Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

PubMed

Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

2015-07-01

The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

PubMed

Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

2001-06-29

The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

Molecular design of sequence specific DNA alkylating agents.

PubMed

Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi

2009-01-01

Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.

DNA sequence responsible for the amplification of adjacent genes.

PubMed

Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

1987-10-01

A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.

PubMed Central

Benslimane, A A; Dron, M; Hartmann, C; Rode, A

1986-01-01

Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

PubMed Central

Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

2013-01-01

Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

PubMed Central

Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

2001-01-01

Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

Influence of flanking sequences on variability in expression levels of an introduced gene in transgenic tobacco plants.

PubMed Central

Dean, C; Jones, J; Favreau, M; Dunsmuir, P; Bedbrook, J

1988-01-01

The petunia rbcS gene SSU301 was introduced into tobacco using Agrobacterium tumefaciens-mediated transformation. The time at which rbcS expression was maximal after transfer of the tobacco plants to the greenhouse was determined. The expression level of the SSU301 gene varied up to 9 fold between individual tobacco plants which had been standardized physiologically as much as possible. The presence of adjacent pUC plasmid sequences did not affect the expression of the SSU301 gene. In an attempt to reduce the between-transformant variability in expression, the SSU301 gene was introduced into tobacco surrounded by 10kb of 5' and 13 kb of 3' DNA sequences which normally flank SSU301 in petunia. The longer flanking regions did not reduce the between-transformant variability of SSU301 gene expression. Images PMID:3174450

Analysis of sequence variation among smeDEF multi drug efflux pump genes and flanking DNA from defined 16S rRNA subgroups of clinical Stenotrophomonas maltophilia isolates.

PubMed

Gould, Virginia C; Okazaki, Aki; Howe, Robin A; Avison, Matthew B

2004-08-01

To determine the level of variation in the smeDEF efflux pump and smeT transcriptional regulator genes among three defined 16S rRNA sequence subgroups of clinical Stenotrophomonas maltophilia isolates. smeDEF sequencing used a PCR genome walking approach. Determination of the sequence surrounding smeDEF used a flanking primer PCR method and specific primers anchored in smeD or smeF together with random primers. smeDEF is chromosomal and located in the same position in the chromosome in all three subgroups of isolates. Flanking smeD is a gene, smeT, encoding a putative transcriptional repressor for smeDEF. Variation at these loci among the isolates is considerably lower (up to 10%) than at intrinsic beta-lactamase loci (up to 30%) in the same isolates, implying greater functional constraint. The smeD-smeT intergenic region contains a highly conserved section, which maps with previously predicted promoter/operator regions, and a hypervariable untranslated region, which can be used to subgroup clinical isolates. These data provide further evidence that it is possible to group clinical isolates of the inherently variable species, S. maltophilia, based on genotypic properties. Isolate D457, in which most work concerning smeDEF expression has been performed, does not fall into S. maltophilia subgroup A, which is the most typical.

Single-molecule DNA unzipping reveals asymmetric modulation of a transcription factor by its binding site sequence and context

PubMed Central

Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa

2018-01-01

Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225

Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

PubMed Central

Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

1986-01-01

Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

PubMed

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

PubMed

Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

2017-11-01

DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing; Progress report, June 1, 1990--May 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richardson, C.C.

1993-12-31

This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

Condensin promotes the juxtaposition of DNA flanking its loading site in Bacillus subtilis

PubMed Central

Wang, Xindan; Le, Tung B.K.; Lajoie, Bryan R.; Dekker, Job; Laub, Michael T.; Rudner, David Z.

2015-01-01

SMC condensin complexes play a central role in compacting and resolving replicated chromosomes in virtually all organisms, yet how they accomplish this remains elusive. In Bacillus subtilis, condensin is loaded at centromeric parS sites, where it encircles DNA and individualizes newly replicated origins. Using chromosome conformation capture and cytological assays, we show that condensin recruitment to origin-proximal parS sites is required for the juxtaposition of the two chromosome arms. Recruitment to ectopic parS sites promotes alignment of large tracks of DNA flanking these sites. Importantly, insertion of parS sites on opposing arms indicates that these “zip-up” interactions only occur between adjacent DNA segments. Collectively, our data suggest that condensin resolves replicated origins by promoting the juxtaposition of DNA flanking parS sites, drawing sister origins in on themselves and away from each other. These results are consistent with a model in which condensin encircles the DNA flanking its loading site and then slides down, tethering the two arms together. Lengthwise condensation via loop extrusion could provide a generalizable mechanism by which condensin complexes act dynamically to individualize origins in B. subtilis and, when loaded along eukaryotic chromosomes, resolve them during mitosis. PMID:26253537

Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

PubMed

Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

2009-11-25

Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

Human renin 5'-flanking DNA to nucleotide-2750.

PubMed

Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J

1995-01-01

Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.

Transcription of telomeric DNA leads to high levels of homologous recombination and t-loops.

PubMed

Kar, Anirban; Willcox, Smaranda; Griffith, Jack D

2016-11-02

The formation of DNA loops at chromosome ends (t-loops) and the transcription of telomeres producing G-rich RNA (TERRA) represent two central features of telomeres. To explore a possible link between them we employed artificial human telomeres containing long arrays of TTAGGG repeats flanked by the T7 or T3 promoters. Transcription of these DNAs generates a high frequency of t-loops within individual molecules and homologous recombination events between different DNAs at their telomeric sequences. T-loop formation does not require a single strand overhang, arguing that both terminal strands insert into the preceding duplex. The loops are very stable and some RNase H resistant TERRA remains at the t-loop, likely adding to their stability. Transcription of DNAs containing TTAGTG or TGAGTG repeats showed greatly reduced loop formation. While in the cell multiple pathways may lead to t-loop formation, the pathway revealed here does not depend on the shelterins but rather on the unique character of telomeric DNA when it is opened for transcription. Hence, telomeric sequences may have evolved to facilitate their ability to loop back on themselves. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oriS stimulate origin function.

PubMed

Wong, S W; Schaffer, P A

1991-05-01

Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Repair of naturally occurring mismatches can induce mutations in flanking DNA

PubMed Central

Chen, Jia; Miller, Brendan F; Furano, Anthony V

2014-01-01

‘Normal’ genomic DNA contains hundreds of mismatches that are generated daily by the spontaneous deamination of C (U/G) and methyl-C (T/G). Thus, a mutagenic effect of their repair could constitute a serious genetic burden. We show here that while mismatches introduced into human cells on an SV40-based episome were invariably repaired, this process induced mutations in flanking DNA at a significantly higher rate than no mismatch controls. Most mutations involved the C of TpC, the substrate of some single strand-specific APOBEC cytidine deaminases, similar to the mutations that can typify the ‘mutator phenotype’ of numerous tumors. siRNA knockdowns and chromatin immunoprecipitation showed that TpC preferring APOBECs mediate the mutagenesis, and siRNA knockdowns showed that both the base excision and mismatch repair pathways are involved. That naturally occurring mispairs can be converted to mutators, represents an heretofore unsuspected source of genetic changes that could underlie disease, aging, and evolutionary change. DOI: http://dx.doi.org/10.7554/eLife.02001.001 PMID:24843013

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

PCR-based study of conserved and variable DNA sequences of Tritrichomonas foetus isolates from Saskatchewan, Canada.

PubMed Central

Riley, D E; Wagner, B; Polley, L; Krieger, J N

1995-01-01

The protozoan parasite Tritrichomonas foetus causes infertility and spontaneous abortion in cattle. In Saskatchewan, Canada, the culture prevalence of trichomonads was 65 of 1,048 (6%) among 1,048 bulls tested within a 1-year period ending in April 1994. Saskatchewan was previously thought to be free of the parasite. To confirm the culture results, possible T. foetus DNA presence was determined by the PCR. All of the 16 culture-positive isolates tested were PCR positive by a single-band test, but one PCR product was weak. DNA fingerprinting by both T17 PCR and randomly amplified polymorphic DNA PCR revealed genetic variation or polymorphism among the T. foetus isolates. T17 PCR also revealed conserved loci that distinguished these T. foetus isolates from Trichomonas vaginalis, from a variety of other protozoa, and from prokaryotes. TCO-1 PCR, a PCR test designed to sample DNA sequence homologous to the 5' flank of a highly conserved cell division control gene, detected genetic polymorphism at low stringency and a conserved, single locus at higher stringency. These findings suggested that T. foetus isolates exhibit both conserved genetic loci and polymorphic loci detectable by independent PCR methods. Both conserved and polymorphic genetic loci may prove useful for improved clinical diagnosis of T. foetus. The polymorphic loci detected by PCR suggested either a long history of infection or multiple lines of T. foetus infection in Saskatchewan. Polymorphic loci detected by PCR may provide data for epidemiologic studies of T. foetus. PMID:7615746

Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Torella, JP; Lienert, F; Boehm, CR

2014-08-07

Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked withmore » UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.« less

GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

2012-01-01

T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications

PubMed Central

Torella, Joseph P.; Lienert, Florian; Boehm, Christian R.; Chen, Jan-Hung; Way, Jeffrey C.; Silver, Pamela A.

2016-01-01

Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts and hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies — for example repeated terminator and insulator sequences — that complicate recombination-based assembly. We and others have recently developed DNA assembly methods that we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly-assembled constructs, or into high-quality combinatorial libraries in only 2–3 days. If the DNA parts must be generated from scratch, an additional 2–5 days are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques. PMID:25101822

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

A Nucleotide-Driven Switch Regulates Flanking DNA Length Sensing by a Dimeric Chromatin Remodeler

PubMed Central

Leonard, John D.; Narlikar, Geeta J.

2015-01-01

SUMMARY The ATP-dependent chromatin assembly factor (ACF) is a dimeric motor that spaces nucleosomes to promote formation of silent chromatin. Two copies of its ATPase subunit SNF2h bind opposite sides of a nucleosome, but how these protomers avoid competition is unknown. SNF2h senses the length of DNA flanking a nucleosome via its HAND-SANT-SLIDE (HSS) domain, yet it is unclear how this interaction enhances remodeling. Using covalently connected SNF2h dimers we show that dimerization accelerates remodeling and that the HSS contributes to communication between protomers. We further identify a nucleotide-dependent conformational change in SNF2h. In one conformation the HSS binds flanking DNA, and in another conformation the HSS engages the nucleosome core. Based on these results, we propose a model in which DNA length sensing and translocation are performed by two distinct conformational states of SNF2h. Such separation of function suggests that these activities could be independently regulated to affect remodeling outcomes. PMID:25684208

DNA Barcode Sequence Identification Incorporating Taxonomic Hierarchy and within Taxon Variability

PubMed Central

Little, Damon P.

2011-01-01

For DNA barcoding to succeed as a scientific endeavor an accurate and expeditious query sequence identification method is needed. Although a global multiple–sequence alignment can be generated for some barcoding markers (e.g. COI, rbcL), not all barcoding markers are as structurally conserved (e.g. matK). Thus, algorithms that depend on global multiple–sequence alignments are not universally applicable. Some sequence identification methods that use local pairwise alignments (e.g. BLAST) are unable to accurately differentiate between highly similar sequences and are not designed to cope with hierarchic phylogenetic relationships or within taxon variability. Here, I present a novel alignment–free sequence identification algorithm–BRONX–that accounts for observed within taxon variability and hierarchic relationships among taxa. BRONX identifies short variable segments and corresponding invariant flanking regions in reference sequences. These flanking regions are used to score variable regions in the query sequence without the production of a global multiple–sequence alignment. By incorporating observed within taxon variability into the scoring procedure, misidentifications arising from shared alleles/haplotypes are minimized. An explicit treatment of more inclusive terminals allows for separate identifications to be made for each taxonomic level and/or for user–defined terminals. BRONX performs better than all other methods when there is imperfect overlap between query and reference sequences (e.g. mini–barcode queries against a full–length barcode database). BRONX consistently produced better identifications at the genus–level for all query types. PMID:21857897

Homology between DNA polymerases of poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus DNA polymerase gene.

PubMed Central

Earl, P L; Jones, E V; Moss, B

1986-01-01

A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524

Dna Sequencing

DOEpatents

Tabor, Stanley; Richardson, Charles C.

1995-04-25

A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

Efficient gusA transient expression in Porphyra yezoensis protoplasts mediated by endogenous beta-tubulin flanking sequences

NASA Astrophysics Data System (ADS)

Gong, Qianhong; Yu, Wengong; Dai, Jixun; Liu, Hongquan; Xu, Rifu; Guan, Huashi; Pan, Kehou

2007-01-01

Endogenous tubulin promoter has been widely used for expressing foreign genes in green algae, but the efficiency and feasibility of endogenous tubulin promoter in the economically important Porphyra yezoensis (Rhodophyta) are unknown. In this study, the flanking sequences of beta-tubulin gene from P. yezoensis were amplified and two transient expression vectors were constructed to determine their transcription promoting feasibility for foreign gene gusA. The testing vector pATubGUS was constructed by inserting 5'-and 3'-flanking regions ( Tub5' and Tub3') up-and down-stream of β-glucuronidase (GUS) gene ( gusA), respectively, into pA, a derivative of pCAT®3-enhancer vector. The control construct, pAGUSTub3, contains only gusA and Tub3'. These constructs were electroporated into P. yezoensis protoplasts and the GUS activities were quantitatively analyzed by spectrometry. The results demonstrated that gusA gene was efficiently expressed in P. yezoensis protoplasts under the regulation of 5'-flanking sequence of the beta-tubulin gene. More interestingly, the pATubGUS produced stronger GUS activity in P. yezoensis protoplasts when compared to the result from pBI221, in which the gusA gene was directed by a constitutive CaMV 35S promoter. The data suggest that the integration of P. yezoensis protoplast and its endogenous beta-tubulin flanking sequences is a potential novel system for foreign gene expression.

Autonomous replication and addition of telomerelike sequences to DNA microinjected into Paramecium tetraurelia macronuclei.

PubMed Central

Gilley, D; Preer, J R; Aufderheide, K J; Polisky, B

1988-01-01

Paramecium tetraurelia can be transformed by microinjection of cloned serotype A gene sequences into the macronucleus. Transformants are detected by their ability to express serotype A surface antigen from the injected templates. After injection, the DNA is converted from a supercoiled form to a linear form by cleavage at nonrandom sites. The linear form appears to replicate autonomously as a unit-length molecule and is present in transformants at high copy number. The injected DNA is further processed by the addition of paramecium-type telomeric sequences to the termini of the linear DNA. To examine the fate of injected linear DNA molecules, plasmid pSA14SB DNA containing the A gene was cleaved into two linear pieces, a 14-kilobase (kb) piece containing the A gene and flanking sequences and a 2.2-kb piece consisting of the procaryotic vector. In transformants expressing the A gene, we observed that two linear DNA species were present which correspond to the two species injected. Both species had Paramecium telomerelike sequences added to their termini. For the 2.2-kb DNA, we show that the site of addition of the telomerelike sequences is directly at one terminus and within one nucleotide of the other terminus. These results indicate that injected procaryotic DNA is capable of autonomous replication in Paramecium macronuclei and that telomeric addition in the macronucleus does not require specific recognition sequences. Images PMID:3211128

Complete mtDNA sequencing reveals mutations m.9185T>C and m.13513G>A in three patients with Leigh syndrome.

PubMed

Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna

2017-12-12

The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

alpha-Putrescinylthymine and the sensitivity of bacteriophage phi W-14 DNA to restriction endonucleases.

PubMed Central

Miller, P B; Wakarchuk, W W; Warren, R A

1985-01-01

The modified base alpha-putrescinylthymine (putT) in phi W-14 DNA blocks cleavage of the DNA by 17 of 32 Type II restriction endonucleases. The enzymes cleaving the DNA do so to widely varying extents. The frequencies of cleavage of three altered forms of the DNA show that putT blocks recognition sites either when it occurs within the site or when it is in a sequence flanking the site. The blocking is dependent on both charge and steric factors. The charge effects can be greater than the steric effects for some of the enzymes tested. All the enzymes cleaving phi W-14 DNA release discrete fragments, showing that the distribution of putT is ordered. The cleavage frequencies for different enzymes suggest that the sequence CAputTG occurs frequently in the DNA. Only TaqI of the enzymes tested appeared not to be blocked by putT, but it was slowed down. TaqI generated fragments are joinable by T4 DNA ligase. PMID:2987859

A single-molecule sequencing assay for the comprehensive profiling of T4 DNA ligase fidelity and bias during DNA end-joining.

PubMed

Potapov, Vladimir; Ong, Jennifer L; Langhorst, Bradley W; Bilotti, Katharina; Cahoon, Dan; Canton, Barry; Knight, Thomas F; Evans, Thomas C; Lohman, Gregory Js

2018-05-08

DNA ligases are key enzymes in molecular and synthetic biology that catalyze the joining of breaks in duplex DNA and the end-joining of DNA fragments. Ligation fidelity (discrimination against the ligation of substrates containing mismatched base pairs) and bias (preferential ligation of particular sequences over others) have been well-studied in the context of nick ligation. However, almost no data exist for fidelity and bias in end-joining ligation contexts. In this study, we applied Pacific Biosciences Single-Molecule Real-Time sequencing technology to directly sequence the products of a highly multiplexed ligation reaction. This method has been used to profile the ligation of all three-base 5'-overhangs by T4 DNA ligase under typical ligation conditions in a single experiment. We report the relative frequency of all ligation products with or without mismatches, the position-dependent frequency of each mismatch, and the surprising observation that 5'-TNA overhangs ligate extremely inefficiently compared to all other Watson-Crick pairings. The method can easily be extended to profile other ligases, end-types (e.g. blunt ends and overhangs of different lengths), and the effect of adjacent sequence on the ligation results. Further, the method has the potential to provide new insights into the thermodynamics of annealing and the kinetics of end-joining reactions.

Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica

PubMed Central

Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur

2012-01-01

Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Deep Sequencing of T-cell Receptor DNA as a Biomarker of Clonally Expanded TILs in Breast Cancer after Immunotherapy.

PubMed

Page, David B; Yuan, Jianda; Redmond, David; Wen, Y Hanna; Durack, Jeremy C; Emerson, Ryan; Solomon, Stephen; Dong, Zhiwan; Wong, Phillip; Comstock, Christopher; Diab, Adi; Sung, Janice; Maybody, Majid; Morris, Elizabeth; Brogi, Edi; Morrow, Monica; Sacchini, Virgilio; Elemento, Olivier; Robins, Harlan; Patil, Sujata; Allison, James P; Wolchok, Jedd D; Hudis, Clifford; Norton, Larry; McArthur, Heather L

2016-10-01

In early-stage breast cancer, the degree of tumor-infiltrating lymphocytes (TIL) predicts response to chemotherapy and overall survival. Combination immunotherapy with immune checkpoint antibody plus tumor cryoablation can induce lymphocytic infiltrates and improve survival in mice. We used T-cell receptor (TCR) DNA sequencing to evaluate both the effect of cryoimmunotherapy in humans and the feasibility of TCR sequencing in early-stage breast cancer. In a pilot clinical trial, 18 women with early-stage breast cancer were treated preoperatively with cryoablation, single-dose anti-CTLA-4 (ipilimumab), or cryoablation + ipilimumab. TCRs within serially collected peripheral blood and tumor tissue were sequenced. In baseline tumor tissues, T-cell density as measured by TCR sequencing correlated with TIL scores obtained by hematoxylin and eosin (H&E) staining. However, tumors with little or no lymphocytes by H&E contained up to 3.6 × 10 6 TCR DNA sequences, highlighting the sensitivity of the ImmunoSEQ platform. In this dataset, ipilimumab increased intratumoral T-cell density over time, whereas cryoablation ± ipilimumab diversified and remodeled the intratumoral T-cell clonal repertoire. Compared with monotherapy, cryoablation plus ipilimumab was associated with numerically greater numbers of peripheral blood and intratumoral T-cell clones expanding robustly following therapy. In conclusion, TCR sequencing correlates with H&E lymphocyte scoring and provides additional information on clonal diversity. These findings support further study of the use of TCR sequencing as a biomarker for T-cell responses to therapy and for the study of cryoimmunotherapy in early-stage breast cancer. Cancer Immunol Res; 4(10); 835-44. ©2016 AACR. ©2016 American Association for Cancer Research.

