukin-13 (IL-13) during protective immunity to helminth infection and detrimentally during allergy and asthma. Using two mouse models to deplete ILC2s in vivo, we demonstrate that T helper 2 (Th2) cell responses are impaired in the absence of ILC2s. We show that MHCII-expressing ILC2s interact with antigen-specific T cells to instigate a dialog in which IL-2 production from T cells promotes ILC2 proliferation and IL-13 production. Deletion of MHCII renders IL-13-expressing ILC2s incapable of efficiently inducing Nippostrongylus brasiliensis expulsion. Thus, during transition to adaptive T cell-mediated immunity, the ILC2 and T cell crosstalk contributes to their mutual maintenance, expansion and cytokine production. This interaction appears to augment dendritic-cell-induced T cell activation and identifies a previously unappreciated pathway in the regulation of type-2 immunity. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  13. T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4+ T cells

    PubMed Central

    Spolski, Rosanne; Robertson, Avril A. B.; Klos, Andreas; Rheinheimer, Claudia; Dutow, Pavel; Woodruff, Trent M.; Yu, Zu Xi; O'Neill, Luke A.; Coll, Rebecca C.; Sher, Alan; Leonard, Warren J.; Köhl, Jörg; Monk, Pete; Cooper, Matthew A.; Arno, Matthew; Afzali, Behdad; Lachmann, Helen J.; Cope, Andrew P.; Mayer-Barber, Katrin D.; Kemper, Claudia

    2016-01-01

    The NLRP3 inflammasome controls interleukin-1β maturation in antigen-presenting cells, but a direct role for NLRP3 in human adaptive immune cells has not been described. We found that the NLRP3 inflammasome assembles in human CD4+ T cells and initiates caspase-1–dependent interleukin-1β secretion, thereby promoting interferon-γ production and T helper 1 (TH1) differentiation in an autocrine fashion. NLRP3 assembly requires intracellular C5 activation and stimulation of C5a receptor 1 (C5aR1), which is negatively regulated by surface-expressed C5aR2. Aberrant NLRP3 activity in T cells affects inflammatory responses in human autoinflammatory disease and in mouse models of inflammation and infection. Our results demonstrate that NLRP3 inflammasome activity is not confined to “innate immune cells” but is an integral component of normal adaptive TH1 responses. PMID:27313051

  14. Postchallenge Administration of Brincidofovir Protects Healthy and Immune-Deficient Mice Reconstituted with Limited Numbers of T Cells from Lethal Challenge with IHD-J-Luc Vaccinia Virus

    PubMed Central

    McCullough, Kevin Tyler; Cruz, Stephanie; Thomas, Antonia; Diaz, Claudia G.; Keilholz, Laurie; Grossi, Irma M.; Trost, Lawrence C.; Golding, Hana

    2015-01-01

    ABSTRACT Protection from lethality by postchallenge administration of brincidofovir (BCV, CMX001) was studied in normal and immune-deficient (nude, nu/nu) BALB/c mice infected with vaccinia virus (VACV). Whole-body bioluminescence imaging was used to record total fluxes in the nasal cavity, lungs, spleen, and liver and to enumerate pox lesions on tails of mice infected via the intranasal route with 105 PFU of recombinant IHD-J-Luc VACV expressing luciferase. Areas under the flux curve (AUCs) were calculated for individual mice to assess viral loads. A three-dose regimen of 20 mg/kg BCV administered every 48 h starting either on day 1 or day 2 postchallenge protected 100% of mice. Initiating BCV treatment earlier was more efficient in reducing viral loads and in providing protection from pox lesion development. All BCV-treated mice that survived challenge were also protected from rechallenge with IHD-J-Luc or WRvFire VACV without additional treatment. In immune-deficient mice, BCV protected animals from lethality and reduced viral loads while animals were on the drug. Viral recrudescence occurred within 4 to 9 days, and mice succumbed ∼10 to 20 days after treatment termination. Nude mice reconstituted with 105 T cells prior to challenge with 104 PFU of IHD-J-Luc and treated with BCV postchallenge survived the infection, cleared the virus from all organs, and survived rechallenge with 105 PFU of IHD-J-Luc VACV without additional BCV treatment. Together, these data suggest that BCV protects immunocompetent and partially T cell-reconstituted immune-deficient mice from lethality, reduces viral dissemination in organs, prevents pox lesion development, and permits generation of VACV-specific memory. IMPORTANCE Mass vaccination is the primary element of the public health response to a smallpox outbreak. In addition to vaccination, however, antiviral drugs are required for individuals with uncertain exposure status to smallpox or for whom vaccination is contraindicated

  15. T-cell-dependent control of acute Giardia lamblia infections in mice.

    PubMed

    Singer, S M; Nash, T E

    2000-01-01

    We have studied immune mechanisms responsible for control of acute Giardia lamblia and Giardia muris infections in adult mice. Association of chronic G. lamblia infection with hypogammaglobulinemia and experimental infections of mice with G. muris have led to the hypothesis that antibodies are required to control these infections. We directly tested this hypothesis by infecting B-cell-deficient mice with either G. lamblia or G. muris. Both wild-type mice and B-cell-deficient mice eliminated the vast majority of parasites between 1 and 2 weeks postinfection with G. lamblia. G. muris was also eliminated in both wild-type and B-cell-deficient mice. In contrast, T-cell-deficient and scid mice failed to control G. lamblia infections, as has been shown previously for G. muris. Treatment of wild-type or B-cell-deficient mice with antibodies to CD4 also prevented elimination of G. lamblia, confirming a role for T cells in controlling infections. By infecting mice deficient in either alphabeta- or gammadelta-T-cell receptor (TCR)-expressing T cells, we show that the alphabeta-TCR-expressing T cells are required to control parasites but that the gammadelta-TCR-expressing T cells are not. Finally, infections in mice deficient in production of gamma interferon or interleukin 4 (IL-4) and mice deficient in responding to IL-4 and IL-13 revealed that neither the Th1 nor the Th2 subset is absolutely required for protection from G. lamblia. We conclude that a T-cell-dependent mechanism is essential for controlling acute Giardia infections and that this mechanism is independent of antibody and B cells.

  16. In vivo induction of a high-avidity, high-frequency cytotoxic T-lymphocyte response is associated with antiviral protective immunity.

    PubMed

    Sedlik, C; Dadaglio, G; Saron, M F; Deriaud, E; Rojas, M; Casal, S I; Leclerc, C

    2000-07-01

    Many approaches are currently being developed to deliver exogenous antigen into the major histocompatibility complex class I-restricted antigen pathway, leading to in vivo priming of CD8(+) cytotoxic T cells. One attractive possibility consists of targeting the antigen to phagocytic or macropinocytic antigen-presenting cells. In this study, we demonstrate that strong CD8(+) class I-restricted cytotoxic responses are induced upon intraperitoneal immunization of mice with different peptides, characterized as CD8(+) T-cell epitopes, bound to 1-microm synthetic latex microspheres and injected in the absence of adjuvant. The cytotoxic response induced against a lymphocytic choriomeningitis virus (LCMV) peptide linked to these microspheres was compared to the cytotoxic T-lymphocyte (CTL) response obtained upon immunization with the nonreplicative porcine parvovirus-like particles (PPV:VLP) carrying the same peptide (PPV:VLP-LCMV) previously described (C. Sedlik, M. F. Saron, J. Sarraseca, I. Casal, and C. Leclerc, Proc. Natl. Acad. Sci. USA 94:7503-7508, 1997). We show that the induction of specific CTL activity by peptides bound to microspheres requires CD4(+) T-cell help in contrast to the CTL response obtained with the peptide delivered by viral pseudoparticles. Furthermore, PPV:VLP are 100-fold more efficient than microspheres in generating a strong CTL response characterized by a high frequency of specific T cells of high avidity. Moreover, PPV:VLP-LCMV are able to protect mice against a lethal LCMV challenge whereas microspheres carrying the LCMV epitope fail to confer such protection. This study demonstrates the crucial involvement of the frequency and avidity of CTLs in conferring antiviral protective immunity and highlights the importance of considering these parameters when developing new vaccine strategies.

  17. γδ T Cells Support Pancreatic Oncogenesis by Restraining αβ T Cell Activation.

    PubMed

    Daley, Donnele; Zambirinis, Constantinos Pantelis; Seifert, Lena; Akkad, Neha; Mohan, Navyatha; Werba, Gregor; Barilla, Rocky; Torres-Hernandez, Alejandro; Hundeyin, Mautin; Mani, Vishnu Raj Kumar; Avanzi, Antonina; Tippens, Daniel; Narayanan, Rajkishen; Jang, Jung-Eun; Newman, Elliot; Pillarisetty, Venu Gopal; Dustin, Michael Loran; Bar-Sagi, Dafna; Hajdu, Cristina; Miller, George

    2016-09-08

    Inflammation is paramount in pancreatic oncogenesis. We identified a uniquely activated γδT cell population, which constituted ∼40% of tumor-infiltrating T cells in human pancreatic ductal adenocarcinoma (PDA). Recruitment and activation of γδT cells was contingent on diverse chemokine signals. Deletion, depletion, or blockade of γδT cell recruitment was protective against PDA and resulted in increased infiltration, activation, and Th1 polarization of αβT cells. Although αβT cells were dispensable to outcome in PDA, they became indispensable mediators of tumor protection upon γδT cell ablation. PDA-infiltrating γδT cells expressed high levels of exhaustion ligands and thereby negated adaptive anti-tumor immunity. Blockade of PD-L1 in γδT cells enhanced CD4(+) and CD8(+) T cell infiltration and immunogenicity and induced tumor protection suggesting that γδT cells are critical sources of immune-suppressive checkpoint ligands in PDA. We describe γδT cells as central regulators of effector T cell activation in cancer via novel cross-talk. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Mucosal BCG Vaccination Induces Protective Lung-Resident Memory T Cell Populations against Tuberculosis.

    PubMed

    Perdomo, Carolina; Zedler, Ulrike; Kühl, Anja A; Lozza, Laura; Saikali, Philippe; Sander, Leif E; Vogelzang, Alexis; Kaufmann, Stefan H E; Kupz, Andreas

    2016-11-22

    Mycobacterium bovis Bacille Calmette-Guérin (BCG) is the only licensed vaccine against tuberculosis (TB), yet its moderate efficacy against pulmonary TB calls for improved vaccination strategies. Mucosal BCG vaccination generates superior protection against TB in animal models; however, the mechanisms of protection remain elusive. Tissue-resident memory T (T RM ) cells have been implicated in protective immune responses against viral infections, but the role of T RM cells following mycobacterial infection is unknown. Using a mouse model of TB, we compared protection and lung cellular infiltrates of parenteral and mucosal BCG vaccination. Adoptive transfer and gene expression analyses of lung airway cells were performed to determine the protective capacities and phenotypes of different memory T cell subsets. In comparison to subcutaneous vaccination, intratracheal and intranasal BCG vaccination generated T effector memory and T RM cells in the lung, as defined by surface marker phenotype. Adoptive mucosal transfer of these airway-resident memory T cells into naive mice mediated protection against TB. Whereas airway-resident memory CD4 + T cells displayed a mixture of effector and regulatory phenotype, airway-resident memory CD8 + T cells displayed prototypical T RM features. Our data demonstrate a key role for mucosal vaccination-induced airway-resident T cells in the host defense against pulmonary TB. These results have direct implications for the design of refined vaccination strategies. BCG remains the only licensed vaccine against TB. Parenterally administered BCG has variable efficacy against pulmonary TB, and thus, improved prevention strategies and a more refined understanding of correlates of vaccine protection are required. Induction of memory T cells has been shown to be essential for protective TB vaccines. Mimicking the natural infection route by mucosal vaccination has been known to generate superior protection against TB in animal models; however, the

  19. Regulating the Adaptive Immune Response to Blood-Stage Malaria: Role of Dendritic Cells and CD4+Foxp3+ Regulatory T Cells

    PubMed Central

    Stevenson, Mary M.; Ing, Rebecca; Berretta, Floriana; Miu, Jenny

    2011-01-01

    Although a clearer understanding of the underlying mechanisms involved in protection and immunopathology during blood-stage malaria has emerged, the mechanisms involved in regulating the adaptive immune response especially those required to maintain a balance between beneficial and deleterious responses remain unclear. Recent evidence suggests the importance of CD11c+ dendritic cells (DC) and CD4+Foxp3+ regulatory T cells in regulating immune responses during infection and autoimmune disease, but information concerning the contribution of these cells to regulating immunity to malaria is limited. Here, we review recent findings from our laboratory and others in experimental models of malaria in mice and in Plasmodium-infected humans on the roles of DC and natural regulatory T cells in regulating adaptive immunity to blood-stage malaria. PMID:22110383

  20. Potentiation of T-cell mediated immunity by levamisole.

    PubMed Central

    Renoux, G; Renoux, M; Teller, M N; McMahon, S; Guillaumin, J M

    1976-01-01

    Cell-mediated immunity is a requirement for recognition and elimination of cells and for prevention or treatment of a variety of diseases. Therefore, the development of a product potentially active in increasing immunity involves its testing in assays specific for cell-mediated immunity. The effectiveness of a single administration of levamisole was demonstrated in the rejection of isografts in a male to female C57BL/6 system, and on the enhancement of levels of the delayed type hypersensitivity (DTH) to sheep red cells (SRBC). Indeed, in five on nine tests, an injection of 25 mg/kg of levamisole to female recipients either on the day of grafting or 7 days after grafting resulted in a RT50% rejection time of 25 days, compared with 46 days in untreated controls. Levamisole administered at the time of immunization with various doses of SRBC elicited earlier, higher and more sustained DTH levels than in untreated controls. Such induction of T-cell activation was accompanied by a switch on anti-SRBC antibodies from IgM to IgG. These findings confirm and extend data evidencing the ability of levamisole to recruit and activate T cells for an increased or restored cell-mediated immunity. PMID:782749

  1. Immune Modules Shared by Innate Lymphoid Cells and T Cells

    PubMed Central

    Robinette, Michelle L.; Colonna, Marco

    2016-01-01

    In recent years, innate lymphoid cells (ILCs) have emerged as innate correlates to T cells. The similarities between ILCs and T cells indicate that lymphocytes of fundamentally distinct lineages can share core “immune modules” that encompass transcriptional circuitry and effector functions, while utilizing non-redundant, complementary mechanisms of pattern recognition to enact these functions. We review modules currently recognized to be shared between ILCs and T cells. PMID:27817796

  2. Ionizing Radiation Selectively Reduces Skin Regulatory T Cells and Alters Immune Function

    PubMed Central

    Zhou, Yu; Ni, Houping; Balint, Klara; Sanzari, Jenine K.; Dentchev, Tzvete; Diffenderfer, Eric S.; Wilson, Jolaine M.; Cengel, Keith A.; Weissman, Drew

    2014-01-01

    The skin serves multiple functions that are critical for life. The protection from pathogens is achieved by a complicated interaction between aggressive effectors and controlling functions that limit damage. Inhomogeneous radiation with limited penetration is used in certain types of therapeutics and is experienced with exposure to solar particle events outside the protection of the Earth’s magnetic field. This study explores the effect of ionizing radiation on skin immune function. We demonstrate that radiation, both homogeneous and inhomogeneous, induces inflammation with resultant specific loss of regulatory T cells from the skin. This results in a hyper-responsive state with increased delayed type hypersensitivity in vivo and CD4+ T cell proliferation in vitro. The effects of inhomogeneous radiation to the skin of astronauts or as part of a therapeutic approach could result in an unexpected enhancement in skin immune function. The effects of this need to be considered in the design of radiation therapy protocols and in the development of countermeasures for extended space travel. PMID:24959865

  3. Activation of T cells recognizing self 60-kD heat shock protein can protect against experimental arthritis

    PubMed Central

    1995-01-01

    Lewis rats are susceptible to several forms of experimental arthritis- induced using heat-killed Mycobacterium tuberculosis (adjuvant arthritis, or AA), streptococcal cell walls, collagen type II, and the lipoidal amine CP20961. Prior immunization with the mycobacterial 65-kD heat shock protein (hsp65) was reported to protect against AA, and other athritis models not using M. tuberculosis, via a T cell-mediated mechanism. Hsp65 shares 48% amino acid identity with mammalian hsp60, which is expressed at elevated levels in inflamed synovia. Several studies have reported cross-reactive T cell recognition of mycobacterial hsp65 and self hsp60 in arthritic and normal individuals. We previously described nine major histocompatibility complex class II- restricted epitopes in mycobacterial hsp65 recognized by Lewis rat T cells. Of these only one, covering the 256-270 sequence, primed for cross-reactive T cell responses to the corresponding region of rat hsp60. Here we have tested each hsp65 epitope for protective activity by immunizing rats with synthetic peptides. A peptide containing the 256-270 epitope, which induced cross-reactive T cells, was the only one able to confer protection against AA. Similarly, administration of a T cell line specific for this epitope protected against AA. Preimmunization with the 256-270 epitope induced T cells that responded to heat-shocked syngeneic antigen-presenting cells, and also protected against CP20961-induced arthritis, indicating that activation of T cells, recognizing an epitope in self hsp60 can protect against arthritis induced without mycobacteria. Therefore, in contrast to the accepted concept that cross-reactive T cell recognition of foreign and self antigens might induce aggressive autoimmune disease, we propose that cross-reactivity between bacterial and self hsp60 might also be used to maintain a protective self-reactive T cell population. This discovery might have important implications for understanding T cell- mediated

  4. Epigenetic programming of T cells impacts immune reconstitution in hematopoietic stem cell transplant recipients.

    PubMed

    Hardy, Kristine; Smith, Corey; Tu, Wen Juan; McCuaig, Robert; Panikkar, Archana; Dasari, Vijayendra; Wu, Fan; Tey, Siok-Keen; Hill, Geoffrey R; Khanna, Rajiv; Rao, Sudha

    2018-03-27

    Immune reconstitution following hematopoietic stem cell transplantation (HSCT) is critical in preventing harmful sequelae in recipients with cytomegalovirus (CMV) infection. To understand the molecular mechanisms underlying immune reconstitution kinetics, we profiled the transcriptome-chromatin accessibility landscape of CMV-specific CD8 + T cells from HCST recipients with different immune reconstitution efficiencies. CMV-specific T cells from HSCT recipients with stable antiviral immunity expressed higher levels of interferon/defense response and cell cycle genes in an interconnected network involving PI3KCG , STAT5B , NFAT , RBPJ , and lower HDAC6 , increasing chromatin accessibility at the enhancer regions of immune and T-cell receptor signaling pathway genes. By contrast, the transcriptional and epigenomic signatures of CMV-specific T cells from HSCT recipients with unstable immune reconstitution showed commonalities with T-cell responses in other nonresolving chronic infections. These signatures included higher levels of EGR and KLF factors that, along with lower JARID2 expression, maintained higher accessibility at promoter and CpG-rich regions of genes associated with apoptosis. Furthermore, epigenetic targeting via inhibition of HDAC6 or JARID2 enhanced the transcription of genes associated with differential responses, suggesting that drugs targeting epigenomic modifiers may have therapeutic potential for enhancing immune reconstitution in HSCT recipients. Taken together, these analyses demonstrate that transcription factors and chromatin modulators create different chromatin accessibility landscapes in T cells of HSCT recipients that not only affect immediate gene expression but also differentially prime cells for responses to additional signals. Epigenetic therapy may be a promising strategy to promote immune reconstitution in HSCT recipients. © 2018 by The American Society of Hematology.

  5. TLR1/2 activation during heterologous prime-boost vaccination (DNA-MVA) enhances CD8+ T Cell responses providing protection against Leishmania (Viannia).

    PubMed

    Jayakumar, Asha; Castilho, Tiago M; Park, Esther; Goldsmith-Pestana, Karen; Blackwell, Jenefer M; McMahon-Pratt, Diane

    2011-06-01

    Leishmania (Viannia) parasites present particular challenges, as human and murine immune responses to infection are distinct from other Leishmania species, indicating a unique interaction with the host. Further, vaccination studies utilizing small animal models indicate that modalities and antigens that prevent infection by other Leishmania species are generally not protective. Using a newly developed mouse model of chronic L. (Viannia) panamensis infection and the heterologous DNA prime - modified vaccinia virus Ankara (MVA) boost vaccination modality, we examined whether the conserved vaccine candidate antigen tryparedoxin peroxidase (TRYP) could provide protection against infection/disease. Heterologous prime - boost (DNA/MVA) vaccination utilizing TRYP antigen can provide protection against disease caused by L. (V.) panamensis. However, protection is dependent on modulating the innate immune response using the TLR1/2 agonist Pam3CSK4 during DNA priming. Prime-boost vaccination using DNA alone fails to protect. Prior to infection protectively vaccinated mice exhibit augmented CD4 and CD8 IFNγ and memory responses as well as decreased IL-10 and IL-13 responses. IL-13 and IL-10 have been shown to be independently critical for disease in this model. CD8 T cells have an essential role in mediating host defense, as CD8 depletion reversed protection in the vaccinated mice; vaccinated mice depleted of CD4 T cells remained protected. Hence, vaccine-induced protection is dependent upon TLR1/2 activation instructing the generation of antigen specific CD8 cells and restricting IL-13 and IL-10 responses. Given the general effectiveness of prime-boost vaccination, the recalcitrance of Leishmania (Viannia) to vaccine approaches effective against other species of Leishmania is again evident. However, prime-boost vaccination modality can with modulation induce protective responses, indicating that the delivery system is critical. Moreover, these results suggest that CD8 T

  6. Recombinant Listeria monocytogenes as a Live Vaccine Vehicle for the Induction of Protective Anti-Viral Cell-Mediated Immunity

    NASA Astrophysics Data System (ADS)

    Shen, Hao; Slifka, Mark K.; Matloubian, Mehrdad; Jensen, Eric R.; Ahmed, Rafi; Miller, Jeff F.

    1995-04-01

    Listeria monocytogenes (LM) is a Gram-positive bacterium that is able to enter host cells, escape from the endocytic vesicle, multiply within the cytoplasm, and spread directly from cell to cell without encountering the extracellular milieu. The ability of LM to gain access to the host cell cytosol allows proteins secreted by the bacterium to efficiently enter the pathway for major histocompatibility complex class I antigen processing and presentation. We have established a genetic system for expression and secretion of foreign antigens by recombinant strains, based on stable site-specific integration of expression cassettes into the LM genome. The ability of LM recombinants to induce protective immunity against a heterologous pathogen was demonstrated with lymphocytic choriomeningitis virus (LCMV). LM strains expressing the entire LCMV nucleoprotein or an H-2L^d-restricted nucleoprotein epitope (aa 118-126) were constructed. Immunization of mice with LM vaccine strains conferred protection against challenge with virulent strains of LCMV that otherwise establish chronic infection in naive adult mice. In vivo depletion of CD8^+ T cells from vaccinated mice abrogated their ability to clear viral infection, showing that protective anti-viral immunity was due to CD8^+ T cells.

  7. Contact hypersensitivity: the mechanism of immune responses and T cell balance.

    PubMed

    Watanabe, Hideaki; Unger, Mark; Tuvel, Brandon; Wang, Binghe; Sauder, Daniel N

    2002-04-01

    The skin is the largest organ in the human body. It acts not only as an important structural barrier against injury but also as a peripheral arm of the immune system. Elucidating the characteristics of this latter function has taken on renewed importance in recent years. Exposure to chemicals in everyday life has increased exponentially over the past decades. This has been accompanied by an increased incidence of contact hypersensitivity (CHS), a dendritic cell-dependent, T cell-derived, cytokine-mediated skin inflammation. Cytokines derived from Langerhans cells (i.e., interleukin-12 [IL-12]) and from T cell (i.e., interferon-gamma [IFN-gamma], IL-4, and IL-10) play a pivotal role in the induction and initiation of CHS. Developments in immunology and molecular biology have improved our understanding of the molecular mechanisms underlying this immune response. However, the conflicting opinions that continue to characterize discussions of CHS supply clear testimony that our knowledge is as yet incomplete.

  8. Immunization of Cattle by Infection with Cowdria ruminantium Elicits T Lymphocytes That Recognize Autologous, Infected Endothelial Cells and Monocytes†

    PubMed Central

    Mwangi, Duncan M.; Mahan, Suman M.; Nyanjui, John K.; Taracha, Evans L. N.; McKeever, Declan J.

    1998-01-01

    Peripheral blood mononuclear cells (PBMC) from immune cattle proliferate in the presence of autologous Cowdria ruminantium-infected endothelial cells and monocytes. Endothelial cells required treatment with T-cell growth factors to induce class II major histocompatibility complex expression prior to infection and use as stimulators. Proliferative responses to both infected autologous endothelial cells and monocytes were characterized by expansion of a mixture of CD4+, CD8+, and γδ T cells. However, γδ T cells dominated following several restimulations. Reverse transcription-PCR analysis of cytokine expression by C. ruminantium-specific T-cell lines and immune PBMC revealed weak interleukin-2 (IL-2), IL-4, and gamma interferon (IFN-γ) transcripts at 3 to 24 h after stimulation. Strong expression of IFN-γ, tumor necrosis factor alpha (TNF-α), TNF-β, and IL-2 receptor α-chain mRNA was detected in T-cell lines 48 h after antigen stimulation. Supernatants from these T-cell cultures contained IFN-γ protein. Our findings suggest that in immune cattle a C. ruminantium-specific T-cell response is induced and that infected endothelial cells and monocytes may present C. ruminantium antigens to specific T lymphocytes in vivo during infection and thereby play a role in induction of protective immune responses to the pathogen. PMID:9573061

  9. Induction of CD8 T Cell Heterologous Protection by a Single Dose of Single-Cycle Infectious Influenza Virus

    PubMed Central

    Baker, Steven F.; Martínez-Sobrido, Luis

    2014-01-01

    ABSTRACT The effector functions of specific CD8 T cells are crucial in mediating influenza heterologous protection. However, new approaches for influenza vaccines that can trigger effective CD8 T cell responses have not been extensively explored. We report here the generation of single-cycle infectious influenza virus that lacks a functional hemagglutinin (HA) gene on an X31 genetic background and demonstrate its potential for triggering protective CD8 T cell immunity against heterologous influenza virus challenge. In vitro, X31-sciIV can infect MDCK cells, but infectious virions are not produced unless HA is transcomplemented. In vivo, intranasal immunization with X31-sciIV does not cause any clinical symptoms in mice but generates influenza-specific CD8 T cells in lymphoid (mediastinal lymph nodes and spleen) and nonlymphoid tissues, including lung and bronchoalveolar lavage fluid, as measured by H2-Db NP366 and PA224 tetramer staining. In addition, a significant proportion of X31-sciIV-induced antigen-specific respiratory CD8 T cells expressed VLA-1, a marker that is associated with heterologous influenza protection. Further, these influenza-specific CD8 T cells produce antiviral cytokines when stimulated with NP366 and PA224 peptides, indicating that CD8 T cells triggered by X31-sciIV are functional. When challenged with a lethal dose of heterologous PR8 virus, X31-sciIV-primed mice were fully protected from death. However, when CD8 T cells were depleted after priming or before priming, mice could not effectively control virus replication or survive the lethal challenge, indicating that X31-sciIV-induced memory CD8 T cells mediate the heterologous protection. Thus, our results demonstrate the potential for sciIV as a CD8 T cell-inducing vaccine. IMPORTANCE One of the challenges for influenza prevention is the existence of multiple influenza virus subtypes and variants and the fact that new strains can emerge yearly. Numerous studies have indicated that the

  10. Activated T cells sustain myeloid-derived suppressor cell-mediated immune suppression

    PubMed Central

    Damuzzo, Vera; Francescato, Samuela; Pozzuoli, Assunta; Berizzi, Antonio; Mocellin, Simone; Rossi, Carlo Riccardo; Bronte, Vincenzo; Mandruzzato, Susanna

    2016-01-01

    The expansion of myeloid derived suppressor cells (MDSCs), a suppressive population able to hamper the immune response against cancer, correlates with tumor progression and overall survival in several cancer types. We have previously shown that MDSCs can be induced in vitro from precursors present in the bone marrow and observed that these cells are able to actively proliferate in the presence of activated T cells, whose activation level is critical to drive the suppressive activity of MDSCs. Here we investigated at molecular level the mechanisms involved in the interplay between MDSCs and activated T cells. We found that activated T cells secrete IL-10 following interaction with MDSCs which, in turn, activates STAT3 phosphorylation on MDSCs then leading to B7-H1 expression. We also demonstrated that B7-H1+ MDSCs are responsible for immune suppression through a mechanism involving ARG-1 and IDO expression. Finally, we show that the expression of ligands B7-H1 and MHC class II both on in vitro-induced MDSCs and on MDSCs in the tumor microenvironment of cancer patients is paralleled by an increased expression of their respective receptors PD-1 and LAG-3 on T cells, two inhibitory molecules associated with T cell dysfunction. These findings highlight key molecules and interactions responsible for the extensive cross-talk between MDSCs and activated T cells that are at the basis of immune suppression. PMID:26700461

  11. CARs: Driving T-cell specificity to enhance anti-tumor immunity

    PubMed Central

    Kebriaei, Partow; Kelly, Susan S.; Manuri, Pallavi; Jena, Bipulendu; Jackson, Rineka; Shpall, Elizabeth; Champlin, Richard; Cooper, Laurence J. N.

    2013-01-01

    Adoptive transfer of antigen-specific T cells is a compelling tool to treat cancer. To overcome issues of immune tolerance which limits the endogenous adaptive immune response to tumor-associated antigens, robust systems for the genetic modification and characterization of T cells expressing chimeric antigen receptors (CARs) to redirect specificity have been produced. Refinements with regards to persistence and trafficking of the genetically modified T cells are underway to help improve the potency of genetically modified T cells. Clinical trials utilizing this technology demonstrate feasibility, and increasingly, antitumor activity, paving the way for multi-center trials to establish the efficacy of this novel T-cell therapy. PMID:22202074

  12. Cellular Self-Defense: How Cell-Autonomous Immunity Protects Against Pathogens

    PubMed Central

    Randow, Felix; MacMicking, John D.; James, Leo C.

    2013-01-01

    Our prevailing view of vertebrate host defense is strongly shaped by the notion of a specialized set of immune cells as sole guardians of antimicrobial resistance. Yet this view greatly underestimates a capacity for most cell lineages—the majority of which fall outside the traditional province of the immune system—to defend themselves against infection. This ancient and ubiquitous form of host protection is termed cell-autonomous immunity and operates across all three domains of life. Here, we discuss the organizing principles that govern cellular self-defense and how intracellular compartmentalization has shaped its activities to provide effective protection against a wide variety of microbial pathogens. PMID:23661752

  13. Cellular self-defense: how cell-autonomous immunity protects against pathogens.

    PubMed

    Randow, Felix; MacMicking, John D; James, Leo C

    2013-05-10

    Our prevailing view of vertebrate host defense is strongly shaped by the notion of a specialized set of immune cells as sole guardians of antimicrobial resistance. Yet this view greatly underestimates a capacity for most cell lineages-the majority of which fall outside the traditional province of the immune system-to defend themselves against infection. This ancient and ubiquitous form of host protection is termed cell-autonomous immunity and operates across all three domains of life. Here, we discuss the organizing principles that govern cellular self-defense and how intracellular compartmentalization has shaped its activities to provide effective protection against a wide variety of microbial pathogens.

  14. Tolerance without clonal expansion: self-antigen-expressing B cells program self-reactive T cells for future deletion.

    PubMed

    Frommer, Friederike; Heinen, Tobias J A J; Wunderlich, F Thomas; Yogev, Nir; Buch, Thorsten; Roers, Axel; Bettelli, Estelle; Müller, Werner; Anderton, Stephen M; Waisman, Ari

    2008-10-15

    B cells have been shown in various animal models to induce immunological tolerance leading to reduced immune responses and protection from autoimmunity. We show that interaction of B cells with naive T cells results in T cell triggering accompanied by the expression of negative costimulatory molecules such as PD-1, CTLA-4, B and T lymphocyte attenuator, and CD5. Following interaction with B cells, T cells were not induced to proliferate, in a process that was dependent on their expression of PD-1 and CTLA-4, but not CD5. In contrast, the T cells became sensitive to Ag-induced cell death. Our results demonstrate that B cells participate in the homeostasis of the immune system by ablation of conventional self-reactive T cells.

  15. Requirements of transcription factor Smad-dependent and -independent TGF-β signaling to control discrete T-cell functions.

    PubMed

    Gu, Ai-Di; Wang, Yunqi; Lin, Lin; Zhang, Song S; Wan, Yisong Y

    2012-01-17

    TGF-β modulates immune response by suppressing non-regulatory T (Treg) function and promoting Treg function. The question of whether TGF-β achieves distinct effects on non-Treg and Treg cells through discrete signaling pathways remains outstanding. In this study, we investigated the requirements of Smad-dependent and -independent TGF-β signaling for T-cell function. Smad2 and Smad3 double deficiency in T cells led to lethal inflammatory disorder in mice. Non-Treg cells were spontaneously activated and produced effector cytokines in vivo on deletion of both Smad2 and Smad3. In addition, TGF-β failed to suppress T helper differentiation efficiently and to promote induced Treg generation of non-Treg cells lacking both Smad2 and Smad3, suggesting that Smad-dependent signaling is obligatory to mediate TGF-β function in non-Treg cells. Unexpectedly, however, the development, homeostasis, and function of Treg cells remained intact in the absence of Smad2 and Smad3, suggesting that the Smad-independent pathway is important for Treg function. Indeed, Treg-specific deletion of TGF-β-activated kinase 1 led to failed Treg homeostasis and lethal immune disorder in mice. Therefore, Smad-dependent and -independent TGF-β signaling discretely controls non-Treg and Treg function to modulate immune tolerance and immune homeostasis.

  16. Intrahepatic T cell receptor β immune repertoire is essential for liver regeneration.

    PubMed

    Liang, Qing; Liu, Zeyuan; Zhu, Chao; Wang, Bin; Liu, Xiaoke; Yang, Yanan; Lv, Xue; Mu, Haiyu; Wang, Kejia

    2018-04-27

    T lymphocytes synergize with the cellular immune system to promote hepatocyte regeneration. The T cell receptor (TCR) immune repertoire is closely associated with the host immune response and regenerative proliferation. High-throughput sequencing of TCR provides deep insight into monitoring the immune microenvironment. Here, we aimed to determine the role of the TCRβ immune repertoire in liver regeneration. We investigated the hepatic regeneration in TCRβ chain-deficient (Tcrb -/- ) mice by two-thirds partial hepatectomy (PHx) method. Our results demonstrated that Tcrb -/- mice revealed a reduced capacity for liver regeneration, which was characterized by impaired hepatocyte proliferation and enhanced hepatocyte apoptosis. Dysregulation of inflammatory signalling activation and inflammatory factors was observed in regenerated Tcrb -/- livers. Simultaneously, significantly altered immunocyte levels and aberrant cytokine levels were observed during hepatic regeneration. In addition, we first determined the profile of the TCRβ immune repertoire during liver regeneration, indicating that PHx resulted in remarkably lower TCRβ diversity in intrahepatic T lymphocytes. Taken together, our data suggest that TCRβ deficiency gives a rise to aberrant intrahepatic immune microenvironment that impairs liver regeneration, and the TCRβ reconstitution is required for hepatic immunocyte recruitment and activation during liver regeneration. This article is protected by copyright. All rights reserved. © 2018 by the American Association for the Study of Liver Diseases.

  17. Cytotoxic effector functions of T cells are not required for protective immunity against fatal Rickettsia typhi infection in a murine model of infection: Role of TH1 and TH17 cytokines in protection and pathology

    PubMed Central

    Rauch, Jessica; Papp, Stefanie; Kuehl, Svenja; Richardt, Ulricke; Fleischer, Bernhard; Osterloh, Anke

    2017-01-01

    Endemic typhus caused by Rickettsia (R.) typhi is an emerging febrile disease that can be fatal due to multiple organ pathology. Here we analyzed the requirements for protection against R. typhi by T cells in the CB17 SCID model of infection. BALB/c wild-type mice generate CD4+ TH1 and cytotoxic CD8+ T cells both of which are sporadically reactivated in persistent infection. Either adoptively transferred CD8+ or CD4+ T cells protected R. typhi-infected CB17 SCID mice from death and provided long-term control. CD8+ T cells lacking either IFNγ or Perforin were still protective, demonstrating that the cytotoxic function of CD8+ T cells is not essential for protection. Immune wild-type CD4+ T cells produced high amounts of IFNγ, induced the release of nitric oxide in R. typhi-infected macrophages and inhibited bacterial growth in vitro via IFNγ and TNFα. However, adoptive transfer of CD4+IFNγ-/- T cells still protected 30–90% of R. typhi-infected CB17 SCID mice. These cells acquired a TH17 phenotype, producing high amounts of IL-17A and IL-22 in addition to TNFα, and inhibited bacterial growth in vitro. Surprisingly, the neutralization of either TNFα or IL-17A in CD4+IFNγ-/- T cell recipient mice did not alter bacterial elimination by these cells in vivo, led to faster recovery and enhanced survival compared to isotype-treated animals. Thus, collectively these data show that although CD4+ TH1 cells are clearly efficient in protection against R. typhi, CD4+ TH17 cells are similarly protective if the harmful effects of combined production of TNFα and IL-17A can be inhibited. PMID:28222146

  18. Protective immunity against Trypanosoma cruzi provided by oral immunization with Phytomonas serpens: role of nitric oxide.

    PubMed

    Pinge-Filho, P; Peron, J P S; de Moura, T R; Menolli, R A; Graça, V K; Estevão, D; Tadokoro, C E; Jankevicius, J V; Rizzo, L V

    2005-01-31

    We have previously demonstrated that Phytomonas serpens, a tomato parasite, shares antigens with Trypanosoma cruzi, the protozoa that causes Chagas' disease. These antigens are recognized by human sera and induce protective immunity in Balb/c mice. In the present study, inducible nitric oxide synthase (iNOS) knockout (KO) mice and C57BL/6 mice treated with the nitric oxide inhibitor, aminoguanidine (AG, 50 mg kg(-1)) infected with T. cruzi, were used to demonstrate the role of nitric oxide (NO) to host protection against T. cruzi infection achieved by oral immunization with live P. serpens. A reduction in parasitaemia and an increase in survival were observed in C57BL/6 infected mice and previously immunized with P. serpens, when compared to non-immunized mice. iNOS (KO) mice immunized and C57BL/6 immunized and treated with AG presented parasitaemia and mortality rates comparable to those of infected and non-immunized mice. By itself, immunization with P. serpens did not induce inflammation in the myocardium, but C57BL/6 mice so immunized showed fewer amastigotes nests in the heart following an acute T. cruzi infection than those in non-immunized mice. These results suggest that protective immunity against T. cruzi infection induced by immunization with P. serpens is dependent upon enhanced NO production during the acute phase of T. cruzi infection.

  19. Anthrax Lethal Factor as an Immune Target in Humans and Transgenic Mice and the Impact of HLA Polymorphism on CD4+ T Cell Immunity

    PubMed Central

    Ascough, Stephanie; Ingram, Rebecca J.; Chu, Karen K.; Reynolds, Catherine J.; Musson, Julie A.; Doganay, Mehmet; Metan, Gökhan; Ozkul, Yusuf; Baillie, Les; Sriskandan, Shiranee; Moore, Stephen J.; Gallagher, Theresa B.; Dyson, Hugh; Williamson, E. Diane; Robinson, John H.; Maillere, Bernard; Boyton, Rosemary J.; Altmann, Daniel M.

    2014-01-01

    Bacillus anthracis produces a binary toxin composed of protective antigen (PA) and one of two subunits, lethal factor (LF) or edema factor (EF). Most studies have concentrated on induction of toxin-specific antibodies as the correlate of protective immunity, in contrast to which understanding of cellular immunity to these toxins and its impact on infection is limited. We characterized CD4+ T cell immunity to LF in a panel of humanized HLA-DR and DQ transgenic mice and in naturally exposed patients. As the variation in antigen presentation governed by HLA polymorphism has a major impact on protective immunity to specific epitopes, we examined relative binding affinities of LF peptides to purified HLA class II molecules, identifying those regions likely to be of broad applicability to human immune studies through their ability to bind multiple alleles. Transgenics differing only in their expression of human HLA class II alleles showed a marked hierarchy of immunity to LF. Immunogenicity in HLA transgenics was primarily restricted to epitopes from domains II and IV of LF and promiscuous, dominant epitopes, common to all HLA types, were identified in domain II. The relevance of this model was further demonstrated by the fact that a number of the immunodominant epitopes identified in mice were recognized by T cells from humans previously infected with cutaneous anthrax and from vaccinated individuals. The ability of the identified epitopes to confer protective immunity was demonstrated by lethal anthrax challenge of HLA transgenic mice immunized with a peptide subunit vaccine comprising the immunodominant epitopes that we identified. PMID:24788397

  20. Antitoxic Cholera Immunity in Mice: Influence of Antigen Deposition on Antitoxin-Containing Cells and Protective Immunity in Different Parts of the Intestine

    PubMed Central

    Lange, Stefan; Nygren, Håkan; Svennerholm, Ann-Mari; Holmgren, Jan

    1980-01-01

    The importance of the mode of antigen presentation (intravenous, oral, or enteral restricted to the lower ileum) in the development of a local immune response and immunological memory for such a response in different parts of the intestine was studied in mice. Cholera toxin was used as antigen and the immune response was assayed by determining both the number of specific antitoxin-containing cells in the lamina propria and protection against experimental cholera. The results showed that all of these routes of antigen presentation could induce significant memory along the entire small intestine. In contrast, the actual production of antitoxin-containing cells or protective immune response elicited by booster immunization was restricted to those parts of the intestine that were directly exposed to antigen; i.e., lower ileum boosting resulted in immunity in the distal ileum but not in the proximal jejunum, whereas oral or intravenous boosting gave a response in both jejunum and ileum. Protection correlated closely with the number of antitoxin-containing cells in the lamina propria (correlation coefficient, 0.88); ≥4,000 antitoxin-containing cells per mm3 conferred solid immunity to cholera toxin-induced diarrhea. The total number of immunoglobulin-containing cells in intestines was not significantly influenced by the specific immunizations. There were four times as many of these cells in the upper jejunum (167,000 cells per mm3) as in the lower ileum, but the proportions of immunoglobulin A-containing cells (80 to 85%), immunoglobulin M-containing cells (14 to 20%), and immunoglobulin G-containing cells (0.4 to 0.9%) were similar in various parts of the intestine. The results indicate a differential dependence on local tissue antigen for the intestinal antibody-secreting cells and their memory cell precursors. PMID:7189747

  1. Structure-guided design of an invariant natural killer T cell agonist for optimum protection from type 1 diabetes in non-obese diabetic mice

    PubMed Central

    Blumenfeld, H J; Tohn, R; Haeryfar, S M M; Liu, Y; Savage, P B; Delovitch, T L

    2011-01-01

    Because invariant natural killer T (iNK T) cells link innate and adaptive immunity, the structure-dependent design of iNK T cell agonists may have therapeutic value as vaccines for many indications, including autoimmune disease. Previously, we showed that treatment of non-obese diabetic (NOD) mice with the iNK T cell activating prototypic glycolipid α-galactosylceramide (α-GalCer) protects them from type 1 diabetes (T1D). However, α-GalCer is a strong agonist that can hyperactivate iNK T cells, elicit several side effects and has shown only limited success in clinical trials. Here, we used a structure-guided design approach to identify an iNK T cell agonist that optimally protects from T1D with minimal side effects. Analyses of the kinetics and function of a panel of synthetic α-GalCer fatty acyl chain derivatives (C8:0-C16:0) were performed in NOD mice. C16:0 elicited the highest protection from insulitis and T1D, which was associated with a higher frequency and survival of iNK T cells and enhanced activity of tolerogenic dendritic cells (DCs) in draining pancreatic lymph nodes (PLN), inability to transactivate NK cells and a more rapid kinetics of induction and recovery of iNK T cells from anergy. We conclude that the length and structure of the acyl chain of α-GalCer regulates the level of protection against T1D in mice, and propose that the extent of this protection depends on the relative capacity of the acyl chain to accommodate an endogenous spacer lipid of appropriate length and structure. Thus, our findings with the α-GalCer C16:0 derivative suggest strongly that it be considered as a lead glycolipid candidate in clinical trials of T1D. PMID:21910729

  2. Nonclassical MHC Ib-restricted CD8+ T Cells Recognize Mycobacterium tuberculosis-Derived Protein Antigens and Contribute to Protection Against Infection

    PubMed Central

    Shang, Shaobin; Siddiqui, Sarah; Bian, Yao; Zhao, Jie; Wang, Chyung-Ru

    2016-01-01

    MHC Ib-restricted CD8+ T cells have been implicated in host defense against Mycobacterium tuberculosis (Mtb) infection. However, the relative contribution of various MHC Ib-restricted T cell populations to anti-mycobacterial immunity remains elusive. In this study, we used mice that lack MHC Ia (Kb-/-Db-/-), MHC Ia/H2-M3 (Kb-/-Db-/-M3-/-), or β2m (β2m-/-) to study the role of M3-restricted and other MHC Ib-restricted T cells in immunity against Mtb. Unlike their dominant role in Listeria infection, we found that M3-restricted CD8+ T cells only represented a small proportion of the CD8+ T cells responding to Mtb infection. Non-M3, MHC Ib-restricted CD8+ T cells expanded preferentially in the lungs of Mtb-infected Kb-/-Db-/-M3-/- mice, exhibited polyfunctional capacities and conferred protection against Mtb. These MHC Ib-restricted CD8+ T cells recognized several Mtb-derived protein antigens at a higher frequency than MHC Ia-restricted CD8+ T cells. The presentation of Mtb antigens to MHC Ib-restricted CD8+ T cells was mostly β2m-dependent but TAP-independent. Interestingly, a large proportion of Mtb-specific MHC Ib-restricted CD8+ T cells in Kb-/-Db-/-M3-/- mice were Qa-2-restricted while no considerable numbers of MR1 or CD1-restricted Mtb-specific CD8+ T cells were detected. Our findings indicate that nonclassical CD8+ T cells other than the known M3, CD1, and MR1-restricted CD8+ T cells contribute to host immune responses against Mtb infection. Targeting these MHC Ib-restricted CD8+ T cells would facilitate the design of better Mtb vaccines with broader coverage across MHC haplotypes due to the limited polymorphism of MHC class Ib molecules. PMID:27272249

  3. PTPROt maintains T cell immunity in the microenvironment of hepatocellular carcinoma.

    PubMed

    Hou, Jiajie; Deng, Lei; Zhuo, Han; Lin, Zhe; Chen, Yun; Jiang, Runqiu; Chen, Dianyu; Zhang, Xudong; Huang, Xingxu; Sun, Beicheng

    2015-08-01

    Intratumoral T cells play a central role in anti-tumor immunity, and the balance between T effector cells (Teff) and regulatory T cells (Treg) affects the prognosis of cancer patients. However, educated by tumor microenvironment, T cells frequently fail in their responsibility. In this study, we aimed to investigate the role of truncated isoform of protein tyrosine phosphatase receptor-type O (PTPROt) in T cell-mediated anti-tumor immunity. We recruited 70 hepatocellular carcinoma (HCC) patients and 30 healthy volunteers for clinical investigation, and analyzed cellular tumor immunity by using ptpro(-/-) C57BL/6 mice and NOD/SCID mice. PTPROt expression was significantly downregulated in human HCC-infiltrating T cells due to the hypoxia microenvironment; PTPROt expression highly correlated with the intratumoral Teff/Treg ratio and clinicopathologic characteristics. Moreover, PTPROt deficiency attenuated T cell-mediated anti-tumor immunity and remarkably promoted mouse HCC growth. Mechanistically, deletion of PTPROt decreased Teff quantity and quality through phosphorylation of lymphocyte-specific tyrosine kinase, but increased Treg differentiation through phosphorylation of signal transducer and activator of transcription 5. In support of the Teff/Treg homeostasis, PTPROt serves as an important tumor suppressor in HCC microenvironment. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

  4. Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA.

    PubMed

    Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle

    2006-03-06

    Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.

  5. Natural CD8{sup +}25{sup +} regulatory T cell-secreted exosomes capable of suppressing cytotoxic T lymphocyte-mediated immunity against B16 melanoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Yufeng; Zhang, Xueshu; Zhao, Tuo

    Highlights: •CD8{sup +}25{sup +} regulatory T cells secrete tolerogenic exosomes. •CD8{sup +}25{sup +} regulatory T cell-derived exosomes exhibit immunosuppressive effect. •CD8{sup +}25{sup +} regulatory T cell-derived exosomes inhibit antitumor immunity. -- Abstract: Natural CD4{sup +}25{sup +} and CD8{sup +}25{sup +} regulatory T (Tr) cells have been shown to inhibit autoimmune diseases. Immune cells secrete exosomes (EXOs), which are crucial for immune regulation. However, immunomodulatory effect of natural Tr cell-secreted EXOs is unknown. In this study, we purified natural CD8{sup +}25{sup +} Tr cells from C57BL/6 mouse naive CD8{sup +} T cells, and in vitro amplified them with CD3/CD28 beads. EXOsmore » (EXO{sub Tr}) were purified from Tr cell’s culture supernatants by differential ultracentrifugation and analyzed by electron microscopy, Western blot and flow cytometry. Our data showed that EXO{sub Tr} had a “saucer” or round shape with 50–100 nm in diameter, contained EXO-associated markers LAMP-1 and CD9, and expressed natural Tr cell markers CD25 and GITR. To assess immunomodulatory effect, we i.v. immunized C57BL/6 mice with ovalbumin (OVA)-pulsed DCs (DC{sub OVA}) plus Tr cells or EXO{sub Tr}, and then assessed OVA-specific CD8{sup +} T cell responses using PE-H-2K{sup b}/OVA tetramer and FITC-anti-CD8 antibody staining by flow cytometry and antitumor immunity in immunized mice with challenge of OVA-expressing BL6–10{sub OVA} melanoma cells. We demonstrated that DC{sub OVA}-stimulated CD8{sup +} T cell responses and protective antitumor immunity significantly dropped from 2.52% to 1.08% and 1.81% (p < 0.05), and from 8/8 to 2/8 and 5/8 mice DC{sub OVA} (p < 0.05) in immunized mice with co-injection of Tr cells and EXO{sub Tr}, respectively. Our results indicate that natural CD8{sup +}25{sup +} Tr cell-released EXOs, alike CD8{sup +}25{sup +} Tr cells, can inhibit CD8{sup +} T cell responses and antitumor immunity. Therefore, EXOs

  6. Overactivation of Mitogen-Activated Protein Kinase and Suppression of Mitofusin-2 Expression Are Two Independent Events in High Mobility Group Box 1 Protein–Mediated T Cell Immune Dysfunction

    PubMed Central

    Tang, Lu-ming; Zhao, Guang-ju; Zhu, Xiao-mei; Dong, Ning; Yu, Yan

    2013-01-01

    High mobility group box 1 protein (HMGB1), a critical proinflammatory cytokine, has recently been identified to be an immunostimulatory signal involved in sepsis-related immune dysfunction when released extracellularly, but the potential mechanism involved remains elusive. Here, we showed that the treatment with HMGB1 in vitro inhibited T lymphocyte immune response and expression of mitofusin-2 (Mfn-2; a member of the mitofusin family) in a dose- and time-dependent manner. Upregulation of Mfn-2 expression attenuated the suppressive effect of HMGB1 on T cell immune function. The phosphorylation of both extracellular signal-regulated kinase (ERK)1/2 and p38 mitogen-activated protein kinase (MAPK) was markedly upregulated by treating with high amount of HMGB1, while pretreatment with ERK1/2 and p38 MAPK-specific inhibitors (U0126 and SB203580) could attenuate suppression of T cell immune function and nuclear factor of activated T cell (NFAT) activation induced by HMGB1, respectively. HMGB1-induced activity of ERK1/2 and p38 was not fully inhibited in the presence of U0126 or SB203580. Interestingly, overexpression of Mfn-2 had no marked effect on HMGB1-mediated activation of MAPK, but could attenuate the suppressive effect of HMGB1 on the activity of NFAT. Thus, the mechanisms involved in HMGB1-induced T cell immune dysfunction in vitro at least partly include suppression of Mfn-2 expression, overactivation of ERK1/2, p38 MAPK, and intervention of NFAT activation, while the protective effect of Mfn-2 on T cell immune dysfunction induced by HMGB1 is dependent on other signaling pathway associated with NFAT, but not MAPK. Taken together, we conclude that overactivation of MAPK and suppression of Mfn-2 expression are two independent events in HMGB1-mediated T cell immune dysfunction. PMID:23697559

  7. Pathogen-Specific T Cell Polyfunctionality Is a Correlate of T Cell Efficacy and Immune Protection

    PubMed Central

    Boyd, Anders; Almeida, Jorge R.; Darrah, Patricia A.; Sauce, Delphine; Seder, Robert A.; Appay, Victor; Gorochov, Guy; Larsen, Martin

    2015-01-01

    Introduction Understanding the factors that delineate the efficacy of T cell responses towards pathogens is crucial for our ability to develop potent therapies against infectious diseases. Multidimensional evaluation of T cell functionality at the single-cell level enables exhaustive analysis of combinatorial functional properties, hence polyfunctionality. We have recently invented an algorithm that quantifies polyfunctionality, the Polyfunctionality Index (Larsen et al. PLoS One 2012). Here we demonstrate that quantitative assessment of T cell polyfunctionality correlates with T cell efficacy measured as the capacity to kill target cells in vitro and control infection in vivo. Methods We employed the polyfunctionality index on two datasets selected for their unique ability to evaluate the polyfunctional imprint on T cell efficacy. 1) HIV-specific CD8+ T cells and 2) Leishmania major-specific CD4+ T cells were analysed for their capacity to secrete multiple effector molecules, kill target cells and control infection. Briefly, employing the Polyfunctionality Index algorithm we determined the parameter estimates resulting in optimal correlation between T cell polyfunctionality and T cell efficacy. Results T cell polyfunctionality is correlated with T cell efficacy measured as 1) target killing (r=0.807, P<0.0001) and 2) lesion size upon challenge with Leishmania major (r=-0.50, P=0.004). Contrary to an approach relying on the Polyfunctionality Index algorithm, quantitative evaluation of T cell polyfunctionality traditionally ignores the gradual contribution of more or less polyfunctional T cells. Indeed, comparing both approaches we show that optimal description of T cell efficacy is obtained when gradually integrating all levels of polyfunctionality in accordance with the Polyfunctionality Index. Conclusions Our study presents a generalizable methodology to objectively evaluate the impact of polyfunctionality on T cell efficacy. We show that T cell polyfunctionality

  8. T cells in chronic lymphocytic leukemia display dysregulated expression of immune checkpoints and activation markers.

    PubMed

    Palma, Marzia; Gentilcore, Giusy; Heimersson, Kia; Mozaffari, Fariba; Näsman-Glaser, Barbro; Young, Emma; Rosenquist, Richard; Hansson, Lotta; Österborg, Anders; Mellstedt, Håkan

    2017-03-01

    Chronic lymphocytic leukemia is characterized by impaired immune functions largely due to profound T-cell defects. T-cell functions also depend on co-signaling receptors, inhibitory or stimulatory, known as immune checkpoints, including cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) and programmed death-1 (PD-1). Here we analyzed the T-cell phenotype focusing on immune checkpoints and activation markers in chronic lymphocytic leukemia patients (n=80) with different clinical characteristics and compared them to healthy controls. In general, patients had higher absolute numbers of CD3 + cells and the CD8 + subset was particularly expanded in previously treated patients. Progressive patients had higher numbers of CD4 + and CD8 + cells expressing PD-1 compared to healthy controls, which was more pronounced in previously treated patients ( P =0.0003 and P =0.001, respectively). A significant increase in antigen-experienced T cells was observed in patients within both the CD4 + and CD8 + subsets, with a significantly higher PD-1 expression. Higher numbers of CD4 + and CD8 + cells with intracellular CTLA-4 were observed in patients, as well as high numbers of proliferating (Ki67 + ) and activated (CD69 + ) CD4 + and CD8 + cells, more pronounced in patients with active disease. The numbers of Th1, Th2, Th17 and regulatory T cells were substantially increased in patients compared to controls ( P <0.05), albeit decreasing to low levels in pre-treated patients. In conclusion, chronic lymphocytic leukemia T cells display increased expression of immune checkpoints, abnormal subset distribution, and a higher proportion of proliferating cells compared to healthy T cells. Disease activity and previous treatment shape the T-cell profile of chronic lymphocytic leukemia patients in different ways. Copyright© Ferrata Storti Foundation.

