CD4+ T-Cell-Independent Secondary Immune Responses to Pneumocystis Pneumonia
de la Rua, Nicholas M.; Samuelson, Derrick R.; Charles, Tysheena P.; Welsh, David A.; Shellito, Judd E.
2016-01-01
Pneumocystis pneumonia is a major cause of morbidity and mortality among immunocompromised patients, especially in the context of HIV/AIDS. In the murine model of Pneumocystis pneumonia, CD4+ T-cells are required for clearance of a primary infection of Pneumocystis, but not the memory recall response. We hypothesized that the memory recall response in the absence of CD4+ T-cells is mediated by a robust memory humoral response, CD8+ T-cells, and IgG-mediated phagocytosis by alveolar macrophages. To investigate the role of CD8+ T-cells and alveolar macrophages in the immune memory response to Pneumocystis, mice previously challenged with Pneumocystis were depleted of CD8+ T-cells or alveolar macrophages prior to re-infection. Mice depleted of CD4+ T-cells prior to secondary challenge cleared Pneumocystis infection within 48 h identical to immunocompetent mice during a secondary memory recall response. However, loss of CD8+ T-cells or macrophages prior to the memory recall response significantly impaired Pneumocystis clearance. Specifically, mice depleted of CD8+ T-cells or alveolar macrophages had significantly higher fungal burden in the lungs. Furthermore, loss of alveolar macrophages significantly skewed the lung CD8+ T-cell response toward a terminally differentiated effector memory population and increased the percentage of IFN-γ+ CD8+ T-cells. Finally, Pneumocystis-infected animals produced significantly more bone marrow plasma cells and Pneumocystis-specific IgG significantly increased macrophage-mediated killing of Pneumocystis in vitro. These data suggest that secondary immune memory responses to Pneumocystis are mediated, in part, by CD8+ T-cells, alveolar macrophages, and the production of Pneumocystis-specific IgG. PMID:27242785
Balázs, Mercedesz; Martin, Flavius; Zhou, Tong; Kearney, John
2002-09-01
Marginal zone (MZ) and B1 B lymphocytes participate jointly in the early immune response against T-independent (TI) particulate antigens. Here we show that blood-derived neutrophil granulocytes and CD11c(lo) immature dendritic cells (DC) are the primary cells that efficiently capture and transport particulate bacteria to the spleen. In a systemic infection, CD11c(lo) DC, but not neutrophils, provide critical survival signals, which can be inhibited by TACI-Fc, to antigen-specific MZ B cells and promote their differentiation into IgM-secreting plasmablasts. In a local TI response, peritoneal cavity macrophages provide similar support to B1 B-derived Ag-specific blasts. In the absence of soluble TACI ligands, Ag-activated MZ- and B1-derived blasts lack survival signals and undergo apoptosis, resulting in severely impaired antibody responses.
Sa, Qila; Woodward, Jerold; Suzuki, Yasuhiro
2013-01-01
Chronic infection with Toxoplasma gondii induces a potent resistance against re-infection, and IFN-γ production by CD8+ T cells is crucial for the protective immunity. However, the molecular mechanisms that regulate the secondary response remain to be elucidated. In the present study, we examined the role of IL-2 in IFN-γ production by CD8+ immune T cells in their secondary responses using T. gondii-specific CD8+ T cell hybridomas and splenic CD8+ immune T cells from chronically infected mice. The majority (92 %) of CD8+ T cell hybridomas produced large amounts of IFN-γ only when a low amount (0.5 ng/ml) of exogenous IL-2 was provided in combination with T. gondii antigens. Inhibition of cell proliferation by mitomycin C (MMC) did not affect the enhancing effect of IL-2 on the IFN-γ production, and significant increases in transcription factor T-bet expression were associated with the IL-2-mediated IFN-γ amplification. Splenic CD8+ immune T cells produced similar low levels of IL-2 in the secondary response to T. gondii, and a blocking of IL-2 signaling by anti-IL-2Rα antibody or inhibitors of JAK1 and JAK3 significantly reduced IFN-γ production of the T cells. This IL-2-mediated upregulation of IFN-γ production was observed in MMC-treated CD8+ immune T cells, thus independent from their cell division. Therefore, endogenous IL-2 produced by CD8+ immune T cells can play an important autocrine enhancing role on their IFN-γ production in the secondary responses to T. gondii, suggesting an importance of induction of CD8+ immune T cells with an appropriate IL-2 production for vaccine development. PMID:23359502
B Cell-Intrinsic IDO1 Regulates Humoral Immunity to T Cell-Independent Antigens.
Shinde, Rahul; Shimoda, Michiko; Chaudhary, Kapil; Liu, Haiyun; Mohamed, Eslam; Bradley, Jillian; Kandala, Sridhar; Li, Xia; Liu, Kebin; McGaha, Tracy L
2015-09-01
Humoral responses to nonproteinaceous Ags (i.e., T cell independent [TI]) are a key component of the early response to bacterial and viral infection and a critical driver of systemic autoimmunity. However, mechanisms that regulate TI humoral immunity are poorly defined. In this study, we report that B cell-intrinsic induction of the tryptophan-catabolizing enzyme IDO1 is a key mechanism limiting TI Ab responses. When Ido1(-/-) mice were immunized with TI Ags, there was a significant increase in Ab titers and formation of extrafollicular Ab-secreting cells compared with controls. This effect was specific to TI Ags, as Ido1 disruption did not affect Ig production after immunization with protein Ags. The effect of IDO1 abrogation was confined to the B cell compartment, as adoptive transfer of Ido1(-/-) B cells to B cell-deficient mice was sufficient to replicate increased TI responses observed in Ido1(-/-) mice. Moreover, in vitro activation with TLR ligands or BCR crosslinking rapidly induced Ido1 expression and activity in purified B cells, and Ido1(-/-) B cells displayed enhanced proliferation and cell survival associated with increased Ig and cytokine production compared with wild-type B cells. Thus, our results demonstrate a novel, B cell-intrinsic, role for IDO1 as a regulator of humoral immunity that has implications for both vaccine design and prevention of autoimmunity. Copyright © 2015 by The American Association of Immunologists, Inc.
[T-lymphocytes--do they control rheumatic immune responses?].
Wagner, U; Schulze-Koops, H
2005-09-01
T cells, in particular CD4(+) T cells, have been implicated in mediating many aspects of rheumatoid inflammation. In rheumatoid arthritis (RA), CD4(+) T cells display various functional abnormalities in the synovium as well as in the peripheral circulation. Current evidence suggests, however, that the role of CD4(+) T cells in the development of rheumatoid inflammation exceeds that of activated pro-inflammatory effector T cells that drive the chronic autoimmune response. Subsets of CD4(+) T cells with regulatory capacity, such as CD25(+) Tregs, have been identified in mice and man, and recent observations suggest that in RA, the function of these regulatory T cells is severely impaired. Thus, in RA, defective regulatory immune mechanisms might allow the breakdown of peripheral tolerance, following which the detrimental CD4(+) T-cell-driven immune response evolves and proceeds to chronic inflammation. Here, we review the functional abnormalities and the contribution of different T-cell subsets to rheumatoid inflammation.
Erickson, L D; Vogel, L A; Cascalho, M; Wong, J; Wabl, M; Durell, B G; Noelle, R J
2000-11-01
This study tracks the fate of antigen-reactive B cells through follicular and extrafollicular responses and addresses the function of CD40 in these processes. The unique feature of this system is the use of transgenic B cells in which the heavy chain locus has been altered by site-directed insertion of a rearranged V(H) DJ(H) exon such that they are able to clonally expand, isotype-switch and follow a normal course of differentiation upon immunization. These Ig transgenic B cells when adoptively transferred into non-transgenic (Tg) mice in measured amounts expanded and differentiated distinctively in response to T cell-independent (TI) or T cell-dependent (TD) antigens. The capacity of these Tg B cells to faithfully recapitulate the humoral immune response to TI and TD antigens provides the means to track clonal B cell behavior in vivo. Challenge with TI antigen in the presence of agonistic anti-CD40 mAb resulted in well-defined alterations of the TI response. In vivo triggering of Tg B cells with TI antigen and CD40 caused an increase in the levels IgG produced and a broadening of the Ig isotype profile, characteristics which partially mimic TD responses. Although some TD characteristics were induced by TI antigen and CD40 triggering, the Tg B cells failed to acquire a germinal center phenotype and failed to generate a memory response. Therefore, TD-like immunity can be only partially reconstituted with CD40 agonists and TI antigens, suggesting that there are additional signals required for germinal center formation and development of memory.
Perfluorooctanoic Acid Exposure Suppresses T-independent Antibody Responses
Exposure to 3.75mg/kg of perfluoroocatnoic acid (PFOA) for 15d suppresses T-dependent antibody responses (TDAR), suggesting that T helper cells and/or B cells/plasma cells may be impacted. This study evaluated effects of PFOA exposure on the T cell-independent antibody response...
Tailored immune responses: novel effector helper T cell subsets in protective immunity.
Kara, Ervin E; Comerford, Iain; Fenix, Kevin A; Bastow, Cameron R; Gregor, Carly E; McKenzie, Duncan R; McColl, Shaun R
2014-02-01
Differentiation of naïve CD4⁺ cells into functionally distinct effector helper T cell subsets, characterised by distinct "cytokine signatures," is a cardinal strategy employed by the mammalian immune system to efficiently deal with the rapidly evolving array of pathogenic microorganisms encountered by the host. Since the T(H)1/T(H)2 paradigm was first described by Mosmann and Coffman, research in the field of helper T cell biology has grown exponentially with seven functionally unique subsets having now been described. In this review, recent insights into the molecular mechanisms that govern differentiation and function of effector helper T cell subsets will be discussed in the context of microbial infections, with a focus on how these different helper T cell subsets orchestrate immune responses tailored to combat the nature of the pathogenic threat encountered.
Sauerborn, Melody; van Beers, Miranda M C; Jiskoot, Wim; Kijanka, Grzegorz M; Boon, Louis; Schellekens, Huub; Brinks, Vera
2013-01-01
The immunological processes underlying immunogenicity of recombinant human therapeutics are poorly understood. Using an immune tolerant mouse model we previously demonstrated that aggregates are a major trigger of the antidrug antibody (ADA) response against recombinant human interferon beta (rhIFNβ) products including Betaferon®, and that immunological memory seems to be lacking after a rechallenge with non-aggregated rhIFNβ. The apparent absence of immunological memory indicates a CD4+ T-cell independent (Tind) immune response underlying ADA formation against Betaferon®. This hypothesis was tested. Using the immune tolerant mouse model we first validated that rechallenge with highly aggregated rhIFNβ (Betaferon®) does not lead to a subsequent fast increase in ADA titers, suggesting a lack of immunological memory. Next we assessed whether Betaferon® could act as Tind antigen by inactivation of marginal zone (MZ) B-cells during treatment. MZ B-cells are major effector cells involved in a Tind immune response. In a following experiment we depleted the mice from CD4+ T-cells to test their involvement in the ADA response against Betaferon®. Inactivation of MZ B-cells at the start of Betaferon® treatment drastically lowered ADA levels, suggesting a Tind immune response. However, persistent depletion of CD4+ T-cells before and during Betaferon® treatment abolished the ADA response in almost all mice. The immune response against rhIFNβ in immune tolerant mice is neither a T-cell independent nor a classical T-cell dependent immune response. Further studies are needed to confirm absence of immunological memory (cells).
Chen, Quanyi; Cannons, Jennifer L.; Paton, James C.; Akiba, Hisaya; Schwartzberg, Pamela L.; Snapper, Clifford M.
2010-01-01
Polysaccharide (PS)- and protein-specific murine IgG responses to intact Streptococcus pneumoniae (Pn) are both dependent upon CD4+ T cell help, B7-dependent costimulation, and CD40/CD40-ligand interactions. However, the primary PS-, relative to protein-specific, IgG response terminates more rapidly, requires a shorter period of T cell help and B7-dependent costimulation, and fails to generate memory. In light of the critical role for ICOS/ICOS-ligand interactions in sustaining T cell-dependent Ig responses and promoting germinal center reactions, we hypothesized that this interaction was non-essential for PS-specific IgG responses to Pn. We now demonstrate that ICOS-/-, relative to WT, mice elicit a normal PS-specific IgG isotype response to Pn, despite marked inhibition of both the primary and secondary IgG anti-protein (i.e. PspA, PspC, and PsaA) response. A blocking anti-ICOS-ligand mAb injected during primary Pn immunization inhibits both the primary anti-protein response and the generation of protein-specific memory, but has no effect when injected during secondary immunization. In contrast to Pn, both PS- and protein-specific IgG responses to a pneumococcal conjugate vaccine are inhibited in ICOS-/- mice. ICOS-/- mice immunized with intact Pn or conjugate exhibit nearly complete abrogation in germinal center formation. Finally, although mice that lack the adaptor molecule SAP resemble ICOS-/- mice (and can exhibit decreased ICOS expression), we observe that the PS-, as well as protein-specific IgG responses to both Pn and conjugate are markedly defective in SAP-/- mice. These data define a novel T cell-, SAP-, and B7-dependent, but ICOS-independent, extrafollicular pathway of Ig induction. PMID:19050242
Lopez, Pamela Aranda; Denny, Mark; Hartmann, Ann-Kathrin; Alflen, Astrid; Probst, Hans Christian; von Stebut, Esther; Tenzer, Stefan; Schild, Hansjörg; Stassen, Michael; Langguth, Peter; Radsak, Markus P
2017-09-01
Transcutaneous immunization (TCI) is a novel vaccination strategy utilizing the skin associated lymphatic tissue to induce immune responses. TCI using a cytotoxic T lymphocyte (CTL) epitope and the Toll-like receptor 7 (TLR7) agonist imiquimod mounts strong CTL responses by activation and maturation of skin-derived dendritic cells (DCs) and their migration to lymph nodes. However, TCI based on the commercial formulation Aldara only induces transient CTL responses that needs further improvement for the induction of durable therapeutic immune responses. Therefore we aimed to develop a novel imiquimod solid nanoemulsion (IMI-Sol) for TCI with superior vaccination properties suited to induce high quality T cell responses for enhanced protection against infections. TCI was performed by applying a MHC class I or II restricted epitope along with IMI-Sol or Aldara (each containing 5% Imiquimod) on the shaved dorsum of C57BL/6, IL-1R, Myd88, Tlr7 or Ccr7 deficient mice. T cell responses as well as DC migration upon TCI were subsequently analyzed by flow cytometry. To determine in vivo efficacy of TCI induced immune responses, CTL responses and frequency of peptide specific T cells were evaluated on day 8 or 35 post vaccination and protection in a lymphocytic choriomeningitis virus (LCMV) infection model was assessed. TCI with the imiquimod formulation IMI-Sol displayed equal skin penetration of imiquimod compared to Aldara, but elicited superior CD8 + as well as CD4 + T cell responses. The induction of T-cell responses induced by IMI-Sol TCI was dependent on the TLR7/MyD88 pathway and independent of IL-1R. IMI-Sol TCI activated skin-derived DCs in skin-draining lymph nodes more efficiently compared to Aldara leading to enhanced protection in a LCMV infection model. Our data demonstrate that IMI-Sol TCI can overcome current limitations of previous imiquimod based TCI approaches opening new perspectives for transcutaneous vaccination strategies and allowing the use of this
Haralambieva, Iana H.; Salk, Hannah M.; Lambert, Nathaniel D.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Warner, Nathaniel D.; Pankratz, V.Shane; Poland, Gregory A.
2014-01-01
Introduction Immune response variations after vaccination are influenced by host genetic factors and demographic variables, such as race, ethnicity and sex. The latter have not been systematically studied in regard to live rubella vaccine, but are of interest for developing next generation vaccines for diverse populations, for predicting immune responses after vaccination, and for better understanding the variables that impact immune response. Methods We assessed associations between demographic variables, including race, ethnicity and sex, and rubella-specific neutralizing antibody levels and secreted cytokines (IFN! , IL-6) in two independent cohorts (1,994 subjects), using linear and linear mixed models approaches, and genetically defined racial and ethnic categorizations. Results Our replicated findings in two independent, large, racially diverse cohorts indicate that individuals of African descent have significantly higher rubella-specific neutralizing antibody levels compared to individuals of European descent and/or Hispanic ethnicity (p! 0.001). Conclusion Our study provides consistent evidence for racial/ethnic differences in humoral immune response following rubella vaccination. PMID:24530932
T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.
Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua
2018-05-09
B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.
Szomolanyi-Tsuda, Eva; Seedhom, Mina O; Carroll, Michael C; Garcea, Robert L
2006-08-15
Polyomavirus (PyV) infection induces protective T cell-independent (TI) IgM and IgG antibody responses in T cell-deficient mice, but these responses are not generated by immunization with viral proteins or virus like particles. We hypothesized that innate signals contribute to the generation of isotype-switched antiviral antibody responses. We studied the role of complement receptor (CR2) engagement in TI and T cell-dependent (TD) antibody responses to PyV using CR2-deficient mice. Antiviral IgG responses were reduced by 80-40% in CR2-/- mice compared to wild type. Adoptive transfer experiments demonstrated the need for CR2 not only in TD, but also in TI IgG responses to PyV. Transfer of CR2-/- B lymphocytes to SCID mice resulted in TI antiviral IgG responses that corresponded to 10% of that seen in wild-type B cell-reconstituted mice. Thus, our studies revealed a profound dependence of TI and TD antiviral antibody responses on CR2-mediated signals in PyV-infected mice, where the viral antigen is abundant and persistent.
Immune-responsiveness of CD4+ T cells during Streptococcus suis serotype 2 infection
Lecours, Marie-Pier; Letendre, Corinne; Clarke, Damian; Lemire, Paul; Galbas, Tristan; Benoit-Biancamano, Marie-Odile; Thibodeau, Jacques; Gottschalk, Marcelo; Segura, Mariela
2016-01-01
The pathogenesis of Streptococcus suis infection, a major swine and human pathogen, is only partially understood and knowledge on the host adaptive immune response is critically scarce. Yet, S. suis virulence factors, particularly its capsular polysaccharide (CPS), enable this bacterium to modulate dendritic cell (DC) functions and potentially impair the immune response. This study aimed to evaluate modulation of T cell activation during S. suis infection and the role of DCs in this response. S. suis-stimulated total mouse splenocytes readily produced TNF-α, IL-6, IFN-γ, CCL3, CXCL9, and IL-10. Ex vivo and in vivo analyses revealed the involvement of CD4+ T cells and a Th1 response. Nevertheless, during S. suis infection, levels of the Th1-derived cytokines TNF-α and IFN-γ were very low. A transient splenic depletion of CD4+ T cells and a poor memory response were also observed. Moreover, CD4+ T cells secreted IL-10 and failed to up-regulate optimal levels of CD40L and CD69 in coculture with DCs. The CPS hampered release of several T cell-derived cytokines in vitro. Finally, a correlation was established between severe clinical signs of S. suis disease and impaired antibody responses. Altogether, these results suggest S. suis interferes with the adaptive immune response. PMID:27905502
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.
Zhang, Jie; Liu, Huan; Wei, Bin
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*
Zhang, Jie; Liu, Huan; Wei, Bin
2017-01-01
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566
Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.
Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia
2017-01-01
During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.
Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G
2015-06-01
The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.