Affordable Hands-On DNA Sequencing and Genotyping: An Exercise for Teaching DNA Analysis to Undergraduates

ERIC Educational Resources Information Center

Shah, Kushani; Thomas, Shelby; Stein, Arnold

2013-01-01

In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C…

Amplification and chromosomal dispersion of human endogenous retroviral sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steele, P.E.; Martin, M.A.; Rabson, A.B.

1986-09-01

Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification andmore » dispersion events may be linked.« less

Sequence and Structure Dependent DNA-DNA Interactions

NASA Astrophysics Data System (ADS)

Kopchick, Benjamin; Qiu, Xiangyun

Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

PubMed

Turner, D P; Connolly, B A

2000-12-15

The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

Nucleosome core particles containing a poly(dA.dT) sequence element exhibit a locally distorted DNA structure.

PubMed

Bao, Yunhe; White, Cindy L; Luger, Karolin

2006-08-25

Poly(dA.dT) DNA sequence elements are thought to promote transcription by either excluding nucleosomes or by altering their structural or dynamic properties. Here, the stability and structure of a defined nucleosome core particle containing a 16 base-pair poly(dA.dT) element (A16 NCP) was investigated. The A16 NCP requires a significantly higher temperature for histone octamer sliding in vitro compared to comparable nucleosomes that do not contain a poly(dA.dT) element. Fluorescence resonance energy transfer showed that the interactions between the nucleosomal DNA ends and the histone octamer were destabilized in A16 NCP. The crystal structure of A16 NCP was determined to a resolution of 3.2 A. The overall structure was maintained except for local deviations in DNA conformation. These results are consistent with previous in vivo and in vitro observations that poly(dA.dT) elements cause only modest changes in DNA accessibility and modest increases in steady-state transcription levels.

High-Throughput Block Optical DNA Sequence Identification.

PubMed

Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant

2018-01-01

Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

2009-11-20

RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

PubMed

Jia, Xianbo; Lin, Xinjian; Chen, Jichen

2017-11-02

Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

Effects of sequence on DNA wrapping around histones

NASA Astrophysics Data System (ADS)

Ortiz, Vanessa

2011-03-01

A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

NASA Astrophysics Data System (ADS)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

PubMed

Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

2014-04-01

Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

PubMed

Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

2014-07-01

Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horton, John R.; Zhang, Xing; Blumenthal, Robert M.

DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

Structures of Escherichia coli DNA adenine methyltransferase (Dam) in complex with a non-GATC sequence: Potential implications for methylation-independent transcriptional repression

DOE PAGES

Horton, John R.; Zhang, Xing; Blumenthal, Robert M.; ...

2015-04-06

DNA adenine methyltransferase (Dam) is widespread and conserved among the γ-proteobacteria. Methylation of the Ade in GATC sequences regulates diverse bacterial cell functions, including gene expression, mismatch repair and chromosome replication. Dam also controls virulence in many pathogenic Gram-negative bacteria. An unexplained and perplexing observation about Escherichia coli Dam (EcoDam) is that there is no obvious relationship between the genes that are transcriptionally responsive to Dam and the promoter-proximal presence of GATC sequences. Here, we demonstrate that EcoDam interacts with a 5-base pair non-cognate sequence distinct from GATC. The crystal structure of a non-cognate complex allowed us to identify amore » DNA binding element, GTYTA/TARAC (where Y = C/T and R = A/G). This element immediately flanks GATC sites in some Dam-regulated promoters, including the Pap operon which specifies pyelonephritis-associated pili. In addition, Dam interacts with near-cognate GATC sequences (i.e. 3/4-site ATC and GAT). All together, these results imply that Dam, in addition to being responsible for GATC methylation, could also function as a methylation-independent transcriptional repressor.« less

Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

PubMed

Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

2016-12-01

Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

2017-01-01

SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

Affordable hands-on DNA sequencing and genotyping: an exercise for teaching DNA analysis to undergraduates.

PubMed

Shah, Kushani; Thomas, Shelby; Stein, Arnold

2013-01-01

In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C Sanger sequencing reactions. They prepare and run the gels, perform Southern blots (which require only 10 min), and detect sequencing ladders using a colorimetric detection system. Students enlarge their sequencing ladders from digital images of their small nylon membranes, and read the sequence manually. They compare their reads with the actual DNA sequence using BLAST2. After mastering the DNA sequencing system, students prepare their own DNA from a cheek swab, polymerase chain reaction-amplify a region of their DNA that encompasses a SNP of interest, and perform sequencing to determine their genotype at the SNP position. A family pedigree can also be constructed. The SNP chosen by the instructor was rs17822931, which is in the ABCC11 gene and is the determinant of human earwax type. Genotypes at the rs178229931 site vary in different ethnic populations. © 2013 by The International Union of Biochemistry and Molecular Biology.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes

NASA Astrophysics Data System (ADS)

Roxbury, Daniel

It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Rational design based synthetic polyepitope DNA vaccine for eliciting HIV-specific CD8+ T cell responses.

PubMed

Bazhan, S I; Karpenko, L I; Ilyicheva, T N; Belavin, P A; Seregin, S V; Danilyuk, N K; Antonets, D V; Ilyichev, A A

2010-04-01

Advances in defining HIV-1 CD8+ T cell epitopes and understanding endogenous MHC class I antigen processing enable the rational design of polyepitope vaccines for eliciting broadly targeted CD8+ T cell responses to HIV-1. Here we describe the construction and comparison of experimental DNA vaccines consisting of ten selected HLA-A2 epitopes from the major HIV-1 antigens Env, Gag, Pol, Nef, and Vpr. The immunogenicity of designed gene constructs was assessed after double DNA prime, single vaccinia virus boost immunization of HLA-A2 transgenic mice. We compared a number of parameters including different strategies for fusing ubiquitin to the polyepitope and including spacer sequences between epitopes to optimize proteasome liberation and TAP transport. It was demonstrated that the vaccine construct that induced in vitro the largest number of [peptide-MHC class I] complexes was also the most immunogenic in the animal experiments. This most immunogenic vaccine construct contained the N-terminal ubiquitin for targeting the polyepitope to the proteasome and included both proteasome liberation and TAP transport optimized spacer sequences that flanked the epitopes within the polyepitope construct. The immunogenicity of determinants was strictly related to their affinities for HLA-A2. Our finding supports the concept of rational vaccine design based on detailed knowledge of antigen processing. Copyright 2010 Elsevier Ltd. All rights reserved.

Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5' flanking region.

PubMed

Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T

1992-03-24

P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.

Protein Interactions in T7 DNA Replisome Facilitate DNA Damage Bypass.

PubMed

Zou, Zhenyu; Chen, Ze; Xue, Qizhen; Xu, Ying; Xiong, Jingyuan; Yang, Ping; Le, Shuai; Zhang, Huidong

2018-06-14

DNA replisome inevitably encounters DNA damage during DNA replication. T7 DNA replisome contains DNA polymerase (gp5), the processivity factor thioredoxin (trx), helicase-primase (gp4), and ssDNA binding protein (gp2.5). T7 protein interactions mediate this DNA replication. However, whether the protein interactions could promote DNA damage bypass is still little addressed. In this study, we investigated the strand-displacement DNA synthesis past 8-oxoG or O6-MeG at the synthetic DNA fork by T7 DNA replisome. DNA damage does not obviously affect the binding affinities among helicase, polymerase, and DNA fork. Relative to unmodified G, both 8-oxoG and O6-MeG, as well as GC-rich template sequence clusters, inhibit the strand-displacement DNA synthesis and produce partial extension products. Relative to gp4 ΔC-tail, gp4 promotes the DNA damage bypass. The presence of gp2.5 further promotes this bypass. Thus, the interactions of polymerase with helicase and ssDNA binidng protein faciliate the DNA damage bypass. Similarly, accessory proteins in other complicated DNA replisomes also facilitate the DNA damage bypass. This work provides the novel mechanism information of DNA damage bypass by DNA replisome. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mitochondrial DNA sequence context in the penetrance of mitochondrial t-RNA mutations: A study across multiple lineages with diagnostic implications

PubMed Central

Queen, Rachel A.; Steyn, Jannetta S.; Lord, Phillip

2017-01-01

Mitochondrial DNA (mtDNA) mutations are well recognized as an important cause of inherited disease. Diseases caused by mtDNA mutations exhibit a high degree of clinical heterogeneity with a complex genotype-phenotype relationship, with many such mutations exhibiting incomplete penetrance. There is evidence that the spectrum of mutations causing mitochondrial disease might differ between different mitochondrial lineages (haplogroups) seen in different global populations. This would point to the importance of sequence context in the expression of mutations. To explore this possibility, we looked for mutations which are known to cause disease in humans, in animals of other species unaffected by mtDNA disease. The mt-tRNA genes are the location of many pathogenic mutations, with the m.3243A>G mutation on the mt-tRNA-Leu(UUR) being the most frequently seen mutation in humans. This study looked for the presence of m.3243A>G in 2784 sequences from 33 species, as well as any of the other mutations reported in association with disease located on mt-tRNA-Leu(UUR). We report a number of disease associated variations found on mt-tRNA-Leu(UUR) in other chordates, as the major population variant, with m.3243A>G being seen in 6 species. In these, we also found a number of mutations which appear compensatory and which could prevent the pathogenicity associated with this change in humans. This work has important implications for the discovery and diagnosis of mtDNA mutations in non-European populations. In addition, it might provide a partial explanation for the conflicting results in the literature that examines the role of mtDNA variants in complex traits. PMID:29161289

Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.

PubMed

Cox, J M; Sloan, L S; Schepartz, A

1995-12-01

HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Phage T4 SegB protein is a homing endonuclease required for the preferred inheritance of T4 tRNA gene region occurring in co-infection with a related phage.

PubMed

Brok-Volchanskaya, Vera S; Kadyrov, Farid A; Sivogrivov, Dmitry E; Kolosov, Peter M; Sokolov, Andrey S; Shlyapnikov, Michael G; Kryukov, Valentine M; Granovsky, Igor E

2008-04-01

Homing endonucleases initiate nonreciprocal transfer of DNA segments containing their own genes and the flanking sequences by cleaving the recipient DNA. Bacteriophage T4 segB gene, which is located in a cluster of tRNA genes, encodes a protein of unknown function, homologous to homing endonucleases of the GIY-YIG family. We demonstrate that SegB protein is a site-specific endonuclease, which produces mostly 3' 2-nt protruding ends at its DNA cleavage site. Analysis of SegB cleavage sites suggests that SegB recognizes a 27-bp sequence. It contains 11-bp conserved sequence, which corresponds to a conserved motif of tRNA TpsiC stem-loop, whereas the remainder of the recognition site is rather degenerate. T4-related phages T2L, RB1 and RB3 contain tRNA gene regions that are homologous to that of phage T4 but lack segB gene and several tRNA genes. In co-infections of phages T4 and T2L, segB gene is inherited with nearly 100% of efficiency. The preferred inheritance depends absolutely on the segB gene integrity and is accompanied by the loss of the T2L tRNA gene region markers. We suggest that SegB is a homing endonuclease that functions to ensure spreading of its own gene and the surrounding tRNA genes among T4-related phages.

Phage T4 SegB protein is a homing endonuclease required for the preferred inheritance of T4 tRNA gene region occurring in co-infection with a related phage

PubMed Central

Brok-Volchanskaya, Vera S.; Kadyrov, Farid A.; Sivogrivov, Dmitry E.; Kolosov, Peter M.; Sokolov, Andrey S.; Shlyapnikov, Michael G.; Kryukov, Valentine M.; Granovsky, Igor E.

2008-01-01

Homing endonucleases initiate nonreciprocal transfer of DNA segments containing their own genes and the flanking sequences by cleaving the recipient DNA. Bacteriophage T4 segB gene, which is located in a cluster of tRNA genes, encodes a protein of unknown function, homologous to homing endonucleases of the GIY-YIG family. We demonstrate that SegB protein is a site-specific endonuclease, which produces mostly 3′ 2-nt protruding ends at its DNA cleavage site. Analysis of SegB cleavage sites suggests that SegB recognizes a 27-bp sequence. It contains 11-bp conserved sequence, which corresponds to a conserved motif of tRNA TψC stem-loop, whereas the remainder of the recognition site is rather degenerate. T4-related phages T2L, RB1 and RB3 contain tRNA gene regions that are homologous to that of phage T4 but lack segB gene and several tRNA genes. In co-infections of phages T4 and T2L, segB gene is inherited with nearly 100% of efficiency. The preferred inheritance depends absolutely on the segB gene integrity and is accompanied by the loss of the T2L tRNA gene region markers. We suggest that SegB is a homing endonuclease that functions to ensure spreading of its own gene and the surrounding tRNA genes among T4-related phages. PMID:18281701

Conserved Sequences at the Origin of Adenovirus DNA Replication

PubMed Central

Stillman, Bruce W.; Topp, William C.; Engler, Jeffrey A.

1982-01-01

The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A · T-rich region which is partially conserved among these serotypes, and a distal G · C-rich region which is less well conserved. The G · C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. Images PMID:7143575

Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

PubMed

Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

2000-07-05

The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

PubMed

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Diagnostics of Neisseriaceae and Moraxellaceae by Ribosomal DNA Sequencing: Ribosomal Differentiation of Medical Microorganisms

PubMed Central

Harmsen, Dag; Singer, Christian; Rothgänger, Jörg; Tønjum, Tone; Sybren de Hoog, Gerrit; Shah, Haroun; Albert, Jürgen; Frosch, Matthias

2001-01-01

Fast and reliable identification of microbial isolates is a fundamental goal of clinical microbiology. However, in the case of some fastidious gram-negative bacterial species, classical phenotype identification based on either metabolic, enzymatic, or serological methods is difficult, time-consuming, and/or inadequate. 16S or 23S ribosomal DNA (rDNA) bacterial sequencing will most often result in accurate speciation of isolates. Therefore, the objective of this study was to find a hypervariable rDNA stretch, flanked by strongly conserved regions, which is suitable for molecular species identification of members of the Neisseriaceae and Moraxellaceae. The inter- and intrageneric relationships were investigated using comparative sequence analysis of PCR-amplified partial 16S and 23S rDNAs from a total of 94 strains. When compared to the type species of the genera Acinetobacter, Moraxella, and Neisseria, an average of 30 polymorphic positions was observed within the partial 16S rDNA investigated (corresponding to Escherichia coli positions 54 to 510) for each species and an average of 11 polymorphic positions was observed within the 202 nucleotides of the 23S rDNA gene (positions 1400 to 1600). Neisseria macacae and Neisseria mucosa subsp. mucosa (ATCC 19696) had identical 16S and 23S rDNA sequences. Species clusters were heterogeneous in both genes in the case of Acinetobacter lwoffii, Moraxella lacunata, and N. mucosa. Neisseria meningitidis isolates failed to cluster only in the 23S rDNA subset. Our data showed that the 16S rDNA region is more suitable than the partial 23S rDNA for the molecular diagnosis of Neisseriaceae and Moraxellaceae and that a reference database should include more than one strain of each species. All sequence chromatograms and taxonomic and disease-related information are available as part of our ribosomal differentiation of medical microorganisms (RIDOM) web-based service (http://www.ridom.hygiene.uni-wuerzburg.de/). Users can submit a

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

PubMed

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

Profiling the genome-wide DNA methylation pattern of porcine ovaries using reduced representation bisulfite sequencing.

PubMed

Yuan, Xiao-Long; Gao, Ning; Xing, Yan; Zhang, Hai-Bin; Zhang, Ai-Ling; Liu, Jing; He, Jin-Long; Xu, Yuan; Lin, Wen-Mian; Chen, Zan-Mou; Zhang, Hao; Zhang, Zhe; Li, Jia-Qi

2016-02-25

Substantial evidence has shown that DNA methylation regulates the initiation of ovarian and sexual maturation. Here, we investigated the genome-wide profile of DNA methylation in porcine ovaries at single-base resolution using reduced representation bisulfite sequencing. The biological variation was minimal among the three ovarian replicates. We found hypermethylation frequently occurred in regions with low gene abundance, while hypomethylation in regions with high gene abundance. The DNA methylation around transcriptional start sites was negatively correlated with their own CpG content. Additionally, the methylation level in the bodies of genes was higher than that in their 5' and 3' flanking regions. The DNA methylation pattern of the low CpG content promoter genes differed obviously from that of the high CpG content promoter genes. The DNA methylation level of the porcine ovary was higher than that of the porcine intestine. Analyses of the genome-wide DNA methylation in porcine ovaries would advance the knowledge and understanding of the porcine ovarian methylome.

Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress.

PubMed

Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László

2009-06-24

Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26 degrees C followed by a gradual decrease to 8 degrees C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA line

The 2.1-kb inverted repeat DNA sequences flank the mat2,3 silent region in two species of Schizosaccharomyces and are involved in epigenetic silencing in Schizosaccharomyces pombe.

PubMed Central

Singh, Gurjeet; Klar, Amar J S

2002-01-01

The mat2,3 region of the fission yeast Schizosaccharomyces pombe exhibits a phenomenon of transcriptional silencing. This region is flanked by two identical DNA sequence elements, 2.1 kb in length, present in inverted orientation: IRL on the left and IRR on the right of the silent region. The repeats do not encode any ORF. The inverted repeat DNA region is also present in a newly identified related species, which we named S. kambucha. Interestingly, the left and right repeats share perfect identity within a species, but show approximately 2% bases interspecies variation. Deletion of IRL results in variegated expression of markers inserted in the silent region, while deletion of the IRR causes their derepression. When deletions of these repeats were genetically combined with mutations in different trans-acting genes previously shown to cause a partial defect in silencing, only mutations in clr1 and clr3 showed additive defects in silencing with the deletion of IRL. The rate of mat1 switching is also affected by deletion of repeats. The IRL or IRR deletion did not cause significant derepression of the mat2 or mat3 loci. These results implicate repeats for maintaining full repression of the mat2,3 region, for efficient mat1 switching, and further support the notion that multiple pathways cooperate to silence the mat2,3 domain. PMID:12399374

Human tRNA genes function as chromatin insulators

PubMed Central

Raab, Jesse R; Chiu, Jonathan; Zhu, Jingchun; Katzman, Sol; Kurukuti, Sreenivasulu; Wade, Paul A; Haussler, David; Kamakaka, Rohinton T

2012-01-01

Insulators help separate active chromatin domains from silenced ones. In yeast, gene promoters act as insulators to block the spread of Sir and HP1 mediated silencing while in metazoans most insulators are multipartite autonomous entities. tDNAs are repetitive sequences dispersed throughout the human genome and we now show that some of these tDNAs can function as insulators in human cells. Using computational methods, we identified putative human tDNA insulators. Using silencer blocking, transgene protection and repressor blocking assays we show that some of these tDNA-containing fragments can function as barrier insulators in human cells. We find that these elements also have the ability to block enhancers from activating RNA pol II transcribed promoters. Characterization of a putative tDNA insulator in human cells reveals that the site possesses chromatin signatures similar to those observed at other better-characterized eukaryotic insulators. Enhanced 4C analysis demonstrates that the tDNA insulator makes long-range chromatin contacts with other tDNAs and ETC sites but not with intervening or flanking RNA pol II transcribed genes. PMID:22085927

Scar-less multi-part DNA assembly design automation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan J.