  9. The Interaction between Regulatory T Cells and NKT Cells in the Liver: A CD1d Bridge Links Innate and Adaptive Immunity

    PubMed Central

    Webb, Tonya J.; Potter, James P.; Li, Zhiping

    2011-01-01

    Background/Aims Regulatory T cells (Tregs) and natural killer T (NKT) cells are two distinct lymphocyte subsets that independently regulate hepatic adaptive and innate immunity, respectively. In the current study, we examine the interaction between Tregs and NKT cells to understand the mechanisms of cross immune regulation by these cells. Methods The frequency and function of Tregs were evaluated in wild type and NKT cell deficient (CD1dko) mice. In vitro lymphocyte proliferation and apoptosis assays were performed with NKT cells co-cultured with Tregs. The ability of Tregs to inhibit NKT cells in vivo was examined by adoptive transfer of Tregs in a model of NKT cell mediated hepatitis. Results CD1dko mice have a significant reduction in hepatic Tregs. Although, the Tregs from CD1dko mice remain functional and can suppress conventional T cells, their ability to suppress activation induced NKT cell proliferation and to promote NKT cell apoptosis is greatly diminished. These effects are CD1d dependent and require cell to cell contact. Adoptive transfer of Tregs inhibits NKT cell-mediated liver injury. Conclusions NKT cells promote Tregs, and Tregs inhibit NKT cells in a CD1d dependent manner requiring cell to cell contact. These cross-talk immune regulations provide a linkage between innate and adaptive immunity. PMID:22073248

  10. Hypercholesterolemia induces T cell expansion in humanized immune mice.

    PubMed

    Proto, Jonathan D; Doran, Amanda C; Subramanian, Manikandan; Wang, Hui; Zhang, Mingyou; Sozen, Erdi; Rymond, Christina C; Kuriakose, George; D'Agati, Vivette; Winchester, Robert; Sykes, Megan; Yang, Yong-Guang; Tabas, Ira

    2018-06-01

    Emerging data suggest that hypercholesterolemia has stimulatory effects on adaptive immunity and that these effects can promote atherosclerosis and perhaps other inflammatory diseases. However, research in this area has relied primarily on inbred strains of mice whose adaptive immune system can differ substantially from that of humans. Moreover, the genetically induced hypercholesterolemia in these models typically results in plasma cholesterol levels that are much higher than those in most humans. To overcome these obstacles, we studied human immune system-reconstituted mice (hu-mice) rendered hypercholesterolemic by treatment with adeno-associated virus 8-proprotein convertase subtilisin/kexin type 9 (AAV8-PCSK9) and a high-fat/high-cholesterol Western-type diet (WD). These mice had a high percentage of human T cells and moderate hypercholesterolemia. Compared with hu-mice that had lower plasma cholesterol, the PCSK9-WD mice developed a T cell-mediated inflammatory response in the lung and liver. Human CD4+ and CD8+ T cells bearing an effector memory phenotype were significantly elevated in the blood, spleen, and lungs of PCSK9-WD hu-mice, whereas splenic and circulating regulatory T cells were reduced. These data show that moderately high plasma cholesterol can disrupt human T cell homeostasis in vivo. This process may not only exacerbate atherosclerosis, but also contribute to T cell-mediated inflammatory diseases in the hypercholesterolemia setting.

  11. Adoptively transferred immune T cells eradicate established tumors in spite of cancer-induced immune suppression

    PubMed Central

    Arina, Ainhoa; Schreiber, Karin; Binder, David C.; Karrison, Theodore; Liu, Rebecca B.; Schreiber, Hans

    2014-01-01

    Myeloid-derived CD11b+Gr1+ suppressor cells (MDSC) and tumor-associated macrophages (TAM) are considered a major obstacle for effective adoptive T cell therapy. Myeloid cells suppress naive T cell proliferation ex vivo and can prevent the generation of T cell responses in vivo. We find, however, that immune T cells adoptively transferred eradicate well-established tumors in the presence of MDSC and TAM which are strongly immunosuppressive ex vivo. These MDSC and TAM were comparable in levels and immunosuppression among different tumor models. Longitudinal microscopy of tumors in vivo revealed that after T cell transfer tumor vasculature and cancer cells disappeared simultaneously. During T-cell mediated tumor destruction, the tumor stroma contained abundant myeloid cells (mainly TAM) that retained their suppressive properties. Preimmunized but not naive mice resisted immune suppression caused by an unrelated tumor-burden supporting the idea that in vivo, myeloid immunosuppressive cells can suppress naive but not memory T cell responses. PMID:24367029

  12. Adoptive cell therapy for lymphoma with CD4 T cells depleted of CD137-expressing regulatory T cells.

    PubMed

    Goldstein, Matthew J; Kohrt, Holbrook E; Houot, Roch; Varghese, Bindu; Lin, Jack T; Swanson, Erica; Levy, Ronald

    2012-03-01

    Adoptive immunotherapy with antitumor T cells is a promising novel approach for the treatment of cancer. However, T-cell therapy may be limited by the cotransfer of regulatory T cells (T(reg)). Here, we explored this hypothesis by using 2 cell surface markers, CD44 and CD137, to isolate antitumor CD4 T cells while excluding T(regs). In a murine model of B-cell lymphoma, only CD137(neg)CD44(hi) CD4 T cells infiltrated tumor sites and provided protection. Conversely, the population of CD137(pos)CD44hi CD4 T cells consisted primarily of activated T(regs). Notably, this CD137(pos) T(reg) population persisted following adoptive transfer and maintained expression of FoxP3 as well as CD137. Moreover, in vitro these CD137(pos) cells suppressed the proliferation of effector cells in a contact-dependent manner, and in vivo adding the CD137(pos)CD44(hi) CD4 cells to CD137(neg)CD44(hi) CD4 cells suppressed the antitumor immune response. Thus, CD137 expression on CD4 T cells defined a population of activated T(regs) that greatly limited antitumor immune responses. Consistent with observations in the murine model, human lymphoma biopsies also contained a population of CD137(pos) CD4 T cells that were predominantly CD25(pos)FoxP3(pos) T(regs). In conclusion, our findings identify 2 surface markers that can be used to facilitate the enrichment of antitumor CD4 T cells while depleting an inhibitory T(reg) population.

  13. Memory T cells and vaccines.

    PubMed

    Esser, Mark T; Marchese, Rocio D; Kierstead, Lisa S; Tussey, Lynda G; Wang, Fubao; Chirmule, Narendra; Washabaugh, Michael W

    2003-01-17

    T lymphocytes play a central role in the generation of a protective immune response in many microbial infections. After immunization, dendritic cells take up microbial antigens and traffic to draining lymph nodes where they present processed antigens to naïve T cells. These naïve T cells are stimulated to proliferate and differentiate into effector and memory T cells. Activated, effector and memory T cells provide B cell help in the lymph nodes and traffic to sites of infection where they secrete anti-microbial cytokines and kill infected cells. At least two types of memory cells have been defined in humans based on their functional and migratory properties. T central-memory (T(CM)) cells are found predominantly in lymphoid organs and can not be immediately activated, whereas T effector-memory (T(EM)) cells are found predominantly in peripheral tissue and sites of inflammation and exhibit rapid effector function. Most currently licensed vaccines induce antibody responses capable of mediating long-term protection against lytic viruses such as influenza and small pox. In contrast, vaccines against chronic pathogens that require cell-mediated immune responses to control, such as malaria, Mycobacterium tuberculosis (TB), human immunodeficiency virus (HIV) and hepatitis C virus (HCV), are currently not available or are ineffective. Understanding the mechanisms by which long-lived cellular immune responses are generated following vaccination should facilitate the development of safe and effective vaccines against these emerging diseases. Here, we review the current literature with respect to memory T cells and their implications to vaccine development.

  14. Changes in Nutritional Status Impact Immune Cell Metabolism and Function.

    PubMed

    Alwarawrah, Yazan; Kiernan, Kaitlin; MacIver, Nancie J

    2018-01-01

    Immune cell function and metabolism are closely linked. Many studies have now clearly demonstrated that alterations in cellular metabolism influence immune cell function and that, conversely, immune cell function determines the cellular metabolic state. Less well understood, however, are the effects of systemic metabolism or whole organism nutritional status on immune cell function and metabolism. Several studies have demonstrated that undernutrition is associated with immunosuppression, which leads to both increased susceptibility to infection and protection against several types of autoimmune disease, whereas overnutrition is associated with low-grade, chronic inflammation that increases the risk of metabolic and cardiovascular disease, promotes autoreactivity, and disrupts protective immunity. Here, we review the effects of nutritional status on immunity and highlight the effects of nutrition on circulating cytokines and immune cell populations in both human studies and mouse models. As T cells are critical members of the immune system, which direct overall immune response, we will focus this review on the influence of systemic nutritional status on T cell metabolism and function. Several cytokines and hormones have been identified which mediate the effects of nutrition on T cell metabolism and function through the expression and action of key regulatory signaling proteins. Understanding how T cells are sensitive to both inadequate and overabundant nutrients may enhance our ability to target immune cell metabolism and alter immunity in both malnutrition and obesity.

  15. Tissue-Resident T Cells as the Central Paradigm of Chlamydia Immunity

    PubMed Central

    Johnson, Raymond M.

    2016-01-01

    For almost 2 decades, results from Chlamydia pathogenesis investigations have been conceptualized using a cytokine polarization narrative. Recent viral immunity studies identifying protective tissue-resident memory T cells (Trm) suggest an alternative paradigm based on localized immune networks. As Chlamydia vaccines enter the preclinical pipeline and, in the case of an attenuated trachoma vaccine, are given to human subjects, it may be useful to ask whether cytokine polarization is the appropriate framework for understanding and evaluating vaccine efficacy. In this review, we revisit C. trachomatis pathogenesis data from mice and humans using a Trm narrative and note a comfortable concordance with the Chlamydia pathogenesis literature. PMID:26787715

  16. Indoleamine 2,3-dioxygenase specific, cytotoxic T cells as immune regulators.

    PubMed

    Sørensen, Rikke Baek; Hadrup, Sine Reker; Svane, Inge Marie; Hjortsø, Mads Christian; Thor Straten, Per; Andersen, Mads Hald

    2011-02-17

    Indoleamine 2,3-dioxygenase (IDO) is an immunoregulatory enzyme that is implicated in suppressing T-cell immunity in normal and pathologic settings. Here, we describe that spontaneous cytotoxic T-cell reactivity against IDO exists not only in patients with cancer but also in healthy persons. We show that the presence of such IDO-specific CD8(+) T cells boosted T-cell immunity against viral or tumor-associated antigens by eliminating IDO(+) suppressive cells. This had profound effects on the balance between interleukin-17 (IL-17)-producing CD4(+) T cells and regulatory T cells. Furthermore, this caused an increase in the production of the proinflammatory cytokines IL-6 and tumor necrosis factor-α while decreasing the IL-10 production. Finally, the addition of IDO-inducing agents (ie, the TLR9 ligand cytosine-phosphate-guanosine, soluble cytotoxic T lymphocyte-associated antigen 4, or interferon γ) induced IDO-specific T cells among peripheral blood mononuclear cells from patients with cancer as well as healthy donors. In the clinical setting, IDO may serve as an important and widely applicable target for immunotherapeutic strategies in which IDO plays a significant regulatory role. We describe for the first time effector T cells with a general regulatory function that may play a vital role for the mounting or maintaining of an effective adaptive immune response. We suggest terming such effector T cells "supporter T cells."

  17. Follicular helper T cell in immunity and autoimmunity.

    PubMed

    Mesquita, D; Cruvinel, W M; Resende, L S; Mesquita, F V; Silva, N P; Câmara, N O S; Andrade, L E C

    2016-01-01

    The traditional concept that effector T helper (Th) responses are mediated by Th1/Th2 cell subtypes has been broadened by the recent demonstration of two new effector T helper cells, the IL-17 producing cells (Th17) and the follicular helper T cells (Tfh). These new subsets have many features in common, such as the ability to produce IL-21 and to express the IL-23 receptor (IL23R), the inducible co-stimulatory molecule ICOS, and the transcription factor c-Maf, all of them essential for expansion and establishment of the final pool of both subsets. Tfh cells differ from Th17 by their ability to home to B cell areas in secondary lymphoid tissue through interactions mediated by the chemokine receptor CXCR5 and its ligand CXCL13. These CXCR5+ CD4+ T cells are considered an effector T cell type specialized in B cell help, with a transcriptional profile distinct from Th1 and Th2 cells. The role of Tfh cells and its primary product, IL-21, on B-cell activation and differentiation is essential for humoral immunity against infectious agents. However, when deregulated, Tfh cells could represent an important mechanism contributing to exacerbated humoral response and autoantibody production in autoimmune diseases. This review highlights the importance of Tfh cells by focusing on their biology and differentiation processes in the context of normal immune response to infectious microorganisms and their role in the pathogenesis of autoimmune diseases.

  18. Preexisting CD4+ T-Cell Immunity in Human Population to Avian Influenza H7N9 Virus: Whole Proteome-Wide Immunoinformatics Analyses

    PubMed Central

    Duvvuri, Venkata R.; Duvvuri, Bhargavi; Alice, Christilda; Wu, Gillian E.; Gubbay, Jonathan B.; Wu, Jianhong

    2014-01-01

    In 2013, a novel avian influenza H7N9 virus was identified in human in China. The antigenically distinct H7N9 surface glycoproteins raised concerns about lack of cross-protective neutralizing antibodies. Epitope-specific preexisting T-cell immunity was one of the protective mechanisms in pandemic 2009 H1N1 even in the absence of cross-protective antibodies. Hence, the assessment of preexisting CD4+ T-cell immunity to conserved epitopes shared between H7N9 and human influenza A viruses (IAV) is critical. A comparative whole proteome-wide immunoinformatics analysis was performed to predict the CD4+ T-cell epitopes that are commonly conserved within the proteome of H7N9 in reference to IAV subtypes (H1N1, H2N2, and H3N2). The CD4+ T-cell epitopes that are commonly conserved (∼556) were further screened against the Immune Epitope Database (IEDB) to validate their immunogenic potential. This analysis revealed that 45.5% (253 of 556) epitopes are experimentally proven to induce CD4+ T-cell memory responses. In addition, we also found that 23.3% of CD4+ T-cell epitopes have ≥90% of sequence homology with experimentally defined CD8+ T-cell epitopes. We also conducted the population coverage analysis across different ethnicities using commonly conserved CD4+ T-cell epitopes and corresponding HLA-DRB1 alleles. Interestingly, the indigenous populations from Canada, United States, Mexico and Australia exhibited low coverage (28.65% to 45.62%) when compared with other ethnicities (57.77% to 94.84%). In summary, the present analysis demonstrate an evidence on the likely presence of preexisting T-cell immunity in human population and also shed light to understand the potential risk of H7N9 virus among indigenous populations, given their high susceptibility during previous pandemic influenza events. This information is crucial for public health policy, in targeting priority groups for immunization programs. PMID:24609014

  19. TNFα and IFNγ but not perforin are critical for CD8 T cell-mediated protection against pulmonary Yersinia pestis infection.

    PubMed

    Szaba, Frank M; Kummer, Lawrence W; Duso, Debra K; Koroleva, Ekaterina P; Tumanov, Alexei V; Cooper, Andrea M; Bliska, James B; Smiley, Stephen T; Lin, Jr-Shiuan

    2014-05-01

    Septic pneumonias resulting from bacterial infections of the lung are a leading cause of human death worldwide. Little is known about the capacity of CD8 T cell-mediated immunity to combat these infections and the types of effector functions that may be most effective. Pneumonic plague is an acutely lethal septic pneumonia caused by the Gram-negative bacterium Yersinia pestis. We recently identified a dominant and protective Y. pestis antigen, YopE69-77, recognized by CD8 T cells in C57BL/6 mice. Here, we use gene-deficient mice, Ab-mediated depletion, cell transfers, and bone marrow chimeric mice to investigate the effector functions of YopE69-77-specific CD8 T cells and their relative contributions during pulmonary Y. pestis infection. We demonstrate that YopE69-77-specific CD8 T cells exhibit perforin-dependent cytotoxicity in vivo; however, perforin is dispensable for YopE69-77-mediated protection. In contrast, YopE69-77-mediated protection is severely impaired when production of TNFα and IFNγ by CD8 T cells is simultaneously ablated. Interestingly, TNFα is absolutely required at the time of challenge infection and can be provided by either T cells or non-T cells, whereas IFNγ provided by T cells prior to challenge appears to facilitate the differentiation of optimally protective CD8 T cells. We conclude that cytokine production, not cytotoxicity, is essential for CD8 T cell-mediated control of pulmonary Y. pestis infection and we suggest that assays detecting Ag-specific TNFα production in addition to antibody titers may be useful correlates of vaccine efficacy against plague and other acutely lethal septic bacterial pneumonias.

  20. Merck Ad5/HIV induces broad innate immune activation that predicts CD8⁺ T-cell responses but is attenuated by preexisting Ad5 immunity.

    PubMed

    Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana

    2012-12-11

    To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.

  1. TolC plays a crucial role in immune protection conferred by Edwardsiella tarda whole-cell vaccines.

    PubMed

    Wang, Chao; Peng, Bo; Li, Hui; Peng, Xuan-Xian

    2016-07-12

    Although vaccines developed from live organisms have better efficacy than those developed from dead organisms, the mechanisms underlying this differential efficacy remain unexplored. In this study, we combined sub-immunoproteomics with immune challenge to investigate the action of the outer membrane proteome in the immune protection conferred by four Edwardsiella tarda whole-cell vaccines prepared via different treatments and to identify protective immunogens that play a key role in this immune protection. Thirteen spots representing five outer membrane proteins and one cytoplasmic protein were identified, and it was found that their abundance was altered in relation with the immune protective abilities of the four vaccines. Among these proteins, TolC and OmpA were found to be the key immunogens conferring the first and second highest degrees of protection, respectively. TolC was detected in the two effective vaccines (live and inactivated-30-F). The total antiserum and anti-OmpA titers were higher for the two effective vaccines than for the two ineffective vaccines (inactivated-80-F and inactivated-100). Further evidence demonstrated that the live and inactivated-30-F vaccines demonstrated stronger abilities to induce CD8+ and CD4+ T cell differentiation than the other two evaluated vaccines. Our results indicate that the outer membrane proteome changes dramatically following different treatments, which contributes to the effectiveness of whole-cell vaccines.

  2. Inactivated Influenza Vaccine That Provides Rapid, Innate-Immune-System-Mediated Protection and Subsequent Long-Term Adaptive Immunity.

    PubMed

    Chua, Brendon Y; Wong, Chinn Yi; Mifsud, Edin J; Edenborough, Kathryn M; Sekiya, Toshiki; Tan, Amabel C L; Mercuri, Francesca; Rockman, Steve; Chen, Weisan; Turner, Stephen J; Doherty, Peter C; Kelso, Anne; Brown, Lorena E; Jackson, David C

    2015-10-27

    The continual threat to global health posed by influenza has led to increased efforts to improve the effectiveness of influenza vaccines for use in epidemics and pandemics. We show in this study that formulation of a low dose of inactivated detergent-split influenza vaccine with a Toll-like receptor 2 (TLR2) agonist-based lipopeptide adjuvant (R4Pam2Cys) provides (i) immediate, antigen-independent immunity mediated by the innate immune system and (ii) significant enhancement of antigen-dependent immunity which exhibits an increased breadth of effector function. Intranasal administration of mice with vaccine formulated with R4Pam2Cys but not vaccine alone provides protection against both homologous and serologically distinct (heterologous) viral strains within a day of administration. Vaccination in the presence of R4Pam2Cys subsequently also induces high levels of systemic IgM, IgG1, and IgG2b antibodies and pulmonary IgA antibodies that inhibit hemagglutination (HA) and neuraminidase (NA) activities of homologous but not heterologous virus. Improved primary virus nucleoprotein (NP)-specific CD8(+) T cell responses are also induced by the use of R4Pam2Cys and are associated with robust recall responses to provide heterologous protection. These protective effects are demonstrated in wild-type and antibody-deficient animals but not in those depleted of CD8(+) T cells. Using a contact-dependent virus transmission model, we also found that heterologous virus transmission from vaccinated mice to naive mice is significantly reduced. These results demonstrate the potential of adding a TLR2 agonist to an existing seasonal influenza vaccine to improve its utility by inducing immediate short-term nonspecific antiviral protection and also antigen-specific responses to provide homologous and heterologous immunity. The innate and adaptive immune systems differ in mechanisms, specificities, and times at which they take effect. The innate immune system responds within hours of

  3. Genetic vaccines to potentiate the effective CD103+ dendritic cell-mediated cross-priming of antitumor immunity.

    PubMed

    Zhang, Yi; Chen, Guo; Liu, Zuqiang; Tian, Shenghe; Zhang, Jiying; Carey, Cara D; Murphy, Kenneth M; Storkus, Walter J; Falo, Louis D; You, Zhaoyang

    2015-06-15

    The development of effective cancer vaccines remains an urgent, but as yet unmet, clinical need. This deficiency is in part due to an incomplete understanding of how to best invoke dendritic cells (DC) that are crucial for the induction of tumor-specific CD8(+) T cells capable of mediating durable protective immunity. In this regard, elevated expression of the transcription factor X box-binding protein 1 (XBP1) in DC appears to play a decisive role in promoting the ability of DC to cross-present Ags to CD8(+) T cells in the therapeutic setting. Delivery of DNA vaccines encoding XBP1 and tumor Ag to skin DC resulted in increased IFN-α production by plasmacytoid DC (pDC) from skin/tumor draining lymph nodes and the cross-priming of Ag-specific CD8(+) T cell responses associated with therapeutic benefit. Antitumor protection was dependent on cross-presenting Batf3(+) DC, pDC, and CD8(+) T cells. CD103(+) DC from the skin/tumor draining lymph nodes of the immunized mice appeared responsible for activation of Ag-specific naive CD8(+) T cells, but were dependent on pDC for optimal effectiveness. Similarly, human XBP1 improved the capacity of human blood- and skin-derived DC to activate human T cells. These data support an important intrinsic role for XBP1 in DC for effective cross-priming and orchestration of Batf3(+) DC-pDC interactions, thereby enabling effective vaccine induction of protective antitumor immunity. Copyright © 2015 by The American Association of Immunologists, Inc.

  4. Augmenting Influenza-Specific T Cell Memory Generation with a Natural Killer T Cell-Dependent Glycolipid-Peptide Vaccine.

    PubMed

    Anderson, Regan J; Li, Jasmine; Kedzierski, Lukasz; Compton, Benjamin J; Hayman, Colin M; Osmond, Taryn L; Tang, Ching-Wen; Farrand, Kathryn J; Koay, Hui-Fern; Almeida, Catarina Filipa Dos Santos Sa E; Holz, Lauren R; Williams, Geoffrey M; Brimble, Margaret A; Wang, Zhongfang; Koutsakos, Marios; Kedzierska, Katherine; Godfrey, Dale I; Hermans, Ian F; Turner, Stephen J; Painter, Gavin F

    2017-11-17

    The development of a universal vaccine for influenza A virus (IAV) that does not require seasonal modification is a long-standing health goal, particularly in the context of the increasing threat of new global pandemics. Vaccines that specifically induce T cell responses are of considerable interest because they can target viral proteins that are more likely to be shared between different virus strains and subtypes and hence provide effective cross-reactive IAV immunity. From a practical perspective, such vaccines should induce T cell responses with long-lasting memory, while also being simple to manufacture and cost-effective. Here we describe the synthesis and evaluation of a vaccine platform based on solid phase peptide synthesis and bio-orthogonal conjugation methodologies. The chemical approach involves covalently attaching synthetic long peptides from a virus-associated protein to a powerful adjuvant molecule, α-galactosylceramide (α-GalCer). Strain-promoted azide-alkyne cycloaddition is used as a simple and efficient method for conjugation, and pseudoproline methodology is used to increase the efficiency of the peptide synthesis. α-GalCer is a glycolipid that stimulates NKT cells, a population of lymphoid-resident immune cells that can provide potent stimulatory signals to antigen-presenting cells engaged in driving proliferation and differentiation of peptide-specific T cells. When used in mice, the vaccine induced T cell responses that provided effective prophylactic protection against IAV infection, with the speed of viral clearance greater than that seen from previous viral exposure. These findings are significant because the vaccines are highly defined, quick to synthesize, and easily characterized and are therefore appropriate for large scale affordable manufacture.

  5. Critical roles of conventional dendritic cells in promoting T cell‐dependent hepatitis through regulating natural killer T cells

    PubMed Central

    Wang, J.; Cao, X.; Zhao, J.; Zhao, H.; Wei, J.; Li, Q.; Qi, X.; Yang, Z.; Wang, L.; Zhang, H.; Bai, L.; Wu, Z.; Zhao, L.; Hong, Z.

    2017-01-01

    Summary Dendritic cells (DCs) play critical roles in initiating and regulating innate immunity as well as adaptive immune responses. However, the role of conventional dendritic cells (cDCs) in concanavalin A (ConA)‐induced fulminant hepatitis is unknown. In this study, we demonstrated that depletion of cDCs using either CD11c‐diphtheria toxin receptor transgenic mice (DTR Tg) mice or anti‐CD11c antibody reduced the severity of liver injury significantly, indicating a detrimental role of cDCs in ConA‐induced hepatitis. We elucidated further the pathological role of cDCs as being the critical source of interleukin (IL)‐12, which induced the secretion of interferon (IFN)‐γ by natural killer (NK) T cells. Reconstitution of cDCs‐depleted mice with IL‐12 restored ConA‐induced hepatitis significantly. Furthermore, we determined that NK T cells were the target of DC‐derived IL‐12, and NK T cells contributed to liver inflammation and injury through production of IFN‐γ. In summary, our study demonstrated a novel function of cDCs in mediating ConA‐induced hepatitis through regulating IFN‐γ secretion of NK T cells in an IL‐12‐dependent fashion. Targeting cDCs might provide potentially therapeutic applications in treating autoimmune related liver diseases. PMID:27891589

  6. Interlesional diversity of T cell receptors in melanoma with immune checkpoints enriched in tissue-resident memory T cells

    PubMed Central

    Boddupalli, Chandra Sekhar; Bar, Noffar; Kadaveru, Krishna; Krauthammer, Michael; Pornputtapong, Natopol; Ariyan, Stephan; Narayan, Deepak; Kluger, Harriet; Deng, Yanhong; Verma, Rakesh; Das, Rituparna; Bacchiocchi, Antonella; Halaban, Ruth; Sznol, Mario; Dhodapkar, Madhav V.; Dhodapkar, Kavita M.

    2016-01-01

    Heterogeneity of tumor cells and their microenvironment can affect outcome in cancer. Blockade of immune checkpoints (ICPs) expressed only on a subset of immune cells leads to durable responses in advanced melanoma. Tissue-resident memory T (TRM) cells have recently emerged as a distinct subset of memory T cells in nonlymphoid tissues. Here, we show that functional properties and expression of ICPs within tumor-infiltrating lymphocytes (TILs) differ from those of blood T cells. TILs secrete less IL-2, IFN-γ, and TNF-α compared with circulating counterparts, and expression of VEGF correlated with reduced TIL infiltration. Within tumors, ICPs are particularly enriched within T cells with phenotype and genomic features of TRM cells and the CD16+ subset of myeloid cells. Concurrent T cell receptor (TCR) and tumor exome sequencing of individual metastases in the same patient revealed that interlesional diversity of TCRs exceeded differences in mutation/neoantigen load in tumor cells. These findings suggest that the TRM subset of TILs may be the major target of ICP blockade and illustrate interlesional diversity of tissue-resident TCRs within individual metastases, which did not equilibrate between metastases and may differentially affect the outcome of immune therapy at each site. PMID:28018970

  7. B and T lymphocyte attenuator restricts the protective immune response against experimental malaria.

    PubMed

    Adler, Guido; Steeg, Christiane; Pfeffer, Klaus; Murphy, Theresa L; Murphy, Kenneth M; Langhorne, Jean; Jacobs, Thomas

    2011-11-15

    The immune response against the blood stage of malaria has to be tightly regulated to allow for vigorous antiplasmodial activity while restraining potentially lethal immunopathologic damage to the host like cerebral malaria. Coinhibitory cell surface receptors are important modulators of immune activation. B and T lymphocyte attenuator (BTLA) (CD272) is a coinhibitory receptor expressed by most leukocytes, with the highest expression levels on T and B cells, and is involved in the maintenance of peripheral tolerance by dampening the activation of lymphocytes. The function of BTLA is described in several models of inflammatory disorders and autoimmunity, but its function in infectious diseases is less well characterized. Also, little is known about the influence of BTLA on non-T cells. In this study, we analyzed the function of BTLA during blood-stage malaria infection with the nonlethal Plasmodium yoelii strain 17NL. We show that BTLA knockout mice exhibit strongly reduced parasitemia and clear the infection earlier compared with wild-type mice. This increased resistance was seen before the onset of adaptive immune mechanisms and even in the absence of T and B cells but was more pronounced at later time points when activation of T and B cells was observed. We demonstrate that BTLA regulates production of proinflammatory cytokines in a T cell-intrinsic way and B cell intrinsically regulates the production of P. yoelii 17NL-specific Abs. These results indicate that the coinhibitory receptor BTLA plays a critical role during experimental malaria and attenuates the innate as well as the subsequent adaptive immune response.

  8. Potentiation by a novel alkaloid glycoside adjuvant of a protective cytotoxic T cell immune response specific for a preerythrocytic malaria vaccine candidate antigen.

    PubMed

    Heal, K G; Sheikh, N A; Hollingdale, M R; Morrow, W J; Taylor-Robinson, A W

    2001-07-20

    We have recently demonstrated that the novel glycoalkaloid tomatine, derived from leaves of the wild tomato Lycopersicon pimpinellifolium, can act as a powerful adjuvant for the elicitation of antigen-specific CD8+ T cell responses. Here, we have extended our previous investigation with the model antigen ovalbumin to an established malaria infection system in mice and evaluated the cellular immune response to a major preerythrocytic stage malaria vaccine candidate antigen when administered with tomatine. The defined MHC H-2kd class I-binding 9-mer peptide (amino acids 252-260) from Plasmodium berghei circumsporozoite (CS) protein was prepared with tomatine to form a molecular aggregate formulation and this used to immunise BALB/c (H-2kd) mice. Antigen-specific IFN-gamma secretion and cytotoxic T lymphocyte activity in vitro were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunised control mice. Moreover, when challenged with P. berghei sporozoites, mice immunised with the CS 9-mer-tomatine preparation had a significantly delayed onset of erythrocytic infection compared to controls. The data presented validate the use of tomatine to potentiate a cellular immune response to antigenic stimulus by testing in an important biologically relevant system. Specifically, the processing of the P. berghei CS 9-mer as an exogenous antigen and its presentation via MHC class I molecules to CD8+ T cells led to an immune response that is an in vitro correlate of protection against preerythrocytic malaria. This was confirmed by the protective capacity of the 9-mer-tomatine combination upon in vivo immunisation. These findings merit further work to optimise the use of tomatine as an adjuvant in malaria vaccine development.

  9. Protective mucosal Th2 immune response against Toxoplasma gondii by murine mesenteric lymph node dendritic cells.

    PubMed

    Dimier-Poisson, Isabelle; Aline, Fleur; Mévélec, Marie-Noëlle; Beauvillain, Céline; Buzoni-Gatel, Dominique; Bout, Daniel

    2003-09-01

    Toxoplasma gondii, an obligate intracellular parasite pathogen which initially invades the intestinal epithelium before disseminating throughout the body, may cause severe sequelae in fetuses and life-threatening neuropathy in immunocompromised patients. Immune protection is usually thought to be performed through a systemic Th1 response; considering the route of parasite entry it is important to study and characterize the local mucosal immune response to T. gondii. Despite considerable effort, Toxoplasma-targeted vaccines have proven to be elusive using conventional strategies. We report the use of mesenteric lymph node dendritic cells (MLNDCs) pulsed ex vivo with T. gondii antigens (TAg) as a novel investigation approach to vaccination against T. gondii-driven pathogenic processes. Using a murine model, we demonstrate in two genetically distinct mouse strains (C57BL/6 and CBA/J) that adoptively transferred TAg-pulsed MLNDCs elicit a mucosal Toxoplasma-specific Th2-biased immune response in vivo and confer strong protection against infection. We also observe that MLNDCs mostly traffic to the intestine where they enhance resistance by reduction in the mortality and in the number of brain cysts. Thus, ex vivo TAg-pulsed MLNDCs represent a powerful tool for the study of protective immunity to T. gondii, delivered through its natural route of entry. These findings might impact the design of vaccine strategies against other invasive microorganisms known to be delivered through digestive tract.

  10. B cell and T cell immunity in the female genital tract: potential of distinct mucosal routes of vaccination and role of tissue-associated dendritic cells and natural killer cells.

    PubMed

    Anjuère, F; Bekri, S; Bihl, F; Braud, V M; Cuburu, N; Czerkinsky, C; Hervouet, C; Luci, C

    2012-10-01

    The female genital mucosa constitutes the major port of entry of sexually transmitted infections. Most genital microbial pathogens represent an enormous challenge for developing vaccines that can induce genital immunity that will prevent their transmission. It is now established that long-lasting protective immunity at mucosal surfaces has to involve local B-cell and T-cell effectors as well as local memory cells. Mucosal immunization constitutes an attractive way to generate systemic and genital B-cell and T-cell immune responses that can control early infection by sexually transmitted pathogens. Nevertheless, no mucosal vaccines against sexually transmitted infections are approved for human use. The mucosa-associated immune system is highly compartmentalized and the selection of any particular route or combinations of routes of immunization is critical when defining vaccine strategies against genital infections. Furthermore, mucosal surfaces are complex immunocompetent tissues that comprise antigen-presenting cells and also innate immune effectors and non-immune cells that can act as 'natural adjuvants' or negative immune modulators. The functions of these cells have to be taken into account when designing tissue-specific antigen-delivery systems and adjuvants. Here, we will discuss data that compare different mucosal routes of immunization to generate B-cell and T-cell responses in the genital tract, with a special emphasis on the newly described sublingual route of immunization. We will also summarize data on the understanding of the effector and induction mechanisms of genital immunity that may influence the development of vaccine strategies against genital infections. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  11. Dendritic Cell Immune Responses in HIV-1 Controllers.

    PubMed

    Martin-Gayo, Enrique; Yu, Xu G

    2017-02-01

    Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.

  12. Cutting Edge: Protection by Antiviral Memory CD8 T Cells Requires Rapidly Produced Antigen in Large Amounts.

    PubMed

    Remakus, Sanda; Ma, Xueying; Tang, Lingjuan; Xu, Ren-Huan; Knudson, Cory; Melo-Silva, Carolina R; Rubio, Daniel; Kuo, Yin-Ming; Andrews, Andrew; Sigal, Luis J

    2018-05-15

    Numerous attempts to produce antiviral vaccines by harnessing memory CD8 T cells have failed. A barrier to progress is that we do not know what makes an Ag a viable target of protective CD8 T cell memory. We found that in mice susceptible to lethal mousepox (the mouse homolog of human smallpox), a dendritic cell vaccine that induced memory CD8 T cells fully protected mice when the infecting virus produced Ag in large quantities and with rapid kinetics. Protection did not occur when the Ag was produced in low amounts, even with rapid kinetics, and protection was only partial when the Ag was produced in large quantities but with slow kinetics. Hence, the amount and timing of Ag expression appear to be key determinants of memory CD8 T cell antiviral protective immunity. These findings may have important implications for vaccine design. Copyright © 2018 by The American Association of Immunologists, Inc.

  13. Novel HIV IL-4R antagonist vaccine strategy can induce both high avidity CD8 T and B cell immunity with greater protective efficacy.

    PubMed

    Jackson, Ronald J; Worley, Matthew; Trivedi, Shubhanshi; Ranasinghe, Charani

    2014-09-29

    We have established that the efficacy of a heterologous poxvirus vectored HIV vaccine, fowlpox virus (FPV)-HIV gag/pol prime followed by attenuated vaccinia virus (VV)-HIV gag/pol booster immunisation, is strongly influenced by the cytokine milieu at the priming vaccination site, with endogenous IL-13 detrimental to the quality of the HIV specific CD8+ T cell response induced. We have now developed a novel HIV vaccine that co-expresses a C-terminal deletion mutant of the mouse IL-4, deleted for the essential tyrosine (Y119) required for signalling. In our vaccine system, the mutant IL-4C118 can bind to IL-4 type I and II receptors with high affinity, and transiently prevent the signalling of both IL-4 and IL-13 at the vaccination site. When this IL-4C118 adjuvanted vaccine was used in an intranasal rFPV/intramuscular rVV prime-boost immunisation strategy, greatly enhanced mucosal/systemic HIV specific CD8+ T cells with higher functional avidity, expressing IFN-γ, TNF-α and IL-2 and greater protective efficacy were detected. Surprisingly, the IL-4C118 adjuvanted vaccines also induced robust long-lived HIV gag-specific serum antibody responses, specifically IgG1 and IgG2a. The p55-gag IgG2a responses induced were of a higher magnitude relative to the IL-13Rα2 adjuvant vaccine. More interestingly, our recently tested IL-13Rα2 adjuvanted vaccine which only inhibited IL-13 activity, even though induced excellent high avidity HIV-specific CD8+ T cells, had a detrimental impact on the induction of gag-specific IgG2a antibody immunity. Our observations suggest that (i) IL-4 cell-signalling in the absence of IL-13 retarded gag-specific antibody isotype class switching, or (ii) IL-13Rα2 signalling was involved in inducing good gag-specific B cell immunity. Thus, we believe our novel IL-4R antagonist adjuvant strategy offers great promise not only for HIV-1 vaccines, but also against a range of chronic infections where sustained high quality mucosal and systemic T and B

  14. Induction of Unconventional T Cells by a Mutant Mycobacterium bovis BCG Strain Formulated in Cationic Liposomes Correlates with Protection against Mycobacterium tuberculosis Infections of Immunocompromised Mice

    PubMed Central

    Yabe, Idalia; Morris, Sheldon; Cowley, Siobhan

    2016-01-01

    Earlier studies aimed at defining protective immunity induced by Mycobacterium bovis BCG immunization have largely focused on the induction of antituberculosis CD4+ and CD8+ T cell responses. Here we describe a vaccine consisting of a BCGΔmmaA4 deletion mutant formulated in dimethyl dioctadecyl-ammonium bromide (DDA) with d-(+)-trehalose 6,6′-dibehenate (TDB) (DDA/TDB) adjuvant (A4/Adj) that protected TCRδ−/− mice depleted of CD4+, CD8+, and NK1.1+ T cells against an aerosol challenge with M. tuberculosis. These mice were significantly protected relative to mice immunized with a nonadjuvanted BCGΔmmaA4 (BCG-A4) mutant and nonvaccinated controls at 2 months and 9 months postvaccination. In the absence of all T cells following treatment with anti-Thy1.2 antibody, the immunized mice lost the ability to control the infection. These results indicate that an unconventional T cell population was mediating protection in the absence of CD4+, CD8+, NK1.1+, and TCRγδ T cells and could exhibit memory. Focusing on CD4− CD8− double-negative (DN) T cells, we found that these cells accumulated in the lungs postchallenge significantly more in A4/Adj-immunized mice and induced significantly greater frequencies of pulmonary gamma interferon (IFN-γ)-producing cells than were seen in the nonvaccinated or nonadjuvanted BCG control groups. Moreover, pulmonary DN T cells from the A4/Adj group exhibited significantly higher IFN-γ integrated median fluorescence intensity (iMFI) values than were seen in the control groups. We also showed that enriched DN T cells from mice immunized with A4/Adj could control mycobacterial growth in vitro significantly better than naive whole-spleen cells. These results suggest that formulating BCG in DDA/TDB adjuvant confers superior protection in immunocompromised mice and likely involves the induction of long-lived memory DN T cells. PMID:27226281

  15. Cellular and Humoral Immunity Protect against Vaginal Zika Virus Infection in Mice.

    PubMed

    Scott, Jason M; Lebratti, Tania J; Richner, Justin M; Jiang, Xiaoping; Fernandez, Estefania; Zhao, Haiyan; Fremont, Daved H; Diamond, Michael S; Shin, Haina

    2018-01-17

    Zika virus (ZIKV), which can cause devastating disease in fetuses of infected pregnant women, can be transmitted by mosquito inoculation and sexual routes. Little is known about immune protection against sexually transmitted ZIKV. In this study, we show that previous infection through intravaginal or subcutaneous routes with a contemporary Brazilian strain of ZIKV can protect against subsequent intravaginal challenge with a homologous strain. Both routes of inoculation induced high titers of ZIKV-specific and neutralizing antibody in serum and the vaginal lumen. Virus-specific T cells were recruited to and retained in the female reproductive tract after intravaginal and subcutaneous ZIKV infection. Studies in mice with genetic or acquired deficiencies in B and/or T cells demonstrated that both lymphocyte populations redundantly protect against intravaginal challenge in ZIKV-immune animals. Passive transfer of ZIKV immune IgG or T cells significantly limited intravaginal infection of naïve mice, although antibody more effectively prevented dissemination throughout the reproductive tract. Collectively, our experiments begin to establish the immune correlates of protection against intravaginal ZIKV infection, which should inform vaccination strategies in non-pregnant and pregnant women. IMPORTANCE The recent ZIKV epidemic resulted in devastating outcomes in fetuses and may affect reproductive health. Unlike other flaviviruses, ZIKV can be spread by sexual contact as well as a mosquito vector. While previous studies have identified correlates of protection for mosquito-mediated infection, few have focused on immunity against sexual transmission. As exposure to ZIKV via mosquito bite has likely occurred to many living in endemic areas, our study addresses whether this route of infection can protect against subsequent sexual exposure. We demonstrate that subcutaneous ZIKV infection can protect against subsequent vaginal infection by generating both local antiviral T

  16. Effect of Vaginal Immunization with HIVgp140 and HSP70 on HIV-1 Replication and Innate and T Cell Adaptive Immunity in Women

    PubMed Central

    Lewis, David J. M.; Wang, Yufei; Huo, Zhiming; Giemza, Raphaela; Babaahmady, Kaboutar; Rahman, Durdana; Shattock, Robin J.; Singh, Mahavir

    2014-01-01

    HIV-1 replication in postimmunization CD4+ T cells compared with that in preimmunization peripheral blood mononuclear cells. There were no significant adverse events. The vaccine induced the significant upregulation of CC chemokines and the downmodulation of CCR5 expression in CD4+ T cells, as well as an inverse correlation between them. Furthermore, the level of CCR5 expression was directly correlated with the viral load, consistent with the protective mechanism in which a decrease in CCR5 molecules on CD4+ T cells decreases HIV-1 envelope binding. Expression of the antiviral restriction factor APOBEC3G was inversely correlated with the viral load, suggesting that it may inhibit intracellular HIV-1 replication. Both CD4+ and CD8+ T cells showed HIVgp140- and HSP70-specific proliferation. A strong inverse correlation between the proportion of CC chemokine-modulated CCR5-expressing CD4+ T cells and the stimulation of CD4+ or CD8+ T cell proliferation by HIVgp140 was found, demonstrating a significant interaction between innate and adaptive immunity. This is the first clinical trial of vaginal immunization in women using only HIVgp140 and HSP70 administered by the mucosal route (3 times) in which a dual innate protective mechanism was induced and enhanced by significant adaptive CD4+ and CD8+ T cell proliferative responses. PMID:25008917

  17. Effect of vaginal immunization with HIVgp140 and HSP70 on HIV-1 replication and innate and T cell adaptive immunity in women.

    PubMed

    Lewis, David J M; Wang, Yufei; Huo, Zhiming; Giemza, Raphaela; Babaahmady, Kaboutar; Rahman, Durdana; Shattock, Robin J; Singh, Mahavir; Lehner, Thomas

    2014-10-01

    of HIV-1 replication in postimmunization CD4(+) T cells compared with that in preimmunization peripheral blood mononuclear cells. There were no significant adverse events. The vaccine induced the significant upregulation of CC chemokines and the downmodulation of CCR5 expression in CD4(+) T cells, as well as an inverse correlation between them. Furthermore, the level of CCR5 expression was directly correlated with the viral load, consistent with the protective mechanism in which a decrease in CCR5 molecules on CD4(+) T cells decreases HIV-1 envelope binding. Expression of the antiviral restriction factor APOBEC3G was inversely correlated with the viral load, suggesting that it may inhibit intracellular HIV-1 replication. Both CD4(+) and CD8(+) T cells showed HIVgp140- and HSP70-specific proliferation. A strong inverse correlation between the proportion of CC chemokine-modulated CCR5-expressing CD4(+) T cells and the stimulation of CD4(+) or CD8(+) T cell proliferation by HIVgp140 was found, demonstrating a significant interaction between innate and adaptive immunity. This is the first clinical trial of vaginal immunization in women using only HIVgp140 and HSP70 administered by the mucosal route (3 times) in which a dual innate protective mechanism was induced and enhanced by significant adaptive CD4(+) and CD8(+) T cell proliferative responses. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Tissue-Resident T Cells as the Central Paradigm of Chlamydia Immunity.

    PubMed

    Johnson, Raymond M; Brunham, Robert C

    2016-04-01

    For almost 2 decades, results from Chlamydia pathogenesis investigations have been conceptualized using a cytokine polarization narrative. Recent viral immunity studies identifying protective tissue-resident memory T cells (Trm) suggest an alternative paradigm based on localized immune networks. As Chlamydia vaccines enter the preclinical pipeline and, in the case of an attenuated trachoma vaccine, are given to human subjects, it may be useful to ask whether cytokine polarization is the appropriate framework for understanding and evaluating vaccine efficacy. In this review, we revisit C. trachomatis pathogenesis data from mice and humans using a Trm narrative and note a comfortable concordance with the Chlamydia pathogenesis literature. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Tumor-specific CD4+ T cells develop cytotoxic activity and eliminate virus-induced tumor cells in the absence of regulatory T cells.

    PubMed

    Akhmetzyanova, Ilseyar; Zelinskyy, Gennadiy; Schimmer, Simone; Brandau, Sven; Altenhoff, Petra; Sparwasser, Tim; Dittmer, Ulf

    2013-02-01

    The important role of tumor-specific cytotoxic CD8(+) T cells is well defined in the immune control of the tumors, but the role of effector CD4(+) T cells is poorly understood. In the current research, we have used a murine retrovirus-induced tumor cell line of C57BL/6 mouse origin, namely FBL-3 cells, as a model to study basic mechanisms of immunological control and escape during tumor formation. This study shows that tumor-specific CD4(+) T cells are able to protect against virus-induced tumor cells. We show here that there is an expansion of tumor-specific CD4(+) T cells producing cytokines and cytotoxic molecule granzyme B (GzmB) in the early phase of tumor growth. Importantly, we demonstrate that in vivo depletion of regulatory T cells (Tregs) and CD8(+) T cells in FBL-3-bearing DEREG transgenic mice augments IL-2 and GzmB production by CD4(+) T cells and increases FV-specific CD4(+) T-cell effector and cytotoxic responses leading to the complete tumor regression. Therefore, the capacity to reject tumor acquired by tumor-reactive CD4(+) T cells largely depends on the direct suppressive activity of Tregs. We suggest that a cytotoxic CD4(+) T-cell immune response may be induced to enhance resistance against oncovirus-associated tumors.

  20. Thiol dependent NF-κB suppression and inhibition of T-cell mediated adaptive immune responses by a naturally occurring steroidal lactone Withaferin A

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gambhir, Lokesh; Checker, Rahul; Sharma, Deepak

    Withaferin A (WA), a steroidal lactone isolated from ayurvedic medicinal plant Withania somnifera, was shown to inhibit tumor growth by inducing oxidative stress and suppressing NF-κB pathway. However, its effect on T-cell mediated adaptive immune responses and the underlying mechanism has not been investigated. Since both T-cell responses and NF-κB pathway are known to be redox sensitive, the present study was undertaken to elucidate the effect of WA on adaptive immune responses in vitro and in vivo. WA inhibited mitogen induced T-cell and B-cell proliferation in vitro without inducing any cell death. It inhibited upregulation of T-cell (CD25, CD69, CD71more » and CD54) and B-cell (CD80, CD86 and MHC-II) activation markers and secretion of Th1 and Th2 cytokines. WA induced oxidative stress by increasing the basal ROS levels and the immunosuppressive effects of WA were abrogated only by thiol anti-oxidants. The redox modulatory effects of WA in T-cells were attributed to its ability to directly interact with free thiols. WA inhibited NF-κB nuclear translocation in lymphocytes and prevented the direct binding of nuclear NF-κB to its consensus sequence. MALDI-TOF analysis using a synthetic NF-κB-p50 peptide containing Cys-62 residue suggested that WA can modify the cysteine residue of NF-κB. The pharmacokinetic studies for WA were also carried out and in vivo efficacy of WA was studied using mouse model of Graft-versus-host disease. In conclusion, WA is a potent inhibitor of T-cell responses and acts via a novel thiol dependent mechanism and inhibition of NF-κB pathway. - Highlights:: • Withaferin A (WA) inhibited T-cell and B-cell mediated immune responses. • WA increased basal ROS levels in lymphocytes. • WA directly interacted with GSH as studied using spectrophotometry and HPLC. • WA inhibited NF-κB nuclear translocation and binding of nuclear NF-κB to DNA. • WA inhibited induction of the graft-versus-host disease in mice.« less

  1. Single-Cell RNA Sequencing Reveals T Helper Cells Synthesizing Steroids De Novo to Contribute to Immune Homeostasis

    PubMed Central

    Mahata, Bidesh; Zhang, Xiuwei; Kolodziejczyk, Aleksandra A.; Proserpio, Valentina; Haim-Vilmovsky, Liora; Taylor, Angela E.; Hebenstreit, Daniel; Dingler, Felix A.; Moignard, Victoria; Göttgens, Berthold; Arlt, Wiebke; McKenzie, Andrew N.J.; Teichmann, Sarah A.

    2014-01-01

    Summary T helper 2 (Th2) cells regulate helminth infections, allergic disorders, tumor immunity, and pregnancy by secreting various cytokines. It is likely that there are undiscovered Th2 signaling molecules. Although steroids are known to be immunoregulators, de novo steroid production from immune cells has not been previously characterized. Here, we demonstrate production of the steroid pregnenolone by Th2 cells in vitro and in vivo in a helminth infection model. Single-cell RNA sequencing and quantitative PCR analysis suggest that pregnenolone synthesis in Th2 cells is related to immunosuppression. In support of this, we show that pregnenolone inhibits Th cell proliferation and B cell immunoglobulin class switching. We also show that steroidogenic Th2 cells inhibit Th cell proliferation in a Cyp11a1 enzyme-dependent manner. We propose pregnenolone as a “lymphosteroid,” a steroid produced by lymphocytes. We speculate that this de novo steroid production may be an intrinsic phenomenon of Th2-mediated immune responses to actively restore immune homeostasis. PMID:24813893

  2. Liver-primed memory T cells generated under noninflammatory conditions provide anti-infectious immunity.

    PubMed

    Böttcher, Jan P; Schanz, Oliver; Wohlleber, Dirk; Abdullah, Zeinab; Debey-Pascher, Svenja; Staratschek-Jox, Andrea; Höchst, Bastian; Hegenbarth, Silke; Grell, Jessica; Limmer, Andreas; Atreya, Imke; Neurath, Markus F; Busch, Dirk H; Schmitt, Edgar; van Endert, Peter; Kolanus, Waldemar; Kurts, Christian; Schultze, Joachim L; Diehl, Linda; Knolle, Percy A

    2013-03-28

    Development of CD8(+) T cell (CTL) immunity or tolerance is linked to the conditions during T cell priming. Dendritic cells (DCs) matured during inflammation generate effector/memory T cells, whereas immature DCs cause T cell deletion/anergy. We identify a third outcome of T cell priming in absence of inflammation enabled by cross-presenting liver sinusoidal endothelial cells. Such priming generated memory T cells that were spared from deletion by immature DCs. Similar to central memory T cells, liver-primed T cells differentiated into effector CTLs upon antigen re-encounter on matured DCs even after prolonged absence of antigen. Their reactivation required combinatorial signaling through the TCR, CD28, and IL-12R and controlled bacterial and viral infections. Gene expression profiling identified liver-primed T cells as a distinct Neuropilin-1(+) memory population. Generation of liver-primed memory T cells may prevent pathogens that avoid DC maturation by innate immune escape from also escaping adaptive immunity through attrition of the T cell repertoire. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  3. A novel vaccination strategy mediating the induction of lung-resident memory CD8 T cells confers heterosubtypic immunity against future pandemic influenza virus

    PubMed Central

    Lee, Yu-Na; Lee, Young-Tae; Kim, Min-Chul; Gewirtz, Andrew T.; Kang, Sang-Moo

    2016-01-01

    The currently used vaccine strategy to combat influenza A virus (IAV) aims to provide highly specific immunity to circulating seasonal IAV strains. However, the outbreak of 2009 influenza pandemic highlights the danger in this strategy. Here, we tested the hypothesis that universal vaccination that offers broader but weaker protection would result in cross protective T-cell responses after primary IAV infection, which would subsequently provide protective immunity against future pandemic strains. Specifically, we used tandem repeat M2e epitopes on virus-like particles (M2e5x VLP) that induced heterosubtypic immunity by eliciting antibodies to a conserved M2e epitope. M2e5x VLP was found to be superior to strain-specific current split vaccine in conferring heterosubtypic cross protection and in equipping the host with cross-protective lung-resident nucleoprotein-specific memory CD8+ T cell responses to a subsequent secondary infection with a new pandemic potential strain. Immune correlates for subsequent heterosubtypic immunity by M2e5x VLP vaccination were found to be virus-specific CD8+ T cells secreting IFN-γ and expressing lung-resident memory phenotypic markers CD69+ and CD103+ as well as M2e antibodies. Hence, vaccination with M2e5x VLP may be developable as a new strategy to combat future pandemic outbreaks. PMID:26864033

  4. Induction of Broad-Spectrum Protective Immunity against Disparate Cryptococcus Serotypes

    PubMed Central

    Van Dyke, Marley C. Caballero; Chaturvedi, Ashok K.; Hardison, Sarah E.; Leopold Wager, Chrissy M.; Castro-Lopez, Natalia; Hole, Camaron R.; Wozniak, Karen L.; Wormley, Floyd L.

    2017-01-01

    Cryptococcosis is a fungal disease caused by multiple Cryptococcus serotypes; particularly C. neoformans (serotypes A and D) and C. gattii (serotypes B and C). To date, there is no clinically available vaccine to prevent cryptococcosis. Mice given an experimental pulmonary vaccination with a C. neoformans serotype A strain engineered to produce interferon-γ, denoted H99γ, are protected against a subsequent otherwise lethal experimental infection with C. neoformans serotype A. Thus, we determined the efficacy of immunization with C. neoformans strain H99γ to elicit broad-spectrum protection in BALB/c mice against multiple disparate Cryptococcus serotypes. We observed significantly increased survival rates and significantly decreased pulmonary fungal burden in H99γ immunized mice challenged with Cryptococcus serotypes A, B, or D compared to heat-killed H99γ (HKH99γ) immunized mice. Results indicated that prolonged protection against Cryptococcus serotypes B or D in H99γ immunized mice was CD4+ T cell dependent and associated with the induction of predominantly Th1-type cytokine responses. Interestingly, immunization with H99γ did not elicit greater protection against challenge with the Cryptococcus serotype C tested either due to low overall virulence of this strain or enhanced capacity of this strain to evade host immunity. Altogether, these studies provide “proof-of-concept” for the development of a cryptococcal vaccine that provides cross-protection against multiple disparate serotypes of Cryptococcus. PMID:29163469

  5. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  6. In Vitro and In Vivo Studies for Assessing the Immune Response and Protection-Inducing Ability Conferred by Fasciola hepatica-Derived Synthetic Peptides Containing B- and T-Cell Epitopes

    PubMed Central

    Rojas-Caraballo, Jose; López-Abán, Julio; Pérez del Villar, Luis; Vizcaíno, Carolina; Vicente, Belén; Fernández-Soto, Pedro; del Olmo, Esther; Patarroyo, Manuel Alfonso; Muro, Antonio

    2014-01-01

    Fasciolosis is considered the most widespread trematode disease affecting grazing animals around the world; it is currently recognised by the World Health Organisation as an emergent human pathogen. Triclabendazole is still the most effective drug against this disease; however, resistant strains have appeared and developing an effective vaccine against this disease has increasingly become a priority. Several bioinformatics tools were here used for predicting B- and T-cell epitopes according to the available data for Fasciola hepatica protein amino acid sequences. BALB/c mice were immunised with the synthetic peptides by using the ADAD vaccination system and several immune response parameters were measured (antibody titres, cytokine levels, T-cell populations) to evaluate their ability to elicit an immune response. Based on the immunogenicity results so obtained, seven peptides were selected to assess their protection-inducing ability against experimental infection with F. hepatica metacercariae. Twenty-four B- or T-epitope-containing peptides were predicted and chemically synthesised. Immunisation of mice with peptides so-called B1, B2, B5, B6, T14, T15 and T16 induced high levels of total IgG, IgG1 and IgG2a (p<0.05) and a mixed Th1/Th2/Th17/Treg immune response, according to IFN-γ, IL-4, IL-17 and IL-10 levels, accompanied by increased CD62L+ T-cell populations. A high level of protection was obtained in mice vaccinated with peptides B2, B5, B6 and T15 formulated in the ADAD vaccination system with the AA0029 immunomodulator. The bioinformatics approach used in the present study led to the identification of seven peptides as vaccine candidates against the infection caused by Fasciola hepatica (a liver-fluke trematode). However, vaccine efficacy must be evaluated in other host species, including those having veterinary importance. PMID:25122166

  7. T-cell-mediated immune response to respiratory coronaviruses

    PubMed Central

    Channappanavar, Rudragouda; Zhao, Jincun; Perlman, Stanley

    2014-01-01

    Emerging respiratory coronaviruses such as the Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) and Middle East Respiratory Syndrome coronavirus (MERS-CoV) pose potential biological threats to humans. SARS and MERS are manifested as severe atypical pneumonia associated with high morbidity and mortality in humans. The majority of studies carried out in SARS-CoV-infected humans and animals attribute a dysregulated/exuberant innate response as a leading contributor to SARS-CoV-mediated pathology. A decade after the 2002–2003 SARS epidemic, we do not have any approved preventive or therapeutic agents available in case of re-emergence of SARS-CoV or other related viruses. A strong neutralizing antibody response generated against the spike (S) glycoprotein of SARS-CoV is completely protective in the susceptible host. However, neutralizing antibody titers and the memory B cell response are short-lived in SARS-recovered patients and the antibody will target primary homologous strain. Interestingly, the acute phase of SARS in humans is associated with a severe reduction in the number of T cells in the blood. Surprisingly, only a limited number of studies have explored the role of the T cell-mediated adaptive immune response in respiratory coronavirus pathogenesis. In this review, we discuss the role of anti-virus CD4 and CD8 T cells during respiratory coronavirus infections with a special emphasis on emerging coronaviruses. PMID:24845462

  8. Effector Regulatory T Cell Differentiation and Immune Homeostasis Depend on the Transcription Factor Myb.

    PubMed

    Dias, Sheila; D'Amico, Angela; Cretney, Erika; Liao, Yang; Tellier, Julie; Bruggeman, Christine; Almeida, Francisca F; Leahy, Jamie; Belz, Gabrielle T; Smyth, Gordon K; Shi, Wei; Nutt, Stephen L

    2017-01-17

    FoxP3-expressing regulatory T (Treg) cells are essential for maintaining immune homeostasis. Activated Treg cells undergo further differentiation into an effector state that highly expresses genes critical for Treg cell function, although how this process is coordinated on a transcriptional level is poorly understood. Here, we demonstrate that mice lacking the transcription factor Myb in Treg cells succumbed to a multi-organ inflammatory disease. Myb was specifically expressed in, and required for the differentiation of, thymus-derived effector Treg cells. The combination of transcriptome and genomic footprint analyses revealed that Myb directly regulated a large proportion of the gene expression specific to effector Treg cells, identifying Myb as a critical component of the gene regulatory network controlling effector Treg cell differentiation and function. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. New approaches to design HIV-1 T-cell vaccines.