The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides
Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria
2010-01-01
The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388
2017-08-01
Award Number: W81XWH-15-1-0328 TITLE: Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against...1 August 2016 - 31 July 2017 4. TITLE AND SUBTITLE Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed...discovered that a subset of regulatory T cells (Tregs), termed peripheral-derived Tregs (pTregs), impair immune responses directed against tumor
Austrup, F; Kucharzik, T; Kölsch, E
1991-01-01
The humoral immune response to the so-called thymus independent antigen dextran B 1355 S in conventionally raised BALB/c mice consists solely of IgM antibodies. Expression of IgG anti-Dex antibodies in these mice is prevented by pre- or perinatally activated idiotype-specific T-suppressor lymphocytes. IgG B-memory cells nevertheless develop during the course of immunization, but are arrested in an anergic state. In the presence of Cremophor EL the induction of this anergic state is inhibited and the immune response shifts fully to an IgG anti-Dex response. Images Figure 1 PMID:1717371
The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization
Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M
2014-01-01
Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325
Hosokawa, T; Tanaka, Y; Aoike, A; Kawai, K; Muramatsu, S
1984-09-01
The time course of B-cell memory development to a dinitrophenyl (DNP) T-independent type-2 (TI-2) antigen was investigated by adoptive cell transfer. Strong IgM and IgG memory developed in BALB/c mice after immunization with DNP-dextran, to be recalled by challenge with either T-dependent (TD) antigen or TI-2 antigen. However, only weak IgM memory and very feeble IgG memory were detected in athymic nude mice receiving the same immunization as euthymic mice. Once memory was established under probable T cell influence, its recall by TI-2 antigen challenge seemed independent of T cell help and did not require sharing of carriers between priming and challenge antigens. The following may be concluded. (i) Long-term IgM and IgG memory is induced by TI-2 antigen priming in the presence of functional T cells. (ii) The class switch from IgM to IgG in the memory B cell pool is driven effectively by TI-2 antigen and is probably T cell-dependent.
Defective B cell response to T-dependent immunization in lupus-prone mice
Niu, Haitao; Sobel, Eric S.; Morel, Laurence
2009-01-01
Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209
Datta, Jashodeep; Berk, Erik; Xu, Shuwen; Fitzpatrick, Elizabeth; Rosemblit, Cinthia; Lowenfeld, Lea; Goodman, Noah; Lewis, David A; Zhang, Paul J; Fisher, Carla; Roses, Robert E; DeMichele, Angela; Czerniecki, Brian J
2015-05-23
A progressive loss of circulating anti-human epidermal growth factor receptor-2/neu (HER2) CD4(+) T-helper type 1 (Th1) immune responses is observed in HER2(pos)-invasive breast cancer (IBC) patients relative to healthy controls. Pathologic complete response (pCR) following neoadjuvant trastuzumab and chemotherapy (T + C) is associated with decreased recurrence and improved prognosis. We examined differences in anti-HER2 Th1 responses between pCR and non-pCR patients to identify modifiable immune correlates to pathologic response following neoadjuvant T + C. Anti-HER2 Th1 responses in 87 HER2(pos)-IBC patients were examined using peripheral blood mononuclear cells pulsed with 6 HER2-derived class II peptides via IFN-γ ELISPOT. Th1 response metrics were anti-HER2 responsivity, repertoire (number of reactive peptides), and cumulative response across 6 peptides (spot-forming cells [SFC]/10(6) cells). Anti-HER2 Th1 responses of non-pCR patients (n = 4) receiving adjuvant HER2-pulsed type 1-polarized dendritic cell (DC1) vaccination were analyzed pre- and post-immunization. Depressed anti-HER2 Th1 responses observed in treatment-naïve HER2(pos)-IBC patients (n = 22) did not improve globally in T + C-treated HER2(pos)-IBC patients (n = 65). Compared with adjuvant T + C receipt, neoadjuvant T + C - utilized in 61.5 % - was associated with higher anti-HER2 Th1 repertoire (p = 0.048). While pCR (n = 16) and non-pCR (n = 24) patients did not differ substantially in demographic/clinical characteristics, pCR patients demonstrated dramatically higher anti-HER2 Th1 responsivity (94 % vs. 33 %, p = 0.0002), repertoire (3.3 vs. 0.3 peptides, p < 0.0001), and cumulative response (148.2 vs. 22.4 SFC/10(6), p < 0.0001) versus non-pCR patients. After controlling for potential confounders, anti-HER2 Th1 responsivity remained independently associated with pathologic response (odds ratio 8.82, p = 0.016). This IFN-γ(+) immune disparity was mediated by anti-HER2 CD4(+)T
B cell function in the immune response to helminths
Harris, Nicola
2010-01-01
Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556
Inducible nitric oxide synthase in T cells regulates T cell death and immune memory
Vig, Monika; Srivastava, Smita; Kandpal, Usha; Sade, Hadassah; Lewis, Virginia; Sarin, Apurva; George, Anna; Bal, Vineeta; Durdik, Jeannine M.; Rath, Satyajit
2004-01-01
The progeny of T lymphocytes responding to immunization mostly die rapidly, leaving a few long-lived survivors functioning as immune memory. Thus, control of this choice of death versus survival is critical for immune memory. There are indications that reactive radicals may be involved in this death pathway. We now show that, in mice lacking inducible nitric oxide synthase (iNOS), higher frequencies of both CD4 and CD8 memory T cells persist in response to immunization, even when iNOS+/+ APCs are used for immunization. Postactivation T cell death by neglect is reduced in iNOS–/– T cells, and levels of the antiapoptotic proteins Bcl-2 and Bcl-xL are increased. Inhibitors of the iNOS-peroxynitrite pathway also enhance memory responses and block postactivation death by neglect in both mouse and human T cells. However, early primary immune responses are not enhanced, which suggests that altered survival, rather than enhanced activation, is responsible for the persistent immunity observed. Thus, in primary immune responses, iNOS in activated T cells autocrinely controls their susceptibility to death by neglect to determine the level of persisting CD4 and CD8 T cell memory, and modulation of this pathway can enhance the persistence of immune memory in response to vaccination. PMID:15199408
Li, Xiaoyan; Ni, Runzhou
2016-11-01
There are over 350 million chronic carriers of hepatitis B virus (HBV) in the world, of whom about a third eventually develop severe HBV-related complications. HBV contributes to liver cirrhosis and hepatocellular carcinoma development. Remarkable progress has been made in selective inhibition of HBV replication by nucleoside analogs. However, how to generate protective antibody of HBsAb in HBV-infected patients after HBV-DNA becomes negative still remains a challenge for scientists. In this study, we show that OmpC-HBsAg 'a' epitope chimeric protein vaccine can break HBV tolerance and induce protective immunity in HBV transgenic mice based on mimicking T cell-independent antigen to bypass T cells from the adaptive immune system. The antibodies induced by the vaccine have the ability to prevent HBV virion infection of human hepatocytes.
Pan, Tingru; Liu, Tianqi; Tan, Siran; Wan, Na; Zhang, Yiming; Li, Shu
2018-04-01
The objective of the present study was to investigate whether dietary selenium (Se) deficiency would affect the expression of selenoprotein T (SelT) and immune response in the immune organs of broilers. Changes in expression of inflammatory cytokines and oxidative stress response caused by Se deficiency can lead to organism damage, which in turn leads to immune response. Sixty (1-day-old) broilers were divided into the control group and Se-deficiency group. Animal models with exudative diathesis were duplicated in the broilers by feeding them Se-deficient diet for 20 days. After the Se-deficient group exhibited symptoms of exudative diathesis, all the broilers were euthanized, and their immune organs were taken for analysis. The tissues including spleen, bursa of Fabricius, and thymus were treated to determine the pathological changes (including microscopic and ultramicroscopic), the messenger RNA (mRNA) expression levels of SelT and its synthetase (SecS and SPS1), cytokine mRNA expression levels, and antioxidant status. The microscopic and ultramicroscopic analyses showed that immune tissues were obviously injured in the Se-deficient group. The mRNA expression of SelT was decreased compared with that in the control group. Meanwhile, the mRNA expression levels of SecS and SPS1 were downregulated. In the Se-deficient group, the mRNA expression levels of IL-1R and IL-1β were higher than those of three control organs. Additionally, the IL-2 and INF-γ mRNA expression levels were lower than those of the control group. The activity of CAT was decreased, and the contents of H 2 O 2 and •OH were increased due to Se deficiency. Pearson method analysis showed that the expression of SelT had a positive correlation with IL-2, INF-γ, SecS, and SPS1 and a negative correlation with IL-1R and IL-1β. In summary, these data indicated that Se-deficient diet decreased the SelT expression and its regulation of oxidative stress, and it inhibited a pleiotropic mechanism of the
SIRT1 and HIF1α signaling in metabolism and immune responses.
Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei
2018-04-01
SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
Cellular immune responses to HIV
NASA Astrophysics Data System (ADS)
McMichael, Andrew J.; Rowland-Jones, Sarah L.
2001-04-01
The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.
[The role of regulatory T cells in the modulation of anti-tumor immune response].
Radosavljević, Gordana D; Jovanović, Ivan P; Kanjevac, Tatjana V; Arsenijević, Nebojsa N
2013-01-01
Regulatory T cells (Treg) represent a subset of CD4+T cells whose function is to suppress immune responses. Treg lymphocytes can be divided into two subsets: natural nTreg lymphocytes that are developed in the thymus and inducible iTreg lymphocytes, which originate from conventional T lymphocytes on the periphery.The majority of Treg lymphocytes express high levels of interleukin-2 (IL-2) receptor a chain (CD25) and transcription factor FoxP3 (critical for the development and suppressor activity of iTreg lymphocytes). Cancer cells can modulate anti-tumor immune response indirectly, through the activation of Treg lymphocytes. It has been shown that the loss of regulatory function by depletion of tumor-induced Treg lymphocytes may enhance effectors response, resulting in tumor rejection, while the increased number of Treg lymphocytes effectively prevents tumor destruction. nTreg lymphocytes express increasingly CTLA-4 and membrane-bound TGF-beta, which inhibits cytokine production and responses of effectors lymphocytes.iTreg lymphocytes secrete immunosuppressive cytokines such as ILreg-10 and TGF-beta.Treg lymphocytes represent one of important obstruction in anti-tumor immunity.
Mantchev, George T; Cortesão, Catarina S; Rebrovich, Michelle; Cascalho, Marilia; Bram, Richard J
2007-08-15
The control of systemic infection by encapsulated microorganisms requires T-independent type II (TI-2) Ab responses to bacterial polysaccharides. To understand how such responses evolve, we explored the function of transmembrane activator calcium modulator and cyclophilin ligand interactor (TACI), a member of the TNFR family, required for TI-2 Ab production. Quasimonoclonal (QM) mice produce robust TI-2 responses to 4-hydroxy-3-nitrophenylacetate (NP)-Ficoll, owing to the high precursor frequency of NP-specific B cells in the marginal zone of the spleen. QM mice that lack TACI produce decreased numbers of IgM (2-fold) and IgG (1.6-fold) NP-specific ASCs, compared with TACI-positive QM mice in response to immunization with NP-Ficoll. Our studies indicate that TACI acts at a remote time from activation because TACI is not necessary for activation and proliferation of B cells both in vitro and in vivo. Instead, TACI-deficient QM B cells remained in the cell cycle longer than TACI-proficient QM cells and had impaired plasma cell differentiation in response to NP-Ficoll. We conclude that TACI has dual B cell-autonomous functions, inhibiting prolonged B cell proliferation and stimulating plasma cell differentiation, thus resolving the longstanding paradox that TACI may have both B cell-inhibitory and -stimulatory functions. By promoting plasma cell differentiation earlier during clonal expansion, TACI may decrease the chances of autoantibody production by somatic hypermutation of Ig genes in response to T-independent Ags.
B and T lymphocyte attenuator restricts the protective immune response against experimental malaria.
Adler, Guido; Steeg, Christiane; Pfeffer, Klaus; Murphy, Theresa L; Murphy, Kenneth M; Langhorne, Jean; Jacobs, Thomas
2011-11-15
The immune response against the blood stage of malaria has to be tightly regulated to allow for vigorous antiplasmodial activity while restraining potentially lethal immunopathologic damage to the host like cerebral malaria. Coinhibitory cell surface receptors are important modulators of immune activation. B and T lymphocyte attenuator (BTLA) (CD272) is a coinhibitory receptor expressed by most leukocytes, with the highest expression levels on T and B cells, and is involved in the maintenance of peripheral tolerance by dampening the activation of lymphocytes. The function of BTLA is described in several models of inflammatory disorders and autoimmunity, but its function in infectious diseases is less well characterized. Also, little is known about the influence of BTLA on non-T cells. In this study, we analyzed the function of BTLA during blood-stage malaria infection with the nonlethal Plasmodium yoelii strain 17NL. We show that BTLA knockout mice exhibit strongly reduced parasitemia and clear the infection earlier compared with wild-type mice. This increased resistance was seen before the onset of adaptive immune mechanisms and even in the absence of T and B cells but was more pronounced at later time points when activation of T and B cells was observed. We demonstrate that BTLA regulates production of proinflammatory cytokines in a T cell-intrinsic way and B cell intrinsically regulates the production of P. yoelii 17NL-specific Abs. These results indicate that the coinhibitory receptor BTLA plays a critical role during experimental malaria and attenuates the innate as well as the subsequent adaptive immune response.
A novel subset of helper T cells promotes immune responses by secreting GM-CSF
Zhang, J; Roberts, A I; Liu, C; Ren, G; Xu, G; Zhang, L; Devadas, S; Shi, Yufang
2013-01-01
Helper T cells are crucial for maintaining proper immune responses. Yet, they have an undefined relationship with one of the most potent immune stimulatory cytokines, granulocyte macrophage-colony-stimulating factor (GM-CSF). By depleting major cytokines during the differentiation of CD4+ T cells in vitro, we derived cells that were found to produce large amounts of GM-CSF, but little of the cytokines produced by other helper T subsets. By their secretion of GM-CSF, this novel subset of helper T cells (which we have termed ThGM cells) promoted the production of cytokines by other T-cell subtypes, including type 1 helper T cell (Th1), type 2 helper T cell (Th2), type 1 cytotoxic T cell (Tc1), type 2 cytotoxic T cell (Tc2), and naive T cells, as evidenced by the fact that antibody neutralization of GM-CSF abolished this effect. ThGM cells were found to be highly prone to activation-induced cell death (AICD). Inhibitors of TRAIL or granzymes could not block AICD in ThGM cells, whereas inhibition of FasL/Fas interaction partially rescued ThGM cells from AICD. Thus, ThGM cells are a novel subpopulation of T helper cells that produce abundant GM-CSF, exhibit exquisite susceptibility to apoptosis, and therefore play a pivotal role in the regulation of the early stages of immune responses. PMID:24076588
Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.
2013-01-01
Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242
Redirecting the Immune Response: Role of Adoptive T Cell Therapy
Dardalhon, Valérie; Michelini, Rodrigo Hess; Loisel-Meyer, Severine
2010-01-01
Abstract Adoptive T cell therapy is aimed at overcoming constraints of the endogenous immune response. In patients with malignancies, this approach is based on the possibility of administering sufficient numbers of tumor-reactive lymphocytes under conditions in which they will promote a therapeutic response. Although this strategy is potentially applicable to a vast number of malignancies, its efficacy, to date, has been limited. This is likely related to several factors including an insufficient persistence and reactivation of infused cells, insufficient tumor infiltration, and the presence of an immunosuppressive environment. Here, we review the importance of pretransplantation host conditioning and posttransplantation strategies that have been shown to contribute to the therapeutic efficacy of infused T lymphocytes. PMID:20201627
Adjuvant-enhanced CD4 T Cell Responses are Critical to Durable Vaccine Immunity.
Martins, Karen A O; Cooper, Christopher L; Stronsky, Sabrina M; Norris, Sarah L W; Kwilas, Steven A; Steffens, Jesse T; Benko, Jacqueline G; van Tongeren, Sean A; Bavari, Sina
2016-01-01
Protein-based vaccines offer a safer alternative to live-attenuated or inactivated vaccines but have limited immunogenicity. The identification of adjuvants that augment immunogenicity, specifically in a manner that is durable and antigen-specific, is therefore critical for advanced development. In this study, we use the filovirus virus-like particle (VLP) as a model protein-based vaccine in order to evaluate the impact of four candidate vaccine adjuvants on enhancing long term protection from Ebola virus challenge. Adjuvants tested include poly-ICLC (Hiltonol), MPLA, CpG 2395, and alhydrogel. We compared and contrasted antibody responses, neutralizing antibody responses, effector T cell responses, and T follicular helper (Tfh) cell frequencies with each adjuvant's impact on durable protection. We demonstrate that in this system, the most effective adjuvant elicits a Th1-skewed antibody response and strong CD4 T cell responses, including an increase in Tfh frequency. Using immune-deficient animals and adoptive transfer of serum and cells from vaccinated animals into naïve animals, we further demonstrate that serum and CD4 T cells play a critical role in conferring protection within effective vaccination regimens. These studies inform on the requirements of long term immune protection, which can potentially be used to guide screening of clinical-grade adjuvants for vaccine clinical development.
Ensoli, Barbara; Bellino, Stefania; Tripiciano, Antonella; Longo, Olimpia; Francavilla, Vittorio; Marcotullio, Simone; Cafaro, Aurelio; Picconi, Orietta; Paniccia, Giovanni; Scoglio, Arianna; Arancio, Angela; Ariola, Cristina; Ruiz Alvarez, Maria J.; Campagna, Massimo; Scaramuzzi, Donato; Iori, Cristina; Esposito, Roberto; Mussini, Cristina; Ghinelli, Florio; Sighinolfi, Laura; Palamara, Guido; Latini, Alessandra; Angarano, Gioacchino; Ladisa, Nicoletta; Soscia, Fabrizio; Mercurio, Vito S.; Lazzarin, Adriano; Tambussi, Giuseppe; Visintini, Raffaele; Mazzotta, Francesco; Di Pietro, Massimo; Galli, Massimo; Rusconi, Stefano; Carosi, Giampiero; Torti, Carlo; Di Perri, Giovanni; Bonora, Stefano; Ensoli, Fabrizio; Garaci, Enrico
2010-01-01
Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4+ T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks) on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002). Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002), served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4+ and CD8+ cellular activation (CD38 and HLA-DR) together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4+ T cells and B cells with reduction of CD8+ T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4+ and CD8+ T cells were accompanied by increases of CD4+ and CD8+ T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite, absent or partial in the
Ensoli, Barbara; Bellino, Stefania; Tripiciano, Antonella; Longo, Olimpia; Francavilla, Vittorio; Marcotullio, Simone; Cafaro, Aurelio; Picconi, Orietta; Paniccia, Giovanni; Scoglio, Arianna; Arancio, Angela; Ariola, Cristina; Ruiz Alvarez, Maria J; Campagna, Massimo; Scaramuzzi, Donato; Iori, Cristina; Esposito, Roberto; Mussini, Cristina; Ghinelli, Florio; Sighinolfi, Laura; Palamara, Guido; Latini, Alessandra; Angarano, Gioacchino; Ladisa, Nicoletta; Soscia, Fabrizio; Mercurio, Vito S; Lazzarin, Adriano; Tambussi, Giuseppe; Visintini, Raffaele; Mazzotta, Francesco; Di Pietro, Massimo; Galli, Massimo; Rusconi, Stefano; Carosi, Giampiero; Torti, Carlo; Di Perri, Giovanni; Bonora, Stefano; Ensoli, Fabrizio; Garaci, Enrico
2010-11-11
Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4(+) T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks) on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002). Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002), served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4(+) and CD8(+) cellular activation (CD38 and HLA-DR) together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4(+) T cells and B cells with reduction of CD8(+) T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4(+) and CD8(+) T cells were accompanied by increases of CD4(+) and CD8(+) T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite, absent
Wang, Shixia; Goguen, Jon D; Li, Fusheng; Lu, Shan
2011-09-09
Yersinia pestis (Y. pestis) is the causative pathogen of plague, a highly fatal disease for which an effective vaccine, especially against mucosal transmission, is still not available. Like many bacterial infections, antigen-specific antibody responses have been traditionally considered critical, if not solely responsible, for vaccine-induced protection against Y. pestis. Studies in recent years have suggested the importance of T cell immune responses against Y. pestis infection but information is still limited about the details of Y. pestis antigen-specific T cell immune responses. In current report, studies are conducted to identify the presence of CD8+ T cell epitopes in LcrV protein, the leading antigen of plague vaccine development. Furthermore, depletion of CD8+ T cells in LcrV DNA vaccinated Balb/C mice led to reduced protection against lethal intranasal challenge of Y. pestis. These findings establish that an LcrV DNA vaccine is able to elicit CD8+ T cell immune responses against specific epitopes of this key plague antigen and that a CD8+ T cell immune response is involved in LcrV DNA vaccine-elicited protection. Future studies in plague vaccine development will need to examine if the presence of detectable T cell immune responses, in particular CD8+ T-cell immune responses, will enhance the protection against Y. pestis in higher animal species or humans. Copyright © 2010 Elsevier Ltd. All rights reserved.