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

oriTfinder: a web-based tool for the identification of origin of transfers in DNA sequences of bacterial mobile genetic elements.

PubMed

Li, Xiaobin; Xie, Yingzhou; Liu, Meng; Tai, Cui; Sun, Jingyong; Deng, Zixin; Ou, Hong-Yu

2018-05-04

oriTfinder is a web server that facilitates the rapid identification of the origin of transfer site (oriT) of a conjugative plasmid or chromosome-borne integrative and conjugative element. The utilized back-end database oriTDB was built upon more than one thousand known oriT regions of bacterial mobile genetic elements (MGEs) as well as the known MGE-encoding relaxases and type IV coupling proteins (T4CP). With a combination of similarity searches for the oriTDB-archived oriT nucleotide sequences and the co-localization of the flanking relaxase homologous genes, the oriTfinder can predict the oriT region with high accuracy in the DNA sequence of a bacterial plasmid or chromosome in minutes. The server also detects the other transfer-related modules, including the potential relaxase gene, T4CP gene and the type IV secretion system gene cluster, and the putative genes coding for virulence factors and acquired antibiotic resistance determinants. oriTfinder may contribute to meeting the increasing demands of re-annotations for bacterial conjugative, mobilizable or non-transferable elements and aid in the rapid risk accession of disease-relevant trait dissemination in pathogenic bacteria of interest. oriTfinder is freely available to all users without any login requirement at http://bioinfo-mml.sjtu.edu.cn/oriTfinder.

A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells

PubMed Central

Chaikind, Brian; Bessen, Jeffrey L.; Thompson, David B.; Hu, Johnny H.; Liu, David R.

2016-01-01

We describe the development of ‘recCas9’, an RNA-programmed small serine recombinase that functions in mammalian cells. We fused a catalytically inactive dCas9 to the catalytic domain of Gin recombinase using an optimized fusion architecture. The resulting recCas9 system recombines DNA sites containing a minimal recombinase core site flanked by guide RNA-specified sequences. We show that these recombinases can operate on DNA sites in mammalian cells identical to genomic loci naturally found in the human genome in a manner that is dependent on the guide RNA sequences. DNA sequencing reveals that recCas9 catalyzes guide RNA-dependent recombination in human cells with an efficiency as high as 32% on plasmid substrates. Finally, we demonstrate that recCas9 expressed in human cells can catalyze in situ deletion between two genomic sites. Because recCas9 directly catalyzes recombination, it generates virtually no detectable indels or other stochastic DNA modification products. This work represents a step toward programmable, scarless genome editing in unmodified cells that is independent of endogenous cellular machinery or cell state. Current and future generations of recCas9 may facilitate targeted agricultural breeding, or the study and treatment of human genetic diseases. PMID:27515511

Structure-affinity relationships for the binding of actinomycin D to DNA

NASA Astrophysics Data System (ADS)

Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

1997-03-01

Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

Biosensors for DNA sequence detection

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; Akeson, Mark

2002-01-01

DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

PubMed Central

Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

2018-01-01

Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

"First generation" automated DNA sequencing technology.

PubMed

Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

2011-10-01

Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

Distant neighbor base sequence context effects in human nucleotide excision repair of a benzo[a]pyrene-derived DNA lesion

PubMed Central

Cai, Yuqin; Kropachev, Konstantin; Xu, Rong; Tang, Yijin; Kolbanovskii, Marina; Kolbanovskii, Alexander; Amin, Shantu; Patel, Dinshaw J.; Broyde, Suse; Geacintov, Nicholas E.

2010-01-01

Summary The effects of non-nearest base sequences, beyond the nucleotides flanking a DNA lesion on either side, on nucleotide excision repair (NER) in extracts from human cells were investigated. We constructed two duplexes containing the same minor groove-aligned 10S (+)-trans-anti-B[a]P-N2-dG (G*) DNA adduct, derived from the environmental carcinogen benzo[a]pyrene (B[a]P): 5′-C-C-A-T-C-G*-C-T-A-C-C-3′ (CG*C-I), and 5′-C-A-C3-A4-C5-G*-C-A-C-A-C-3′ (CG*C-II). We utilized gel electrophoresis to compare the extent of DNA bending, and molecular dynamics (MD) simulations to analyze the structural characteristics of these two DNA duplexes. The NER efficiencies are 1.6 ± 0.2 times greater in the case of the CG*C-II than the CG*C-I sequence context in 135-mer duplexes. Gel electrophoresis and self-ligation circularization experiments revealed that the CG*C-II duplex is more bent than the CG*C-I duplex, while MD simulations showed that the unique -C3-A4-C5- segment in the CG*C-II duplex plays a key role. The presence of a minor groove-positioned guanine amino group, namely, the Watson-Crick partner to C3, acts as a wedge; facilitated by a highly deformable local -C3-A4- base step, this amino group allows the B[a]P ring system to produce a more enlarged minor groove in CG*C-II than in CG*C-I, as well as a local untwisting and enlarged and flexible Roll only in the CG*C-II sequence. These structural properties fit well with our prior findings that in the case of the family of minor groove 10S (+)-trans-anti-B[a]P-N2-dG lesions, flexible bends and enlarged minor groove widths (Cai et al. (2009) J. Mol. Biol., 385: 30–44) constitute NER recognition signals, and extend our understanding of sequence context effects on NER to the neighbors that are distant to the lesion. PMID:20399214

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

PubMed Central

Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

2012-01-01

The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

Activity Enhancement of G-Quadruplex/Hemin DNAzyme by Flanking d(CCC).

PubMed

Chang, Tianjun; Gong, Hongmei; Ding, Pi; Liu, Xiangjun; Li, Weiguo; Bing, Tao; Cao, Zehui; Shangguan, Dihua

2016-03-14

G-quadruplex (G4)/hemin DNAzymes have been extensively applied in bioanalysis and molecular devices. However, their catalytic activity is still much lower than that of proteinous enzymes. The G4/hemin DNAzyme activity is correlated with the G4 conformations and the solution conditions. However, little is known about the effect of the flanking sequences on the activity, though they are important parts of G4s. Here, we report sequences containing d(CCC), flanked on both ends of the G4-core sequences remarkably enhance their DNAzyme activity. By using circular dichroism and UV-visible spectroscopy, the d(CCC) flanking sequences were demonstrated to improve the hemin binding affinity to G4s instead of increasing the parallel G4 formation, which might explain the enhanced DNAzyme activity. Meanwhile, the increased hemin binding ability promoted the degradation of hemin within the DNAzyme by H2O2. Furthermore, the DNAzyme with d(CCC) flanking sequences showed strong tolerance to pH value changes, which makes it more suitable for applications requiring wide pH conditions. The results highlight the influence of the flanking sequences on the DNAzyme activity and provide insightful information for the design of highly active DNAzymes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Danish STR sequence database: duplicate typing of 363 Danes with the ForenSeq™ DNA Signature Prep Kit.

PubMed

Hussing, C; Bytyci, R; Huber, C; Morling, N; Børsting, C

2018-05-24

Some STR loci have internal sequence variations, which are not revealed by the standard STR typing methods used in forensic genetics (PCR and fragment length analysis by capillary electrophoresis (CE)). Typing of STRs with next-generation sequencing (NGS) uncovers the sequence variation in the repeat region and in the flanking regions. In this study, 363 Danish individuals were typed for 56 STRs (26 autosomal STRs, 24 Y-STRs, and 6 X-STRs) using the ForenSeq™ DNA Signature Prep Kit to establish a Danish STR sequence database. Increased allelic diversity was observed in 34 STRs by the PCR-NGS assay. The largest increases were found in DYS389II and D12S391, where the numbers of sequenced alleles were around four times larger than the numbers of alleles determined by repeat length alone. Thirteen SNPs and one InDel were identified in the flanking regions of 12 STRs. Furthermore, 36 single positions and five longer stretches in the STR flanking regions were found to have dubious genotyping quality. The combined match probability of the 26 autosomal STRs was 10,000 times larger using the PCR-NGS assay than by using PCR-CE. The typical paternity indices for trios and duos were 500 and 100 times larger, respectively, than those obtained with PCR-CE. The assay also amplified 94 SNPs selected for human identification. Eleven of these loci were not in Hardy-Weinberg equilibrium in the Danish population, most likely because the minimum threshold for allele calling (30 reads) in the ForenSeq™ Universal Analysis Software was too low and frequent allele dropouts were not detected.

On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

PubMed

Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

1996-07-12

TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

[Genome-scale sequence data processing and epigenetic analysis of DNA methylation].

PubMed

Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong

2013-06-01

A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

Sequence independent amplification of DNA

DOEpatents

Bohlander, S.K.

1998-03-24

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

Sequence independent amplification of DNA

DOEpatents

Bohlander, Stefan K.

1998-01-01

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei.

Statistical properties of DNA sequences

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

1995-01-01

We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

Analysis of JC virus DNA replication using a quantitative and high-throughput assay

PubMed Central

Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.

2015-01-01

Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. PMID:25155200

A microfabricated hybrid device for DNA sequencing.

PubMed

Liu, Shaorong

2003-11-01

We have created a hybrid device of a microfabricated round-channel twin-T injector incorporated with a separation capillary in order to extend the straight separation distance for high speed and long readlength DNA sequencing. Semicircular grooves on glass wafers are obtained using a photomask with a narrow line-width and a standard isotropic photolithographic etching process. Round channels are made when two etched wafers are face-to-face aligned and bonded. A two-mask fabrication process has been developed to make channels of two different diameters. The twin-T injector is formed by the smaller channels whose diameter matches the bore of the separation capillary, and the "usual" separation channel, now called the connection channel, is formed by the larger ones whose diameter matches the outer diameter of the separation capillary. The separation capillary is inserted through the connection channel all the way to the twin-T injector to allow the capillary bore flush with the twin-T injector channels. The total dead-volume of the connection is estimated to be approximately 5 pL. To demonstrate the efficiency of this hybrid device, we have performed four-color DNA sequencing on it. Using a 200 microm twin-T injector coupled with a separation capillary of 20 cm effective separation distance, we have obtained readlengths of 800 plus bases at an accuracy of 98.5% in 56 min, compared to about 650 bases in 100 min on a conventional 40 cm long capillary sequencing machine under similar conditions. At an increased separation field strength and using a diluted sieving matrix, the separation time has been reduced to 20 min with a readlength of 700 bases at 98.5% base-calling accuracy.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Chromosomal rearrangements involving telomeric DNA sequences in Balb/3T3 cells transfected with the Ha-ras oncogene.

PubMed

Peitl, Paulo; Mello, Stephano S; Camparoto, Marjori L; Passos, Geraldo A S; Hande, Manoor P; Cardoso, Renato S; Sakamoto-Hojo, Elza T

2002-01-01

Chromosomal instability involving telomeric DNA sequences was studied in mouse Balb/3T3 fibroblasts transfected with a mutated human c-Ha-ras-1 gene (B61 cells) and spontaneously immortalized normal parental cells (A31 cells), using fluorescence in situ hybridization (FISH). FISH analysis with a telomeric probe revealed high frequencies of chromosome alterations involving telomeric regions, mainly stable and unstable Robertsonian fusion-like configurations (RLC) (0.25 and 1.95/cell in A31 and B61 cells, respectively) and chromosome ends lacking telomeric signals in one (LTS') or both chromatids (LTS") (5.9 and 17.5/cell for A31 and B61 cells, respectively). Interstitial telomeric sequences (ITS) were also detected at both non-telomeric sites and in the centromeres of RLC. The frequencies of RLCs with ITS located in the centromeres were 3-fold higher in B61 compared with A31 cells. We demonstrated a high level of chromosome instability involving telomeric DNA sequences in ras-transfected cells overexpressing ras mRNA, which could be a consequence of rapid cell cycle progression associated with a deficient telomere capping mechanism.

The evolution processes of DNA sequences, languages and carols

NASA Astrophysics Data System (ADS)

Hauck, Jürgen; Henkel, Dorothea; Mika, Klaus

2001-04-01

The sequences of bases A, T, C and G of about 100 enolase, secA and cytochrome DNA were analyzed for attractive or repulsive interactions by the numbers T 1,T 2,T 3; r of nearest, next-nearest and third neighbor bases of the same kind and the concentration r=other bases/analyzed base. The area of possible T1, T2 values is limited by the linear borders T 2=2T 1-2, T 2=0 or T1=0 for clustering, attractive or repulsive interactions and the border T2=-2 T1+2(2- r) for a variation from repulsive to attractive interactions at r⩽2. Clustering is preferred by most bases in sequences of enolases and secA’ s. Major deviations with repulsive interactions of some bases are observed for archaea bacteria in secA and for highly developed animals and the human species in enolase sequences. The borders of the structure map for enthalpy stabilized structures with maximum interactions are approached in few cases. Most letters of the natural languages and some music notes are at the borders of the structure map.

Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

PubMed

Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

2018-05-14

The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen

DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

PubMed

Rieben, W Kurt; Coulombe, Roger A

2004-12-01

Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

Kilo-sequencing: an ordered strategy for rapid DNA sequence data acquisition.

PubMed Central

Barnes, W M; Bevan, M

1983-01-01

A strategy for rapid DNA sequence acquisition in an ordered, nonrandom manner, while retaining all of the conveniences of the dideoxy method with M13 transducing phage DNA template, is described. Target DNA 3 to 14 kb in size can be stably carried by our M13 vectors. Suitable targets are stretches of DNA which lack an enzyme recognition site which is unique on our cloning vectors and adjacent to the sequencing primer; current sites that are so useful when lacking are Pst, Xba, HindIII, BglII, EcoRI. By an in vitro procedure, we cut RF DNA once randomly and once specifically, to create thousands of deletions which start at the unique restriction site adjacent to the dideoxy sequencing primer and extend various distances across the target DNA. Phage carrying a desired size of deletions, whose DNA as template will give rise to DNA sequence data in a desired location along the target DNA, may be purified by electrophoresis alive on agarose gels. Phage running in the same location on the agarose gel thus conveniently give rise to nucleotide sequence data from the same kilobase of target DNA. Images PMID:6298723

Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

PubMed

Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

2016-11-01

Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Separation and parallel sequencing of the genomes and transcriptomes of single cells using G&T-seq.

PubMed

Macaulay, Iain C; Teng, Mabel J; Haerty, Wilfried; Kumar, Parveen; Ponting, Chris P; Voet, Thierry

2016-11-01

Parallel sequencing of a single cell's genome and transcriptome provides a powerful tool for dissecting genetic variation and its relationship with gene expression. Here we present a detailed protocol for G&T-seq, a method for separation and parallel sequencing of genomic DNA and full-length polyA(+) mRNA from single cells. We provide step-by-step instructions for the isolation and lysis of single cells; the physical separation of polyA(+) mRNA from genomic DNA using a modified oligo-dT bead capture and the respective whole-transcriptome and whole-genome amplifications; and library preparation and sequence analyses of these amplification products. The method allows the detection of thousands of transcripts in parallel with the genetic variants captured by the DNA-seq data from the same single cell. G&T-seq differs from other currently available methods for parallel DNA and RNA sequencing from single cells, as it involves physical separation of the DNA and RNA and does not require bespoke microfluidics platforms. The process can be implemented manually or through automation. When performed manually, paired genome and transcriptome sequencing libraries from eight single cells can be produced in ∼3 d by researchers experienced in molecular laboratory work. For users with experience in the programming and operation of liquid-handling robots, paired DNA and RNA libraries from 96 single cells can be produced in the same time frame. Sequence analysis and integration of single-cell G&T-seq DNA and RNA data requires a high level of bioinformatics expertise and familiarity with a wide range of informatics tools.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

PubMed

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

New insights into Trypanosoma cruzi evolution, genotyping and molecular diagnostics from satellite DNA sequence analysis.

PubMed

Ramírez, Juan C; Torres, Carolina; Curto, María de Los A; Schijman, Alejandro G

2017-12-01

Trypanosoma cruzi has been subdivided into seven Discrete Typing Units (DTUs), TcI-TcVI and Tcbat. Two major evolutionary models have been proposed to explain the origin of hybrid lineages, but while it is widely accepted that TcV and TcVI are the result of genetic exchange between TcII and TcIII strains, the origin of TcIII and TcIV is still a matter of debate. T. cruzi satellite DNA (SatDNA), comprised of 195 bp units organized in tandem repeats, from both TcV and TcVI stocks were found to have SatDNA copies type TcI and TcII; whereas contradictory results were observed for TcIII stocks and no TcIV sequence has been analyzed yet. Herein, we have gone deeper into this matter analyzing 335 distinct SatDNA sequences from 19 T. cruzi stocks representative of DTUs TcI-TcVI for phylogenetic inference. Bayesian phylogenetic tree showed that all sequences were grouped in three major clusters, which corresponded to sequences from DTUs TcI/III, TcII and TcIV; whereas TcV and TcVI stocks had two sets of sequences distributed into TcI/III and TcII clusters. As expected, the lowest genetic distances were found between TcI and TcIII, and between TcV and TcVI sequences; whereas the highest ones were observed between TcII and TcI/III, and among TcIV sequences and those from the remaining DTUs. In addition, signature patterns associated to specific T. cruzi lineages were identified and new primers that improved SatDNA-based qPCR sensitivity were designed. Our findings support the theory that TcIII is not the result of a hybridization event between TcI and TcII, and that TcIV had an independent origin from the other DTUs, contributing to clarifying the evolutionary history of T. cruzi lineages. Moreover, this work opens the possibility of typing samples from Chagas disease patients with low parasitic loads and improving molecular diagnostic methods of T. cruzi infection based on SatDNA sequence amplification.

DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

PubMed

Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

2012-01-01

DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

Control of photosynthetic membrane assembly in Rhodobacter sphaeroides mediated by puhA and flanking sequences.