    PubMed

    Perrin, Hélène; Canderan, Glenda; Sékaly, Rafick-Pierre; Trautmann, Lydie

    2010-09-01

    Following the evidence that T-cell responses are crucial in the control of HIV-1 infection, vaccines targeting T-cell responses were tested in recent clinical trials. However, these vaccines showed a lack of efficacy. This review attempts to define the qualitative and quantitative features that are desirable for T-cell-induced responses by vaccines. We also describe strategies that could lead to achievement of this goal. Using the yellow fever vaccine as a benchmark of an efficient vaccine, recent studies identified factors of immune protection and more importantly innate immune pathways needed for the establishment of long-term protective adaptive immunity. To prevent or control HIV-1 infection, a vaccine must induce efficient and persistent antigen-specific T cells endowed with mucosal homing capacity. Such cells should have the capability to counteract HIV-1 diversity and its rapid spread from the initial site of infection. To achieve this goal, the activation of a diversified innate immune response is critical. New systems biology approaches will provide more precise correlates of immune protection that will pave the way for new approaches in T-cell-based vaccines.

  10. Plasmacytoid dendritic cells induce NK cell-dependent, tumor antigen-specific T cell cross-priming and tumor regression in mice.

    PubMed

    Liu, Chengwen; Lou, Yanyan; Lizée, Gregory; Qin, Hong; Liu, Shujuan; Rabinovich, Brian; Kim, Grace J; Wang, Yi-Hong; Ye, Yang; Sikora, Andrew G; Overwijk, Willem W; Liu, Yong-Jun; Wang, Gang; Hwu, Patrick

    2008-03-01

    A prerequisite for strong adaptive antiviral immunity is the robust initial activation of the innate immune system, which is frequently mediated by TLR-activated plasmacytoid DCs (pDCs). Natural antitumor immunity is often comparatively weak, potentially due to the lack of TLR-mediated activation signals within the tumor microenvironment. To assess whether pDCs are capable of directly facilitating effective antitumor immune responses, mice bearing established subcutaneous B16 melanoma tumors were administered TLR9-activated pDCs directly into the tumor. We found that TLR9-activated pDCs induced robust, spontaneous CTL cross-priming against multiple B16 tumor antigens, leading to the regression of both treated tumors and untreated tumors at distant contralateral sites. This T cell cross-priming was mediated by conventional DCs (cDCs) and was completely dependent upon the early recruitment and activation of NK cells at the tumor site. NK cell recruitment was mediated by CCR5 via chemokines secreted by pDCs, and optimal IFN-gamma production by NK cells was mediated by OX40L expressed by pDCs. Our data thus demonstrated that activated pDCs are capable of initiating effective and systemic antitumor immunity through the orchestration of an immune cascade involving the sequential activation of NK cells, cDCs, and CD8(+) T cells.

  11. T-cell dependent immunogenicity of protein therapeutics: Preclinical assessment and mitigation.

    PubMed

    Jawa, Vibha; Cousens, Leslie P; Awwad, Michel; Wakshull, Eric; Kropshofer, Harald; De Groot, Anne S

    2013-12-01

    Protein therapeutics hold a prominent and rapidly expanding place among medicinal products. Purified blood products, recombinant cytokines, growth factors, enzyme replacement factors, monoclonal antibodies, fusion proteins, and chimeric fusion proteins are all examples of therapeutic proteins that have been developed in the past few decades and approved for use in the treatment of human disease. Despite early belief that the fully human nature of these proteins would represent a significant advantage, adverse effects associated with immune responses to some biologic therapies have become a topic of some concern. As a result, drug developers are devising strategies to assess immune responses to protein therapeutics during both the preclinical and the clinical phases of development. While there are many factors that contribute to protein immunogenicity, T cell- (thymus-) dependent (Td) responses appear to play a critical role in the development of antibody responses to biologic therapeutics. A range of methodologies to predict and measure Td immune responses to protein drugs has been developed. This review will focus on the Td contribution to immunogenicity, summarizing current approaches for the prediction and measurement of T cell-dependent immune responses to protein biologics, discussing the advantages and limitations of these technologies, and suggesting a practical approach for assessing and mitigating Td immunogenicity. © 2013. Published by Elsevier Inc. All rights reserved.

  12. Expression of immune checkpoints in T cells of esophageal cancer patients.

    PubMed

    Xie, Jinhua; Wang, Ji; Cheng, Shouliang; Zheng, Liangfeng; Ji, Feiyue; Yang, Lin; Zhang, Yan; Ji, Haoming

    2016-09-27

    Inhibition of immune checkpoint proteins (checkpoints) has become a promising anti-esophageal cancer strategy. We here tested expressions of immune checkpoints in human esophageal cancers. Our results showed the expressions of many immune checkpoints, including CD28, CD27, CD137L, programmed death 1 (PD-1), T cell immunoglobulin mucin-3 (TIM-3), T cell Ig and ITIM domain (TIGIT), CD160, cytotoxic T lymphocyte antigen 4 (CTLA-4), CD200, CD137 and CD158, were dysregulated in peripheral T cells of esophageal cancer patients. Further, the expressions of PD-1, TIM-3 and TIGIT were upregulated in tumor infiltrating lymphocytes (TILs), which might be associated with TILs exhaustion. Meanwhile, the expressions of PD-1 and TIM-3 on CD4+ T cells were closely associated with clinic pathological features of esophageal cancer patients. These results indicate that co-inhibitory receptors PD-1, TIM-3 and TIGIT may be potential therapeutic oncotargets for esophageal cancer.

  13. Mesenchymal Stem Cells and Myeloid Derived Suppressor Cells: Common Traits in Immune Regulation

    PubMed Central

    Nikolaev, Alexander

    2016-01-01

    To protect host against immune-mediated damage, immune responses are tightly regulated. The regulation of immune responses is mediated by various populations of mature immune cells, such as T regulatory cells and B regulatory cells, but also by immature cells of different origins. In this review, we discuss regulatory properties and mechanisms whereby two distinct populations of immature cells, mesenchymal stem cells, and myeloid derived suppressor cells mediate immune regulation, focusing on their similarities, discrepancies, and potential clinical applications. PMID:27529074

  14. Strain-specific protective immunity following vaccination against experimental Trypanosoma cruzi infection.

    PubMed

    Haolla, Filipe A; Claser, Carla; de Alencar, Bruna C G; Tzelepis, Fanny; de Vasconcelos, José Ronnie; de Oliveira, Gabriel; Silvério, Jaline C; Machado, Alexandre V; Lannes-Vieira, Joseli; Bruna-Romero, Oscar; Gazzinelli, Ricardo T; dos Santos, Ricardo Ribeiro; Soares, Milena B P; Rodrigues, Mauricio M

    2009-09-18

    Immunisation with Amastigote Surface Protein 2 (asp-2) and trans-sialidase (ts) genes induces protective immunity in highly susceptible A/Sn mice, against infection with parasites of the Y strain of Trypanosoma cruzi. Based on immunological and biological strain variations in T. cruzi parasites, our goal was to validate our vaccination results using different parasite strains. Due to the importance of the CD8(+) T cells in protective immunity, we initially determined which strains expressed the immunodominant H-2K(k)-restricted epitope TEWETGQI. We tested eight strains, four of which elicited immune responses to this epitope (Y, G, Colombian and Colombia). We selected the Colombian and Colombia strains for our studies. A/Sn mice were immunised with different regimens using both T. cruzi genes (asp-2 and ts) simultaneously and subsequently challenged with blood trypomastigotes. Immune responses before the challenge were confirmed by the presence of specific antibodies and peptide-specific T cells. Genetic vaccination did not confer protective immunity against acute infection with a lethal dose of the Colombian strain. In contrast, we observed a drastic reduction in parasitemia and a significant increase in survival, following challenge with an otherwise lethal dose of the Colombia strain. In many surviving animals with late-stage chronic infection, we observed alterations in the heart's electrical conductivity, compared to naive mice. In summary, we concluded that immunity against T. cruzi antigens, similar to viruses and bacteria, may be strain-specific and have a negative impact on vaccine development.

  15. Natural and adoptive T-cell immunity against herpes family viruses after allogeneic hematopoietic stem cell transplantation.

    PubMed

    Thomas, Simone; Herr, Wolfgang

    2011-06-01

    Reactivated infections with herpes family-related cytomegalovirus, Epstein-Barr virus and varicella zoster virus are serious and sometimes life-threatening complications for patients undergoing allogeneic hematopoietic stem cell transplantation. The pathogenesis of these infections critically involves the slow and inefficient recovery of antiviral T-cell immunity after transplantation. Although efficient drugs to decrease viral load during this vulnerable period have been developed, long-term control of herpes viruses and protection from associated diseases require the sufficient reconstitution of virus-specific memory T cells. To heal the deficiency by immunotherapeutic means, numerous research groups have developed antiviral vaccines and strategies based on the adoptive transfer of virus-specific T cells. This article summarizes the substantial progress made in this field during the past two decades and gives future perspectives about challenges that need to be addressed before antigen-specific immunotherapy against herpes family viruses can be implemented in general clinical practice.

  16. Immune Control of Burkholderia pseudomallei––Common, High-Frequency T-Cell Responses to a Broad Repertoire of Immunoprevalent Epitopes

    PubMed Central

    Nithichanon, Arnone; Rinchai, Darawan; Buddhisa, Surachat; Saenmuang, Pornpun; Kewcharoenwong, Chidchamai; Kessler, Bianca; Khaenam, Prasong; Chetchotisakd, Ploenchan; Maillere, Bernard; Robinson, John; Reynolds, Catherine J.; Boyton, Rosemary J.; Altmann, Daniel M.; Lertmemongkolchai, Ganjana

    2018-01-01

    Burkholderia pseudomallei (Bp) is an environmental bacterial pathogen that causes potentially lethal sepsis in susceptible individuals and is considered a Category B, Tier-1 biothreat agent. As such, it is crucial to gain an improved understanding of protective immunity and potential vaccine candidates. The nature of immune correlates dictating why most exposed individuals in endemic regions undergo asymptomatic seroconversion while others succumb to life-threatening sepsis is largely uncharted. Bp seroreactive, immunogenic proteins have previously been identified by antigen microarray. We here set out to conduct an analysis of T-cell recognition of the Bp immunome using serodominant antigens represented in the original antigen microarray, examining immune correlates of disease in healthy seropositive individuals and those with acute disease or in convalescence. By screening a library of 739 overlapping peptides representing the sequences of 20 different Bp antigens, we aimed to define immune correlates of protection at the level of immunoprevalent T-cell epitopes. Responses to a large number of epitopes were common in healthy seropositive individuals: we found remarkably broad responsiveness to Bp epitopes, with 235 of 739 peptides recognized by ≥80% of all tested donors. The cumulative response to Bp epitopes in healthy, seropositive, donors from this endemic region were of the order of thousands of spot forming cells per million cells, making Bp recognition a significant component of the T-cell repertoire. Noteworthy among our findings, analysis revealed 10 highly immunoprevalent T-cell epitopes, able to induce Bp-specific IFNγ responses that were high in responding T-cell frequency within the repertoire, and also common across individuals with different human leukocyte antigen types. Acute melioidosis patients showed poor T-cell responses to the immunoprevalent epitopes, but acquired responsiveness following recovery from infection. Our findings suggest

  17. ZFP36 RNA-binding proteins restrain T-cell activation and anti-viral immunity.

    PubMed

    Moore, Michael J; Blachere, Nathalie E; Fak, John J; Park, Christopher Y; Sawicka, Kirsty; Parveen, Salina; Zucker-Scharff, Ilana; Moltedo, Bruno; Rudensky, Alexander Y; Darnell, Robert B

    2018-05-31

    Dynamic post-transcriptional control of RNA expression by RNA-binding proteins (RBPs) is critical during immune response. ZFP36 RBPs are prominent inflammatory regulators linked to autoimmunity and cancer, but functions in adaptive immunity are less clear. We used HITS-CLIP to define ZFP36 targets in mouse T cells, revealing unanticipated actions in regulating T cell activation, proliferation, and effector functions. Transcriptome and ribosome profiling showed that ZFP36 represses mRNA target abundance and translation, notably through novel AU-rich sites in coding sequence. Functional studies revealed that ZFP36 regulates early T cell activation kinetics cell autonomously, by attenuating activation marker expression, limiting T cell expansion, and promoting apoptosis. Strikingly, loss of ZFP36 in vivo accelerated T cell responses to acute viral infection and enhanced anti-viral immunity. These findings uncover a critical role for ZFP36 RBPs in restraining T cell expansion and effector functions, and suggest ZFP36 inhibition as a strategy to enhance immune-based therapies. © 2018, Moore et al.

  18. Mast cells enhance T cell activation: Importance of mast cell-derived TNF

    NASA Astrophysics Data System (ADS)

    Nakae, Susumu; Suto, Hajime; Kakurai, Maki; Sedgwick, Jonathon D.; Tsai, Mindy; Galli, Stephen J.

    2005-05-01

    Mast cells are not only important effector cells in immediate hypersensitivity reactions and immune responses to pathogens but also can contribute to T cell-mediated disorders. However, the mechanisms by which mast cells might influence T cells in such settings are not fully understood. We find that mast cells can enhance proliferation and cytokine production in multiple T cell subsets. Mast cell-dependent enhancement of T cell activation can be promoted by FcRI-dependent mast cell activation, TNF production by both mast cells and T cells, and mast cell-T cell contact. However, at high concentrations of cells, mast cells can promote T cell activation independent of IgE or TNF. Finally, mast cells also can promote T cell activation by means of soluble factors. These findings identify multiple mechanisms by which mast cells can influence T cell proliferation and cytokine production. allergy | asthma | autoimmunity | cytokines | immune response

  19. Leishmania-infected MHC class IIhigh dendritic cells polarize CD4+ T cells toward a nonprotective T-bet+ IFN-γ+ IL-10+ phenotype.

    PubMed

    Resende, Mariana; Moreira, Diana; Augusto, Jorge; Cunha, Joana; Neves, Bruno; Cruz, Maria Teresa; Estaquier, Jérôme; Cordeiro-da-Silva, Anabela; Silvestre, Ricardo

    2013-07-01

    A differential behavior among infected and bystander dendritic cells (DCs) has been explored in different infection models. We have analyzed both populations sorted on contact with visceral Leishmania infantum on a susceptible mice model evaluating the subsequent repercussions on adaptive immune response. Our results demonstrate a clear dichotomy between the immunomodulatory abilities of bystander and infected DCs. The bystander population presents increased levels of IL-12p40 and costimulatory molecules being capable to induce CD4(+) T cell activation with immune protective capabilities. In contrast, infected DCs, which express lower costimulatory molecules and higher levels of IL-10, promote the development of Leishmania Ag-specific, nonprotective T-bet(+)IFN-γ(+)IL-10(+) CD4(+) T cells with an effector phenotype. This specific polarization was found to be dependent on IL-12p70. Splenic infected DCs recovered from chronic infected animals are similarly capable to polarize ex vivo syngeneic naive CD4(+) T cells toward a T-bet(+)IFN-γ(+)IL-10(+) phenotype. Further analysis revealed that only MHC class II(high)-infected DCs were responsible for this polarization. The adoptive transfer of such polarized CD4(+) T cells facilitates visceral leishmaniasis in BALB/c mice in a clear contrast with their counterpart generated with bystander DCs that significantly potentiate protection. Further, we demonstrated that CD4(+) T cells primed by infected DCs in an IL-10 free system, thus deprived of T-bet(+)IFN-γ(+)IL-10(+) population, restore the immune response and reduce parasite load, supporting a deleterious role of IFN-γ(+)IL-10(+) T cells in the maintenance of infection. Overall, our results highlight novel subversion mechanisms by which nonprotective T-bet(+)IFN-γ(+)IL-10(+) T cells are associated with chronicity and prolonged parasite persistence.

  20. Ectopic expression of anti-HIV-1 shRNAs protects CD8{sup +} T cells modified with CD4ζ CAR from HIV-1 infection and alleviates impairment of cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamata, Masakazu, E-mail: masa3k@ucla.edu; Kim, Patrick Y.; Ng, Hwee L.

    Chimeric antigen receptors (CARs) are artificially engineered receptors that confer a desired specificity to immune effector T cells. As an HIV-1-specific CAR, CD4ζ CAR has been extensively tested in vitro as well as in clinical trials. T cells modified with this CAR mediated highly potent anti-HIV-1 activities in vitro and were well-tolerated in vivo, but exerted limited effects on viral load and reservoir size due to poor survival and/or functionality of the transduced cells in patients. We hypothesize that ectopic expression of CD4ζ on CD8{sup +} T cells renders them susceptible to HIV-1 infection, resulting in poor survival of those cells. To testmore » this possibility, highly purified CD8{sup +} T cells were genetically modified with a CD4ζ-encoding lentiviral vector and infected with HIV-1. CD8{sup +} T cells were vulnerable to HIV-1 infection upon expression of CD4ζ as evidenced by elevated levels of p24{sup Gag} in cells and culture supernatants. Concurrently, the number of CD4ζ-modified CD8{sup +} T cells was reduced relative to control cells upon HIV-1 infection. To protect these cells from HIV-1 infection, we co-expressed two anti-HIV-1 shRNAs previously developed by our group together with CD4ζ. This combination vector was able to suppress HIV-1 infection without impairing HIV-1-dependent effector activities of CD4ζ. In addition, the number of CD4ζ-modified CD8{sup +} T cells maintained similar levels to that of the control even under HIV-1 infection. These results suggest that protecting CD4ζ-modified CD8{sup +} T cells from HIV-1 infection is required for prolonged HIV-1-specific immune surveillance. - Highlights: • Ectopic expression of CD4ζ CAR in CD8{sup +} T cells renders them susceptible to HIV-1 infection. • Co-expression of two anti-HIV-1 shRNAs protects CD4ζ CAR-modified CD8{sup +} T cells from HIV-1 infection. • Protecting CD4ζ CAR-modified CD8{sup +} T cells from HIV-1 infection suppresses its cytopathic effect.« less

  1. Gut symbiotic microbes imprint intestinal immune cells with the innate receptor SLAMF4 which contributes to gut immune protection against enteric pathogens

    PubMed Central

    Cabinian, Allison; Sinsimer, Daniel; Tang, May; Jang, Youngsoon; Choi, Bongkum; Laouar, Yasmina; Laouar, Amale

    2018-01-01

    Background Interactions between host immune cells and gut microbiota are crucial for the integrity and function of the intestine. How these interactions regulate immune cell responses in the intestine remains a major gap in the field. Aim We have identified the signalling lymphocyte activation molecule family member 4 (SLAMF4) as an immunomodulator of the intestinal immunity. The aim is to determine how SLAMF4 is acquired in the gut and what its contribution to intestinal immunity is. Methods Expression of SLAMF4 was assessed in mice and humans. The mechanism of induction was studied using GFPtg bone marrow chimaera mice, lymphotoxin α and TNLG8A-deficient mice, as well as gnotobiotic mice. Role in immune protection was revealed using oral infection with Listeria monocytogenes and Cytobacter rodentium. Results SLAMF4 is a selective marker of intestinal immune cells of mice and humans. SLAMF4 induction occurs directly in the intestinal mucosa without the involvement of the gut-associated lymphoid tissue. Gut bacterial products, particularly those of gut anaerobes, and gut-resident antigen-presenting cell (APC)TNLG8A are key contributors of SLAMF4 induction in the intestine. Importantly, lack of SLAMF4 expression leads the increased susceptibility of mice to infection by oral pathogens culminating in their premature death. Conclusions SLAMF4 is a marker of intestinal immune cells which contributes to the protection against enteric pathogens and whose expression is dependent on the presence of the gut microbiota. This discovery provides a possible mechanism for answering the long-standing question of how the intertwining of the host and gut microbial biology regulates immune cell responses in the gut. PMID:28341747

  2. IL-12p40-dependent agonistic effects on the development of protective innate and adaptive immunity against Salmonella enteritidis.

    PubMed

    Lehmann, J; Bellmann, S; Werner, C; Schröder, R; Schütze, N; Alber, G

    2001-11-01

    To study a potential IL-12p40-dependent but IL-12p75-independent agonistic activity regulating the immune response against Salmonella Enteritidis, the course of infection in IL-12p35-deficient mice (IL-12p35(-/-), capable of producing IL-12p40) was compared with that of IL-12p40(-/-) mice. Mice lacking IL-12p40 revealed a higher mortality rate and higher bacterial organ burden than mice capable of producing IL-12p40. This phenotype was found in both genetically susceptible (BALB/c, Ity(s)) and resistant mice (129Sv/Ev, Ity(r)) indicating Ity-independent mechanisms. The more effective control of bacteria in the IL-12p35(-/-) mice was associated with elevated serum IFN-gamma and TNF-alpha levels. In contrast, IL-12p40(-/-) mice showed reduced IFN-gamma production, which was associated with significantly elevated serum IgE levels. Early during infection (days 3 and 4 postinfection), as well as late (day 20 postinfection), the number of infected phagocytes was strongly increased in the absence of IL-12p40 indicating impaired bactericidal activity when IL-12p40 was missing. Liver histopathology revealed a decreased number of mononuclear granulomas in IL-12p40(-/-) mice. Depletion of CD4(+) or CD8(+) T lymphocytes in vivo suggested that both T cell subpopulations contribute to the IL-12p40-dependent protective functions. Analysis of IL-12p40 vs IL-23p19 mRNA expression revealed an up-regulation of only IL-12p40 mRNA during Salmonella infection. Together these data indicate that IL-12p40 can induce protective mechanisms during both the innate and the adaptive type 1 immune response in Salmonella infection. This novel activity of IL-12p40 complements the well described dominant and essential role of IL-12p75 in protective immunity to Salmonella infection.

  3. Providence of CD25+ KIR+ CD127- FOXP3- CD8+ T cell subset determines the dynamics of tumor immune surveillance.

    PubMed

    Chakraborty, Sreeparna; Bhattacharjee, Pushpak; Panda, Abir K; Kajal, Kirti; Bose, Sayantan; Sa, Gaurisankar

    2018-05-16

    CD8 + T-regulatory cells are progressively emerging as crucial components of immune system. The previous report suggests the presence of FOXP3-positive CD8 + Treg cells, similar to CD4 + Tregs, in cancer patients which produce high levels of IL10 and TGFβ for its immunosuppressive activities. At an early stage of tumor development, we have identified a subset of FOXP3-negative CD8 + CD25 + KIR + CD127 - a Treg-like subset which is essentially IFNγ-positive. However, this early induced CD8 + CD25 + CD127 - T cell subset certainly distinct from the IFNγ + CD8 + T-effecter cells. This CD8 + CD25 + CD127 - T cells are equipped with other FOXP3 - CD8 + Treg cell signature markers and can selectively suppress HLA-E-positive T FH cells in autoimmune condition as well as tumor-induced CD4 + Treg cells. Contrasting to FOXP3-positive CD8 + Tregs, this subset does not inhibit effector T cell proliferation or their functions as they are HLA-E-negative. Adoptive transfer of this early-CD8 + Treg-like subset detained tumor growth and inhibited CD4 + Treg generation that obstacles the immune surveillance and impairs cancer immunotherapy. At the late stage of tumor development, when CD4 + Treg cells dominate tumor-microenvironment, CD4 + Tregs mediate the clonal deletion of this tumor-suppressive FOXP3 - IFNγ + CD8 + CD25 + CD127 - T cells and ensures tumor immune evasion. Our findings suggest that at an early stage of the tumor, this tumor-induced IFNγ-producing FOXP3-negative CD8 + CD25 + CD127 - T cell subset can potentiate immune surveillance by targeting HLA-E-restricted CD4 + Treg cells whereas leaving the effector T cell population unaffected, and hence maneuvering their profile can open up a new avenue in cancer immunotherapy. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. Identification of B- and T-cell epitopes from glycoprotein B of herpes simplex virus 2 and evaluation of their immunogenicity and protection efficacy.

    PubMed

    Liu, Kun; Jiang, Deyu; Zhang, Liangyan; Yao, Zhidong; Chen, Zhongwei; Yu, Sanke; Wang, Xiliang

    2012-04-19

    Herpes simplex virus (HSV) infection is a major health concern worldwide. Evidence obtained from animals and humans indicates that B- and T-cell responses contribute to protective immunity against herpes virus infection. Glycoprotein B is a transmembrane envelope component of HSV-1 and HSV-2, which plays an important role in virion morphogenesis and penetration into host cells, and can induce neutralizing antibodies and protective T-cell response when it is used to immunize humans and animals. However, little is known about gB epitopes that are involved in B- and T-cell activities in vitro and in vivo. Thus, the HSV-2 gB sequence was screened using B- and T-cell epitope prediction systems, and the B-cell regions and the HLA-A*0201-restricted epitopes were identified. These B-cell epitopes elicited high IgG antibody titers in Balb/C mice, with a predominantly IgG1 subclass distribution, which indicated a Th2 bias. Specific IgGs induced by these two epitopes were evaluated as the neutralizing antibodies for virus neutralization. The predicted T-cell epitopes stabilized the HLA-A*0201 molecules on T(2) cells, and stimulate interferon-γ-secreting and cytotoxic CD8(+) T cells. Immunization with the predicted peptides reduced virus shedding and protected against lethal viral challenge in mice. The functional epitopes described herein, both B- and T-cell epitopes, are potentially implicated in vaccine development. Copyright © 2012. Published by Elsevier Ltd.

  5. Decreased Vδ2 γδ T cells associated with liver damage by regulation of Th17 response in patients with chronic hepatitis B.

    PubMed

    Wu, Xiaoli; Zhang, Ji-Yuan; Huang, Ang; Li, Yuan-Yuan; Zhang, Song; Wei, Jun; Xia, Siyuan; Wan, Yajuan; Chen, Weiwei; Zhang, Zheng; Li, Yangguang; Wen, Ti; Chen, Yan; Tanaka, Yoshimasa; Cao, Youjia; Wang, Puyue; Zhao, Liqing; Wu, Zhenzhou; Wang, Fu-Sheng; Yin, Zhinan

    2013-10-15

     γδ T cells comprise a small subset of T cells and play a protective role against cancer and viral infections; however, their precise role in patients with chronic hepatitis B remains unclear.  Flow cytometry and immunofunctional assays were performed to analyze the impact of Vδ2 γδ (Vδ2) T cells in 64 immune-activated patients, 22 immune-tolerant carriers, and 30 healthy controls.  The frequencies of peripheral and hepatic Vδ2 T cells decreased with disease progression from immune tolerant to immune activated. In the latter group of patients, the decreases in peripheral and intrahepatic frequencies of Vδ2 T cells reversely correlated with alanine aminotransferase levels and histological activity index. These activated terminally differentiated memory phenotypic Vδ2 T cells exhibited impaired abilities in proliferation and chemotaxis, while maintained a relative intact interferon (IFN) γ production. Importantly, Vδ2 T cells, in vitro, significantly suppressed the production of cytokines associated with interleukin 17-producing CD4+ T (Th17) cells through both cell contact-dependent and IFN-γ-dependent mechanisms.  Inflammatory microenvironment in IA patients result in decreased numbers of Vδ2 T cells, which play a novel role by regulating the pathogenic Th17 response to protect the liver in patients with chronic hepatitis B.

  6. Therapeutic Immunization with HIV-1 Tat Reduces Immune Activation and Loss of Regulatory T-Cells and Improves Immune Function in Subjects on HAART

    PubMed Central

    Ensoli, Barbara; Bellino, Stefania; Tripiciano, Antonella; Longo, Olimpia; Francavilla, Vittorio; Marcotullio, Simone; Cafaro, Aurelio; Picconi, Orietta; Paniccia, Giovanni; Scoglio, Arianna; Arancio, Angela; Ariola, Cristina; Ruiz Alvarez, Maria J.; Campagna, Massimo; Scaramuzzi, Donato; Iori, Cristina; Esposito, Roberto; Mussini, Cristina; Ghinelli, Florio; Sighinolfi, Laura; Palamara, Guido; Latini, Alessandra; Angarano, Gioacchino; Ladisa, Nicoletta; Soscia, Fabrizio; Mercurio, Vito S.; Lazzarin, Adriano; Tambussi, Giuseppe; Visintini, Raffaele; Mazzotta, Francesco; Di Pietro, Massimo; Galli, Massimo; Rusconi, Stefano; Carosi, Giampiero; Torti, Carlo; Di Perri, Giovanni; Bonora, Stefano; Ensoli, Fabrizio; Garaci, Enrico

    2010-01-01

    Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4+ T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks) on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002). Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002), served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4+ and CD8+ cellular activation (CD38 and HLA-DR) together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4+ T cells and B cells with reduction of CD8+ T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4+ and CD8+ T cells were accompanied by increases of CD4+ and CD8+ T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite, absent or partial in the

  7. Therapeutic immunization with HIV-1 Tat reduces immune activation and loss of regulatory T-cells and improves immune function in subjects on HAART.

    PubMed

    Ensoli, Barbara; Bellino, Stefania; Tripiciano, Antonella; Longo, Olimpia; Francavilla, Vittorio; Marcotullio, Simone; Cafaro, Aurelio; Picconi, Orietta; Paniccia, Giovanni; Scoglio, Arianna; Arancio, Angela; Ariola, Cristina; Ruiz Alvarez, Maria J; Campagna, Massimo; Scaramuzzi, Donato; Iori, Cristina; Esposito, Roberto; Mussini, Cristina; Ghinelli, Florio; Sighinolfi, Laura; Palamara, Guido; Latini, Alessandra; Angarano, Gioacchino; Ladisa, Nicoletta; Soscia, Fabrizio; Mercurio, Vito S; Lazzarin, Adriano; Tambussi, Giuseppe; Visintini, Raffaele; Mazzotta, Francesco; Di Pietro, Massimo; Galli, Massimo; Rusconi, Stefano; Carosi, Giampiero; Torti, Carlo; Di Perri, Giovanni; Bonora, Stefano; Ensoli, Fabrizio; Garaci, Enrico

    2010-11-11

    Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4(+) T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks) on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002). Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002), served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4(+) and CD8(+) cellular activation (CD38 and HLA-DR) together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4(+) T cells and B cells with reduction of CD8(+) T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4(+) and CD8(+) T cells were accompanied by increases of CD4(+) and CD8(+) T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite, absent

  8. Tumor exosomes block dendritic cells maturation to decrease the T cell immune response.

    PubMed

    Ning, Yongling; Shen, Kai; Wu, Qiyong; Sun, Xiao; Bai, Yu; Xie, Yewen; Pan, Jie; Qi, Chunjian

    2018-07-01

    Tumors can induce the generation and accumulation of immunosuppression in a tumor microenvironment, contributing to the tumor's escape from immunological surveillance. Although tumor antigen-pulsed dendritic cell can improve anti-tumor immune responses, tumor associated regulatory dendritic cells are involved in the induction of immune tolerance. The current study sought to investigate whether exosomes produced by tumor cells had any effect on DCs in immune suppression. In this study, we examined the effect of tumor exosomes on DCs and found that exosomes from LLC Lewis lung carcinoma or 4T1 breast cancer cell blocked the differentiation of myeloid precursor cells into CD11c + DCs and induced cell apoptosis. Tumor exosome treatment inhibited the maturation and migration of DCs and promoted the immune suppression of DCs. The treatment of tumor exosomes drastically decreased CD4 + IFN-γ + Th1 differentiation but increased the rates of regulatory T (Treg) cells. The immunosuppressive ability of tumor exosome-treated DCs were partially restored with PD-L1 blockage. These data suggested that PD-L1 played a role in tumor exosome-induced DC-associated immune suppression. Copyright © 2018 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  9. Dendritic cell-tumor coculturing vaccine can induce antitumor immunity through both NK and CTL interaction.

    PubMed

    Kim, K D; Choi, S C; Kim, A; Choe, Y K; Choe, I S; Lim, J S

    2001-11-01

    Immunization of dendritic cells (DC) pulsed with tumor antigen can activate tumor-specific cytotoxic T lymphocytes (CTL) that are responsible for protection and regression. We show here that immunization with bone marrow-derived DC cocultured with tumor cells can induce a protective immunity against challenges to viable tumor cells. In this study, we further investigated the mechanism by which the antitumor activity was induced. Immunization of mice with DC cocultured with murine colon carcinoma. CT-26 cells, augmented CTL activity against the tumor cells. Concomitantly, an increase in natural killer (NK) cell activity was also detected in the same mice. When DC were fixed with paraformaldehyde prior to coculturing with tumor cells, most of the CTL and NK cell activity diminished, indicating that DC are involved in the process of presenting the tumor antigen(s) to CTL. NK cell depletion in vivo produced markedly low tumor-specific CTL activity responsible for tumor prevention. In addition, RT-PCR analysis confirmed the high expression of INF-gamma mRNA in splenocytes after vaccination with DC cocultured with tumors, but low expression in splenocytes from NK-depleted mice. Most importantly, the tumor protective effect rendered to DC by the coculturing with CT-26 cells was not observed in NK-depleted mice, which suggests that DC can induce an antitumor immune response by enhancing NK cell-dependent CTL activation. Collectively, our results indicate that NK cells are required during the priming of cytotoxic T-cell response by DC-based tumor vaccine and seem to delineate a mechanism by which DC vaccine can provide the desired immunity.

  10. The essential role of G protein-coupled receptor (GPCR) signaling in regulating T cell immunity.

    PubMed

    Wang, Dashan

    2018-06-01

    The aim of this paper is to clarify the critical role of GPCR signaling in T cell immunity. The G protein-coupled receptors (GPCRs) are the most common targets in current pharmaceutical industry, and represent the largest and most versatile family of cell surface communicating molecules. GPCRs can be activated by a diverse array of ligands including neurotransmitters, chemokines as well as sensory stimuli. Therefore, GPCRs are involved in many key cellular and physiological processes, such as sense of light, taste and smell, neurotransmission, metabolism, endocrine and exocrine secretion. In recent years, GPCRs have been found to play an important role in immune system. T cell is an important type of immune cell, which plays a central role in cell-mediated immunity. A variety of GPCRs and their signaling mediators (RGS proteins, GRKs and β-arrestin) have been found to express in T cells and involved T cell-mediated immunity. We will summarize the role of GPCR signaling and their regulatory molecules in T cell activation, homeostasis and function in this article. GPCR signaling plays an important role in T cell activation, homeostasis and function. GPCR signaling is critical in regulating T cell immunity.

  11. Human Pancreatic Cancer Cells Induce a MyD88-Dependent Stromal Response To Promote a Tumor-Tolerant Immune Microenvironment

    PubMed Central

    Delitto, Daniel; Delitto, Andrea E.; DiVita, Bayli B.; Pham, Kien; Han, Song; Hartlage, Emily R.; Newby, Brittney N.; Gerber, Michael H.; Behrns, Kevin E.; Moldawer, Lyle L.; Thomas, Ryan M.; George, Thomas J.; Brusko, Todd M.; Mathews, Clayton E.; Liu, Chen; Trevino, Jose G.; Hughes, Steven J.; Wallet, Shannon M.

    2016-01-01

    Cancer cells exert mastery over the local tumor-associated stroma (TAS) to configure protective immunity within the tumor microenvironment. The immunomodulatory character of pancreatic lysates of patients with cancer differs from those with pancreatitis. In this study, we evaluated the crosstalk between pancreatic cancer (PC) and its TAS in primary human cell culture models. Upon exposure of TAS to PC cell-conditioned media, we documented robust secretion of IL-6 and IL-8. This TAS response was MyD88-dependent and sufficient to directly suppress both CD4+ and CD8+ T cell proliferation, inducing Th17 polarization at the expense of Th1. We found that patients possessed a similar shift in circulating effector memory Th17:Th1 ratios compared to healthy controls. The TAS response also directly suppressed CD8+ T cell-mediated cytotoxicity. Overall, our results demonstrate how TAS contributes to the production of an immunosuppressive tumor microenvironment in pancreatic cancer. PMID:27864347

  12. Antitumor immune responses mediated by dendritic cells

    PubMed Central

    Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne

    2013-01-01

    Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744

  13. Programmed cell death 1 inhibits inflammatory helper T-cell development through controlling the innate immune response

    PubMed Central

    Rui, Yuxiang; Honjo, Tasuku; Chikuma, Shunsuke

    2013-01-01

    Programmed cell death 1 (PD-1) is an inhibitory coreceptor on immune cells and is essential for self-tolerance because mice genetically lacking PD-1 (PD-1−/−) develop spontaneous autoimmune diseases. PD-1−/− mice are also susceptible to severe experimental autoimmune encephalomyelitis (EAE), characterized by a massive production of effector/memory T cells against myelin autoantigen, the mechanism of which is not fully understood. We found that an increased primary response of PD-1−/− mice to heat-killed mycobacteria (HKMTB), an adjuvant for EAE, contributed to the enhanced production of T-helper 17 (Th17) cells. Splenocytes from HKMTB-immunized, lymphocyte-deficient PD-1−/− recombination activating gene (RAG)2−/− mice were found to drive antigen-specific Th17 cell differentiation more efficiently than splenocytes from HKMTB-immunized PD-1+/+ RAG2−/− mice. This result suggested PD-1’s involvement in the regulation of innate immune responses. Mice reconstituted with PD-1−/− RAG2−/− bone marrow and PD-1+/+ CD4+ T cells developed more severe EAE compared with the ones reconstituted with PD-1+/+ RAG2−/− bone marrow and PD-1+/+ CD4+ T cells. We found that upon recognition of HKMTB, CD11b+ macrophages from PD-1−/− mice produced very high levels of IL-6, which helped promote naive CD4+ T-cell differentiation into IL-17–producing cells. We propose a model in which PD-1 negatively regulates antimycobacterial responses by suppressing innate immune cells, which in turn prevents autoreactive T-cell priming and differentiation to inflammatory effector T cells. PMID:24043779

  14. Metronomic cyclophosphamide eradicates large implanted GL261 gliomas by activating antitumor Cd8+ T-cell responses and immune memory

    PubMed Central

    Wu, Junjie; Waxman, David J

    2015-01-01

    Cancer chemotherapy using cytotoxic drugs can induce immunogenic tumor cell death; however, dosing regimens and schedules that enable single-agent chemotherapy to induce adaptive immune-dependent ablation of large, established tumors with activation of long-term immune memory have not been identified. Here, we investigate this issue in a syngeneic, implanted GL261 glioma model in immune-competent mice given cyclophosphamide on a 6-day repeating metronomic schedule. Two cycles of metronomic cyclophosphamide treatment induced sustained upregulation of tumor-associated CD8+ cytotoxic T lymphocyte (CTL) cells, natural killer (NK) cells, macrophages, and other immune cells. Expression of CTL- and NK–cell-shared effectors peaked on Day 6, and then declined by Day 9 after the second cyclophosphamide injection and correlated inversely with the expression of the regulatory T cell (Treg) marker Foxp3. Sustained tumor regression leading to tumor ablation was achieved after several cyclophosphamide treatment cycles. Tumor ablation required CD8+ T cells, as shown by immunodepletion studies, and was associated with immunity to re-challenge with GL261 glioma cells, but not B16-F10 melanoma or Lewis lung carcinoma cells. Rejection of GL261 tumor re-challenge was associated with elevated CTLs in blood and increased CTL infiltration in tumors, consistent with the induction of long-term, specific CD8+ T-cell anti-GL261 tumor memory. Co-depletion of CD8+ T cells and NK cells did not inhibit tumor regression beyond CD8+ T-cell depletion alone, suggesting that the metronomic cyclophosphamide-activated NK cells function via CD8a+ T cells. Taken together, these findings provide proof-of-concept that single-agent chemotherapy delivered on an optimized metronomic schedule can eradicate large, established tumors and induce long-term immune memory. PMID:26137402

  15. Maternal Milk T Cells Drive Development of Transgenerational Th1 Immunity in Offspring Thymus.

    PubMed

    Ghosh, Mrinal K; Nguyen, Virginia; Muller, H Konrad; Walker, Ameae M

    2016-09-15

    Using multiple murine foster-nursing protocols, thereby eliminating placental transfer and allowing a distinction between dam- and pup-derived cells, we show that foster nursing by an immunized dam results in development of CD8(+) T cells in nonimmunized foster pups that are specific for Ags against which the foster dam was immunized (Mycobacterium tuberculosis or Candida albicans). We have dubbed this process "maternal educational immunity" to distinguish it from passive cellular immunity. Of the variety of maternal immune cells present in milk, only T cells were detected in pup tissues. Maternal T cells, a substantial percentage of which were CD4(+)MHC class II(+), accumulated in the pup thymus and spleen during the nursing period. Further analysis of maternal cells in the pup thymus showed that a proportion was positive for maternal immunogen-specific MHC class II tetramers. To determine the outcome of Ag presentation in the thymus, the maternal or foster pup origin of immunogen-responding CD8(+) cells in foster pup spleens was assessed. Whereas ∼10% were maternally derived in the first few weeks after weaning, all immunogen-responding CD8(+) T cells were pup derived by 12 wk of age. Pup-derived immunogen-responsive CD8(+) cells persisted until at least 1 y of age. Passive cellular immunity is well accepted and has been demonstrated in the human population. In this study, we show an arguably more important role for transferred immune cells: the direction of offspring T cell development. Harnessing maternal educational immunity through prepregnancy immunization programs has potential for improvement of infant immunity. Copyright © 2016 by The American Association of Immunologists, Inc.

  16. Non-Invasive Radiofrequency Field Treatment of 4T1 Breast Tumors Induces T-cell Dependent Inflammatory Response.

    PubMed

    Newton, Jared M; Flores-Arredondo, Jose H; Suki, Sarah; Ware, Matthew J; Krzykawska-Serda, Martyna; Agha, Mahdi; Law, Justin J; Sikora, Andrew G; Curley, Steven A; Corr, Stuart J

    2018-02-22

    Previous work using non-invasive radiofrequency field treatment (RFT) in cancer has demonstrated its therapeutic potential as it can increase intratumoral blood perfusion, localization of intravenously delivered drugs, and promote a hyperthermic intratumoral state. Despite the well-known immunologic benefits that febrile hyperthermia can induce, an investigation of how RFT could modulate the intra-tumoral immune microenvironment had not been studied. Thus, using an established 4T1 breast cancer model in immune competent mice, we demonstrate that RFT induces a transient, localized, and T-cell dependent intratumoral inflammatory response. More specifically we show that multi- and singlet-dose RFT promote an increase in tumor volume in immune competent Balb/c mice, which does not occur in athymic nude models. Further leukocyte subset analysis at 24, 48, and 120 hours after a single RFT show a rapid increase in tumoral trafficking of CD4+ and CD8+ T-cells 24 hours post-treatment. Additional serum cytokine analysis reveals an increase in numerous pro-inflammatory cytokines and chemokines associated with enhanced T-cell trafficking. Overall, these data demonstrate that non-invasive RFT could be an effective immunomodulatory strategy in solid tumors, especially for enhancing the tumoral trafficking of lymphocytes, which is currently a major hindrance of numerous cancer immunotherapeutic strategies.

  17. Pregnancy immunology: decidual immune cells.

    PubMed

    Sanguansermsri, Donruedee; Pongcharoen, Sutatip

    2008-01-01

    Human pregnancy is a complex process. Placental development depends on the function of secretory molecules produced by placental trophoblast cells as well as by maternal uterine immune cells within the decidua. These decidual immune cells are T cells, natural killer cells, macrophages and dendritic cells. The interactions between the trophoblast cells and the maternal immune cells have an impact on the outcome of the pregnancy. Knowledge about the phenotypes and functions of the maternal immune cells in normal and pathological pregnancies including recurrent spontaneous abortions, preeclampsia and hydatidiform moles may improve our understanding of the immunobiology of the normal pregnancy as a whole and may provide approaches for improving the treatment of pathological pregnancies.

  18. Alpha-beta T cells provide protection against lethal encephalitis in the murine model of VEEV infection

    PubMed Central

    Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.; Dziuba, Natallia; Zacks, Michele A.; Grund, Anna H.; Frolov, Ilya; Campbell, Gerald A.; Weaver, Scott C.; Estes, D. Mark

    2007-01-01

    We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta (αβ) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ( γδ) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chain and a minority of vaccinated immunoglobulin heavy chain-deficient (μMT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3+ T cells are required for protection. PMID:17610927

  19. Mucosal-associated invariant T cells in autoimmunity, immune-mediated diseases and airways disease.

    PubMed

    Hinks, Timothy S C

    2016-05-01

    Mucosal-associated invariant T (MAIT) cells are a novel class of innate-like T cells, expressing a semi-invariant T-cell receptor (TCR) and able to recognize small molecules presented on the non-polymorphic MHC-related protein 1. Their intrinsic effector-memory phenotype, enabling secretion of pro-inflammatory cytokines, and their relative abundance in humans imply a significant potential to contribute to autoimmune processes. However, as MAIT cells were unknown until recently and specific immunological tools were unavailable, little is known of their roles in disease. Here I review observations from clinical studies and animal models of autoimmune and immune-mediated diseases including the roles of MAIT cells in systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease and airways diseases. MAIT cell deficiencies are frequently observed in peripheral blood, and at sites of disease such as the airways in asthma. However, MAIT cells have a specific sensitivity to suppression by therapeutic corticosteroids that may confound many of these observations, as may the tendency of the surface marker CD161 to activation-induced down-regulation. Nonetheless, the dependence on bacteria for the development of MAIT cells suggests a potentially important protective role linking the influences of early life microbial exposures and subsequent development of autoimmunity. Conversely, MAIT cells could contribute to chronic inflammation either through TCR-independent activation, or potentially by TCR recognition of as yet undiscovered ligands. Future research will be greatly facilitated by the immunological tools that are now available, including murine genetic models and human and murine specific tetramers. © 2016 The Authors. Immunology published by John Wiley & Sons Ltd.

  20. Dissection of SAP-dependent and SAP-independent SLAM family signaling in NKT cell development and humoral immunity.

    PubMed

    Chen, Shasha; Cai, Chenxu; Li, Zehua; Liu, Guangao; Wang, Yuande; Blonska, Marzenna; Li, Dan; Du, Juan; Lin, Xin; Yang, Meixiang; Dong, Zhongjun

    2017-02-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) mutations in X-linked lymphoproliferative disease (XLP) lead to defective NKT cell development and impaired humoral immunity. Because of the redundancy of SLAM family receptors (SFRs) and the complexity of SAP actions, how SFRs and SAP mediate these processes remains elusive. Here, we examined NKT cell development and humoral immunity in mice completely deficient in SFR. We found that SFR deficiency severely impaired NKT cell development. In contrast to SAP deficiency, SFR deficiency caused no apparent defect in follicular helper T (T FH ) cell differentiation. Intriguingly, the deletion of SFRs completely rescued the severe defect in T FH cell generation caused by SAP deficiency, whereas SFR deletion had a minimal effect on the defective NKT cell development in SAP-deficient mice. These findings suggest that SAP-dependent activating SFR signaling is essential for NKT cell selection; however, SFR signaling is inhibitory in SAP-deficient T FH cells. Thus, our current study revises our understanding of the mechanisms underlying T cell defects in patients with XLP. © 2017 Chen et al.

  1. Attenuated PfSPZ Vaccine induces strain-transcending T cells and durable protection against heterologous controlled human malaria infection.

    PubMed

    Lyke, Kirsten E; Ishizuka, Andrew S; Berry, Andrea A; Chakravarty, Sumana; DeZure, Adam; Enama, Mary E; James, Eric R; Billingsley, Peter F; Gunasekera, Anusha; Manoj, Anita; Li, Minglin; Ruben, Adam J; Li, Tao; Eappen, Abraham G; Stafford, Richard E; Kc, Natasha; Murshedkar, Tooba; Mendoza, Floreliz H; Gordon, Ingelise J; Zephir, Kathryn L; Holman, LaSonji A; Plummer, Sarah H; Hendel, Cynthia S; Novik, Laura; Costner, Pamela J M; Saunders, Jamie G; Berkowitz, Nina M; Flynn, Barbara J; Nason, Martha C; Garver, Lindsay S; Laurens, Matthew B; Plowe, Christopher V; Richie, Thomas L; Graham, Barney S; Roederer, Mario; Sim, B Kim Lee; Ledgerwood, Julie E; Hoffman, Stephen L; Seder, Robert A

    2017-03-07

    A live-attenuated malaria vaccine, Plasmodium falciparum sporozoite vaccine (PfSPZ Vaccine), confers sterile protection against controlled human malaria infection (CHMI) with Plasmodium falciparum (Pf) parasites homologous to the vaccine strain up to 14 mo after final vaccination. No injectable malaria vaccine has demonstrated long-term protection against CHMI using Pf parasites heterologous to the vaccine strain. Here, we conducted an open-label trial with PfSPZ Vaccine at a dose of 9.0 × 10 5 PfSPZ administered i.v. three times at 8-wk intervals to 15 malaria-naive adults. After CHMI with homologous Pf parasites 19 wk after final immunization, nine (64%) of 14 (95% CI, 35-87%) vaccinated volunteers remained without parasitemia compared with none of six nonvaccinated controls ( P = 0.012). Of the nine nonparasitemic subjects, six underwent repeat CHMI with heterologous Pf7G8 parasites 33 wk after final immunization. Five (83%) of six (95% CI, 36-99%) remained without parasitemia compared with none of six nonvaccinated controls. PfSPZ-specific T-cell and antibody responses were detected in all vaccine recipients. Cytokine production by T cells from vaccinated subjects after in vitro stimulation with homologous (NF54) or heterologous (7G8) PfSPZ were highly correlated. Interestingly, PfSPZ-specific T-cell responses in the blood peaked after the first immunization and were not enhanced by subsequent immunizations. Collectively, these data suggest durable protection against homologous and heterologous Pf parasites can be achieved with PfSPZ Vaccine. Ongoing studies will determine whether protective efficacy can be enhanced by additional alterations in the vaccine dose and number of immunizations.

  2. Airway Memory CD4(+) T Cells Mediate Protective Immunity against Emerging Respiratory Coronaviruses.

    PubMed

    Zhao, Jincun; Zhao, Jingxian; Mangalam, Ashutosh K; Channappanavar, Rudragouda; Fett, Craig; Meyerholz, David K; Agnihothram, Sudhakar; Baric, Ralph S; David, Chella S; Perlman, Stanley

    2016-06-21

    Two zoonotic coronaviruses (CoVs)-SARS-CoV and MERS-CoV-have crossed species to cause severe human respiratory disease. Here, we showed that induction of airway memory CD4(+) T cells specific for a conserved epitope shared by SARS-CoV and MERS-CoV is a potential strategy for developing pan-coronavirus vaccines. Airway memory CD4(+) T cells differed phenotypically and functionally from lung-derived cells and were crucial for protection against both CoVs in mice. Protection was dependent on interferon-γ and required early induction of robust innate and virus-specific CD8(+) T cell responses. The conserved epitope was also recognized in SARS-CoV- and MERS-CoV-infected human leukocyte antigen DR2 and DR3 transgenic mice, indicating potential relevance in human populations. Additionally, this epitope was cross-protective between human and bat CoVs, the progenitors for many human CoVs. Vaccine strategies that induce airway memory CD4(+) T cells targeting conserved epitopes might have broad applicability in the context of new CoVs and other respiratory virus outbreaks. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Unexpected Role for IL-17 in Protective Immunity against Hypervirulent Mycobacterium tuberculosis HN878 Infection

    PubMed Central

    Gopal, Radha; Monin, Leticia; Slight, Samantha; Uche, Uzodinma; Blanchard, Emmeline; A. Fallert Junecko, Beth; Ramos-Payan, Rosalio; Stallings, Christina L.; Reinhart, Todd A.; Kolls, Jay K.; Kaushal, Deepak; Nagarajan, Uma; Rangel-Moreno, Javier; Khader, Shabaana A.

    2014-01-01

    Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis (TB), infects one third of the world's population. Among these infections, clinical isolates belonging to the W-Beijing appear to be emerging, representing about 50% of Mtb isolates in East Asia, and about 13% of all Mtb isolates worldwide. In animal models, infection with W-Beijing strain, Mtb HN878, is considered “hypervirulent” as it results in increased mortality and causes exacerbated immunopathology in infected animals. We had previously shown the Interleukin (IL) -17 pathway is dispensable for primary immunity against infection with the lab adapted Mtb H37Rv strain. However, it is not known whether IL-17 has any role to play in protective immunity against infection with clinical Mtb isolates. We report here that lab adapted Mtb strains, such as H37Rv, or less virulent Mtb clinical isolates, such as Mtb CDC1551, do not require IL-17 for protective immunity against infection while infection with Mtb HN878 requires IL-17 for early protective immunity. Unexpectedly, Mtb HN878 induces robust production of IL-1β through a TLR-2-dependent mechanism, which supports potent IL-17 responses. We also show that the role for IL-17 in mediating protective immunity against Mtb HN878 is through IL-17 Receptor signaling in non-hematopoietic cells, mediating the induction of the chemokine, CXCL-13, which is required for localization of T cells within lung lymphoid follicles. Correct T cell localization within lymphoid follicles in the lung is required for maximal macrophage activation and Mtb control. Since IL-17 has a critical role in vaccine-induced immunity against TB, our results have far reaching implications for the design of vaccines and therapies to prevent and treat emerging Mtb strains. In addition, our data changes the existing paradigm that IL-17 is dispensable for primary immunity against Mtb infection, and instead suggests a differential role for IL-17 in early protective immunity against

  4. Tumor-targeted IL-2 amplifies T cell-mediated immune response induced by gene therapy with single-chain IL-12

    PubMed Central

    Lode, Holger N.; Xiang, Rong; Duncan, Steven R.; Theofilopoulos, Argyrios N.; Gillies, Stephen D.; Reisfeld, Ralph A.