T-cell-mediated immune response to respiratory coronaviruses
Channappanavar, Rudragouda; Zhao, Jincun; Perlman, Stanley
2014-01-01
Emerging respiratory coronaviruses such as the Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) and Middle East Respiratory Syndrome coronavirus (MERS-CoV) pose potential biological threats to humans. SARS and MERS are manifested as severe atypical pneumonia associated with high morbidity and mortality in humans. The majority of studies carried out in SARS-CoV-infected humans and animals attribute a dysregulated/exuberant innate response as a leading contributor to SARS-CoV-mediated pathology. A decade after the 2002–2003 SARS epidemic, we do not have any approved preventive or therapeutic agents available in case of re-emergence of SARS-CoV or other related viruses. A strong neutralizing antibody response generated against the spike (S) glycoprotein of SARS-CoV is completely protective in the susceptible host. However, neutralizing antibody titers and the memory B cell response are short-lived in SARS-recovered patients and the antibody will target primary homologous strain. Interestingly, the acute phase of SARS in humans is associated with a severe reduction in the number of T cells in the blood. Surprisingly, only a limited number of studies have explored the role of the T cell-mediated adaptive immune response in respiratory coronavirus pathogenesis. In this review, we discuss the role of anti-virus CD4 and CD8 T cells during respiratory coronavirus infections with a special emphasis on emerging coronaviruses. PMID:24845462
Aline, Fleur; Bout, Daniel; Amigorena, Sébastian; Roingeard, Philippe; Dimier-Poisson, Isabelle
2004-01-01
It was previously demonstrated that immunizing mice with spleen dendritic cells (DCs) that had been pulsed ex vivo with Toxoplasma gondii antigens triggers a systemic Th1-biased specific immune response and induces protection against infection. T. gondii can cause severe sequelae in the fetuses of mothers who acquire the infection during pregnancy, as well as life-threatening neuropathy in immunocompromised patients, in particular those with AIDS. Here, we investigate the efficacy of a novel cell-free vaccine composed of DC exosomes, which are secreted antigen-presenting vesicles that express functional major histocompatibility complex class I and II and T-cell-costimulatory molecules. They have already been shown to induce potent antitumor immune responses. We investigated the potential of DC2.4 cell line-derived exosomes to induce protective immunity against toxoplasmosis. Our data show that most adoptively transferred T. gondii-pulsed DC-derived exosomes were transferred to the spleen, elicited a strong systemic Th1-modulated Toxoplasma-specific immune response in vivo, and conferred good protection against infection. These findings support the possibility that DC-derived exosomes can be used for T. gondii immunoprophylaxis and for immunoprophylaxis against many other pathogens. PMID:15213158
Genomics of immune response to typhoid and cholera vaccines
Majumder, Partha P.
2015-01-01
Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways. PMID:25964454
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanay, A.; Strober, S.
The authors have previously observed a reduction of the T cell-dependent primary antibody response to dinitrophenylated keyhole limpet hemocyanin, and an enhancement of the T cell-independent response to trinitrophenylated Brucella abortus (TNP-BA) in BALB/c mice after treatment with total lymphoid irradiation (TLI). To elucidate the relative contribution of T and B cells to the enhanced T cell-independent antibody responses after TLI, a syngeneic primary adoptive transfer system was utilized whereby irradiated hosts were reconstituted with unfractionated spleen cells or a combination of purified T and B cells from TLI-treated and untreated control mice. Antibody responses of purified splenic B cellsmore » from TLI-treated BALB/c mice (TLI/B) to TNP-BA were enhanced 10-fold as compared with those of unfractionated (UF) spleen cells or B cells from normal (NL) BALB/c mice (NL/UF and NL/B, respectively). Splenic T cells from normal animals (NL/T) suppressed the anti-TNP-BA response of TLI/B by more than 100-fold. NL/T neither suppressed nor enhanced the response of NL/B. On the other hand, T cells from TLI-treated mice (TLI/T) enhanced by 100-fold the anti-TNP-BA response of NL/B, but neither suppressed nor enhanced the response of TLI/B. Thus, T cells can regulate the T cell-independent antibody response to TNP-BA. However, experimental manipulation of the T and B cell populations is needed to demonstrate the regulatory functions.« less
Cao, Qi; Wang, Li; Du, Fang; Sheng, Huiming; Zhang, Yan; Wu, Juanjuan; Shen, Baihua; Shen, Tianwei; Zhang, Jingwu; Li, Dangsheng; Li, Ningli
2007-07-01
Regulatory T cells (Treg) play important roles in immune system homeostasis, and may also be involved in tumor immunotolerance by suppressing Th1 immune response which is involved in anti-tumor immunity. We have previously reported that immunization with attenuated activated autologous T cells leads to enhanced anti-tumor immunity and upregulated Th1 responses in vivo. However, the underlying molecular mechanisms are not well understood. Here we show that Treg function was significantly downregulated in mice that received immunization of attenuated activated autologous T cells. We found that Foxp3 expression decreased in CD4+CD25+ T cells from the immunized mice. Moreover, CD4+CD25+Foxp3+ Treg obtained from immunized mice exhibited diminished immunosuppression ability compared to those from naïve mice. Further analysis showed that the serum of immunized mice contains a high level of anti-CD25 antibody (about 30 ng/ml, p<0.01 vs controls). Consistent with a role of anti-CD25 response in the downregulation of Treg, adoptive transfer of serum from immunized mice to naïve mice led to a significant decrease in Treg population and function in recipient mice. The triggering of anti-CD25 response in immunized mice can be explained by the fact that CD25 was induced to a high level in the ConA activated autologous T cells used for immunization. Our results demonstrate for the first time that immunization with attenuated activated autologous T cells evokes anti-CD25 antibody production, which leads to impeded CD4+CD25+Foxp3+ Treg expansion and function in vivo. We suggest that dampened Treg function likely contributes to enhanced Th1 response in immunized mice and is at least part of the mechanism underlying the boosted anti-tumor immunity.
Ottinger, Christopher A.; Honeyfield, Dale C.; Densmore, Christine L.; Iwanowicz, Luke R.
2012-01-01
Lake trout Salvelinus namaycush on thiamine-replete and thiamine-depleted diets were evaluated for the effects of thiamine status on in vivo responses to the T-dependent antigen trinitophenol (TNP)-keyhole limpet hemocyanin (TNP-KLH), the T-independent antigen trinitrophenol-lipolysaccaharide (TNP-LPS), or Dulbecco's phosphate-buffered saline (DPBS; negative control fish). Plasma antibody concentrations were evaluated for possible differences in total anti-TNP activity as well as differences in response kinetics. Associations between anti-TNP activity and muscle and liver thiamine concentrations as well as ratios of muscle-to-liver thiamine to anti-TNP activity were also examined. Thiamine-depleted lake trout that were injected with TNP-LPS exhibited significantly more anti-TNP activity than thiamine-replete fish. The depleted fish injected with TNP-LPS also exhibited significantly different response kinetics relative to thiamine-replete lake trout. No differences in activity or kinetics were observed between the thiamine-replete and -depleted fish injected with TNP-KLH or in the DPBS negative controls. Anti-TNP activity in thiamine-depleted lake trout injected with TNP-KLH was positively associated with muscle thiamine pyrophosphate (thiamine diphosphate; TPP) concentration. A negative association was observed between the ratio of muscle-to-liver TPP and T-independent responses. No significant associations between anti-TNP activity and tissue thiamine concentration were observed in the thiamine-replete fish. We demonstrated that thiamine deficiency leads to alterations in both T-dependent and T-independent immune responses in lake trout.
Ottinger, Christopher A; Honeyfield, Dale C; Densmore, Christine L; Iwanowicz, Luke R
2012-12-01
Lake trout Salvelinus namaycush on thiamine-replete and thiamine-depleted diets were evaluated for the effects of thiamine status on in vivo responses to the T-dependent antigen trinitophenol (TNP)-keyhole limpet hemocyanin (TNP-KLH), the T-independent antigen trinitrophenol-lipolysaccaharide (TNP-LPS), or Dulbecco's phosphate-buffered saline (DPBS; negative control fish). Plasma antibody concentrations were evaluated for possible differences in total anti-TNP activity as well as differences in response kinetics. Associations between anti-TNP activity and muscle and liver thiamine concentrations as well as ratios of muscle-to-liver thiamine to anti-TNP activity were also examined. Thiamine-depleted lake trout that were injected with TNP-LPS exhibited significantly more anti-TNP activity than thiamine-replete fish. The depleted fish injected with TNP-LPS also exhibited significantly different response kinetics relative to thiamine-replete lake trout. No differences in activity or kinetics were observed between the thiamine-replete and -depleted fish injected with TNP-KLH or in the DPBS negative controls. Anti-TNP activity in thiamine-depleted lake trout injected with TNP-KLH was positively associated with muscle thiamine pyrophosphate (thiamine diphosphate; TPP) concentration. A negative association was observed between the ratio of muscle-to-liver TPP and T-independent responses. No significant associations between anti-TNP activity and tissue thiamine concentration were observed in the thiamine-replete fish. We demonstrated that thiamine deficiency leads to alterations in both T-dependent and T-independent immune responses in lake trout.
Measles virus-induced suppression of immune responses.
Griffin, Diane E
2010-07-01
Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.
Rui, Yuxiang; Honjo, Tasuku; Chikuma, Shunsuke
2013-01-01
Programmed cell death 1 (PD-1) is an inhibitory coreceptor on immune cells and is essential for self-tolerance because mice genetically lacking PD-1 (PD-1−/−) develop spontaneous autoimmune diseases. PD-1−/− mice are also susceptible to severe experimental autoimmune encephalomyelitis (EAE), characterized by a massive production of effector/memory T cells against myelin autoantigen, the mechanism of which is not fully understood. We found that an increased primary response of PD-1−/− mice to heat-killed mycobacteria (HKMTB), an adjuvant for EAE, contributed to the enhanced production of T-helper 17 (Th17) cells. Splenocytes from HKMTB-immunized, lymphocyte-deficient PD-1−/− recombination activating gene (RAG)2−/− mice were found to drive antigen-specific Th17 cell differentiation more efficiently than splenocytes from HKMTB-immunized PD-1+/+ RAG2−/− mice. This result suggested PD-1’s involvement in the regulation of innate immune responses. Mice reconstituted with PD-1−/− RAG2−/− bone marrow and PD-1+/+ CD4+ T cells developed more severe EAE compared with the ones reconstituted with PD-1+/+ RAG2−/− bone marrow and PD-1+/+ CD4+ T cells. We found that upon recognition of HKMTB, CD11b+ macrophages from PD-1−/− mice produced very high levels of IL-6, which helped promote naive CD4+ T-cell differentiation into IL-17–producing cells. We propose a model in which PD-1 negatively regulates antimycobacterial responses by suppressing innate immune cells, which in turn prevents autoreactive T-cell priming and differentiation to inflammatory effector T cells. PMID:24043779
Regulatory T cells as suppressors of anti-tumor immunity: Role of metabolism.
De Rosa, Veronica; Di Rella, Francesca; Di Giacomo, Antonio; Matarese, Giuseppe
2017-06-01
Novel concepts in immunometabolism support the hypothesis that glucose consumption is also used to modulate anti-tumor immune responses, favoring growth and expansion of specific cellular subsets defined in the past as suppressor T cells and currently reborn as regulatory T (Treg) cells. During the 1920s, Otto Warburg and colleagues observed that tumors consumed high amounts of glucose compared to normal tissues, even in the presence of oxygen and completely functioning mitochondria. However, the role of the Warburg Effect is still not completely understood, particularly in the context of an ongoing anti-tumor immune response. Current experimental evidence suggests that tumor-derived metabolic restrictions can drive T cell hyporesponsiveness and immune tolerance. For example, several glycolytic enzymes, deregulated in cancer, contribute to tumor progression independently from their canonical metabolic activity. Indeed, they can control apoptosis, gene expression and activation of specific intracellular pathways, thus suggesting a direct link between metabolic switches and pro-tumorigenic transcriptional programs. Focus of this review is to define the specific metabolic pathways controlling Treg cell immunobiology in the context of anti-tumor immunity and tumor progression. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cellular Immune Responses against Simian T-Lymphotropic Virus Type 1 Target Tax in Infected Baboons
Castro, Iris; Giret, Teresa M.; Magnani, Diogo M.; Maxwell, Helen S.; Umland, Oliver; Perry, Jessica K.; Pecotte, Jerilyn K.; Brasky, Kathleen M.; Barber, Glen N.; Desrosiers, Ronald C.
2016-01-01
ABSTRACT There are currently 5 million to 10 million human T-lymphotropic virus type 1 (HTLV-1)-infected people, and many of them will develop severe complications resulting from this infection. A vaccine is urgently needed in areas where HTLV-1 is endemic. Many vaccines are best tested in nonhuman primate animal models. As a first step in designing an effective HTLV-1 vaccine, we defined the CD8+ and CD4+ T cell response against simian T-lymphotropic virus type 1 (STLV-1), a virus closely related to HTLV-1, in olive baboons (Papio anubis). Consistent with persistent antigenic exposure, we observed that STLV-1-specific CD8+ T cells displayed an effector memory phenotype and usually expressed CD107a, gamma interferon (IFN-γ), and tumor necrosis factor alpha (TNF-α). To assess the viral targets of the cellular immune response in STLV-1-infected animals, we used intracellular cytokine staining to detect responses against overlapping peptides covering the entire STLV-1 proteome. Our results show that, similarly to humans, the baboon CD8+ T cell response narrowly targeted the Tax protein. Our findings suggest that the STLV-1-infected baboon model may recapitulate some of the important aspects of the human response against HTLV-1 and could be an important tool for the development of immune-based therapy and prophylaxis. IMPORTANCE HTLV-1 infection can lead to many different and often fatal conditions. A vaccine deployed in areas of high prevalence might reduce the incidence of HTLV-1-induced disease. Unfortunately, there are very few animal models of HTLV-1 infection useful for testing vaccine approaches. Here we describe cellular immune responses in baboons against a closely related virus, STLV-1. We show for the first time that the immune response against STLV-1 in naturally infected baboons is largely directed against the Tax protein. Similar findings in humans and the sequence similarity between the human and baboon viruses suggest that the STLV-1-infected baboon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, Will; Korber, Bette
2009-01-01
Creation of a successful HIV vaccine will require the development of a strategy to generate cellular immunity with sufficient cross-clade breadth to deal with the extreme genetic diversity of the virus. Polyvalent mosaic immunogens derived from in silica recombination of natural strains of HIV are designed to induce cellular immune responses that maximally cover the sequence diversity of circulating virus isolates. Immunization of rhesus monkeys with plasmid DNA and recombinant vaccinia virus vaccine constructs expressing either consensus immunogens or polyvalent mosaic immunogens elicited a CD4+ T lymphocyte-biased response with comparably broad epitope-specific total T lymphocyte specificities. However, immunization with themore » mosaic immunogens induced HIV-specific CD8+ T lymphocyte responses with markedly greater depth and breadth. Therefore, the use of polyvalent mosaic immunogens is a promising strategy for a global vaccine for HIV.« less
Holmström, Morten Orebo; Riley, Caroline Hasselbalch; Skov, Vibe; Svane, Inge Marie; Hasselbalch, Hans Carl; Andersen, Mads Hald
2018-01-01
The Chronic Myeloproliferative Neoplasms (MPN) are cancers characterized by hyperinflammation and immune deregulation. Concurrently, the expression of the immune check point programmed death ligand 1 (PD-L1) is induced by inflammation. In this study we report on the occurrence of spontaneous T cell responses against a PD-L1 derived epitope in patients with MPN. We show that 71% of patients display a significant immune response against PD-L1, and patients with advanced MPN have significantly fewer and weaker PD-L1 specific immune responses compared to patients with non-advanced MPN. The PD-L1 specific T cell responses are CD4 + T cell responses, and by gene expression analysis we show that expression of PD-L1 is enhanced in patients with MPN. This could imply that the tumor specific immune response in MPN could be enhanced by vaccination with PD-L1 derived epitopes by boosting the anti-regulatory immune response hereby allowing tumor specific T cell to exert anti-tumor immunity.
Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M
2009-01-01
Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731
Allard, Jenna B.; Rinaldi, Lisa; Wargo, Matt; Allen, Gilman; Akira, Shizuo; Uematsu, Satoshi; Poynter, Matthew E.; Hogan, Deborah A.; Rincon, Mercedes; Whittaker, Laurie A.
2009-01-01
SUMMARY Allergic airway disease is characterized by eosinophilic inflammation, mucus hypersecretion and increased airway resistance. Fungal antigens are ubiquitous within the environment and are well know triggers of allergic disease. Bacterial products are also frequently encountered within the environment and may alter the immune response to certain antigens. The consequence of simultaneous exposure to bacterial and fungal products on the lung adaptive immune response has not been explored. Here we show that oropharyngeal aspiration of fungal lysates (Candida albicans, Aspergillus fumigatus) promotes airway eosinophilia, secretion of Th2 cytokines and mucus cell metaplasia. In contrast, oropharyngeal exposure to bacterial lysates (Pseudomonas aeruginosa) promotes airway inflammation characterized by neutrophils, Th1 cytokine secretion and no mucus production. More importantly, administration of bacterial lysates together with fungal lysates deviates the adaptive immune response to a Th1 type associated with neutrophilia and diminished mucus production. The immunomodulatory effect that bacterial lysates have on the response to fungi is TLR4-independent but MyD88 dependent. Thus, different types of microbial products within the airway can alter the host's adaptive immune response, and potentially impact the development of allergic airway disease to environmental fungal antigens. PMID:19224641
Kragh, M; Larsen, J M; Thysen, A H; Rasmussen, M A; Wolsk, H M; Bisgaard, H; Brix, S
2016-03-01
First-born children are at higher risk of developing a range of immune-mediated diseases. The underlying mechanism of 'birth-order effects' on disease risk is largely unknown, but in utero programming of the child's immune system may play a role. We studied the association between birth order and the functional response of stimulated cord blood T cells. Purified cord blood T cells were polyclonally activated with anti-CD3-/anti-CD28-coated beads in a subgroup of 28 children enrolled in the COPSAC2010 birth cohort. Expression levels of seven activation markers on helper and cytotoxic T cells as well as the percentage of CD4(+) CD25(+) T cells were assessed by flow cytometry. Production of IFN-γ, TNF-α, IL-17, IL-4, IL-5, IL-13, and IL-10 was measured in the supernatants. IL-10 secretion (P = 0.007) and CD25 expression on CD4(+) helper T cells (P = 0.0003) in the activated cord blood T cells were selectively reduced in first-born children, while the percentage of circulating CD4(+) CD25(+) cord blood T cells was independent of birth order. First-born infants display a reduced anti-inflammatory profile in T cells at birth. This possible in utero 'birth-order' T-cell programming may contribute to later development of immune-mediated diseases by increasing overall immune reactivity in first-born children as compared to younger siblings. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Gu, Ai-Di; Wang, Yunqi; Lin, Lin; Zhang, Song S; Wan, Yisong Y
2012-01-17
TGF-β modulates immune response by suppressing non-regulatory T (Treg) function and promoting Treg function. The question of whether TGF-β achieves distinct effects on non-Treg and Treg cells through discrete signaling pathways remains outstanding. In this study, we investigated the requirements of Smad-dependent and -independent TGF-β signaling for T-cell function. Smad2 and Smad3 double deficiency in T cells led to lethal inflammatory disorder in mice. Non-Treg cells were spontaneously activated and produced effector cytokines in vivo on deletion of both Smad2 and Smad3. In addition, TGF-β failed to suppress T helper differentiation efficiently and to promote induced Treg generation of non-Treg cells lacking both Smad2 and Smad3, suggesting that Smad-dependent signaling is obligatory to mediate TGF-β function in non-Treg cells. Unexpectedly, however, the development, homeostasis, and function of Treg cells remained intact in the absence of Smad2 and Smad3, suggesting that the Smad-independent pathway is important for Treg function. Indeed, Treg-specific deletion of TGF-β-activated kinase 1 led to failed Treg homeostasis and lethal immune disorder in mice. Therefore, Smad-dependent and -independent TGF-β signaling discretely controls non-Treg and Treg function to modulate immune tolerance and immune homeostasis.