PubMed Central

Sockett, R E; Donohue, T J; Varga, A R; Kaplan, S

1989-01-01

A reaction center H- strain (RCH-) of Rhodobacter sphaeroides, PUHA1, was made by in vitro deletion of an XhoI restriction endonuclease fragment from the puhA gene coupled with insertion of a kanamycin resistance gene cartridge. The resulting construct was delivered to R. sphaeroides wild-type 2.4.1, with the defective puhA gene replacing the wild-type copy by recombination, followed by selection for kanamycin resistance. When grown under conditions known to induce intracytoplasmic membrane development, PUHA1 synthesized a pigmented intracytoplasmic membrane. Spectral analysis of this membrane showed that it was deficient in B875 spectral complexes as well as functional reaction centers and that the level of B800-850 spectral complexes was greater than in the wild type. The RCH- strain was photosythetically incompetent, but photosynthetic growth was restored by complementation with a 1.45-kilobase (kb) BamHI restriction endonuclease fragment containing the puhA gene carried in trans on plasmid pRK404. B875 spectral complexes were not restored by complementation with the 1.45-kb BamHI restriction endonuclease fragment containing the puhA gene but were restored along with photosynthetic competence by complementation with DNA from a cosmid carrying the puhA gene, as well as a flanking DNA sequence. Interestingly, B875 spectral complexes, but not photosynthetic competence, were restored to PUHA1 by introduction in trans of a 13-kb BamHI restriction endonuclease fragment carrying genes encoding the puf operon region of the DNA. The effect of the puhA deletion was further investigated by an examination of the levels of specific mRNA species derived from the puf and puc operons, as well as by determinations of the relative abundances of polypeptides associated with various spectral complexes by immunological methods. The roles of puhA and other genetic components in photosynthetic gene expression and membrane assembly are discussed. Images PMID:2644200

Recognition of the DNA sequence by an inorganic crystal surface

PubMed Central

Sampaolese, Beatrice; Bergia, Anna; Scipioni, Anita; Zuccheri, Giampaolo; Savino, Maria; Samorì, Bruno; De Santis, Pasquale

2002-01-01

The sequence-dependent curvature is generally recognized as an important and biologically relevant property of DNA because it is involved in the formation and stability of association complexes with proteins. When a DNA tract, intrinsically curved for the periodical recurrence on the same strand of A-tracts phased with the B-DNA periodicity, is deposited on a flat surface, it exposes to that surface either a T- or an A-rich face. The surface of a freshly cleaved mica crystal recognizes those two faces and preferentially interacts with the former one. Statistical analysis of scanning force microscopy (SFM) images provides evidence of this recognition between an inorganic crystal surface and nanoscale structures of double-stranded DNA. This finding could open the way toward the use of the sequence-dependent adhesion to specific crystal faces for nanotechnological purposes. PMID:12361979

DNA Sequencing apparatus

DOEpatents

Tabor, Stanley; Richardson, Charles C.

1992-01-01

An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

Sequence Effect on the Formation of DNA Minidumbbells.

PubMed

Liu, Yuan; Lam, Sik Lok

2017-11-16

The DNA minidumbbell (MDB) is a recently identified non-B structure. The reported MDBs contain two TTTA, CCTG, or CTTG type II loops. At present, the knowledge and understanding of the sequence criteria for MDB formation are still limited. In this study, we performed a systematic high-resolution nuclear magnetic resonance (NMR) and native gel study to investigate the effect of sequence variations in tandem repeats on the formation of MDBs. Our NMR results reveal the importance of hydrogen bonds, base-base stacking, and hydrophobic interactions from each of the participating residues. We conclude that in the MDBs formed by tandem repeats, C-G loop-closing base pairs are more stabilizing than T-A loop-closing base pairs, and thymine residues in both the second and third loop positions are more stabilizing than cytosine residues. The results from this study enrich our knowledge on the sequence criteria for the formation of MDBs, paving a path for better exploring their potential roles in biological systems and DNA nanotechnology.

Development of Active DNA Control Technique for DNA Sequencer With a Solid-state Nanopore

NASA Astrophysics Data System (ADS)

Akahori, Rena; Harada, Kunio; Goto, Yusuke; Yanagi, Itaru; Yokoi, Takahide; Oura, Takeshi; Shibahara, Masashi; Takeda, Ken-Ichi

We have developed a technique that can control the arbitrary speeds of DNA passing through a solid-state nanopore of a DNA sequencer. For this active DNA control technique, we used a DNA-immobilized Si probe, larger than the membrane with a nanopore, and used a piezoelectric actuator and stepper motor to drive the probe. This probe enables a user to adjust the relative position between the nanopore and DNA immobilized on the probe without the need for precise lateral control. In this presentation, we demonstrate how DNA (block copolymer ([(dT)25-(dC)25-(dA)50]m)), immobilized on the probe, slid through a nanopore and was pulled out using the active DNA control technique. As the DNA-immobilized probe was being pulled out, we obtained various ion-current signal levels corresponding to the number of different nucleotides in a single strand of DNA.

Characterization of Trichuris trichiura from humans and T. suis from pigs in China using internal transcribed spacers of nuclear ribosomal DNA.

PubMed

Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q

2014-03-01

Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.

Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

NASA Technical Reports Server (NTRS)

Harada, Kazuo; Orgel, Leslie E.

1993-01-01

We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

PubMed

Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

2000-12-01

Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

Method for sequencing DNA base pairs

DOEpatents

Sessler, Andrew M.; Dawson, John

1993-01-01

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

Method for sequencing DNA base pairs

DOEpatents

Sessler, A.M.; Dawson, J.

1993-12-14

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

PubMed

Xie, Guosen; Mo, Zhongxi

2011-01-21

In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

Structural and sequencing analysis of local target DNA recognition by MLV integrase.

PubMed

Aiyer, Sriram; Rossi, Paolo; Malani, Nirav; Schneider, William M; Chandar, Ashwin; Bushman, Frederic D; Montelione, Gaetano T; Roth, Monica J

2015-06-23

Target-site selection by retroviral integrase (IN) proteins profoundly affects viral pathogenesis. We describe the solution nuclear magnetic resonance structure of the Moloney murine leukemia virus IN (M-MLV) C-terminal domain (CTD) and a structural homology model of the catalytic core domain (CCD). In solution, the isolated MLV IN CTD adopts an SH3 domain fold flanked by a C-terminal unstructured tail. We generated a concordant MLV IN CCD structural model using SWISS-MODEL, MMM-tree and I-TASSER. Using the X-ray crystal structure of the prototype foamy virus IN target capture complex together with our MLV domain structures, residues within the CCD α2 helical region and the CTD β1-β2 loop were predicted to bind target DNA. The role of these residues was analyzed in vivo through point mutants and motif interchanges. Viable viruses with substitutions at the IN CCD α2 helical region and the CTD β1-β2 loop were tested for effects on integration target site selection. Next-generation sequencing and analysis of integration target sequences indicate that the CCD α2 helical region, in particular P187, interacts with the sequences distal to the scissile bonds whereas the CTD β1-β2 loop binds to residues proximal to it. These findings validate our structural model and disclose IN-DNA interactions relevant to target site selection. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Phylogenetic relationships of bears (the Ursidae) inferred from mitochondrial DNA sequences.

PubMed

Zhang, Y P; Ryder, O A

1994-12-01

The phylogenetic relationships among some bear species are still open questions. We present here mitochondrial DNA sequences of D-loop region, cytochrome b, 12S rRNA, tRNA(Pro), and tRNA(Thr) genes from all bear species and the giant panda. A series of evolutionary trees with concordant topology has been derived based on the combined data set of all of the mitochondrial DNA sequences, which may have resolved the evolutionary relationships of all bear species: the ancestor of the spectacled bear diverged first, followed by the sloth bear; the brown bear and polar bear are sister taxa relative to the Asiatic black bear; the closest relative of the American black bear is the sun bear. Primers for forensic identification of the giant panda and bears are proposed. Analysis of these data, in combination with data from primates and antelopes, suggests that relative substitutional rates between different mitochondrial DNA regions may vary greatly among different taxa of the vertebrates.

Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

PubMed

Rackwitz, Jenny; Bald, Ilko

2018-03-26

During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (<20 eV) electrons, which are able to damage DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate

PubMed Central

Yang, Yu; Hebron, Haroun R.; Hang, Jun

2009-01-01

A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455

Molecular phylogeny for marine turtles based on sequences of the ND4-leucine tRNA and control regions of mitochondrial DNA.

PubMed

Dutton, P H; Davis, S K; Guerra, T; Owens, D

1996-06-01

Marine turtles are divided into two families, the Dermochelyidae and the Cheloniidae. The majority of species are currently placed within the two tribes of the Cheloniidae, the Chelonini and the Carettini, but debate continues over generic and tribal affinities as well as species boundaries. We used nucleotide sequences (907 bp) from the ND4-LEU tRNA region and the control region (526 bp) of mitochondrial DNA to resolve areas of uncertainty in marine turtle (Chelonioidae) systematics. The ND4-LEU tRNA fragment was more conserved than the fragment from the control region, with sequence divergences ranging from 0.026 to 0.148 and 0.067 to 0.267, respectively. Parsimony analysis based only on the ND4-LEU tRNA data suggests that the hawksbill, Eretmochelys imbricata, lies within the tribe Carettni and is closely related to the genus Caretta, but could not resolve the position of the flatback, Natator depressus. A similar analysis based only on the control region sequence data suggested that N. depressus is affiliated with the Chelonini, but failed to resolve the position of E. imbricata and the loggerhead, Caretta caretta. In contrast to these results, the combination of both data sets with published cytochrome b data produced a phylogeny based on 1924 bp of sequence data which resolves the position of E. imbricata relative to Caretta and Lepidochelys and joins N. depressus as sister to the Carettini. Based on the molecular data, the Chelonini contains the Chelonia species, while the Carettini contains the remaining species of Cheloniidae. The control region sequence divergence between Pacific and Atlantic populations of the leatherback, Dermochelys coriacea, was relatively low (0.0081) when compared with the green turtle, Chelonia mydas (0.071-0.074). Atlantic and Pacific populations of Ch. mydas were found to be paraphyletic with respect to the black turtle, Ch. agassizi, suggesting that the current taxonomic designations within the Pacific Chelonia are questionable

A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xun; Guanga, Gerald P; Wan, Cheng

2012-11-13

MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

Massively parallel sequencing of forensic STRs: Considerations of the DNA commission of the International Society for Forensic Genetics (ISFG) on minimal nomenclature requirements.

PubMed

Parson, Walther; Ballard, David; Budowle, Bruce; Butler, John M; Gettings, Katherine B; Gill, Peter; Gusmão, Leonor; Hares, Douglas R; Irwin, Jodi A; King, Jonathan L; Knijff, Peter de; Morling, Niels; Prinz, Mechthild; Schneider, Peter M; Neste, Christophe Van; Willuweit, Sascha; Phillips, Christopher

2016-05-01

The DNA Commission of the International Society for Forensic Genetics (ISFG) is reviewing factors that need to be considered ahead of the adoption by the forensic community of short tandem repeat (STR) genotyping by massively parallel sequencing (MPS) technologies. MPS produces sequence data that provide a precise description of the repeat allele structure of a STR marker and variants that may reside in the flanking areas of the repeat region. When a STR contains a complex arrangement of repeat motifs, the level of genetic polymorphism revealed by the sequence data can increase substantially. As repeat structures can be complex and include substitutions, insertions, deletions, variable tandem repeat arrangements of multiple nucleotide motifs, and flanking region SNPs, established capillary electrophoresis (CE) allele descriptions must be supplemented by a new system of STR allele nomenclature, which retains backward compatibility with the CE data that currently populate national DNA databases and that will continue to be produced for the coming years. Thus, there is a pressing need to produce a standardized framework for describing complex sequences that enable comparison with currently used repeat allele nomenclature derived from conventional CE systems. It is important to discern three levels of information in hierarchical order (i) the sequence, (ii) the alignment, and (iii) the nomenclature of STR sequence data. We propose a sequence (text) string format the minimal requirement of data storage that laboratories should follow when adopting MPS of STRs. We further discuss the variant annotation and sequence comparison framework necessary to maintain compatibility among established and future data. This system must be easy to use and interpret by the DNA specialist, based on a universally accessible genome assembly, and in place before the uptake of MPS by the general forensic community starts to generate sequence data on a large scale. While the established

CaMV-35S promoter sequence-specific DNA methylation in lettuce.

PubMed

Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

2016-01-01

We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore

DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

PubMed

Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

2014-02-03

The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

Mitochondrial DNA variation and phylogenetic relationships among five tuna species based on sequencing of D-loop region.

PubMed

Kumar, Girish; Kocour, Martin; Kunal, Swaraj Priyaranjan

2016-05-01

In order to assess the DNA sequence variation and phylogenetic relationship among five tuna species (Auxis thazard, Euthynnus affinis, Katsuwonus pelamis, Thunnus tonggol, and T. albacares) out of all four tuna genera, partial sequences of the mitochondrial DNA (mtDNA) D-loop region were analyzed. The estimate of intra-specific sequence variation in studied species was low, ranging from 0.027 to 0.080 [Kimura's two parameter distance (K2P)], whereas values of inter-specific variation ranged from 0.049 to 0.491. The longtail tuna (T. tonggol) and yellowfin tuna (T. albacares) were found to share a close relationship (K2P = 0.049) while skipjack tuna (K. pelamis) was most divergent studied species. Phylogenetic analysis using Maximum-Likelihood (ML) and Neighbor-Joining (NJ) methods supported the monophyletic origin of Thunnus species. Similarly, phylogeny of Auxis and Euthynnus species substantiate the monophyly. However, results showed a distinct origin of K. pelamis from genus Thunnus as well as Auxis and Euthynnus. Thus, the mtDNA D-loop region sequence data supports the polyphyletic origin of tuna species.

ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences.

PubMed

Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia

2017-12-01

Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.

Two-Tailed Comet Assay (2T-Comet): Simultaneous Detection of DNA Single and Double Strand Breaks.

PubMed

Cortés-Gutiérrez, Elva I; Fernández, José Luis; Dávila-Rodríguez, Martha I; López-Fernández, Carmen; Gosálvez, Jaime

2017-01-01

A modification of the original comet assay was developed for the simultaneous evaluation of DNA single strand breaks (SSBs) and double strand breaks (DSBs) in human spermatozoa. The two-dimensional perpendicular tail comet assay (2T-comet) combines non-denaturing and denaturant conditions to the same sperm nucleoid. In this case, the species-specific deproteinized sperm is first subjected to an electrophoretic field under non-denaturing conditions to mobilize isolated free discrete DNA fragments produced from DSBs; this is then followed by a second electrophoresis running perpendicular to the first one but under alkaline conditions to produce DNA denaturation, exposing SSBs on the same linear DNA chain or DNA fragments flanked by DSBs. This procedure results in a two dimensional comet tail emerging from the core where two types of original DNA affected molecule can be simultaneously discriminated. The 2T-comet is a fast, sensitive, and reliable procedure to distinguish between single and double strand DNA damage within the same cell. It is an innovative method for assessing sperm DNA integrity, which has important implications for human fertility and andrological pathology. This technique may be adapted to assess different DNA break types in other species and other cell types.

SamSelect: a sample sequence selection algorithm for quorum planted motif search on large DNA datasets.

PubMed

Yu, Qiang; Wei, Dingbang; Huo, Hongwei

2018-06-18

Given a set of t n-length DNA sequences, q satisfying 0 < q ≤ 1, and l and d satisfying 0 ≤ d < l < n, the quorum planted motif search (qPMS) finds l-length strings that occur in at least qt input sequences with up to d mismatches and is mainly used to locate transcription factor binding sites in DNA sequences. Existing qPMS algorithms have been able to efficiently process small standard datasets (e.g., t = 20 and n = 600), but they are too time consuming to process large DNA datasets, such as ChIP-seq datasets that contain thousands of sequences or more. We analyze the effects of t and q on the time performance of qPMS algorithms and find that a large t or a small q causes a longer computation time. Based on this information, we improve the time performance of existing qPMS algorithms by selecting a sample sequence set D' with a small t and a large q from the large input dataset D and then executing qPMS algorithms on D'. A sample sequence selection algorithm named SamSelect is proposed. The experimental results on both simulated and real data show (1) that SamSelect can select D' efficiently and (2) that the qPMS algorithms executed on D' can find implanted or real motifs in a significantly shorter time than when executed on D. We improve the ability of existing qPMS algorithms to process large DNA datasets from the perspective of selecting high-quality sample sequence sets so that the qPMS algorithms can find motifs in a short time in the selected sample sequence set D', rather than take an unfeasibly long time to search the original sequence set D. Our motif discovery method is an approximate algorithm.

Hybridization of Tamarix ramosissima and T. chinensis (saltcedars) with T. aphylla (athel) (tamaricaceae) in the southwestern USA dertermined from DNA sequence data

USGS Publications Warehouse

Gaskin, John F.; Shafroth, Patrick B.

2005-01-01

Morphological intermediates between Tamarix ramosissima or T. chinensis (saltcedars) and T. aphylla (athel) were found recently in three locations in the southwestern USA, and were assumed to be hybrids or a previously unreported species. We sequenced chloroplast and nuclear DNA from putative parental and hybrid morphotypes and hybrid status of morphological intermediates was supported. Chloroplast data suggest that the seed source for these hybrids is T. aphylla. Invasive T. aphylla genotypes found in Australia match those found in the USA. Seed was collected from one of the hybrids, and a low percentage of it was viable. This hybrid combination has not been previously reported in the USA or the native ranges of the species. Although populations of this novel Tamarix hybrid appear to be uncommon at present, both parental species are considered invasive (saltcedars in North America; athel in Australia), and it is possible that more aggressive hybrid genotypes could be produced. Therefore, natural resource managers concerned with the potential spread of non-native species should be aware of the existence of these plants and monitor their future spread.

Comparative oncology DNA sequencing of canine T cell lymphoma via human hotspot panel

PubMed Central

Beheshti, Afshin; Pilichowska, Monika; Burgess, Kristine; Ricks-Santi, Luisel; McNiel, Elizabeth; London, Cheryl B.; Ravi, Dashnamoorthy; Evens, Andrew M.

2018-01-01

T-cell lymphoma (TCL) is an uncommon and aggressive form of human cancer. Lymphoma is the most common hematopoietic tumor in canines (companion animals), with TCL representing approximately 30% of diagnoses. Collectively, the canine is an appealing model for cancer research given the spontaneous occurrence of cancer, intact immune system, and phytogenetic proximity to humans. We sought to establish mutational congruence of the canine with known human TCL mutations in order to identify potential actionable oncogenic pathways. Following pathologic confirmation, DNA was sequenced in 16 canine TCL (cTCL) cases using a custom Human Cancer Hotspot Panel of 68 genes commonly mutated in human TCL. Sequencing identified 4,527,638 total reads with average length of 229 bases containing 346 unique variants and 1,474 total variants; each sample had an average of 92 variants. Among these, there were 258 germline and 32 somatic variants. Among the 32 somatic variants there were 8 missense variants, 1 splice junction variant and the remaining were intron or synonymous variants. A frequency of 4 somatic mutations per sample were noted with >7 mutations detected in MET, KDR, STK11 and BRAF. Expression of these associated proteins were also detected via Western blot analyses. In addition, Sanger sequencing confirmed three variants of high quality (MYC, MET, and TP53 missense mutation). Taken together, the mutational spectrum and protein analyses showed mutations in signaling pathways similar to human TCL and also identified novel mutations that may serve as drug targets as well as potential biomarkers. PMID:29854308

[Norrie syndrome: identification of carriers by segregation analysis with flanking DNA markers].

PubMed

Körner, J; Uhlhaas, S; Neugebauer, M; Gal, A

1989-01-01

Norrie disease is an X-linked recessive disorder. Affected males present with congenital blindness. Additionally, hearing loss and psychotic behavior may occur at any time. Since carriers are clinically healthy, they can only be identified by genetic means. Daughters of carriers or sisters of affected males have an à priori 50% risk of being carriers themselves. Close linkage has been found between the Norrie disease locus (NDP) and the DNA locus DXS7 mapped to Xp11.3. For genetic counselling, this linkage relationship allows carriers of the disease to be identified in informative families. We describe a large pedigree with Norrie disease. Segregation analysis was carried out with DXS7 and a second flanking marker, DXS255, both linked to NDP. In this way, three females at risk were identified who had a high probability of being carriers for Norrie disease.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Tandemly repeated sequences in mtDNA control region of whitefish, Coregonus lavaretus.

PubMed

Brzuzan, P

2000-06-01

Length variation of the mitochondrial DNA control region was observed with PCR amplification of a sample of 138 whitefish (Coregonus lavaretus). Nucleotide sequences of representative PCR products showed that the variation was due to the presence of an approximately 100-bp motif tandemly repeated two, three, or five times in the region between the conserved sequence block-3 (CSB-3) and the gene for phenylalanine tRNA. This is the first report on the tandem array composed of long repeat units in mitochondrial DNA of salmonids.