    1999-01-01

    Induction, maintenance, and amplification of tumor-protective immunity after cytokine gene therapy is essential for the clinical success of immunotherapeutic approaches. We investigated whether this could be achieved by single-chain IL-12 (scIL-12) gene therapy followed by tumor-targeted IL-2 using a fusion protein containing a tumor-specific recombinant anti-ganglioside GD2 antibody and IL-2 (ch14.18-IL-2) in a poorly immunogenic murine neuroblastoma model. Herein, we demonstrate the absence of liver and bone marrow metastases after a lethal challenge with NXS2 wild-type cells only in mice (five of six animals) vaccinated with scIL-12-producing NXS2 cells and given a booster injection of low-dose ch14.18-IL-2 fusion protein. This tumor-protective immunity was effective 3 months after initial vaccination, in contrast to control animals treated with a nonspecific fusion protein or an equivalent mixture of antibody and IL-2. Only vaccinated mice receiving the tumor-specific ch14.18-IL-2 fusion protein revealed a reactivation of CD8+ T cells and subsequent MHC class I-restricted tumor target cell lysis in vitro. The sequential increase in the usage of TCR chains Vβ11 and -13 in mouse CD8+ T cells after vaccination and amplification with ch14.18-IL-2 suggests that the initial polyclonal CD8+ T cell response is effectively boosted by targeted IL-2. In conclusion, we demonstrate that a successful boost of a partially protective memory T cell immune response that is induced by scIL-12 gene therapy could be generated by tumor-specific targeting of IL-2 with a ch14.18-IL-2 fusion protein. This approach could increase success rates of clinical cancer vaccine trials. PMID:10411920

  5. Infection of human T lymphotropic virus-I-specific immune T cell clones by human T lymphotropic virus-I.

    PubMed Central

    Mitsuya, H; Jarrett, R F; Cossman, J; Cohen, O J; Kao, C S; Guo, H G; Reitz, M S; Broder, S

    1986-01-01

    Human T lymphotropic virus-I (HTLV-I)-specific T cell lines were established and cloned. K5, an OKT8+ clone bearing multiple proviral integration sites, retained its HTLV-I-specific cytotoxicity and a normal dependence on interleukin 2 (IL-2), indicating that there is a finite number of transforming integration sites. R2, an OKT4+ HTLV-I-infected clone, initially mounted a proliferative response to HTLV-I; but then its IL-2-independent proliferation increased and the antigen specificity was lost. All HTLV-I-infected clones tested including K7, another OKT8+ transformed cytotoxic clone that had lost its reactivity, expressed comparable levels of T cell receptor beta-chain (TCR-beta) messenger (m)RNA. Although clones K5 and K7 had different functional properties, they had the same rearrangement of the TCR-beta gene, suggesting that they had the same clonal origin. These data indicate that HTLV-I-specific T cells retain their immune reactivity for variable periods of time following infection, but then usually lose it; in some cases, however, no alteration in function can be detected. The data also suggest that different consequences can take place in the same clone depending on the pattern of retroviral infection. Images PMID:2877011

  6. Protective immunity to Japanese encephalitis virus associated with anti-NS1 antibodies in a mouse model.

    PubMed

    Li, Yize; Counor, Dorian; Lu, Peng; Duong, Veasna; Yu, Yongxin; Deubel, Vincent

    2012-07-24

    Japanese encephalitis virus (JEV) is a major mosquito-borne pathogen that causes viral encephalitis throughout Asia. Vaccination with an inactive JEV particle or attenuated virus is an efficient preventative measure for controlling infection. Flavivirus NS1 protein is a glycoprotein secreted during viral replication that plays multiple roles in the viral life cycle and pathogenesis. Utilizing JEV NS1 as an antigen in viral vectors induces a limited protective immune response against infection. Previous studies using E. coli-expressed JEV NS1 to immunize mice induced protection against lethal challenge; however, the protection mechanism through cellular and humoral immune responses was not described. JEV NS1 was expressed in and purified from Drosophila S2 cells in a native glycosylated multimeric form, which induced T-cell and antibody responses in immunized C3H/HeN mice. Mice vaccinated with 1 μg NS1 with or without water-in-oil adjuvant were partially protected against viral challenge and higher protection was observed in mice with higher antibody titers. IgG1 was preferentially elicited by an adjuvanted NS1 protein, whereas a larger load of IFN-γ was produced in splenocytes from mice immunized with aqueous NS1. Mice that passively received anti-NS1 mouse polyclonal immune sera were protected, and this phenomenon was dose-dependent, whereas protection was low or delayed after the passive transfer of anti-NS1 MAbs. The purified NS1 subunit induced protective immunity in relation with anti-NS1 IgG1 antibodies. NS1 protein efficiently stimulated Th1-cell proliferation and IFN-γ production. Protection against lethal challenge was elicited by passive transfer of anti-NS1 antisera, suggesting that anti-NS1 antibodies play a substantial role in anti-viral immunity.

  7. Gut symbiotic microbes imprint intestinal immune cells with the innate receptor SLAMF4 which contributes to gut immune protection against enteric pathogens.

    PubMed

    Cabinian, Allison; Sinsimer, Daniel; Tang, May; Jang, Youngsoon; Choi, Bongkum; Laouar, Yasmina; Laouar, Amale

    2018-05-01

    Interactions between host immune cells and gut microbiota are crucial for the integrity and function of the intestine. How these interactions regulate immune cell responses in the intestine remains a major gap in the field. We have identified the signalling lymphocyte activation molecule family member 4 (SLAMF4) as an immunomodulator of the intestinal immunity. The aim is to determine how SLAMF4 is acquired in the gut and what its contribution to intestinal immunity is. Expression of SLAMF4 was assessed in mice and humans. The mechanism of induction was studied using GFP tg bone marrow chimaera mice, lymphotoxin α and TNLG8A-deficient mice, as well as gnotobiotic mice. Role in immune protection was revealed using oral infection with Listeria monocytogenes and Cytobacter rodentium . SLAMF4 is a selective marker of intestinal immune cells of mice and humans. SLAMF4 induction occurs directly in the intestinal mucosa without the involvement of the gut-associated lymphoid tissue. Gut bacterial products, particularly those of gut anaerobes, and gut-resident antigen-presenting cell (APC) TNLG8A are key contributors of SLAMF4 induction in the intestine. Importantly, lack of SLAMF4 expression leads the increased susceptibility of mice to infection by oral pathogens culminating in their premature death. SLAMF4 is a marker of intestinal immune cells which contributes to the protection against enteric pathogens and whose expression is dependent on the presence of the gut microbiota. This discovery provides a possible mechanism for answering the long-standing question of how the intertwining of the host and gut microbial biology regulates immune cell responses in the gut. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  8. Role for Lyt-2+ T cells in resistance to cutaneous leishmaniasis in immunized mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farrell, J.P.; Muller, I.; Louis, J.A.

    1989-03-15

    The role of Lyt-2+ T cells in immunologic resistance to cutaneous leishmaniasis was analyzed by comparing infection patterns in resistant C57BL/6 mice and susceptible BALB/c mice induced to heal their infections after sub-lethal irradiation or i.v. immunization, with similar mice treated in vivo with anti-Lyt-2 antibodies. Administration of anti-Lyt-2 mAb resulted in a dramatic reduction in the number of lymphoid cells expressing the Lyt-2+ phenotype. Such treatment led to enhanced disease in both resistant C57BL/6 and irradiated BALB/c mice, as assessed by lesion size, but did not affect the capacity of these mice to ultimately resolve their infections. In contrast,more » anti-Lyt-2 treatment totally blocked the induction of resistance in i.v. immunized mice. These results suggest, that Lyt-2+ T cells may play a role in immunity to a Leishmania major infection and that their relative importance to resistance may depend on how resistance is induced.« less

  9. IL-33 promotes an innate immune pathway of intestinal tissue protection dependent on amphiregulin-EGFR interactions.

    PubMed

    Monticelli, Laurel A; Osborne, Lisa C; Noti, Mario; Tran, Sara V; Zaiss, Dietmar M W; Artis, David

    2015-08-25

    The barrier surfaces of the skin, lung, and intestine are constantly exposed to environmental stimuli that can result in inflammation and tissue damage. Interleukin (IL)-33-dependent group 2 innate lymphoid cells (ILC2s) are enriched at barrier surfaces and have been implicated in promoting inflammation; however, the mechanisms underlying the tissue-protective roles of IL-33 or ILC2s at surfaces such as the intestine remain poorly defined. Here we demonstrate that, following activation with IL-33, expression of the growth factor amphiregulin (AREG) is a dominant functional signature of gut-associated ILC2s. In the context of a murine model of intestinal damage and inflammation, the frequency and number of AREG-expressing ILC2s increases following intestinal injury and genetic disruption of the endogenous AREG-epidermal growth factor receptor (EGFR) pathway exacerbated disease. Administration of exogenous AREG limited intestinal inflammation and decreased disease severity in both lymphocyte-sufficient and lymphocyte-deficient mice, revealing a previously unrecognized innate immune mechanism of intestinal tissue protection. Furthermore, treatment with IL-33 or transfer of ILC2s ameliorated intestinal disease severity in an AREG-dependent manner. Collectively, these data reveal a critical feedback loop in which cytokine cues from damaged epithelia activate innate immune cells to express growth factors essential for ILC-dependent restoration of epithelial barrier function and maintenance of tissue homeostasis.

  10. Current understanding of HIV-1 and T-cell adaptive immunity: progress to date.

    PubMed

    Mohan, Teena; Bhatnagar, Santwana; Gupta, Dablu L; Rao, D N

    2014-08-01

    The cellular immune response to human immunodeficiency virus (HIV) has different components originating from both the adaptive and innate immune systems. HIV cleverly utilizes the host machinery to survive by its intricate nature of interaction with the host immune system. HIV evades the host immune system at innate ad adaptive, allows the pathogen to replicate and transmit from one host to another. Researchers have shown that HIV has multipronged effects especially on the adaptive immunity, with CD4(+) cells being the worst effect T-cell populations. Various analyses have revealed that, the exposure to HIV results in clonal expansion and excessive activation of the immune system. Also, an abnormal process of differentiation has been observed suggestive of an alteration and blocks in the maturation of various T-cell subsets. Additionally, HIV has shown to accelerate immunosenescence and exhaustion of the overtly activated T-cells. Apart from causing phenotypic changes, HIV has adverse effects on the functional aspect of the immune system, with evidences implicating it in the loss of the capacity of T-cells to secrete various antiviral cytokines and chemokines. However, there continues to be many aspects of the immune- pathogenesis of HIV that are still unknown and thus required further research in order to convert the malaise of HIV into a manageable epidemic. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. B and T Lymphocyte Attenuator Down-regulation by HIV-1 Depends on Type I Interferon and Contributes to T-Cell Hyperactivation

    PubMed Central

    Zhang, Zheng; Xu, Xiangsheng; Lu, Jiyun; Zhang, Shuye; Gu, Lanlan; Fu, Junliang; Jin, Lei; Li, Haiying; Zhao, Min; Zhang, Jiyuan; Wu, Hao; Su, Lishan; Fu, Yang-Xin

    2011-01-01

    Background. Nonspecific T-cell hyperactivation is the main driving force for human immunodeficiency virus (HIV)–1 disease progression, but the reasons why the excess immune response is not properly shut off are poorly defined. Methods. Eighty-five HIV-1–infected individuals were enrolled to characterize B and T lymphocyte attenuator (BTLA) expression and function. Infection and blockade assays were used to dissect the factors that influenced BTLA signaling in vitro. Results. BTLA expression on overall CD4+ and CD8+ T cells was progressively decreased in HIV-1 infection, which was directly correlated with disease progression and CD4+ T-cell differentiation and activation. BTLA+CD4+ T cells from HIV-1–infected patients also displayed an altered immune status, which was indicated by reduced expression of naive markers but increased activation and exhaustion markers. Cross-linking of BTLA can substantially decrease CD4+ T-cell activation in vitro. This responsiveness of CD4+ T cells to BTLA-mediated inhibitory signaling was further found to be impaired in HIV-1–infected patients. Furthermore, HIV-1 NL4-3 down-regulated BTLA expression on CD4+ T cells dependent on plasmacytoid dendritic cell (pDC)-derived interferon (IFN)-α. Blockade of IFN-α or depletion of pDCs prevents HIV-1-induced BTLA down-regulation. Conclusions. HIV-1 infection potentially impairs BTLA-mediated signaling dependent on pDC-derived IFN-α, which may contribute to broad T-cell hyperactivation induced by chronic HIV-1 infection. PMID:21592997

  12. Immune Protection against Lethal Fungal-Bacterial Intra-Abdominal Infections.

    PubMed

    Lilly, Elizabeth A; Ikeh, Melanie; Nash, Evelyn E; Fidel, Paul L; Noverr, Mairi C

    2018-01-16

    Polymicrobial intra-abdominal infections (IAIs) are clinically prevalent and cause significant morbidity and mortality, especially those involving fungi. Our laboratory developed a mouse model of IAI and demonstrated that intraperitoneal inoculation with Candida albicans or other virulent non- albicans Candida (NAC) species plus Staphylococcus aureus resulted in 70 to 80% mortality in 48 to 72 h due to robust local and systemic inflammation (sepsis). Surprisingly, inoculation with Candida dubliniensis or Candida glabrata with S. aureus resulted in minimal mortality, and rechallenge of these mice with lethal C. albicans / S. aureus (i.e., coninfection) resulted in >90% protection. The purpose of this study was to define requirements for C. dubliniensis / S. aureus -mediated protection and interrogate the mechanism of the protective response. Protection was conferred by C. dubliniensis alone or by killed C. dubliniensis plus live S. aureus S. aureus alone was not protective, and killed S. aureus compromised C. dubliniensis -induced protection. C. dubliniensis / S. aureus also protected against lethal challenge by NAC plus S. aureus and could protect for a long-term duration (60 days between primary challenge and C. albicans/S. aureus rechallenge). Unexpectedly, mice deficient in T and B cells (Rag-1 knockouts [KO]) survived both the initial C. dubliniensis/S. aureus challenge and the C. albicans/S. aureus rechallenge, indicating that adaptive immunity did not play a role. Similarly, mice depleted of macrophages prior to rechallenge were also protected. In contrast, protection was associated with high numbers of Gr-1 hi polymorphonuclear leukocytes (PMNLs) in peritoneal lavage fluid within 4 h of rechallenge, and in vivo depletion of Gr-1 + cells prior to rechallenge abrogated protection. These results suggest that Candida species can induce protection against a lethal C. albicans / S. aureus IAI that is mediated by PMNLs and postulated to be a unique form of

  13. Non-immune cells equipped with T cell receptor-like signaling for cancer cell ablation

    PubMed Central

    Kojima, Ryosuke; Scheller, Leo; Fussenegger, Martin

    2017-01-01

    The ability to engineer custom cell-contact-sensing output devices into human non-immune cells would be useful for extending the applicability of cell-based cancer therapies and avoiding risks associated with engineered immune cells. Here, we have developed a new class of synthetic T-cell receptor-like signal-transduction device that functions efficiently in human non-immune cells and triggers release of output molecules specifically upon sensing contact with a target cell. This device employs an interleukin signaling cascade, whose OFF/ON switching is controlled by biophysical segregation of a transmembrane signal-inhibitory protein from the sensor cell/target cell interface. We further showed that designer non-immune cells equipped with this device driving expression of a membrane-penetrator/prodrug-activating enzyme construct could specifically kill target cells in the presence of the prodrug, indicating its potential usefulness for target-cell-specific, cell-based enzyme-prodrug cancer therapy. Our study also contributes to advancement of synthetic biology by extending available design principles to transmit extracellular information to cells. PMID:29131143

  14. Systems analysis of protective immune responses to RTS,S malaria vaccination in humans

    PubMed Central

    Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali

    2017-01-01

    RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898

  15. Antibody response against Betaferon® in immune tolerant mice: involvement of marginal zone B-cells and CD4+ T-cells and apparent lack of immunological memory.

    PubMed

    Sauerborn, Melody; van Beers, Miranda M C; Jiskoot, Wim; Kijanka, Grzegorz M; Boon, Louis; Schellekens, Huub; Brinks, Vera

    2013-01-01

    The immunological processes underlying immunogenicity of recombinant human therapeutics are poorly understood. Using an immune tolerant mouse model we previously demonstrated that aggregates are a major trigger of the antidrug antibody (ADA) response against recombinant human interferon beta (rhIFNβ) products including Betaferon®, and that immunological memory seems to be lacking after a rechallenge with non-aggregated rhIFNβ. The apparent absence of immunological memory indicates a CD4+ T-cell independent (Tind) immune response underlying ADA formation against Betaferon®. This hypothesis was tested. Using the immune tolerant mouse model we first validated that rechallenge with highly aggregated rhIFNβ (Betaferon®) does not lead to a subsequent fast increase in ADA titers, suggesting a lack of immunological memory. Next we assessed whether Betaferon® could act as Tind antigen by inactivation of marginal zone (MZ) B-cells during treatment. MZ B-cells are major effector cells involved in a Tind immune response. In a following experiment we depleted the mice from CD4+ T-cells to test their involvement in the ADA response against Betaferon®. Inactivation of MZ B-cells at the start of Betaferon® treatment drastically lowered ADA levels, suggesting a Tind immune response. However, persistent depletion of CD4+ T-cells before and during Betaferon® treatment abolished the ADA response in almost all mice. The immune response against rhIFNβ in immune tolerant mice is neither a T-cell independent nor a classical T-cell dependent immune response. Further studies are needed to confirm absence of immunological memory (cells).

  16. Enhanced Immune Response and Protective Effects of Nano-chitosan-based DNA Vaccine Encoding T Cell Epitopes of Esat-6 and FL against Mycobacterium Tuberculosis Infection

    PubMed Central

    Feng, Ganzhu; Jiang, Qingtao; Xia, Mei; Lu, Yanlai; Qiu, Wen; Zhao, Dan; Lu, Liwei; Peng, Guangyong; Wang, Yingwei

    2013-01-01

    Development of a novel and effective vaccine against Mycobacterium tuberculosis (M.tb) is a challenging for preventing TB infection. In this study, a novel nanoparticle-based recombinant DNA vaccine was developed, which contains Esat-6 three T cell epitopes (Esat-6/3e) and fms-like tyrosine kinase 3 ligand (FL) genes (termed Esat-6/3e-FL), and was enveloped with chitosan (CS) nanoparticles (nano-chitosan). The immunologic and protective efficacy of the nano-chitosan-based DNA vaccine (termed nano-Esat-6/3e-FL) was assessed in C57BL/6 mice after intramuscular prime vaccination with the plasmids DNA and nasal boost with the Esat-6/3e peptides. The results showed that the immunized mice remarkably elicited enhanced T cell responses and protection against M.tb H37Rv challenge. These findings indicate that the nano-chitosan can significantly elevate the immunologic and protective effects of the DNA vaccine, and the nano-Esat-6/3e-FL is a useful vaccine for preventing M.tb infection in mice. PMID:23637790

  17. Rapamycin increases RSV RNA levels and survival of RSV-infected dendritic cell depending on T cell contact.

    PubMed

    do Nascimento de Freitas, Deise; Gassen, Rodrigo Benedetti; Fazolo, Tiago; Souza, Ana Paula Duarte de

    2016-10-01

    The macrolide rapamycin inhibits mTOR (mechanist target of rapamycin) function and has been broadly used to unveil the role of mTOR in immune responses. Inhibition of mTOR on dendritic cells (DC) can influence cellular immune response and the survival of DC. RSV is the most common cause of hospitalization in infants and is a high priority candidate to vaccine development. In this study we showed that rapamycin treatment on RSV-infected murine bone marrow-derived DC (BMDC) decreases the frequency of CD8(+)CD44(high) T cells. However, inhibition of mTOR on RSV-infected BMDC did not modify the activation phenotype of these cells. RSV-RNA levels increase when infected BMDC were treated with rapamycin. Moreover, we observed that rapamycin diminishes apoptosis cell death of RSV-infected BMDC co-culture with T cells and this effect was abolished when the cells were co-cultured in a transwell system that prevents cell-to-cell contact or migration. Taken together, these data indicate that rapamycin treatment present a toxic effect on RSV-infected BMDC increasing RSV-RNA levels, affecting partially CD8 T cell differentiation and also increasing BMDC survival in a mechanism dependent on T cell contact. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. A single vaccination with non-replicating MVA at birth induces both immediate and long-term protective immune responses.

    PubMed

    Cheminay, Cédric; Körner, Jana; Bernig, Constanze; Brückel, Michael; Feigl, Markus; Schletz, Martin; Suter, Mark; Chaplin, Paul; Volkmann, Ariane

    2018-04-25

    Newborns are considered difficult to protect against infections shortly after birth, due to their ineffective immune system that shows quantitative and qualitative differences compared to adults. However, here we show that a single vaccination of mice at birth with a replication-deficient live vaccine Modified Vaccinia Ankara [MVA] efficiently induces antigen-specific B- and T-cells that fully protect against a lethal Ectromelia virus challenge. Protection was induced within 2 weeks and using genetically modified mice we show that this protection was mainly T-cell dependent. Persisting immunological T-cell memory and neutralizing antibodies were obtained with the single vaccination. Thus, MVA administered as early as at birth induced immediate and long-term protection against an otherwise fatal disease and appears attractive as a new generation smallpox vaccine that is effective also in children. Moreover, it may have the potential to serve as platform for childhood vaccines as indicated by measles specific T- and B-cell responses induced in newborn mice vaccinated with recombinant MVA expressing measles antigens. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Vaginal type-II mucosa is an inductive site for primary CD8+ T-cell mucosal immunity

    PubMed Central

    Wang, Yichuan; Sui, Yongjun; Kato, Shingo; Hogg, Alison E.; Steel, Jason C.; Morris, John C.; Berzofsky, Jay A.

    2014-01-01

    The structured lymphoid tissues are considered the only inductive sites where primary T cell immune responses occur. The naïve T cells in structured lymphoid tissues, once being primed by antigen -bearing dendritic cells, differentiate into memory T cells and traffic back to the mucosal sites through the bloodstream. Contrary to this belief, here we show that the vaginal type-II mucosa itself, despite lack of structured lymphoid tissues, can act as an inductive site during primary CD8+ T cell immune responses. We provide evidence that the vaginal mucosa supports both the local immune priming of naïve CD8+ T cells and the local expansion of antigen-specific CD8+ T cells, thereby demonstrating a different paradigm for primary mucosal T cell immune induction. PMID:25600442

  20. Immune cell functions in pancreatic cancer.

    PubMed

    Plate, J M; Harris, J E

    2000-01-01

    Pancreatic cancer kills nearly 29,000 people in the United States annually-as many people as are diagnosed with the disease. Chemotherapeutic treatment is ineffective in halting progression of the disease. Yet, specific immunity to pancreatic tumor cells in subjects with pancreatic cancer has been demonstrated repeatedly during the last 24 years. Attempts to expand and enhance tumor-specific immunity with biotherapy, however, have not met with success. The question remains, "Why can't specific immunity regulate pancreatic cancer growth?" The idea that tumor cells have evolved protective mechanisms against immunity was raised years ago and has recently been revisited by a number of research laboratories. In pancreatic cancer, soluble factors produced by and for the protection of the tumor environment have been detected and are often distributed to the victim's circulatory system where they may effect a more generalized immunosuppression. Yet the nature of these soluble factors remains controversial, since some also serve as tumor antigens that are recognized by the same T cells that may become inactivated by them. Unless the problem of tumor-derived immunosuppressive products is addressed directly through basic and translational research studies, successful biotherapeutic treatment for pancreatic cancer may not be forthcoming.

  1. Selective resistance of CD44hi T cells to p53-dependent cell death results in persistence of immunologic memory after total body irradiation.

    PubMed

    Yao, Zhenyu; Jones, Jennifer; Kohrt, Holbrook; Strober, Samuel

    2011-10-15

    Our previous studies showed that treatment of mice with total body irradiation (TBI) or total lymphoid tissue irradiation markedly changes the balance of residual T cell subsets to favor CD4(+)CD44(hi) NKT cells because of the differential resistance of the latter subset to cell death. The object of the current study was to further elucidate the changed balance and mechanisms of differential radioresistance of T cell subsets after graded doses of TBI. The experimental results showed that CD4(+) T cells were markedly more resistant than CD8(+) T cells, and CD44(hi) T cells, including NKT cells and memory T cells, were markedly more resistant than CD44(lo) (naive) T cells. The memory T cells immunized to alloantigens persisted even after myeloablative (1000 cGy) TBI and were able to prevent engraftment of bone marrow transplants. Although T cell death after 1000 cGy was prevented in p53(-/-) mice, there was progressive T cell death in p53(-/-) mice at higher doses. Although p53-dependent T cell death changed the balance of subsets, p53-independent T cell death did not. In conclusion, resistance of CD44(hi) T cells to p53-dependent cell death results in the persistence of immunological memory after TBI and can explain the immune-mediated rejection of marrow transplants in sensitized recipients.

  2. Intravenous apoptotic spleen cell infusion induces a TGF-beta-dependent regulatory T-cell expansion

    PubMed Central

    Kleinclauss, François M.; Perruche, Sylvain; Masson, Emeline; De Carvalho Bittencourt, Marcelo; Biichle, Sabeha; Remy-Martin, Jean-Paul; Ferrand, Christophe; Martin, Mael; Bittard, Hugues; Chalopin, Jean-Marc; Seilles, Estelle; Tiberghien, Pierre; Saas, Philippe

    2006-01-01

    Apoptotic leukocytes are endowed with immunomodulatory properties that can be used to enhance hematopoietic engraftment and prevent graft-versus-host disease. This apoptotic cell-induced tolerogenic effect is mediated by host macrophages and not recipient dendritic cells or donor phagocytes present in the bone marrow graft as evidenced by selective cell depletion and trafficking experiments. Furthermore, apoptotic cell infusion is associated with TGF-β-dependent donor CD4+CD25+ T cell expansion. Such cells have a regulatory phenotype (CD62Lhigh and intracellular CTLA-4+), express high levels of Foxp3 mRNA and exert ex vivo suppressive activity through a cell-to-cell contact mechanism. In vivo CD25 depletion after apoptotic cell infusion prevents the apoptotic spleen cell-induced beneficial effects on engraftment and graft-versus-host disease occurrence. This highlights the role of regulatory T cells in the tolerogenic effect of apoptotic spleen cell infusion. This novel association between apoptosis and regulatory T cell expansion may also contribute to preventing deleterious auto-immune responses during normal turnover. PMID:15962005

  3. Empowering gamma delta T cells with antitumor immunity by dendritic cell-based immunotherapy

    PubMed Central

    Van Acker, Heleen H; Anguille, Sébastien; Van Tendeloo, Viggo F; Lion, Eva

    2015-01-01

    Gamma delta (γδ) T cells are the all-rounders of our immune-system with their major histocompatibility complex-unrestricted cytotoxicity, capacity to secrete immunosti-mulatory cytokines and ability to promote the generation of tumor antigen-specific CD8+ and CD4+ T cell responses. Dendritic cell (DC)-based vaccine therapy has the prospective to harness these unique features of the γδ T cells in the fight against cancer. In this review, we will discuss our current knowledge on DC-mediated γδ T cell activation and related opportunities for tumor immunologists. PMID:26405575

  4. Mucosal immunization in macaques upregulates the innate APOBEC 3G anti-viral factor in CD4(+) memory T cells.

    PubMed

    Wang, Yufei; Bergmeier, Lesley A; Stebbings, Richard; Seidl, Thomas; Whittall, Trevor; Singh, Mahavir; Berry, Neil; Almond, Neil; Lehner, Thomas

    2009-02-05

    APOBEC3G is an innate intracellular anti-viral factor which deaminates retroviral cytidine to uridine. In vivo studies of APOBEC3G (A3G) were carried out in rhesus macaques, following mucosal immunization with SIV antigens and CCR5 peptides, linked to the 70kDa heat shock protein. A progressive increase in A3G mRNA was elicited in PBMC after each immunization (p<0.0002 to p< or =0.02), which was maintained for at least 17 weeks. Analysis of memory T cells showed a significant increase in A3G mRNA and protein in CD4(+)CCR5(+) memory T cells in circulating (p=0.0001), splenic (p=0.0001), iliac lymph nodes (p=0.002) and rectal (p=0.01) cells of the immunized compared with unimmunized macaques. Mucosal challenge with SIVmac 251 showed a significant increase in A3G mRNA in the CD4(+)CCR5(+) circulating cells (p<0.01) and the draining iliac lymph node cells (p<0.05) in the immunized uninfected macaques, consistent with a protective effect exerted by A3G. The results suggest that mucosal immunization in a non-human primate can induce features of a memory response to an innate anti-viral factor in CCR5(+)CD4(+) memory and CD4(+)CD95(+)CCR7(-) effector memory T cells.

  5. Human immune cell targeting of protein nanoparticles - caveospheres

    NASA Astrophysics Data System (ADS)

    Glass, Joshua J.; Yuen, Daniel; Rae, James; Johnston, Angus P. R.; Parton, Robert G.; Kent, Stephen J.; de Rose, Robert

    2016-04-01

    Nanotechnology has the power to transform vaccine and drug delivery through protection of payloads from both metabolism and off-target effects, while facilitating specific delivery of cargo to immune cells. However, evaluation of immune cell nanoparticle targeting is conventionally restricted to monocultured cell line models. We generated human caveolin-1 nanoparticles, termed caveospheres, which were efficiently functionalized with monoclonal antibodies. Using this platform, we investigated CD4+ T cell and CD20+ B cell targeting within physiological mixtures of primary human blood immune cells using flow cytometry, imaging flow cytometry and confocal microscopy. Antibody-functionalization enhanced caveosphere binding to targeted immune cells (6.6 to 43.9-fold) within mixed populations and in the presence of protein-containing fluids. Moreover, targeting caveospheres to CCR5 enabled caveosphere internalization by non-phagocytic CD4+ T cells--an important therapeutic target for HIV treatment. This efficient and flexible system of immune cell-targeted caveosphere nanoparticles holds promise for the development of advanced immunotherapeutics and vaccines.

  6. B cell function in the immune response to helminths

    PubMed Central

    Harris, Nicola

    2010-01-01

    Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556

  7. Staphylococcus aureus infection of mice expands a population of memory γδ T cells that are protective against subsequent infection

    PubMed Central

    Murphy, Alison G.; O’Keeffe, Kate M.; Lalor, Stephen J.; Maher, Belinda M.; Mills, Kingston H. G.; McLoughlin, Rachel M.

    2014-01-01

    The development of vaccines against S. aureus has consistently failed in clinical trials, likely due to inefficient induction of cellular immunity. T cell-derived IL-17 is one of the few known correlates of anti-staphyloccoal immunity, conferring protection against S. aureus infections through its ability to promote phagocytic cell effector functions. A comprehensive understanding of the discrete T cell subsets critical for site-specific IL-17-mediated bacterial clearance will therefore be necessary to inform the development of vaccines that efficiently target cellular immunity. In this study, we have identified a population of CD44+CD27− memory γδ T cells, expanded upon infection of C57BL/6 mice with S. aureus, which produce high levels of IL-17 and mediate enhanced bacterial clearance upon re-infection with the bacterium. These cells are comprised largely of the Vγ4+ subset and accumulate at the site of infection subsequent to an initial Vγ1.1+ and Vγ2+ T cell response. Moreover, these Vγ4+ T cells are retained in the peritoneum and draining mediastinal lymph nodes for a prolonged period following bacterial clearance. In contrast to its critical requirement for γδ T cell activation during the primary infection, IL-1 signalling was dispensable for activation and expansion of memory γδ T cells upon re-exposure to S. aureus. Our findings demonstrate that a γδ T cell memory response can be induced upon exposure to S. aureus, in a fashion analogous to that associated with classical αβ T cells, and suggest that induction of IL-17-expressing γδ T cells may be an important property of a protective vaccine against S. aureus. PMID:24623128

  8. 9-cis-Retinoic Acid Promotes Cell Adhesion Through Integrin Dependent and Independent Mechanisms Across Immune Lineages

    PubMed Central

    Whelan, Jarrett T.; Chen, Jianming; Miller, Jabin; Morrow, Rebekah L.; Lingo, Joshuah D.; Merrell, Kaitlin; Shaikh, Saame Raza; Bridges, Lance C.

    2012-01-01

    Retinoids are essential in the proper establishment and maintenance of immunity. Although retinoids are implicated in immune related processes, their role in immune cell adhesion has not been well established. In this study, the effect of 9-cis-retinoic acid (9-cis-RA) on human hematopoietic cell adhesion was investigated. 9-cis-RA treatment specifically induced cell adhesion of the human immune cell lines HuT-78, NB4, RPMI 8866, and U937. Due to the prominent role of integrin receptors in mediating immune cell adhesion, we sought to evaluate if cell adhesion was integrin-dependent. By employing a variety of integrin antagonist including function-blocking antibodies and EDTA, we establish that 9-cis-RA prompts immune cell adhesion through established integrin receptors in addition to a novel integrin-independent process. The novel integrin-independent adhesion required the presence of retinoid and was attenuated by treatment with synthetic corticosteroids. Finally, we demonstrate that 9-cis-RA treatment of primary murine B-cells induces ex vivo adhesion that persists in the absence of integrin function. Our study is the first to demonstrate that 9-cis-retinoic acid influences immune cell adhesion through at least two functionally distinct mechanisms. PMID:22925918

  9. Microbiota regulate the ability of lung dendritic cells to induce IgA class-switch recombination and generate protective gastrointestinal immune responses

    PubMed Central

    Ruane, Darren; Chorny, Alejo; Lee, Haekyung; Faith, Jeremiah; Pandey, Gaurav; Shan, Meimei; Simchoni, Noa; Rahman, Adeeb; Garg, Aakash; Weinstein, Erica G.; Oropallo, Michael; Gaylord, Michelle; Ungaro, Ryan; Cunningham-Rundles, Charlotte; Alexandropoulos, Konstantina; Mucida, Daniel; Merad, Miriam; Cerutti, Andrea

    2016-01-01

    Protective immunoglobulin A (IgA) responses to oral antigens are usually orchestrated by gut dendritic cells (DCs). Here, we show that lung CD103+ and CD24+CD11b+ DCs induced IgA class-switch recombination (CSR) by activating B cells through T cell–dependent or –independent pathways. Compared with lung DCs (LDC), lung CD64+ macrophages had decreased expression of B cell activation genes and induced significantly less IgA production. Microbial stimuli, acting through Toll-like receptors, induced transforming growth factor-β (TGF-β) production by LDCs and exerted a profound influence on LDC-mediated IgA CSR. After intranasal immunization with inactive cholera toxin (CT), LDCs stimulated retinoic acid–dependent up-regulation of α4β7 and CCR9 gut-homing receptors on local IgA-expressing B cells. Migration of these B cells to the gut resulted in IgA-mediated protection against an oral challenge with active CT. However, in germ-free mice, the levels of LDC-induced, CT–specific IgA in the gut are significantly reduced. Herein, we demonstrate an unexpected role of the microbiota in modulating the protective efficacy of intranasal vaccination through their effect on the IgA class-switching function of LDCs. PMID:26712806

  10. A T-cell-dependent humoral immune response is preserved during the administration of the nerve agent pre-treatment pyridostigmine bromide in a murine model.

    PubMed

    Griffiths, Gareth D; Telford, Gary; Hooi, Doreen S W; Cook, David L; Wilkinson, Lucy J; Green, Christopher A; Pritchard, David I

    2005-03-01

    Immune regulation, either via the autonomic nervous system or by a proposed "non-neuronal" cholinergic system, suggests that the immune system may be susceptible to perturbation by compounds affecting cholinergic function. Here, the current UK and US nerve agent pre-treatment, pyridostigmine bromide (PB) and the related anti-acetylcholinesterase (AChE) compounds physostigmine (PHY) and BW284c51 were tested for their ability to affect mouse splenocyte function in vitro. In addition, PB, at a dose equivalent to that received during pre-treatment for nerve agent poisoning, was tested for its effect on a T-cell-dependent humoral response to antigen in vivo in the mouse. None of the anti-AChEs tested affected concanavalin A (Con A)-, anti-CD3- or lipopolysaccharide LPS-driven splenocyte proliferation, in vitro, at concentrations expected to give effective nerve agent pre-treatment. However, higher concentrations (>100 microM) particularly of PHY caused some inhibition of the proliferative responses. In vivo, PB or saline was administered via 28-day mini-osmotic pumps to give a 25-40% inhibition of whole blood AChE in the PB-treated animals. During PB or saline administration, primary and secondary doses (i.p.) of sheep red blood cells (SRBC) were given and the humoral response determined by monitoring anti-SRBC IgM and IgG levels. Splenocytes isolated from the experimental animals were also examined for their proliferative and cytokine responses to stimulation. No remarkable effects of PB were seen during the period of AChE inhibition on the humoral immune response. However, a modest elevation in IL-2 and IFN(gamma) in Con A-stimulated lymphocytes was seen in PB-treated animals following pump removal. Overall these data suggest that, in vivo, the SRBC stimulated T-cell-dependent immune response is unaffected by the administration of PB at pre-treatment doses.

  11. Tissue reservoirs of antiviral T cell immunity in persistent human CMV infection

    PubMed Central

    Gordon, Claire L.; Thome, Joseph J.C.; Igarashi, Suzu

    2017-01-01

    T cell responses to viruses are initiated and maintained in tissue sites; however, knowledge of human antiviral T cells is largely derived from blood. Cytomegalovirus (CMV) persists in most humans, requires T cell immunity to control, yet tissue immune responses remain undefined. Here, we investigated human CMV-specific T cells, virus persistence and CMV-associated T cell homeostasis in blood, lymphoid, mucosal and secretory tissues of 44 CMV seropositive and 28 seronegative donors. CMV-specific T cells were maintained in distinct distribution patterns, highest in blood, bone marrow (BM), or lymph nodes (LN), with the frequency and function in blood distinct from tissues. CMV genomes were detected predominantly in lung and also in spleen, BM, blood and LN. High frequencies of activated CMV-specific T cells were found in blood and BM samples with low virus detection, whereas in lung, CMV-specific T cells were present along with detectable virus. In LNs, CMV-specific T cells exhibited quiescent phenotypes independent of virus. Overall, T cell differentiation was enhanced in sites of viral persistence with age. Together, our results suggest tissue T cell reservoirs for CMV control shaped by both viral and tissue-intrinsic factors, with global effects on homeostasis of tissue T cells over the lifespan. PMID:28130404

  12. Tissue reservoirs of antiviral T cell immunity in persistent human CMV infection.

    PubMed

    Gordon, Claire L; Miron, Michelle; Thome, Joseph J C; Matsuoka, Nobuhide; Weiner, Joshua; Rak, Michael A; Igarashi, Suzu; Granot, Tomer; Lerner, Harvey; Goodrum, Felicia; Farber, Donna L

    2017-03-06

    T cell responses to viruses are initiated and maintained in tissue sites; however, knowledge of human antiviral T cells is largely derived from blood. Cytomegalovirus (CMV) persists in most humans, requires T cell immunity to control, yet tissue immune responses remain undefined. Here, we investigated human CMV-specific T cells, virus persistence and CMV-associated T cell homeostasis in blood, lymphoid, mucosal and secretory tissues of 44 CMV seropositive and 28 seronegative donors. CMV-specific T cells were maintained in distinct distribution patterns, highest in blood, bone marrow (BM), or lymph nodes (LN), with the frequency and function in blood distinct from tissues. CMV genomes were detected predominantly in lung and also in spleen, BM, blood and LN. High frequencies of activated CMV-specific T cells were found in blood and BM samples with low virus detection, whereas in lung, CMV-specific T cells were present along with detectable virus. In LNs, CMV-specific T cells exhibited quiescent phenotypes independent of virus. Overall, T cell differentiation was enhanced in sites of viral persistence with age. Together, our results suggest tissue T cell reservoirs for CMV control shaped by both viral and tissue-intrinsic factors, with global effects on homeostasis of tissue T cells over the lifespan. @Gordon et al.

  13. Armc5 deletion causes developmental defects and compromises T-cell immune responses

    PubMed Central

    Hu, Yan; Lao, Linjiang; Mao, Jianning; Jin, Wei; Luo, Hongyu; Charpentier, Tania; Qi, Shijie; Peng, Junzheng; Hu, Bing; Marcinkiewicz, Mieczyslaw Martin; Lamarre, Alain; Wu, Jiangping

    2017-01-01

    Armadillo repeat containing 5 (ARMC5) is a cytosolic protein with no enzymatic activities. Little is known about its function and mechanisms of action, except that gene mutations are associated with risks of primary macronodular adrenal gland hyperplasia. Here we map Armc5 expression by in situ hybridization, and generate Armc5 knockout mice, which are small in body size. Armc5 knockout mice have compromised T-cell proliferation and differentiation into Th1 and Th17 cells, increased T-cell apoptosis, reduced severity of experimental autoimmune encephalitis, and defective immune responses to lymphocytic choriomeningitis virus infection. These mice also develop adrenal gland hyperplasia in old age. Yeast 2-hybrid assays identify 16 ARMC5-binding partners. Together these data indicate that ARMC5 is crucial in fetal development, T-cell function and adrenal gland growth homeostasis, and that the functions of ARMC5 probably depend on interaction with multiple signalling pathways. PMID:28169274

  14. Alpha-beta T cells provide protection against lethal encephalitis in the murine model of VEEV infection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.

    2007-10-25

    We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta ({alpha}{beta}) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ({gamma}{delta}) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chainmore » and a minority of vaccinated immunoglobulin heavy chain-deficient ({mu}MT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3{sup +} T cells are required for protection.« less

  15. Eliciting Epitope-Specific CD8+ T Cell Response by Immunization with Microbial Protein Antigens Formulated with α-Galactosylceramide: Theory, Practice, and Protocols.

    PubMed

    Gilchuk, Pavlo; Knight, Frances C; Wilson, John T; Joyce, Sebastian

    2017-01-01

    CD8+ cytotoxic T lymphocytes confer protection against infectious diseases caused by viruses, bacteria, and parasites. Hence, significant efforts have been invested into devising ways to generate CD8+ T cell-targeted vaccines. Generation of microbe-free protein subunit vaccines requires a thorough knowledge of protective target antigens. Such antigens are proteolytically processed peptides presented by MHC class I molecules. To induce a robust antigen-specific CD8+ T cell response through vaccination, it is essential to formulate the antigen with an effective adjuvant. Here, we describe a versatile method for generating high-frequency antigen-specific CD8+ T cells through immunization of mice using the invariant natural killer T cell agonist α-galactosylceramide as the adjuvant.

  16. Neutrophilic NLRP3 inflammasome-dependent IL-1β secretion regulates the γδT17 cell response in respiratory bacterial infections.

    PubMed

    Hassane, M; Demon, D; Soulard, D; Fontaine, J; Keller, L E; Patin, E C; Porte, R; Prinz, I; Ryffel, B; Kadioglu, A; Veening, J-W; Sirard, J-C; Faveeuw, C; Lamkanfi, M; Trottein, F; Paget, C

    2017-07-01

    Traditionally regarded as simple foot soldiers of the innate immune response limited to the eradication of pathogens, neutrophils recently emerged as more complex cells endowed with a set of immunoregulatory functions. Using a model of invasive pneumococcal disease, we highlighted an unexpected key role for neutrophils as accessory cells in innate interleukin (IL)-17A production by lung resident Vγ6Vδ1 + T cells via nucleotide-binding oligomerization domain receptor, pyrin-containing 3 (NLRP3) inflammasome-dependent IL-1β secretion. In vivo activation of the NLRP3 inflammasome in neutrophils required both host-derived and bacterial-derived signals. Elaborately, it relies on (i) alveolar macrophage-secreted TNF-α for priming and (ii) subsequent exposure to bacterial pneumolysin for activation. Interestingly, this mechanism can be translated to human neutrophils. Our work revealed the cellular and molecular dynamic events leading to γδT17 cell activation, and highlighted for the first time the existence of a fully functional NLRP3 inflammasome in lung neutrophils. This immune axis thus regulates the development of a protective host response to respiratory bacterial infections.

  17. A T-cell response to a liver-stage Plasmodium antigen is not boosted by repeated sporozoite immunizations

    PubMed Central

    Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.

    2013-01-01

    Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242

  18. Substantial gaps in knowledge of Bordetella pertussis antibody and T cell epitopes relevant for natural immunity and vaccine efficacy

    PubMed Central

    Vaughan, Kerrie; Seymour, Emily; Peters, Bjoern; Sette, Alessandro

    2016-01-01

    The recent increase in whooping cough in vaccinated populations has been attributed to waning immunity associated with the acellular vaccine. The Immune Epitope Database (IEDB) is a repository of immune epitope data from the published literature and includes T cell and antibody epitopes for human pathogens. The IEDB conducted a review of the epitope literature, which revealed 300 Bordetella pertussis-related epitopes from 39 references. Epitope data are currently available for six virulence factors of B. pertussis: pertussis toxin, pertactin, fimbrial 2, fimbrial 3, adenylate cyclase and filamentous hemagglutinin. The majority of epitopes were defined for antibody reactivity; fewer T cell determinants were reported. Analysis of available protective correlates data revealed a number of candidate epitopes; however few are defined in humans and few have been shown to be protective. Moreover, there are a limited number of studies defining epitopes from natural infection versus whole cell or acellular/subunit vaccines. The relationship between epitope location and structural features, as well as antigenic drift (SNP analysis) was also investigated. We conclude that the cumulative data is yet insufficient to address many fundamental questions related to vaccine failure and this underscores the need for further investigation of B. pertussis immunity at the molecular level. PMID:24530743

  19. Capacity of Lung Stroma to Educate Dendritic Cells Inhibiting Mycobacteria-Specific T-Cell Response Depends upon Genetic Susceptibility to Tuberculosis

    PubMed Central

    Majorov, Konstantin B.; Logunova, Nadezhda N.; Apt, Alexander S.

    2013-01-01

    The balance between activation and inhibition of local immune responses in affected tissues during prolonged chronic infections is important for host protection. There is ample evidence that regulatory, tolerogenic dendritic cells (DC) are developed and present in tissues and inhibit overwhelming inflammatory reactions. Also, it was firmly established that stromal microenvironment of many organs is able to induce development of immature regulatory DC (DCreg), an essential element of a general immune regulatory network. However, direct experimental data demonstrating inhibition of immune responses by stroma-instructed immature DCreg in infectious models are scarce, and virtually nothing is known about functioning of this axis of immunity during tuberculosis (TB) infection. In this study, we demonstrate that lung stromal cells are capable of supporting the development in culture of immature CD11b+CD11clowCD103- DCreg from lineage-negative (lin-) bone marrow precursors. DCreg developed on lung stroma isolated from mice of genetically TB-hyper-susceptible I/St and relatively resistant B6 inbred strains inhibited proliferative response of mycobacteria-specific CD4+ T-cell lines a dose-dependent manner. Importantly, the inhibitory activity of B6 DCreg was substantially higher than that of I/St Dcreg. Moreover, when the donors of stromal cells were chronically infected with virulent mycobacteria, the capacity to instruct inhibitory DCreg was retained in B6, but further diminished in I/St stromal cells. DCreg-provided suppression was mediated by a few soluble mediators, including PGE2, NO and IL-10. The content of CD4+Foxp3+ Treg cells in the mediastinal, lung-draining lymph nodes at the advanced stages of chronic infection did not change in I/St, but increased 2-fold in B6 mice, and lung pathology was much more pronounced in the former mice. Taken together, these data provide genetic evidence that the capacity to maintain populations of regulatory cells during M

  20. Capacity of lung stroma to educate dendritic cells inhibiting mycobacteria-specific T-cell response depends upon genetic susceptibility to tuberculosis.

    PubMed

    Kapina, Marina A; Rubakova, Elvira I; Majorov, Konstantin B; Logunova, Nadezhda N; Apt, Alexander S

    2013-01-01

    The balance between activation and inhibition of local immune responses in affected tissues during prolonged chronic infections is important for host protection. There is ample evidence that regulatory, tolerogenic dendritic cells (DC) are developed and present in tissues and inhibit overwhelming inflammatory reactions. Also, it was firmly established that stromal microenvironment of many organs is able to induce development of immature regulatory DC (DCreg), an essential element of a general immune regulatory network. However, direct experimental data demonstrating inhibition of immune responses by stroma-instructed immature DCreg in infectious models are scarce, and virtually nothing is known about functioning of this axis of immunity during tuberculosis (TB) infection. In this study, we demonstrate that lung stromal cells are capable of supporting the development in culture of immature CD11b(+)CD11c(low)CD103(-) DCreg from lineage-negative (lin(-)) bone marrow precursors. DCreg developed on lung stroma isolated from mice of genetically TB-hyper-susceptible I/St and relatively resistant B6 inbred strains inhibited proliferative response of mycobacteria-specific CD4(+) T-cell lines a dose-dependent manner. Importantly, the inhibitory activity of B6 DCreg was substantially higher than that of I/St Dcreg. Moreover, when the donors of stromal cells were chronically infected with virulent mycobacteria, the capacity to instruct inhibitory DCreg was retained in B6, but further diminished in I/St stromal cells. DCreg-provided suppression was mediated by a few soluble mediators, including PGE2, NO and IL-10. The content of CD4(+)Foxp3(+) Treg cells in the mediastinal, lung-draining lymph nodes at the advanced stages of chronic infection did not change in I/St, but increased 2-fold in B6 mice, and lung pathology was much more pronounced in the former mice. Taken together, these data provide genetic evidence that the capacity to maintain populations of regulatory cells

  1. PCV2 vaccination induces IFN-γ/TNF-α co-producing T cells with a potential role in protection.

    PubMed

    Koinig, Hanna C; Talker, Stephanie C; Stadler, Maria; Ladinig, Andrea; Graage, Robert; Ritzmann, Mathias; Hennig-Pauka, Isabel; Gerner, Wilhelm; Saalmüller, Armin

    2015-03-03

    Porcine circovirus type 2 (PCV2) is one of the economically most important pathogens for swine production worldwide. Vaccination is a powerful tool to control porcine circovirus diseases (PCVD). However, it is not fully understood how PCV2 vaccination interacts with the porcine immune system. Especially knowledge on the cellular immune response against PCV2 is sparse. In this study we analysed antigen-specific T cell responses against PCV2 in a controlled vaccination and infection experiment. We focused on the ability of CD4(+) T cells to produce cytokines using multicolour flow cytometry (FCM). Vaccination with a PCV2 subunit vaccine (Ingelvac CircoFLEX®) induced PCV2-specific antibodies only in five out of 12 animals. Conversely, vaccine-antigen specific CD4(+) T cells which simultaneously produced IFN-γ and TNF-α and had a phenotype of central and effector memory T cells were detected in all vaccinated piglets. After challenge, seroconversion occurred earlier in vaccinated and infected pigs compared to the non-vaccinated, infected group. Vaccinated pigs were fully protected against viremia after subsequent challenge. Therefore, our data suggests that the induction of IFN-γ/TNF-α co-producing T cells by PCV2 vaccination may serve as a potential correlate of protection for this type of vaccine.

  2. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

    PubMed

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

    2016-01-05

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

  3. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    PubMed Central

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

    2016-01-01

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

  4. Tumor inhibitory T cell immunity may be largely a transplantation artifact not necessarily dependent upon a lack of Tregs.

    PubMed

    Prehn, Richmond T; Prehn, Liisa M

    2013-06-25

    There exists a very large literature suggesting that T cells come in a variety of species and that without the action of Tregs tumors would seldom survive inhibition by T cell effectors. We believe that much of the evidence supporting the role of Tregs in cancer is compatible with a perhaps simpler hypothesis based upon the demonstration that that small quantities of effector T cells tend to stimulate tumors while larger quantities of seemingly the same cells are inhibitory (an hormesis-like effect). This possibility seems to destroy much of the need to postulate a role for T cell suppressors (Tregs) in cancer, but the exposure of effector T cells to antigen may convert them into Tregs (Tregs do exist). Furthermore, many other data suggest the possibility that immune inhibition of cancer could be a laboratory artifact seldom if ever seen in unmodified nature.

  5. Tumor inhibitory T cell immunity may be largely a transplantation artifact not necessarily dependent upon a lack of Tregs

    PubMed Central

    2013-01-01

    There exists a very large literature suggesting that T cells come in a variety of species and that without the action of Tregs tumors would seldom survive inhibition by T cell effectors. We believe that much of the evidence supporting the role of Tregs in cancer is compatible with a perhaps simpler hypothesis based upon the demonstration that that small quantities of effector T cells tend to stimulate tumors while larger quantities of seemingly the same cells are inhibitory (an hormesis-like effect). This possibility seems to destroy much of the need to postulate a role for T cell suppressors (Tregs) in cancer, but the exposure of effector T cells to antigen may convert them into Tregs (Tregs do exist). Furthermore, many other data suggest the possibility that immune inhibition of cancer could be a laboratory artifact seldom if ever seen in unmodified nature. PMID:23800315

  6. Preserved immune functionality and high CMV-specific T-cell responses in HIV-infected individuals with poor CD4+ T-cell immune recovery.

    PubMed

    Gómez-Mora, Elisabet; García, Elisabet; Urrea, Victor; Massanella, Marta; Puig, Jordi; Negredo, Eugenia; Clotet, Bonaventura; Blanco, Julià; Cabrera, Cecilia

    2017-09-15

    Poor CD4 + T-cell recovery after cART has been associated with skewed T-cell maturation, inflammation and immunosenescence; however, T-cell functionality in those individuals has not been fully characterized. In the present study, we assessed T-cell function by assessing cytokine production after polyclonal, CMV and HIV stimulations of T-cells from ART-suppressed HIV-infected individuals with CD4 + T-cell counts >350 cells/μL (immunoconcordants) or <350 cells/μL (immunodiscordants). A group of HIV-uninfected individuals were also included as controls. Since CMV co-infection significantly affected T-cell maturation and polyfunctionality, only CMV + individuals were analyzed. Despite their reduced and skewed CD4 + T-cell compartment, immunodiscordant individuals showed preserved polyclonal and HIV-specific responses. However, CMV response in immunodiscordant participants was significantly different from immunoconcordant or HIV-seronegative individuals. In immunodiscordant subjects, the magnitude of IFN-γ + CD8 + and IL-2 + CD4 + T-cells in response to CMV was higher and differently associated with the CD4 + T-cell maturation profile., showing an increased frequency of naïve, central memory and EMRA CMV-specific CD4 + T-cells. In conclusion, CD4 + and CD8 + T-cell polyfunctionality was not reduced in immunodiscordant individuals, although heightened CMV-specific immune responses, likely related to subclinical CMV reactivations, may be contributing to the skewed T-cell maturation and the higher risk of clinical progression observed in those individuals.

  7. CD8 T-cell-mediated protection against liver-stage malaria: lessons from a mouse model

    PubMed Central

    Van Braeckel-Budimir, Natalija; Harty, John T.