Gómez-Mora, Elisabet; García, Elisabet; Urrea, Victor; Massanella, Marta; Puig, Jordi; Negredo, Eugenia; Clotet, Bonaventura; Blanco, Julià; Cabrera, Cecilia
2017-09-15
Poor CD4 + T-cell recovery after cART has been associated with skewed T-cell maturation, inflammation and immunosenescence; however, T-cell functionality in those individuals has not been fully characterized. In the present study, we assessed T-cell function by assessing cytokine production after polyclonal, CMV and HIV stimulations of T-cells from ART-suppressed HIV-infected individuals with CD4 + T-cell counts >350 cells/μL (immunoconcordants) or <350 cells/μL (immunodiscordants). A group of HIV-uninfected individuals were also included as controls. Since CMV co-infection significantly affected T-cell maturation and polyfunctionality, only CMV + individuals were analyzed. Despite their reduced and skewed CD4 + T-cell compartment, immunodiscordant individuals showed preserved polyclonal and HIV-specific responses. However, CMV response in immunodiscordant participants was significantly different from immunoconcordant or HIV-seronegative individuals. In immunodiscordant subjects, the magnitude of IFN-γ + CD8 + and IL-2 + CD4 + T-cells in response to CMV was higher and differently associated with the CD4 + T-cell maturation profile., showing an increased frequency of naïve, central memory and EMRA CMV-specific CD4 + T-cells. In conclusion, CD4 + and CD8 + T-cell polyfunctionality was not reduced in immunodiscordant individuals, although heightened CMV-specific immune responses, likely related to subclinical CMV reactivations, may be contributing to the skewed T-cell maturation and the higher risk of clinical progression observed in those individuals.
Dunham, Richard; Pagliardini, Paola; Gordon, Shari; Sumpter, Beth; Engram, Jessica; Moanna, Abeer; Paiardini, Mirko; Mandl, Judith N.; Lawson, Benton; Garg, Seema; McClure, Harold M.; Xu, Yong-Xian; Ibegbu, Chris; Easley, Kirk; Katz, Nathalia; Pandrea, Ivona; Apetrei, Cristian; Sodora, Donald L.; Staprans, Silvija I.; Feinberg, Mark B.; Silvestri, Guido
2006-01-01
In contrast to human immunodeficiency virus (HIV)-infected humans, natural hosts for simian immunodeficiency virus (SIV) very rarely progress to acquired immunodeficiency syndrome (AIDS). While the mechanisms underlying this disease resistance are still poorly understood, a consistent feature of natural SIV infection is the absence of the generalized immune activation associated with HIV infection. To investigate the immunologic mechanisms underlying the absence of AIDS in SIV-infected sooty mangabeys (SMs), a natural host species, we performed a detailed analysis of the SIV-specific cellular immune responses in 110 SIV-infected SMs. We found that while SIV-specific T-cell responses are detectable in the majority of animals, their magnitude and breadth are, in fact, lower than what has been described in HIV-infected humans, both in terms of cytokine production (ie, IFN-γ, TNF-α, and IL-2) and degranulation (ie, CD107a expression). Of importance, SIV-specific T-cell responses were similarly low when either SIVmac239-derived peptides or autologous SIVsmm peptides were used as stimuli. No correlation was found between SIV-specific T-cell responses and either viral load or CD4+ T-cell count, or between these responses and markers of T-cell activation and proliferation. These findings indicate that the absence of AIDS in naturally SIV-infected sooty mangabeys is independent of a strong cellular immune response to the virus. (Blood. 2006;108:209-217) PMID:16522814
alpha(4)beta(7) independent pathway for CD8(+) T cell-mediated intestinal immunity to rotavirus.
Kuklin, N A; Rott, L; Darling, J; Campbell, J J; Franco, M; Feng, N; Müller, W; Wagner, N; Altman, J; Butcher, E C; Greenberg, H B
2000-12-01
Rotavirus (RV), which replicates exclusively in cells of the small intestine, is the most important cause of severe diarrhea in young children worldwide. Using a mouse model, we show that expression of the intestinal homing integrin alpha(4)ss(7) is not essential for CD8(+) T cells to migrate to the intestine or provide immunity to RV. Mice deficient in ss7 expression (ss7(-/-)) and unable to express alpha(4)ss(7) integrin were found to clear RV as quickly as wild-type (wt) animals. Depletion of CD8(+) T cells in ss7(-/-) animals prolonged viral shedding, and transfer of immune ss7(-/-) CD8(+) T cells into chronically infected Rag-2-deficient mice resolved RV infection as efficiently as wt CD8(+) T cells. Paradoxically, alpha(4)ss(7)(hi) memory CD8(+) T cells purified from wt mice that had been orally immunized cleared RV more efficiently than alpha(4)ss(7)(low) CD8(+) T cells. We explained this apparent contradiction by demonstrating that expression of alpha(4)ss(7) on effector CD8(+) T cells depends upon the site of initial antigen exposure: oral immunization generates RV-specific CD8(+) T cells primarily of an alpha(4)ss(7)(hi) phenotype, but subcutaneous immunization yields both alpha(4)ss(7)(hi) and alpha(4)ss(7)(low) immune CD8(+) T cells with anti-RV effector capabilities. Thus, alpha(4)ss(7) facilitates normal intestinal immune trafficking to the gut, but it is not required for effective CD8(+) T cell immunity.
You, Lu; Liu, Ci; Yang, Zi-Jiang; Li, Ming; Li, Shu
2014-08-01
Selenoprotein T (SelT) is associated with the regulation of calcium homeostasis and neuroendocrine secretion. SelT can also change cell adhesion and is involved in redox regulation and cell fixation. However, the structure and function of chicken SelT and its response to selenium (Se) remains unclear. In the present study, 150 1-day-old chickens were randomly divided into a low Se group (L group, fed a Se-deficient diet containing 0.020 mg/kg Se) and a control group (C group, fed a diet containing sodium selenite at 0.2 mg/kg Se). The immune organs (spleen, thymus, and bursa of Fabricius) were collected at 15, 25, 35, 45, and 55 days of age. We performed a sequence analysis and predicted the structure and function of SelT. We also investigated the effects of Se deficiency on the expression of SelT, selenophosphate synthetase-1 (SPS1), and selenocysteine synthase (SecS) using RT-PCR and the oxidative stress in the chicken immune organs. The data showed that the coding sequence (CDS) and deduced amino acid sequence of SelT were highly similar to those of 17 other animals. Se deficiency induced lower (P < 0.05) levels of SelT, SPS1, and SecS, reduced the catalase (CAT) activity, and increased the levels of hydrogen peroxide (H2O2) and hydroxyl radical (-OH) in immune organs. In conclusion, the CDS and deduced amino acid sequence of chicken SelT are highly homologous to those of various mammals. The redox function and response to the Se deficiency of chicken SelT may be conserved. A Se-deficient diet led to a decrease in SelT, SecS, and SPS1 and induced oxidative stress in the chicken immune organs. To our knowledge, this is the first report of predictions of chicken SelT structure and function. The present study demonstrated the relationship between the selenoprotein synthases (SPS1, SecS) and SelT expression in the chicken immune organs and further confirmed oxidative stress caused by Se deficiency. Thus, the information presented in this study is helpful to
Uicker, William C; McCracken, James P; Buchanan, Kent L
2006-02-01
Cryptococcosis is a life-threatening disease caused by the encapsulated yeast, Cryptococcus neoformans. Although infection with C. neoformans is initiated in the lungs, morbidity and mortality is mostly associated with infections of the central nervous system (CNS). Individuals with deficiencies in cell-mediated immunity, such as patients with AIDS, are more susceptible to disseminated cryptococcosis, highlighting the importance of cell-mediated immunity and CD4+ T cells in host resistance against C. neoformans. Using a mouse model of cryptococcal meningoencephalitis, we have shown that immunization of mice with a cryptococcal antigen induced a protective immune response that crossed the blood-brain barrier and initiated an immune response directly in the CNS if C. neoformans was present. The regional protective response was characteristic of a Type-1 (Th1) response in the types of cells present at the site of infection and in the cytokines and chemokines expressed. Here, we extend those findings and report that CD4+ T cells are required for survival of immune mice infected directly in the brain with C. neoformans and sensitized CD4 + T cells can transfer partial protection to naive mice infected intracerebrally with C. neoformans. Furthermore, CD4 + T cells were also important for optimal infiltration of inflammatory cells at the site of infection and in the expression of cytokines and chemokines associated with protection in the brain. Lastly, CD4+ T cells were required for optimal regional production and secretion of IFNgamma and in the significantly increased expression of iNOS in C. neoformans-infected brains of immune mice.
Tang, Lu-ming; Zhao, Guang-ju; Zhu, Xiao-mei; Dong, Ning; Yu, Yan
2013-01-01
High mobility group box 1 protein (HMGB1), a critical proinflammatory cytokine, has recently been identified to be an immunostimulatory signal involved in sepsis-related immune dysfunction when released extracellularly, but the potential mechanism involved remains elusive. Here, we showed that the treatment with HMGB1 in vitro inhibited T lymphocyte immune response and expression of mitofusin-2 (Mfn-2; a member of the mitofusin family) in a dose- and time-dependent manner. Upregulation of Mfn-2 expression attenuated the suppressive effect of HMGB1 on T cell immune function. The phosphorylation of both extracellular signal-regulated kinase (ERK)1/2 and p38 mitogen-activated protein kinase (MAPK) was markedly upregulated by treating with high amount of HMGB1, while pretreatment with ERK1/2 and p38 MAPK-specific inhibitors (U0126 and SB203580) could attenuate suppression of T cell immune function and nuclear factor of activated T cell (NFAT) activation induced by HMGB1, respectively. HMGB1-induced activity of ERK1/2 and p38 was not fully inhibited in the presence of U0126 or SB203580. Interestingly, overexpression of Mfn-2 had no marked effect on HMGB1-mediated activation of MAPK, but could attenuate the suppressive effect of HMGB1 on the activity of NFAT. Thus, the mechanisms involved in HMGB1-induced T cell immune dysfunction in vitro at least partly include suppression of Mfn-2 expression, overactivation of ERK1/2, p38 MAPK, and intervention of NFAT activation, while the protective effect of Mfn-2 on T cell immune dysfunction induced by HMGB1 is dependent on other signaling pathway associated with NFAT, but not MAPK. Taken together, we conclude that overactivation of MAPK and suppression of Mfn-2 expression are two independent events in HMGB1-mediated T cell immune dysfunction. PMID:23697559
Saison, J; Ferry, T; Demaret, J; Maucort Boulch, D; Venet, F; Perpoint, T; Ader, F; Icard, V; Chidiac, C; Monneret, G
2014-06-01
The mechanisms sustaining the absence of complete immune recovery in HIV-infected patients upon long-term effective highly active anti-retroviral therapy (HAART) remain elusive. Immune activation, regulatory T cells (T(regs)) or very low-level viraemia (VLLV) have been alternatively suspected, but rarely investigated simultaneously. We performed a cross-sectional study in HIV-infected aviraemic subjects (mean duration of HAART: 12 years) to concomitantly assess parameters associated independently with inadequate immunological response. Patients were classified as complete immunological responders (cIR, n = 48) and inadequate immunological responders (iIR, n = 39), depending on the CD4(+) T cell count (> or < 500/mm(3)). Clinical and virological data (including very low-level viraemia) were collected. In parallel, immunophenotyping of CD4(+) lymphocytes, including T(reg) subsets, and CD8(+) T cells was performed. Percentages of activated CD4(+) T cells, T(regs), effector T(regs) and terminal effector T(regs) were found to be significantly elevated in iIR. Neither the percentage of activated CD8(+) T cells nor VLLV were found to be associated with iIR. In the multivariate analysis, nadir of CD4(+) T cell count and percentage of T(regs) were the only two parameters associated independently with iIR [odds ratio (OR) = 2·339, P = 0·001, and OR = 0·803, P = 0·041]. We present here the largest study investigating simultaneously the immune response to long-term HAART, activation of CD4(+) and CD8(+) T cells, T(reg) percentages and very low-level viraemia. Causative interactions between T(regs) and CD4(+) T cells should now be explored prospectively in a large patients cohort. © 2014 British Society for Immunology.
Johnson, Teresa R.; Hong, Seokmann; Van Kaer, Luc; Koezuka, Yasuhiko; Graham, Barney S.
2002-01-01
CD1d-deficient mice have normal numbers of T lymphocytes and natural killer cells but lack Vα14+ natural killer T cells. Respiratory syncytial virus (RSV) immunopathogenesis was evaluated in 129×C57BL/6, C57BL/6, and BALB/c CD1d−/− mice. CD8+ T lymphocytes were reduced in CD1d−/− mice of all strains, as shown by cell surface staining and major histocompatibility complex class I tetramer analysis, and resulted in strain-specific alterations in illness, viral clearance, and gamma interferon (IFN-γ) production. Transient activation of NK T cells in CD1d+/+ mice by α-GalCer resulted in reduced illness and delayed viral clearance. These data suggest that early IFN-γ production and efficient induction of CD8+-T-cell responses during primary RSV infection require CD1d-dependent events. We also tested the ability of α-GalCer as an adjuvant to modulate the type 2 immune responses induced by RSV glycoprotein G or formalin-inactivated RSV immunization. However, immunized CD1-deficient or α-GalCer-treated wild-type mice did not exhibit diminished disease following RSV challenge. Rather, some disease parameters, including cytokine production, eosinophilia, and viral clearance, were increased. These findings indicate that CD1d-dependent NK T cells play a role in expansion of CD8+ T cells and amplification of antiviral responses to RSV. PMID:11932395
Lee, Sung Won; Park, Hyun Jung; Kim, Nayoung; Hong, Seokmann
2013-01-01
Natural killer dendritic cells (NKDCs) possess potent anti-tumor activity, but the cellular effect of NKDC interactions with other innate immune cells is unclear. In this study, we demonstrate that the interaction of NKDCs and natural killer T (NKT) cells is required for the anti-tumor immune responses that are elicited by α -galactosylceramide ( α -GC) in mice. The rapid and strong expression of interferon- γ by NKDCs after α -GC stimulation was dependent on NKT cells. Various NK and DC molecular markers and cytotoxic molecules were up-regulated following α -GC administration. This up-regulation could improve NKDC presentation of tumor antigens and increase cytotoxicity against tumor cells. NKDCs were required for the stimulation of DCs, NK cells, and NKT cells. The strong anti-tumor immune responses elicited by α -GC may be due to the down-regulation of regulatory T cells. Furthermore, the depletion of NKDCs dampened the tumor clearance mediated by α -GC-stimulated NKT cells in vivo. Taken together, these results indicate that complex interactions of innate immune cells might be required to achieve optimal anti-tumor immune responses during the early stages of tumorigenesis.
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Tay, Szun Szun; Wong, Yik Chun; McDonald, David M; Wood, Nicole A W; Roediger, Ben; Sierro, Frederic; Mcguffog, Claire; Alexander, Ian E; Bishop, G Alex; Gamble, Jennifer R; Weninger, Wolfgang; McCaughan, Geoffrey W; Bertolino, Patrick; Bowen, David G
2014-06-24
CD8 T-cell responses to liver-expressed antigens range from deletional tolerance to full effector differentiation resulting in overt hepatotoxicity. The reasons for these heterogeneous outcomes are not well understood. To identify factors that govern the fate of CD8 T cells activated by hepatocyte-expressed antigen, we exploited recombinant adenoassociated viral vectors that enabled us to vary potential parameters determining these outcomes in vivo. Our findings reveal a threshold of antigen expression within the liver as the dominant factor determining T-cell fate, irrespective of T-cell receptor affinity or antigen cross-presentation. Thus, when a low percentage of hepatocytes expressed cognate antigen, high-affinity T cells developed and maintained effector function, whereas, at a high percentage, they became functionally exhausted and silenced. Exhaustion was not irreversibly determined by initial activation, but was maintained by high intrahepatic antigen load during the early phase of the response; cytolytic function was restored when T cells primed under high antigen load conditions were transferred into an environment of low-level antigen expression. Our study reveals a hierarchy of factors dictating the fate of CD8 T cells during hepatic immune responses, and provides an explanation for the different immune outcomes observed in a variety of immune-mediated liver pathologic conditions.
Adam, Jacqueline; Wuillemin, Natascha; Watkins, Stephan; Jamin, Heidi; Eriksson, Klara K; Villiger, Peter; Fontana, Stefano; Pichler, Werner J; Yerly, Daniel
2014-01-01
Abacavir hypersensitivity is a severe hypersensitivity reaction which occurs exclusively in carriers of the HLA-B*57∶01 allele. In vitro culture of PBMC with abacavir results in the outgrowth of abacavir-reacting CD8+ T cells, which release IFNγ and are cytotoxic. How this immune response is induced and what is recognized by these T cells is still a matter of debate. We analyzed the conditions required to develop an abacavir-dependent T cell response in vitro. The abacavir reactivity was independent of co-stimulatory signals, as neither DC maturation nor release of inflammatory cytokines were observed upon abacavir exposure. Abacavir induced T cells arose in the absence of professional APC and stemmed from naïve and memory compartments. These features are reminiscent of allo-reactivity. Screening for allo-reactivity revealed that about 5% of generated T cell clones (n = 136) from three donors were allo-reactive exclusively to the related HLA-B*58∶01. The addition of peptides which can bind to the HLA-B*57∶01-abacavir complex and to HLA-B*58∶01 during the induction phase increased the proportion of HLA-B*58∶01 allo-reactive T cell clones from 5% to 42%. In conclusion, abacavir can alter the HLA-B*57∶01-peptide complex in a way that mimics an allo-allele ('altered self-allele') and create the potential for robust T cell responses.
Adam, Jacqueline; Wuillemin, Natascha; Watkins, Stephan; Jamin, Heidi; Eriksson, Klara K.; Villiger, Peter; Fontana, Stefano; Pichler, Werner J.; Yerly, Daniel
2014-01-01
Abacavir hypersensitivity is a severe hypersensitivity reaction which occurs exclusively in carriers of the HLA-B*57∶01 allele. In vitro culture of PBMC with abacavir results in the outgrowth of abacavir-reacting CD8+ T cells, which release IFNγ and are cytotoxic. How this immune response is induced and what is recognized by these T cells is still a matter of debate. We analyzed the conditions required to develop an abacavir-dependent T cell response in vitro. The abacavir reactivity was independent of co-stimulatory signals, as neither DC maturation nor release of inflammatory cytokines were observed upon abacavir exposure. Abacavir induced T cells arose in the absence of professional APC and stemmed from naïve and memory compartments. These features are reminiscent of allo-reactivity. Screening for allo-reactivity revealed that about 5% of generated T cell clones (n = 136) from three donors were allo-reactive exclusively to the related HLA-B*58∶01. The addition of peptides which can bind to the HLA-B*57∶01-abacavir complex and to HLA-B*58∶01 during the induction phase increased the proportion of HLA-B*58∶01 allo-reactive T cell clones from 5% to 42%. In conclusion, abacavir can alter the HLA-B*57∶01-peptide complex in a way that mimics an allo-allele (‘altered self-allele’) and create the potential for robust T cell responses. PMID:24751900
Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W
2012-01-01
Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, p<0.0001). The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.