Transposon facilitated DNA sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, D.E.; Berg, C.M.; Huang, H.V.

1990-01-01

The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

PubMed

Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

2011-07-01

Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value < 2 × 10(-16)). We found distinct patterns of promoter methylation around transcription start sites, where methylation occurred not only on the CGIs, but also on flanking regions and CGI sparse promoters. Among the 6691 methylated promoters in prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

Sequence periodicity in nucleosomal DNA and intrinsic curvature.

PubMed

Nair, T Murlidharan

2010-05-17

Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

Sequence periodicity in nucleosomal DNA and intrinsic curvature

PubMed Central

2010-01-01

Background Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Results Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. Conclusions The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA. PMID:20487515

Osmylated DNA, a novel concept for sequencing DNA using nanopores

NASA Astrophysics Data System (ADS)

Kanavarioti, Anastassia

2015-03-01

Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

The determination of complete human mitochondrial DNA sequences in single cells: implications for the study of somatic mitochondrial DNA point mutations

PubMed Central

Taylor, Robert W.; Taylor, Geoffrey A.; Durham, Steve E.; Turnbull, Douglass M.

2001-01-01

Studies of single cells have previously shown intracellular clonal expansion of mitochondrial DNA (mtDNA) mutations to levels that can cause a focal cytochrome c oxidase (COX) defect. Whilst techniques are available to study mtDNA rearrangements at the level of the single cell, recent interest has focused on the possible role of somatic mtDNA point mutations in ageing, neurodegenerative disease and cancer. We have therefore developed a method that permits the reliable determination of the entire mtDNA sequence from single cells without amplifying contaminating, nuclear-embedded pseudogenes. Sequencing and PCR–RFLP analyses of individual COX-negative muscle fibres from a patient with a previously described heteroplasmic COX II (T7587C) mutation indicate that mutant loads as low as 30% can be reliably detected by sequencing. This technique will be particularly useful in identifying the mtDNA mutational spectra in age-related COX-negative cells and will increase our understanding of the pathogenetic mechanisms by which they occur. PMID:11470889

Compressing DNA sequence databases with coil.

PubMed

White, W Timothy J; Hendy, Michael D

2008-05-20

Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip) compression - an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression - the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST) data. Finally, coil can efficiently encode incremental additions to a sequence database. coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.

All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

PubMed Central

Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

1981-01-01

In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

Sequence specificity of single-stranded DNA-binding proteins: a novel DNA microarray approach

PubMed Central

Morgan, Hugh P.; Estibeiro, Peter; Wear, Martin A.; Max, Klaas E.A.; Heinemann, Udo; Cubeddu, Liza; Gallagher, Maurice P.; Sadler, Peter J.; Walkinshaw, Malcolm D.

2007-01-01

We have developed a novel DNA microarray-based approach for identification of the sequence-specificity of single-stranded nucleic-acid-binding proteins (SNABPs). For verification, we have shown that the major cold shock protein (CspB) from Bacillus subtilis binds with high affinity to pyrimidine-rich sequences, with a binding preference for the consensus sequence, 5′-GTCTTTG/T-3′. The sequence was modelled onto the known structure of CspB and a cytosine-binding pocket was identified, which explains the strong preference for a cytosine base at position 3. This microarray method offers a rapid high-throughput approach for determining the specificity and strength of ss DNA–protein interactions. Further screening of this newly emerging family of transcription factors will help provide an insight into their cellular function. PMID:17488853

Bacterial identification and subtyping using DNA microarray and DNA sequencing.

PubMed

Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

2012-01-01

The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

Mechanism of degradation of 2'-deoxycytidine by formamide: implications for chemical DNA sequencing procedures.

PubMed

Saladino, R; Crestini, C; Mincione, E; Costanzo, G; Di Mauro, E; Negri, R

1997-11-01

We describe the reaction of formamide with 2'-deoxycytidine to give pyrimidine ring opening by nucleophilic addition on the electrophilic C(6) and C(4) positions. This information is confirmed by the analysis of the products of formamide attack on 2'-deoxycytidine, 5-methyl-2'-deoxycytidine, and 5-bromo-2'-deoxycytidine, residues when the latter are incorporated into oligonucleotides by DNA polymerase-driven polymerization and solid-phase phosphoramidite procedure. The increased sensitivity of 5-bromo-2'-deoxycytidine relative to that of 2'-deoxycytidine is pivotal for the improvement of the one-lane chemical DNA sequencing procedure based on the base-selective reaction of formamide with DNA. In many DNA sequencing cases it will in fact be possible to incorporate this base analogue into the DNA to be sequenced, thus providing a complete discrimination between its UV absorption signal and that of the thymidine residues. The wide spectrum of different sensitivities to formamide displayed by the 2'-deoxycytidine analogues solves, in the DNA single-lane chemical sequencing procedure, the possible source of errors due to low discrimination between C and T residues.

DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

PubMed Central

Palzkill, T G; Oliver, S G; Newlon, C S

1986-01-01

Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Direct Detection and Sequencing of Damaged DNA Bases

PubMed Central

2011-01-01

Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597

Direct detection and sequencing of damaged DNA bases.

PubMed

Clark, Tyson A; Spittle, Kristi E; Turner, Stephen W; Korlach, Jonas

2011-12-20

Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications.

Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage

PubMed Central

Black, Paul J.; Miller, Adam S.; Hayes, Jeffrey J.

2016-01-01

Purpose As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. Materials and methods To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. Results We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines, and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. Conclusions These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation. PMID:27349757

Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

PubMed Central

Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

2003-01-01

Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase alpha 3 subunit gene are required for brain expression in transgenic mice.

PubMed Central

Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B

1994-01-01

The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427

Enhanced Detection of Antigen-Specific CD4+ T Cells Using Altered Peptide Flanking Residue Peptide–MHC Class II Multimers

PubMed Central

Holland, Christopher J.; Dolton, Garry; Scurr, Martin; Ladell, Kristin; Schauenburg, Andrea J.; Miners, Kelly; Madura, Florian; Sewell, Andrew K.; Price, David A.

2015-01-01

Fluorochrome-conjugated peptide–MHC (pMHC) class I multimers are staple components of the immunologist’s toolbox, enabling reliable quantification and analysis of Ag-specific CD8+ T cells irrespective of functional outputs. In contrast, widespread use of the equivalent pMHC class II (pMHC-II) reagents has been hindered by intrinsically weaker TCR affinities for pMHC-II, a lack of cooperative binding between the TCR and CD4 coreceptor, and a low frequency of Ag-specific CD4+ T cell populations in the peripheral blood. In this study, we show that peptide flanking regions, extending beyond the central nonamer core of MHC-II–bound peptides, can enhance TCR–pMHC-II binding and T cell activation without loss of specificity. Consistent with these findings, pMHC-II multimers incorporating peptide flanking residue modifications proved superior for the ex vivo detection, characterization, and manipulation of Ag-specific CD4+ T cells, highlighting an unappreciated feature of TCR–pMHC-II interactions. PMID:26553072

Silicene nanoribbon as a new DNA sequencing device

NASA Astrophysics Data System (ADS)

Alesheikh, Sara; Shahtahmassebi, Nasser; Roknabadi, Mahmood Rezaee; Pilevar Shahri, Raheleh

2018-02-01

The importance of applying DNA sequencing in different fields, results in looking for fast and cheap methods. Nanotechnology helps this development by introducing nanostructures used for DNA sequencing. In this work we study the interaction between zigzag silicene nanoribbon and DNA nucleobases using DFT and non equilibrium Green's function approach, to investigate the possibility of using zigzag silicene nanoribbons as a biosensor for DNA sequencing.

A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

PubMed

Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

1996-08-01

DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

The sequence of sequencers: The history of sequencing DNA

PubMed Central

Heather, James M.; Chain, Benjamin

2016-01-01

Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. PMID:26554401

Compressing DNA sequence databases with coil

PubMed Central

White, W Timothy J; Hendy, Michael D

2008-01-01

Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip) compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST) data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work. PMID:18489794

DNA Sequencing by Capillary Electrophoresis

PubMed Central

Karger, Barry L.; Guttman, Andras

2009-01-01

Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

PubMed

Burger, C; Fanning, E

1983-04-15

Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

The sequence of sequencers: The history of sequencing DNA.

PubMed

Heather, James M; Chain, Benjamin

2016-01-01

Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

The Dynamics of DNA Sequencing.

ERIC Educational Resources Information Center

Morvillo, Nancy

1997-01-01

Describes a paper-and-pencil activity that helps students understand DNA sequencing and expands student understanding of DNA structure, replication, and gel electrophoresis. Appropriate for advanced biology students who are familiar with the Sanger method. (DDR)

Toward rules relating zinc finger protein sequences and DNA binding site preferences.

PubMed

Desjarlais, J R; Berg, J M

1992-08-15

Zinc finger proteins of the Cys2-His2 type consist of tandem arrays of domains, where each domain appears to contact three adjacent base pairs of DNA through three key residues. We have designed and prepared a series of variants of the central zinc finger within the DNA binding domain of Sp1 by using information from an analysis of a large data base of zinc finger protein sequences. Through systematic variations at two of the three contact positions (underlined), relatively specific recognition of sequences of the form 5'-GGGGN(G or T)GGG-3' has been achieved. These results provide the basis for rules that may develop into a code that will allow the design of zinc finger proteins with preselected DNA site specificity.

On site DNA barcoding by nanopore sequencing

PubMed Central

Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo

2017-01-01

Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016

Sequence-selective DNA cleavage by a chimeric metallopeptide.

PubMed

Kovacic, Roger T; Welch, Joel T; Franklin, Sonya J

2003-06-04

A chimeric metallopeptide derived from the sequences of two structurally superimposable motifs was designed as an artificial nuclease. Both DNA recognition and nuclease activity have been incorporated into a small peptide sequence. P3W, a 33-mer peptide comprising helices alpha2 and alpha3 from the engrailed homeodomain and the consensus EF-hand Ca-binding loop binds one equivalent of lanthanides or calcium and folds upon metal binding. The conditional formation constants (in the presence of 50 mM Tris) of P3W for Eu(III) (K(a) = (2.1 +/- 0.1) x 10(5) M(-1)) and Ce(IV) (K(a) = (2.6 +/- 0.1) x 10(5) M(-1)) are typical of isolated EF-hand peptides. Circular dichroism studies show that 1:1 CeP3W is 26% alpha-helical and EuP3W is up to 40% alpha-helical in the presence of excess metal. The predicted helicity of the folded peptide based on helix length and end effects is about 50%, showing the metallopeptides are significantly folded. EuP3W has considerably more secondary structure than our previously reported chimeras (Welch, J. T.; Sirish, M.; Lindstrom, K. M.; Franklin, S. J. Inorg. Chem. 2001, 40, 1982-1984). Eu(III)P3W and Ce(IV)P3W nick supercoiled DNA at pH 6.9, although EuP3W is more active at pH 8. CeP3W cleaves linearized, duplex DNA as well as supercoiled plasmid. The cleavage of a 5'-(32)P-labeled 121-mer DNA fragment was followed by polyacrylamide gel electrophoresis. The cleavage products are 3'-OPO(3) termini exclusively, suggesting a regioselective or multistep mechanism. In contrast, uncomplexed Ce(IV) and Eu(III) ions produce both 3'-OPO(3) and 3'-OH, and no evidence of 4'-oxidative cleavage termini with either metal. The complementary 3'-(32)P-labeled oligonucleotide experiment also showed both 5'-OPO(3) and 5'-OH termini were produced by the free ions, whereas CeP3W produces only 5'-OPO(3) termini. In addition to apparent regioselectivity, the metallopeptides cut DNA with modest sequence discrimination, which suggests that the HTH motif binds DNA as

Winnowing DNA for Rare Sequences: Highly Specific Sequence and Methylation Based Enrichment

PubMed Central

Thompson, Jason D.; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue. PMID:22355378

Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

PubMed

Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

Highly multiplexed targeted DNA sequencing from single nuclei.

PubMed

Leung, Marco L; Wang, Yong; Kim, Charissa; Gao, Ruli; Jiang, Jerry; Sei, Emi; Navin, Nicholas E

2016-02-01

Single-cell DNA sequencing methods are challenged by poor physical coverage, high technical error rates and low throughput. To address these issues, we developed a single-cell DNA sequencing protocol that combines flow-sorting of single nuclei, time-limited multiple-displacement amplification (MDA), low-input library preparation, DNA barcoding, targeted capture and next-generation sequencing (NGS). This approach represents a major improvement over our previous single nucleus sequencing (SNS) Nature Protocols paper in terms of generating higher-coverage data (>90%), thereby enabling the detection of genome-wide variants in single mammalian cells at base-pair resolution. Furthermore, by pooling 48-96 single-cell libraries together for targeted capture, this approach can be used to sequence many single-cell libraries in parallel in a single reaction. This protocol greatly reduces the cost of single-cell DNA sequencing, and it can be completed in 5-6 d by advanced users. This single-cell DNA sequencing protocol has broad applications for studying rare cells and complex populations in diverse fields of biological research and medicine.

Rényi continuous entropy of DNA sequences.

PubMed

Vinga, Susana; Almeida, Jonas S

2004-12-07

Entropy measures of DNA sequences estimate their randomness or, inversely, their repeatability. L-block Shannon discrete entropy accounts for the empirical distribution of all length-L words and has convergence problems for finite sequences. A new entropy measure that extends Shannon's formalism is proposed. Renyi's quadratic entropy calculated with Parzen window density estimation method applied to CGR/USM continuous maps of DNA sequences constitute a novel technique to evaluate sequence global randomness without some of the former method drawbacks. The asymptotic behaviour of this new measure was analytically deduced and the calculation of entropies for several synthetic and experimental biological sequences was performed. The results obtained were compared with the distributions of the null model of randomness obtained by simulation. The biological sequences have shown a different p-value according to the kernel resolution of Parzen's method, which might indicate an unknown level of organization of their patterns. This new technique can be very useful in the study of DNA sequence complexity and provide additional tools for DNA entropy estimation. The main MATLAB applications developed and additional material are available at the webpage . Specialized functions can be obtained from the authors.

Identification of an inducible regulator of c-myb expression during T-cell activation.

PubMed Central

Phan, S C; Feeley, B; Withers, D; Boxer, L M

1996-01-01

Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306

Analysis of JC virus DNA replication using a quantitative and high-throughput assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Jong; Phelan, Paul J.; Chhum, Panharith

2014-11-15

Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCVmore » DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication.« less

Ancient DNA sequence revealed by error-correcting codes.

PubMed

Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

2015-07-10

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

Ancient DNA sequence revealed by error-correcting codes

PubMed Central

Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

2015-01-01

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

DNA Sequencing Using capillary Electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dr. Barry Karger

2011-05-09

The overall goal of this program was to develop capillary electrophoresis as the tool to be used to sequence for the first time the Human Genome. Our program was part of the Human Genome Project. In this work, we were highly successful and the replaceable polymer we developed, linear polyacrylamide, was used by the DOE sequencing lab in California to sequence a significant portion of the human genome using the MegaBase multiple capillary array electrophoresis instrument. In this final report, we summarize our efforts and success. We began our work by separating by capillary electrophoresis double strand oligonucleotides using cross-linkedmore » polyacrylamide gels in fused silica capillaries. This work showed the potential of the methodology. However, preparation of such cross-linked gel capillaries was difficult with poor reproducibility, and even more important, the columns were not very stable. We improved stability by using non-cross linked linear polyacrylamide. Here, the entangled linear chains could move when osmotic pressure (e.g. sample injection) was imposed on the polymer matrix. This relaxation of the polymer dissipated the stress in the column. Our next advance was to use significantly lower concentrations of the linear polyacrylamide that the polymer could be automatically blown out after each run and replaced with fresh linear polymer solution. In this way, a new column was available for each analytical run. Finally, while testing many linear polymers, we selected linear polyacrylamide as the best matrix as it was the most hydrophilic polymer available. Under our DOE program, we demonstrated initially the success of the linear polyacrylamide to separate double strand DNA. We note that the method is used even today to assay purity of double stranded DNA fragments. Our focus, of course, was on the separation of single stranded DNA for sequencing purposes. In one paper, we demonstrated the success of our approach in sequencing up to 500 bases. Other

PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities

PubMed Central

2011-01-01

Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/. PMID:21385349

PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities.

PubMed

Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J

2011-03-07

Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

Entropic fluctuations in DNA sequences

NASA Astrophysics Data System (ADS)

Thanos, Dimitrios; Li, Wentian; Provata, Astero

2018-03-01

The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.

Nanopore Kinetic Proofreading of DNA Sequences

NASA Astrophysics Data System (ADS)

Ling, Xinsheng Sean

The concept of DNA sequencing using the time dependence of the nanopore ionic current was proposed in 1996 by Kasianowicz, Brandin, Branton, and Deamer (KBBD). The KBBD concept has generated tremendous amount interests in recent decade. In this talk, I will review the current understanding of the DNA ``translocation'' dynamics and how it can be described by Schrodinger's 1915 paper on first-passage-time distribution function. Schrodinger's distribution function can be used to give a rigorous criterion for achieving nanopore DNA sequencing which turns out to be identical to that of gel electrophoresis used by Sanger in the first-generation Sanger method. A nanopore DNA sequencing technology also requires discrimination of bases with high accuracies. I will describe a solid-state nanopore sandwich structure that can function as a proofreading device capable of discriminating between correct and incorrect hybridization probes with an accuracy rivaling that of high-fidelity DNA polymerases. The latest results from Nanjing will be presented. This work is supported by China 1000-Talent Program at Southeast University, Nanjing, China.

DNA Replication Profiling Using Deep Sequencing.

PubMed

Saayman, Xanita; Ramos-Pérez, Cristina; Brown, Grant W

2018-01-01

Profiling of DNA replication during progression through S phase allows a quantitative snap-shot of replication origin usage and DNA replication fork progression. We present a method for using deep sequencing data to profile DNA replication in S. cerevisiae.

Sequences with high propensity to form G-quartet structures in kinetoplast DNA from Phytomonas serpens.

PubMed

Sá-Carvalho, D; Traub-Cseko, Y M

1995-06-01

Naturally occurring sequences containing repetitive guanine motifs have the potential to form tetraplex DNA. Phytomonas serpens minicircle DNA shows some regions where one strand is composed mainly of G and T (GT regions). These regions contain several stretches of contiguous guanines. An oligonucleotide was constructed with the sequence corresponding to one of these regions (Phyto-GT). It was demonstrated by native gel electrophoresis and methylation protection that Phyto-GT forms tetramolecular (G4), bimolecular (G'2) and unimolecular (G4') structures stabilized through G-quartets. Tetraplex DNA formation by this sequence could have biological relevance as it can be formed in physiological conditions and GT regions comprise approximately one-third of P. serpens and Crithidia oncopelti minicircles.

Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

PubMed

Gupta, P D

2016-10-01

In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

PubMed

Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

2015-01-01

It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software

Phylogenetic relationships within Chamaecrista sect. Xerocalyx (Leguminosae, Caesalpinioideae) inferred from the cpDNA trnE-trnT intergenic spacer and nrDNA ITS sequences

PubMed Central

Torres, Davi Coe; Lima, João Paulo Matos Santos; Fernandes, Afrânio Gomes; Nunes, Edson Paula; Grangeiro, Thalles Barbosa

2011-01-01

Chamaecrista belongs to subtribe Cassiinae (Caesalpinioideae), and it comprises over 330 species, divided into six sections. The section Xerocalyx has been subjected to a profound taxonomic shuffling over the years. Therefore, we conducted a phylogenetic analysis using a cpDNA trnE-trnT intergenic spacer and nrDNA ITS/5.8S sequences from Cassiinae taxa, in an attempt to elucidate the relationships within this section from Chamaecrista. The tree topology was congruent between the two data sets studied in which the monophyly of the genus Chamaecrista was strongly supported. Our analyses reinforce that new sectional boundaries must be defined in the Chamaecrista genus, especially the inclusion of sections Caliciopsis and Xerocalyx in sect. Chamaecrista, considered here paraphyletic. The section Xerocalyx was strongly supported as monophyletic; however, the current data did not show C. ramosa (microphyllous) and C. desvauxii (macrophyllous) and their respective varieties in distinct clades, suggesting that speciation events are still ongoing in these specimens. PMID:21734825

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Sequence analysis of Leukemia DNA

NASA Astrophysics Data System (ADS)

Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

2018-03-01

Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

Polymerase ribozyme efficiency increased by G/T-rich DNA oligonucleotides

PubMed Central

Yao, Chengguo; Müller, Ulrich F.

2011-01-01

The RNA world hypothesis states that the early evolution of life went through a stage where RNA served as genome and as catalyst. The replication of RNA world organisms would have been facilitated by ribozymes that catalyze RNA polymerization. To recapitulate an RNA world in the laboratory, a series of RNA polymerase ribozymes was developed previously. However, these ribozymes have a polymerization efficiency that is too low for self-replication, and the most efficient ribozymes prefer one specific template sequence. The limiting factor for polymerization efficiency is the weak sequence-independent binding to its primer/template substrate. Most of the known polymerase ribozymes bind an RNA heptanucleotide to form the P2 duplex on the ribozyme. By modifying this heptanucleotide, we were able to significantly increase polymerization efficiency. Truncations at the 3′-terminus of this heptanucleotide increased full-length primer extension by 10-fold, on a specific template sequence. In contrast, polymerization on several different template sequences was improved dramatically by replacing the RNA heptanucleotide with DNA oligomers containing randomized sequences of 15 nt. The presence of G and T in the random sequences was sufficient for this effect, with an optimal composition of 60% G and 40% T. Our results indicate that these DNA sequences function by establishing many weak and nonspecific base-pairing interactions to the single-stranded portion of the template. Such low-specificity interactions could have had important functions in an RNA world. PMID:21622900

Hiding message into DNA sequence through DNA coding and chaotic maps.

PubMed

Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

2014-09-01

The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

PubMed

Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

2012-07-01

Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

Transposition-mediated DNA re-replication in maize

PubMed Central

Zhang, Jianbo; Zuo, Tao; Wang, Dafang; Peterson, Thomas

2014-01-01

Every DNA segment in a eukaryotic genome normally replicates once and only once per cell cycle to maintain genome stability. We show here that this restriction can be bypassed through alternative transposition, a transposition reaction that utilizes the termini of two separate, nearby transposable elements (TEs). Our results suggest that alternative transposition during S phase can induce re-replication of the TEs and their flanking sequences. The DNA re-replication can spontaneously abort to generate double-strand breaks, which can be repaired to generate Composite Insertions composed of transposon termini flanking segmental duplications of various lengths. These results show how alternative transposition coupled with DNA replication and repair can significantly alter genome structure and may have contributed to rapid genome evolution in maize and possibly other eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.03724.001 PMID:25406063

Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

PubMed Central

Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

2004-01-01

An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

Adenine specific DNA chemical sequencing reaction.

PubMed Central

Iverson, B L; Dervan, P B

1987-01-01

Reaction of DNA with K2PdCl4 at pH 2.0 followed by a piperidine workup produces specific cleavage at adenine (A) residues. Product analysis revealed the K2PdCl4 reaction involves selective depurination at adenine, affording an excision reaction analogous to the other chemical DNA sequencing reactions. Adenine residues methylated at the exocyclic amine (N6) react with lower efficiency than unmethylated adenine in an identical sequence. This simple protocol specific for A may be a useful addition to current chemical sequencing reactions. Images PMID:3671067

Multiple tag labeling method for DNA sequencing

DOEpatents

Mathies, R.A.; Huang, X.C.; Quesada, M.A.

1995-07-25

A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

Multiple tag labeling method for DNA sequencing

DOEpatents

Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.

1995-01-01

A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

Detection of DNA Methylation by Whole-Genome Bisulfite Sequencing.

PubMed

Li, Qing; Hermanson, Peter J; Springer, Nathan M

2018-01-01

DNA methylation plays an important role in the regulation of the expression of transposons and genes. Various methods have been developed to assay DNA methylation levels. Bisulfite sequencing is considered to be the "gold standard" for single-base resolution measurement of DNA methylation levels. Coupled with next-generation sequencing, whole-genome bisulfite sequencing (WGBS) allows DNA methylation to be evaluated at a genome-wide scale. Here, we described a protocol for WGBS in plant species with large genomes. This protocol has been successfully applied to assay genome-wide DNA methylation levels in maize and barley. This protocol has also been successfully coupled with sequence capture technology to assay DNA methylation levels in a targeted set of genomic regions.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

PubMed

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

Sequence-Dependent Persistence Length of Long DNA

NASA Astrophysics Data System (ADS)

Chuang, Hui-Min; Reifenberger, Jeffrey G.; Cao, Han; Dorfman, Kevin D.

2017-12-01

Using a high-throughput genome-mapping approach, we obtained circa 50 million measurements of the extension of internal human DNA segments in a 41 nm ×41 nm nanochannel. The underlying DNA sequences, obtained by mapping to the reference human genome, are 2.5-393 kilobase pairs long and contain percent GC contents between 32.5% and 60%. Using Odijk's theory for a channel-confined wormlike chain, these data reveal that the DNA persistence length increases by almost 20% as the percent GC content increases. The increased persistence length is rationalized by a model, containing no adjustable parameters, that treats the DNA as a statistical terpolymer with a sequence-dependent intrinsic persistence length and a sequence-independent electrostatic persistence length.

Dynamics and control of DNA sequence amplification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marimuthu, Karthikeyan; Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu; Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054

2014-10-28

DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reactionmore » are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.« less

Genome-wide evidence for local DNA methylation spreading from small RNA-targeted sequences in Arabidopsis.

PubMed

Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi

2011-09-01

Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Case study: using a nondestructive DNA extraction method to generate mtDNA sequences from historical chimpanzee specimens.

PubMed

Mohandesan, Elmira; Prost, Stefan; Hofreiter, Michael

2012-01-01

A major challenge for ancient DNA (aDNA) studies using museum specimens is that sampling procedures usually involve at least the partial destruction of each specimen used, such as the removal of skin, pieces of bone, or a tooth. Recently, a nondestructive DNA extraction method was developed for the extraction of amplifiable DNA fragments from museum specimens without appreciable damage to the specimen. Here, we examine the utility of this method by attempting DNA extractions from historic (older than 70 years) chimpanzee specimens. Using this method, we PCR-amplified part of the mitochondrial HVR-I region from 65% (56/86) of the specimens from which we attempted DNA extraction. However, we found a high incidence of multiple sequences in individual samples, suggesting substantial cross-contamination among samples, most likely originating from storage and handling in the museums. Consequently, reproducible sequences could be reconstructed from only 79% (44/56) of the successfully extracted samples, even after multiple extractions and amplifications. This resulted in an overall success rate of just over half (44/86 of samples, or 51% success), from which 39 distinct HVR-I haplotypes were recovered. We found a high incidence of C to T changes, arguing for both low concentrations of and substantial damage to the endogenous DNA. This chapter highlights both the potential and the limitations of nondestructive DNA extraction from museum specimens.

Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Whale phylogeny and rapid radiation events revealed using novel retroposed elements and their flanking sequences.

PubMed

Chen, Zhuo; Xu, Shixia; Zhou, Kaiya; Yang, Guang

2011-10-27

A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future.

Whale phylogeny and rapid radiation events revealed using novel retroposed elements and their flanking sequences

PubMed Central

2011-01-01

Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic

Googling DNA sequences on the World Wide Web.

PubMed

Hajibabaei, Mehrdad; Singer, Gregory A C

2009-11-10

New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.

Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

PubMed Central

Clary, D O; Wolstenholme, D R

1983-01-01

Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

PubMed

Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

2018-04-11

Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions

T-DNA transfer and T-DNA integration efficiencies upon Arabidopsis thaliana root explant cocultivation and floral dip transformation.

PubMed

Ghedira, Rim; De Buck, Sylvie; Van Ex, Frédéric; Angenon, Geert; Depicker, Ann

2013-12-01

T-DNA transfer and integration frequencies during Agrobacterium-mediated root explant cocultivation and floral dip transformations of Arabidopsis thaliana were analyzed with and without selection for transformation-competent cells. Based on the presence or absence of CRE recombinase activity without or with the CRE T-DNA being integrated, transient expression versus stable transformation was differentiated. During root explant cocultivation, continuous light enhanced the number of plant cells competent for interaction with Agrobacterium and thus the number of transient gene expression events. However, in transformation competent plant cells, continuous light did not further enhance cotransfer or cointegration frequencies. Upon selection for root transformants expressing a first T-DNA, 43-69 % of these transformants showed cotransfer of another non-selected T-DNA in two different light regimes. However, integration of the non-selected cotransferred T-DNA occurred only in 19-46 % of these transformants, indicating that T-DNA integration in regenerating root cells limits the transformation frequencies. After floral dip transformation, transient T-DNA expression without integration could not be detected, while stable T-DNA transformation occurred in 0.5-1.3 % of the T1 seedlings. Upon selection for floral dip transformants with a first T-DNA, 8-34 % of the transformants showed cotransfer of the other non-selected T-DNA and in 93-100 % of them, the T-DNA was also integrated. Therefore, a productive interaction between the agrobacteria and the female gametophyte, rather than the T-DNA integration process, restricts the floral dip transformation frequencies.

Laser Desorption Mass Spectrometry for DNA Sequencing and Analysis

NASA Astrophysics Data System (ADS)

Chen, C. H. Winston; Taranenko, N. I.; Golovlev, V. V.; Isola, N. R.; Allman, S. L.

1998-03-01

Rapid DNA sequencing and/or analysis is critically important for biomedical research. In the past, gel electrophoresis has been the primary tool to achieve DNA analysis and sequencing. However, gel electrophoresis is a time-consuming and labor-extensive process. Recently, we have developed and used laser desorption mass spectrometry (LDMS) to achieve sequencing of ss-DNA longer than 100 nucleotides. With LDMS, we succeeded in sequencing DNA in seconds instead of hours or days required by gel electrophoresis. In addition to sequencing, we also applied LDMS for the detection of DNA probes for hybridization LDMS was also used to detect short tandem repeats for forensic applications. Clinical applications for disease diagnosis such as cystic fibrosis caused by base deletion and point mutation have also been demonstrated. Experimental details will be presented in the meeting. abstract.

T.C.G triplet in an antiparallel purine.purine.pyrimidine DNA triplex. Conformational studies by NMR.

PubMed

Dittrich, K; Gu, J; Tinder, R; Hogan, M; Gao, X

1994-04-12

The antiparallel purine.purine.pyrimidine DNA triplex, RRY6, which contains a T.C.G inverted triplet in the center of the sequence, was examined by proton and phosphorous two-dimensional NMR spectroscopy. The local conformation of the T.C.G triplet (T4.C11.G18) and the effect of this triplet on the global helical structure were analyzed in detail. The formation of the T.C.G triplet is confirmed by a set of cross-strand NOEs, including unusual cross-strand NOEs between the third strand and the pyrimidine strand as opposed to the purine strand of the duplex. NMR data suggest that the T.C.G triplet may be present in an equilibrium between a non-hydrogen-bonded form and a T(O4)-C(NH2) hydrogen-bonded form and that there is a distortion of the in-plane alignment of the three bases. The flanking G.G.C base triplets are well-defined on the 5'-side of T4, but somewhat interrupted on the 3'-side of T4. The effect of the third strand binding on the Watson-Crick duplex was probed by an NMR study of the free duplex RY6. NMR parameters are affected mostly around the T.C.G inversion site. The perturbations extend to at least two adjacent base triplets on either side. The binding of the third purine strand and the accommodation of a central T.C.G inversion in RRY6 does not require a readjustment in sugar pucker, which remains in the range of C2'-endo. 31P resonances of RRY6 distribute over a range of 2.2 ppm. The H-P coupling patterns of the third strand differ from those of the duplex. General spectral patterns defined by the marker protons of the RRY and YRY triplexes are compared.

Multiplexed Sequence Encoding: A Framework for DNA Communication

PubMed Central

Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

Multiplexed Sequence Encoding: A Framework for DNA Communication.

PubMed

Zakeri, Bijan; Carr, Peter A; Lu, Timothy K

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.

DNA sequence analysis with droplet-based microfluidics

PubMed Central

Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

2014-01-01

Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402

An evolution based biosensor receptor DNA sequence generation algorithm.

PubMed

Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

2010-01-01

A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.

PubMed

Goris, Johan; Konstantinidis, Konstantinos T; Klappenbach, Joel A; Coenye, Tom; Vandamme, Peter; Tiedje, James M

2007-01-01

DNA-DNA hybridization (DDH) values have been used by bacterial taxonomists since the 1960s to determine relatedness between strains and are still the most important criterion in the delineation of bacterial species. Since the extent of hybridization between a pair of strains is ultimately governed by their respective genomic sequences, we examined the quantitative relationship between DDH values and genome sequence-derived parameters, such as the average nucleotide identity (ANI) of common genes and the percentage of conserved DNA. A total of 124 DDH values were determined for 28 strains for which genome sequences were available. The strains belong to six important and diverse groups of bacteria for which the intra-group 16S rRNA gene sequence identity was greater than 94 %. The results revealed a close relationship between DDH values and ANI and between DNA-DNA hybridization and the percentage of conserved DNA for each pair of strains. The recommended cut-off point of 70 % DDH for species delineation corresponded to 95 % ANI and 69 % conserved DNA. When the analysis was restricted to the protein-coding portion of the genome, 70 % DDH corresponded to 85 % conserved genes for a pair of strains. These results reveal extensive gene diversity within the current concept of "species". Examination of reciprocal values indicated that the level of experimental error associated with the DDH method is too high to reveal the subtle differences in genome size among the strains sampled. It is concluded that ANI can accurately replace DDH values for strains for which genome sequences are available.

Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

PubMed

Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

2004-06-01

Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

PubMed

Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

2008-06-15

A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

Human Chromosome 7: DNA Sequence and Biology

PubMed Central

Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.; Fernandez, Bridget A.; Kanematsu, Emiko; Gentles, Simone; Christopoulos, Constantine C.; Choufani, Sanaa; Kwasnicka, Dorota; Zheng, Xiangqun H.; Lai, Zhongwu; Nusskern, Deborah; Zhang, Qing; Gu, Zhiping; Lu, Fu; Zeesman, Susan; Nowaczyk, Malgorzata J.; Teshima, Ikuko; Chitayat, David; Shuman, Cheryl; Weksberg, Rosanna; Zackai, Elaine H.; Grebe, Theresa A.; Cox, Sarah R.; Kirkpatrick, Susan J.; Rahman, Nazneen; Friedman, Jan M.; Heng, Henry H. Q.; Pelicci, Pier Giuseppe; Lo-Coco, Francesco; Belloni, Elena; Shaffer, Lisa G.; Pober, Barbara; Morton, Cynthia C.; Gusella, James F.; Bruns, Gail A. P.; Korf, Bruce R.; Quade, Bradley J.; Ligon, Azra H.; Ferguson, Heather; Higgins, Anne W.; Leach, Natalia T.; Herrick, Steven R.; Lemyre, Emmanuelle; Farra, Chantal G.; Kim, Hyung-Goo; Summers, Anne M.; Gripp, Karen W.; Roberts, Wendy; Szatmari, Peter; Winsor, Elizabeth J. T.; Grzeschik, Karl-Heinz; Teebi, Ahmed; Minassian, Berge A.; Kere, Juha; Armengol, Lluis; Pujana, Miguel Angel; Estivill, Xavier; Wilson, Michael D.; Koop, Ben F.; Tosi, Sabrina; Moore, Gudrun E.; Boright, Andrew P.; Zlotorynski, Eitan; Kerem, Batsheva; Kroisel, Peter M.; Petek, Erwin; Oscier, David G.; Mould, Sarah J.; Döhner, Hartmut; Döhner, Konstanze; Rommens, Johanna M.; Vincent, John B.; Venter, J. Craig; Li, Peter W.; Mural, Richard J.; Adams, Mark D.; Tsui, Lap-Chee

2010-01-01

DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate genes for developmental diseases including autism. PMID:12690205

Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

PubMed Central

Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

2014-01-01

Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

1992-01-01

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

1992-05-12

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

DNA Shape Dominates Sequence Affinity in Nucleosome Formation

NASA Astrophysics Data System (ADS)

Freeman, Gordon S.; Lequieu, Joshua P.; Hinckley, Daniel M.; Whitmer, Jonathan K.; de Pablo, Juan J.

2014-10-01

Nucleosomes provide the basic unit of compaction in eukaryotic genomes, and the mechanisms that dictate their position at specific locations along a DNA sequence are of central importance to genetics. In this Letter, we employ molecular models of DNA and proteins to elucidate various aspects of nucleosome positioning. In particular, we show how DNA's histone affinity is encoded in its sequence-dependent shape, including subtle deviations from the ideal straight B-DNA form and local variations of minor groove width. By relying on high-precision simulations of the free energy of nucleosome complexes, we also demonstrate that, depending on DNA's intrinsic curvature, histone binding can be dominated by bending interactions or electrostatic interactions. More generally, the results presented here explain how sequence, manifested as the shape of the DNA molecule, dominates molecular recognition in the problem of nucleosome positioning.

j5 DNA assembly design automation.

PubMed

Hillson, Nathan J

2014-01-01

Modern standardized methodologies, described in detail in the previous chapters of this book, have enabled the software-automated design of optimized DNA construction protocols. This chapter describes how to design (combinatorial) scar-less DNA assembly protocols using the web-based software j5. j5 assists biomedical and biotechnological researchers construct DNA by automating the design of optimized protocols for flanking homology sequence as well as type IIS endonuclease-mediated DNA assembly methodologies. Unlike any other software tool available today, j5 designs scar-less combinatorial DNA assembly protocols, performs a cost-benefit analysis to identify which portions of an assembly process would be less expensive to outsource to a DNA synthesis service provider, and designs hierarchical DNA assembly strategies to mitigate anticipated poor assembly junction sequence performance. Software integrated with j5 add significant value to the j5 design process through graphical user-interface enhancement and downstream liquid-handling robotic laboratory automation.

Short, interspersed, and repetitive DNA sequences in Spiroplasma species.

PubMed

Nur, I; LeBlanc, D J; Tully, J G

1987-03-01

Small fragments of DNA from an 8-kbp plasmid, pRA1, from a plant pathogenic strain of Spiroplasma citri were shown previously to be present in the chromosomal DNA of at least two species of Spiroplasma. We describe here the shot-gun cloning of chromosomal DNA from S. citri Maroc and the identification of two distinct sequences exhibiting homology to pRA1. Further subcloning experiments provided specific molecular probes for the identification of these two sequences in chromosomal DNA from three distinct plant pathogenic species of Spiroplasma. The results of Southern blot hybridization indicated that each of the pRA1-associated sequences is present as multiple copies in short, dispersed, and repetitive sequences in the chromosomes of these three strains. None of the sequences was detectable in chromosomal DNA from an additional nine Spiroplasma strains examined.