    2014-01-01

    Malaria is a major global health problem, with severe mortality in children living in sub-Saharan Africa, and there is currently no licensed, effective vaccine. However, vaccine-induced protection from Plasmodium infection, the causative agent of malaria, was established for humans in small clinical trials and for rodents in the 1960s. Soon after, a critical role for memory CD8 T cells in vaccine-induced protection against Plasmodium liver-stage infection was established in rodent models and is assumed to apply to humans. However, these seminal early studies have led to only modest advances over the ensuing years in our understanding the basic features of memory CD8 T cells required for protection against liver-stage Plasmodium infection, an issue which has likely impeded the development of effective vaccines for humans. Given the ethical and practical limitations in gaining mechanistic insight from human vaccine and challenge studies, animal models still have an important role in dissecting the basic parameters underlying memory CD8 T-cell immunity to Plasmodium. Here, we will highlight recent data from our own work in the mouse model of Plasmodium infection that identify quantitative and qualitative features of protective memory CD8 T-cell responses. Finally, these lessons will be discussed in the context of recent findings from clinical trials of vaccine-induced protection in controlled human challenge models. PMID:24936199

  8. A novel subset of helper T cells promotes immune responses by secreting GM-CSF

    PubMed Central

    Zhang, J; Roberts, A I; Liu, C; Ren, G; Xu, G; Zhang, L; Devadas, S; Shi, Yufang

    2013-01-01

    Helper T cells are crucial for maintaining proper immune responses. Yet, they have an undefined relationship with one of the most potent immune stimulatory cytokines, granulocyte macrophage-colony-stimulating factor (GM-CSF). By depleting major cytokines during the differentiation of CD4+ T cells in vitro, we derived cells that were found to produce large amounts of GM-CSF, but little of the cytokines produced by other helper T subsets. By their secretion of GM-CSF, this novel subset of helper T cells (which we have termed ThGM cells) promoted the production of cytokines by other T-cell subtypes, including type 1 helper T cell (Th1), type 2 helper T cell (Th2), type 1 cytotoxic T cell (Tc1), type 2 cytotoxic T cell (Tc2), and naive T cells, as evidenced by the fact that antibody neutralization of GM-CSF abolished this effect. ThGM cells were found to be highly prone to activation-induced cell death (AICD). Inhibitors of TRAIL or granzymes could not block AICD in ThGM cells, whereas inhibition of FasL/Fas interaction partially rescued ThGM cells from AICD. Thus, ThGM cells are a novel subpopulation of T helper cells that produce abundant GM-CSF, exhibit exquisite susceptibility to apoptosis, and therefore play a pivotal role in the regulation of the early stages of immune responses. PMID:24076588

  9. T cell exit from quiescence and differentiation into Th2 cells depend on Raptor-mTORC1-mediated metabolic programming

    PubMed Central

    Yang, Kai; Shrestha, Sharad; Zeng, Hu; Karmaus, Peer W.F.; Neale, Geoffrey; Vogel, Peter; Guertin, David A.; Lamb, Richard F.; Chi, Hongbo

    2014-01-01

    SUMMARY Naïve T cells respond to antigen stimulation by exiting from quiescence and initiating clonal expansion and functional differentiation, but the control mechanism is elusive. Here we describe that Raptor-mTORC1-dependent metabolic programming is a central determinant of this transitional process. Loss of Raptor abrogated T cell priming and Th2 cell differentiation, although Raptor function is less important for continuous proliferation of actively cycling cells. mTORC1 coordinated multiple metabolic programs in T cells including glycolysis, lipid synthesis and oxidative phosphorylation to mediate antigen-triggered exit from quiescence. mTORC1 further linked glucose metabolism to the initiation of Th2 cell differentiation by orchestrating cytokine receptor expression and cytokine responsiveness. Activation of Raptor-mTORC1 integrated T cell receptor and CD28 co-stimulatory signals in antigen-stimulated T cells. Our studies identify a Raptor-mTORC1-dependent pathway linking signal-dependent metabolic reprogramming to quiescence exit, and this in turn coordinates lymphocyte activation and fate decisions in adaptive immunity. PMID:24315998

  10. Foxp3+ regulatory T cells impede the priming of protective CD8+ T cells

    PubMed Central

    Ertelt, James M.; Rowe, Jared H.; Mysz, Margaret A.; Singh, Charanjeet; Roychowdhury, Monika; Aguilera, Marijo N.; Way, Sing Sing

    2011-01-01

    T cell activation is controlled by incompletely defined opposing stimulation and suppression signals that together sustain the balance between optimal host defense against infection and peripheral tolerance. Herein, we explored the impacts of Foxp3+ regulatory T cell (Treg) suppression in priming antigen-specific T cell activation under non-infection and infection conditions. We find the transient ablation of Foxp3+ Tregs unleashes the robust expansion and activation of peptide stimulated CD8+ T cells that provide protection against Listeria monocytogenes (Lm) infection in an antigen-specific fashion. By contrast, Treg-ablation had non-significant impacts on the CD8+ T cell response primed by infection with recombinant Lm. Similarly, non-recombinant Lm administered with peptide stimulated the expansion and activation of CD8+ T cells that paralleled the response primed by Treg-ablation. Interestingly, these adjuvant properties of Lm did not require CD8+ T cell stimulation by IL-12 produced in response to infection, but instead were associated with sharp reductions in Foxp3+ Treg suppressive potency. Therefore, Foxp3+ Tregs impose critical barriers that when overcome naturally during infection or artificially with ablation allows the priming of protective antigen-specific CD8+ T cells. PMID:21810602

  11. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  12. T Cell Receptor Excision Circle (TREC) Monitoring after Allogeneic Stem Cell Transplantation; a Predictive Marker for Complications and Clinical Outcome

    PubMed Central

    Gaballa, Ahmed; Sundin, Mikael; Stikvoort, Arwen; Abumaree, Muhamed; Uzunel, Mehmet; Sairafi, Darius; Uhlin, Michael

    2016-01-01

    Allogeneic hematopoietic stem cell transplantation (HSCT) is a well-established treatment modality for a variety of malignant diseases as well as for inborn errors of the metabolism or immune system. Regardless of disease origin, good clinical effects are dependent on proper immune reconstitution. T cells are responsible for both the beneficial graft-versus-leukemia (GVL) effect against malignant cells and protection against infections. The immune recovery of T cells relies initially on peripheral expansion of mature cells from the graft and later on the differentiation and maturation from donor-derived hematopoietic stem cells. The formation of new T cells occurs in the thymus and as a byproduct, T cell receptor excision circles (TRECs) are released upon rearrangement of the T cell receptor. Detection of TRECs by PCR is a reliable method for estimating the amount of newly formed T cells in the circulation and, indirectly, for estimating thymic function. Here, we discuss the role of TREC analysis in the prediction of clinical outcome after allogeneic HSCT. Due to the pivotal role of T cell reconstitution we propose that TREC analysis should be included as a key indicator in the post-HSCT follow-up. PMID:27727179

  13. γδ T Cells Are a Component of Early Immunity against Preerythrocytic Malaria Parasites

    PubMed Central

    McKenna, Kyle C.; Tsuji, Moriya; Sarzotti, Marcella; Sacci, John B.; Witney, Adam A.; Azad, Abdu F.

    2000-01-01

    We tested the hypothesis that γδ T cells are a component of an early immune response directed against preerythrocytic malaria parasites that are required for the induction of an effector αβ T-cell immune response generated by irradiated-sporozoite (irr-spz) immunization. γδ T-cell-deficient (TCRδ−/−) mice on a C57BL/6 background were challenged with Plasmodium yoelii (17XNL strain) sporozoites, and then liver parasite burden was measured at 42 h postchallenge. Liver parasite burden was measured by quantification of parasite-specific 18S rRNA in total liver RNA by quantitative-competitive reverse transcription-PCR and by an automated 5′ exonuclease PCR. Sporozoite-challenged TCRδ−/− mice showed a significant (P < 0.01) increase in liver parasite burden compared to similarly challenged immunocompetent mice. In support of this result, TCRδ−/− mice were also found to be more susceptible than immunocompetent mice to a sporozoite challenge when blood-stage parasitemia was used as a readout. A greater percentage of TCRδ−/− mice than of immunocompetent mice progressed to a blood-stage infection when challenged with five or fewer sporozoites (odds ratio = 2.35, P = 0.06). TCRδ−/− mice receiving a single irr-spz immunization showed percent inhibition of liver parasites comparable to that of immunized immunocompetent mice following a sporozoite challenge. These data support the hypothesis that γδ T cells are a component of early immunity directed against malaria preerythrocytic parasites and suggest that γδ T cells are not required for the induction of an effector αβ T-cell immune response generated by irr-spz immunization. PMID:10722623

  14. APRIL modulates B and T cell immunity

    PubMed Central

    Stein, Jens V.; López-Fraga, Marta; Elustondo, Fernando A.; Carvalho-Pinto, Carla E.; Rodríguez, Dolores; Gómez-Caro, Ruth; de Jong, Joan; Martínez-A, Carlos; Medema, Jan Paul; Hahne, Michael

    2002-01-01

    The TNF-like ligands APRIL and BLyS are close relatives and share the capacity to bind the receptors TACI and BCMA. BLyS has been shown to play an important role in B cell homeostasis and autoimmunity, but the biological role of APRIL remains less well defined. Analysis of T cells revealed an activation-dependent increase in APRIL mRNA expression. We therefore generated mice expressing APRIL as a transgene in T cells. These mice appeared normal and showed no signs of B cell hyperplasia. Transgenic T cells revealed a greatly enhanced survival in vitro as well as enhanced survival of staphylococcal enterotoxin B–reactive CD4+ T cells in vivo, which both directly correlate with elevated Bcl-2 levels. Analysis of humoral responses to T cell–dependent antigens in the transgenic mice indicated that APRIL affects only IgM but not IgG responses. In contrast, T cell–independent type 2 (TI-2) humoral response was enhanced in APRIL transgenic mice. As TACI was previously reported to be indispensable for TI-2 antibody formation, these results suggest a role for APRIL/TACI interactions in the generation of this response. Taken together, our data indicate that APRIL is involved in the induction and/or maintenance of T and B cell responses. PMID:12070306

  15. An Anti-HIV-1 V3 Loop Antibody Fully Protects Cross-Clade and Elicits T-Cell Immunity in Macaques Mucosally Challenged with an R5 Clade C SHIV

    PubMed Central

    Lakhashe, Samir K.; Humbert, Michael; Sholukh, Anton; Hemashettar, Girish; Wong, Yin Ling; Yoon, John K.; Wang, Wendy; Novembre, Francis J.; Villinger, Francois; Ibegbu, Chris; Patel, Kalpana; Corti, Davide; Agatic, Gloria; Vanzetta, Fabrizia; Bianchi, Siro; Heeney, Jonathan L.; Sallusto, Federica; Lanzavecchia, Antonio; Ruprecht, Ruth M.

    2011-01-01

    Neutralizing antibodies have been shown to protect macaques against SHIV challenge. However, genetically diverse HIV-1 clades have evolved, and a key question left unanswered is whether neutralizing antibodies can confer cross-clade protection in vivo. The novel human monoclonal antibody HGN194 was isolated from an individual infected with an HIV-1 clade AG recombinant circulating recombinant form (CRF). HGN194 targets an epitope in the third hypervariable loop (V3) of HIV-1 gp120 and neutralizes a range of relatively neutralization-sensitive and resistant viruses. We evaluated the potential of HGN194 to protect infant rhesus monkeys against a SHIV encoding a primary CCR5-tropic HIV-1 clade C envelope. After high-dose mucosal challenge, all untreated controls became highly viremic while all HGN194-treated animals (50 mg/kg) were completely protected. When HGN194 was given at 1 mg/kg, one out of two monkeys remained aviremic, whereas the other had delayed, lower peak viremia. Interestingly, all protected monkeys given high-dose HGN194 developed Gag-specific proliferative responses of both CD4+ and CD8+ T cells. To test whether generation of the latter involved cryptic infection, we ablated CD8+ cells after HGN194 clearance. No viremia was detected in any protected monkeys, thus ruling out virus reservoirs. Thus, induction of CD8 T-cell immunity may have resulted from transient “Hit and Run” infection or cross priming via Ag-Ab-mediated cross-presentation. Together, our data identified the HGN194 epitope as protective and provide proof-of-concept that this anti-V3 loop mAb can prevent infection with sterilizing immunity after challenge with virus of a different clade, implying that V3 is a potential vaccine target. PMID:21483815

  16. Prior Dengue Virus Exposure Shapes T Cell Immunity to Zika Virus in Humans

    PubMed Central

    Grifoni, Alba; Pham, John; Sidney, John; O'Rourke, Patrick H.; Paul, Sinu; Peters, Bjoern; Martini, Sheridan R.; de Silva, Aruna D.; Ricciardi, Michael J.; Silveira, Cassia G. T.; Maestri, Alvino; Costa, Priscilla R.; de-Oliveira-Pinto, Luzia Maria; de Azeredo, Elzinandes Leal; Damasco, Paulo Vieira; Phillips, Elizabeth; Mallal, Simon; de Silva, Aravinda M.; Collins, Matthew; Durbin, Anna; Diehl, Sean A.; Cerpas, Cristhiam; Balmaseda, Angel; Kuan, Guillermina; Coloma, Josefina; Harris, Eva; Crowe, James E.; Stone, Mars; Busch, Michael; Vivanco-Cid, Hector; Cox, Josephine; Graham, Barney S.; Ledgerwood, Julie E.; Turtle, Lance; Solomon, Tom; Kallas, Esper G.; Watkins, David I.; Weiskopf, Daniela

    2017-01-01

    ABSTRACT While progress has been made in characterizing humoral immunity to Zika virus (ZIKV) in humans, little is known regarding the corresponding T cell responses to ZIKV. Here, we investigate the kinetics and viral epitopes targeted by T cells responding to ZIKV and address the critical question of whether preexisting dengue virus (DENV) T cell immunity modulates these responses. We find that memory T cell responses elicited by prior infection with DENV or vaccination with tetravalent dengue attenuated vaccines (TDLAV) recognize ZIKV-derived peptides. This cross-reactivity is explained by the sequence similarity of the two viruses, as the ZIKV peptides recognized by DENV-elicited memory T cells are identical or highly conserved in DENV and ZIKV. DENV exposure prior to ZIKV infection also influences the timing and magnitude of the T cell response. ZIKV-reactive T cells in the acute phase of infection are detected earlier and in greater magnitude in DENV-immune patients. Conversely, the frequency of ZIKV-reactive T cells continues to rise in the convalescent phase in DENV-naive donors but declines in DENV-preexposed donors, compatible with more efficient control of ZIKV replication and/or clearance of ZIKV antigen. The quality of responses is also influenced by previous DENV exposure, and ZIKV-specific CD8 T cells from DENV-preexposed donors selectively upregulated granzyme B and PD1, unlike DENV-naive donors. Finally, we discovered that ZIKV structural proteins (E, prM, and C) are major targets of both the CD4 and CD8 T cell responses, whereas DENV T cell epitopes are found primarily in nonstructural proteins. IMPORTANCE The issue of potential ZIKV and DENV cross-reactivity and how preexisting DENV T cell immunity modulates Zika T cell responses is of great relevance, as the two viruses often cocirculate and Zika virus has been spreading in geographical regions where DENV is endemic or hyperendemic. Our data show that memory T cell responses elicited by prior

  17. Adoptive immunotherapy with allodepleted donor T-cells improves immune reconstitution after haploidentical stem cell transplantation

    PubMed Central

    Amrolia, Persis J.; Muccioli-Casadei, Giada; Huls, Helen; Adams, Stuart; Durett, April; Gee, Adrian; Yvon, Eric; Weiss, Heidi; Cobbold, Mark; Gaspar, H. Bobby; Rooney, Cliona; Kuehnle, Ingrid; Ghetie, Victor; Schindler, John; Krance, Robert; Heslop, Helen E.; Veys, Paul; Vitetta, Ellen; Brenner, Malcolm K.

    2006-01-01

    Poor T lymphocyte reconstitution limits the use of haploidentical stem cell transplantation (SCT) because it results in a high mortality from viral infections. One approach to overcome this problem is to infuse donor T cells from which alloreactive lymphocytes have been selectively depleted, but the immunologic benefit of this approach is unknown. We have used an anti-CD25 immunotoxin to deplete alloreactive lymphocytes and have compared immune reconstitution after allodepleted donor T cells were infused at 2 dose levels into recipients of T-cell–depleted haploidentical SCT. Eight patients were treated at 104 cells/kg/dose, and 8 patients received 105 cells/kg/dose. Patients receiving 105 cells/kg/dose showed significantly improved T-cell recovery at 3, 4, and 5 months after SCT compared with those receiving 104 cells/kg/dose (P < .05). Accelerated T-cell recovery occurred as a result of expansion of the effector memory (CD45RA–CCR-7-) population (P < .05), suggesting that protective T-cell responses are likely to be long lived. T-cell–receptor signal joint excision circles (TRECs) were not detected in reconstituting T cells in dose-level 2 patients, indicating they are likely to be derived from the infused allodepleted cells. Spectratyping of the T cells at 4 months demonstrated a polyclonal Vβ repertoire. Using tetramer and enzyme-linked immunospot (ELISPOT) assays, we have observed cytomegalovirus (CMV)– and Epstein-Barr virus (EBV)–specific responses in 4 of 6 evaluable patients at dose level 2 as early as 2 to 4 months after transplantation, whereas such responses were not observed until 6 to 12 months in dose-level 1 patients. The incidence of significant acute (2 of 16) and chronic graft-versus-host disease (GVHD; 2 of 15) was low. These data demonstrate that allodepleted donor T cells can be safely used to improve T-cell recovery after haploidentical SCT and may broaden the applicability of this approach. PMID:16741253

  18. Salecan protected against concanavalin A-induced acute liver injury by modulating T cell immune responses and NMR-based metabolic profiles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Qi; Xu, Xi, E-mail: xuxi@njust.edu.cn; Yang,

    Salecan, a water-soluble extracellular β-glucan produced by Agrobacterium sp. ZX09, has been reported to exhibit a wide range of biological effects. The aims of the present study were to investigate the protective effect of salecan against Concanavalin A (ConA)-induced hepatitis, a well-established animal model of immune-mediated liver injury, and to search for possible mechanisms. C57BL/6 mice were pretreated with salecan followed by ConA injection. Salecan treatment significantly reduced ConA-induced acute liver injury, and suppressed the expression and secretion of inflammatory cytokines including interferon (IFN)-γ, interleukin (IL)-6 and IL-1β in ConA-induced liver injury model. The high expression levels of chemokines andmore » adhesion molecules such as MIP-1α, MIP-1β, ICAM-1, MCP-1 and RANTES in the liver induced by ConA were also down-regulated after salecan treatment. Salecan inhibited the infiltration and activation of inflammatory cells, especially T cells, in the liver induced by ConA. Moreover, salecan reversed the metabolic profiles of ConA-treated mice towards the control group by partly recovering the metabolic perturbations induced by ConA. Our results suggest the preventive and therapeutic potential of salecan in immune-mediated hepatitis. - Highlights: • Salecan treatment significantly reduced ConA-induced liver injury. • Salecan suppressed the expression and secretion of inflammatory cytokines. • Salecan decreased the expression of chemokines and adhesion molecules in liver. • Salecan inhibited the infiltration and activation of T cells induced by ConA. • Salecan partly recovered the metabolic perturbations induced by ConA.« less

  19. Age-Dependent Cell Trafficking Defects in Draining Lymph Nodes Impair Adaptive Immunity and Control of West Nile Virus Infection.

    PubMed

    Richner, Justin M; Gmyrek, Grzegorz B; Govero, Jennifer; Tu, Yizheng; van der Windt, Gerritje J W; Metcalf, Talibah U; Haddad, Elias K; Textor, Johannes; Miller, Mark J; Diamond, Michael S

    2015-07-01

    Impaired immune responses in the elderly lead to reduced vaccine efficacy and increased susceptibility to viral infections. Although several groups have documented age-dependent defects in adaptive immune priming, the deficits that occur prior to antigen encounter remain largely unexplored. Herein, we identify novel mechanisms for compromised adaptive immunity that occurs with aging in the context of infection with West Nile virus (WNV), an encephalitic flavivirus that preferentially causes disease in the elderly. An impaired IgM and IgG response and enhanced vulnerability to WNV infection during aging was linked to delayed germinal center formation in the draining lymph node (DLN). Adoptive transfer studies and two-photon intravital microscopy revealed a decreased trafficking capacity of donor naïve CD4+ T cells from old mice, which manifested as impaired T cell diapedesis at high endothelial venules and reduced cell motility within DLN prior to antigen encounter. Furthermore, leukocyte accumulation in the DLN within the first few days of WNV infection or antigen-adjuvant administration was diminished more generally in old mice and associated with a second aging-related defect in local cytokine and chemokine production. Thus, age-dependent cell-intrinsic and environmental defects in the DLN result in delayed immune cell recruitment and antigen recognition. These deficits compromise priming of early adaptive immune responses and likely contribute to the susceptibility of old animals to acute WNV infection.

  20. An integrated view of suppressor T cell subsets in immunoregulation

    PubMed Central

    Jiang, Hong; Chess, Leonard

    2004-01-01

    The immune system evolved to protect organisms from a virtually infinite variety of disease-causing agents but to avoid harmful responses to self. Because immune protective mechanisms include the elaboration of potent inflammatory molecules, antibodies, and killer cell activation — which together can not only destroy invading microorganisms, pathogenic autoreactive cells, and tumors, but also mortally injure normal cells — the immune system is inherently a “double-edged sword” and must be tightly regulated. Immune response regulation includes homeostatic mechanisms intrinsic to the activation and differentiation of antigen-triggered immunocompetent cells and extrinsic mechanisms mediated by suppressor cells. This review series will focus on recent advances indicating that distinct subsets of regulatory CD4+ and CD8+ T cells as well as NK T cells control the outgrowth of potentially pathogenic antigen-reactive T cells and will highlight the evidence that these suppressor T cells may play potentially important clinical roles in preventing and treating immune-mediated disease. Here we provide a historical overview of suppressor cells and the experimental basis for the existence of functionally and phenotypically distinct suppressor subsets. Finally, we will speculate on how the distinct suppressor cell subsets may function in concert to regulate immune responses. PMID:15520848

  1. IL-27 promotes IL-10 production by effector Th1 CD4+ T cells; a critical mechanism for protection from severe immunopathology during malaria infection1

    PubMed Central

    Freitas do Rosário, Ana Paula; Lamb, Tracey; Spence, Philip; Stephens, Robin; Lang, Agathe; Roers, Axel; Muller, Werner; O’Garra, Anne; Langhorne, Jean

    2012-01-01

    Infection with the malaria parasite, Plasmodium, is characterized by excessive inflammation. The establishment of a precise balance between the pro- and anti-inflammatory responses is critical to guarantee control of the parasite and survival of the host. Interleukin (IL)-10, a key regulatory cytokine produced by many cells of the immune system, has been shown to protect mice against pathology during acute Plasmodium chabaudi chabaudi AS model of malaria. However, the critical cellular source of IL-10 is still unknown. Here, we demonstrate that T cell-derived IL-10 is necessary for the control of pathology during acute malaria, as mice bearing specific deletion of Il10 in T cells fully reproduce the phenotype observed in Il10−/− mice, with significant weight loss, drop in temperature and increased mortality. Furthermore, we show that IFN-γ+ Th1 cells are the main producers of IL-10 throughout acute infection, expressing high levels of CD44 and ICOS and low levels of CD127. Although Foxp3+ regulatory CD4+ T cells produce IL-10 during infection, highly activated IFN-γ+ Th1 cells were shown to be the essential and sufficient source of IL-10 to guarantee protection against severe immune-mediated pathology. Finally, in this model of malaria we demonstrate that the generation of protective IL10+IFN-γ+ Th1 cells is dependent on IL-27 signaling, and independent of IL-21. PMID:22205023

  2. Effect of Aerva lanata on cell-mediated immune responses and cytotoxic T-lymphocyte generation in normal and tumor-bearing mice.

    PubMed

    Siveen, K S; Kuttan, Girija

    2012-01-01

    Cell-mediated immunity offers protection against virus-infected cells and tumor cells, involves activation of natural killer (NK) cells, production of antigen-specific cytotoxic T-lymphocytes, and release of various cytokines in response to an antigen. Administration of an ethanolic extract of Aerva lanata was found to stimulate cell-mediated immunological responses in normal and tumor-bearing BALB/c mice. A significant enhancement in NK cell activity in both normal and tumor-bearing hosts was observed after administration of A. lanata. Antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent complement-mediated cytotoxicity (ACC) were significantly enhanced as well in both sets of treated hosts. In addition, in vivo production of IL-2 and IFNg were each significantly enhanced by extract treatment. The stimulatory effect of A. lanata on cytotoxic T-lymphocyte (CTL) production was determined by Winn's neutralization assay using CTL-sensitive EL4 thymoma cells. A. lanata treatment caused a significant increase in CTL production in both in vivo and in vitro models, in each case as indicated by a significant increase in the life-spans of tumor-injected mice. Taken together, all of these results in the murine model indicate that administration of an ethanolic extract of A. lanata could enhance the cell-mediated anti-tumor response.

  3. CD8+ T Cells Primed in the Periphery Provide Time-Bound Immune-Surveillance to the Central Nervous System

    PubMed Central

    Young, Kevin G.; MacLean, Susanne; Dudani, Renu; Krishnan, Lakshmi; Sad, Subash

    2016-01-01

    After vaccination, memory CD8+ T cells migrate to different organs to mediate immune surveillance. In most nonlymphoid organs, following an infection, CD8+ T cells differentiate to become long-lived effector-memory cells, thereby providing long-term protection against a secondary infection. In this study, we demonstrated that Ag-specific CD8+ T cells that migrate to the mouse brain following a systemic Listeria infection do not display markers reminiscent of long-term memory cells. In contrast to spleen and other nonlymphoid organs, none of the CD8+ T cells in the brain reverted to a memory phenotype, and all of the cells were gradually eliminated. These nonmemory phenotype CD8+ T cells were found primarily within the choroid plexus, as well as in the cerebrospinal fluid-filled spaces. Entry of these CD8+ T cells into the brain was governed primarily by CD49d/VCAM-1, with the majority of entry occurring in the first week postinfection. When CD8+ T cells were injected directly into the brain parenchyma, cells that remained in the brain retained a highly activated (CD69hi) phenotype and were gradually lost, whereas those that migrated out to the spleen were CD69low and persisted long-term. These results revealed a mechanism of time-bound immune surveillance to the brain by CD8+ T cells that do not reside in the parenchyma. PMID:21715683

  4. A Plasmodium Promiscuous T Cell Epitope Delivered within the Ad5 Hexon Protein Enhances the Protective Efficacy of a Protein Based Malaria Vaccine.

    PubMed

    Fonseca, Jairo Andres; Cabrera-Mora, Monica; Kashentseva, Elena A; Villegas, John Paul; Fernandez, Alejandra; Van Pelt, Amelia; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto

    2016-01-01

    A malaria vaccine is a public health priority. In order to produce an effective vaccine, a multistage approach targeting both the blood and the liver stage infection is desirable. The vaccine candidates also need to induce balanced immune responses including antibodies, CD4+ and CD8+ T cells. Protein-based subunit vaccines like RTS,S are able to induce strong antibody response but poor cellular reactivity. Adenoviral vectors have been effective inducing protective CD8+ T cell responses in several models including malaria; nonetheless this vaccine platform exhibits a limited induction of humoral immune responses. Two approaches have been used to improve the humoral immunogenicity of recombinant adenovirus vectors, the use of heterologous prime-boost regimens with recombinant proteins or the genetic modification of the hypervariable regions (HVR) of the capsid protein hexon to express B cell epitopes of interest. In this study, we describe the development of capsid modified Ad5 vectors that express a promiscuous Plasmodium yoelii T helper epitope denominated PyT53 within the hexon HVR2 region. Several regimens were tested in mice to determine the relevance of the hexon modification in enhancing protective immune responses induced by the previously described protein-based multi-stage experimental vaccine PyCMP. A heterologous prime-boost immunization regime that combines a hexon modified vector with transgenic expression of PyCMP followed by protein immunizations resulted in the induction of robust antibody and cellular immune responses in comparison to a similar regimen that includes a vector with unmodified hexon. These differences in immunogenicity translated into a better protective efficacy against both the hepatic and red blood cell stages of P. yoelii. To our knowledge, this is the first time that a hexon modification is used to deliver a promiscuous T cell epitope. Our data support the use of such modification to enhance the immunogenicity and protective

  5. An Unmutated IgM Response to the Vi Polysaccharide of Salmonella Typhi Contributes to Protective Immunity in a Murine Model of Typhoid.

    PubMed

    Pandya, Kalgi D; Palomo-Caturla, Isabel; Walker, Justin A; K Sandilya, Vijay; Zhong, Zhijiu; Alugupalli, Kishore R

    2018-06-15

    T cell-dependent B cell responses typically develop in germinal centers. Abs generated during such responses are isotype switched and have a high affinity to the Ag because of somatic hypermutation of Ab genes. B cell responses to purified polysaccharides are T cell independent and do not result in the formation of bona fide germinal centers, and the dominant Ab isotype produced during such responses is IgM with very few or no somatic mutations. Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and Ig isotype switching in humans and mice. To test the extent to which unmutated polysaccharide-specific IgM confers protective immunity, we immunized wildtype and AID -/- mice with either heat-killed Salmonella enterica serovar Typhi ( S. Typhi) or purified Vi polysaccharide (ViPS). We found that wildtype and AID -/- mice immunized with heat-killed S. Typhi generated similar anti-ViPS IgM responses. As expected, wildtype, but not AID -/- mice generated ViPS-specific IgG. However, the differences in the Ab-dependent killing of S. Typhi mediated by the classical pathway of complement activation were not statistically significant. In ViPS-immunized wildtype and AID -/- mice, the ViPS-specific IgM levels and S. Typhi bactericidal Ab titers at 7 but not at 28 d postimmunization were also comparable. To test the protective immunity conferred by these immunizations, mice were challenged with a chimeric S. Typhimurium strain expressing ViPS. Compared with their naive counterparts, immunized wildtype and AID -/- mice exhibited significantly reduced bacterial burden regardless of the route of infection. These data indicate that an unmutated IgM response to ViPS contributes to protective immunity to S. Typhi. Copyright © 2018 by The American Association of Immunologists, Inc.

  6. Activated natural killer cell-mediated immunity is required for the inhibition of tumor metastasis by dendritic cell vaccination.

    PubMed

    Kim, Aeyung; Noh, Young-Woock; Kim, Kwang Dong; Jang, Yong-Suk; Choe, Yong-Kyung; Lim, Jong-Seok

    2004-10-31

    Immunization with dendritic cells (DCs) pulsed with tumor antigen can activate tumor-specific cytotoxic T lymphocytes (CTL), which is responsible for tumor protection and regression. In this study, we examined whether DCs pulsed with necrotic tumor lysates can efficiently prevent malignant melanoma tumor cell metastasis to the lung. DCs derived from mouse bone marrow were found to produce remarkably elevated levels of IL-12 after being pulsed with the tumor lysates. Moreover, immunization with these DCs induced CTL activation and protected mice from metastasis development by intravenously inoculated tumor cells. In addition, these DCs activated NK cells in vitro in a contact-dependent manner, and induced NK activities in vivo. Furthermore, NK cell depletion before DC vaccination significantly reduced the tumor-specific CTL activity, IFN-gamma production, and IFN-gamma- inducible gene expression, and eventually interfered with the antitumor effect of tumor-pulsed DCs. Finally, similar findings with respect to NK cell dependency were obtained in the C57BL/ 6J-bg/bg mice, which have severe deficiency in cytolytic activity of NK cells. These data suggest that the antitumor effect elicited by DC vaccination, at least in a B16 melanoma model, requires the participation of both cytolytic NK and CD8(+) T cells. The findings of this study would provide important data for the effective design of DC vaccines for cancer immunotherapy.

  7. Memory CD4+ T cells: beyond “helper” functions

    PubMed Central

    Boonnak, Kobporn; Subbarao, Kanta

    2012-01-01

    In influenza virus infection, antibodies, memory CD8+ T cells, and CD4+ T cells have all been shown to mediate immune protection, but how they operate and interact with one another to mediate efficient immune responses against virus infection is not well understood. In this issue of the JCI, McKinstry et al. have identified unique functions of memory CD4+ T cells beyond providing “help” for B cell and CD8+ T cell responses during influenza virus infection. PMID:22820285

  8. Protective Efficacy of Serially Up-Ranked Subdominant CD8+ T Cell Epitopes against Virus Challenges

    PubMed Central

    Roshorm, Yaowaluck; Bridgeman, Anne; Létourneau, Sven; Liljeström, Peter; Potash, Mary Jane; Volsky, David J.; McMichael, Andrew J.; Hanke, Tomáš

    2011-01-01

    Immunodominance in T cell responses to complex antigens like viruses is still incompletely understood. Some data indicate that the dominant responses to viruses are not necessarily the most protective, while other data imply that dominant responses are the most important. The issue is of considerable importance to the rational design of vaccines, particularly against variable escaping viruses like human immunodeficiency virus type 1 and hepatitis C virus. Here, we showed that sequential inactivation of dominant epitopes up-ranks the remaining subdominant determinants. Importantly, we demonstrated that subdominant epitopes can induce robust responses and protect against whole viruses if they are allowed at least once in the vaccination regimen to locally or temporally dominate T cell induction. Therefore, refocusing T cell immune responses away from highly variable determinants recognized during natural virus infection towards subdominant, but conserved regions is possible and merits evaluation in humans. PMID:21625575

  9. The NLRP3 Inflammasome Suppresses Protective Immunity to Gastrointestinal Helminth Infection.

    PubMed

    Alhallaf, Rafid; Agha, Zainab; Miller, Catherine M; Robertson, Avril A B; Sotillo, Javier; Croese, John; Cooper, Matthew A; Masters, Seth L; Kupz, Andreas; Smith, Nicholas C; Loukas, Alex; Giacomin, Paul R

    2018-04-24

    Inflammasomes promote immunity to microbial pathogens by regulating the function of IL-1-family cytokines such as IL-18 and IL-1β. However, the roles for inflammasomes during parasitic helminth infections remain unclear. We demonstrate that mice and humans infected with gastrointestinal nematodes display increased IL-18 secretion, which in Trichuris-infected or worm antigen-treated mice and in macrophages co-cultured with Trichuris antigens or exosome-like vesicles was dependent on the NLRP3 inflammasome. NLRP3-deficient mice displayed reduced pro-inflammatory type 1 cytokine responses and augmented protective type 2 immunity, which was reversed by IL-18 administration. NLRP3-dependent suppression of immunity partially required CD4 + cells but was apparent even in Rag1 -/- mice that lack adaptive immune cells, suggesting that NLRP3 influences both innate and adaptive immunity. These data highlight a role for NLRP3 in limiting protective immunity to helminths, suggesting that targeting the NLRP3 inflammasome may be an approach for limiting the disease burden associated with helminth infections. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. Natural T Cell–mediated Protection against Seasonal and Pandemic Influenza. Results of the Flu Watch Cohort Study

    PubMed Central

    Wang, Lili; Goonetilleke, Nilu; Fragaszy, Ellen B.; Bermingham, Alison; Copas, Andrew; Dukes, Oliver; Millett, Elizabeth R. C.; Nazareth, Irwin; Nguyen-Van-Tam, Jonathan S.; Watson, John M.; Zambon, Maria; Johnson, Anne M.; McMichael, Andrew J.

    2015-01-01

    Rationale: A high proportion of influenza infections are asymptomatic. Animal and human challenge studies and observational studies suggest T cells protect against disease among those infected, but the impact of T-cell immunity at the population level is unknown. Objectives: To investigate whether naturally preexisting T-cell responses targeting highly conserved internal influenza proteins could provide cross-protective immunity against pandemic and seasonal influenza. Methods: We quantified influenza A(H3N2) virus–specific T cells in a population cohort during seasonal and pandemic periods between 2006 and 2010. Follow-up included paired serology, symptom reporting, and polymerase chain reaction (PCR) investigation of symptomatic cases. Measurements and Main Results: A total of 1,414 unvaccinated individuals had baseline T-cell measurements (1,703 participant observation sets). T-cell responses to A(H3N2) virus nucleoprotein (NP) dominated and strongly cross-reacted with A(H1N1)pdm09 NP (P < 0.001) in participants lacking antibody to A(H1N1)pdm09. Comparison of paired preseason and post-season sera (1,431 sets) showed 205 (14%) had evidence of infection based on fourfold influenza antibody titer rises. The presence of NP-specific T cells before exposure to virus correlated with less symptomatic, PCR-positive influenza A (overall adjusted odds ratio, 0.27; 95% confidence interval, 0.11–0.68; P = 0.005, during pandemic [P = 0.047] and seasonal [P = 0.049] periods). Protection was independent of baseline antibodies. Influenza-specific T-cell responses were detected in 43%, indicating a substantial population impact. Conclusions: Naturally occurring cross-protective T-cell immunity protects against symptomatic PCR-confirmed disease in those with evidence of infection and helps to explain why many infections do not cause symptoms. Vaccines stimulating T cells may provide important cross-protective immunity. PMID:25844934

  11. Distinct Effects of Saracatinib on Memory CD8+ T-cell Differentiation

    PubMed Central

    Takai, Shinji; Sabzevari, Helen; Farsaci, Benedetto; Schlom, Jeffrey; Greiner, John W.

    2012-01-01

    Immunologic memory involving CD8+ T-cells is a hallmark of an adaptive antigen-specific immune response and comprises a critical component of protective immunity. Designing approaches that enhance long-term T-cell memory would, for the most part, fortify vaccines and enhance host protection against infectious diseases and, perhaps, cancer immunotherapy. A better understanding of the cellular programs involved in the antigen-specific T-cell response has led to new approaches that target the magnitude and quality of the memory T-cell response. Here we show that T-cells from T-cell receptor transgenic mice for the nucleoprotein of influenza virus NP68 exhibit the distinct phases priming, expansion, contraction, memory - of an antigen-specific T-cell response when exposed in vitro to the cognate peptide. Saracatinib, a specific inhibitor of Src family kinases, administered at low doses during the expansion or contraction phases, increased CD62Lhigh/CD44high central memory CD8+ T-cells and IFN-γ production, while suppressing immunity when added during the priming phase. These effects by saracatinib were not accompanied by the expected decline of Src family kinases, but were accompanied by Akt-mTOR suppression and/or mediated via another pathway. Increased central memory cells by saracatinib were recapitulated in mice using a poxvirus-based influenza vaccine, thus underscoring the importance of dose and timing of the inhibitor in the context of memory T-cell differentiation. Finally, vaccine plus saracatinib treatment showed better protection against tumor challenge. The immune-potentiating effects on CD8+ T-cells by a low dose of saracatinib might afford better protection from pathogen or cancer when combined with vaccine. PMID:22450814

  12. Bet v 1-specific T-cell receptor/forkhead box protein 3 transgenic T cells suppress Bet v 1-specific T-cell effector function in an activation-dependent manner.

    PubMed

    Schmetterer, Klaus G; Haiderer, Daniela; Leb-Reichl, Victoria M; Neunkirchner, Alina; Jahn-Schmid, Beatrice; Küng, Hans J; Schuch, Karina; Steinberger, Peter; Bohle, Barbara; Pickl, Winfried F

    2011-01-01

    Regulatory T (Treg) cells establish and maintain tolerance to self-antigens and many foreign antigens, such as allergens, by suppressing effector T-cell proliferation and function. We have previously shown that human T-cell receptor (TCR) αβ-chains specific for allergen-derived epitopes confer allergen specificity on peripheral blood T cells of individuals with and without allergy. To study the feasibility of generating allergen-specific human Treg cells by retroviral transduction of a transcription unit encoding forkhead box protein 3 (FOXP3) and allergen-specific TCR αβ-chains. cDNAs encoding the α and β-chains of a Bet v 1(142-153)-specific TCR (TCR alpha variable region 6/TCR beta variable region 20) and human FOXP3 were linked via picornaviral 2A sequences and expressed as single translational unit from an internal ribosomal entry site-green fluorescence protein-containing retroviral vector. Retrovirally transduced peripheral blood T cells were tested for expression of transgenes, Treg phenotype, and regulatory capacity toward allergen-specific effector T cells. Transduced T cells displayed a Treg phenotype with clear-cut upregulation of CD25, CD39, and cytotoxic T-lymphocyte antigen 4. The transduced cells were hyporesponsive in cytokine production and secretion and, like naturally occurring Treg cells, did not proliferate after antigen-specific or antigen-mimetic stimulation. However, proliferation was inducible upon exposure to exogenous IL-2. In coculture experiments, TRAV6(+)TRBV20(+)FOXP3(+) transgenic T cells, unlike FOXP3(+) single transgenic T cells or naturally occurring Treg cells, highly significantly suppressed T cell cytokine production and proliferation of corresponding allergen-specific effector T cells in an allergen-specific, dose-dependent manner. We demonstrate a transgenic approach to engineer human allergen-specific Treg cells that exert their regulatory function in an activation-dependent manner. Customized Treg cells might become

  13. Role of T cell death in maintaining immune tolerance during persistent viral hepatitis.

    PubMed

    Larrubia, Juan Ramón; Lokhande, Megha Uttam; García-Garzón, Silvia; Miquel, Joaquín; Subirá, Dolores; Sanz-de-Villalobos, Eduardo

    2013-03-28

    Virus-specific T cells play an important role in the resolution of hepatic infection. However, during chronic hepatitis infection these cells lack their effector functions and fail to control the virus. Hepatitis B virus and hepatitis C virus have developed several mechanisms to generate immune tolerance. One of these strategies is the depletion of virus-specific T cells by apoptosis. The immunotolerogenic liver has unique property to retain and activate naïve T cell to avoid the over reactivation of immune response against antigens which is exploited by hepatotropic viruses to persist. The deletion of the virus-specific T cells occurs by intrinsic (passive) apoptotic mechanism. The pro-apoptotic molecule Bcl-2 interacting mediator (Bim) has attracted increasing attention as a pivotal involvement in apoptosis, as a regulator of tissue homeostasis and an enhancer for the viral persistence. Here, we reviewed our current knowledge on the evidence showing critical role of Bim in viral-specific T cell death by apoptotic pathways and helps in the immune tolerance.

  14. Mechanisms Underlying Helper T cell Plasticity: Implications for Immune-mediated Disease

    PubMed Central

    Hirahara, Kiyoshi; Poholek, Amanda; Vahedi, Golnaz; Laurence, Arian; Kanno, Yuka; Milner, Joshua D.; O’Shea, John J.

    2013-01-01

    CD4 helper T cells are critical for proper immune cell homeostasis and host defense, but are also major contributes to immune and inflammatory disease. Arising from a simple, biphasic model of differentiation, Th1 and Th2 cells, a bewildering number of fates seem to possible for helper T cells. To what extent different helper cell subsets maintain their characteristic gene expression profiles or exhibit functional plasticity is a hotly debated topic. In this review, we will discuss how the expression of “signature cytokines” and “master regulator” transcription factors do not neatly conform to a simple T helper paradigm. While this may seem confusing, the good news is that the newly recognized complexity fits better with our understanding of immunopathogenesis. Finally, we will discuss factors include epigenetic regulation and metabolic alterations that contribute to helper cell specific and plasticity. PMID:23622118

  15. Effective Respiratory CD8 T-Cell Immunity to Influenza Virus Induced by Intranasal Carbomer-Lecithin-Adjuvanted Non-replicating Vaccines

    PubMed Central

    Gasper, David J.; Neldner, Brandon; Plisch, Erin H.; Rustom, Hani; Imai, Hirotaka; Kawaoka, Yoshihiro; Suresh, M.

    2016-01-01

    CD8+ cytotoxic T lymphocytes (CTLs) are critical for clearing many viral infections, and protective CTL memory can be induced by vaccination with attenuated viruses and vectors. Non-replicating vaccines are typically potentiated by the addition of adjuvants that enhance humoral responses, however few are capable of generating CTL responses. Adjuplex is a carbomer-lecithin-based adjuvant demonstrated to elicit robust humoral immunity to non-replicating antigens. We report that mice immunized with non-replicating Adjuplex-adjuvanted vaccines generated robust antigen-specific CTL responses. Vaccination by the subcutaneous or the intranasal route stimulated systemic and mucosal CTL memory respectively. However, only CTL memory induced by intranasal vaccination was protective against influenza viral challenge, and correlated with an enhancement of memory CTLs in the airways and CD103+ CD69+ CXCR3+ resident memory-like CTLs in the lungs. Mechanistically, Myd88-deficient mice mounted primary CTL responses to Adjuplex vaccines that were similar in magnitude to wild-type mice, but exhibited altered differentiation of effector cell subsets. Immune potentiating effects of Adjuplex entailed alterations in the frequency of antigen-presenting-cell subsets in vaccine draining lymph nodes, and in the lungs and airways following intranasal vaccination. Further, Adjuplex enhanced the ability of dendritic cells to promote antigen-induced proliferation of naïve CD8 T cells by modulating antigen uptake, its intracellular localization, and rate of processing. Taken together, we have identified an adjuvant that elicits both systemic and mucosal CTL memory to non-replicating antigens, and engenders protective CTL-based heterosubtypic immunity to influenza A virus in the respiratory tract. Further, findings presented in this manuscript have provided key insights into the mechanisms and factors that govern the induction and programming of systemic and protective memory CTLs in the

  16. Effective Respiratory CD8 T-Cell Immunity to Influenza Virus Induced by Intranasal Carbomer-Lecithin-Adjuvanted Non-replicating Vaccines.

    PubMed

    Gasper, David J; Neldner, Brandon; Plisch, Erin H; Rustom, Hani; Carrow, Emily; Imai, Hirotaka; Kawaoka, Yoshihiro; Suresh, M

    2016-12-01

    CD8+ cytotoxic T lymphocytes (CTLs) are critical for clearing many viral infections, and protective CTL memory can be induced by vaccination with attenuated viruses and vectors. Non-replicating vaccines are typically potentiated by the addition of adjuvants that enhance humoral responses, however few are capable of generating CTL responses. Adjuplex is a carbomer-lecithin-based adjuvant demonstrated to elicit robust humoral immunity to non-replicating antigens. We report that mice immunized with non-replicating Adjuplex-adjuvanted vaccines generated robust antigen-specific CTL responses. Vaccination by the subcutaneous or the intranasal route stimulated systemic and mucosal CTL memory respectively. However, only CTL memory induced by intranasal vaccination was protective against influenza viral challenge, and correlated with an enhancement of memory CTLs in the airways and CD103+ CD69+ CXCR3+ resident memory-like CTLs in the lungs. Mechanistically, Myd88-deficient mice mounted primary CTL responses to Adjuplex vaccines that were similar in magnitude to wild-type mice, but exhibited altered differentiation of effector cell subsets. Immune potentiating effects of Adjuplex entailed alterations in the frequency of antigen-presenting-cell subsets in vaccine draining lymph nodes, and in the lungs and airways following intranasal vaccination. Further, Adjuplex enhanced the ability of dendritic cells to promote antigen-induced proliferation of naïve CD8 T cells by modulating antigen uptake, its intracellular localization, and rate of processing. Taken together, we have identified an adjuvant that elicits both systemic and mucosal CTL memory to non-replicating antigens, and engenders protective CTL-based heterosubtypic immunity to influenza A virus in the respiratory tract. Further, findings presented in this manuscript have provided key insights into the mechanisms and factors that govern the induction and programming of systemic and protective memory CTLs in the

  17. Oral Vaccination with Lipid-Formulated BCG Induces a Long-lived, Multifunctional CD4+ T Cell Memory Immune Response

    PubMed Central

    Ancelet, Lindsay R.; Aldwell, Frank E.; Rich, Fenella J.; Kirman, Joanna R.

    2012-01-01

    Oral delivery of BCG in a lipid formulation (Liporale™-BCG) targets delivery of viable bacilli to the mesenteric lymph nodes and confers protection against an aerosol Mycobacterium tuberculosis challenge. The magnitude, quality and duration of the effector and memory immune response induced by Liporale™-BCG vaccination is unknown. Therefore, we compared the effector and memory CD4+ T cell response in the spleen and lungs of mice vaccinated with Liporale™-BCG to the response induced by subcutaneous BCG vaccination. Liporale™-BCG vaccination induced a long-lived CD4+ T cell response, evident by the detection of effector CD4+ T cells in the lungs and a significant increase in the number of Ag85B tetramer-specific CD4+ T cells in the spleen up to 30 weeks post vaccination. Moreover, following polyclonal stimulation, Liporale™-BCG vaccination, but not s.c. BCG vaccination, induced a significant increase in both the percentage of CD4+ T cells in the lungs capable of producing IFNγ and the number of multifunctional CD4+ T cells in the lungs at 30 weeks post vaccination. These results demonstrate that orally delivered Liporale™-BCG vaccine induces a long-lived multifunctional immune response, and could therefore represent a practical and effective means of delivering novel BCG-based TB vaccines. PMID:23049885

  18. Strategy for eliciting antigen-specific CD8+ T cell-mediated immune response against a cryptic CTL epitope of merkel cell polyomavirus large T antigen

    PubMed Central

    2012-01-01

    Background Merkel cell carcinoma (MCC) is a relatively new addition to the expanding category of oncovirus-induced cancers. Although still comparably rare, the number of cases has risen dramatically in recent years. Further complicating this trend is that MCC is an extremely aggressive neoplasm with poor patient prognosis and limited treatment options for advanced disease. The causative agent of MCC has been identified as the merkel cell polyomavirus (MCPyV). The MCPyV-encoded large T (LT) antigen is an oncoprotein that is theorized to be essential for virus-mediated tumorigenesis and is therefore, an excellent MCC antigen for the generation of antitumor immune responses. As a foreign antigen, the LT oncoprotein avoids the obstacle of immune tolerance, which normally impedes the development of antitumor immunity. Ergo, it is an excellent target for anti-MCC immunotherapy. Since tumor-specific CD8+ T cells lead to better prognosis for MCC and numerous other cancers, we have generated a DNA vaccine that is capable of eliciting LT-specific CD8+ T cells. The DNA vaccine (pcDNA3-CRT/LT) encodes the LT antigen linked to a damage-associated molecular pattern, calreticulin (CRT), as it has been demonstrated that the linkage of CRT to antigens promotes the induction of antigen-specific CD8+ T cells. Results The present study shows that DNA vaccine-induced generation of LT-specific CD8+ T cells is augmented by linking CRT to the LT antigen. This is relevant since the therapeutic effects of the pcDNA3-CRT/LT DNA vaccine is mediated by LT-specific CD8+ T cells. Mice vaccinated with the DNA vaccine produced demonstrably more LT-specific CD8+ T cells. The DNA vaccine was also able to confer LT-specific CD8+ T cell-mediated protective and therapeutic effects to prolong the survival of mice with LT-expressing tumors. In the interest of determining the LT epitope which most MCC-specific CD8+ T cells recognize, we identified the amino acid sequence of the immunodominant LT epitope

  19. B cells and TCR avidity determine distinct functions of CD4+ T cells in retroviral infection1

    PubMed Central

    Ploquin, Mickaël J-Y; Eksmond, Urszula; Kassiotis, George

    2011-01-01

    The T-cell-dependent B-cell response relies on cognate interaction between B cells and CD4+ Th cells. However, the consequences of this interaction for CD4+ T cells are not entirely known. B cells generally promote CD4+ T-cell responses to pathogens, albeit to a variable degree. In contrast, CD4+ T-cell responses to self or tumor antigens are often suppressed by B cells. Here we demonstrated that interaction with B cells dramatically inhibited the function of virus-specific CD4+ T cells in retroviral infection. We have used Friend virus (FV) infection of mice as a model for retroviral infection, in which the behavior of virus-specific CD4+ T cells was monitored according to their TCR avidity. We report that avidity for antigen and interaction with B cells determine distinct aspects of the primary CD4+ T-cell response to FV infection. Virus-specific CD4+ T cells followed exclusive Th1 and T follicular helper (Tfh) differentiation. High avidity for antigen facilitated expansion during priming and enhanced the capacity for IFN-γ and IL-21 production. In contrast, Tfh differentiation was not affected by avidity for antigen. By reducing or preventing B-cell interaction we found that B cells promoted Tfh differentiation, induced programmed death 1 (PD-1) expression and inhibited IFN-γ production by virus-specific CD4+ T cells. Ultimately, B cells protected hosts from CD4+ T-cell-mediated immune pathology, at the detriment of CD4+ T-cell-mediated protective immunity. Our results suggest that B-cell presentation of vaccine antigens could be manipulated to direct the appropriate CD4+ T-cell response. PMID:21841129

  20. HIV-TB coinfection impairs CD8(+) T-cell differentiation and function while dehydroepiandrosterone improves cytotoxic antitubercular immune responses.

    PubMed

    Suarez, Guadalupe V; Angerami, Matías T; Vecchione, María B; Laufer, Natalia; Turk, Gabriela; Ruiz, Maria J; Mesch, Viviana; Fabre, Bibiana; Maidana, Patricia; Ameri, Diego; Cahn, Pedro; Sued, Omar; Salomón, Horacio; Bottasso, Oscar A; Quiroga, María F

    2015-09-01

    Tuberculosis (TB) is the leading cause of death among HIV-positive patients. The decreasing frequencies of terminal effector (TTE ) CD8(+) T cells may increase reactivation risk in persons latently infected with Mycobacterium tuberculosis (Mtb). We have previously shown that dehydroepiandrosterone (DHEA) increases the protective antitubercular immune responses in HIV-TB patients. Here, we aimed to study Mtb-specific cytotoxicity, IFN-γ secretion, memory status of CD8(+) T cells, and their modulation by DHEA during HIV-TB coinfection. CD8(+) T cells from HIV-TB patients showed a more differentiated phenotype with diminished naïve and higher effector memory and TTE T-cell frequencies compared to healthy donors both in total and Mtb-specific CD8(+) T cells. Notably, CD8(+) T cells from HIV-TB patients displayed higher Terminal Effector (TTE ) CD45RA(dim) proportions with lower CD45RA expression levels, suggesting a not fully differentiated phenotype. Also, PD-1 expression levels on CD8(+) T cells from HIV-TB patients increased although restricted to the CD27(+) population. Interestingly, DHEA plasma levels positively correlated with TTE in CD8(+) T cells and in vitro DHEA treatment enhanced Mtb-specific cytotoxic responses and terminal differentiation in CD8(+) T cells from HIV-TB patients. Our data suggest that HIV-TB coinfection promotes a deficient CD8(+) T-cell differentiation, whereas DHEA may contribute to improving antitubercular immunity by enhancing CD8(+) T-cell functions during HIV-TB coinfection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Regulatory T cells protect mice against coxsackievirus-induced myocarditis through the transforming growth factor beta-coxsackie-adenovirus receptor pathway.

    PubMed

    Shi, Yu; Fukuoka, Masahiro; Li, Guohua; Liu, Youan; Chen, Manyin; Konviser, Michael; Chen, Xin; Opavsky, Mary Anne; Liu, Peter P

    2010-06-22

    Coxsackievirus B3 infection is an excellent model of human myocarditis and dilated cardiomyopathy. Cardiac injury is caused either by a direct cytopathic effect of the virus or through immune-mediated mechanisms. Regulatory T cells (Tregs) play an important role in the negative modulation of host immune responses and set the threshold of autoimmune activation. This study was designed to test the protective effects of Tregs and to determine the underlying mechanisms. Carboxyfluorescein diacetate succinimidyl ester-labeled Tregs or naïve CD4(+) T cells were injected intravenously once every 2 weeks 3 times into mice. The mice were then challenged with intraperitoneal coxsackievirus B3 immediately after the last cell transfer. Transfer of Tregs showed higher survival rates than transfer of CD4(+) T cells (P=0.0136) but not compared with the PBS injection group (P=0.0589). Interestingly, Tregs also significantly decreased virus titers and inflammatory scores in the heart. Transforming growth factor-beta and phosphorylated AKT were upregulated in Tregs-transferred mice and coxsackie-adenovirus receptor expression was decreased in the heart compared with control groups. Transforming growth factor-beta decreased coxsackie-adenovirus receptor expression and inhibited coxsackievirus B3 infection in HL-1 cells and neonatal cardiac myocytes. Splenocytes collected from Treg-, CD4(+) T-cell-, and PBS-treated mice proliferated equally when stimulated with heat-inactivated virus, whereas in the Treg group, the proliferation rate was reduced significantly when stimulated with noninfected heart tissue homogenate. Adoptive transfer of Tregs protected mice from coxsackievirus B3-induced myocarditis through the transforming growth factor beta-coxsackie-adenovirus receptor pathway and thus suppresses the immune response to cardiac tissue, maintaining the antiviral immune response.

  2. Incorporation of Immune Checkpoint Blockade into Chimeric Antigen Receptor T Cells (CAR-Ts): Combination or Built-In CAR-T

    PubMed Central

    Yoon, Dok Hyun; Osborn, Mark J.; Tolar, Jakub; Kim, Chong Jai

    2018-01-01

    Chimeric antigen receptor (CAR) T cell therapy represents the first U.S. Food and Drug Administration approved gene therapy and these engineered cells function with unprecedented efficacy in the treatment of refractory CD19 positive hematologic malignancies. CAR translation to solid tumors is also being actively investigated; however, efficacy to date has been variable due to tumor-evolved mechanisms that inhibit local immune cell activity. To bolster the potency of CAR-T cells, modulation of the immunosuppressive tumor microenvironment with immune-checkpoint blockade is a promising strategy. The impact of this approach on hematological malignancies is in its infancy, and in this review we discuss CAR-T cells and their synergy with immune-checkpoint blockade. PMID:29364163

  3. Mucosal immunity and novel tuberculosis vaccine strategies: route of immunisation-determined T-cell homing to restricted lung mucosal compartments.

    PubMed

    Lai, Rocky; Afkhami, Sam; Haddadi, Siamak; Jeyanathan, Mangalakumari; Xing, Zhou

    2015-06-01

    Despite the use of bacille Calmette-Guérin (BCG) for almost a century, pulmonary tuberculosis (TB) continues to be a serious global health concern. Therefore, there has been a pressing need for the development of new booster vaccines to enhance existing BCG-induced immunity. Protection following mucosal intranasal immunisation with AdHu5Ag85A is associated with the localisation of antigen-specific T-cells to the lung airway. However, parenteral intramuscular immunisation is unable to provide protection despite the apparent presence of antigen-specific T-cells in the lung interstitium. Recent advances in intravascular staining have allowed us to reassess the previously established T-cell distribution profile and its relationship with the observed differential protection. Respiratory mucosal immunisation empowers T-cells to home to both the lung interstitium and the airway lumen, whereas intramuscular immunisation-activated T-cells are largely trapped within the pulmonary vasculature, unable to populate the lung interstitium and airway. Given the mounting evidence supporting the safety and enhanced efficacy of respiratory mucosal immunisation over the traditional parenteral immunisation route, a greater effort should be made to clinically develop respiratory mucosal-deliverable TB vaccines. Copyright ©ERS 2015.

  4. CD8+ T cells of chronic HCV-infected patients express multiple negative immune checkpoints following stimulation with HCV peptides.