Natural killer cells regulate T cell immune responses in primary biliary cirrhosis.
Shimoda, Shinji; Hisamoto, Satomi; Harada, Kenichi; Iwasaka, Sho; Chong, Yong; Nakamura, Minoru; Bekki, Yuki; Yoshizumi, Tomoharu; Shirabe, Ken; Ikegami, Toru; Maehara, Yoshihiko; He, Xiao-Song; Gershwin, M Eric; Akashi, Koichi
2015-12-01
The hallmark of primary biliary cirrhosis (PBC) is the presence of autoreactive T- and B-cell responses that target biliary epithelial cells (BECs). Biliary cell cytotoxicity is dependent upon initiation of innate immune responses followed by chronic adaptive, as well as bystander, mechanisms. Critical to these mechanisms are interactions between natural killer (NK) cells and BECs. We have taken advantage of the ability to isolate relatively pure viable preparations of liver-derived NK cells, BECs, and endothelial cells, and studied interactions between NK cells and BECs and focused on the mechanisms that activate autoreactive T cells, their dependence on interferon (IFN)-γ, and expression of BEC major histocompatibility complex (MHC) class I and II molecules. Here we show that at a high NK/BEC ratio, NK cells are cytotoxic for autologous BECs, but are not dependent on autoantigen, yet still activate autoreactive CD4(+) T cells in the presence of antigen presenting cells. In contrast, at a low NK/BEC ratio, BECs are not lysed, but IFN-γ production is induced, which facilitates expression of MHC class I and II molecules on BEC and protects them from lysis upon subsequent exposure to autoreactive NK cells. Furthermore, IFN-γ secreted from NK cells after exposure to autologous BECs is essential for this protective function and enables autoreactive CD4(+) T cells to become cytopathic. NK cell-mediated innate immune responses are likely critical at the initial stage of PBC, but also facilitate and maintain the chronic cytopathic effect of autoantigen-specific T cells, essential for progression of disease. © 2015 by the American Association for the Study of Liver Diseases.
Tissue reservoirs of antiviral T cell immunity in persistent human CMV infection
Gordon, Claire L.; Thome, Joseph J.C.; Igarashi, Suzu
2017-01-01
T cell responses to viruses are initiated and maintained in tissue sites; however, knowledge of human antiviral T cells is largely derived from blood. Cytomegalovirus (CMV) persists in most humans, requires T cell immunity to control, yet tissue immune responses remain undefined. Here, we investigated human CMV-specific T cells, virus persistence and CMV-associated T cell homeostasis in blood, lymphoid, mucosal and secretory tissues of 44 CMV seropositive and 28 seronegative donors. CMV-specific T cells were maintained in distinct distribution patterns, highest in blood, bone marrow (BM), or lymph nodes (LN), with the frequency and function in blood distinct from tissues. CMV genomes were detected predominantly in lung and also in spleen, BM, blood and LN. High frequencies of activated CMV-specific T cells were found in blood and BM samples with low virus detection, whereas in lung, CMV-specific T cells were present along with detectable virus. In LNs, CMV-specific T cells exhibited quiescent phenotypes independent of virus. Overall, T cell differentiation was enhanced in sites of viral persistence with age. Together, our results suggest tissue T cell reservoirs for CMV control shaped by both viral and tissue-intrinsic factors, with global effects on homeostasis of tissue T cells over the lifespan. PMID:28130404
Tissue reservoirs of antiviral T cell immunity in persistent human CMV infection.
Gordon, Claire L; Miron, Michelle; Thome, Joseph J C; Matsuoka, Nobuhide; Weiner, Joshua; Rak, Michael A; Igarashi, Suzu; Granot, Tomer; Lerner, Harvey; Goodrum, Felicia; Farber, Donna L
2017-03-06
T cell responses to viruses are initiated and maintained in tissue sites; however, knowledge of human antiviral T cells is largely derived from blood. Cytomegalovirus (CMV) persists in most humans, requires T cell immunity to control, yet tissue immune responses remain undefined. Here, we investigated human CMV-specific T cells, virus persistence and CMV-associated T cell homeostasis in blood, lymphoid, mucosal and secretory tissues of 44 CMV seropositive and 28 seronegative donors. CMV-specific T cells were maintained in distinct distribution patterns, highest in blood, bone marrow (BM), or lymph nodes (LN), with the frequency and function in blood distinct from tissues. CMV genomes were detected predominantly in lung and also in spleen, BM, blood and LN. High frequencies of activated CMV-specific T cells were found in blood and BM samples with low virus detection, whereas in lung, CMV-specific T cells were present along with detectable virus. In LNs, CMV-specific T cells exhibited quiescent phenotypes independent of virus. Overall, T cell differentiation was enhanced in sites of viral persistence with age. Together, our results suggest tissue T cell reservoirs for CMV control shaped by both viral and tissue-intrinsic factors, with global effects on homeostasis of tissue T cells over the lifespan. @Gordon et al.
Contact hypersensitivity: the mechanism of immune responses and T cell balance.
Watanabe, Hideaki; Unger, Mark; Tuvel, Brandon; Wang, Binghe; Sauder, Daniel N
2002-04-01
The skin is the largest organ in the human body. It acts not only as an important structural barrier against injury but also as a peripheral arm of the immune system. Elucidating the characteristics of this latter function has taken on renewed importance in recent years. Exposure to chemicals in everyday life has increased exponentially over the past decades. This has been accompanied by an increased incidence of contact hypersensitivity (CHS), a dendritic cell-dependent, T cell-derived, cytokine-mediated skin inflammation. Cytokines derived from Langerhans cells (i.e., interleukin-12 [IL-12]) and from T cell (i.e., interferon-gamma [IFN-gamma], IL-4, and IL-10) play a pivotal role in the induction and initiation of CHS. Developments in immunology and molecular biology have improved our understanding of the molecular mechanisms underlying this immune response. However, the conflicting opinions that continue to characterize discussions of CHS supply clear testimony that our knowledge is as yet incomplete.
Saison, J; Ferry, T; Demaret, J; Maucort Boulch, D; Venet, F; Perpoint, T; Ader, F; Icard, V; Chidiac, C; Monneret, G
2014-01-01
The mechanisms sustaining the absence of complete immune recovery in HIV-infected patients upon long-term effective highly active anti-retroviral therapy (HAART) remain elusive. Immune activation, regulatory T cells (Tregs) or very low-level viraemia (VLLV) have been alternatively suspected, but rarely investigated simultaneously. We performed a cross-sectional study in HIV-infected aviraemic subjects (mean duration of HAART: 12 years) to concomitantly assess parameters associated independently with inadequate immunological response. Patients were classified as complete immunological responders (cIR, n = 48) and inadequate immunological responders (iIR, n = 39), depending on the CD4+ T cell count (> or < 500/mm3). Clinical and virological data (including very low-level viraemia) were collected. In parallel, immunophenotyping of CD4+ lymphocytes, including Treg subsets, and CD8+ T cells was performed. Percentages of activated CD4+ T cells, Tregs, effector Tregs and terminal effector Tregs were found to be significantly elevated in iIR. Neither the percentage of activated CD8+ T cells nor VLLV were found to be associated with iIR. In the multivariate analysis, nadir of CD4+ T cell count and percentage of Tregs were the only two parameters associated independently with iIR [odds ratio (OR) = 2·339, P = 0·001, and OR = 0·803, P = 0·041]. We present here the largest study investigating simultaneously the immune response to long-term HAART, activation of CD4+ and CD8+ T cells, Treg percentages and very low-level viraemia. Causative interactions between Tregs and CD4+ T cells should now be explored prospectively in a large patients cohort. PMID:24460818
Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana
2012-12-11
To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.
Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.
Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M
2017-09-04
Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.
Retinoic Acid as a Modulator of T Cell Immunity
Bono, Maria Rosa; Tejon, Gabriela; Flores-Santibañez, Felipe; Fernandez, Dominique; Rosemblatt, Mario; Sauma, Daniela
2016-01-01
Vitamin A, a generic designation for an array of organic molecules that includes retinal, retinol and retinoic acid, is an essential nutrient needed in a wide array of aspects including the proper functioning of the visual system, maintenance of cell function and differentiation, epithelial surface integrity, erythrocyte production, reproduction, and normal immune function. Vitamin A deficiency is one of the most common micronutrient deficiencies worldwide and is associated with defects in adaptive immunity. Reports from epidemiological studies, clinical trials and experimental studies have clearly demonstrated that vitamin A plays a central role in immunity and that its deficiency is the cause of broad immune alterations including decreased humoral and cellular responses, inadequate immune regulation, weak response to vaccines and poor lymphoid organ development. In this review, we will examine the role of vitamin A in immunity and focus on several aspects of T cell biology such as T helper cell differentiation, function and homing, as well as lymphoid organ development. Further, we will provide an overview of the effects of vitamin A deficiency in the adaptive immune responses and how retinoic acid, through its effect on T cells can fine-tune the balance between tolerance and immunity. PMID:27304965
Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection
Duan, Susu; Thomas, Paul G.
2016-01-01
Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022
Méndez-Lagares, Gema; Lu, Ding; Merriam, David; Baker, Christopher A; Villinger, François; Van Rompay, Koen K A; McCune, Joseph M; Hartigan-O'Connor, Dennis J
2017-11-01
Human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) replicate during acute infection in lymphocytes of the gastrointestinal tract, before disseminating systemically. Localized replication and associated loss of gut-resident CD4 + T cells occur regardless of the portal of entry of the virus (e.g., intravenous vs. rectal). Thus, HIV and SIV are tropic for gut tissue, and their pathogenesis requires the special environment of the intestine. T helper 17 (Th17) cells are important contributors to microbial defense in the gut that are vulnerable to HIV infection and whose loss is associated with translocation of microbial products to the systemic circulation, leading to chronic immune activation and disease progression. Interleukin (IL)-21 promotes differentiation and survival of Th17 cells and stimulates CD8 + T cell function. By promoting Th17 cell survival, IL-21 could limit bacterial translocation and immune activation in the setting of acute or rebounding HIV/SIV disease. In this study, we tested the effect of recombinant IL-21-IgFc treatment, given at the time of infection, on SIV mac251 infection. We found that rIL-21-IgFc decreases immune activation and maintains effective antiviral responses by CD8 + T cells in blood, but this maintenance is not associated with lower viral loads. rIL-21-IgFc treatment also did not generally support Th17 cell populations, but Th17 cells remained strongly and independently associated with control of plasma viremia. For example, the single animal exhibiting greatest control over viremia in our study also manifested the highest levels of IL-21 in plasma, Th17 cell maintenance in blood, and Th17 cells in intestinal tissue. These findings provide rationale for further exploration of IL-21 treatment as a support for host CD8 + T cell responses in HIV cure strategies.
Interplay between behavioural thermoregulation and immune response in mealworms.
Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco
2012-11-01
Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Tumor exosomes block dendritic cells maturation to decrease the T cell immune response.
Ning, Yongling; Shen, Kai; Wu, Qiyong; Sun, Xiao; Bai, Yu; Xie, Yewen; Pan, Jie; Qi, Chunjian
2018-07-01
Tumors can induce the generation and accumulation of immunosuppression in a tumor microenvironment, contributing to the tumor's escape from immunological surveillance. Although tumor antigen-pulsed dendritic cell can improve anti-tumor immune responses, tumor associated regulatory dendritic cells are involved in the induction of immune tolerance. The current study sought to investigate whether exosomes produced by tumor cells had any effect on DCs in immune suppression. In this study, we examined the effect of tumor exosomes on DCs and found that exosomes from LLC Lewis lung carcinoma or 4T1 breast cancer cell blocked the differentiation of myeloid precursor cells into CD11c + DCs and induced cell apoptosis. Tumor exosome treatment inhibited the maturation and migration of DCs and promoted the immune suppression of DCs. The treatment of tumor exosomes drastically decreased CD4 + IFN-γ + Th1 differentiation but increased the rates of regulatory T (Treg) cells. The immunosuppressive ability of tumor exosome-treated DCs were partially restored with PD-L1 blockage. These data suggested that PD-L1 played a role in tumor exosome-induced DC-associated immune suppression. Copyright © 2018 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
New Perspectives on the Role of Vitiligo in Immune Responses to Melanoma
Byrne, Katelyn T.; Turk, Mary Jo
2011-01-01
Melanoma-associated vitiligo is the best-studied example of the linkage between tumor immunity and autoimmunity. Although vitiligo is an independent positive prognostic factor for melanoma patients, the autoimmune destruction of melanocytes was long thought to be merely a side effect of robust anti-tumor immunity. However, new data reveal a key role for vitiligo in supporting T cell responses to melanoma. This research perspective reviews the history of melanoma-associated vitiligo in patients, the experimental studies that form the basis for understanding this relationship, and the unique characteristics of melanoma-specific CD8 T cells found in hosts with vitiligo. We also discuss the implications of our recent findings for the interpretation of patient responses, and the design of next-generation cancer immunotherapies. PMID:21911918
Human Memory CD4+ T Cell Immune Responses against Giardia lamblia
Sørnes, Steinar; Peirasmaki, Dimitra; Svärd, Staffan; Langeland, Nina
2015-01-01
The intestinal protozoan parasite Giardia lamblia may cause severe prolonged diarrheal disease or pass unnoticed as an asymptomatic infection. T cells seem to play an important role in the immune response to Giardia infection, and memory responses may last years. Recently, TH17 responses have been found in three animal studies of Giardia infection. The aim of this study was to characterize the human CD4+ T cell responses to Giardia. Peripheral blood mononuclear cells (PBMCs) were obtained from 21 returning travelers with recent or ongoing giardiasis and 12 low-risk healthy controls and stimulated in vitro with Giardia lamblia proteins. Production of tumor necrosis factor alpha (TNF-α), gamma interferon, interleukin-17A (IL-17A), IL-10, and IL-4 was measured in CD4+ effector memory (EM) T cells after 24 h by flow cytometry. After 6 days of culture, activation and proliferation were measured by flow cytometry, while an array of inflammatory cytokine levels in supernatants were measured with multiplex assays. We found the number of IL-17A-producing CD4+ EM T cells, as well as that of cells simultaneously producing both IL-17A and TNF-α, to be significantly elevated in the Giardia-exposed individuals after 24 h of antigen stimulation. In supernatants of PBMCs stimulated with Giardia antigens for 6 days, we found inflammation-associated cytokines, including 1L-17A, as well as CD4+ T cell activation and proliferation, to be significantly elevated in the Giardia-exposed individuals. We conclude that symptomatic Giardia infection in humans induces a CD4+ EM T cell response of which IL-17A production seems to be an important component. PMID:26376930
Pathogen-Sensing and Regulatory T Cells: Integrated Regulators of Immune Responses
Grossman, Zvi; Paul, William E.
2014-01-01
We present the concept that pathogen-sensing and Tregs mutually regulate immune responses to conventional and tumor antigens through countervailing effects on dendritic cells. Normally, conventional CD4 T cells recognizing their cognate antigen-presented by a dendritic cell will respond only if the dendritic cell also receives a signal through its pathogen-sensing/ danger / adjuvant recognition systems (the pathogen-sensing triad). However, if Tregs capable of interacting with the same DC are absent, dendritic cells are competent to present antigens, both foreign and self, even without the stimulation provided by the pathogen-sensing triad. Tregs recognizing an antigen presented by the DC that is also presenting antigen to a conventional CD4 T cell will prevent such responses but a signal delivered by a member of the pathogen-sensing traid will overcome the Tregs’inhibitory action and will allow responses to go forward. These considerations take on special meaning for responses to “weak antigens” such as many of the antigens displayed by spontaneous human tumors. PMID:24894087
Basso, B; Marini, V
2015-03-01
Trypanosoma cruzi is a real challenge to the host's immune system, because it requires strong humoral and cellular immune response to remove circulating trypomastigote forms, and to prevent the replication of amastigote forms in tissues, involving many regulator and effector components. This protozoan is responsible for Chagas disease, a major public health problem in Latinamerica. We have developed a model of vaccination with Trypanosoma rangeli, a parasite closely related to T. cruzi, but nonpathogenic to humans, which reduces the infectiousness in three different species of animals, mice, dogs and guinea pigs, against challenge with T. cruzi. In a previous work, we demonstrated that mice vaccinated with T. rangeli showed important soluble mediators that stimulate phagocytic activity versus only infected groups. The aim of this work was to study the innate immune response in mice vaccinated or not with T. rangeli. Different population cells and some soluble mediators (cytokines) in peritoneal fluid and plasma in mice vaccinated-infected and only infected with T. cruzi were studied. In the first hours of challenge vaccinated mice showed an increase of macrophages, NK, granulocytes, and regulation of IL6, IFNγ, TNFα and IL10, with an increase of IL12, with respect to only infected mice. Furthermore an increase was observed of Li T, Li B responsible for adaptative response. Finally the findings showed that the innate immune response plays an important role in vaccinated mice for the early elimination of the parasites, complementary with the adaptative immune response, suggesting that vaccination with T. rangeli modulates the innate response, which develops some kind of immunological memory, recognizing shared antigens with T. cruzi. These results could contribute to the knowledge of new mechanisms which would have an important role in the immune response to Chagas disease. Copyright © 2014 Elsevier GmbH. All rights reserved.