An extended sequence specificity for UV-induced DNA damage.

PubMed

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

PubMed Central

Arthur, A K; Höss, A; Fanning, E

1988-01-01

The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

Nanopore-CMOS Interfaces for DNA Sequencing

PubMed Central

Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim

2016-01-01

DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces. PMID:27509529

Nanopore-CMOS Interfaces for DNA Sequencing.

PubMed

Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim

2016-08-06

DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces.

Real-Time DNA Sequencing in the Antarctic Dry Valleys Using the Oxford Nanopore Sequencer

PubMed Central

Johnson, Sarah S.; Zaikova, Elena; Goerlitz, David S.; Bai, Yu; Tighe, Scott W.

2017-01-01

The ability to sequence DNA outside of the laboratory setting has enabled novel research questions to be addressed in the field in diverse areas, ranging from environmental microbiology to viral epidemics. Here, we demonstrate the application of offline DNA sequencing of environmental samples using a hand-held nanopore sequencer in a remote field location: the McMurdo Dry Valleys, Antarctica. Sequencing was performed using a MK1B MinION sequencer from Oxford Nanopore Technologies (ONT; Oxford, United Kingdom) that was equipped with software to operate without internet connectivity. One-direction (1D) genomic libraries were prepared using portable field techniques on DNA isolated from desiccated microbial mats. By adequately insulating the sequencer and laptop, it was possible to run the sequencing protocol for up to 2½ h under arduous conditions. PMID:28337073

Sequencing of adenine in DNA by scanning tunneling microscopy

NASA Astrophysics Data System (ADS)

Tanaka, Hiroyuki; Taniguchi, Masateru

2017-08-01

The development of DNA sequencing technology utilizing the detection of a tunnel current is important for next-generation sequencer technologies based on single-molecule analysis technology. Using a scanning tunneling microscope, we previously reported that dI/dV measurements and dI/dV mapping revealed that the guanine base (purine base) of DNA adsorbed onto the Cu(111) surface has a characteristic peak at V s = -1.6 V. If, in addition to guanine, the other purine base of DNA, namely, adenine, can be distinguished, then by reading all the purine bases of each single strand of a DNA double helix, the entire base sequence of the original double helix can be determined due to the complementarity of the DNA base pair. Therefore, the ability to read adenine is important from the viewpoint of sequencing. Here, we report on the identification of adenine by STM topographic and spectroscopic measurements using a synthetic DNA oligomer and viral DNA.

The Value of DNA Sequencing - TCGA

Cancer.gov

DNA sequencing: what it tells us about DNA changes in cancer, how looking across many tumors will help to identify meaningful changes and potential drug targets, and how genomics is changing the way we think about cancer.

Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

NASA Astrophysics Data System (ADS)

Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Chung, C. N.; Allman, S. L.

1997-05-01

Since laser mass spectrometry has the potential for achieving very fast DNA analysis, we recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Sanger's enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. Our preliminary results indicate laser mass spectrometry can possible be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, we applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

PubMed Central

Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

1996-01-01

Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

Chiral Differentiation of DNA Adducts Formed by Enantiomeric Analogues of Antitumor Cisplatin Is Sequence-Dependent

PubMed Central

Delalande, Olivier; Malina, Jaroslav; Brabec, Viktor; Kozelka, Jiří

2005-01-01

1,2-GG intrastrand cross-links formed in DNA by the enantiomeric complexes [PtCl2(R,R-2,3-diaminobutane (DAB))] and [PtCl2(S,S-DAB)] were studied by biophysical methods. Molecular modeling revealed that structure of the cross-links formed at the TGGT sequence was affected by repulsion between the 5′-directed methyl group of the DAB ligand and the methyl group of the 5′-thymine of the TGGT fragment. Molecular dynamics simulations of the solvated platinated duplexes and our recent structural data indicated that the adduct of [PtCl2(R,R-DAB)] alleviated this repulsion by unwinding the TpG step, whereas the adduct of [PtCl2(S,S-DAB)] avoided the unfavorable methyl-methyl interaction by decreasing the kink angle. Electrophoretic retardation measurements on DNA duplexes containing 1,2-GG intrastrand cross-links of Pt(R,R-DAB)2+ or Pt(S,S-DAB)2+ at a CGGA site showed that in this sequence both enantiomers distorted the double helix to the identical extent similar to that found previously for the same sequence containing the cross-links of the parent antitumor \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} \\begin{equation*}cis-{\\mathrm{Pt}}({\\mathrm{NH}}_{3})_{2}^{2+}\\end{equation*}\\end{document} (cisplatin). In addition, the adducts showed similar affinities toward the high-mobility-group box 1 proteins. Hence, whereas the structural perturbation induced in DNA by 1,2-GG intrastrand cross-links of cisplatin does not depend largely on the bases flanking the cross-links, the perturbation related to GG cross-linking by bulkier platinum diamine derivatives does. PMID:15805172

Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

PubMed

Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

2018-06-27

Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

Apparatus for improved DNA sequencing

DOEpatents

Douthart, R.J.; Crowell, S.L.

1996-05-07

This invention is a means for the rapid sequencing of DNA samples. More specifically, it consists of a new design direct blotting electrophoresis unit. The DNA sequence is deposited on a membrane attached to a rotating drum. Initial data compaction is facilitated by the use of a machined multi-channeled plate called a ribbon channel plate. Each channel is an isolated mini gel system much like a gel filled capillary. The system as a whole, however, is in a slab gel like format with the advantages of uniformity and easy reusability. The system can be used in different embodiments. The drum system is unique in that after deposition the drum rotates the deposited DNA into a large non-buffer open space where processing and detection can occur. The drum can also be removed in toto to special workstations for downstream processing, multiplexing and detection. 18 figs.

Apparatus for improved DNA sequencing

DOEpatents

Douthart, Richard J.; Crowell, Shannon L.

1996-01-01

This invention is a means for the rapid sequencing of DNA samples. More specifically, it consists of a new design direct blotting electrophoresis unit. The DNA sequence is deposited on a membrane attached to a rotating drum. Initial data compaction is facilitated by the use of a machined multi-channeled plate called a ribbon channel plate. Each channel is an isolated mini gel system much like a gel filled capillary. The system as a whole, however, is in a slab gel like format with the advantages of uniformity and easy reusability. The system can be used in different embodiments. The drum system is unique in that after deposition the drum rotates the deposited DNA into a large non-buffer open space where processing and detection can occur. The drum can also be removed in toto to special workstations for downstream processing, multiplexing and detection.

The number of reduced alignments between two DNA sequences

PubMed Central

2014-01-01

Background In this study we consider DNA sequences as mathematical strings. Total and reduced alignments between two DNA sequences have been considered in the literature to measure their similarity. Results for explicit representations of some alignments have been already obtained. Results We present exact, explicit and computable formulas for the number of different possible alignments between two DNA sequences and a new formula for a class of reduced alignments. Conclusions A unified approach for a wide class of alignments between two DNA sequences has been provided. The formula is computable and, if complemented by software development, will provide a deeper insight into the theory of sequence alignment and give rise to new comparison methods. AMS Subject Classification Primary 92B05, 33C20, secondary 39A14, 65Q30 PMID:24684679

Biomolecule Sequencer: Next-Generation DNA Sequencing Technology for In-Flight Environmental Monitoring, Research, and Beyond

NASA Technical Reports Server (NTRS)

Smith, David J.; Burton, Aaron; Castro-Wallace, Sarah; John, Kristen; Stahl, Sarah E.; Dworkin, Jason Peter; Lupisella, Mark L.

2016-01-01

On the International Space Station (ISS), technologies capable of rapid microbial identification and disease diagnostics are not currently available. NASA still relies upon sample return for comprehensive, molecular-based sample characterization. Next-generation DNA sequencing is a powerful approach for identifying microorganisms in air, water, and surfaces onboard spacecraft. The Biomolecule Sequencer payload, manifested to SpaceX-9 and scheduled on the Increment 4748 research plan (June 2016), will assess the functionality of a commercially-available next-generation DNA sequencer in the microgravity environment of ISS. The MinION device from Oxford Nanopore Technologies (Oxford, UK) measures picoamp changes in electrical current dependent on nucleotide sequences of the DNA strand migrating through nanopores in the system. The hardware is exceptionally small (9.5 x 3.2 x 1.6 cm), lightweight (120 grams), and powered only by a USB connection. For the ISS technology demonstration, the Biomolecule Sequencer will be powered by a Microsoft Surface Pro3. Ground-prepared samples containing lambda bacteriophage, Escherichia coli, and mouse genomic DNA, will be launched and stored frozen on the ISS until experiment initiation. Immediately prior to sequencing, a crew member will collect and thaw frozen DNA samples, connect the sequencer to the Surface Pro3, inject thawed samples into a MinION flow cell, and initiate sequencing. At the completion of the sequencing run, data will be downlinked for ground analysis. Identical, synchronous ground controls will be used for data comparisons to determine sequencer functionality, run-time sequence, current dynamics, and overall accuracy. We will present our latest results from the ISS flight experiment the first time DNA has ever been sequenced in space and discuss the many potential applications of the Biomolecule Sequencer for environmental monitoring, medical diagnostics, higher fidelity and more adaptable Space Biology Human

Complete mitochondrial DNA sequence of a tadpole shrimp (Triops cancriformis) and analysis of museum samples.

PubMed

Umetsu, Kazuo; Iwabuchi, Naruki; Yuasa, Isao; Saitou, Naruya; Clark, Paul F; Boxshall, Geoff; Osawa, Motoki; Igarashi, Keiji

2002-12-01

The complete mitochondrial DNA (mtNDA) of the tadpole shrimp Triops cancriformis was sequenced. The sequence consisted of 15,101 bp with an A+T content of 69%. Its gene arrangement was identical with those sequences of the water flea (Daphnia pulex) and giant tiger prawn (Penaeus monodon), whereas it differed from that of the brine shrimp (Artemia franciscana) in the arrangement of its genes for tRNAs. Phylogenetic analysis revealed T. cancriformis to be more closely related to the water flea than to the brine shrimp and giant tiger prawn. We also compared the 16S rRNA sequences of five formalin-fixed tadpole shrimps that had been collected in five different locations and stored in a museum. The sequence divergence was in the range of 0-1.51%, suggesting that those samples were closely related to each other.

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.

PubMed

Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G

2010-06-01

The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

Integrated DNA walking system to characterize a broad spectrum of GMOs in food/feed matrices.

PubMed

Fraiture, Marie-Alice; Herman, Philippe; Lefèvre, Loic; Taverniers, Isabel; De Loose, Marc; Deforce, Dieter; Roosens, Nancy H

2015-08-14

In order to provide a system fully integrated with qPCR screening, usually used in GMO routine analysis, as well as being able to detect, characterize and identify a broad spectrum of GMOs in food/feed matrices, two bidirectional DNA walking methods targeting p35S or tNOS, the most common transgenic elements found in GM crops, were developed. These newly developed DNA walking methods are completing the previously implemented DNA walking method targeting the t35S pCAMBIA element. Food/feed matrices containing transgenic crops (Bt rice or MON863 maize) were analysed using the integrated DNA walking system. First, the newly developed DNA walking methods, anchored on the sequences used for the p35S or tNOS qPCR screening, were tested on Bt rice that contains these two transgenic elements. Second, the methods were assessed on a maize sample containing a low amount of the GM MON863 event, representing a more complex matrix in terms of genome size and sensitivity. Finally, to illustrate its applicability in GMO routine analysis by enforcement laboratories, the entire workflow of the integrated strategy, including qPCR screening to detect the potential presence of GMOs and the subsequent DNA walking methods to characterize and identify the detected GMOs, was applied on a GeMMA Scheme Proficiency Test matrix. Via the characterization of the transgene flanking region between the transgenic cassette and the plant genome as well as of a part of the transgenic cassette, the presence of GMOs was properly confirmed or infirmed in all tested samples. Due to their simple procedure and their short time-frame to get results, the developed DNA walking methods proposed here can be easily implemented in GMO routine analysis by the enforcement laboratories. In providing crucial information about the transgene flanking regions and/or the transgenic cassettes, this DNA walking strategy is a key molecular tool to prove the presence of GMOs in any given food/feed matrix.

Pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis in a child with 711+G>T/IVS8-5T mutation: a new face of an old disease.

PubMed

Tinsa, Faten; Hadj Fredj, Sondes; Bel Hadj, Imen; Khalsi, Fatma; Abdelhak, Sonia; Boussetta, Khadija; Messaoud, Taieb

2017-08-01

Pseudo-Bartter syndrome (PBS) describes an uncommon complication of cystic fibrosis leading to hypochloraemic, hypokalaemic metabolic alkalosis. PBS as the sole manifestation of cystic fibrosis in children is extremely rare and has never been described in patients carrying 5T variant. We report a clinical, biochemical and genetic study of a four year-old boy presenting a pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis. All 27 exons and the flanking intron regions of the CFTR gene were analysed by PCR and direct sequencing. Direct sequencing was also used to analyse TG m T n and M470V polymorphisms in the patient and his parents. Two sweat tests were abnormal with elevated chloride levels at 78 and 88 mmol/L. DNA sequencing revealed a heterozygous mutation 711+1 G>T and an IVS8-T5 allele. The mutation 711+1 G>T is in trans with the IVS8-T5-TG11 allele and the child carried M470/V470 genotype. To the best of our knowledge, the genotype 711+1 G>T /IVS8-5T found in our patient is described for the first time. The role of TG11-5T-V470 allele in cases of cystic fibrosis with PB syndrome remains to be determined.

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Mitochondrial DNA sequence data reveals association of haplogroup U with psychosis in bipolar disorder.

PubMed

Frye, Mark A; Ryu, Euijung; Nassan, Malik; Jenkins, Gregory D; Andreazza, Ana C; Evans, Jared M; McElroy, Susan L; Oglesbee, Devin; Highsmith, W Edward; Biernacka, Joanna M

2017-01-01

Converging genetic, postmortem gene-expression, cellular, and neuroimaging data implicate mitochondrial dysfunction in bipolar disorder. This study was conducted to investigate whether mitochondrial DNA (mtDNA) haplogroups and single nucleotide variants (SNVs) are associated with sub-phenotypes of bipolar disorder. MtDNA from 224 patients with Bipolar I disorder (BPI) was sequenced, and association of sequence variations with 3 sub-phenotypes (psychosis, rapid cycling, and adolescent illness onset) was evaluated. Gene-level tests were performed to evaluate overall burden of minor alleles for each phenotype. The haplogroup U was associated with a higher risk of psychosis. Secondary analyses of SNVs provided nominal evidence for association of psychosis with variants in the tRNA, ND4 and ND5 genes. The association of psychosis with ND4 (gene that encodes NADH dehydrogenase 4) was further supported by gene-level analysis. Preliminary analysis of mtDNA sequence data suggests a higher risk of psychosis with the U haplogroup and variation in the ND4 gene implicated in electron transport chain energy regulation. Further investigation of the functional consequences of this mtDNA variation is encouraged. Copyright © 2016. Published by Elsevier Ltd.

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

The interaction of polyglutamine peptides with lipid membranes is regulated by flanking sequences associated with huntingtin.

PubMed

Burke, Kathleen A; Kauffman, Karlina J; Umbaugh, C Samuel; Frey, Shelli L; Legleiter, Justin

2013-05-24

Huntington disease (HD) is caused by an expanded polyglutamine (poly(Q)) repeat near the N terminus of the huntingtin (htt) protein. Expanded poly(Q) facilitates formation of htt aggregates, eventually leading to deposition of cytoplasmic and intranuclear inclusion bodies containing htt. Flanking sequences directly adjacent to the poly(Q) domain, such as the first 17 amino acids on the N terminus (Nt17) and the polyproline (poly(P)) domain on the C-terminal side of the poly(Q) domain, heavily influence aggregation. Additionally, htt interacts with a variety of membraneous structures within the cell, and Nt17 is implicated in lipid binding. To investigate the interaction between htt exon1 and lipid membranes, a combination of in situ atomic force microscopy, Langmuir trough techniques, and vesicle permeability assays were used to directly monitor the interaction of a variety of synthetic poly(Q) peptides with different combinations of flanking sequences (KK-Q35-KK, KK-Q35-P10-KK, Nt17-Q35-KK, and Nt17-Q35-P10-KK) on model membranes and surfaces. Each peptide aggregated on mica, predominately forming extended, fibrillar aggregates. In contrast, poly(Q) peptides that lacked the Nt17 domain did not appreciably aggregate on or insert into lipid membranes. Nt17 facilitated the interaction of peptides with lipid surfaces, whereas the poly(P) region enhanced this interaction. The aggregation of Nt17-Q35-P10-KK on the lipid bilayer closely resembled that of a htt exon1 construct containing 35 repeat glutamines. Collectively, this data suggests that the Nt17 domain plays a critical role in htt binding and aggregation on lipid membranes, and this lipid/htt interaction can be further modulated by the presence of the poly(P) domain.

Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

PubMed

Feng, X; Happ, G M

1996-11-14

The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

Widespread recombination in published animal mtDNA sequences.

PubMed

Tsaousis, A D; Martin, D P; Ladoukakis, E D; Posada, D; Zouros, E

2005-04-01

Mitochondrial DNA (mtDNA) recombination has been observed in several animal species, but there are doubts as to whether it is common or only occurs under special circumstances. Animal mtDNA sequences retrieved from public databases were unambiguously aligned and rigorously tested for evidence of recombination. At least 30 recombination events were detected among 186 alignments examined. Recombinant sequences were found in invertebrates and vertebrates, including primates. It appears that mtDNA recombination may occur regularly in the animal cell but rarely produces new haplotypes because of homoplasmy. Common animal mtDNA recombination would necessitate a reexamination of phylogenetic and biohistorical inference based on the assumption of clonal mtDNA transmission. Recombination may also have an important role in producing and purging mtDNA mutations and thus in mtDNA-based diseases and senescence.

Reconstruction of DNA sequences using genetic algorithms and cellular automata: towards mutation prediction?

PubMed

Mizas, Ch; Sirakoulis, G Ch; Mardiris, V; Karafyllidis, I; Glykos, N; Sandaltzopoulos, R

2008-04-01

Change of DNA sequence that fuels evolution is, to a certain extent, a deterministic process because mutagenesis does not occur in an absolutely random manner. So far, it has not been possible to decipher the rules that govern DNA sequence evolution due to the extreme complexity of the entire process. In our attempt to approach this issue we focus solely on the mechanisms of mutagenesis and deliberately disregard the role of natural selection. Hence, in this analysis, evolution refers to the accumulation of genetic alterations that originate from mutations and are transmitted through generations without being subjected to natural selection. We have developed a software tool that allows modelling of a DNA sequence as a one-dimensional cellular automaton (CA) with four states per cell which correspond to the four DNA bases, i.e. A, C, T and G. The four states are represented by numbers of the quaternary number system. Moreover, we have developed genetic algorithms (GAs) in order to determine the rules of CA evolution that simulate the DNA evolution process. Linear evolution rules were considered and square matrices were used to represent them. If DNA sequences of different evolution steps are available, our approach allows the determination of the underlying evolution rule(s). Conversely, once the evolution rules are deciphered, our tool may reconstruct the DNA sequence in any previous evolution step for which the exact sequence information was unknown. The developed tool may be used to test various parameters that could influence evolution. We describe a paradigm relying on the assumption that mutagenesis is governed by a near-neighbour-dependent mechanism. Based on the satisfactory performance of our system in the deliberately simplified example, we propose that our approach could offer a starting point for future attempts to understand the mechanisms that govern evolution. The developed software is open-source and has a user-friendly graphical input interface.