    PubMed

    Barathan, Muttiah; Mohamed, Rosmawati; Vadivelu, Jamuna; Chang, Li Yen; Vignesh, Ramachandran; Krishnan, Jayalakshmi; Sigamani, Panneer; Saeidi, Alireza; Ram, M Ravishankar; Velu, Vijayakumar; Larsson, Marie; Shankar, Esaki M

    2017-03-01

    Hepatitis C virus (HCV)-specific CD4+ and CD8+ T cells are key to successful viral clearance in HCV disease. Accumulation of exhausted HCV-specific T cells during chronic infection results in considerable loss of protective functional immune responses. The role of T-cell exhaustion in chronic HCV disease remains poorly understood. Here, we studied the frequency of HCV peptide-stimulated T cells expressing negative immune checkpoints (PD-1, CTLA-4, TRAIL, TIM-3 and BTLA) by flow cytometry, and measured the levels of Th1/Th2/Th17 cytokines secreted by T cells by a commercial Multi-Analyte ELISArray™ following in vitro stimulation of T cells using HCV peptides and phytohemagglutinin (PHA). HCV peptide-stimulated CD4+ and CD8+ T cells of chronic HCV (CHC) patients showed significant increase of CTLA-4. Furthermore, HCV peptide-stimulated CD4+ T cells of CHC patients also displayed relatively higher levels of PD-1 and TRAIL, whereas TIM-3 was up-regulated on HCV peptide-stimulated CD8+ T cells. Whereas the levels of IL-10 and TGF-β1 were significantly increased, the levels of pro-inflammatory cytokines IL-2, TNF-α, IL-17A and IL-6 were markedly decreased in the T cell cultures of CHC patients. Chronic HCV infection results in functional exhaustion of CD4+ and CD8+ T cells likely contributing to viral persistence. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Desirable cytolytic immune effector cell recruitment by interleukin-15 dendritic cells.

    PubMed

    Van Acker, Heleen H; Beretta, Ottavio; Anguille, Sébastien; De Caluwé, Lien; Papagna, Angela; Van den Bergh, Johan M; Willemen, Yannick; Goossens, Herman; Berneman, Zwi N; Van Tendeloo, Viggo F; Smits, Evelien L; Foti, Maria; Lion, Eva

    2017-02-21

    Success of dendritic cell (DC) therapy in treating malignancies is depending on the DC capacity to attract immune effector cells, considering their reciprocal crosstalk is partially regulated by cell-contact-dependent mechanisms. Although critical for therapeutic efficacy, immune cell recruitment is a largely overlooked aspect regarding optimization of DC vaccination. In this paper we have made a head-to-head comparison of interleukin (IL)-15-cultured DCs and conventional IL-4-cultured DCs with regard to their proficiency in the recruitment of (innate) immune effector cells. Here, we demonstrate that IL-4 DCs are suboptimal in attracting effector lymphocytes, while IL15 DCs provide a favorable chemokine milieu for recruiting CD8+ T cells, natural killer (NK) cells and gamma delta (γδ) T cells. Gene expression analysis revealed that IL-15 DCs exhibit a high expression of chemokines involved in antitumor immune effector cell attraction, while IL-4 DCs display a more immunoregulatory profile characterized by the expression of Th2 and regulatory T cell-attracting chemokines. This is confirmed by functional data indicating an enhanced recruitment of granzyme B+ effector lymphocytes by IL-15 DCs, as compared to IL-4 DCs, and subsequent superior killing of tumor cells by the migrated lymphocytes. Elevated CCL4 gene expression in IL-15 DCs and lowered CCR5 expression on both migrated γδ T cells and NK cells, led to validation of increased CCL4 secretion by IL15 DCs. Moreover, neutralization of CCR5 prior to migration resulted in an important inhibition of γδ T cell and NK cell recruitment by IL-15 DCs. These findings further underscore the strong immunotherapeutic potential of IL-15 DCs.

  6. CD4+ T-Cell-Independent Secondary Immune Responses to Pneumocystis Pneumonia

    PubMed Central

    de la Rua, Nicholas M.; Samuelson, Derrick R.; Charles, Tysheena P.; Welsh, David A.; Shellito, Judd E.

    2016-01-01

    Pneumocystis pneumonia is a major cause of morbidity and mortality among immunocompromised patients, especially in the context of HIV/AIDS. In the murine model of Pneumocystis pneumonia, CD4+ T-cells are required for clearance of a primary infection of Pneumocystis, but not the memory recall response. We hypothesized that the memory recall response in the absence of CD4+ T-cells is mediated by a robust memory humoral response, CD8+ T-cells, and IgG-mediated phagocytosis by alveolar macrophages. To investigate the role of CD8+ T-cells and alveolar macrophages in the immune memory response to Pneumocystis, mice previously challenged with Pneumocystis were depleted of CD8+ T-cells or alveolar macrophages prior to re-infection. Mice depleted of CD4+ T-cells prior to secondary challenge cleared Pneumocystis infection within 48 h identical to immunocompetent mice during a secondary memory recall response. However, loss of CD8+ T-cells or macrophages prior to the memory recall response significantly impaired Pneumocystis clearance. Specifically, mice depleted of CD8+ T-cells or alveolar macrophages had significantly higher fungal burden in the lungs. Furthermore, loss of alveolar macrophages significantly skewed the lung CD8+ T-cell response toward a terminally differentiated effector memory population and increased the percentage of IFN-γ+ CD8+ T-cells. Finally, Pneumocystis-infected animals produced significantly more bone marrow plasma cells and Pneumocystis-specific IgG significantly increased macrophage-mediated killing of Pneumocystis in vitro. These data suggest that secondary immune memory responses to Pneumocystis are mediated, in part, by CD8+ T-cells, alveolar macrophages, and the production of Pneumocystis-specific IgG. PMID:27242785

  7. Aryl Hydrocarbon Receptor Promotes RORγt+ ILCs and Controls Intestinal Immunity and Inflammation

    PubMed Central

    Qiu, Ju; Zhou, Liang

    2013-01-01

    Unlike adaptive immune cells that require antigen recognition and functional maturation during infection, innate lymphoid cells (ILCs) usually respond to pathogens promptly and serve as the first line of defense in infectious diseases. RAR-related orphan receptors (RORγt)+ ILCs are one of the innate cell populations that have recently been intensively studied. During the fetal stage of development, RORγt+ ILCs (e.g., lymphoid tissue inducer-LTi cells) are required for lymphoid organogenesis. In adult mice, RORγt+ ILCs are abundantly present in the gut to exert immune defensive functions. Under certain circumstances, however, RORγt+ ILCs can be pathogenic and contribute to intestinal inflammation. Aryl hydrocarbon receptor (Ahr), a ligand-dependent transcriptional factor, is widely expressed by various immune and non-immune cells. In the gut, the ligand for Ahr can be derived/generated from diet, microflora, and/or host cells. Ahr has been shown to regulate different cell populations in the immune system including RORγt+ ILCs, T helper (Th)17/22 cells, γδT cells, regulatory T cells (Tregs), Tr1 cells, and antigen presenting cells (APCs). In this review, we will focus on the development and function of RORγt+ ILCs, and discuss the role of Ahr in intestinal immunity and inflammation in mice and in humans. Better understanding the function of Ahr in the gut is important for developing new therapeutic means to target Ahr in future treatment of infectious and autoimmune diseases. PMID:23975386

  8. Bee venom phospholipase A2 induces a primary type 2 response that is dependent on the receptor ST2 and confers protective immunity

    PubMed Central

    Palm, Noah W.; Rosenstein, Rachel K.; Yu, Shuang; Schenten, Dominik; Florsheim, Esther; Medzhitov, Ruslan

    2013-01-01

    SUMMARY Venoms consist of toxic components that are delivered to their victims via bites or stings. Venoms also represent a major class of allergens in humans. Phospholipase A2 (PLA2) is a conserved component of venoms from multiple species and is the major allergen in bee venom. Here we examined how bee venom PLA2 is sensed by the innate immune system and induces a type 2 immune response in mice. We found that bee venom PLA2 induced a T helper type 2 (Th2) cell-type response and group 2 innate lymphoid cell activation via the enzymatic cleavage of membrane phospholipids and release of interleukin-33. Furthermore, we showed that the IgE response to PLA2 could protect mice from future challenge with a near-lethal dose of PLA2. These data suggest that the innate immune system can detect the activity of a conserved component of venoms and induce a protective immune response against a venom toxin. PMID:24210353

  9. Regulatory T cells in atherosclerosis: critical immune regulatory function and therapeutic potential.

    PubMed

    Spitz, Charlotte; Winkels, Holger; Bürger, Christina; Weber, Christian; Lutgens, Esther; Hansson, Göran K; Gerdes, Norbert

    2016-03-01

    Atherosclerosis is a chronic inflammatory disease that is mediated by innate and adaptive immune responses. The disease is characterized by sub-endothelial accumulation and modification of lipids in the artery wall triggering an inflammatory reaction which promotes lesion progression and eventual plaque rupture, thrombus formation, and the respective clinical sequelae such as myocardial infarction or stroke. During the past decade, T-cell-mediated immune responses, especially control of pro-inflammatory signals by regulatory T cells (Tregs), have increasingly attracted the interest of experimental and clinical researchers. By suppression of T cell proliferation and secretion of anti-inflammatory cytokines, such as interleukin-10 (IL-10) and transforming growth factor-β, Tregs exert their atheroprotective properties. Atherosclerosis-prone, hyperlipidemic mice harbor systemically less Tregs compared to wild-type mice, suggesting an imbalance of immune cells which affects local and systemic inflammatory and potentially metabolic processes leading to atherogenesis. Restoring or increasing Treg frequency and enhancing their suppressive capacity by various modulations may pose a promising approach for treating inflammatory conditions such as cardiovascular diseases. In this review, we briefly summarize the immunological basics of atherosclerosis and introduce the role and contribution of different subsets of T cells. We then discuss experimental data and current knowledge pertaining to Tregs in atherosclerosis and perspectives on manipulating the adaptive immune system to alleviate atherosclerosis and cardiovascular disease.

  10. CD147 stimulates hepatoma cells escaping from immune surveillance of T cells by interaction with Cyclophilin A.

    PubMed

    Ren, Yi-Xin; Wang, Shu-Jing; Fan, Jian-Hui; Sun, Shi-Jie; Li, Xia; Padhiar, Arshad Ahmed; Zhang, Jia-Ning

    2016-05-01

    T cells play an important role in tumor immune surveillance. CD147 is a member of immunoglobulin superfamily present on the surface of many tumor cells and mediates malignant cell behaviors. Cyclophilin A (CypA) is an intracellular protein promoting inflammation when released from cells. CypA is a natural ligand for CD147. In this study, CD147 specific short hairpin RNAs (shRNA) were transfected into murine hepatocellular carcinoma Hepa1-6 cells to assess the effects of CD147 on hepatoma cells escaping from immune surveillance of T cells. We found extracellular CypA stimulated cell proliferation through CD147 by activating ERK1/2 signaling pathway. Downregulation of CD147 expression on Hepa1-6 cells significantly suppressed tumor progression in vivo, and decreased cell viability when co-cultured with T cells in vitro. Importantly, knockdown of CD147 on Hepa1-6 cells resulted in significantly increased T cells chemotaxis induced by CypA both in vivo and in vitro. These findings provide novel mechanisms how tumor cells escaping from immune surveillance of T cells. We provide a potential therapy for hepatocellular carcinoma by targeting CD147 or CD147-CypA interactions. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Selective T-cell depletion targeting CD45RA reduces viremia and enhances early T-cell recovery compared with CD3-targeted T-cell depletion.

    PubMed

    Triplett, Brandon M; Muller, Brad; Kang, Guolian; Li, Ying; Cross, Shane J; Moen, Joseph; Cunningham, Lea; Janssen, William; Mamcarz, Ewelina; Shook, David R; Srinivasan, Ashok; Choi, John; Hayden, Randall T; Leung, Wing

    2018-02-01

    T-cell depletion (TCD) effectively reduces severe graft-versus-host disease in recipients of HLA-mismatched allografts. However, TCD is associated with delayed immune recovery and increased infections. We hypothesized that specific depletion of CD45RA+ naive T cells, rather than broad depletion of CD3+ T cells, can preserve memory-immunity in the allografts and confer protection against important viral infections in the early post-transplant period. Sixty-seven patients who received TCD haploidentical donor transplantation for hematologic malignancy on 3 consecutive trials were analyzed. Patients receiving CD45RA-depleted donor grafts had 2000-fold more donor T cells infused, significantly higher T-cell counts at Day +30 post transplant (550/μL vs 10/μL; P < .001), and higher T-cell diversity by Vbeta spectratyping at Day +100 (P < .001). Importantly, these recipients experienced a significant reduction in both the incidence (P = .002) and duration (P = .02) of any viremia (cytomegalovirus, Epstein-Barr virus, or adenovirus) in the first 6 months post transplant. Specifically, recipients of CD3-depleted grafts were more likely to experience adenovirus viremia (27% vs 4%, P = .02). CD45RA-depletion provided a large number of donor memory T cells to the recipients and was associated with enhanced early T-cell recovery and protection against viremia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Prior Dengue virus exposure shapes T cell immunity to Zika virus in humans.

    PubMed

    Grifoni, Alba; Pham, John; Sidney, John; O'Rourke, Patrick H; Paul, Sinu; Peters, Bjoern; Martini, Sheridan R; de Silva, Aruna D; Ricciardi, Michael J; Magnani, Diogo M; Silveira, Cassia G T; Maestri, Alvino; Costa, Priscilla R; de-Oliveira-Pinto, Luzia Maria; de Azeredo, Elzinandes Leal; Damasco, Paulo Vieira; Phillips, Elizabeth; Mallal, Simon; de Silva, Aravinda M; Collins, Matthew; Durbin, Anna; Diehl, Sean A; Cerpas, Cristhiam; Balmaseda, Angel; Kuan, Guillermina; Coloma, Josefina; Harris, Eva; Crowe, James E; Stone, Mars; Norris, Phillip J; Busch, Michael; Vivanco-Cid, Hector; Cox, Josephine; Graham, Barney S; Ledgerwood, Julie E; Turtle, Lance; Solomon, Tom; Kallas, Esper G; Watkins, David I; Weiskopf, Daniela; Sette, Alessandro

    2017-10-04

    While progress has been made in characterizing humoral immunity to Zika virus (ZIKV) in humans, little is known regarding the corresponding T cell responses to ZIKV. Here we investigate the kinetics and viral epitopes targeted by T cells responding to ZIKV and address the critical question of whether pre-existing dengue virus (DENV) T cell immunity modulates these responses. We find that memory T cell responses elicited by prior infection with DENV or vaccination with Tetravalent Dengue Attenuated Vaccines (TDLAV) recognize ZIKV-derived peptides. This cross-reactivity is explained by the sequence similarity of the two viruses, as the ZIKV peptides recognized by DENV-elicited memory T cells are identical or highly conserved in DENV and ZIKV. DENV exposure prior to ZIKV infection also influences the timing and magnitude of the T cell response. ZIKV-reactive T cells in the acute phase of infection are detected earlier and in greater magnitude in DENV-immune patients. Conversely, the frequency of ZIKV-reactive T cells continues to rise in the convalescent phase in DENV-naive donors, but declines in DENV pre-exposed donors, compatible with more efficient control of ZIKV replication and/or clearance of ZIKV antigen. The quality of responses is also influenced by previous DENV exposure, and ZIKV-specific CD8 T cells form DENV pre-exposed donors selectively up-regulated granzyme B and PD1, as compared to DENV-naïve donors. Finally, we discovered that ZIKV structural proteins (E, prM and C) are major targets of both the CD4 and CD8 T cell responses, whereas DENV T cell epitopes are found primarily in nonstructural proteins. IMPORTANCE The issue of potential ZIKV and DENV cross-reactivity and how pre-existing DENV T cell immunity modulates ZIKA T cell responses is of great relevance as the two viruses often co-circulate and ZIKA virus has been spreading in geographical regions where DENV is endemic or hyper-endemic. Our data show that memory T cell responses elicited by

  13. The Rho regulator Myosin IXb enables nonlymphoid tissue seeding of protective CD8+ T cells.

    PubMed

    Moalli, Federica; Ficht, Xenia; Germann, Philipp; Vladymyrov, Mykhailo; Stolp, Bettina; de Vries, Ingrid; Lyck, Ruth; Balmer, Jasmin; Fiocchi, Amleto; Kreutzfeldt, Mario; Merkler, Doron; Iannacone, Matteo; Ariga, Akitaka; Stoffel, Michael H; Sharpe, James; Bähler, Martin; Sixt, Michael; Diz-Muñoz, Alba; Stein, Jens V

    2018-06-06

    T cells are actively scanning pMHC-presenting cells in lymphoid organs and nonlymphoid tissues (NLTs) with divergent topologies and confinement. How the T cell actomyosin cytoskeleton facilitates this task in distinct environments is incompletely understood. Here, we show that lack of Myosin IXb (Myo9b), a negative regulator of the small GTPase Rho, led to increased Rho-GTP levels and cell surface stiffness in primary T cells. Nonetheless, intravital imaging revealed robust motility of Myo9b -/- CD8 + T cells in lymphoid tissue and similar expansion and differentiation during immune responses. In contrast, accumulation of Myo9b -/- CD8 + T cells in NLTs was strongly impaired. Specifically, Myo9b was required for T cell crossing of basement membranes, such as those which are present between dermis and epidermis. As consequence, Myo9b -/- CD8 + T cells showed impaired control of skin infections. In sum, we show that Myo9b is critical for the CD8 + T cell adaptation from lymphoid to NLT surveillance and the establishment of protective tissue-resident T cell populations. © 2018 Moalli et al.

  14. Persistence and Adaptation in Immunity: T Cells Balance the Extent and Thoroughness of Search

    PubMed Central

    Fricke, G. Matthew; Letendre, Kenneth A.; Moses, Melanie E.; Cannon, Judy L.

    2016-01-01

    Effective search strategies have evolved in many biological systems, including the immune system. T cells are key effectors of the immune response, required for clearance of pathogenic infection. T cell activation requires that T cells encounter antigen-bearing dendritic cells within lymph nodes, thus, T cell search patterns within lymph nodes may be a crucial determinant of how quickly a T cell immune response can be initiated. Previous work suggests that T cell motion in the lymph node is similar to a Brownian random walk, however, no detailed analysis has definitively shown whether T cell movement is consistent with Brownian motion. Here, we provide a precise description of T cell motility in lymph nodes and a computational model that demonstrates how motility impacts T cell search efficiency. We find that both Brownian and Lévy walks fail to capture the complexity of T cell motion. Instead, T cell movement is better described as a correlated random walk with a heavy-tailed distribution of step lengths. Using computer simulations, we identify three distinct factors that contribute to increasing T cell search efficiency: 1) a lognormal distribution of step lengths, 2) motion that is directionally persistent over short time scales, and 3) heterogeneity in movement patterns. Furthermore, we show that T cells move differently in specific frequently visited locations that we call “hotspots” within lymph nodes, suggesting that T cells change their movement in response to the lymph node environment. Our results show that like foraging animals, T cells adapt to environmental cues, suggesting that adaption is a fundamental feature of biological search. PMID:26990103

  15. A recombinant chimeric Ad5/3 vector expressing a multi-stage Plasmodium antigen induces protective immunity in mice using heterologous prime-boost immunization regimens1

    PubMed Central

    Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Zhao, Chunxia; Makarova, Natalia; Dmitriev, Igor; Curiel, David T.; Blackwell, Jerry; Moreno, Alberto

    2016-01-01

    An ideal malaria vaccine should target several stages of the parasite life cycle and induce anti-parasite and anti-disease immunity. We have reported a Plasmodium yoelii chimeric multi-stage recombinant protein (PyLPC/RMC), engineered to express several autologous T cell epitopes and sequences derived from the circumsporozoite protein (CSP) and the merozoite surface protein 1 (MSP-1). This chimeric protein elicits protective immunity, mediated by CD4+ T cells and neutralizing antibodies. However, experimental evidence from pre-erythrocytic vaccine candidates and irradiated sporozoites has shown that CD8+ T cells play a significant role in protection. Recombinant viral vectors have been used as a vaccine platform to elicit effective CD8+ T cell responses. The human adenovirus serotype 5 (Ad5) has been tested in malaria vaccine clinical trials with excellent safety profile. Nevertheless, a major concern for the use of Ad5 is the high prevalence of anti-vector neutralizing antibodies in humans, hampering its immunogenicity. To minimize the impact of anti-vector pre-existing immunity we developed a chimeric Ad5/3 vector in which the knob region of Ad5 was replaced with that of Ad3, conferring partial resistance to anti-Ad5 neutralizing antibodies. Furthermore, we implemented heterologous adenovirus/protein immunization regimens which include a single immunization with recombinant Ad vectors. Our data show that immunization with the recombinant Ad5/3 vector induces protective efficacy indistinguishable from that elicited by Ad5. Our study also demonstrate that the dose of the Ad vectors has an impact on the memory profile and protective efficacy. The results support further studies with Ad5/3 for malaria vaccine development. PMID:27574299

  16. Regulatory T cells as suppressors of anti-tumor immunity: Role of metabolism.

    PubMed

    De Rosa, Veronica; Di Rella, Francesca; Di Giacomo, Antonio; Matarese, Giuseppe

    2017-06-01

    Novel concepts in immunometabolism support the hypothesis that glucose consumption is also used to modulate anti-tumor immune responses, favoring growth and expansion of specific cellular subsets defined in the past as suppressor T cells and currently reborn as regulatory T (Treg) cells. During the 1920s, Otto Warburg and colleagues observed that tumors consumed high amounts of glucose compared to normal tissues, even in the presence of oxygen and completely functioning mitochondria. However, the role of the Warburg Effect is still not completely understood, particularly in the context of an ongoing anti-tumor immune response. Current experimental evidence suggests that tumor-derived metabolic restrictions can drive T cell hyporesponsiveness and immune tolerance. For example, several glycolytic enzymes, deregulated in cancer, contribute to tumor progression independently from their canonical metabolic activity. Indeed, they can control apoptosis, gene expression and activation of specific intracellular pathways, thus suggesting a direct link between metabolic switches and pro-tumorigenic transcriptional programs. Focus of this review is to define the specific metabolic pathways controlling Treg cell immunobiology in the context of anti-tumor immunity and tumor progression. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Enhancing T cell activation and antiviral protection by introducing the HIV-1 protein transduction domain into a DNA vaccine.

    PubMed

    Leifert, J A; Lindencrona, J A; Charo, J; Whitton, J L

    2001-10-10

    Protein transduction domains (PTD), which can transport proteins or peptides across biological membranes, have been identified in several proteins of viral, invertebrate, and vertebrate origin. Here, we evaluate the immunological and biological consequences of including PTD in synthetic peptides and in DNA vaccines that contain CD8(+) T cell epitopes from lymphocytic choriomeningitis virus (LCMV). Synthetic PTD-peptides did not induce detectable CD8(+) T cell responses. However, fusion of an open reading frame encoding a PTD to an epitope minigene caused transfected tissue culture cells to stimulate epitope-specific T cells much more effectively. Kinetic studies indicated that the epitope reached the surface of transfected cells more rapidly and that the number of transfected cells needed to stimulate T cell responses was reduced by 35- to 50-fold when compared to cells transfected with a standard minigene plasmid. The mechanism underlying the effect of PTD linkage is not clear, but transit of the PTD-attached epitope from transfected cells to nontransfected cells (cross presentation) seemed to play, at most, a minimal role. Mice immunized once with the plasmid encoding the PTD-linked epitope showed a markedly accelerated CD8(+) T cell response and, unlike mice immunized with a standard plasmid, were completely protected against a normally lethal LCMV challenge administered only 8 days post-immunization.

  18. Development of a co-culture of keratinocytes and immune cells for in vitro investigation of cutaneous sulfur mustard toxicity.

    PubMed

    Balszuweit, Frank; Menacher, Georg; Bloemeke, Brunhilde; Schmidt, Annette; Worek, Franz; Thiermann, Horst; Steinritz, Dirk

    2014-11-05

    Sulfur mustard (SM) is a chemical warfare agent causing skin blistering, ulceration and delayed wound healing. Inflammation and extrinsic apoptosis are known to have an important role in SM-induced cytotoxicity. As immune cells are involved in those processes, they may significantly modulate SM toxicity, but the extent of those effects is unknown. We adapted a co-culture model of immortalized keratinocytes (HaCaT) and immune cells (THP-1) and exposed this model to SM. Changes in necrosis, apoptosis and inflammation, depending on SM challenge, absence or presence and number of THP-1 cells were investigated. THP-1 were co-cultured for 24h prior to SM exposure in order to model SM effects on immune cells continuously present in the skin. Our results indicate that the presence of THP-1 strongly increased necrosis, apoptosis and inflammation. This effect was already significant when the ratio of THP-1 and HaCaT cells was similar to the ratio of Langerhans immune cells and keratinocytes in vivo. Any further increases in the number of THP-1 had only slight additional effects on SM-induced cytotoxicity. In order to assess the effects of immune cells migrating into skin areas damaged by SM, we added non-exposed THP-1 to SM-exposed HaCaT. Those THP-1 had only slight effects on SM-induced cytotoxicity. Notably, in HaCaT exposed to 300μM SM, necrosis and inflammation were slightly reduced by adding intact THP-1. This effect was dependent on the number of immune cells, steadily increasing with the number of unexposed THP-1 added. In summary, we have demonstrated that (a) the presented co-culture is a robust model to assess SM toxicity and can be used to test the efficacy of potential antidotes in vitro; (b) immune cells, damaged by SM strongly amplified cytotoxicity, (c) in contrast, unexposed THP-1 (simulating migration of immune cells into affected areas after exposure in vivo) had no pronounced adverse, but exhibited some protective effects. Thus, protecting immune cells

  19. A prime-boost immunization regimen based on a simian adenovirus 36 vectored multi-stage malaria vaccine induces protective immunity in mice.

    PubMed

    Fonseca, Jairo A; McCaffery, Jessica N; Kashentseva, Elena; Singh, Balwan; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto

    2017-05-31

    Malaria remains a considerable burden on public health. In 2015, the WHO estimates there were 212 million malaria cases causing nearly 429,000 deaths globally. A highly effective malaria vaccine is needed to reduce the burden of this disease. We have developed an experimental vaccine candidate (PyCMP) based on pre-erythrocytic (CSP) and erythrocytic (MSP1) stage antigens derived from the rodent malaria parasite P. yoelii. Our protein-based vaccine construct induces protective antibodies and CD4 + T cell responses. Based on evidence that viral vectors increase CD8 + T cell-mediated immunity, we also have tested heterologous prime-boost immunization regimens that included human adenovirus serotype 5 vector (Ad5), obtaining protective CD8 + T cell responses. While Ad5 is commonly used for vaccine studies, the high prevalence of pre-existing immunity to Ad5 severely compromises its utility. Here, we report the use of the novel simian adenovirus 36 (SAd36) as a candidate for a vectored malaria vaccine since this virus is not known to infect humans, and it is not neutralized by anti-Ad5 antibodies. Our study shows that the recombinant SAd36PyCMP can enhance specific CD8 + T cell response and elicit similar antibody titers when compared to an immunization regimen including the recombinant Ad5PyCMP. The robust immune responses induced by SAd36PyCMP are translated into a lower parasite load following P. yoelii infectious challenge when compared to mice immunized with Ad5PyCMP. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Prolonged evolution of virus-specific memory T cell immunity post severe avian influenza A (H7N9) virus infection.

    PubMed

    Zhao, Min; Chen, Junbo; Tan, Shuguang; Dong, Tao; Jiang, Hui; Zheng, Jiandong; Quan, Chuansong; Liao, Qiaohong; Zhang, Hangjie; Wang, Xiling; Wang, Qianli; Bi, Yuhai; Liu, Fengfeng; Feng, Luzhao; Horby, Peter W; Klenerman, Paul; Gao, George F; Liu, William J; Yu, Hongjie

    2018-06-20

    Since 2013, influenza A/H7N9 has emerged as the commonest avian influenza subtype causing human infection, and is associated with a high fatality risk. However, the characteristics of immune memory in patients who have recovered from H7N9 infection are not well understood. We assembled a cohort of forty-five H7N9 survivors followed for up to 15 months after infection. Humoral and cellular immune responses were analyzed in sequential samples obtained at 1.5-4 months, 6-8 months and 12-15 months post-infection. H7N9-specific antibody concentrations declined over time, and protective antibodies persisted longer in severely ill patients admitted to ICU and patients presenting with ARDS than that in patients with mild disease. Frequencies of virus-specific IFN-γ secreting T cells were lower in critically ill patients requiring ventilation than those in patients without ventilation within four months after infection. The percentages of H7N9-specific IFN-γ secreting T cells tended to increase over time in patients ≥60 years or critically ill patients requiring ventilation. Elevated levels of antigen-specific CD8 + T cells expressing lung-homing marker CD49a were observed at 6-8 months after H7N9 infection compared to samples obtained at 1.5-4 months. Our findings indicate the prolonged reconstruction and evolution of virus-specific T cell immunity in older or critically ill patients, and provide implications for T-cell directed immunization strategies. IMPORTANCE Avian influenza A H7N9 remains a major threat to public health. However, no previous studies have determined the characteristics and dynamics of virus specific T cell immune memory in patients who have recovered from H7N9 infection. Our findings showed that establishment of H7N9-specific T cell memory after H7N9 infection was prolonged in older and severely affected patients. Severely ill patients mounted lower T cell responses in the first 4 months after infection, while T cell responses tended to increase

  1. IL-2 Produced by CD8+ Immune T cells Can Augment Their IFN-γ Production Independently from Their Proliferation in the Secondary Response to an Intracellular Pathogen

    PubMed Central

    Sa, Qila; Woodward, Jerold; Suzuki, Yasuhiro

    2013-01-01

    Chronic infection with Toxoplasma gondii induces a potent resistance against re-infection, and IFN-γ production by CD8+ T cells is crucial for the protective immunity. However, the molecular mechanisms that regulate the secondary response remain to be elucidated. In the present study, we examined the role of IL-2 in IFN-γ production by CD8+ immune T cells in their secondary responses using T. gondii-specific CD8+ T cell hybridomas and splenic CD8+ immune T cells from chronically infected mice. The majority (92 %) of CD8+ T cell hybridomas produced large amounts of IFN-γ only when a low amount (0.5 ng/ml) of exogenous IL-2 was provided in combination with T. gondii antigens. Inhibition of cell proliferation by mitomycin C (MMC) did not affect the enhancing effect of IL-2 on the IFN-γ production, and significant increases in transcription factor T-bet expression were associated with the IL-2-mediated IFN-γ amplification. Splenic CD8+ immune T cells produced similar low levels of IL-2 in the secondary response to T. gondii, and a blocking of IL-2 signaling by anti-IL-2Rα antibody or inhibitors of JAK1 and JAK3 significantly reduced IFN-γ production of the T cells. This IL-2-mediated upregulation of IFN-γ production was observed in MMC-treated CD8+ immune T cells, thus independent from their cell division. Therefore, endogenous IL-2 produced by CD8+ immune T cells can play an important autocrine enhancing role on their IFN-γ production in the secondary responses to T. gondii, suggesting an importance of induction of CD8+ immune T cells with an appropriate IL-2 production for vaccine development. PMID:23359502

  2. NK Cells and Their Ability to Modulate T Cells during Virus Infections

    PubMed Central

    Cook, Kevin D.; Waggoner, Stephen N.; Whitmire, Jason K.

    2014-01-01

    Natural killer (NK) cells are important in protection against virus infections, and many viruses have evolved mechanisms to thwart NK cell activity. NK cells respond to inflammatory signals at an early stage of virus infection, resulting in proliferation, cytokine production, and cytolytic activity that can reduce virus loads. Moreover, the rapid kinetics of the NK cell response enables NK cells to influence other populations of innate immune cells, affect the inflammatory milieu, and guide adaptive immune responses to infection. Early NK cell interactions with other leukocytes can have long-lasting effects on the number and quality of memory T cells, as well as impact the exhaustion of T cells during chronic infections. The ability of NK cells to modulate T cell responses can be mediated through direct T-NK interactions, cytokine production, or indirectly through dendritic cells and other cell types. Herein, we summarize our current understanding of how NK cells interact with T cells, dendritic cells, B cells, and other cell types involved in adaptive immune responses to virus infection. We outline several mechanisms by which NK cells enhance or suppress adaptive immune response and long-lived immunological memory. PMID:25404045

  3. Schistosoma Infection and Schistosoma-Derived Products Modulate the Immune Responses Associated with Protection against Type 2 Diabetes

    PubMed Central

    Tang, Chun-Lian; Liu, Zhi-Ming; Gao, Yan Ru; Xiong, Fei

    2018-01-01

    Studies on parasite-induced immunoregulatory mechanisms could contribute to the development of new therapies for inflammatory diseases such as type 2 diabetes (T2D), which is a chronic inflammatory disease characterized by persistent elevated glucose levels due to insulin resistance. The association between previous Schistosoma infection and T2D has been confirmed—Schistosoma infection and Schistosoma-derived products modulate the immune system, including innate and acquired immune responses, contributing to T2D disease control. Schistosoma infections and Schistosoma-derived molecules affect the immune cell composition in adipose tissue, dampening inflammation and improving glucose tolerance. This protective role includes the polarization of immune cells to alternatively activated macrophages, dendritic cells, eosinophils, and group 2 innate lymphoid cells. Furthermore, Schistosoma infection and Schistosoma products are effective for the treatment of T2D, as they increase the number of type 2 helper T cells (Th2) and regulatory T cells (Tregs) and decrease type 1 helper T cells (Th1) and type 17 helper T cells (Th17) cells. Thus, our aim was to comprehensively review the mechanism through which Schistosoma infection and Schistosoma products modulate the immune response against T2D. PMID:29387059

  4. Schistosoma Infection and Schistosoma-Derived Products Modulate the Immune Responses Associated with Protection against Type 2 Diabetes.

    PubMed

    Tang, Chun-Lian; Liu, Zhi-Ming; Gao, Yan Ru; Xiong, Fei

    2017-01-01

    Studies on parasite-induced immunoregulatory mechanisms could contribute to the development of new therapies for inflammatory diseases such as type 2 diabetes (T2D), which is a chronic inflammatory disease characterized by persistent elevated glucose levels due to insulin resistance. The association between previous Schistosoma infection and T2D has been confirmed- Schistosoma infection and Schistosoma -derived products modulate the immune system, including innate and acquired immune responses, contributing to T2D disease control. Schistosoma infections and Schistosoma -derived molecules affect the immune cell composition in adipose tissue, dampening inflammation and improving glucose tolerance. This protective role includes the polarization of immune cells to alternatively activated macrophages, dendritic cells, eosinophils, and group 2 innate lymphoid cells. Furthermore, Schistosoma infection and Schistosoma products are effective for the treatment of T2D, as they increase the number of type 2 helper T cells (Th2) and regulatory T cells (Tregs) and decrease type 1 helper T cells (Th1) and type 17 helper T cells (Th17) cells. Thus, our aim was to comprehensively review the mechanism through which Schistosoma infection and Schistosoma products modulate the immune response against T2D.

  5. The Role of NKT Cells in Tumor Immunity

    PubMed Central

    Terabe, Masaki; Berzofsky, Jay A.

    2009-01-01

    NKT cells are a relatively newly recognized member of the immune community, with profound effects on the rest of the immune system despite their small numbers. They are true T cells with a T cell receptor (TCR), but unlike conventional T cells that detect peptide antigens presented by conventional major histocompatibility (MHC) molecules, NKT cells recognize lipid antigens presented by CD1d, a non-classical MHC molecule. As members of both the innate and adaptive immune systems, they bridge the gap between these, and respond rapidly to set the tone for subsequent immune responses. They fill a unique niche in providing the immune system a cellular arm to recognize lipid antigens. They play both effector and regulatory roles in infectious and autoimmune diseases. Furthermore, subsets of NKT cells can play distinct and sometimes opposing roles. In cancer, type I NKT cells, defined by their invariant TCR using Vα14Jα18 in mice and Vα24Jα18 in humans, are mostly protective, by producing interferon-γ to activate NK and CD8+ T cells and by activating dendritic cells to make IL-12. In contrast, type II NKT cells, characterized by more diverse TCRs recognizing lipids presented by CD1d, primarily inhibit tumor immunity. Moreover, type I and type II NKT cells counter-regulate each other, forming a new immunoregulatory axis. Because NKT cells respond rapidly, the balance along this axis can greatly influence other immune responses that follow. Therefore, learning to manipulate the balance along the NKT regulatory axis may be critical to devising successful immunotherapies for cancer. PMID:19055947

  6. Intranasal immunization with protective antigen of Bacillus anthracis induces a long-term immunological memory response.

    PubMed

    Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun

    2015-10-01

    Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Immune modulation of CD4+CD25+ regulatory T cells by zoledronic acid.

    PubMed

    Liu, Hsien; Wang, Shih-Han; Chen, Shin-Cheh; Chen, Ching-Ying; Lo, Jo-Lin; Lin, Tsun-Mei

    2016-11-25

    CD4 + CD25 + regulatory T (Treg) cells suppress tumor immunity by inhibiting immune cells. Manipulation of Treg cells represents a new strategy for cancer treatment. Zoledronic acid (ZA), a nitrogen-containing bisphosphonate, inhibits the expression of receptor activator of nuclear factor kappa-B ligand (RANKL) on osteoblasts to inhibit osteoclastogenesis. In a mouse model of bisphosphonate-related osteonecrosis of the jaw, administration of ZA suppressed Treg-cell activity and activated inflammatory Th17 cells. However, the interaction between ZA and Treg cells remained unclear. This study investigated the immune modulation of Treg cells by ZA. Flow cytometry was used to analyze the phenotypic and immunosuppressive characteristics of Treg cells treated with ZA. Chemotactic migration was evaluated using transwell assays. Quantitative real-time PCR (qRT-PCR) was used to investigate the effect of ZA on the expression of suppressive molecules by Treg cells. Proliferation of isolated Treg cells in culture was inhibited by ZA, although ZA did not induce apoptosis. qRT-PCR and flow cytometry showed that ZA significantly downregulated the expression of CCR4, CTLA4, PD-1 and RANKL on Treg cells. Chemotactic migration and immunosuppressive functions were also significantly attenuated in Treg cells pretreated with ZA, and these effects were dose-dependent. Co-culture with Treg cells significantly increased the migration rate of breast cancer cells, while pretreatment of Treg cells with ZA attenuated this effect. Our findings demonstrated that ZA acted as an immune modulator by significantly inhibiting the expansion, migration, immunosuppressive function and pro-metastatic ability of Treg cells. Immunomodulation of Treg cells by ZA represents a new strategy for cancer therapy.

  8. Cell-mediated immune response and Th/Th cytokine profile of B-T constructs of F1 and V antigen of Yersinia pestis.

    PubMed

    Gupta, G; Khan, A A; Rao, D N

    2010-03-01

    Yersinia pestis, a Gram-negative bacterium, is the etiological agent of pneumonic and bubonic plague and still active in various regions of the world. Because plague is highly infectious and can readily spread by aerosolization, it poses a bioterrorism threat. The effective induction of mucosal as well as systemic immunity is an important attribute of an improved vaccine for plague. An alternative approach described here is the use of protective epitopes derived from immunodominant antigens (F1 and V) of Yersinia pestis. As T-cell immunity is also a major contributor of protection, microencapsulated B-T constructs of F1 and V antigen were used to immunize outbred and inbred mice through intranasal route, and lympho-proliferative response and cytokine profile of both Th(1) and Th(2) arms were measured in spleen, lamina propria and Peyer's patches. Three B-T constructs of F1 antigen and seven of V antigen showed significantly high T-cell response in terms of inducing systemic as well as mucosal response when compared to constituent peptides. These ten conjugates showed Th(1) cytokine profile whereas rest of the conjugates showed mixed Th(1)/Th(2) response. Four conjugates of V antigen showed high level of IL-10 production. In present study, microencapsulated B-T constructs after intranasal immunization generated systemic as well as mucosal immune response in all three sites, which offers an alternative approach for plague vaccine.

  9. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival.

    PubMed

    Curiel, Tyler J; Coukos, George; Zou, Linhua; Alvarez, Xavier; Cheng, Pui; Mottram, Peter; Evdemon-Hogan, Melina; Conejo-Garcia, Jose R; Zhang, Lin; Burow, Matthew; Zhu, Yun; Wei, Shuang; Kryczek, Ilona; Daniel, Ben; Gordon, Alan; Myers, Leann; Lackner, Andrew; Disis, Mary L; Knutson, Keith L; Chen, Lieping; Zou, Weiping

    2004-09-01

    Regulatory T (T(reg)) cells mediate homeostatic peripheral tolerance by suppressing autoreactive T cells. Failure of host antitumor immunity may be caused by exaggerated suppression of tumor-associated antigen-reactive lymphocytes mediated by T(reg) cells; however, definitive evidence that T(reg) cells have an immunopathological role in human cancer is lacking. Here we show, in detailed studies of CD4(+)CD25(+)FOXP3(+) T(reg) cells in 104 individuals affected with ovarian carcinoma, that human tumor T(reg) cells suppress tumor-specific T cell immunity and contribute to growth of human tumors in vivo. We also show that tumor T(reg) cells are associated with a high death hazard and reduced survival. Human T(reg) cells preferentially move to and accumulate in tumors and ascites, but rarely enter draining lymph nodes in later cancer stages. Tumor cells and microenvironmental macrophages produce the chemokine CCL22, which mediates trafficking of T(reg) cells to the tumor. This specific recruitment of T(reg) cells represents a mechanism by which tumors may foster immune privilege. Thus, blocking T(reg) cell migration or function may help to defeat human cancer.

  10. Critical role of CD4 T cells in maintaining lymphoid tissue structure for immune cell homeostasis and reconstitution.

    PubMed

    Zeng, Ming; Paiardini, Mirko; Engram, Jessica C; Beilman, Greg J; Chipman, Jeffrey G; Schacker, Timothy W; Silvestri, Guido; Haase, Ashley T

    2012-08-30

    Loss of the fibroblastic reticular cell (FRC) network in lymphoid tissues during HIV-1 infection has been shown to impair the survival of naive T cells and limit immune reconstitution after antiretroviral therapy. What causes this FRC loss is unknown. Because FRC loss correlates with loss of both naive CD4 and CD8 T-cell subsets and decreased lymphotoxin-β, a key factor for maintenance of FRC network, we hypothesized that loss of naive T cells is responsible for loss of the FRC network. To test this hypothesis, we assessed the consequences of antibody-mediated depletion of CD4 and CD8 T cells in rhesus macaques and sooty mangabeys. We found that only CD4 T-cell depletion resulted in FRC loss in both species and that this loss was caused by decreased lymphotoxin-β mainly produced by the CD4 T cells. We further found the same dependence of the FRC network on CD4 T cells in HIV-1-infected patients before and after antiretroviral therapy and in other immunodeficiency conditions, such as CD4 depletion in cancer patients induced by chemotherapy and irradiation. CD4 T cells thus play a central role in the maintenance of lymphoid tissue structure necessary for their own homeostasis and reconstitution.

  11. Critical role of CD4 T cells in maintaining lymphoid tissue structure for immune cell homeostasis and reconstitution

    PubMed Central

    Zeng, Ming; Paiardini, Mirko; Engram, Jessica C.; Beilman, Greg J.; Chipman, Jeffrey G.; Schacker, Timothy W.; Silvestri, Guido

    2012-01-01

    Loss of the fibroblastic reticular cell (FRC) network in lymphoid tissues during HIV-1 infection has been shown to impair the survival of naive T cells and limit immune reconstitution after antiretroviral therapy. What causes this FRC loss is unknown. Because FRC loss correlates with loss of both naive CD4 and CD8 T-cell subsets and decreased lymphotoxin-β, a key factor for maintenance of FRC network, we hypothesized that loss of naive T cells is responsible for loss of the FRC network. To test this hypothesis, we assessed the consequences of antibody-mediated depletion of CD4 and CD8 T cells in rhesus macaques and sooty mangabeys. We found that only CD4 T-cell depletion resulted in FRC loss in both species and that this loss was caused by decreased lymphotoxin-β mainly produced by the CD4 T cells. We further found the same dependence of the FRC network on CD4 T cells in HIV-1–infected patients before and after antiretroviral therapy and in other immunodeficiency conditions, such as CD4 depletion in cancer patients induced by chemotherapy and irradiation. CD4 T cells thus play a central role in the maintenance of lymphoid tissue structure necessary for their own homeostasis and reconstitution. PMID:22613799

  12. Polyfunctional CD4+ T Cells As Targets for Tuberculosis Vaccination

    PubMed Central

    Lewinsohn, Deborah A.; Lewinsohn, David M.; Scriba, Thomas J.

    2017-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), remains a leading cause of morbidity and mortality worldwide, despite the widespread use of the only licensed vaccine, Bacille Calmette Guerin (BCG). Eradication of TB will require a more effective vaccine, yet evaluation of new vaccine candidates is hampered by lack of defined correlates of protection. Animal and human studies of intracellular pathogens have extensively evaluated polyfunctional CD4+ T cells producing multiple pro-inflammatory cytokines (IFN-γ, TNF-α, and IL-2) as a possible correlate of protection from infection and disease. In this study, we review the published literature that evaluates whether or not BCG and/or novel TB vaccine candidates induce polyfunctional CD4+ T cells and if these T cell responses correlate with vaccine-mediated protection. Ample evidence suggests that BCG and several novel vaccine candidates evaluated in animal models and humans induce polyfunctional CD4+ T cells. However, while a number of studies utilizing the mouse TB model support that polyfunctional CD4+ T cells are associated with vaccine-induced protection, other studies in mouse and human infants demonstrate no correlation between these T cell responses and protection. We conclude that induction of polyfunctional CD4+ T cells is certainly not sufficient and may not even be necessary to mediate protection and suggest that other functional attributes, such as additional effector functions, T cell differentiation state, tissue homing potential, or long-term survival capacity of the T cell may be equally or more important to promote protection. Thus, a correlate of protection for TB vaccine development remains elusive. Future studies should address polyfunctional CD4+ T cells within the context of more comprehensive immunological signatures of protection that include other functions and phenotypes of T cells as well as the full spectrum of immune cells and mediators that participate in the immune

  13. A new effect of IL-4 on human γδ T cells: promoting regulatory Vδ1 T cells via IL-10 production and inhibiting function of Vδ2 T cells.

    PubMed

    Mao, Yujia; Yin, Shanshan; Zhang, Jianmin; Hu, Yu; Huang, Bo; Cui, Lianxian; Kang, Ning; He, Wei

    2016-03-01

    Interleukin 4 (IL-4) has a variety of immune functions, including helper T-cell (Th-cell) differentiation and innate immune-response processes. However, the impact of IL-4 on gamma delta (γδ) T cells remains unclear. In this study, we investigate the effects of IL-4 on the activation and proliferation of γδ T cells and the balance between variable delta 1 (Vδ1) and Vδ2 T cells in humans. The results show that IL-4 inhibits the activation of γδ T cells in the presence of γδ T-cell receptor (TCR) stimulation in a STAT6-dependent manner. IL-4 promoted the growth of activated γδ T cells and increased the levels of Vδ1 T cells, which in turn inhibited Vδ2 T-cell growth via significant IL-10 secretion. Vδ1 T cells secreted significantly less interferon gamma (IFNγ) and more IL-10 relative to Vδ2. Furthermore, Vδ1 T cells showed relatively low levels of Natural Killer Group 2D (NKG2D) expression in the presence of IL-4, suggesting that Vδ1 T cells weaken the γδ T cell-mediated anti-tumor immune response. For the first time, our findings demonstrate a negative regulatory role of IL-4 in γδ T cell-mediated anti-tumor immunity.

  14. MHCII-Mediated Dialog between Group 2 Innate Lymphoid Cells and CD4+ T Cells Potentiates Type 2 Immunity and Promotes Parasitic Helminth Expulsion

    PubMed Central

    Oliphant, Christopher J.; Hwang, You Yi; Walker, Jennifer A.; Salimi, Maryam; Wong, See Heng; Brewer, James M.; Englezakis, Alexandros; Barlow, Jillian L.; Hams, Emily; Scanlon, Seth T.; Ogg, Graham S.; Fallon, Padraic G.; McKenzie, Andrew N.J.

    2014-01-01

    Summary Group 2 innate lymphoid cells (ILC2s) release interleukin-13 (IL-13) during protective immunity to helminth infection and detrimentally during allergy and asthma. Using two mouse models to deplete ILC2s in vivo, we demonstrate that T helper 2 (Th2) cell responses are impaired in the absence of ILC2s. We show that MHCII-expressing ILC2s interact with antigen-specific T cells to instigate a dialog in which IL-2 production from T cells promotes ILC2 proliferation and IL-13 production. Deletion of MHCII renders IL-13-expressing ILC2s incapable of efficiently inducing Nippostrongylus brasiliensis expulsion. Thus, during transition to adaptive T cell-mediated immunity, the ILC2 and T cell crosstalk contributes to their mutual maintenance, expansion and cytokine production. This interaction appears to augment dendritic-cell-induced T cell activation and identifies a previously unappreciated pathway in the regulation of type-2 immunity. PMID:25088770

  15. The immunization site of cytokine-secreting tumor cell vaccines influences the trafficking of tumor-specific T lymphocytes and antitumor efficacy against regional tumors.

    PubMed

    Chang, Chun-Jung; Tai, Kuo-Feng; Roffler, Steve; Hwang, Lih-Hwa

    2004-11-15

    Tumor cells engineered to secrete cytokines, referred to as tumor cell vaccines, can often generate systemic antitumor immunity and, in many cases, cause tumor regression. We compared the efficacy of s.c. immunization or intrahepatic immunization of GM-CSF-expressing tumor cell vaccines on the growth of s.c. or orthotopic liver tumors. A chemically transformed hepatic epithelial cell line, GP7TB, derived from Fischer 344 rats, was used to generate tumor models and tumor cell vaccines. Our results demonstrated that two s.c. injections of an irradiated tumor cell vaccine significantly controlled the growth of s.c. tumors, but was completely ineffective against orthotopic liver tumors. Effector cell infiltration in liver tumors was markedly reduced compared with s.c. tumors. Enhanced apoptosis of some effector cells was observed in the liver tumors compared with the s.c. tumors. Furthermore, the T cells induced by s.c. immunization preferentially migrated to s.c. tumor sites, as demonstrated by adoptive transfer experiments. In contrast, intrahepatic immunization, using parental tumor cells admixed with adenoviruses carrying the GM-CSF gene, yielded significantly better therapeutic effects on the liver tumors than on the s.c. tumors. Adoptive transfer experiments further confirmed that the T cells induced by liver immunization preferentially migrated to the liver tumor sites. Our results demonstrate that distinct T cell populations are induced by different immunization routes. Thus, the homing behavior of T cells depends on the route of immunization and is an important factor determining the efficacy of immunotherapy for regional tumors.

  16. Drug Hypersensitivity: How Drugs Stimulate T Cells via Pharmacological Interaction with Immune Receptors.

    PubMed

    Pichler, Werner J; Adam, Jacqueline; Watkins, Stephen; Wuillemin, Natascha; Yun, James; Yerly, Daniel

    2015-01-01

    Small chemicals like drugs tend to bind to proteins via noncovalent bonds, e.g. hydrogen bonds, salt bridges or electrostatic interactions. Some chemicals interact with other molecules than the actual target ligand, representing so-called 'off-target' activities of drugs. Such interactions are a main cause of adverse side effects to drugs and are normally classified as predictable type A reactions. Detailed analysis of drug-induced immune reactions revealed that off-target activities also affect immune receptors, such as highly polymorphic human leukocyte antigens (HLA) or T cell receptors (TCR). Such drug interactions with immune receptors may lead to T cell stimulation, resulting in clinical symptoms of delayed-type hypersensitivity. They are assigned the 'pharmacological interaction with immune receptors' (p-i) concept. Analysis of p-i has revealed that drugs bind preferentially or exclusively to distinct HLA molecules (p-i HLA) or to distinct TCR (p-i TCR). P-i reactions differ from 'conventional' off-target drug reactions as the outcome is not due to the effect on the drug-modified cells themselves, but is the consequence of reactive T cells. Hence, the complex and diverse clinical manifestations of delayed-type hypersensitivity are caused by the functional heterogeneity of T cells. In the abacavir model of p-i HLA, the drug binding to HLA may result in alteration of the presenting peptides. More importantly, the drug binding to HLA generates a drug-modified HLA, which stimulates T cells directly, like an allo-HLA. In the sulfamethoxazole model of p-i TCR, responsive T cells likely require costimulation for full T cell activation. These findings may explain the similarity of delayed-type hypersensitivity reactions to graft-versus-host disease, and how systemic viral infections increase the risk of delayed-type hypersensitivity reactions. © 2015 The Author(s) Published by S. Karger AG, Basel.

  17. Novel Role for Interleukin-17 in Enhancing Type 1 Helper T Cell Immunity in the Female Genital Tract following Mucosal Herpes Simplex Virus 2 Vaccination.

    PubMed

    Bagri, Puja; Anipindi, Varun C; Nguyen, Philip V; Vitali, Danielle; Stämpfli, Martin R; Kaushic, Charu

    2017-12-01

    It is well established that interferon gamma (IFN-γ) production by CD4 + T cells is critical for antiviral immunity against herpes simplex virus 2 (HSV-2) genital infection. However, the role of interleukin-17A (IL-17A) production by CD4 + T cells in HSV-2 antiviral immunity is yet to be elucidated. Here we demonstrate that IL-17A plays an important role in enhancing antiviral T helper type 1 (T h 1) responses in the female genital tract (FGT) and is essential for effective protection conferred by HSV-2 vaccination. While IL-17A did not play a critical role during primary genital HSV-2 infection, seen by lack of differences in susceptibility between IL-17A-deficient ( IL-17A -/- ) and wild-type (WT) C57BL/6 mice, it was critical for mediating antiviral responses after challenge/reexposure. Compared to WT mice, IL-17A -/- mice (i) infected intravaginally and reexposed or (ii) vaccinated intranasally and challenged intravaginally demonstrated poor outcomes. Following intravaginal HSV-2 reexposure or challenge, vaccinated IL-17A -/- mice had significantly higher mortality, greater disease severity, higher viral shedding, and higher levels of proinflammatory cytokines and chemokines in vaginal secretions. Furthermore, IL-17A -/- mice had impaired T h 1 cell responses after challenge/reexposure, with significantly lower proportions of vaginal IFN-γ + CD4 + T cells. The impaired T h 1 cell responses in IL-17A -/- mice coincided with smaller populations of IFN-γ + CD4 + tissue resident memory T (T RM ) cells in the genital tract postimmunization. Taken together, these findings describe a novel role for IL-17A in regulating antiviral IFN-γ + T h 1 cell immunity in the vaginal tract. This strategy could be exploited to enhance antiviral immunity following HSV-2 vaccination. IMPORTANCE T helper type 1 (T h 1) immunity, specifically interferon gamma (IFN-γ) production by CD4 + T cells, is critical for protection against genital herpesvirus (HSV-2) infection, and

  18. Assessment of Immune Isolation of Allogeneic Mouse Pancreatic Progenitor Cells by a Macroencapsulation Device

    PubMed Central

    Faleo, Gaetano; Lee, Karim; Nguyen, Vinh; Tang, Qizhi

    2016-01-01

    Background Embryonic-stem-cell (ESC)-derived islets hold the promise of providing a renewable source of tissue for the treatment of insulin-dependent diabetes. Encapsulation may allow ESC-derived islets to be transplanted without immunosuppression, thus enabling wider application of this therapy. Methods In this study, we investigated the immunogenicity of mouse pancreatic progenitor cells and efficacy of a new macroencapsulation device in protecting these cells against alloimmune and autoimmune responses in mouse models. Results Mouse pancreatic progenitor cells activated the indirect but not the direct pathway of alloimmune response and were promptly rejected in immune competent hosts. The new macroencapsulation device abolished T cell activation induced by allogeneic splenocytes and protected allogeneic MIN6 β cells and pancreatic progenitors from rejection even in pre-sensitized recipients. In addition, the device was effective in protecting MIN6 cells in spontaneously diabetic non-obese diabetic recipients against both alloimmune and recurring autoimmune responses. Conclusion Our results demonstrate that macroencapsulation can effectively prevent immune sensing and rejection of allogeneic pancreatic progenitor cells in fully sensitized and autoimmune hosts. PMID:26982952

  19. CD4+ T Cells Recognizing PE/PPE Antigens Directly or via Cross Reactivity Are Protective against Pulmonary Mycobacterium tuberculosis Infection

    PubMed Central

    Sayes, Fadel; Pawlik, Alexandre; Frigui, Wafa; Gröschel, Matthias I.; Crommelynck, Samuel; Fayolle, Catherine; Cia, Felipe; Bancroft, Gregory J.; Bottai, Daria; Leclerc, Claude; Brosch, Roland; Majlessi, Laleh

    2016-01-01

    Mycobacterium tuberculosis (Mtb), possesses at least three type VII secretion systems, ESX-1, -3 and -5 that are actively involved in pathogenesis and host-pathogen interaction. We recently showed that an attenuated Mtb vaccine candidate (Mtb Δppe25-pe19), which lacks the characteristic ESX-5-associated pe/ppe genes, but harbors all other components of the ESX-5 system, induces CD4+ T-cell immune responses against non-esx-5-associated PE/PPE protein homologs. These T cells strongly cross-recognize the missing esx-5-associated PE/PPE proteins. Here, we characterized the fine composition of the functional cross-reactive Th1 effector subsets specific to the shared PE/PPE epitopes in mice immunized with the Mtb Δppe25-pe19 vaccine candidate. We provide evidence that the Mtb Δppe25-pe19 strain, despite its significant attenuation, is comparable to the WT Mtb strain with regard to: (i) its antigenic repertoire related to the different ESX systems, (ii) the induced Th1 effector subset composition, (iii) the differentiation status of the Th1 cells induced, and (iv) its particular features at stimulating the innate immune response. Indeed, we found significant contribution of PE/PPE-specific Th1 effector cells in the protective immunity against pulmonary Mtb infection. These results offer detailed insights into the immune mechanisms underlying the remarkable protective efficacy of the live attenuated Mtb Δppe25-pe19 vaccine candidate, as well as the specific potential of PE/PPE proteins as protective immunogens. PMID:27467705

  20. Squamous cell carcinomas escape immune surveillance via inducing chronic activation and exhaustion of CD8+ T Cells co-expressing PD-1 and LAG-3 inhibitory receptors.