Dulek, Daniel E.; Newcomb, Dawn C.; Toki, Shinji; Goliniewska, Kasia; Cephus, Jacqueline; Reiss, Sara; Bates, John T.; Crowe, James E.; Boyd, Kelli L.; Moore, Martin L.; Zhou, Weisong
2014-01-01
ABSTRACT Immune-mediated lung injury is a hallmark of lower respiratory tract illness caused by respiratory syncytial virus (RSV). STAT4 plays a critical role in CD4+ Th1 lineage differentiation and gamma interferon (IFN-γ) protein expression by CD4+ T cells. As CD4+ Th1 differentiation is associated with negative regulation of CD4+ Th2 and Th17 differentiation, we hypothesized that RSV infection of STAT4−/− mice would result in enhanced lung Th2 and Th17 inflammation and impaired lung Th1 inflammation compared to wild-type (WT) mice. We performed primary and secondary RSV challenges in WT and STAT4−/− mice and used STAT1−/− mice as a positive control for the development of RSV-specific lung Th2 and Th17 inflammation during primary challenge. Primary RSV challenge of STAT4−/− mice resulted in decreased T-bet and IFN-γ expression levels in CD4+ T cells compared to those of WT mice. Lung Th2 and Th17 inflammation did not develop in primary RSV-challenged STAT4−/− mice. Decreased IFN-γ expression by NK cells, CD4+ T cells, and CD8+ T cells was associated with attenuated weight loss and enhanced viral clearance with primary challenge in STAT4−/− mice compared to WT mice. Following secondary challenge, WT and STAT4−/− mice also did not develop lung Th2 or Th17 inflammation. In contrast to primary challenge, secondary RSV challenge of STAT4−/− mice resulted in enhanced weight loss, an increased lung IFN-γ expression level, and an increased lung RSV-specific CD8+ T cell response compared to those of WT mice. These data demonstrate that STAT4 regulates the RSV-specific CD8+ T cell response to secondary infection but does not independently regulate lung Th2 or Th17 immune responses to RSV challenge. IMPORTANCE STAT4 is a protein critical for both innate and adaptive immune responses to viral infection. Our results show that STAT4 regulates the immune response to primary and secondary challenge with RSV but does not restrain RSV
Kai, S; Tanaka, J; Nomoto, K; Torisu, M
1979-01-01
The effects of the anti-tumour agent OK-432 on the immune response to hamster erythrocytes (HRBC) and nucleated chicken erythrocytes (CRBC) were studied in inbred SL mice. Mice were treated repeatedly with OK-432 before immunization with erythrocytes in saline. The cytotoxicity of CRBC-primed spleen cells, as demonstrated by 51Cr release from labelled CRBC, was markedly increased by treatment with OD-432. The delayed footpad reaction to CRBC was significantly augmented by treatment with OK-432. These results in mice indicate that OK-432 can enhance the cellular immune responses which require the contribution of T cells. Such an activation of T cells by OK-432 was observed in the humoral immune response to a trinitrophenyl group. Augmentation of anti-hapten antibody production, suggesting the enhancement of helper T cell activity by OK-432, was noticed after immunization with trinitrophenyl conjugated to erythrocytes. Furthermore, this enhancement of helper T cell activity by OK-432 was confirmed by utilizing an adoptive transfer system. These results support the possibility that T cell activation may be one of the important effects of OK-432 as an immunopotentiator. PMID:314874
Harder, Jeffrey M; Braine, Catherine E; Williams, Pete A; Zhu, Xianjun; MacNicoll, Katharine H; Sousa, Gregory L; Buchanan, Rebecca A; Smith, Richard S; Libby, Richard T; Howell, Gareth R; John, Simon W M
2017-05-09
Various immune response pathways are altered during early, predegenerative stages of glaucoma; however, whether the early immune responses occur secondarily to or independently of neuronal dysfunction is unclear. To investigate this relationship, we used the Wld s allele, which protects from axon dysfunction. We demonstrate that DBA/2J .Wld s mice develop high intraocular pressure (IOP) but are protected from retinal ganglion cell (RGC) dysfunction and neuroglial changes that otherwise occur early in DBA/2J glaucoma. Despite this, immune pathways are still altered in DBA/2J .Wld s mice. This suggests that immune changes are not secondary to RGC dysfunction or altered neuroglial interactions, but may be directly induced by the increased strain imposed by high IOP. One early immune response following IOP elevation is up-regulation of complement C3 in astrocytes of DBA/2J and DBA/2J. Wld s mice. Unexpectedly, because the disruption of other complement components, such as C1Q, is protective in glaucoma, C3 deficiency significantly increased the number of DBA/2J eyes with nerve damage and RGC loss at an early time point after IOP elevation. Transcriptional profiling of C3-deficient cultured astrocytes implicated EGFR signaling as a hub in C3-dependent responses. Treatment with AG1478, an EGFR inhibitor, also significantly increased the number of DBA/2J eyes with glaucoma at the same early time point. These findings suggest that C3 protects from early glaucomatous damage, a process that may involve EGFR signaling and other immune responses in the optic nerve head. Therefore, therapies that target specific components of the complement cascade, rather than global inhibition, may be more applicable for treating human glaucoma.
Harder, Jeffrey M.; Braine, Catherine E.; Williams, Pete A.; Zhu, Xianjun; MacNicoll, Katharine H.; Sousa, Gregory L.; Buchanan, Rebecca A.; Smith, Richard S.; Howell, Gareth R.; John, Simon W. M.
2017-01-01
Various immune response pathways are altered during early, predegenerative stages of glaucoma; however, whether the early immune responses occur secondarily to or independently of neuronal dysfunction is unclear. To investigate this relationship, we used the Wlds allele, which protects from axon dysfunction. We demonstrate that DBA/2J.Wlds mice develop high intraocular pressure (IOP) but are protected from retinal ganglion cell (RGC) dysfunction and neuroglial changes that otherwise occur early in DBA/2J glaucoma. Despite this, immune pathways are still altered in DBA/2J.Wlds mice. This suggests that immune changes are not secondary to RGC dysfunction or altered neuroglial interactions, but may be directly induced by the increased strain imposed by high IOP. One early immune response following IOP elevation is up-regulation of complement C3 in astrocytes of DBA/2J and DBA/2J.Wlds mice. Unexpectedly, because the disruption of other complement components, such as C1Q, is protective in glaucoma, C3 deficiency significantly increased the number of DBA/2J eyes with nerve damage and RGC loss at an early time point after IOP elevation. Transcriptional profiling of C3-deficient cultured astrocytes implicated EGFR signaling as a hub in C3-dependent responses. Treatment with AG1478, an EGFR inhibitor, also significantly increased the number of DBA/2J eyes with glaucoma at the same early time point. These findings suggest that C3 protects from early glaucomatous damage, a process that may involve EGFR signaling and other immune responses in the optic nerve head. Therefore, therapies that target specific components of the complement cascade, rather than global inhibition, may be more applicable for treating human glaucoma. PMID:28446616
Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor
2008-04-01
Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.
Frencher, James T.; Shen, Hongbo; Yan, Lin; Wilson, Jessica O.; Freitag, Nancy E.; Rizzo, Alicia N.; Chen, Crystal Y.; Chen, Zheng W.
2014-01-01
Whereas infection or immunization of humans/primates with microbes coproducing HMBPP/IPP can remarkably activate Vγ2Vδ2 T cells, in vivo studies have not been done to dissect HMBPP- and IPP-driven expansion, pulmonary trafficking, effector functions, and memory polarization of Vγ2Vδ2 T cells. We define these phosphoantigen-host interplays by comparative immunizations of macaques with the HMBPP/IPP-coproducing Listeria ΔactA prfA* and HMBPP-deficient Listeria ΔactAΔgcpE prfA* mutant. The HMBPP-deficient ΔgcpE mutant shows lower ability to expand Vγ2Vδ2 T cells in vitro than the parental HMBPP-producing strain but displays comparably attenuated infectivity or immunogenicity. Respiratory immunization of macaques with the HMBPP-deficient mutant elicits lower pulmonary and systemic responses of Vγ2Vδ2 T cells compared with the HMBPP-producing vaccine strain. Interestingly, HMBPP-deficient mutant reimmunization or boosting elicits enhanced responses of Vγ2Vδ2 T cells, but the magnitude is lower than that by HMBPP-producing listeria. HMBPP-deficient listeria differentiated fewer Vγ2Vδ2 T effector cells capable of coproducing IFN-γ and TNF-α and inhibiting intracellular listeria than HMBPP-producing listeria. Furthermore, HMBPP deficiency in listerial immunization influences memory polarization of Vγ2Vδ2 T cells. Thus, both HMBPP and IPP production in listerial immunization or infection elicit systemic/pulmonary responses and differentiation of Vγ2Vδ2 T cells, but a role for HMBPP is more dominant. Findings may help devise immune intervention. PMID:25114162
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Donglai; Wang, Chu; Hora, Bhavna
Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less
Liu, Donglai; Wang, Chu; Hora, Bhavna; ...
2017-10-10
Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less
Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P.; Grassi, Maria Fernanda R.; Carvalho, Edgar M.
2016-01-01
T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4+ T cells expressing IFN-γ, TNF and IL-10 in response to TT were lower in the (HC) than in the controls. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it’s necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4+ T cell immune responses after vaccination. PMID:27282836
Tolerance induction of IgG+ memory B cells by T cell-independent type II antigens.
Haniuda, Kei; Nojima, Takuya; Ohyama, Kyosuke; Kitamura, Daisuke
2011-05-15
Memory B cells generated during a T cell-dependent immune response rapidly respond to a secondary immunization by producing abundant IgG Abs that bind cognate Ag with high affinity. It is currently unclear whether this heightened recall response by memory B cells is due to augmented IgG-BCR signaling, which has only been demonstrated in the context of naive transgenic B cells. To address this question, we examined whether memory B cells can respond in vivo to Ags that stimulate only through BCR, namely T cell-independent type II (TI-II) Ags. In this study, we show that the TI-II Ag (4-hydroxy-3-nitrophenyl) acetyl (NP)-Ficoll cannot elicit the recall response in mice first immunized with the T cell-dependent Ag NP-chicken γ-globulin. Moreover, the NP-Ficoll challenge in vivo as well as in vitro significantly inhibits a subsequent recall response to NP-chicken γ-globulin in a B cell-intrinsic manner. This NP-Ficoll-mediated tolerance is caused by the preferential elimination of IgG(+) memory B cells binding to NP with high affinity. These data indicate that BCR cross-linking with a TI-II Ag does not activate IgG(+) memory B cells, but rather tolerizes them, identifying a terminal checkpoint of memory B cell differentiation that may prevent autoimmunity.
Conditional deletion of SLP-76 in mature T cells abrogates peripheral immune responses.
Wu, Gregory F; Corbo, Evann; Schmidt, Michelle; Smith-Garvin, Jennifer E; Riese, Matthew J; Jordan, Martha S; Laufer, Terri M; Brown, Eric J; Maltzman, Jonathan S
2011-07-01
The adaptor protein Src homology 2 domain-containing leukocyte-specific protein of 76 kDa (SLP-76) is central to the organization of intracellular signaling downstream of the T-cell receptor (TCR). Evaluation of its role in mature, primary T cells has been hampered by developmental defects that occur in the absence of WT SLP-76 protein in thymocytes. Here, we show that following tamoxifen-regulated conditional deletion of SLP-76, mature, antigen-inexperienced T cells maintain normal TCR surface expression but fail to transduce TCR-generated signals. Conditionally deficient T cells fail to proliferate in response to antigenic stimulation or a lymphopenic environment. Mice with induced deletion of SLP-76 are resistant to induction of the CD4+ T-cell-mediated autoimmune disease experimental autoimmune encephalomyelitis. Altogether, our findings demonstrate the critical role of SLP-76-mediated signaling in initiating T-cell-directed immune responses both in vitro and in vivo and highlight the ability to analyze signaling processes in mature T cells in the absence of developmental defects. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Verification of immune response optimality through cybernetic modeling.
Batt, B C; Kompala, D S
1990-02-09
An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.
TLR10 is a B-cell Intrinsic Suppressor of Adaptive Immune Responses
Hess, Nicholas J.; Jiang, Song; Li, Xinyan; Guan, Yue; Tapping, Richard I.
2016-01-01
Toll-like receptors (TLRs) play a central role in the initiation of adaptive immune responses with several TLR agonists acting as known B-cell mitogens. Despite thousands of publications on TLRs, the function of TLR10 remains unknown. We have found that antibody mediated engagement of TLR10 on primary human B-cells suppresses B-cell proliferation, cytokine production and signal transduction. When challenged with either a T-independent or T-dependent antigen, TLR10 transgenic mice exhibit diminished antibody responses. Adoptive transfer of splenic B-cells into B-cell deficient mice revealed that the suppressive effects on antigen-specific humoral immune responses are entirely B-cell intrinsic. Our results demonstrate that TLR10 has a functional role within the B-cell lineage that is distinct from that of other TLR family members and may provide a potential therapeutic target for diseases characterized by dysregulated B-cell activity. PMID:27956526
Follicular helper T cells in immunity and systemic autoimmunity.
Craft, Joseph E
2012-05-01
Follicular helper T (T(FH)) cells are essential for B-cell maturation and immunoglobulin production after immunization with thymus-dependent antigens. Nevertheless, the development and function of T(FH) cells have been less clearly defined than classic CD4(+) effector T-cell subsets, including T-helper-1 (T(H)1), T(H)2 and T(H)17 cells. As such, our understanding of the genesis of T(FH) cells in humans and their role in the development of autoimmunity remains incomplete. However, evidence from animal models of systemic lupus erythematosus (SLE) and patients with systemic autoimmune diseases suggests that these cells are necessary for pathogenic autoantibody production, in a manner analogous to their role in promotion of B-cell maturation during normal immune responses. In this Review, I discuss the findings that have increased our knowledge of T(FH)-cell development and function in normal and aberrant immune responses. Such information might improve our understanding of autoimmune diseases, such as SLE, and highlights the potential of T(FH) cells as therapeutic targets in these diseases.
Nithichanon, Arnone; Rinchai, Darawan; Buddhisa, Surachat; Saenmuang, Pornpun; Kewcharoenwong, Chidchamai; Kessler, Bianca; Khaenam, Prasong; Chetchotisakd, Ploenchan; Maillere, Bernard; Robinson, John; Reynolds, Catherine J.; Boyton, Rosemary J.; Altmann, Daniel M.; Lertmemongkolchai, Ganjana
2018-01-01
Burkholderia pseudomallei (Bp) is an environmental bacterial pathogen that causes potentially lethal sepsis in susceptible individuals and is considered a Category B, Tier-1 biothreat agent. As such, it is crucial to gain an improved understanding of protective immunity and potential vaccine candidates. The nature of immune correlates dictating why most exposed individuals in endemic regions undergo asymptomatic seroconversion while others succumb to life-threatening sepsis is largely uncharted. Bp seroreactive, immunogenic proteins have previously been identified by antigen microarray. We here set out to conduct an analysis of T-cell recognition of the Bp immunome using serodominant antigens represented in the original antigen microarray, examining immune correlates of disease in healthy seropositive individuals and those with acute disease or in convalescence. By screening a library of 739 overlapping peptides representing the sequences of 20 different Bp antigens, we aimed to define immune correlates of protection at the level of immunoprevalent T-cell epitopes. Responses to a large number of epitopes were common in healthy seropositive individuals: we found remarkably broad responsiveness to Bp epitopes, with 235 of 739 peptides recognized by ≥80% of all tested donors. The cumulative response to Bp epitopes in healthy, seropositive, donors from this endemic region were of the order of thousands of spot forming cells per million cells, making Bp recognition a significant component of the T-cell repertoire. Noteworthy among our findings, analysis revealed 10 highly immunoprevalent T-cell epitopes, able to induce Bp-specific IFNγ responses that were high in responding T-cell frequency within the repertoire, and also common across individuals with different human leukocyte antigen types. Acute melioidosis patients showed poor T-cell responses to the immunoprevalent epitopes, but acquired responsiveness following recovery from infection. Our findings suggest
Ancelet, Lindsay R.; Aldwell, Frank E.; Rich, Fenella J.; Kirman, Joanna R.
2012-01-01
Oral delivery of BCG in a lipid formulation (Liporale™-BCG) targets delivery of viable bacilli to the mesenteric lymph nodes and confers protection against an aerosol Mycobacterium tuberculosis challenge. The magnitude, quality and duration of the effector and memory immune response induced by Liporale™-BCG vaccination is unknown. Therefore, we compared the effector and memory CD4+ T cell response in the spleen and lungs of mice vaccinated with Liporale™-BCG to the response induced by subcutaneous BCG vaccination. Liporale™-BCG vaccination induced a long-lived CD4+ T cell response, evident by the detection of effector CD4+ T cells in the lungs and a significant increase in the number of Ag85B tetramer-specific CD4+ T cells in the spleen up to 30 weeks post vaccination. Moreover, following polyclonal stimulation, Liporale™-BCG vaccination, but not s.c. BCG vaccination, induced a significant increase in both the percentage of CD4+ T cells in the lungs capable of producing IFNγ and the number of multifunctional CD4+ T cells in the lungs at 30 weeks post vaccination. These results demonstrate that orally delivered Liporale™-BCG vaccine induces a long-lived multifunctional immune response, and could therefore represent a practical and effective means of delivering novel BCG-based TB vaccines. PMID:23049885
Sobarzo, Ariel; Stonier, Spencer W; Herbert, Andrew S; Ochayon, David E; Kuehne, Ana I; Eskira, Yael; Fedida-Metula, Shlomit; Tali, Neta; Lewis, Eli C; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Yavelsky, Victoria; Dye, John M; Lobel, Leslie
2016-05-11
Robust humoral and cellular immunity are critical for survival in humans during an ebolavirus infection. However, the interplay between these two arms of immunity is poorly understood. To address this, we examined residual immune responses in survivors of the Sudan virus (SUDV) outbreak in Gulu, Uganda (2000-2001). Cytokine and chemokine expression levels in SUDV stimulated whole blood cultures were assessed by multiplex ELISA and flow cytometry. Antibody and corresponding neutralization titers were also determined. Flow cytometry and multiplex ELISA results demonstrated significantly higher levels of cytokine and chemokine responses in survivors with serological neutralizing activity. This correspondence was not detected in survivors with serum reactivity to SUDV but without neutralization activity. This previously undefined relationship between memory CD4 T cell responses and serological neutralizing capacity in SUDV survivors is key for understanding long lasting immunity in survivors of filovirus infections.
Behar, Samuel M.; Carpenter, Stephen M.; Booty, Matthew G.; Barber, Daniel L.; Jayaraman, Pushpa
2014-01-01
Despite the introduction almost a century ago of Mycobacterium bovis BCG (BCG), an attenuated form of M. bovis that is used as a vaccine against Mycobacterium tuberculosis, tuberculosis remains a global health threat and kills more than 1.5 million people each year. This is mostly because BCG fails to prevent pulmonary disease – the contagious form of tuberculosis. Although there have been significant advances in understanding how the immune system responds to infection, the qualities that define protective immunity against M. tuberculosis remain poorly characterized. The ability to predict who will maintain control over the infection and who will succumb to clinical disease would revolutionize our approach to surveillance, control, and treatment. Here we review the current understanding of pulmonary T cell responses following M. tuberculosis infection. While infection elicits a strong immune response that contains infection, M. tuberculosis evades eradication. Traditionally, its intracellular lifestyle and alteration of macrophage function are viewed as the dominant mechanisms of evasion. Now we appreciate that chronic inflammation leads to T cell dysfunction. While this may arise as the host balances the goals of bacterial sterilization and avoidance of tissue damage, it is becoming clear that T cell dysfunction impairs host resistance. Defining the mechanisms that lead to T cell dysfunction is crucial as memory T cell responses are likely to be subject to the same subject to the same pressures. Thus, success of T cell based vaccines is predicated on memory T cells avoiding exhaustion while at the same time not promoting overt tissue damage. PMID:25311810
Behar, Samuel M; Carpenter, Stephen M; Booty, Matthew G; Barber, Daniel L; Jayaraman, Pushpa
2014-12-01
Despite the introduction almost a century ago of Mycobacterium bovis BCG (BCG), an attenuated form of M. bovis that is used as a vaccine against Mycobacterium tuberculosis, tuberculosis remains a global health threat and kills more than 1.5 million people each year. This is mostly because BCG fails to prevent pulmonary disease--the contagious form of tuberculosis. Although there have been significant advances in understanding how the immune system responds to infection, the qualities that define protective immunity against M. tuberculosis remain poorly characterized. The ability to predict who will maintain control over the infection and who will succumb to clinical disease would revolutionize our approach to surveillance, control, and treatment. Here we review the current understanding of pulmonary T cell responses following M. tuberculosis infection. While infection elicits a strong immune response that contains infection, M. tuberculosis evades eradication. Traditionally, its intracellular lifestyle and alteration of macrophage function are viewed as the dominant mechanisms of evasion. Now we appreciate that chronic inflammation leads to T cell dysfunction. While this may arise as the host balances the goals of bacterial sterilization and avoidance of tissue damage, it is becoming clear that T cell dysfunction impairs host resistance. Defining the mechanisms that lead to T cell dysfunction is crucial as memory T cell responses are likely to be subject to the same subject to the same pressures. Thus, success of T cell based vaccines is predicated on memory T cells avoiding exhaustion while at the same time not promoting overt tissue damage. Copyright © 2014 Elsevier Ltd. All rights reserved.