Fluorogenic DNA Sequencing in PDMS Microreactors

PubMed Central

Sims, Peter A.; Greenleaf, William J.; Duan, Haifeng; Xie, X. Sunney

2012-01-01

We have developed a multiplex sequencing-by-synthesis method combining terminal-phosphate labeled fluorogenic nucleotides (TPLFNs) and resealable microreactors. In the presence of phosphatase, the incorporation of a non-fluorescent TPLFN into a DNA primer by DNA polymerase results in a fluorophore. We immobilize DNA templates within polydimethylsiloxane (PDMS) microreactors, sequentially introduce one of the four identically labeled TPLFNs, seal the microreactors, allow template-directed TPLFN incorporation, and measure the signal from the fluorophores trapped in the microreactors. This workflow allows sequencing in a manner akin to pyrosequencing but without constant monitoring of each microreactor. With cycle times of <10 minutes, we demonstrate 30 base reads with ∼99% raw accuracy. “Fluorogenic pyrosequencing” combines benefits of pyrosequencing, such as rapid turn-around, native DNA generation, and single-color detection, with benefits of fluorescence-based approaches, such as highly sensitive detection and simple parallelization. PMID:21666670

Long-range correlations and charge transport properties of DNA sequences

NASA Astrophysics Data System (ADS)

Liu, Xiao-liang; Ren, Yi; Xie, Qiong-tao; Deng, Chao-sheng; Xu, Hui

2010-04-01

By using Hurst's analysis and transfer approach, the rescaled range functions and Hurst exponents of human chromosome 22 and enterobacteria phage lambda DNA sequences are investigated and the transmission coefficients, Landauer resistances and Lyapunov coefficients of finite segments based on above genomic DNA sequences are calculated. In a comparison with quasiperiodic and random artificial DNA sequences, we find that λ-DNA exhibits anticorrelation behavior characterized by a Hurst exponent 0.5sequence displays a transition from correlation behavior to anticorrelation behavior. The resonant peaks of the transmission coefficient in genomic sequences can survive in longer sequence length than in random sequences but in shorter sequence length than in quasiperiodic sequences. It is shown that the genomic sequences have long-range correlation properties to some extent but the correlations are not strong enough to maintain the scale invariance properties.

Local alignment of two-base encoded DNA sequence

PubMed Central

Homer, Nils; Merriman, Barry; Nelson, Stanley F

2009-01-01

Background DNA sequence comparison is based on optimal local alignment of two sequences using a similarity score. However, some new DNA sequencing technologies do not directly measure the base sequence, but rather an encoded form, such as the two-base encoding considered here. In order to compare such data to a reference sequence, the data must be decoded into sequence. The decoding is deterministic, but the possibility of measurement errors requires searching among all possible error modes and resulting alignments to achieve an optimal balance of fewer errors versus greater sequence similarity. Results We present an extension of the standard dynamic programming method for local alignment, which simultaneously decodes the data and performs the alignment, maximizing a similarity score based on a weighted combination of errors and edits, and allowing an affine gap penalty. We also present simulations that demonstrate the performance characteristics of our two base encoded alignment method and contrast those with standard DNA sequence alignment under the same conditions. Conclusion The new local alignment algorithm for two-base encoded data has substantial power to properly detect and correct measurement errors while identifying underlying sequence variants, and facilitating genome re-sequencing efforts based on this form of sequence data. PMID:19508732

Functional classification of rice flanking sequence tagged genes using MapMan terms and global understanding on metabolic and regulatory pathways affected by dxr mutant having defects in light response.

PubMed

Chandran, Anil Kumar Nalini; Lee, Gang-Seob; Yoo, Yo-Han; Yoon, Ung-Han; Ahn, Byung-Ohg; Yun, Doh-Won; Kim, Jin-Hyun; Choi, Hong-Kyu; An, GynHeung; Kim, Tae-Ho; Jung, Ki-Hong

2016-12-01

Rice is one of the most important food crops for humans. To improve the agronomical traits of rice, the functions of more than 1,000 rice genes have been recently characterized and summarized. The completed, map-based sequence of the rice genome has significantly accelerated the functional characterization of rice genes, but progress remains limited in assigning functions to all predicted non-transposable element (non-TE) genes, estimated to number 37,000-41,000. The International Rice Functional Genomics Consortium (IRFGC) has generated a huge number of gene-indexed mutants by using mutagens such as T-DNA, Tos17 and Ds/dSpm. These mutants have been identified by 246,566 flanking sequence tags (FSTs) and cover 65 % (25,275 of 38,869) of the non-TE genes in rice, while the mutation ratio of TE genes is 25.7 %. In addition, almost 80 % of highly expressed non-TE genes have insertion mutations, indicating that highly expressed genes in rice chromosomes are more likely to have mutations by mutagens such as T-DNA, Ds, dSpm and Tos17. The functions of around 2.5 % of rice genes have been characterized, and studies have mainly focused on transcriptional and post-transcriptional regulation. Slow progress in characterizing the function of rice genes is mainly due to a lack of clues to guide functional studies or functional redundancy. These limitations can be partially solved by a well-categorized functional classification of FST genes. To create this classification, we used the diverse overviews installed in the MapMan toolkit. Gene Ontology (GO) assignment to FST genes supplemented the limitation of MapMan overviews. The functions of 863 of 1,022 known genes can be evaluated by current FST lines, indicating that FST genes are useful resources for functional genomic studies. We assigned 16,169 out of 29,624 FST genes to 34 MapMan classes, including major three categories such as DNA, RNA and protein. To demonstrate the MapMan application on FST genes, transcriptome

Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

Advances in high throughput DNA sequence data compression.

PubMed

Sardaraz, Muhammad; Tahir, Muhammad; Ikram, Ataul Aziz

2016-06-01

Advances in high throughput sequencing technologies and reduction in cost of sequencing have led to exponential growth in high throughput DNA sequence data. This growth has posed challenges such as storage, retrieval, and transmission of sequencing data. Data compression is used to cope with these challenges. Various methods have been developed to compress genomic and sequencing data. In this article, we present a comprehensive review of compression methods for genome and reads compression. Algorithms are categorized as referential or reference free. Experimental results and comparative analysis of various methods for data compression are presented. Finally, key challenges and research directions in DNA sequence data compression are highlighted.

Flank pain

MedlinePlus

Pain - side; Side pain ... Flank pain can be a sign of a kidney problem. But, since many organs are in this area, other causes are possible. If you have flank pain and fever , chills, blood in the urine, or ...

Sequencing intractable DNA to close microbial genomes.

PubMed

Hurt, Richard A; Brown, Steven D; Podar, Mircea; Palumbo, Anthony V; Elias, Dwayne A

2012-01-01

Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

PubMed

Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

2001-08-01

Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the

Crystal structure of the Msx-1 homeodomain/DNA complex.

PubMed

Hovde, S; Abate-Shen, C; Geiger, J H

2001-10-09

The Msx-1 homeodomain protein plays a crucial role in craniofacial, limb, and nervous system development. Homeodomain DNA-binding domains are comprised of 60 amino acids that show a high degree of evolutionary conservation. We have determined the structure of the Msx-1 homeodomain complexed to DNA at 2.2 A resolution. The structure has an unusually well-ordered N-terminal arm with a unique trajectory across the minor groove of the DNA. DNA specificity conferred by bases flanking the core TAAT sequence is explained by well ordered water-mediated interactions at Q50. Most interactions seen at the TAAT sequence are typical of the interactions seen in other homeodomain structures. Comparison of the Msx-1-HD structure to all other high resolution HD-DNA complex structures indicate a remarkably well-conserved sphere of hydration between the DNA and protein in these complexes.

SNP discovery through de novo deep sequencing using the next generation of DNA sequencers

USDA-ARS?s Scientific Manuscript database

The production of high volumes of DNA sequence data using new technologies has permitted more efficient identification of single nucleotide polymorphisms in vertebrate genomes. This chapter presented practical methodology for production and analysis of DNA sequence data for SNP discovery....

Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA

PubMed Central

Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev

2012-01-01

B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Target sites for the transposition of rat long interspersed repeated DNA elements (LINEs) are not random.

PubMed Central

Furano, A V; Somerville, C C; Tsichlis, P N; D'Ambrosio, E

1986-01-01

The long interspersed repeated DNA family of rats (LINE or L1Rn family) contains about 40,000 6.7-kilobase (kb) long members (1). LINE members may be currently mobile since their presence or absence causes allelic variation at three single copy loci (2, 3): insulin 1, Moloney leukemia virus integration 2 (Mlvi-2) (4), and immunoglobulin heavy chain (Igh). To characterize target sites for LINE insertion, we compared the DNA sequences of the unoccupied Mlvi-2 target site, its LINE-containing allele, and several other LINE-containing sites. Although not homologous overall, the target sites share three characteristics: First, depending on the site, they are from 68% to 86% (A+T) compared to 58% (A+T) for total rat DNA (5). Depending on the site, a 7- to 15-bp target site sequence becomes duplicated and flanks the inserted LINE member. The second is a version (0 or 1 mismatch) of the hexanucleotide, TACTCA, which is also present in the LINE member, in a highly conserved region located just before the A-rich right end of the LINE member. The third is a stretch of alternating purine/pyrimidine (PQ). The A-rich right ends of different LINE members vary in length and composition, and the sequence of a particularly long one suggests that it contains the A-rich target site from a previous transposition. PMID:3012480

Recent patents of nanopore DNA sequencing technology: progress and challenges.

PubMed

Zhou, Jianfeng; Xu, Bingqian

2010-11-01

DNA sequencing techniques witnessed fast development in the last decades, primarily driven by the Human Genome Project. Among the proposed new techniques, Nanopore was considered as a suitable candidate for the single DNA sequencing with ultrahigh speed and very low cost. Several fabrication and modification techniques have been developed to produce robust and well-defined nanopore devices. Many efforts have also been done to apply nanopore to analyze the properties of DNA molecules. By comparing with traditional sequencing techniques, nanopore has demonstrated its distinctive superiorities in main practical issues, such as sample preparation, sequencing speed, cost-effective and read-length. Although challenges still remain, recent researches in improving the capabilities of nanopore have shed a light to achieve its ultimate goal: Sequence individual DNA strand at single nucleotide level. This patent review briefly highlights recent developments and technological achievements for DNA analysis and sequencing at single molecule level, focusing on nanopore based methods.

The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

PubMed Central

Allison, J; Hall, L; MacIntyre, I; Craig, R K

1981-01-01

(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

Statistical and linguistic features of DNA sequences

NASA Technical Reports Server (NTRS)

Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

Marker-Dependent Recombination in T4 Bacteriophage. IV. Recombinational Effects of Antimutator T4 DNA Polymerase

PubMed Central

Shcherbakov, V. P.; Plugina, L. A.; Kudryashova, E. A.

1995-01-01

Recombinational effects of the antimutator allele tsL42 of gene 43 of phage T4, encoding DNA polymerase, were studied in crosses between rIIB mutants. Recombination under tsL42-restricted conditions differed from the normal one in several respects: (1) basic recombination was enhanced, especially within very short distances; (2) mismatch repair tracts were shortened, while the contribution of mismatch repair to recombination was not changed; (3) marker interference at very short distances was augmented. We infer that the T4 DNA polymerase is directly involved in mismatch repair, performing both excision of a nonmatched single strand (by its 3' -> 5' exonuclease) and filling the resulting gap. A pathway for the mismatch repair was substantiated; it includes sequential action of endo VII (gp49) -> 3'->5' exonuclease (gp43) -> DNA polymerase (gp43) -> DNA ligase (gp30). It is argued that the marker interference at very short distances may result from the same sequence of events during the final processing of recombinational intermediates. PMID:7635281

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Complete mitochondrial DNA sequence of the Eastern keelback mullet Liza affinis.

PubMed

Gong, Xiaoling; Zhu, Wenjia; Bao, Baolong

2016-05-01

Eastern keelback mullet (Liza affinis) inhabits inlet waters and estuaries of rivers. In this paper, we initially determined the complete mitochondrial genome of Liza affinis. The entire mtDNA sequence is 16,831 bp in length, including 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes and 1 putative control region. Its order and numbers of genes are similar to most bony fishes.

Cladistic biogeography of Juglans (Juglandaceae) based on chloroplast DNA intergenic spacer sequences

USDA-ARS?s Scientific Manuscript database

The phylogenetic utility of sequence variation from five chloroplast DNA intergenic spacer (IGS) regions: trnT-trnF, psbA-trnH, atpB-rbcL, trnV-16S rRNA, and trnS-trnfM was examined in the genus Juglans. A total of seventeen taxa representing the four sections within Juglans and an outgroup taxon, ...

Assessing the Fidelity of Ancient DNA Sequences Amplified From Nuclear Genes

PubMed Central

Binladen, Jonas; Wiuf, Carsten; Gilbert, M. Thomas P.; Bunce, Michael; Barnett, Ross; Larson, Greger; Greenwood, Alex D.; Haile, James; Ho, Simon Y. W.; Hansen, Anders J.; Willerslev, Eske

2006-01-01

To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from environments ranging from permafrost to desert, we demonstrate the presence of miscoding lesion damage in both the mtDNA and nuDNA, resulting in insertion of erroneous bases during amplification. Interestingly, no significant differences in the frequency of miscoding lesion damage are recorded between mtDNA and nuDNA despite great differences in cellular copy numbers. For both mtDNA and nuDNA, we find significant positive correlations between total sequence heterogeneity and the rates of type 1 transitions (adenine → guanine and thymine → cytosine) and type 2 transitions (cytosine → thymine and guanine → adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nuDNA sequences. We argue that the problems presented by postmortem damage, as well as problems with contamination from exogenous sources of conserved nuclear genes, allelic variation, and the reliance on single nucleotide polymorphisms, call for great caution in studies relying on ancient nuDNA sequences. PMID:16299392

An Optimal Seed Based Compression Algorithm for DNA Sequences

PubMed Central

Gopalakrishnan, Gopakumar; Karunakaran, Muralikrishnan

2016-01-01

This paper proposes a seed based lossless compression algorithm to compress a DNA sequence which uses a substitution method that is similar to the LempelZiv compression scheme. The proposed method exploits the repetition structures that are inherent in DNA sequences by creating an offline dictionary which contains all such repeats along with the details of mismatches. By ensuring that only promising mismatches are allowed, the method achieves a compression ratio that is at par or better than the existing lossless DNA sequence compression algorithms. PMID:27555868

Novel numerical and graphical representation of DNA sequences and proteins.

PubMed

Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

2006-12-01

We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

A DNA sequence analysis package for the IBM personal computer.

PubMed Central

Lagrimini, L M; Brentano, S T; Donelson, J E

1984-01-01

We present here a collection of DNA sequence analysis programs, called "PC Sequence" (PCS), which are designed to run on the IBM Personal Computer (PC). These programs are written in IBM PC compiled BASIC and take full advantage of the IBM PC's speed, error handling, and graphics capabilities. For a modest initial expense in hardware any laboratory can use these programs to quickly perform computer analysis on DNA sequences. They are written with the novice user in mind and require very little training or previous experience with computers. Also provided are a text editing program for creating and modifying DNA sequence files and a communications program which enables the PC to communicate with and collect information from mainframe computers and DNA sequence databases. PMID:6546433

Brain Connectivity as a DNA Sequencing Problem

NASA Astrophysics Data System (ADS)

Zador, Anthony

The mammalian cortex consists of millions or billions of neurons, each connected to thousands of other neurons. Traditional methods for determining the brain connectivity rely on microscopy to visualize neuronal connections, but such methods are slow, labor-intensive and often lack single neuron resolution. We have recently developed a new method, MAPseq, to recast the determination of brain wiring into a form that can exploit the tremendous recent advances in high-throughput DNA sequencing. DNA sequencing technology has outpaced even Moore's law, so that the cost of sequencing the human genome has dropped from a billion dollars in 2001 to below a thousand dollars today. MAPseq works by introducing random sequences of DNA-``barcodes''-to tag neurons uniquely. With MAPseq, we can determine the connectivity of over 50K single neurons in a single mouse cortex in about a week, an unprecedented throughput, ushering in the era of ``big data'' for brain wiring. We are now developing analytical tools and algorithms to make sense of these novel data sets.

The complete DNA sequence of lymphocystis disease virus.

PubMed

Tidona, C A; Darai, G

1997-04-14

Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, which has been reported to occur in over 100 different fish species worldwide. LCDV is a member of the family Iridoviridae and the type species of the genus Lymphocystivirus. The virions contain a single linear double-stranded DNA molecule, which is circularly permuted, terminally redundant, and heavily methylated at cytosines in CpG sequences. The complete nucleotide sequence of LCDV-1 (flounder isolate) was determined by automated cycle sequencing and primer walking. The genome of LCDV-1 is 102.653 bp in length and contains 195 open reading frames with coding capacities ranging from 40 to 1199 amino acids. Computer-assisted analyses of the deduced amino acid sequences led to the identification of several putative gene products with significant homologies to entries in protein data banks, such as the two major subunits of the viral DNA-dependent RNA polymerase, DNA polymerase, several protein kinases, two subunits of the ribonucleoside diphosphate reductase, DNA methyltransferase, the viral major capsid protein, insulin-like growth factor, and tumor necrosis factor receptor homolog.

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

PubMed

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis

PubMed Central

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611

Clones from a shooty tobacco crown gall tumor I: deletions, rearrangements and amplifications resulting in irregular T-DNA structures and organizations.

PubMed

Peerbolte, R; Leenhouts, K; Hooykaas-van Slogteren, G M; Hoge, J H; Wullems, G J; Schilperoort, R A

1986-07-01

Transformed clones from a shooty tobacco crown gall tumor, induced byAgrobacterium tumefaciens strain LBA1501, having a Tn1831 insertion in the auxin locus, were investigated for their T-DNA structure and expression. In addition to clones with the expected phenotype, i.e. phytohormone autonomy, regeneration of non-rooting shoots and octopine synthesis (Aut(+)Reg(+)Ocs(+) 'type I' clones), clones were obtained with an aberrant phenotype. Among these were the Aut(-)Reg(-)Ocs(+) 'type II' clones. Two shooty type I clones and three type II callus clones (all randomly chosen) as well as a rooting shoot regenerated from a type II clone via a high kinetin treatment, all had a T-DNA structure which differed significantly from 'regular' T-DNA structures. No Tn1831 DNA sequences were detected in these clones. The two type I clones were identical: they both contained the same highly truncated T-DNA segments. One TL-DNA segment of approximately 0.7 kb, originating form the left part of the TL-region, was present at one copy per diploid tobacco genome. Another segment with a maximum size of about 7 kb was derived from the right hand part of the TL-region and was present at minimally two copies. Three copies of a truncated TR-DNA segment were detected, probably starting at the right TR-DNA border repeat and ending halfway the regular TR-region. Indications have been obtained that at least some of the T-DNA segments are closely linked, sometimes via intervening plant DNA sequences. The type I clones harbored TL-DNA transcripts 4, 6a/b and 3 as well as TR-DNA transcript 0'. The type II clones harbored three to six highly truncated T-DNA segments, originating from the right part of the TL-region. In addition they had TR-DNA segments, similar to those of the type I clones. On Northern blots TR-DNA transcripts 0' and 1' were detected as well as the TL-DNA transcripts 3 and 6a/b and an 1800 bp hybrid transcript (tr.Y) containing gene 6b sequences. Possible origins of the observed

Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

PubMed Central

Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

1993-01-01

The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.