    PubMed

    Mishra, Ameet K; Kadoishi, Tanya; Wang, Xiaoguang; Driver, Emily; Chen, Zhangguo; Wang, Xiao-Jing; Wang, Jing H

    2016-12-06

    Squamous cell carcinoma (SCC) is the second commonest type of skin cancer. Moreover, about 90% of head and neck cancers are SCCs. SCCs develop at a significantly higher rate under chronic immunosuppressive conditions, implicating a role of immune surveillance in controlling SCCs. It remains largely unknown how SCCs evade immune recognition. Here, we established a mouse model by injecting tumor cells derived from primary SCCs harboring KrasG12D mutation and Smad4 deletion into wild-type (wt) or CD8-/- recipients. We found comparable tumor growth between wt and CD8-/- recipients, indicating a complete escape of CD8+ T cell-mediated anti-tumor responses by these SCCs. Mechanistically, CD8+ T cells apparently were not defective in infiltrating tumors given their relatively increased percentage among tumor infiltrating lymphocytes (TILs). CD8+ TILs exhibited phenotypes of chronic activation and exhaustion, including overexpression of activation markers, co-expression of programmed cell death 1 (PD-1) and lymphocyte activation gene-3 (LAG-3), as well as TCRβ downregulation. Among CD4+ TILs, T regulatory cells (Tregs) were preferentially expanded. Contradictory to prior findings in melanoma, Treg expansion was independent of CD8+ T cells in our SCC model. Unexpectedly, CD8+ T cells were required for promoting NK cell infiltration within SCCs. Furthermore, we uncovered AKT-dependent lymphocyte-induced PD-L1 upregulation on SCCs, which was contributed greatly by combinatorial effects of CD8+ T and NK cells. Lastly, dual blockade of PD-1 and LAG-3 inhibited the tumor growth of SCCs. Thus, our findings identify novel immune evasion mechanisms of SCCs and suggest that immunosuppressive mechanisms operate in a cancer-type specific and context-dependent manner.

  1. Aberrant T-cell function in vitro and impaired T-cell dependent antibody response in vivo in vitamin A-deficient rats.

    PubMed Central

    Wiedermann, U; Hanson, L A; Kahu, H; Dahlgren, U I

    1993-01-01

    We have previously reported that vitamin A deficiency resulted in a reduced IgA antibody response to cholera toxin (CT) after per-oral immunization. In the present investigation we have studied the in vivo and in vitro immune response in vitamin A-deficient rats to two parenterally applied antigens, beta-lactoglobulin (beta-LG) and picrylsulphonic acid (TNP)-Ficoll. The serum IgG and IgM antibody responses to the T-cell dependent antigen beta-LG were significantly lower in the vitamin A-deficient rats than in the pair-fed control rats. No such differences were seen with the IgG and IgM responses to the T-cell independent antigen TNP-Ficoll. However, the biliary IgA and the serum IgE antibodies against both antigens were decreased in the vitamin A-deficient rats. In vitro lymphocyte stimulation with concanavalin A (Con A) or beta-LG gave higher T-cell proliferation rates in the vitamin A-deficient than in the control rats. Interleukin-2 (IL-2) and interferon-gamma (IFN-gamma) levels in supernatants from Con A-stimulated mesenteric lymph node cells were also higher in the vitamin A-deficient rats, while IL-6 levels were decreased, which is consistent with an up-regulated Th1 activity. Proliferation studies on purified accessory cells and T cells from the deficient and the control rats, mixed in different combinations, showed that the T cells, but not the accessory cells, were disturbed in the vitamin A-deficient rats. Despite the increased T-cell activity in vitro the vitamin A-deficient rats had a lower delayed-type hypersensitivity (DTH) reaction than the pair-fed control rats. In conclusion, the increased IL-2 and IFN-gamma levels may reflect an up-regulation of Th1 cell function, while the decreased IgA, IgE and IL-6 levels indicate a suppression of Th2 cells. The disturbed T-lymphocyte function is manifested in vivo as a decreased DTH reaction and suppressed antibody production, the latter possibly due to a lack of B-cell switching and proliferation factors in

  2. Production of interferon-gamma by in vivo tumor-sensitized T cells: Association with active antitumor immunity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bursuker, I.; Pearce, M.T.

    1990-02-01

    The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less

  3. Phenotypic and Functional Alterations in Circulating Memory CD8 T Cells with Time after Primary Infection.

    PubMed

    Martin, Matthew D; Kim, Marie T; Shan, Qiang; Sompallae, Ramakrishna; Xue, Hai-Hui; Harty, John T; Badovinac, Vladimir P

    2015-10-01

    Memory CD8 T cells confer increased protection to immune hosts upon secondary viral, bacterial, and parasitic infections. The level of protection provided depends on the numbers, quality (functional ability), and location of memory CD8 T cells present at the time of infection. While primary memory CD8 T cells can be maintained for the life of the host, the full extent of phenotypic and functional changes that occur over time after initial antigen encounter remains poorly characterized. Here we show that critical properties of circulating primary memory CD8 T cells, including location, phenotype, cytokine production, maintenance, secondary proliferation, secondary memory generation potential, and mitochondrial function change with time after infection. Interestingly, phenotypic and functional alterations in the memory population are not due solely to shifts in the ratio of effector (CD62Llo) and central memory (CD62Lhi) cells, but also occur within defined CD62Lhi memory CD8 T cell subsets. CD62Lhi memory cells retain the ability to efficiently produce cytokines with time after infection. However, while it is was not formally tested whether changes in CD62Lhi memory CD8 T cells over time occur in a cell intrinsic manner or are due to selective death and/or survival, the gene expression profiles of CD62Lhi memory CD8 T cells change, phenotypic heterogeneity decreases, and mitochondrial function and proliferative capacity in either a lymphopenic environment or in response to antigen re-encounter increase with time. Importantly, and in accordance with their enhanced proliferative and metabolic capabilities, protection provided against chronic LCMV clone-13 infection increases over time for both circulating memory CD8 T cell populations and for CD62Lhi memory cells. Taken together, the data in this study reveal that memory CD8 T cells continue to change with time after infection and suggest that the outcome of vaccination strategies designed to elicit protective memory

  4. Abundant tax protein expression in CD4+ T cells infected with human T-cell lymphotropic virus type I (HTLV-I) is prevented by cytotoxic T lymphocytes.

    PubMed

    Hanon, E; Hall, S; Taylor, G P; Saito, M; Davis, R; Tanaka, Y; Usuku, K; Osame, M; Weber, J N; Bangham, C R

    2000-02-15

    The role of the cellular immune response in human T-cell leukemia virus type I (HTLV-I) infection is not fully understood. A persistently activated cytotoxic T lymphocyte (CTL) response to HTLV-I is found in the majority of infected individuals. However, it remains unclear whether this CTL response is protective or causes tissue damage. In addition, several observations paradoxically suggest that HTLV-I is transcriptionally silent in most infected cells and, therefore, not detectable by virus-specific CTLs. With the use of a new flow cytometric procedure, we show here that a high proportion of naturally infected CD4+ peripheral blood mononuclear cells (PBMC) (between 10% and 80%) are capable of expressing Tax, the immunodominant target antigen recognized by virus-specific CTLs. Furthermore, we provide direct evidence that autologous CD8+ T cells rapidly kill CD4+ cells naturally infected with HTLV-I and expressing Tax in vitro by a perforin-dependent mechanism. Consistent with these observations, we observed a significant negative correlation between the frequency of Tax(11-19)-specific CD8+ T cells and the percentage of CD4+ T cells in peripheral blood of patients infected with HTLV-I. Those results are in accordance with the view that virus-specific CTLs participate in a highly efficient immune surveillance mechanism that persistently destroys Tax-expressing HTLV-I-infected CD4+ T cells in vivo. (Blood. 2000;95:1386-1392)

  5. Expansion and retention of pulmonary CD4+ T cells after prime boost vaccination correlates with improved longevity and strength of immunity against tularemia.

    PubMed

    Roberts, Lydia M; Wehrly, Tara D; Crane, Deborah D; Bosio, Catharine M

    2017-05-02

    Francisella tularensis subsp. tularensis strain SchuS4 (Ftt) is a highly virulent intracellular bacterium. Inhalation of 10 or fewer organisms results in an acute and potentially lethal disease called pneumonic tularemia. Ftt infections occur naturally in the U.S. and Ftt was developed as a bioweapon. Thus, there is a need for vaccines that protect against this deadly pathogen. Although a live vaccine strain of Francisella tularensis (LVS) exists, LVS fails to generate long-lived protective immunity against modest challenge doses of Ftt. We recently identified an important role for high avidity CD4 + T cells in short-term protection and hypothesized that expanding this pool of cells would improve overall vaccine efficacy with regard to longevity and challenge dose. In support of our hypothesis, application of a prime/boost vaccination strategy increased the pool of high avidity CD4 + T cells which correlated with improved survival following challenge with either increased doses of virulent Ftt or at late time points after vaccination. In summary, we demonstrate that both epitope selection and vaccination strategies that expand antigen-specific T cells correlate with superior immunity to Ftt as measured by survival. Copyright © 2017. Published by Elsevier Ltd.

  6. Regional delivery of mesothelin-targeted CAR T cell therapy generates potent and long-lasting CD4-dependent tumor immunity

    PubMed Central

    Adusumilli, Prasad S.; Cherkassky, Leonid; Villena-Vargas, Jonathan; Colovos, Christos; Servais, Elliot; Plotkin, Jason; Jones, David R.; Sadelain, Michel

    2015-01-01

    Translating the recent success of chimeric antigen receptor (CAR) T cell therapy for hematological malignancies to solid tumors will necessitate overcoming several obstacles, including inefficient T cell tumor infiltration and insufficient functional persistence. Taking advantage of an orthotopic model that faithfully mimics human pleural malignancy, we evaluated two routes of administration of mesothelin-targeted T cells using the M28z CAR. We found that intra-pleurally administered CAR T cells vastly out-performed systemically infused T cells, requiring 30-fold fewer M28z T cells to induce long-term complete remissions. Following intrapleural T cell administration, prompt in vivo antigen-induced T cell activation allowed robust CAR T cell expansion and effector differentiation, resulting in enhanced anti-tumor efficacy and functional T cell persistence for 200 days. Regional T cell administration also promoted efficient elimination of extrathoracic tumor sites. This therapeutic efficacy was dependent on early CD4+ T cell activation associated with a higher intra-tumoral CD4/CD8 cell ratios and CD28-dependent CD4+ T cell-mediated cytotoxicity. In contrast, intravenously delivered CAR T cells, even when accumulated at equivalent numbers in the pleural tumor, did not achieve comparable activation, tumor eradication or persistence. The remarkable ability of intrapleurally administered T cells to circulate and persist supports the concept of delivering optimal CAR T cell therapy through “regional distribution centers.” Based on these results, we are opening a phase I clinical trial to evaluate the safety of intrapleural administration of mesothelin-targeted CAR T cells in patients with primary or secondary pleural malignancies. PMID:25378643

  7. T Cell Receptors and the Evolution of Recognition Mechanisms in Immunity.

    ERIC Educational Resources Information Center

    Inchley, C. J.

    1986-01-01

    Discusses recent advances in the study of mammalian immunology. Explains the roles of two families of lymphocytes, the B cells and T cells. Also examines evolutionary mechanisms related to the immune system. (ML)

  8. Immune privilege as an intrinsic CNS property: astrocytes protect the CNS against T-cell-mediated neuroinflammation.

    PubMed

    Gimsa, Ulrike; Mitchison, N Avrion; Brunner-Weinzierl, Monika C

    2013-01-01

    Astrocytes have many functions in the central nervous system (CNS). They support differentiation and homeostasis of neurons and influence synaptic activity. They are responsible for formation of the blood-brain barrier (BBB) and make up the glia limitans. Here, we review their contribution to neuroimmune interactions and in particular to those induced by the invasion of activated T cells. We discuss the mechanisms by which astrocytes regulate pro- and anti-inflammatory aspects of T-cell responses within the CNS. Depending on the microenvironment, they may become potent antigen-presenting cells for T cells and they may contribute to inflammatory processes. They are also able to abrogate or reprogram T-cell responses by inducing apoptosis or secreting inhibitory mediators. We consider apparently contradictory functions of astrocytes in health and disease, particularly in their interaction with lymphocytes, which may either aggravate or suppress neuroinflammation.

  9. Immune complexes stimulate CCR7-dependent dendritic cell migration to lymph nodes

    PubMed Central

    Clatworthy, Menna R.; Aronin, Caren E. Petrie; Mathews, Rebeccah J.; Morgan, Nicole; Smith, Kenneth G.C.; Germain, Ronald N.

    2014-01-01

    Antibodies are critical for defence against a variety of microbes but may also be pathogenic in some autoimmune diseases. Many effector functions of antibody are mediated by Fcγ receptors (FcγRs), which are found on most immune cells, including dendritic cells (DCs). DCs are important antigen presenting cells and play a central role in inducing antigen-specific tolerance or immunity1,2. Following antigen acquisition in peripheral tissues, DCs migrate to draining lymph nodes via lymphatics to present antigen to T cells. In this study we demonstrate that FcγR engagement by IgG immune complexes (IC) stimulates DC migration from peripheral tissues to the paracortex of draining lymph nodes. In vitro, IC-stimulated murine and human DCs showed enhanced directional migration in a CCL19 gradient and increased CCR7 expression. Using intravital two-photon microscopy, we observed that local administration of IC resulted in dermal DC mobilisation. We confirmed that dermal DC migration to lymph nodes was CCR7-dependent and increased in the absence of the inhibitory receptor, FcγRIIb. These observations have relevance to autoimmunity, because autoantibody-containing serum from mice and humans with SLE also increased dermal DC migration to lymph nodes in vivo, suggesting that this process may occur in lupus, potentially driving the inappropriate localisation of autoantigen-bearing DCs. PMID:25384086

  10. Immunization with Salmonella Enteritidis secreting mucosal adjuvant labile toxin confers protection against wild type challenge via augmentation of CD3+CD4+ T-cell proliferation and enhancement of IFN-γ, IL-6 and IL-10 expressions in chicken.

    PubMed

    Lalsiamthara, Jonathan; Lee, John Hwa

    2017-02-01

    The protective efficacy and immunological profiles of chickens immunized with an attenuated Salmonella Enteritidis (SE) constitutively secreting double mutant heat labile enterotoxin (dmLT) were investigated. The dmLT is a detoxified variant of Escherichia coli heat labile toxin and is a potent mucosal adjuvant capable of inducing both humoral and cell-mediated immunity. In this study, four-week-old chickens were inoculated with SE-dmLT strain JOL1641, parental SE strain JOL1087 or phosphate buffered saline control. Peripheral blood mononuclear cells of SE-dmLT inoculated birds showed significant proliferation upon stimulation with SE antigens as compared to the control and JOL1087 groups (P⩽0.05). One week post-challenge, the ratio of CD3 + CD4 + to CD3 + CD8 + T-cells showed a significant increase in the immunized groups. Significant increases in IFN-γ levels were observed in JOL1641 birds immunized via oral and intramuscular routes. While immunizations with the JOL1087 strain via the intramuscular route also induced significant increases in IFN-γ, immunization via the oral route did not trigger significant changes. Pro-inflammatory cytokine IL-6 was also elevated significantly in immunized birds; a significant elevation of IL-10 was observed only in oral immunization with JOL1641 (P⩽0.05). JOL1641 immunized birds showed significant reduction of challenge bacterial-organ recovery as compared to JOL1087 and non-immunized birds. Collectively, our results revealed that immunization with the adjuvant-secreting S. Enteritidis confers protection against wild type SE challenge via induction of strong cell proliferative response, augmentation of CD3 + CD4 + : CD3 + CD8 + T-cells ratio and enhancement of IFN-γ, IL-6 and IL-10 cytokine secretion. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. What on "irf" is this gene 4? Irf4 transcription-factor-dependent dendritic cells are required for T helper 2 cell responses in murine skin.

    PubMed

    Flutter, Barry; Nestle, Frank O

    2013-10-17

    Interferon regulatory factors play an important role in the transcriptional regulation of immunity. In this issue of Immunity, Kumamoto et al. (2013) and Gao et al. (2013) identify an Irf4-dependent migratory dendritic cell subset required for T helper 2 cell polarization following cutaneous challenge. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Surface protein Adr2 of Rickettsia rickettsii induced protective immunity against Rocky Mountain spotted fever in C3H/HeN mice.

    PubMed

    Gong, Wenping; Xiong, Xiaolu; Qi, Yong; Jiao, Jun; Duan, Changsong; Wen, Bohai

    2014-04-11

    Rickettsia rickettsii is the pathogen of Rocky Mountain spotted fever (RMSF), a life-threatening tick-transmitted infection. Adr2 was a surface-exposed adhesion protein of R. rickettsii and its immunoprotection against RMSF was investigated in mice. Recombinant Adr2 (rAdr2) was used to immunize C3H/HeN mice, and the rickettsial loads in organs of the mice were detected after challenge with R. rickettsii. The levels of specific antibodies of sera from the immunized mice were determined and the sera from immunized mice were applied to neutralize R. rickettsii. Proliferation and cytokine secretion of CD4(+) and CD8(+) T cells isolated from R. rickettsii-infected mice were also assayed after rAdr2 stimulation. After R. rickettsii challenge, the rickettsial loads in spleens, livers, and lungs were significantly lower and the impairment degrees of these organs in rAdr2-immunized mice were markedly slighter, compared with those in negative control mice. The ratio of specific IgG2a/IgG1 of rAdr2-immunized mice kept increasing during the immunization. After treatment with rAdr2-immunized sera, the total number of R. rickettsii organisms adhering and invading host cells was significantly lower than that treated with PBS-immunized sera. Interferon-γ secretion by CD4(+) or CD8(+) T cells and tumor necrosis factor-α secretion by CD4(+) T cells from R. rickettsii-infected mice were respectively significantly greater than those from uninfected mice after rAdr2 stimulation. Adr2 is a protective antigen of R. rickettsii. Protection offered by Adr2 is mainly dependent on antigen-specific cell-mediated immune responses, including efficient activity of CD4(+) and CD8(+) T cells to produce great amount of TNF-α and/or IFN-γ as well as rapid increase of specific IgG2a, which synergistically activate and opsonize host cells to killing intracellular rickettsiae. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Th9 Cells Drive Host Immunity against Gastrointestinal Worm Infection.

    PubMed

    Licona-Limón, Paula; Henao-Mejia, Jorge; Temann, Angela U; Gagliani, Nicola; Licona-Limón, Ileana; Ishigame, Harumichi; Hao, Liming; Herbert, De'broski R; Flavell, Richard A

    2013-10-17

    Type 2 inflammatory cytokines, including interleukin-4 (IL-4), IL-5, IL-9, and IL-13, drive the characteristic features of immunity against parasitic worms and allergens. Whether IL-9 serves an essential role in the initiation of host-protective responses is controversial, and the importance of IL-9- versus IL-4-producing CD4⁺ effector T cells in type 2 immunity is incompletely defined. Herein, we generated IL-9-deficient and IL-9-fluorescent reporter mice that demonstrated an essential role for this cytokine in the early type 2 immunity against Nippostrongylus brasiliensis. Whereas T helper 9 (Th9) cells and type 2 innate lymphoid cells (ILC2s) were major sources of infection-induced IL-9 production, the adoptive transfer of Th9 cells, but not Th2 cells, caused rapid worm expulsion, marked basophilia, and increased mast cell numbers in Rag2-deficient hosts. Taken together, our data show a critical and nonredundant role for Th9 cells and IL-9 in host-protective type 2 immunity against parasitic worm infection. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Dissection of SAP-dependent and SAP-independent SLAM family signaling in NKT cell development and humoral immunity

    PubMed Central

    Cai, Chenxu; Liu, Guangao; Wang, Yuande; Du, Juan; Lin, Xin; Yang, Meixiang

    2017-01-01

    Signaling lymphocytic activation molecule (SLAM)–associated protein (SAP) mutations in X-linked lymphoproliferative disease (XLP) lead to defective NKT cell development and impaired humoral immunity. Because of the redundancy of SLAM family receptors (SFRs) and the complexity of SAP actions, how SFRs and SAP mediate these processes remains elusive. Here, we examined NKT cell development and humoral immunity in mice completely deficient in SFR. We found that SFR deficiency severely impaired NKT cell development. In contrast to SAP deficiency, SFR deficiency caused no apparent defect in follicular helper T (TFH) cell differentiation. Intriguingly, the deletion of SFRs completely rescued the severe defect in TFH cell generation caused by SAP deficiency, whereas SFR deletion had a minimal effect on the defective NKT cell development in SAP-deficient mice. These findings suggest that SAP-dependent activating SFR signaling is essential for NKT cell selection; however, SFR signaling is inhibitory in SAP-deficient TFH cells. Thus, our current study revises our understanding of the mechanisms underlying T cell defects in patients with XLP. PMID:28049627

  15. Airway-Resident Memory CD8 T Cells Provide Antigen-Specific Protection against Respiratory Virus Challenge through Rapid IFN-γ Production.

    PubMed

    McMaster, Sean R; Wilson, Jarad J; Wang, Hong; Kohlmeier, Jacob E

    2015-07-01

    CD8 airway resident memory T (TRM) cells are a distinctive TRM population with a high turnover rate and a unique phenotype influenced by their localization within the airways. Their role in mediating protective immunity to respiratory pathogens, although suggested by many studies, has not been directly proven. This study provides definitive evidence that airway CD8 TRM cells are sufficient to mediate protection against respiratory virus challenge. Despite being poorly cytolytic in vivo and failing to expand after encountering Ag, airway CD8 TRM cells rapidly express effector cytokines, with IFN-γ being produced most robustly. Notably, established airway CD8 TRM cells possess the ability to produce IFN-γ faster than systemic effector memory CD8 T cells. Furthermore, naive mice receiving intratracheal transfer of airway CD8 TRM cells lacking the ability to produce IFN-γ were less effective at controlling pathogen load upon heterologous challenge. This direct evidence of airway CD8 TRM cell-mediated protection demonstrates the importance of these cells as a first line of defense for optimal immunity against respiratory pathogens and suggests they should be considered in the development of future cell-mediated vaccines. Copyright © 2015 by The American Association of Immunologists, Inc.

  16. HIV-specific antibodies but not t-cell responses are associated with protection in seronegative partners of HIV-1-infected individuals in Cambodia.

    PubMed

    Nguyen, Marie; Pean, Polidy; Lopalco, Lucia; Nouhin, Janin; Phoung, Viseth; Ly, Nary; Vermisse, Pierre; Henin, Yvette; Barré-Sinoussi, Françoise; Burastero, Samuele E; Reynes, Jean-Marc; Carcelain, Guislaine; Pancino, Gianfranco

    2006-08-01

    To study biological factors related to protection against HIV-1 infection in Cambodia, we recruited 48 partners of HIV-1-infected patients who remained uninfected (exposed uninfected individuals, EUs) despite unprotected sexual intercourse for more than 1 year and 49 unexposed controls (UCs). HIV-1-specific antibodies (IgA anti-gp41 and IgG anti-CD4-gp120 complex), T-cell responses, and cellular factors that may be involved in protection (peripheral blood mononuclear cell [PBMC] resistance to HIV-1 infection and beta-chemokine production) were evaluated. Anti-HIV-1 antibodies were higher in EUs than those in UCs (P = 0.01 and P = 0.04 for anti-gp41 and anti-CD4-gp120, respectively). We observed a decreased susceptibility to a primary Cambodian isolate, HIV-1KH019, in EU PBMCs as compared with UC PBMCs (P = 0.03). A weak T-cell response to one pool of HIV-1 Gag peptides was found by ELISpot in 1 of 19 EUs. Whereas T-cell specific immunity was not associated to protection, our results suggest that HIV-specific humoral immunity and reduced cell susceptibility to infection may contribute to protection against HIV-1 infection in Cambodian EUs.

  17. Allicin enhances host pro-inflammatory immune responses and protects against acute murine malaria infection

    PubMed Central

    2012-01-01

    Background During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. Methods To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Results Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Conclusions Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses. PMID:22873687

  18. Allicin enhances host pro-inflammatory immune responses and protects against acute murine malaria infection.

    PubMed

    Feng, Yonghui; Zhu, Xiaotong; Wang, Qinghui; Jiang, Yongjun; Shang, Hong; Cui, Liwang; Cao, Yaming

    2012-08-08

    During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses.

  19. ICOS and Bcl6-dependent pathways maintain a CD4 T cell population with memory-like properties during tuberculosis

    PubMed Central

    Moguche, Albanus O.; Shafiani, Shahin; Clemons, Corey; Larson, Ryan P.; Dinh, Crystal; Higdon, Lauren E.; Cambier, C.J.; Sissons, James R.; Gallegos, Alena M.; Fink, Pamela J.

    2015-01-01

    Immune control of persistent infection with Mycobacterium tuberculosis (Mtb) requires a sustained pathogen-specific CD4 T cell response; however, the molecular pathways governing the generation and maintenance of Mtb protective CD4 T cells are poorly understood. Using MHCII tetramers, we show that Mtb-specific CD4 T cells are subject to ongoing antigenic stimulation. Despite this chronic stimulation, a subset of PD-1+ cells is maintained within the lung parenchyma during tuberculosis (TB). When transferred into uninfected animals, these cells persist, mount a robust recall response, and provide superior protection to Mtb rechallenge when compared to terminally differentiated Th1 cells that reside preferentially in the lung-associated vasculature. The PD-1+ cells share features with memory CD4 T cells in that their generation and maintenance requires intrinsic Bcl6 and intrinsic ICOS expression. Thus, the molecular pathways required to maintain Mtb-specific CD4 T cells during ongoing infection are similar to those that maintain memory CD4 T cells in scenarios of antigen deprivation. These results suggest that vaccination strategies targeting the ICOS and Bcl6 pathways in CD4 T cells may provide new avenues to prevent TB. PMID:25918344

  20. ICOS and Bcl6-dependent pathways maintain a CD4 T cell population with memory-like properties during tuberculosis.

    PubMed

    Moguche, Albanus O; Shafiani, Shahin; Clemons, Corey; Larson, Ryan P; Dinh, Crystal; Higdon, Lauren E; Cambier, C J; Sissons, James R; Gallegos, Alena M; Fink, Pamela J; Urdahl, Kevin B

    2015-05-04

    Immune control of persistent infection with Mycobacterium tuberculosis (Mtb) requires a sustained pathogen-specific CD4 T cell response; however, the molecular pathways governing the generation and maintenance of Mtb protective CD4 T cells are poorly understood. Using MHCII tetramers, we show that Mtb-specific CD4 T cells are subject to ongoing antigenic stimulation. Despite this chronic stimulation, a subset of PD-1(+) cells is maintained within the lung parenchyma during tuberculosis (TB). When transferred into uninfected animals, these cells persist, mount a robust recall response, and provide superior protection to Mtb rechallenge when compared to terminally differentiated Th1 cells that reside preferentially in the lung-associated vasculature. The PD-1(+) cells share features with memory CD4 T cells in that their generation and maintenance requires intrinsic Bcl6 and intrinsic ICOS expression. Thus, the molecular pathways required to maintain Mtb-specific CD4 T cells during ongoing infection are similar to those that maintain memory CD4 T cells in scenarios of antigen deprivation. These results suggest that vaccination strategies targeting the ICOS and Bcl6 pathways in CD4 T cells may provide new avenues to prevent TB. © 2015 Moguche et al.

  1. Dendritic cell immunization route determines CD8+ T cell trafficking to inflamed skin: role for tissue microenvironment and dendritic cells in establishment of T cell-homing subsets.

    PubMed

    Dudda, Jan C; Simon, Jan C; Martin, Stefan

    2004-01-15

    The effector/memory T cell pool branches in homing subsets selectively trafficking to organs such as gut or skin. Little is known about the critical factors in the generation of skin-homing CD8+ T cells, although they are crucial effectors in skin-restricted immune responses such as contact hypersensitivity and melanoma defense. In this study, we show that intracutaneous, but not i.v. injection of bone marrow-derived dendritic cells induced skin-homing CD8+ T cells with up-regulated E-selectin ligand expression and effector function in contact hypersensitivity. The skin-homing potential and E-selectin ligand expression remained stable in memory phase without further Ag contact. In contrast, i.p. injection induced T cells expressing the gut-homing integrin alpha(4)beta(7). Although differential expression of these adhesion molecules was strictly associated with the immunization route, the postulated skin-homing marker CCR4 was transiently up-regulated in all conditions. Interestingly, dendritic cells from different tissues effectively induced the corresponding homing markers on T cells in vitro. Our results suggest a crucial role for the tissue microenvironment and dendritic cells in the instruction of T cells for tissue-selective homing and demonstrate that Langerhans cells are specialized to target T cells to inflamed skin.

  2. Tumor-derived exosomes regulate expression of immune function-related genes in human T cell subsets.

    PubMed

    Muller, Laurent; Mitsuhashi, Masato; Simms, Patricia; Gooding, William E; Whiteside, Theresa L

    2016-02-04

    Tumor cell-derived exosomes (TEX) suppress functions of immune cells. Here, changes in the gene profiles of primary human T lymphocytes exposed in vitro to exosomes were evaluated. CD4(+) Tconv, CD8(+) T or CD4(+) CD39(+) Treg were isolated from normal donors' peripheral blood and co-incubated with TEX or exosomes isolated from supernatants of cultured dendritic cells (DEX). Expression levels of 24-27 immune response-related genes in these T cells were quantified by qRT-PCR. In activated T cells, TEX and DEX up-regulated mRNA expression levels of multiple genes. Multifactorial data analysis of ΔCt values identified T cell activation and the immune cell type, but not exosome source, as factors regulating gene expression by exosomes. Treg were more sensitive to TEX-mediated effects than other T cell subsets. In Treg, TEX-mediated down-regulation of genes regulating the adenosine pathway translated into high expression of CD39 and increased adenosine production. TEX also induced up-regulation of inhibitory genes in CD4(+) Tconv, which translated into a loss of CD69 on their surface and a functional decline. Exosomes are not internalized by T cells, but signals they carry and deliver to cell surface receptors modulate gene expression and functions of human T lymphocytes.

  3. Ornamental comb colour predicts T-cell-mediated immunity in male red grouse Lagopus lagopus scoticus

    NASA Astrophysics Data System (ADS)

    Mougeot, Francois

    2008-02-01

    Sexual ornaments might reliably indicate the ability to cope with parasites and diseases, and a better ability to mount a primary inflammatory response to a novel challenge. Carotenoid-based ornaments are amongst the commonest sexual signals of birds and often influence mate choice. Because carotenoids are immuno-stimulants, signallers may trade-off allocating these to ornamental colouration or using them for immune responses, so carotenoid-based ornaments might be particularly useful as honest indicators of immuno-compentence. Tetraonid birds, such as the red grouse Lagopus lagopus scoticus, exhibit supra-orbital yellow red combs, a conspicuous ornament which functions in intra- and inter-sexual selection. The colour of combs is due to epidermal pigmentation by carotenoids, while their size is testosterone-dependent. In this study, I investigated whether comb characteristics, and in particular, comb colour, indicated immuno-competence in free-living male red grouse. I assessed T-cell-mediated immunity using a standardised challenge with phytohaemagglutinin. Red grouse combs reflect in the red and in the ultraviolet spectrum of light, which is not visible to humans but that grouse most likely see, so I measured comb colour across the whole bird visible spectrum (300 700 nm) using a reflectance spectrometer. I found that males with bigger and redder combs, but with less ultraviolet reflectance, had greater T-cell-mediated immune response. Comb colour predicted T-cell-mediated immune response better than comb size, indicating that the carotenoid-based colouration of this ornament might reliably signal this aspect of male quality.

  4. Gamma delta T cells and the immune response to respiratory syncytial virus infection

    USDA-ARS?s Scientific Manuscript database

    'd T cells are a subset of nonconventional T cells that play a critical role in bridging the innate and adaptive arms of the immune system. 'd T cells are particularly abundant in ruminant species and may constitute of up 60% of the circulating lymphocyte pool in young cattle. The frequency of circ...

  5. Selective Resistance of CD44hi T Cells to p53 Dependent Cell Death Results in Persistence of Immunologic Memory after Total Body Irradiation1,2,3

    PubMed Central

    Yao, Zhenyu; Jones, Jennifer; Kohrt, Holbrook; Strober, Samuel

    2011-01-01

    Our previous studies showed that treatment of mice with total body irradiation (TBI) or total lymphoid tissue irradiation (TLI) markedly changes the balance of residual T cell subsets to favor CD4+CD44hi natural killer T (NKT) cells due to differential resistance of the latter subset to cell death. The object of the current study was to further elucidate the changed balance and mechanisms of differential radioresistance of T cell subsets after graded doses of TBI. The experimental results show that CD4+ T cells were markedly more resistant than CD8+ T cells, and CD44hi T cells including NKT cells and memory T cells were markedly more resistant than CD44lo (naïve) T cells. The memory T cells immunized to alloantigens persisted even after myeloabloative (1,000cGy) TBI, and were able to prevent engraftment of bone marrow transplants. Although T cell death after 1,000cGy was prevented in p53−/− mice, there was progressive T cell death in p53−/− mice at higher doses. Whereas, p53 dependent T cell death changed the balance of subsets, the p53 independent T cell death did not. In conclusion, resistance of CD44hi T cells to p53 dependent cell death results in the persistence of immunological memory after TBI, and can explain the immune mediated rejection of marrow transplants in sensitized recipients. PMID:21930972

  6. Foetal immune programming: hormones, cytokines, microbes and regulatory T cells.

    PubMed

    Hsu, Peter; Nanan, Ralph

    2014-10-01

    In addition to genetic factors, environmental cues play important roles in shaping the immune system. The first environment that the developing foetal immune system encounters is the uterus. Although physically the mother and the foetus are separated by the placental membranes, various factors such as hormones and cytokines may provide "environmental cues" to the foetal immune system. Additionally, increasing evidence suggests that prenatal maternal environmental factors, particularly microbial exposure, might significantly influence the foetal immune system, affecting long-term outcomes, a concept termed foetal immune programming. Here we discuss the potential mediators of foetal immune programming, focusing on the role of pregnancy-related hormones, cytokines and regulatory T cells, which play a critical role in immune tolerance. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.

    PubMed

    Griffin, Diane E

    2016-10-12

    Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.

  8. A Lipid Based Antigen Delivery System Efficiently Facilitates MHC Class-I Antigen Presentation in Dendritic Cells to Stimulate CD8+ T Cells

    NASA Astrophysics Data System (ADS)

    Maji, Mithun; Mazumder, Saumyabrata; Bhattacharya, Souparno; Choudhury, Somsubhra Thakur; Sabur, Abdus; Shadab, Md.; Bhattacharya, Pradyot; Ali, Nahid

    2016-06-01

    The most effective strategy for protection against intracellular infections such as Leishmania is vaccination with live parasites. Use of recombinant proteins avoids the risks associated with live vaccines. However, due to low immunogenicity, they fail to trigger T cell responses particularly of CD8+ cells requisite for persistent immunity. Previously we showed the importance of protein entrapment in cationic liposomes and MPL as adjuvant for elicitation of CD4+ and CD8+ T cell responses for long-term protection. In this study we investigated the role of cationic liposomes on maturation and antigen presentation capacity of dendritic cells (DCs). We observed that cationic liposomes were taken up very efficiently by DCs and transported to different cellular sites. DCs activated with liposomal rgp63 led to efficient presentation of antigen to specific CD4+ and CD8+ T cells. Furthermore, lymphoid CD8+ T cells from liposomal rgp63 immunized mice demonstrated better proliferative ability when co-cultured ex vivo with stimulated DCs. Addition of MPL to vaccine enhanced the antigen presentation by DCs and induced more efficient antigen specific CD8+ T cell responses when compared to free and liposomal antigen. These liposomal formulations presented to CD8+ T cells through TAP-dependent MHC-I pathway offer new possibilities for a safe subunit vaccine.

  9. Advances in direct T-cell alloreactivity: function, avidity, biophysics and structure.

    PubMed

    Smith, C; Miles, J J; Khanna, R

    2012-01-01

    Although T-cell-based adaptive immunity plays a crucial role in protection against infectious pathogens and uncontrolled outgrowth of malignant cells, a large portion of these T cells are also capable of responding to allogeneic HLA molecules, violating the paradigm of self-major histocompatibility complex (MHC) restriction. Recent studies have provided insights into the mechanisms by which these T cells recognize allogeneic targets. The role of antiviral T cells in direct alloreactivity through peptide-dependent molecular mimicry and alternate peptide-MHC docking modes has emerged as major models for the human alloresponse. Here, we review in depth recent advances in this field and discuss how molecular interactions between T cells and HLA molecules drive the activation of these effector cells and its potential implications for alloreactivity in human transplantation. ©Copyright 2011 American Society of Transplantation and the American Society of Transplant Surgeons.

  10. Validation of T-Track® CMV to assess the functionality of cytomegalovirus-reactive cell-mediated immunity in hemodialysis patients.

    PubMed

    Banas, Bernhard; Böger, Carsten A; Lückhoff, Gerhard; Krüger, Bernd; Barabas, Sascha; Batzilla, Julia; Schemmerer, Mathias; Köstler, Josef; Bendfeldt, Hanna; Rascle, Anne; Wagner, Ralf; Deml, Ludwig; Leicht, Joachim; Krämer, Bernhard K

    2017-03-07

    Uncontrolled cytomegalovirus (CMV) replication in immunocompromised solid-organ transplant recipients is a clinically relevant issue and an indication of impaired CMV-specific cell-mediated immunity (CMI). Primary aim of this study was to assess the suitability of the immune monitoring tool T-Track® CMV to determine CMV-reactive CMI in a cohort of hemodialysis patients representative of patients eligible for renal transplantation. Positive and negative agreement of T-Track® CMV with CMV serology was examined in 124 hemodialysis patients, of whom 67 (54%) revealed a positive CMV serostatus. Secondary aim of the study was to evaluate T-Track® CMV performance against two unrelated CMV-specific CMI monitoring assays, QuantiFERON®-CMV and a cocktail of six class I iTAg™ MHC Tetramers. Positive T-Track® CMV results were obtained in 90% (60/67) of CMV-seropositive hemodialysis patients. In comparison, 73% (45/62) and 77% (40/52) positive agreement with CMV serology was achieved using QuantiFERON®-CMV and iTAg™ MHC Tetramer. Positive T-Track® CMV responses in CMV-seropositive patients were dominated by pp65-reactive cells (58/67 [87%]), while IE-1-responsive cells contributed to an improved (87% to 90%) positive agreement of T-Track® CMV with CMV serology. Interestingly, T-Track® CMV, QuantiFERON®-CMV and iTAg™ MHC Tetramers showed 79% (45/57), 87% (48/55) and 93% (42/45) negative agreement with serology, respectively, and a strong inter-assay variability. Notably, T-Track® CMV was able to detect IE-1-reactive cells in blood samples of patients with a negative CMV serology, suggesting either a previous exposure to CMV that yielded a cellular but no humoral immune response, or TCR cross-reactivity with foreign antigens, both suggesting a possible protective immunity against CMV in these patients. T-Track® CMV is a highly sensitive assay, enabling the functional assessment of CMV-responsive cells in hemodialysis patients prior to renal transplantation. T

  11. CD301b⁺ dermal dendritic cells drive T helper 2 cell-mediated immunity.

    PubMed

    Kumamoto, Yosuke; Linehan, Melissa; Weinstein, Jason S; Laidlaw, Brian J; Craft, Joseph E; Iwasaki, Akiko

    2013-10-17

    Unlike other types of T helper (Th) responses, whether the development of Th2 cells requires instruction from particular subset of dendritic cells (DCs) remains unclear. By using an in vivo depletion approach, we have shown that DCs expressing CD301b were required for the generation of Th2 cells after subcutaneous immunization with ovalbumin (OVA) along with papain or alum. CD301b⁺ DCs are distinct from epidermal or CD207⁺ dermal DCs (DDCs) and were responsible for transporting antigen injected subcutaneously with Th2-type adjuvants. Transient depletion of CD301b⁺ DCs resulted in less effective accumulation and decreased expression of CD69 by polyclonal CD4⁺ T cells in the lymph node. Moreover, despite intact cell division and interferon-γ production, CD301b⁺ DC depletion led to blunted interleukin-4 production by OVA-specific OT-II transgenic CD4⁺ T cells and significantly impaired Th2 cell development upon infection with Nippostrongylus brasiliensis. These results reveal CD301b⁺ DDCs as the key mediators of Th2 immunity. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Antigen localization controls T cell-mediated tumor immunity.

    PubMed

    Zeelenberg, Ingrid S; van Maren, Wendy W C; Boissonnas, Alexandre; Van Hout-Kuijer, Maaike A; Den Brok, Martijn H M G M; Wagenaars, Jori A L; van der Schaaf, Alie; Jansen, Eric J R; Amigorena, Sebastian; Théry, Clotilde; Figdor, Carl G; Adema, Gosse J

    2011-08-01

    Effective antitumor immunotherapy requires the identification of suitable target Ags. Interestingly, many of the tumor Ags used in clinical trials are present in preparations of secreted tumor vesicles (exosomes). In this study, we compared T cell responses elicited by murine MCA101 fibrosarcoma tumors expressing a model Ag at different localizations within the tumor cell in association with secreted vesicles (exosomes), as a nonsecreted cell-associated protein, or as secreted soluble protein. Remarkably, we demonstrated that only the tumor-secreting vesicle-bound Ag elicited a strong Ag-specific CD8(+) T cell response, CD4(+) T cell help, Ag-specific Abs, and a decrease in the percentage of immunosuppressive regulatory T cells in the tumor. Moreover, in a therapeutic tumor model of cryoablation, only in tumors secreting vesicle-bound Ag could Ag-specific CD8(+) T cells still be detected up to 16 d after therapy. We concluded that the localization of an Ag within the tumor codetermines whether a robust immunostimulatory response is elicited. In vivo, vesicle-bound Ag clearly skews toward a more immunogenic phenotype, whereas soluble or cell-associated Ag expression cannot prevent or even delay outgrowth and results in tumor tolerance. This may explain why particular immunotherapies based on these vesicle-bound tumor Ags are potentially successful. Therefore, we conclude that this study may have significant implications in the discovery of new tumor Ags suitable for immunotherapy and that their location should be taken into account to ensure a strong antitumor immune response.

  13. Tumor-associated mesenchymal stem cells inhibit naïve T cell expansion by blocking cysteine export from dendritic cells.

    PubMed

    Ghosh, Tithi; Barik, Subhasis; Bhuniya, Avishek; Dhar, Jesmita; Dasgupta, Shayani; Ghosh, Sarbari; Sarkar, Madhurima; Guha, Ipsita; Sarkar, Koustav; Chakrabarti, Pinak; Saha, Bhaskar; Storkus, Walter J; Baral, Rathindranath; Bose, Anamika

    2016-11-01

    Mesenchymal stem cells (MSCs) represent an important cellular constituent of the tumor microenvironment, which along with tumor cells themselves, serve to regulate protective immune responses in support of progressive disease. We report that tumor MSCs prevent the ability of dendritic cells (DC) to promote naïve CD4(+) and CD8(+) T cell expansion, interferon gamma secretion and cytotoxicity against tumor cells, which are critical to immune-mediated tumor eradication. Notably, tumor MSCs fail to prevent DC-mediated early T cell activation events or the ability of responder T cells to produce IL-2. The immunoregulatory activity of tumor MSCs is IL-10- and STAT3-dependent, with STAT3 repressing DC expression of cystathionase, a critical enzyme that converts methionine-to-cysteine. Under cysteine-deficient priming conditions, naïve T cells exhibit defective cellular metabolism and proliferation. Bioinformatics analyses as well as in vitro observations suggest that STAT3 may directly bind to a GAS-like motif within the cystathionase promoter (-269 to -261) leading to IL-10-STAT3 mediated repression of cystathionase gene transcription. Our collective results provide evidence for a novel mechanism of tumor MSC-mediated T cell inhibition within tumor microenvironment. © 2016 UICC.

  14. Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

    DTIC Science & Technology

    2017-08-01

    Award Number: W81XWH-15-1-0328 TITLE: Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against...1 August 2016 - 31 July 2017 4. TITLE AND SUBTITLE Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed...discovered that a subset of regulatory T cells (Tregs), termed peripheral-derived Tregs (pTregs), impair immune responses directed against tumor

  15. Immune and Genetic Correlates of Vaccine Protection Against Mucosal Infection by SIV in Monkeys

    PubMed Central

    Letvin, Norman L.; Rao, Srinivas S.; Montefiori, David C.; Seaman, Michael S.; Sun, Yue; Lim, So-Yon; Yeh, Wendy W.; Asmal, Mohammed; Gelman, Rebecca S.; Shen, Ling; Whitney, James B.; Seoighe, Cathal; Lacerda, Miguel; Keating, Sheila; Norris, Philip J.; Hudgens, Michael G.; Gilbert, Peter B.; Buzby, Adam P.; Mach, Linh V.; Zhang, Jinrong; Balachandran, Harikrishnan; Shaw, George M.; Schmidt, Stephen D.; Todd, John-Paul; Dodson, Alan; Mascola, John R.; Nabel, Gary J.

    2013-01-01

    The RV144 vaccine trial in Thailand demonstrated that an HIV vaccine could prevent infection in humans and highlights the importance of understanding protective immunity against HIV. We used a nonhuman primate model to define immune and genetic mechanisms of protection against mucosal infection by the simian immunodeficiency virus (SIV). A plasmid DNA prime/recombinant adenovirus serotype 5 (rAd5) boost vaccine regimen was evaluated for its ability to protect monkeys from infection by SIVmac251 or SIVsmE660 isolates after repeat intrarectal challenges. Although this prime-boost vaccine regimen failed to protect against SIVmac251 infection, 50% of vaccinated monkeys were protected from infection with SIVsmE660. Among SIVsmE660-infected animals, there was an about one-log reduction in peak plasma virus RNA in monkeys expressing the major histocompatibility complex class I allele Mamu-A*01, implicating cytotoxic T lymphocytes in the control of SIV replication once infection is established. Among Mamu-A*01–negative monkeys challenged with SIVsmE660, no CD8+ T cell response or innate immune response was associated with protection against virus acquisition. However, low levels of neutralizing antibodies and an envelope-specific CD4+ T cell response were associated with vaccine protection in these monkeys. Moreover, monkeys that expressed two TRIM5 alleles that restrict SIV replication were more likely to be protected from infection than monkeys that expressed at least one permissive TRIM5 allele. This study begins to elucidate the mechanism of vaccine protection against immunodeficiency viruses and highlights the need to analyze these immune and genetic correlates of protection in future trials of HIV vaccine strategies. PMID:21543722

  16. Immune and Genetic Correlates of Vaccine Protection Against Mucosal Infection by SIV in Monkeys.

    PubMed

    Letvin, Norman L; Rao, Srinivas S; Montefiori, David C; Seaman, Michael S; Sun, Yue; Lim, So-Yon; Yeh, Wendy W; Asmal, Mohammed; Gelman, Rebecca S; Shen, Ling; Whitney, James B; Seoighe, Cathal; Lacerda, Miguel; Keating, Sheila; Norris, Philip J; Hudgens, Michael G; Gilbert, Peter B; Buzby, Adam P; Mach, Linh V; Zhang, Jinrong; Balachandran, Harikrishnan; Shaw, George M; Schmidt, Stephen D; Todd, John-Paul; Dodson, Alan; Mascola, John R; Nabel, Gary J

    2011-05-04

    The RV144 vaccine trial in Thailand demonstrated that an HIV vaccine could prevent infection in humans and highlights the importance of understanding protective immunity against HIV. We used a nonhuman primate model to define immune and genetic mechanisms of protection against mucosal infection by the simian immunodeficiency virus (SIV). A plasmid DNA prime/recombinant adenovirus serotype 5 (rAd5) boost vaccine regimen was evaluated for its ability to protect monkeys from infection by SIVmac251 or SIVsmE660 isolates after repeat intrarectal challenges. Although this prime-boost vaccine regimen failed to protect against SIVmac251 infection, 50% of vaccinated monkeys were protected from infection with SIVsmE660. Among SIVsmE660-infected animals, there was about a one-log reduction in peak plasma virus RNA in monkeys expressing the major histocompatibility complex class I allele Mamu-A*01, implicating cytotoxic T lymphocytes in the control of SIV replication once infection is established. Among Mamu-A*01-negative monkeys challenged with SIVsmE660, no CD8(+) T cell response or innate immune response was associated with protection against virus acquisition. However, low levels of neutralizing antibodies and an envelope-specific CD4(+) T cell response were associated with vaccine protection in these monkeys. Moreover, monkeys that expressed two TRIM5 alleles that restrict SIV replication were more likely to be protected from infection than monkeys that expressed at least one permissive TRIM5 allele. This study begins to elucidate the mechanisms of vaccine protection against immunodeficiency viruses and highlights the need to analyze these immune and genetic correlates of protection in future trials of HIV vaccine strategies.

  17. Segregated Regulatory CD39+ CD4+ T Cell Function: TGF-β-Producing FoxP3− and IL-10-Producing FoxP3+ Cells Are Interdependent for Protection Against Collagen-Induced Arthritis1

    PubMed Central

    Kochetkova, Irina; Thornburg, Theresa; Callis, Gayle; Pascual, David W.

    2011-01-01

    Oral immunization with a Salmonella vaccine vector expressing enterotoxigenic E. coli colonization factor antigen I (CFA/I) can protect against collagen-induced arthritis (CIA) by dampening IL-17 and IFN-γ via enhanced IL-4, IL-10, and TGF-β. To identify the responsible regulatory CD4+ T cells making the host refractory to CIA, Salmonella-CFA/I induced CD39+CD4+ T cells with enhanced apyrase activity relative to Salmonella vector-immunized mice. Adoptive transfer of vaccine-induced CD39+CD4+ T cells into CIA mice conferred complete protection, while CD39−CD4+ T cells did not. Subsequent analysis of vaccinated FoxP3-GFP mice revealed the CD39+ T cells were composed of FoxP3-GFP− and FoxP3-GFP+ subpopulations. Although each adoptively transferred Salmonella-CFA/I-induced FoxP3− and FoxP3+CD39+CD4+ T cells could protect against CIA, each subset was not as efficacious as total CD39+CD4+ T cells, suggesting their interdependence for optimal protection. Cytokine analysis revealed FoxP3− CD39+CD4+ T cells produced TGF-β, and FoxP3+CD39+CD4+ T cells produced IL-10, showing a segregation of function. Moreover, donor FoxP3-GFP− CD4+ T cells converted to FoxP3-GFP+ CD39+CD4+ T cells in the recipients, showing plasticity of these regulatory T cells. TGF-β was found to be essential for protection since in vivo TGF-β neutralization reversed activation of cAMP-response element-binding protein (CREB) and reduced the development of CD39+CD4+ T cells. Thus, CD39 apyrase-expressing CD4+ T cells stimulated by Salmonella-CFA/I are composed of TGF-β-producing FoxP3− CD39+CD4+ T cells and support the stimulation of IL-10-producing FoxP3+ CD39+CD4+ T cells. PMID:21967895

  18. c-Maf controls immune responses by regulating disease-specific gene networks and repressing IL-2 in CD4+ T cells.

    PubMed

    Gabryšová, Leona; Alvarez-Martinez, Marisol; Luisier, Raphaëlle; Cox, Luke S; Sodenkamp, Jan; Hosking, Caroline; Pérez-Mazliah, Damián; Whicher, Charlotte; Kannan, Yashaswini; Potempa, Krzysztof; Wu, Xuemei; Bhaw, Leena; Wende, Hagen; Sieweke, Michael H; Elgar, Greg; Wilson, Mark; Briscoe, James; Metzis, Vicki; Langhorne, Jean; Luscombe, Nicholas M; O'Garra, Anne

    2018-05-01

    The transcription factor c-Maf induces the anti-inflammatory cytokine IL-10 in CD4 + T cells in vitro. However, the global effects of c-Maf on diverse immune responses in vivo are unknown. Here we found that c-Maf regulated IL-10 production in CD4 + T cells in disease models involving the T H 1 subset of helper T cells (malaria), T H 2 cells (allergy) and T H 17 cells (autoimmunity) in vivo. Although mice with c-Maf deficiency targeted to T cells showed greater pathology in T H 1 and T H 2 responses, T H 17 cell-mediated pathology was reduced in this context, with an accompanying decrease in T H 17 cells and increase in Foxp3 + regulatory T cells. Bivariate genomic footprinting elucidated the c-Maf transcription-factor network, including enhanced activity of NFAT; this led to the identification and validation of c-Maf as a negative regulator of IL-2. The decreased expression of the gene encoding the transcription factor RORγt (Rorc) that resulted from c-Maf deficiency was dependent on IL-2, which explained the in vivo observations. Thus, c-Maf is a positive and negative regulator of the expression of cytokine-encoding genes, with context-specific effects that allow each immune response to occur in a controlled yet effective manner.

  19. Nasal Vaccination Stimulates CD8+ T Cells for Potent Protection Against Mucosal Brucella melitensis Challenge

    PubMed Central

    Clapp, Beata; Yang, Xinghong; Thornburg, Theresa; Walters, Nancy; Pascual, David W.

    2016-01-01

    Brucellosis remains a significant zoonotic threat worldwide. Humans and animals acquire infection via their oropharynx and upper respiratory tract following oral or aerosol exposure. After mucosal infection, brucellosis develops into a systemic disease. Mucosal vaccination could offer a viable alternative to conventional injection practices to deter disease. Using a nasal vaccination approach, the ΔznuA B. melitensis was found to confer potent protection against pulmonary Brucella challenge, and reduce colonization of spleens and lungs by more than 2500-fold, with more than 50% of vaccinated mice showing no detectable brucellae. Furthermore, tenfold more brucellae-specific, IFN-γ-producing CD8+ T cells than CD4+ T cells were induced in the spleen and respiratory lymph nodes. Evaluation of pulmonary and splenic CD8+ T cells from mice vaccinated with ΔznuA B. melitensis revealed that these expressed an activated effector memory (CD44hiCD62LloCCR7lo) T cells producing elevated levels of IFN-γ, TNF-α, perforin, and granzyme B. To assess the relative importance of these increased numbers of CD8+ T cells, CD8−/− mice were challenged with virulent B. melitensis, and they showed markedly increased bacterial loads in organs in contrast to similarly challenged CD4−/− mice. Only ΔznuA B. melitensis- and Rev-1-vaccinated CD4−/− and wild-type mice, not CD8−/− mice, were completely protected against Brucella challenge. Determination of cytokines responsible for conferring protection showed the relative importance of IFN-γ, but not IL-17. Unlike wild-type mice, IL-17 was greatly induced in IFN-γ−/− mice, but IL-17 could not substitute for IFN-γ’s protection, although an increase in brucellae dissemination was observed upon in vivo IL-17 neutralization. These results show that nasal ΔznuA B. melitensis vaccination represents an attractive means to stimulate systemic and mucosal immune protection via CD8+ T cell engagement. PMID:26752510

  20. The effect of induction therapy on established CMV specific T cell immunity in living donor kidney transplantation.

    PubMed

    Stranavova, L; Hruba, P; Girmanova, E; Tycova, I; Slavcev, A; Fronek, J; Slatinska, J; Reinke, P; Volk, H-D; Viklicky, O

    2018-05-04

    Cytomegalovirus (CMV) infection influences both short and long term outcomes in immunosuppressed organ transplant recipients. The aim of this study was to evaluate the effect of different induction immunosuppression regimens on CMV specific T cell response in patients with already established CMV immunity. In 24 seropositive living donor kidney recipients, the frequency of CMV specific T cells was determined by ELISPOT (Enzyme-Linked ImmunoSpot) assay prior and 6 months after transplantation. Recipients' peripheral blood mononuclear cells were stimulated with immediate-early (IE1) and phosphoprotein 65 (pp65) CMV-derived peptide pools and the number of cells producing interferon gamma (IFN-gamma) was assessed. Patients received quadruple immunosuppression based either on depletive rabbit antithymocyte globulin (rATG) or non-depletive basiliximab induction and tacrolimus/mycophenolate mofetil/steroids. Patients with rATG induction received valgancyclovir prophylaxis. No effects of different induction agents on CMV specific T cell immunity were found at sixth month after kidney transplantation. There were no associations among dialysis vintage, pretransplant CMV specific T cell immunity, and later CMV DNAemia. Similarly, no effect of CMV prophylaxis on CMV specific T cell immunity was revealed. This study shows no effect of posttransplant immunosuppression on CMV specific T cell immunity in living donor kidney transplant recipients with CMV immunity already established, regardless of lymphocyte depletion and CMV prophylaxis.