Nomizo, Auro; Postol, Edilberto; de Alencar, Raquel; Cardillo, Fabíola; Mengel, José
2005-01-01
We show, here, that one single injection or weekly injections of staphylococcal enterotoxin B (SEB), starting in 1-day-old newborn mice, induced a powerful immune response with a T helper type 2 (Th2) pattern, as judged by the isotype and cytokine profile, with the production of large amounts of SEB-specific immunoglobulin G1 (IgG1), detectable levels of SEB-specific IgE and increased production of interleukin-4 by spleen cells. These protocols also induced an increase in the levels of total IgE in the serum. Memory of SEB was transferred to secondary recipients by using total spleen cells from primed animals. The secondary humoral response in transferred mice was diminished if spleen cells from SEB-treated mice were previously depleted of CD3+ or Vβ8+ T cells or NK1.1+ cells. In vivo depletion of NK1.1+ cells in adult mice resulted in a marked reduction in the SEB-specific antibody response in both the primary and secondary immune responses. Additionally, purified NK1.1+ T cells were able to perform SEB-specific helper B-cell actions in vitro and in vivo. These results suggest that NK1.1+ T cells are required for the full development of humoral immunological memory, whilst making neonatal tolerance to SEB unachievable. PMID:16162272
CD22 Promotes B-1b Cell Responses to T Cell-Independent Type 2 Antigens.
Haas, Karen M; Johnson, Kristen L; Phipps, James P; Do, Cardinal
2018-03-01
CD22 (Siglec-2) is a critical regulator of B cell activation and survival. CD22 -/- mice generate significantly impaired Ab responses to T cell-independent type 2 (TI-2) Ags, including haptenated Ficoll and pneumococcal polysaccharides, Ags that elicit poor T cell help and activate BCR signaling via multivalent epitope crosslinking. This has been proposed to be due to impaired marginal zone (MZ) B cell development/maintenance in CD22 -/- mice. However, mice expressing a mutant form of CD22 unable to bind sialic acid ligands generated normal TI-2 Ab responses, despite significantly reduced MZ B cells. Moreover, mice treated with CD22 ligand-binding blocking mAbs, which deplete MZ B cells, had little effect on TI-2 Ab responses. We therefore investigated the effects of CD22 deficiency on B-1b cells, an innate-like B cell population that plays a key role in TI-2 Ab responses. B-1b cells from CD22 -/- mice had impaired BCR-induced proliferation and significantly increased intracellular Ca 2+ concentration responses following BCR crosslinking. Ag-specific B-1b cell expansion and plasmablast differentiation following TI-2 Ag immunization was significantly impaired in CD22 -/- mice, consistent with reduced TI-2 Ab responses. We generated CD22 -/- mice with reduced CD19 levels (CD22 -/- CD19 +/- ) to test the hypothesis that augmented B-1b cell BCR signaling in CD22 -/- mice contributes to impaired TI-2 Ab responses. BCR-induced proliferation and intracellular Ca 2+ concentration responses were normalized in CD22 -/- CD19 +/- B-1b cells. Consistent with this, TI-2 Ag-specific B-1b cell expansion, plasmablast differentiation, survival, and Ab responses were rescued in CD22 -/- CD19 +/- mice. Thus, CD22 plays a critical role in regulating TI-2 Ab responses through regulating B-1b cell signaling thresholds. Copyright © 2018 by The American Association of Immunologists, Inc.
Gupta, G; Khan, A A; Rao, D N
2010-03-01
Yersinia pestis, a Gram-negative bacterium, is the etiological agent of pneumonic and bubonic plague and still active in various regions of the world. Because plague is highly infectious and can readily spread by aerosolization, it poses a bioterrorism threat. The effective induction of mucosal as well as systemic immunity is an important attribute of an improved vaccine for plague. An alternative approach described here is the use of protective epitopes derived from immunodominant antigens (F1 and V) of Yersinia pestis. As T-cell immunity is also a major contributor of protection, microencapsulated B-T constructs of F1 and V antigen were used to immunize outbred and inbred mice through intranasal route, and lympho-proliferative response and cytokine profile of both Th(1) and Th(2) arms were measured in spleen, lamina propria and Peyer's patches. Three B-T constructs of F1 antigen and seven of V antigen showed significantly high T-cell response in terms of inducing systemic as well as mucosal response when compared to constituent peptides. These ten conjugates showed Th(1) cytokine profile whereas rest of the conjugates showed mixed Th(1)/Th(2) response. Four conjugates of V antigen showed high level of IL-10 production. In present study, microencapsulated B-T constructs after intranasal immunization generated systemic as well as mucosal immune response in all three sites, which offers an alternative approach for plague vaccine.
Lee, Hye-Yeon; Kim, Juri; Ryu, Jae-Sook; Park, Soon-Jung
2017-08-01
Trichomonas vaginalis is a pathogen that triggers severe immune responses in hosts. T. vaginalis α-actinin 2, Tvα-actinin 2, has been used to diagnose trichomoniasis. This study was undertaken to examine the role of Tvα-actinin 2 as an antigenic molecule to induce immune responses from humans. Western blot analysis using anti-Tvα-actinin 2 antibodies indicated its presence in the secreted proteins of T. vaginalis. ELISA was employed to measure cytokine production by vaginal epithelial cells, prostate cells, mouse dendritic cells (DCs), or T cells stimulated with T. vaginalis or Tvα-actinin 2 protein. Both T. vaginalis and rTvα-actinin 2 induced cytokine production from epithelial cell lines, including IL-10. Moreover, CD4+CD25- regulatory T cells (Treg cells) incubated with rTvα-actinin 2-treated DCs produced high levels of IL-10. These data indicate that Tvα-actinin 2 modulates immune responses via IL-10 production by Treg cells.
Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P; Grassi, Maria Fernanda R; Carvalho, Edgar M
2016-08-01
T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls (UC) with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4(+) T cells expressing IFN-γ, TNF-α and IL-10 in response to TT were lower in the HC than in the UC. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it's necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4(+) T cell immune responses after vaccination. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Stevenson, Mary M.; Ing, Rebecca; Berretta, Floriana; Miu, Jenny
2011-01-01
Although a clearer understanding of the underlying mechanisms involved in protection and immunopathology during blood-stage malaria has emerged, the mechanisms involved in regulating the adaptive immune response especially those required to maintain a balance between beneficial and deleterious responses remain unclear. Recent evidence suggests the importance of CD11c+ dendritic cells (DC) and CD4+Foxp3+ regulatory T cells in regulating immune responses during infection and autoimmune disease, but information concerning the contribution of these cells to regulating immunity to malaria is limited. Here, we review recent findings from our laboratory and others in experimental models of malaria in mice and in Plasmodium-infected humans on the roles of DC and natural regulatory T cells in regulating adaptive immunity to blood-stage malaria. PMID:22110383
Antitumor immune responses mediated by dendritic cells
Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne
2013-01-01
Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744
Xu, Aizhang; Freywald, Andrew; Xie, Yufeng; Li, Zejun; Xiang, Jim
2017-01-01
Whether inflation of CD8 + memory T (mT) cells, which is often derived from repeated prime-boost vaccinations or chronic viral infections in the elderly, would affect late CD8 + T-cell immunity is a long-standing paradox. We have previously established an animal model with mT-cell inflation by transferring ConA-stimulated monoclonal CD8 + T cells derived from Ova-specific T-cell-receptor transgenic OTI mice into irradiation-induced lymphopenic B6 mice. In this study, we also established another two animal models with mT-cell inflation by transferring, 1) ConA-stimulated monoclonal CD8 + T cells derived from lymphocytic choriomeningitis virus glycoprotein-specific T-cell-receptor transgenic P14 mice, and 2) ConA-stimulated polyclonal CD8 + T cells derived from B6.1 mice into B6 mice with irradiation-induced lymphopenia. We vaccinated these mice with recombinant Ova-expressing Listeria monocytogenes and Ova-pulsed dendritic cells, which stimulated CD4 + T cell-independent and CD4 + T-cell-dependent CD8 + T-cell responses, respectively, and assessed Ova-specific CD8 + T-cell responses by flow cytometry. We found that Ova-specific CD8 + T-cell responses derived from the latter but not the former vaccination were significantly reduced in mice with CD8 + mT-cell inflation compared to wild-type B6 mice. We determined that naïve CD8 + T cells purified from splenocytes of mice with mT-cell inflation had defects in cell proliferation upon stimulation in vitro and in vivo and upregulated T-cell anergy-associated Itch and GRAIL molecules. Taken together, our data reveal that CD8 + mT-cell inflation renders compromised CD4 + T-cell-dependent CD8 + T-cell immunity via naïve T-cell anergy, and thus show promise for the design of efficient vaccines for elderly patients with CD8 + mT-cell inflation.
NASA Astrophysics Data System (ADS)
Mittelbrunn, María; Molina, Ana; Escribese, María M.; Yáñez-Mó, María; Escudero, Ester; Ursa, Ángeles; Tejedor, Reyes; Mampaso, Francisco; Sánchez-Madrid, Francisco
2004-07-01
The integrin 41 (VLA-4) not only mediates the adhesion and transendothelial migration of leukocytes, but also provides costimulatory signals that contribute to the activation of T lymphocytes. However, the behavior of 41 during the formation of the immune synapse is currently unknown. Here, we show that 41 is recruited to both human and murine antigen-dependent immune synapses, when the antigen-presenting cell is a B lymphocyte or a dendritic cell, colocalizing with LFA-1 at the peripheral supramolecular activation complex. However, when conjugates are formed in the presence of anti-4 antibodies, VLA-4 colocalizes with the CD3- chain at the center of the synapse. In addition, antibody engagement of 4 integrin promotes polarization toward a T helper 1 (Th1) response in human in vitro models of CD4+ T cell differentiation and naïve T cell priming by dendritic cells. The in vivo administration of anti-4 integrin antibodies also induces an immune deviation to Th1 response that dampens a Th2-driven autoimmune nephritis in Brown Norway rats. These data reveal a regulatory role of 4 integrins on T lymphocyte-antigen presenting cell cognate immune interactions.
Sobarzo, Ariel; Stonier, Spencer W.; Herbert, Andrew S.; Ochayon, David E.; Kuehne, Ana I.; Eskira, Yael; Fedida-Metula, Shlomit; Tali, Neta; Lewis, Eli C.; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Yavelsky, Victoria; Dye, John M.; Lobel, Leslie
2016-01-01
Robust humoral and cellular immunity are critical for survival in humans during an ebolavirus infection. However, the interplay between these two arms of immunity is poorly understood. To address this, we examined residual immune responses in survivors of the Sudan virus (SUDV) outbreak in Gulu, Uganda (2000–2001). Cytokine and chemokine expression levels in SUDV stimulated whole blood cultures were assessed by multiplex ELISA and flow cytometry. Antibody and corresponding neutralization titers were also determined. Flow cytometry and multiplex ELISA results demonstrated significantly higher levels of cytokine and chemokine responses in survivors with serological neutralizing activity. This correspondence was not detected in survivors with serum reactivity to SUDV but without neutralization activity. This previously undefined relationship between memory CD4 T cell responses and serological neutralizing capacity in SUDV survivors is key for understanding long lasting immunity in survivors of filovirus infections. PMID:27187443
Biophysical Aspects of T Lymphocyte Activation at the Immune Synapse
Hivroz, Claire; Saitakis, Michael
2016-01-01
T lymphocyte activation is a pivotal step of the adaptive immune response. It requires the recognition by T-cell receptors (TCR) of peptides presented in the context of major histocompatibility complex molecules (pMHC) present at the surface of antigen-presenting cells (APCs). T lymphocyte activation also involves engagement of costimulatory receptors and adhesion molecules recognizing ligands on the APC. Integration of these different signals requires the formation of a specialized dynamic structure: the immune synapse. While the biochemical and molecular aspects of this cell–cell communication have been extensively studied, its mechanical features have only recently been addressed. Yet, the immune synapse is also the place of exchange of mechanical signals. Receptors engaged on the T lymphocyte surface are submitted to many tensile and traction forces. These forces are generated by various phenomena: membrane undulation/protrusion/retraction, cell mobility or spreading, and dynamic remodeling of the actomyosin cytoskeleton inside the T lymphocyte. Moreover, the TCR can both induce force development, following triggering, and sense and convert forces into biochemical signals, as a bona fide mechanotransducer. Other costimulatory molecules, such as LFA-1, engaged during immune synapse formation, also display these features. Moreover, T lymphocytes themselves are mechanosensitive, since substrate stiffness can modulate their response. In this review, we will summarize recent studies from a biophysical perspective to explain how mechanical cues can affect T lymphocyte activation. We will particularly discuss how forces are generated during immune synapse formation; how these forces affect various aspects of T lymphocyte biology; and what are the key features of T lymphocyte response to stiffness. PMID:26913033
Kawabe, T; Naka, T; Yoshida, K; Tanaka, T; Fujiwara, H; Suematsu, S; Yoshida, N; Kishimoto, T; Kikutani, H
1994-06-01
An engagement of CD40 with CD40 ligand (CD40L) expressed on activated T cells is known to provide an essential costimulatory signal to B cells in vitro. To investigate the role of CD40 in in vivo immune responses, CD40-deficient mice were generated by gene targeting. The significant reduction of CD23 expression on mature B cells and relatively decreased number of IgM bright and IgD dull B cells were observed in the mutant mice. The mutant mice mounted IgM responses but no IgG, IgA, and IgE responses to thymus-dependent (TD) antigens. However, IgG as well as IgM responses to thymus-independent (TI) antigens were normal. Furthermore, the germinal center formation was defective in the mutant mice. These results suggest that CD40 is essential for T cell-dependent immunoglobulin class switching and germinal center formation, but not for in vivo T cell-dependent IgM responses and T cell-independent antibody responses.
The immune response to human CMV
La Rosa, Corinna; Diamond, Don J
2012-01-01
This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079
Luci, Carmelo; Bekri, Selma; Bihl, Franck; Pini, Jonathan; Bourdely, Pierre; Nouhen, Kelly; Malgogne, Angélique; Walzer, Thierry; Braud, Véronique M.; Anjuère, Fabienne
2015-01-01
Innate and adaptive immune cells work in concert to generate efficient protection at mucosal surface. Vaginal mucosa is an epithelial tissue that contains innate and adaptive immune effector cells. Our previous studies demonstrated that vaginal administration of Cholera toxin -based vaccines generate antigen-specific CD8 T cells through the stimulation of local dendritic cells (DC). Innate lymphoid cells (ILC) are a group of lymphocytes localized in epithelial tissues that have important immune functions against pathogens and in tissue homeostasis. Their contribution to vaccine-induced mucosal T cell responses is an important issue for the design of protective vaccines. We report here that the vaginal mucosa contains a heterogeneous population of NKp46+ ILC that includes conventional NK cells and ILC1-like cells. We show that vaginal NKp46+ ILC dampen vaccine-induced CD8 T cell responses generated after local immunization. Indeed, in vivo depletion of NKp46+ ILC with anti-NK1.1 antibody or NKG2D blockade increases the magnitude of vaginal OVA-specific CD8 T cells. Furthermore, such treatments also increase the number of DC in the vagina. NKG2D ligands being expressed by vaginal DC but not by CD8 T cells, these results support that NKp46+ ILC limit mucosal CD8 T cell responses indirectly through the NKG2D-dependent elimination of vaginal DC. Our data reveal an unappreciated role of NKp46+ ILC in the regulation of mucosal CD8 T cell responses. PMID:26630176
Immune Privilege and Eye-Derived T-Regulatory Cells.
Keino, Hiroshi; Horie, Shintaro; Sugita, Sunao
2018-01-01
Certain cellular components of the eye, such as neural retina, are unable to regenerate and replicate after destructive inflammation. Ocular immune privilege provides the eye with immune protection against intraocular inflammation in order to minimize the risk to vision integrity. The eye and immune system use strategies to maintain the ocular immune privilege by regulating the innate and adaptive immune response, which includes immunological ignorance, peripheral tolerance to eye-derived antigens, and intraocular immunosuppressive microenvironment. In this review, we summarize current knowledge regarding the molecular mechanism responsible for the development and maintenance of ocular immune privilege via regulatory T cells (Tregs), which are generated by the anterior chamber-associated immune deviation (ACAID), and ocular resident cells including corneal endothelial (CE) cells, ocular pigment epithelial (PE) cells, and aqueous humor. Furthermore, we examined the therapeutic potential of Tregs generated by RPE cells that express transforming growth factor beta (TGF- β ), cytotoxic T lymphocyte-associated antigen-2 alpha (CTLA-2 α ), and retinoic acid for autoimmune uveoretinitis and evaluated a new strategy using human RPE-induced Tregs for clinical application in inflammatory ocular disease. We believe that a better understanding of the ocular immune privilege associated with Tregs might offer a new approach with regard to therapeutic interventions for ocular autoimmunity.
Conditional deletion of SLP-76 in mature T cells abrogates peripheral immune responses1
Wu, Gregory F.; Corbo, Evann; Schmidt, Michelle; Smith-Garvin, Jennifer E.; Riese, Matthew J.; Jordan, Martha S.; Laufer, Terri M.; Brown, Eric J.; Maltzman, Jonathan S.
2011-01-01
SUMMARY The adaptor protein Src homology 2 domain-containing leukocyte-specific protein of 76 kDa (SLP-76) is central to the organization of intracellular signaling downstream of the T cell receptor (TCR). Evaluation of its role in mature, primary T cells has been hampered by developmental defects that occur in the absence of wild-type SLP-76 protein in thymocytes. Following tamoxifen-regulated conditional deletion of SLP-76, mature, antigen-inexperienced T cells maintain normal TCR surface expression but fail to transduce TCR generated signals. Conditionally deficient T cells fail to proliferate in response to antigenic stimulation or a lymphopenic environment. Mice with induced deletion of SLP-76 are resistant to induction of the CD4+ T cell mediated autoimmune disease experimental autoimmune encephalomyelitis. Our findings demonstrate the critical role of SLP-76-mediated signaling in initiating T cell-directed immune responses both in vitro and in vivo and highlight the ability to analyze signaling processes in mature T cells in the absence of developmental defects. PMID:21469089
Curcumin reverses T cell-mediated adaptive immune dysfunctions in tumor-bearing hosts.
Bhattacharyya, Sankar; Md Sakib Hossain, Dewan; Mohanty, Suchismita; Sankar Sen, Gouri; Chattopadhyay, Sreya; Banerjee, Shuvomoy; Chakraborty, Juni; Das, Kaushik; Sarkar, Diptendra; Das, Tanya; Sa, Gaurisankar
2010-07-01
Immune dysfunction is well documented during tumor progression and likely contributes to tumor immune evasion. CD8(+) cytotoxic T lymphocytes (CTLs) are involved in antigen-specific tumor destruction and CD4(+) T cells are essential for helping this CD8(+) T cell-dependent tumor eradication. Tumors often target and inhibit T-cell function to escape from immune surveillance. This dysfunction includes loss of effector and memory T cells, bias towards type 2 cytokines and expansion of T regulatory (Treg) cells. Curcumin has previously been shown to have antitumor activity and some research has addressed the immunoprotective potential of this plant-derived polyphenol in tumor-bearing hosts. Here we examined the role of curcumin in the prevention of tumor-induced dysfunction of T cell-based immune responses. We observed severe loss of both effector and memory T-cell populations, downregulation of type 1 and upregulation of type 2 immune responses and decreased proliferation of effector T cells in the presence of tumors. Curcumin, in turn, prevented this loss of T cells, expanded central memory T cell (T(CM))/effector memory T cell (T(EM)) populations, reversed the type 2 immune bias and attenuated the tumor-induced inhibition of T-cell proliferation in tumor-bearing hosts. Further investigation revealed that tumor burden upregulated Treg cell populations and stimulated the production of the immunosuppressive cytokines transforming growth factor (TGF)-beta and IL-10 in these cells. Curcumin, however, inhibited the suppressive activity of Treg cells by downregulating the production of TGF-beta and IL-10 in these cells. More importantly, curcumin treatment enhanced the ability of effector T cells to kill cancer cells. Overall, our observations suggest that the unique properties of curcumin may be exploited for successful attenuation of tumor-induced suppression of cell-mediated immune responses.