  1. Role of immune activation in CD4+ T-cell depletion in HIV-1 infected Indian patients.

    PubMed

    Vajpayee, M; Kaushik, S; Sreenivas, V; Mojumdar, K; Mendiratta, S; Chauhan, N K

    2009-01-01

    The correlation of immune activation with CD4(+) depletion and HIV-1 disease progression has been evidenced by several studies involving mainly clade B virus. However, this needs to be investigated in developing countries such as India predominately infected with clade C virus. In a cross-sectional study of 68 antiretroviral treatment naïve, HIV-1 infected Indian patients, we studied the association between CD4(+) T cells, plasma HIV-1 RNA levels, and immune activation markers using unadjusted and adjusted correlative analyses. Significant negative correlations of higher magnitude were observed between the CD4(+) T cell percentages and plasma HIV-1 RNA levels in the study population when adjusted for the effects of immune activation markers. However, the negative association of CD4(+) T cells with immune activation markers remained unaffected when controlled for the effects of plasma HIV-1 RNA levels. Our results support the important role of immune activation in CD4(+) T cell depletion and disease progression during untreated HIV-1 infection.

  2. ArtinM Mediates Murine T Cell Activation and Induces Cell Death in Jurkat Human Leukemic T Cells

    PubMed Central

    Oliveira-Brito, Patrícia Kellen Martins; Gonçalves, Thiago Eleutério; Vendruscolo, Patrícia Edivânia; Roque-Barreira, Maria Cristina

    2017-01-01

    The recognition of cell surface glycans by lectins may be critical for the innate and adaptive immune responses. ArtinM, a d-mannose-binding lectin from Artocarpus heterophyllus, activates antigen-presenting cells by recognizing TLR2 N-glycans and induces Th1 immunity. We recently demonstrated that ArtinM stimulated CD4+ T cells to produce proinflammatory cytokines. Here, we further studied the effects of ArtinM on adaptive immune cells. We showed that ArtinM activates murine CD4+ and CD8+ T cells, augmenting their positivity for CD25, CD69, and CD95 and showed higher interleukin (IL)-2 and interferon (IFN)-γ production. The CD4+ T cells exhibited increased T-bet expression in response to ArtinM, and IL-2 production by CD4+ and CD8+ T cells depended on the recognition of CD3εγ-chain glycans by ArtinM. The ArtinM effect on aberrantly-glycosylated neoplastic lymphocytes was studied in Jurkat T cells, in which ArtinM induced IL-2, IFN-γ, and IL-1β production, but decreased cell viability and growth. A higher frequency of AnnexinV- and propidium iodide-stained cells demonstrated the induction of Jurkat T cells apoptosis by ArtinM, and this apoptotic response was reduced by caspases and protein tyrosine kinase inhibitors. The ArtinM effects on murine T cells corroborated with the immunomodulatory property of lectin, whereas the promotion of Jurkat T cells apoptosis may reflect a potential applicability of ArtinM in novel strategies for treating lymphocytic leukemia. PMID:28665310

  3. Immune-responsiveness of CD4+ T cells during Streptococcus suis serotype 2 infection

    PubMed Central

    Lecours, Marie-Pier; Letendre, Corinne; Clarke, Damian; Lemire, Paul; Galbas, Tristan; Benoit-Biancamano, Marie-Odile; Thibodeau, Jacques; Gottschalk, Marcelo; Segura, Mariela

    2016-01-01

    The pathogenesis of Streptococcus suis infection, a major swine and human pathogen, is only partially understood and knowledge on the host adaptive immune response is critically scarce. Yet, S. suis virulence factors, particularly its capsular polysaccharide (CPS), enable this bacterium to modulate dendritic cell (DC) functions and potentially impair the immune response. This study aimed to evaluate modulation of T cell activation during S. suis infection and the role of DCs in this response. S. suis-stimulated total mouse splenocytes readily produced TNF-α, IL-6, IFN-γ, CCL3, CXCL9, and IL-10. Ex vivo and in vivo analyses revealed the involvement of CD4+ T cells and a Th1 response. Nevertheless, during S. suis infection, levels of the Th1-derived cytokines TNF-α and IFN-γ were very low. A transient splenic depletion of CD4+ T cells and a poor memory response were also observed. Moreover, CD4+ T cells secreted IL-10 and failed to up-regulate optimal levels of CD40L and CD69 in coculture with DCs. The CPS hampered release of several T cell-derived cytokines in vitro. Finally, a correlation was established between severe clinical signs of S. suis disease and impaired antibody responses. Altogether, these results suggest S. suis interferes with the adaptive immune response. PMID:27905502

  4. Amplifying IFN-γ Signaling in Dendritic Cells by CD11c-Specific Loss of SOCS1 Increases Innate Immunity to Infection while Decreasing Adaptive Immunity.

    PubMed

    Alice, Alejandro F; Kramer, Gwen; Bambina, Shelly; Baird, Jason R; Bahjat, Keith S; Gough, Michael J; Crittenden, Marka R

    2018-01-01

    Although prophylactic vaccines provide protective humoral immunity against infectious agents, vaccines that elicit potent CD8 T cell responses are valuable tools to shape and drive cellular immunity against cancer and intracellular infection. In particular, IFN-γ-polarized cytotoxic CD8 T cell immunity is considered optimal for protective immunity against intracellular Ags. Suppressor of cytokine signaling (SOCS)1 is a cross-functional negative regulator of TLR and cytokine receptor signaling via degradation of the receptor-signaling complex. We hypothesized that loss of SOCS1 in dendritic cells (DCs) would improve T cell responses by accentuating IFN-γ-directed immune responses. We tested this hypothesis using a recombinant Listeria monocytogenes vaccine platform that targets CD11c + DCs in mice in which SOCS1 is selectively deleted in all CD11c + cells. Unexpectedly, in mice lacking SOCS1 expression in CD11c + cells, we observed a decrease in CD8 + T cell response to the L. monocytogenes vaccine. NK cell responses were also decreased in mice lacking SOCS1 expression in CD11c + cells but did not explain the defect in CD8 + T cell immunity. We found that DCs lacking SOCS1 expression were functional in driving Ag-specific CD8 + T cell expansion in vitro but that this process was defective following infection in vivo. Instead, monocyte-derived innate TNF-α and inducible NO synthase-producing DCs dominated the antibacterial response. Thus, loss of SOCS1 in CD11c + cells skewed the balance of immune response to infection by increasing innate responses while decreasing Ag-specific adaptive responses to infectious Ags. Copyright © 2017 by The American Association of Immunologists, Inc.

  5. Genetic interaction between two insulin-dependent diabetes susceptibility loci, Idd2 and Idd13, in determining immunoregulatory DN T cell proportion.

    PubMed

    Collin, Roxanne; Doyon, Kathy; Mullins-Dansereau, Victor; Karam, Martin; Chabot-Roy, Geneviève; Hillhouse, Erin E; Orthwein, Alexandre; Lesage, Sylvie

    2018-04-25

    Several immune regulatory cell types participate in the protection against autoimmune diseases such as autoimmune diabetes. Of these immunoregulatory cells, we and others have shown that peripheral CD4 - CD8 - double negative (DN) T cells can induce antigen-specific immune tolerance. Particularly, we have described that diabetes-prone mice exhibit a lower number of peripheral DN T cells compared to diabetes-resistant mice. Identifying the molecular pathways that influence the size of the DN T cell pool in peripheral lymphoid organs may thus be of interest for maintaining antigen-specific immune tolerance. Hence, through immunogenetic approaches, we found that two genetic loci linked to autoimmune diabetes susceptibility, namely Idd2 and Idd13, independently contribute to the partial restoration of DN T cell proportion in secondary lymphoid organs. We now extend these findings to show an interaction between the Idd2 and Idd13 loci in determining the number of DN T cells in secondary lymphoid organs. Using bioinformatics tools, we link potential biological pathways arising from interactions of genes encoded within the two loci. By focusing on cell cycle, we validate that both the Idd2 and Idd13 loci influence RAD51 expression as well as DN T cell progression through the cell cycle. Altogether, we find that genetic interactions between Idd2 and Idd13 loci modulate cell cycle progression, which contributes, at least in part, to defining the proportion of DN T cells in secondary lymphoid organs.

  6. In Vivo Expansion of Activated Foxp3+ Regulatory T Cells and Establishment of a Type 2 Immune Response upon IL-33 Treatment Protect against Experimental Arthritis.

    PubMed

    Biton, Jérôme; Khaleghparast Athari, Sara; Thiolat, Allan; Santinon, François; Lemeiter, Delphine; Hervé, Roxane; Delavallée, Laure; Levescot, Anais; Roga, Stéphane; Decker, Patrice; Girard, Jean-Philippe; Herbelin, André; Boissier, Marie-Christophe; Bessis, Natacha

    2016-09-01

    IL-33 is strongly involved in several inflammatory and autoimmune disorders with both pro- and anti-inflammatory properties. However, its contribution to chronic autoimmune inflammation, such as rheumatoid arthritis, is ill defined and probably requires tight regulation. In this study, we aimed at deciphering the complex role of IL-33 in a model of rheumatoid arthritis, namely, collagen-induced arthritis (CIA). We report that repeated injections of IL-33 during induction (early) and during development (late) of CIA strongly suppressed clinical and histological signs of arthritis. In contrast, a late IL-33 injection had no effect. The cellular mechanism involved in protection was related to an enhanced type 2 immune response, including the expansion of eosinophils, Th2 cells, and type 2 innate lymphoid cells, associated with an increase in type 2 cytokine levels in the serum of IL-33-treated mice. Moreover, our work strongly highlights the interplay between IL-33 and regulatory T cells (Tregs), demonstrated by the dramatic in vivo increase in Treg frequencies after IL-33 treatment of CIA. More importantly, Tregs from IL-33-treated mice displayed enhanced capacities to suppress IFN-γ production by effector T cells, suggesting that IL-33 not only favors Treg proliferation but also enhances their immunosuppressive properties. In concordance with these observations, we found that IL-33 induced the emergence of a CD39(high) Treg population in a ST2L-dependent manner. Our findings reveal a powerful anti-inflammatory mechanism by which IL-33 administration inhibits arthritis development. Copyright © 2016 by The American Association of Immunologists, Inc.

  7. Innate cell communication kick-starts pathogen-specific immunity

    PubMed Central

    Rivera, Amariliz; Siracusa, Mark C.; Yap, George S.; Gause, William C.

    2016-01-01

    Innate cells are responsible for the rapid recognition of infection and mediate essential mechanisms of pathogen elimination, and also facilitate adaptive immune responses. We review here the numerous intricate interactions among innate cells that initiate protective immunity. The efficient eradication of pathogens depends on the coordinated actions of multiple cells, including innate cells and epithelial cells. Rather than acting as isolated effector cells, innate cells are in constant communication with other responding cells of the immune system, locally and distally. These interactions are critically important for the efficient control of primary infections as well for the development of ‘trained’ innate cells that facilitate the rapid elimination of homologous or heterologous infections. PMID:27002843

  8. The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

    PubMed Central

    Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

    2014-01-01

    Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

  9. Distinct T and NK cell populations may serve as immune correlates of protection against symptomatic pandemic influenza A(H1N1) virus infection during pregnancy

    PubMed Central

    Dembinski, Jennifer L.; Laake, Ida; Hungnes, Olav; Cox, Rebecca; Oftung, Fredrik; Trogstad, Lill; Mjaaland, Siri

    2017-01-01

    Maternal influenza infection during pregnancy is associated with increased risk of morbidity and mortality. However, the link between the anti-influenza immune responses and health-related risks during infection is not well understood. We have analyzed memory T and NK cell mediated immunity (CMI) responses in pandemic influenza A(H1N1)pdm09 (pdm09) virus infected non-vaccinated pregnant women participating in the Norwegian Influenza Pregnancy Cohort (NorFlu). The cohort includes information on immunization, self-reported health and disease status, and biological samples (plasma and PBMC). Infected cases (N = 75) were defined by having a serum hemagglutination inhibition (HI) titer > = 20 to influenza pdm09 virus at the time of delivery, while controls (N = 75) were randomly selected among non-infected pregnant women (HI titer <10). In ELISpot assays cases had higher frequencies of IFNγ+ CD8+ T cells responding to pdm09 virus or conserved CD8 T cell-restricted influenza A virus epitopes, compared to controls. Within this T cell population, frequencies of CD95+ late effector (CD45RA+CCR7-) and naive (CD45RA+CCR7+) CD8+ memory T cells correlated inversely with self-reported influenza illness (ILI) symptoms. ILI symptoms in infected women were also associated with lower numbers of poly-functional (IFNγ+TNFα+, IL2+IFNγ+, IL2+IFNγ+TNFα+) CD4+ T cells and increased frequencies of IFNγ+CD3-CD7+ NK cells compared to asymptomatic cases, or controls, after stimulation with the pdm09 virus. Taken together, virus specific and functionally distinct T and NK cell populations may serve as cellular immune correlates of clinical outcomes of pandemic influenza disease in pregnant women. Our results may provide information important for future universal influenza vaccine design. PMID:29145441

  10. Distinct T and NK cell populations may serve as immune correlates of protection against symptomatic pandemic influenza A(H1N1) virus infection during pregnancy.

    PubMed

    Savic, Miloje; Dembinski, Jennifer L; Laake, Ida; Hungnes, Olav; Cox, Rebecca; Oftung, Fredrik; Trogstad, Lill; Mjaaland, Siri

    2017-01-01

    Maternal influenza infection during pregnancy is associated with increased risk of morbidity and mortality. However, the link between the anti-influenza immune responses and health-related risks during infection is not well understood. We have analyzed memory T and NK cell mediated immunity (CMI) responses in pandemic influenza A(H1N1)pdm09 (pdm09) virus infected non-vaccinated pregnant women participating in the Norwegian Influenza Pregnancy Cohort (NorFlu). The cohort includes information on immunization, self-reported health and disease status, and biological samples (plasma and PBMC). Infected cases (N = 75) were defined by having a serum hemagglutination inhibition (HI) titer > = 20 to influenza pdm09 virus at the time of delivery, while controls (N = 75) were randomly selected among non-infected pregnant women (HI titer <10). In ELISpot assays cases had higher frequencies of IFNγ+ CD8+ T cells responding to pdm09 virus or conserved CD8 T cell-restricted influenza A virus epitopes, compared to controls. Within this T cell population, frequencies of CD95+ late effector (CD45RA+CCR7-) and naive (CD45RA+CCR7+) CD8+ memory T cells correlated inversely with self-reported influenza illness (ILI) symptoms. ILI symptoms in infected women were also associated with lower numbers of poly-functional (IFNγ+TNFα+, IL2+IFNγ+, IL2+IFNγ+TNFα+) CD4+ T cells and increased frequencies of IFNγ+CD3-CD7+ NK cells compared to asymptomatic cases, or controls, after stimulation with the pdm09 virus. Taken together, virus specific and functionally distinct T and NK cell populations may serve as cellular immune correlates of clinical outcomes of pandemic influenza disease in pregnant women. Our results may provide information important for future universal influenza vaccine design.

  11. NLRP3 signaling drives macrophage-induced adaptive immune suppression in pancreatic carcinoma

    PubMed Central

    Daley, Donnele; Mani, Vishnu R.; Mohan, Navyatha; Akkad, Neha; Savadkar, Shivraj; Lee, Ki Buom; Torres-Hernandez, Alejandro; Aykut, Berk; Diskin, Brian; Wang, Wei; Farooq, Mohammad S.; Mahmud, Arif I.; Werba, Gregor; Morales, Eduardo J.; Lall, Sarah; Rubin, Amanda G.; Berman, Matthew E.; Hundeyin, Mautin

    2017-01-01

    The tumor microenvironment (TME) in pancreatic ductal adenocarcinoma (PDA) is characterized by immune tolerance, which enables disease to progress unabated by adaptive immunity. However, the drivers of this tolerogenic program are incompletely defined. In this study, we found that NLRP3 promotes expansion of immune-suppressive macrophages in PDA. NLRP3 signaling in macrophages drives the differentiation of CD4+ T cells into tumor-promoting T helper type 2 cell (Th2 cell), Th17 cell, and regulatory T cell populations while suppressing Th1 cell polarization and cytotoxic CD8+ T cell activation. The suppressive effects of NLRP3 signaling were IL-10 dependent. Pharmacological inhibition or deletion of NLRP3, ASC (apoptosis-associated speck-like protein containing a CARD complex), or caspase-1 protected against PDA and was associated with immunogenic reprogramming of innate and adaptive immunity within the TME. Similarly, transfer of PDA-entrained macrophages or T cells from NLRP3−/− hosts was protective. These data suggest that targeting NLRP3 holds the promise for the immunotherapy of PDA. PMID:28442553

  12. Age-dependent changes in the sphingolipid composition of CD4+ T cell membranes and immune synapses implicate glucosylceramides in age-related T cell dysfunction

    USDA-ARS?s Scientific Manuscript database

    Sphingolipid (SL4) composition can influence the biophysical properties of cell membranes. Additionally, specific SL modulate signaling pathways involved in proliferation, senescence, and apoptosis. We investigated age-dependent changes in the SL composition of CD4+ T cells, and the impact of these ...

  13. Specificity, Privacy, and Degeneracy in the CD4 T Cell Receptor Repertoire Following Immunization

    PubMed Central

    Sun, Yuxin; Best, Katharine; Cinelli, Mattia; Heather, James M.; Reich-Zeliger, Shlomit; Shifrut, Eric; Friedman, Nir; Shawe-Taylor, John; Chain, Benny

    2017-01-01

    T cells recognize antigen using a large and diverse set of antigen-specific receptors created by a complex process of imprecise somatic cell gene rearrangements. In response to antigen-/receptor-binding-specific T cells then divide to form memory and effector populations. We apply high-throughput sequencing to investigate the global changes in T cell receptor sequences following immunization with ovalbumin (OVA) and adjuvant, to understand how adaptive immunity achieves specificity. Each immunized mouse contained a predominantly private but related set of expanded CDR3β sequences. We used machine learning to identify common patterns which distinguished repertoires from mice immunized with adjuvant with and without OVA. The CDR3β sequences were deconstructed into sets of overlapping contiguous amino acid triplets. The frequencies of these motifs were used to train the linear programming boosting (LPBoost) algorithm LPBoost to classify between TCR repertoires. LPBoost could distinguish between the two classes of repertoire with accuracies above 80%, using a small subset of triplet sequences present at defined positions along the CDR3. The results suggest a model in which such motifs confer degenerate antigen specificity in the context of a highly diverse and largely private set of T cell receptors. PMID:28450864

  14. Genetically modified anthrax lethal toxin safely delivers whole HIV protein antigens into the cytosol to induce T cell immunity

    NASA Astrophysics Data System (ADS)

    Lu, Yichen; Friedman, Rachel; Kushner, Nicholas; Doling, Amy; Thomas, Lawrence; Touzjian, Neal; Starnbach, Michael; Lieberman, Judy

    2000-07-01

    Bacillus anthrax lethal toxin can be engineered to deliver foreign proteins to the cytosol for antigen presentation to CD8 T cells. Vaccination with modified toxins carrying 8-9 amino acid peptide epitopes induces protective immunity in mice. To evaluate whether large protein antigens can be used with this system, recombinant constructs encoding several HIV antigens up to 500 amino acids were produced. These candidate HIV vaccines are safe in animals and induce CD8 T cells in mice. Constructs encoding gag p24 and nef stimulate gag-specific CD4 proliferation and a secondary cytotoxic T lymphocyte response in HIV-infected donor peripheral blood mononuclear cells in vitro. These results lay the foundation for future clinical vaccine studies.

  15. Impact of immune-metabolic interactions on age-related thymic demise and T cell senescence.

    PubMed

    Dixit, Vishwa Deep

    2012-10-01

    Emerging evidence indicates that the immune and metabolic interactions control several aspects of the aging process and associated chronic diseases. Among several sites of immune-metabolic interactions, thymic demise represents a particularly puzzling phenomenon because even in metabolically healthy middle-aged individuals the majority of thymic space is replaced with ectopic lipids. The new T cell specificities can only be generated in a functional thymus and, peripheral proliferation of pre-existing T cell clones provides limited immune-vigilance in the elderly. Therefore, it is hypothesized that the strategies that enhance thymic-lymphopoiesis may extend healthspan. Recent data suggest that byproducts of thymic fatty acids and lipids result in accumulation of 'lipotoxic DAMPs' (damage associated molecular patterns), which triggers the innate immune-sensing mechanism like inflammasome activation which links aging to thymic demise. The immune-metabolic interaction within the aging thymus produces a local pro-inflammatory state that directly compromises the thymic stromal microenvironment, thymic-lymphopoiesis and serves a precursor of systemic immune-dysregulation in the elderly. New evidence also suggests that ectopic thymic adipocytes may develop from specific intrathymic stromal cell precursors instead of a passive process that is simply a consequence of thymic lymphopenia. Thus the complex bidirectional interactions between metabolic and immune systems may link aging to health, T cell senescence, and associated diseases. This review discusses the immune-metabolic mechanisms during aging - with implications for developing future therapeutic strategies for living well beyond the expected. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Role of T Cell TGF-β Signaling in Intestinal Cytokine Responses and Helminthic Immune Modulation

    PubMed Central

    Ince, M. Nedim; Elliott, David E.; Setiawan, Tommy; Metwali, Ahmed; Blum, Arthur; Chen, Hung-lin; Urban, Joseph F.; Flavell, Richard A.; Weinstock, Joel V.

    2010-01-01

    Colonization with helminthic parasites induces mucosal regulatory cytokines, like IL-10 or TGF-β that are important in suppressing colitis. Helminths induce mucosal T cell IL-10 secretion and regulate lamina propria mononuclear cell Th1 cytokine generation in an IL-10 dependent manner in wild-type mice. Helminths also stimulate mucosal TGF-β release. As TGF-β exerts major regulatory effects on T lymphocytes, we investigated the role of T lymphocyte TGF-β signaling in helminthic modulation of intestinal immunity. T cell TGF-β signaling is interrupted in TGF-βRII DN mice by T cell-specific over-expression of a dominant negative TGF-β receptor II. We studied lamina propria mononuclear cell responses in wild-type and TGF-βRII DN mice that were uninfected or colonized with the nematode, Heligmosomoides polygyrus. Our results indicate an essential role of T cell TGF-β signaling in limiting mucosal Th1 and Th2 responses. Furthermore, we demonstrate that helminthic induction of intestinal T cell IL-10 secretion requires intact T cell TGF-β signaling pathway. Helminths fail to curtail robust, dysregulated intestinal Th1 cytokine production and chronic colitis in TGF-βRII DN mice. Thus, T cell TGF-β signaling is essential for helminthic stimulation of mucosal IL-10 production, helminthic modulation of intestinal interferon-γ generation and H. polygyrus-mediated suppression of chronic colitis. PMID:19544487

  17. Downregulation of the T-cell receptor by human immunodeficiency virus type 2 Nef does not protect against disease progression.

    PubMed

    Feldmann, Jérôme; Leligdowicz, Aleksandra; Jaye, Assan; Dong, Tao; Whittle, Hilton; Rowland-Jones, Sarah L

    2009-12-01

    Chronic immune activation is thought to play a major role in human immunodeficiency virus (HIV) pathogenesis, but the relative contributions of multiple factors to immune activation are not known. One proposed mechanism to protect against immune activation is the ability of Nef proteins from some HIV and simian immunodeficiency virus strains to downregulate the T-cell receptor (TCR)-CD3 complex of the infected cell, thereby reducing the potential for deleterious activation. HIV type 1 (HIV-1) Nef has lost this property. In contrast to HIV-1, HIV-2 infection is characterized by a marked disparity in the disease course, with most individuals maintaining a normal life span. In this study, we examined the relationship between the ability of HIV-2 Nef proteins to downregulate the TCR and immune activation, comparing progressors and nonprogressors. Representative Nef variants were isolated from 28 HIV-2-infected individuals. We assessed their abilities to downregulate the TCR from the surfaces of CD4 T cells. In the same individuals, the activation of peripheral lymphocytes was evaluated by measurement of the expression levels of HLA-DR and CD38. We observed a striking correlation of the TCR downregulation efficiency of HIV-2 Nef variants with immune activation in individuals with a low viral load. This strongly suggests that Nef expression can influence the activation state of the immune systems of infected individuals. However, the efficiency of TCR downregulation by Nef was not reduced in progressing individuals, showing that TCR downregulation does not protect against progression in HIV-2 infection.

  18. HIV-1 adenoviral vector vaccines expressing multi-trimeric BAFF and 4-1BBL enhance T cell mediated anti-viral immunity.

    PubMed

    Kanagavelu, Saravana; Termini, James M; Gupta, Sachin; Raffa, Francesca N; Fuller, Katherine A; Rivas, Yaelis; Philip, Sakhi; Kornbluth, Richard S; Stone, Geoffrey W

    2014-01-01

    Adenoviral vectored vaccines have shown considerable promise but could be improved by molecular adjuvants. Ligands in the TNF superfamily (TNFSF) are potential adjuvants for adenoviral vector (Ad5) vaccines based on their central role in adaptive immunity. Many TNFSF ligands require aggregation beyond the trimeric state (multi-trimerization) for optimal biological function. Here we describe Ad5 vaccines for HIV-1 Gag antigen (Ad5-Gag) adjuvanted with the TNFSF ligands 4-1BBL, BAFF, GITRL and CD27L constructed as soluble multi-trimeric proteins via fusion to Surfactant Protein D (SP-D) as a multimerization scaffold. Mice were vaccinated with Ad5-Gag combined with Ad5 expressing one of the SP-D-TNFSF constructs or single-chain IL-12p70 as adjuvant. To evaluate vaccine-induced protection, mice were challenged with vaccinia virus expressing Gag (vaccinia-Gag) which is known to target the female genital tract, a major route of sexually acquired HIV-1 infection. In this system, SP-D-4-1BBL or SP-D-BAFF led to significantly reduced vaccinia-Gag replication when compared to Ad5-Gag alone. In contrast, IL-12p70, SP-D-CD27L and SP-D-GITRL were not protective. Histological examination following vaccinia-Gag challenge showed a dramatic lymphocytic infiltration into the uterus and ovaries of SP-D-4-1BBL and SP-D-BAFF-treated animals. By day 5 post challenge, proinflammatory cytokines in the tissue were reduced, consistent with the enhanced control over viral replication. Splenocytes had no specific immune markers that correlated with protection induced by SP-D-4-1BBL and SP-D-BAFF versus other groups. IL-12p70, despite lack of anti-viral efficacy, increased the total numbers of splenic dextramer positive CD8+ T cells, effector memory T cells, and effector Gag-specific CD8+ T cells, suggesting that these markers are poor predictors of anti-viral immunity in this model. In conclusion, soluble multi-trimeric 4-1BBL and BAFF adjuvants led to strong protection from vaccinia

  19. The T Cell Response to Staphylococcus aureus

    PubMed Central

    Bröker, Barbara M.; Mrochen, Daniel; Péton, Vincent

    2016-01-01

    Staphylococcus aureus (S. aureus) is a dangerous pathogen and a leading cause of both nosocomial and community acquired bacterial infection worldwide. However, on the other hand, we are all exposed to this bacterium, often within the first hours of life, and usually manage to establish equilibrium and coexist with it. What does the adaptive immune system contribute toward lifelong control of S. aureus? Will it become possible to raise or enhance protective immune memory by vaccination? While in the past the S. aureus-specific antibody response has dominated this discussion, the research community is now coming to appreciate the role that the cellular arm of adaptive immunity, the T cells, plays. There are numerous T cell subsets, each with differing functions, which together have the ability to orchestrate the immune response to S. aureus and hence to tip the balance between protection and pathology. This review summarizes the state of the art in this dynamic field of research. PMID:26999219

  20. Exposure to Melan-A/MART-126-35 tumor epitope specific CD8+T cells reveals immune escape by affecting the ubiquitin-proteasome system (UPS)

    PubMed Central

    Ebstein, Frédéric; Keller, Martin; Paschen, Annette; Walden, Peter; Seeger, Michael; Bürger, Elke; Krüger, Elke; Schadendorf, Dirk; Kloetzel, Peter-M.; Seifert, Ulrike

    2016-01-01

    Efficient processing of target antigens by the ubiquitin-proteasome-system (UPS) is essential for treatment of cancers by T cell therapies. However, immune escape due to altered expression of IFN-γ-inducible components of the antigen presentation machinery and consequent inefficient processing of HLA-dependent tumor epitopes can be one important reason for failure of such therapies. Here, we show that short-term co-culture of Melan-A/MART-1 tumor antigen-expressing melanoma cells with Melan-A/MART-126-35-specific cytotoxic T lymphocytes (CTL) led to resistance against CTL-induced lysis because of impaired Melan-A/MART-126-35 epitope processing. Interestingly, deregulation of p97/VCP expression, which is an IFN-γ-independent component of the UPS and part of the ER-dependent protein degradation pathway (ERAD), was found to be essentially involved in the observed immune escape. In support, our data demonstrate that re-expression of p97/VCP in Melan-A/MART-126-35 CTL-resistant melanoma cells completely restored immune recognition by Melan-A/MART-126-35 CTL. In conclusion, our experiments show that impaired expression of IFN-γ-independent components of the UPS can exert rapid immune evasion of tumor cells and suggest that tumor antigens processed by distinct UPS degradation pathways should be simultaneously targeted in T cell therapies to restrict the likelihood of immune evasion due to impaired antigen processing. PMID:27143649

  1. The new numerology of immunity mediated by virus-specific CD8(+) T cells.

    PubMed

    Doherty, P C

    1998-08-01

    Our understanding of virus-specific CD8(+) T cell responses is currently being revolutionized by peptide-based assay systems that allow flow cytometric analysis of effector and memory cytotoxic T lymphocyte populations. These techniques are, for the first time, putting the analysis of T-cell-mediated immunity on a quantitative basis.

  2. The cryo-thermal therapy eradicated melanoma in mice by eliciting CD4+ T-cell-mediated antitumor memory immune response.

    PubMed

    He, Kun; Liu, Ping; Xu, Lisa X

    2017-03-23

    Tumor metastasis is a major concern in tumor therapy. In our previous studies, a novel tumor therapeutic modality of the cryo-thermal therapy has been presented, highlighting its effect on the suppression of distal metastasis and leading to long-term survival in 4T1 murine mammary carcinoma model. To demonstrate the therapeutic efficacy in other aggressive tumor models and further investigate the mechanism of long-term survival induced, in this study, spontaneous metastatic murine B16F10 melanoma model was used. The cryo-thermal therapy induced regression of implanted melanoma and prolonged long-term survival while inhibiting lung metastasis. It also promoted the activation of CD4 + CD25 - conventional T cells, while reduced the percentage of CD4 + CD25 + regulatory T cells (Tregs) and myeloid-derived suppressor cells (MDSCs) in the spleen, lung and blood. Furthermore, the cryo-thermal therapy enhanced the cytolytic function of CD8 + T cells and induced differentiation of CD8 + T cells into memory stem T cell (T SCM ), and differentiation of CD4 + T cells into dominant CD4-CTL, Th1 and Tfh subsets in the spleen for 90 days after the treatment. It was found that good therapeutic effect was mainly dependent on CD4 + T cells providing a durable memory antitumor immune response. At the same time, significant increase of serum IFN-γ was also observed to provide an ideal microenvironment of antitumor immunity. Further study showed that the rejection of re-challenge of B16F10 but not GL261 tumor in the treated mice in 45 or 60 days after the treatment, implied a strong systemic and melanoma-specific memory antitumor immunity induced by the treatment. Thus the cryo-thermal therapy would be considered as a new therapeutic strategy to prevent tumor recurrence and metastasis with potential clinical applications in the near future.

  3. PD-L2 Elbows out PD-L1 to Rescue T Cell Immunity to Malaria.

    PubMed

    Crompton, Peter D; Pierce, Susan K

    2016-08-16

    How early interactions between innate and adaptive immune cells influence outcomes of acute infections is incompletely understood. In this issue of Immunity, Karunarathne et al. (2016) show that dendritic cells help CD4(+) T helper 1 cell immunity against malaria through PD-L2's competition with PD-L1. Published by Elsevier Inc.

  4. Memory T cells in organ transplantation: progress and challenges

    PubMed Central

    Espinosa, Jaclyn R.; Samy, Kannan P.; Kirk, Allan D.

    2017-01-01

    Antigen-experienced T cells, also known as memory T cells, are functionally and phenotypically distinct from naive T cells. Their enhanced expression of adhesion molecules and reduced requirement for co-stimulation enables them to mount potent and rapid recall responses to subsequent antigen encounters. Memory T cells generated in response to prior antigen exposures can cross-react with other nonidentical, but similar, antigens. This heterologous cross-reactivity not only enhances protective immune responses, but also engenders de novo alloimmunity. This latter characteristic is increasingly recognized as a potential barrier to allograft acceptance that is worthy of immunotherapeutic intervention, and several approaches have been investigated. Calcineurin inhibition effectively controls memory T-cell responses to allografts, but this benefit comes at the expense of increased infectious morbidity. Lymphocyte depletion eliminates allospecific T cells but spares memory T cells to some extent, such that patients do not completely lose protective immunity. Co-stimulation blockade is associated with reduced adverse-effect profiles and improved graft function relative to calcineurin inhibition, but lacks efficacy in controlling memory T-cell responses. Targeting the adhesion molecules that are upregulated on memory T cells might offer additional means to control co-stimulation-blockade-resistant memory T-cell responses. PMID:26923209

  5. Impaired B cell immunity in acute myeloid leukemia patients after chemotherapy.

    PubMed

    Goswami, Meghali; Prince, Gabrielle; Biancotto, Angelique; Moir, Susan; Kardava, Lela; Santich, Brian H; Cheung, Foo; Kotliarov, Yuri; Chen, Jinguo; Shi, Rongye; Zhou, Huizhi; Golding, Hana; Manischewitz, Jody; King, Lisa; Kunz, Lauren M; Noonan, Kimberly; Borrello, Ivan M; Smith, B Douglas; Hourigan, Christopher S

    2017-07-10

    Changes in adaptive immune cells after chemotherapy in adult acute myeloid leukemia (AML) may have implications for the success of immunotherapy. This study was designed to determine the functional capacity of the immune system in adult patients with AML who have completed chemotherapy and are potential candidates for immunotherapy. We used the response to seasonal influenza vaccination as a surrogate for the robustness of the immune system in 10 AML patients in a complete remission post-chemotherapy and performed genetic, phenotypic, and functional characterization of adaptive immune cell subsets. Only 2 patients generated protective titers in response to vaccination, and a majority of patients had abnormal frequencies of transitional and memory B-cells. B-cell receptor sequencing showed a B-cell repertoire with little evidence of somatic hypermutation in most patients. Conversely, frequencies of T-cell populations were similar to those seen in healthy controls, and cytotoxic T-cells demonstrated antigen-specific activity after vaccination. Effector T-cells had increased PD-1 expression in AML patients least removed from chemotherapy. Our results suggest that while some aspects of cellular immunity recover quickly, humoral immunity is incompletely reconstituted in the year following intensive cytotoxic chemotherapy for AML. The observed B-cell abnormalities may explain the poor response to vaccination often seen in AML patients after chemotherapy. Furthermore, the uncoupled recovery of B-cell and T-cell immunity and increased PD-1 expression shortly after chemotherapy might have implications for the success of several modalities of immunotherapy.

  6. T-bet-dependent NKp46+ innate lymphoid cells regulate the onset of TH17-induced neuroinflammation.

    PubMed

    Kwong, Brandon; Rua, Rejane; Gao, Yuanyuan; Flickinger, John; Wang, Yan; Kruhlak, Michael J; Zhu, Jinfang; Vivier, Eric; McGavern, Dorian B; Lazarevic, Vanja

    2017-10-01

    The transcription factor T-bet has been associated with increased susceptibility to systemic and organ-specific autoimmunity, but the mechanism by which T-bet expression promotes neuroinflammation remains unknown. In this study, we demonstrate a cardinal role of T-bet-dependent NKp46 + innate lymphoid cells (ILCs) in the initiation of CD4 + T H 17-mediated neuroinflammation. Loss of T-bet specifically in NKp46 + ILCs profoundly impaired the ability of myelin-reactive T H 17 cells to invade central nervous system (CNS) tissue and protected the mice from autoimmunity. T-bet-dependent NKp46 + ILCs localized in the meninges and acted as chief coordinators of meningeal inflammation by inducing the expression of proinflammatory cytokines, chemokines and matrix metalloproteinases, which together facilitated T cell entry into CNS parenchyma. Our findings uncover a detrimental role of T-bet-dependent NKp46 + ILCs in the development of CNS autoimmune disease.

  7. Immunity in the spleen and blood of mice immunized with irradiated Toxoplasma gondii tachyzoites.

    PubMed

    Zorgi, Nahiara Esteves; Galisteo, Andrés Jimenez; Sato, Maria Notomi; do Nascimento, Nanci; de Andrade, Heitor Franco

    2016-08-01

    Toxoplasma gondii infection induces a strong and long-lasting immune response that is able to prevent most reinfections but allows tissue cysts. Irradiated, sterilized T. gondii tachyzoites are an interesting vaccine, and they induce immunity that is similar to infection, but without cysts. In this study, we evaluated the cellular immune response in the blood and spleen of mice immunized with this preparation by mouth (v.o.) or intraperitoneally (i.p.) and analyzed the protection after challenge with viable parasites. BALB/c mice were immunized with three i.p. or v.o. doses of irradiated T. gondii tachyzoites. Oral challenge with ten cysts of the ME-49 or VEG strain at 90 days after the last dose resulted in high levels of protection with low parasite burden in the immunized animals. There were higher levels of specific IgG, IgA and IgM antibodies in the serum, and the i.p. immunized mice had higher levels of the high-affinity IgG and IgM antibodies than the orally immunized mice, which had more high-affinity IgA antibodies. B cells (CD19(+)), plasma cells (CD138(+)) and the CD4(+) and CD8(+) T cell populations were increased in both the blood and spleen. Cells from the spleen of the i.p. immunized mice also showed antigen-induced production of interleukin-10 (IL-10), interferon gamma (IFN-γ) and interleukin 4 (IL-4). The CD4(+) T cells, B cells and likely CD8(+) T cells from the spleens of the i.p. immunized mice proliferated with a specific antigen. The protection was correlated with the spleen and blood CD8(+) T cell, high-affinity IgG and IgM and antigen-induced IL-10 and IL-4 production. Immunization with irradiated T. gondii tachyzoites induces an immune response that is mediated by B cells and CD4(+) and CD8(+) T cells, with increased humoral and cellular immune responses that are necessary for host protection after infection. The vaccine is similar to natural infection, but free of tissue cysts; this immunity restrains infection at challenge and can be an

  8. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    PubMed

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  9. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*

    PubMed Central

    Zhang, Jie; Liu, Huan; Wei, Bin

    2017-01-01

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566

  10. Depressed immune surveillance against cancer: role of deficient T cell: extracellular matrix interactions.

    PubMed

    Górski, A; Castronovo, V; Stepień-Sopniewska, B; Grieb, P; Ryba, M; Mrowiec, T; Korczak-Kowalska, G; Wierzbicki, P; Matysiak, W; Dybowska, B

    1994-07-01

    Although T cells infiltrate malignant tumors, the local immune response is usually inefficient and tumors escape destruction. While extracellular matrix proteins strongly costimulate T cell responses in normal individuals, our studies indicate that peripheral blood T cells from cancer patients and tumor infiltrating cells respond poorly or are resistant to stimulative signals mediated by collagen I and IV and fibronectin. Moreover, the adhesive properties of cancer T cells are markedly depressed. Those functional deficiencies are paralleled by variable deficits in integrin and non-integrin T cell receptors for extracellular matrix. Immunotherapy with BCG causes a dramatic but transient increase in T cell: ECM interactions.

  11. B Cell-Intrinsic IDO1 Regulates Humoral Immunity to T Cell-Independent Antigens.

    PubMed

    Shinde, Rahul; Shimoda, Michiko; Chaudhary, Kapil; Liu, Haiyun; Mohamed, Eslam; Bradley, Jillian; Kandala, Sridhar; Li, Xia; Liu, Kebin; McGaha, Tracy L

    2015-09-01

    Humoral responses to nonproteinaceous Ags (i.e., T cell independent [TI]) are a key component of the early response to bacterial and viral infection and a critical driver of systemic autoimmunity. However, mechanisms that regulate TI humoral immunity are poorly defined. In this study, we report that B cell-intrinsic induction of the tryptophan-catabolizing enzyme IDO1 is a key mechanism limiting TI Ab responses. When Ido1(-/-) mice were immunized with TI Ags, there was a significant increase in Ab titers and formation of extrafollicular Ab-secreting cells compared with controls. This effect was specific to TI Ags, as Ido1 disruption did not affect Ig production after immunization with protein Ags. The effect of IDO1 abrogation was confined to the B cell compartment, as adoptive transfer of Ido1(-/-) B cells to B cell-deficient mice was sufficient to replicate increased TI responses observed in Ido1(-/-) mice. Moreover, in vitro activation with TLR ligands or BCR crosslinking rapidly induced Ido1 expression and activity in purified B cells, and Ido1(-/-) B cells displayed enhanced proliferation and cell survival associated with increased Ig and cytokine production compared with wild-type B cells. Thus, our results demonstrate a novel, B cell-intrinsic, role for IDO1 as a regulator of humoral immunity that has implications for both vaccine design and prevention of autoimmunity. Copyright © 2015 by The American Association of Immunologists, Inc.

  12. Protective and destructive immunity in the periodontium: Part 1--innate and humoral immunity and the periodontium.

    PubMed

    Teng, Y-T A

    2006-03-01

    Based on the results of recent research in the field, the present paper will discuss the protective and destructive aspects of the innate vs. adaptive (humoral and cell-mediated) immunity associated with the bacterial virulent factors or antigenic determinants during periodontal pathogenesis. Attention will be focused on: (i) the Toll-like receptors (TLR), the innate immune repertoire for recognizing the unique molecular patterns of microbial components that trigger innate and adaptive immunity for effective host defenses, in some general non-oral vs. periodontal microbial infections; (ii) T-cell-mediated immunity, Th-cytokines, and osteoclastogenesis in periodontal disease progression; and (iii) some molecular techniques developed and used to identify critical microbial virulence factors or antigens associated with host immunity (using Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis as the model species). Therefore, further understanding of the molecular interactions and mechanisms associated with the host's innate and adaptive immune responses will facilitate the development of new and innovative therapeutics for future periodontal treatments.

  13. Memory Th1 Cells Are Protective in Invasive Staphylococcus aureus Infection

    PubMed Central

    Lalor, Stephen J.; Leech, John M.; O’Keeffe, Kate M.; Mac Aogáin, Micheál; O’Halloran, Dara P.; Lacey, Keenan A.; Tavakol, Mehri; Hearnden, Claire H.; Fitzgerald-Hughes, Deirdre; Humphreys, Hilary; Fennell, Jérôme P.; van Wamel, Willem J.; Foster, Timothy J.; Geoghegan, Joan A.; Lavelle, Ed C.; Rogers, Thomas R.; McLoughlin, Rachel M.

    2015-01-01

    Mechanisms of protective immunity to Staphylococcus aureus infection in humans remain elusive. While the importance of cellular immunity has been shown in mice, T cell responses in humans have not been characterised. Using a murine model of recurrent S. aureus peritonitis, we demonstrated that prior exposure to S. aureus enhanced IFNγ responses upon subsequent infection, while adoptive transfer of S. aureus antigen-specific Th1 cells was protective in naïve mice. Translating these findings, we found that S. aureus antigen-specific Th1 cells were also significantly expanded during human S. aureus bloodstream infection (BSI). These Th1 cells were CD45RO+, indicative of a memory phenotype. Thus, exposure to S. aureus induces memory Th1 cells in mice and humans, identifying Th1 cells as potential S. aureus vaccine targets. Consequently, we developed a model vaccine comprising staphylococcal clumping factor A, which we demonstrate to be an effective human T cell antigen, combined with the Th1-driving adjuvant CpG. This novel Th1-inducing vaccine conferred significant protection during S. aureus infection in mice. This study notably advances our understanding of S. aureus cellular immunity, and demonstrates for the first time that a correlate of S. aureus protective immunity identified in mice may be relevant in humans. PMID:26539822

  14. Antigen presentation under the influence of 'immune evasion' proteins and its modulation by interferon-gamma: implications for immunotherapy of cytomegalovirus infection with antiviral CD8 T cells.

    PubMed

    Fink, Annette; Lemmermann, Niels A W; Gillert-Marien, Dorothea; Thomas, Doris; Freitag, Kirsten; Böhm, Verena; Wilhelmi, Vanessa; Reifenberg, Kurt; Reddehase, Matthias J; Holtappels, Rafaela

    2012-11-01

    Cytomegalovirus (CMV) disease with multiple organ manifestations is the most feared viral complication limiting the success of hematopoietic cell transplantation as a therapy of hematopoietic malignancies. A timely endogenous reconstitution of CD8 T cells controls CMV infection, and adoptive transfer of antiviral CD8 T cells is a therapeutic option to prevent CMV disease by bridging the gap between an early CMV reactivation and delayed endogenous reconstitution of protective immunity. Preclinical research in murine models has provided 'proof of concept' for CD8 T-cell therapy of CMV disease. Protection by CD8 T cells appears to be in conflict with the finding that CMVs encode proteins that inhibit antigen presentation to CD8 T cells by interfering with the constitutive trafficking of peptide-loaded MHC class I molecules (pMHC-I complexes) to the cell surface. Here, we have systematically explored antigen presentation in the presence of the three currently noted immune evasion proteins of murine CMV in all possible combinations and its modulation by pre-treatment of cells with interferon-gamma (IFN-γ). The data reveal improvement in antigen processing by pre-treatment with IFN-γ can almost overrule the inhibitory function of immune evasion molecules in terms of pMHC-I expression levels capable of triggering most of the specific CD8 T cells, though the intensity of stimulation did not retrieve their full functional capacity. Notably, an in vivo conditioning of host tissue cells with IFN-γ in adoptive cell transfer recipients constitutively overexpressing IFN-γ (B6-SAP-IFN-γ mice) enhanced the antiviral efficiency of CD8 T cells in this transgenic cytoimmunotherapy model.

  15. Antigen-Specific CD8+ T Cells Fail To Respond to Shigella flexneri ▿

    PubMed Central

    Jehl, Stephanie P.; Doling, Amy M.; Giddings, Kara S.; Phalipon, Armelle; Sansonetti, Philippe J.; Goldberg, Marcia B.; Starnbach, Michael N.

    2011-01-01

    CD8+ T lymphocytes often play a primary role in adaptive immunity to cytosolic microbial pathogens. Surprisingly, CD8+ T cells are not required for protective immunity to the enteric pathogen Shigella flexneri, despite the ability of Shigella to actively secrete proteins into the host cytoplasm, a location from which antigenic peptides are processed for presentation to CD8+ T cells. To determine why CD8+ T cells fail to play a role in adaptive immunity to S. flexneri, we investigated whether antigen-specific CD8+ T cells are primed during infection but are unable to confer protection or, alternatively, whether T cells fail to be primed. To test whether Shigella is capable of stimulating an antigen-specific CD8+ T-cell response, we created an S. flexneri strain that constitutively secretes a viral CD8+ T-cell epitope via the Shigella type III secretion system and characterized the CD8+ T-cell response to this strain both in mice and in cultured cells. Surprisingly, no T cells specific for the viral epitope were stimulated in mice infected with this strain, and cells infected with the recombinant strain were not targeted by epitope-specific T cells. Additionally, we found that the usually robust T-cell response to antigens artificially introduced into the cytoplasm of cultured cells was significantly reduced when the antigen-presenting cell was infected with Shigella. Collectively, these results suggest that antigen-specific CD8+ T cells are not primed during S. flexneri infection and, as a result, afford little protection to the host during primary or subsequent infection. PMID:21357720

  16. CTLA-4 blockade plus adoptive T cell transfer promotes optimal melanoma immunity in mice

    PubMed Central

    Mahvi, David A.; Meyers, Justin V.; Tatar, Andrew J.; Contreras, Amanda; Suresh, M.; Leverson, Glen E.; Sen, Siddhartha; Cho, Clifford S.

    2014-01-01

    Immunotherapeutic approaches to the treatment of advanced melanoma have relied on strategies that augment the responsiveness of endogenous tumor-specific T cell populations (e.g., CTLA-4 blockade-mediated checkpoint inhibition) or introduce exogenously-prepared tumor-specific T cell populations (e.g., adoptive cell transfer). Although both approaches have shown considerable promise, response rates to these therapies remain suboptimal. We hypothesized that a combinatorial approach to immunotherapy using both CTLA-4 blockade and non-lymphodepletional adoptive cell transfer could offer additive therapeutic benefit. C57BL/6 mice were inoculated with syngeneic B16F10 melanoma tumors transfected to express low levels of the lymphocytic choriomeningitis virus peptide GP33 (B16GP33), and treated with no immunotherapy, CTLA-4 blockade, adoptive cell transfer, or combination immunotherapy of CTLA-4 blockade with adoptive cell transfer. Combination immunotherapy resulted in optimal control of B16GP33 melanoma tumors. Combination immunotherapy promoted a stronger local immune response reflected by enhanced tumor-infiltrating lymphocyte populations, as well as a stronger systemic immune responses reflected by more potent tumor antigen-specific T cell activity in splenocytes. In addition, whereas both CTLA-4 blockade and combination immunotherapy were able to promote long-term immunity against B16GP33 tumors, only combination immunotherapy was capable of promoting immunity against parental B16F10 tumors as well. Our findings suggest that a combinatorial approach using CTLA-4 blockade with non-lymphodepletional adoptive cell transfer may promote additive endogenous and exogenous T cell activities that enable greater therapeutic efficacy in the treatment of melanoma. PMID:25658614

  17. Inability To Detect Cross-Reactive Memory T Cells Challenges the Frequency of Heterologous Immunity among Common Viruses.

    PubMed

    Rowntree, Louise C; Nguyen, Thi H O; Halim, Hanim; Purcell, Anthony W; Rossjohn, Jamie; Gras, Stephanie; Kotsimbos, Tom C; Mifsud, Nicole A

    2018-06-15

    Human memory T cells that cross-react with epitopes from unrelated viruses can potentially modulate immune responses to subsequent infections by a phenomenon termed heterologous immunity. However, it is unclear whether similarities in structure rather than sequence underpin heterologous T cell cross-reactivity. In this study, we aimed to explore the mechanism of heterologous immunity involving immunodominant epitopes derived from common viruses restricted to high-frequency HLA allotypes (HLA-A*02:01, -B*07:02, and -B*08:01). We examined EBV-specific memory T cells for their ability to cross-react with CMV or influenza A virus-derived epitopes. Following T cell immunoassays to determine phenotype and function, complemented with biophysical and structural investigations of peptide/HLA complexes, we did not detect cross-reactivity of EBV-specific memory T cells toward either CMV or influenza A virus epitopes presented by any of the selected HLA allomorphs. Thus, despite the ubiquitous nature of these human viruses and the dominant immune response directed toward the selected epitopes, heterologous virus-specific T cell cross-reactivity was not detected. This suggests that either heterologous immunity is not as common as previously reported, or that it requires a very specific biological context to develop and be clinically relevant. Copyright © 2018 by The American Association of Immunologists, Inc.

  18. Induction and Subversion of Human Protective Immunity: Contrasting Influenza and Respiratory Syncytial Virus

    PubMed Central

    Ascough, Stephanie; Paterson, Suzanna; Chiu, Christopher

    2018-01-01

    Respiratory syncytial virus (RSV) and influenza are among the most important causes of severe respiratory disease worldwide. Despite the clinical need, barriers to developing reliably effective vaccines against these viruses have remained firmly in place for decades. Overcoming these hurdles requires better understanding of human immunity and the strategies by which these pathogens evade it. Although superficially similar, the virology and host response to RSV and influenza are strikingly distinct. Influenza induces robust strain-specific immunity following natural infection, although protection by current vaccines is short-lived. In contrast, even strain-specific protection is incomplete after RSV and there are currently no licensed RSV vaccines. Although animal models have been critical for developing a fundamental understanding of antiviral immunity, extrapolating to human disease has been problematic. It is only with recent translational advances (such as controlled human infection models and high-dimensional technologies) that the mechanisms responsible for differences in protection against RSV compared to influenza have begun to be elucidated in the human context. Influenza infection elicits high-affinity IgA in the respiratory tract and virus-specific IgG, which correlates with protection. Long-lived influenza-specific T cells have also been shown to ameliorate disease. This robust immunity promotes rapid emergence of antigenic variants leading to immune escape. RSV differs markedly, as reinfection with similar strains occurs despite natural infection inducing high levels of antibody against conserved antigens. The immunomodulatory mechanisms of RSV are thus highly effective in inhibiting long-term protection, with disturbance of type I interferon signaling, antigen presentation and chemokine-induced inflammation possibly all contributing. These lead to widespread effects on adaptive immunity with impaired B cell memory and reduced T cell generation and

  19. Barrier Epithelial Cells and the Control of Type 2 Immunity.

    PubMed

    Hammad, Hamida; Lambrecht, Bart N

    2015-07-21

    Type-2-cell-mediated immunity, rich in eosinophils, basophils, mast cells, CD4(+) T helper 2 (Th2) cells, and type 2 innate lymphoid cells (ILC2s), protects the host from helminth infection but also drives chronic allergic diseases like asthma and atopic dermatitis. Barrier epithelial cells (ECs) represent the very first line of defense and express pattern recognition receptors to recognize type-2-cell-mediated immune insults like proteolytic allergens or helminths. These ECs mount a prototypical response made up of chemokines, innate cytokines such as interleukin-1 (IL-1), IL-25, IL-33, and thymic stromal lymphopoietin (TSLP), as well as the alarmins uric acid, ATP, HMGB1, and S100 proteins. These signals program dendritic cells (DCs) to mount Th2-cell-mediated immunity and in so doing boost ILC2, basophil, and mast cell function. Here we review the general mechanisms of how different stimuli trigger type-2-cell-mediated immunity at mucosal barriers and how this leads to protection or disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Adjuvant properties of thermal component of hyperthermia enhanced transdermal immunization: effect on dendritic cells.

    PubMed

    Joshi, Neha; Duhan, Vikas; Lingwal, Neelam; Bhaskar, Sangeeta; Upadhyay, Pramod

    2012-01-01

    Hyperthermia enhanced transdermal (HET) immunization is a novel needle free immunization strategy employing application of antigen along with mild local hyperthermia (42°C) to intact skin resulting in detectable antigen specific Ig in serum. In the present study, we investigated the adjuvant effect of thermal component of HET immunization in terms of maturation of dendritic cells and its implication on the quality of the immune outcome in terms of antibody production upon HET immunization with tetanus toxoid (TT). We have shown that in vitro hyperthermia exposure at 42°C for 30 minutes up regulates the surface expression of maturation markers on bone marrow derived DCs. This observation correlated in vivo with an increased and accelerated expression of maturation markers on DCs in the draining lymph node upon HET immunization in mice. This effect was found to be independent of the antigen delivered and depends only on the thermal component of HET immunization. In vitro hyperthermia also led to enhanced capacity to stimulate CD4+ T cells in allo MLR and promotes the secretion of IL-10 by BMDCs, suggesting a potential for Th2 skewing of T cell response. HET immunization also induced a systemic T cell response to TT, as suggested by proliferation of splenocytes from immunized animal upon in vitro stimulation by TT. Exposure to heat during primary immunization led to generation of mainly IgG class of antibodies upon boosting, similar to the use of conventional alum adjuvant, thus highlighting the adjuvant potential of heat during HET immunization. Lastly, we have shown that mice immunized by tetanus toxoid using HET route exhibited protection against challenge with a lethal dose of tetanus toxin. Thus, in addition to being a painless, needle free delivery system it also has an immune modulatory potential.