Senescence of T Lymphocytes: Implications for Enhancing Human Immunity.
Akbar, Arne N; Henson, Sian M; Lanna, Alessio
2016-12-01
As humans live longer, a central concern is to find ways to maintain their health as they age. Immunity declines during ageing, as shown by the increased susceptibility to infection by both previously encountered and new pathogens and by the decreased efficacy of vaccination. It is therefore crucial to understand the mechanisms responsible for this decrease in immunity and to develop new strategies to enhance immune function in older humans. We discuss here how the induction of senescence alters leukocyte, and specifically T cell, function. An emerging concept is that senescence and nutrient sensing-signalling pathways within T cells converge to regulate functional responses, and the manipulation of these pathways may offer new ways to enhance immunity during ageing. Copyright © 2016 Elsevier Ltd. All rights reserved.
DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.
Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y
2016-01-05
On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.
DCAF1 controls T-cell function via p53-dependent and -independent mechanisms
Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.
2016-01-01
On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942
Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W
2014-11-28
NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors
Geczy, A F; de Weck, A L
1977-10-01
Further breeding studies were carried out to investigate the polygenic control of the cellular immune response in the guinea-pig to low doses of aspirin anhydride (ASAN), penicilloylated bovine immunoglobulin (BPO-BGG) and to the multi-chain copolymer (T, G)-A-L. Although responsiveness to these three antigens is controlled by three independently segregating loci, at least one gene required for these responses is linked to the strain 13 haplotype.
Zhang, Ping; Martin, Michael; Yang, Qiu-Bo; Michalek, Suzanne M; Katz, Jannet
2004-02-01
In addition to antigen-specific signals mediated through the T-cell receptor, T cells also require antigen nonspecific costimulation for activation. The B7 family of molecules on antigen-presenting cells, which include B7-1 (CD80) and B7-2 (CD86), play important roles in providing costimulatory signals required for development of antigen-specific immune responses. Hemagglutinin B (HagB) is a nonfimbrial adhesin of the periodontopathic microorganism Porphyromonas gingivalis and is thought to be involved in the attachment of the bacterium to host tissues. However, the immune mechanisms involved in responses to HagB and their roles in pathogenesis have yet to be elucidated. Therefore, the purpose of this study was to determine the role of B7 costimulatory molecules on T-helper-cell differentiation for the induction of immune responses to HagB. Mice deficient in either or both of the costimulatory molecules B7-1 and B7-2 were used to explore their role in immune responses to HagB after subcutaneous immunization. B7-1(-/-) mice had levels of immunoglobulin G (IgG) anti-HagB antibody activity in serum similar to those of wild-type mice, whereas lower serum IgG anti-HagB antibody responses were seen in B7-2(-/-) mice. Moreover, significantly lower numbers of IgG antibody-secreting cells and lower levels of CD4(+)-T-cell proliferation were observed in B7-2(-/-) mice compared to wild-type mice. No serum IgG response to HagB was detected in B7-1/B7-2(-/-) mice. Analysis of the subclass of the serum IgG responses and the cytokines induced in response to HagB revealed that B7-2(-/-) mice had significantly lower IgG1 and higher IgG2a anti-HagB antibody responses compared to wild-type mice. The B7-2(-/-) mice also had significantly reduced levels of interleukin-4 (IL-4) and IL-5 and enhanced level of gamma interferon. Furthermore, assessment of B7-1 and B7-2 expression on B cells and macrophages derived from wild-type BALB/c mice after in vitro stimulation with HagB revealed a
Asymmetric T lymphocyte division in the initiation of adaptive immune responses.
Chang, John T; Palanivel, Vikram R; Kinjyo, Ichiko; Schambach, Felix; Intlekofer, Andrew M; Banerjee, Arnob; Longworth, Sarah A; Vinup, Kristine E; Mrass, Paul; Oliaro, Jane; Killeen, Nigel; Orange, Jordan S; Russell, Sarah M; Weninger, Wolfgang; Reiner, Steven L
2007-03-23
A hallmark of mammalian immunity is the heterogeneity of cell fate that exists among pathogen-experienced lymphocytes. We show that a dividing T lymphocyte initially responding to a microbe exhibits unequal partitioning of proteins that mediate signaling, cell fate specification, and asymmetric cell division. Asymmetric segregation of determinants appears to be coordinated by prolonged interaction between the T cell and its antigen-presenting cell before division. Additionally, the first two daughter T cells displayed phenotypic and functional indicators of being differentially fated toward effector and memory lineages. These results suggest a mechanism by which a single lymphocyte can apportion diverse cell fates necessary for adaptive immunity.
Prescott, Joseph B; Hall, Pamela R; Bondu-Hawkins, Virginie S; Ye, Chunyan; Hjelle, Brian
2007-08-01
Sin Nombre virus (SNV) is a highly pathogenic New World virus and etiologic agent of hantavirus cardiopulmonary syndrome. We have previously shown that replication-defective virus particles are able to induce a strong IFN-stimulated gene (ISG) response in human primary cells. RNA viruses often stimulate the innate immune response by interactions between viral nucleic acids, acting as a pathogen-associated molecular pattern, and cellular pattern-recognition receptors (PRRs). Ligand binding to PRRs activates transcription factors which regulate the expression of antiviral genes, and in all systems examined thus far, IFN regulatory factor 3 (IRF3) has been described as an essential intermediate for induction of ISG expression. However, we now describe a model in which IRF3 is dispensable for the induction of ISG transcription in response to viral particles. IRF3-independent ISG transcription in human hepatoma cell lines is initiated early after exposure to SNV virus particles in an entry- and replication-independent fashion. Furthermore, using gene knockdown, we discovered that this activation is independent of the best-characterized RNA- and protein-sensing PRRs including the cytoplasmic caspase recruitment domain-containing RNA helicases and the TLRs. SNV particles engage a heretofore unrecognized PRR, likely located at the cell surface, and engage a novel IRF3-independent pathway that activates the innate immune response.
Sedlik, C; Dadaglio, G; Saron, M F; Deriaud, E; Rojas, M; Casal, S I; Leclerc, C
2000-07-01
Many approaches are currently being developed to deliver exogenous antigen into the major histocompatibility complex class I-restricted antigen pathway, leading to in vivo priming of CD8(+) cytotoxic T cells. One attractive possibility consists of targeting the antigen to phagocytic or macropinocytic antigen-presenting cells. In this study, we demonstrate that strong CD8(+) class I-restricted cytotoxic responses are induced upon intraperitoneal immunization of mice with different peptides, characterized as CD8(+) T-cell epitopes, bound to 1-microm synthetic latex microspheres and injected in the absence of adjuvant. The cytotoxic response induced against a lymphocytic choriomeningitis virus (LCMV) peptide linked to these microspheres was compared to the cytotoxic T-lymphocyte (CTL) response obtained upon immunization with the nonreplicative porcine parvovirus-like particles (PPV:VLP) carrying the same peptide (PPV:VLP-LCMV) previously described (C. Sedlik, M. F. Saron, J. Sarraseca, I. Casal, and C. Leclerc, Proc. Natl. Acad. Sci. USA 94:7503-7508, 1997). We show that the induction of specific CTL activity by peptides bound to microspheres requires CD4(+) T-cell help in contrast to the CTL response obtained with the peptide delivered by viral pseudoparticles. Furthermore, PPV:VLP are 100-fold more efficient than microspheres in generating a strong CTL response characterized by a high frequency of specific T cells of high avidity. Moreover, PPV:VLP-LCMV are able to protect mice against a lethal LCMV challenge whereas microspheres carrying the LCMV epitope fail to confer such protection. This study demonstrates the crucial involvement of the frequency and avidity of CTLs in conferring antiviral protective immunity and highlights the importance of considering these parameters when developing new vaccine strategies.
Gao, J; Liu, Z; Huang, M; Li, X; Wang, Z
2011-01-01
The latent membrane protein 1 (LMP1) encoded by Epstein-Barr virus (EBV) has become a potential target in EBV-associated tumor prevention and treatment due to its multiple biological effects. In this study, the recombinant T7 phage displaying full-length LMP1 protein was cloned and used as an immunogen to immunize rats. Results of flow cytometry, Western blot analysis, and ELISA confirmed that both humoral and cellular immune responses were elicited in the immunized rats. Our data suggested that T7 phage was an efficient antigen carrier. The recombinant T7-LMP1 phage reconstitutes the antigenic and immunogenic properties of LMP1 and can serve as a vaccine against EBV.
Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...
Photodynamic therapy for cancer and activation of immune response
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.
2010-02-01
Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.
Arina, Ainhoa; Schreiber, Karin; Binder, David C.; Karrison, Theodore; Liu, Rebecca B.; Schreiber, Hans
2014-01-01
Myeloid-derived CD11b+Gr1+ suppressor cells (MDSC) and tumor-associated macrophages (TAM) are considered a major obstacle for effective adoptive T cell therapy. Myeloid cells suppress naive T cell proliferation ex vivo and can prevent the generation of T cell responses in vivo. We find, however, that immune T cells adoptively transferred eradicate well-established tumors in the presence of MDSC and TAM which are strongly immunosuppressive ex vivo. These MDSC and TAM were comparable in levels and immunosuppression among different tumor models. Longitudinal microscopy of tumors in vivo revealed that after T cell transfer tumor vasculature and cancer cells disappeared simultaneously. During T-cell mediated tumor destruction, the tumor stroma contained abundant myeloid cells (mainly TAM) that retained their suppressive properties. Preimmunized but not naive mice resisted immune suppression caused by an unrelated tumor-burden supporting the idea that in vivo, myeloid immunosuppressive cells can suppress naive but not memory T cell responses. PMID:24367029
Sarkar, Koustav; Goswami, Shyamal; Roy, Soumyabrata; Mallick, Atanu; Chakraborty, Krishnendu; Bose, Anamika; Baral, Rathindranath
2010-08-01
Vaccination with neem leaf glycoprotein matured carcinoembryonic antigen (CEA) pulsed dendritic cells (DCs) enhances antigen-specific humoral and cellular immunity against CEA and restricts the growth of CEA(+) murine tumors. NLGP helps better CEA uptake, processing and presentation to T/B cells. This vaccination (DCNLGPCEA) elicits mitogen induced and CEA specific T cell proliferation, IFN gamma secretion and induces specific cytotoxic reactions to CEA(+) colon tumor cells. In addition to T cell response, DCNLGPCEA vaccine generates anti-CEA antibody response, which is principally IgG2a in nature. This antibody participates in cytotoxicity of CEA(+) cells in antibody-dependent manner. This strong anti-CEA cellular and humoral immunity protects mice from tumor development and these mice remained tumor free following second tumor inoculation, indicating generation of effector memory response. Evaluation of underlying mechanism suggests vaccination generates strong CEA specific CTL and antibody response that can completely prevent the tumor growth following adoptive transfer. In support, significant upregulation of CD44 on the surface of lymphocytes from DCNLGPCEA immunized mice was noticed with a substantial reduction in L-selectin (CD62L). (c) 2010 Elsevier B.V. All rights reserved.
Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke
2013-01-01
Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066
Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai
2010-12-01
The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).
Armc5 deletion causes developmental defects and compromises T-cell immune responses
Hu, Yan; Lao, Linjiang; Mao, Jianning; Jin, Wei; Luo, Hongyu; Charpentier, Tania; Qi, Shijie; Peng, Junzheng; Hu, Bing; Marcinkiewicz, Mieczyslaw Martin; Lamarre, Alain; Wu, Jiangping
2017-01-01
Armadillo repeat containing 5 (ARMC5) is a cytosolic protein with no enzymatic activities. Little is known about its function and mechanisms of action, except that gene mutations are associated with risks of primary macronodular adrenal gland hyperplasia. Here we map Armc5 expression by in situ hybridization, and generate Armc5 knockout mice, which are small in body size. Armc5 knockout mice have compromised T-cell proliferation and differentiation into Th1 and Th17 cells, increased T-cell apoptosis, reduced severity of experimental autoimmune encephalitis, and defective immune responses to lymphocytic choriomeningitis virus infection. These mice also develop adrenal gland hyperplasia in old age. Yeast 2-hybrid assays identify 16 ARMC5-binding partners. Together these data indicate that ARMC5 is crucial in fetal development, T-cell function and adrenal gland growth homeostasis, and that the functions of ARMC5 probably depend on interaction with multiple signalling pathways. PMID:28169274
Gabryšová, Leona; Alvarez-Martinez, Marisol; Luisier, Raphaëlle; Cox, Luke S; Sodenkamp, Jan; Hosking, Caroline; Pérez-Mazliah, Damián; Whicher, Charlotte; Kannan, Yashaswini; Potempa, Krzysztof; Wu, Xuemei; Bhaw, Leena; Wende, Hagen; Sieweke, Michael H; Elgar, Greg; Wilson, Mark; Briscoe, James; Metzis, Vicki; Langhorne, Jean; Luscombe, Nicholas M; O'Garra, Anne
2018-05-01
The transcription factor c-Maf induces the anti-inflammatory cytokine IL-10 in CD4 + T cells in vitro. However, the global effects of c-Maf on diverse immune responses in vivo are unknown. Here we found that c-Maf regulated IL-10 production in CD4 + T cells in disease models involving the T H 1 subset of helper T cells (malaria), T H 2 cells (allergy) and T H 17 cells (autoimmunity) in vivo. Although mice with c-Maf deficiency targeted to T cells showed greater pathology in T H 1 and T H 2 responses, T H 17 cell-mediated pathology was reduced in this context, with an accompanying decrease in T H 17 cells and increase in Foxp3 + regulatory T cells. Bivariate genomic footprinting elucidated the c-Maf transcription-factor network, including enhanced activity of NFAT; this led to the identification and validation of c-Maf as a negative regulator of IL-2. The decreased expression of the gene encoding the transcription factor RORγt (Rorc) that resulted from c-Maf deficiency was dependent on IL-2, which explained the in vivo observations. Thus, c-Maf is a positive and negative regulator of the expression of cytokine-encoding genes, with context-specific effects that allow each immune response to occur in a controlled yet effective manner.
Raczkowski, Friederike; Rissiek, Anne; Ricklefs, Isabell; Heiss, Kirsten; Schumacher, Valéa; Wundenberg, Kira; Haag, Friedrich; Koch-Nolte, Friedrich; Tolosa, Eva; Mittrücker, Hans-Willi
2018-01-01
The ectoenzymes CD39 and CD73 degrade extracellular ATP to adenosine. ATP is released by stressed or damaged cells and provides pro-inflammatory signals to immune cells through P2 receptors. Adenosine, on the other hand, suppresses immune cells by stimulating P1 receptors. Thus, CD39 and CD73 can shape the quality of immune responses. Here we demonstrate that upregulation of CD39 is a consistent feature of activated conventional CD4+ and CD8+ T cells. Following stimulation in vitro, CD4+ and CD8+ T cells from human blood gained surface expression of CD39 but displayed only low levels of CD73. Activated human T cells from inflamed joints largely presented with a CD39+CD73- phenotype. In line, in spleens of mice with acute Listeria monocytogenes, listeria-specific CD4+ and CD8+ T cells acquired a CD39+CD73- phenotype. To test the function of CD39 in control of bacterial infection, CD39-deficient (CD39-/-) mice were infected with L. monocytogenes. CD39-/- mice showed better initial control of L. monocytogenes, which was associated with enhanced production of inflammatory cytokines. In the late stage of infection, CD39-/- mice accumulated more listeria-specific CD8+ T cells in the spleen than wildtype animals suggesting that CD39 attenuates the CD8+ T-cell response to infection. In conclusion, our results demonstrate that CD39 is upregulated on conventional CD4+ and CD8+ T cells at sites of acute infection and inflammation, and that CD39 dampens responses to bacterial infection.
Brodmerkel, Carrie; Wadman, Eric; Langley, Richard G; Papp, Kim A A; Bourcier, Marc; Poulin, Yves; Ho, Vincent; Guenther, Lyn; Kunynetz, Rod; Nigen, Simon; Vender, Ronald; Wasel, Norman; Hsu, Ming-Chun; Szapary, Philippe
2013-10-01
Little is known about the impact of long-term use of immunosuppressive agents on immune response. Assess the impact of continuous maintenance ustekinumab treatment on patients' ability to mount immune responses to pneumococcal (T-cell-independent) and tetanus toxoid (T-cell-dependent) vaccines. Ustekinumab-treated patients with moderate-to-severe psoriasis treated in the long-term extension of the Phase 3 PHOENIX 2 trial (n=60) were compared with control psoriasis patients not receiving systemic therapy (n=56). Patients were vaccinated with both 23-valent pneumococcal and tetanus toxoid vaccines. Serum samples collected pre-vaccination and 4 weeks post-vaccination were assessed for antibody responses. No differences in the ability of ustekinumab-treated patients to respond to pneumococcal or tetanus toxoid vaccinations were observed compared with controls. A ≥2-fold increase in antibody levels in ≥7 of 14 serotypes of the pneumococcal vaccine was observed in ustekinumab-treated (96.6%) and untreated control (92.6%) patients following vaccination. Ustekinumab-treated patients achieved a ≥4-fold increase (84.7%) in anti-tetanus antibody vs. 77.8% in the control group. No differences were detected in ex-vivo responses to anti-CD3/CD28 or tetanus toxoid between ustekinumab-treated and control groups. Long-term treatment (≥3 years) with ustekinumab does not compromise the immune response to T-cell-dependent/-independent vaccines in patients with moderate-to-severe psoriasis.
Allelic polymorphism in the T cell receptor and its impact on immune responses.
Gras, Stephanie; Chen, Zhenjun; Miles, John J; Liu, Yu Chih; Bell, Melissa J; Sullivan, Lucy C; Kjer-Nielsen, Lars; Brennan, Rebekah M; Burrows, Jacqueline M; Neller, Michelle A; Khanna, Rajiv; Purcell, Anthony W; Brooks, Andrew G; McCluskey, James; Rossjohn, Jamie; Burrows, Scott R
2010-07-05
In comparison to human leukocyte antigen (HLA) polymorphism, the impact of allelic sequence variation within T cell receptor (TCR) loci is much less understood. Particular TCR loci have been associated with autoimmunity, but the molecular basis for this phenomenon is undefined. We examined the T cell response to an HLA-B*3501-restricted epitope (HPVGEADYFEY) from Epstein-Barr virus (EBV), which is frequently dominated by a TRBV9*01(+) public TCR (TK3). However, the common allelic variant TRBV9*02, which differs by a single amino acid near the CDR2beta loop (Gln55-->His55), was never used in this response. The structure of the TK3 TCR, its allelic variant, and a nonnaturally occurring mutant (Gln55-->Ala55) in complex with HLA-B*3501(HPVGEADYFEY) revealed that the Gln55-->His55 polymorphism affected the charge complementarity at the TCR-peptide-MHC interface, resulting in reduced functional recognition of the cognate and naturally occurring variants of this EBV peptide. Thus, polymorphism in the TCR loci may contribute toward variability in immune responses and the outcome of infection.
Juleff, Nicholas; Windsor, Miriam; Lefevre, Eric A.; Gubbins, Simon; Hamblin, Pip; Reid, Elizabeth; McLaughlin, Kerry; Beverley, Peter C. L.; Morrison, Ivan W.; Charleston, Bryan
2009-01-01
The role of T-lymphocyte subsets in recovery from foot-and-mouth disease virus (FMDV) infection in calves was investigated by administering subset-specific monoclonal antibodies. The depletion of circulating CD4+ or WC1+ γδ T cells was achieved for a period extending from before challenge to after resolution of viremia and peak clinical signs, whereas CD8+ cell depletion was only partial. The depletion of CD4+ cells was also confirmed by analysis of lymph node biopsy specimens 5 days postchallenge. Depletion with anti-WC1 and anti-CD8 antibodies had no effect on the kinetics of infection, clinical signs, and immune responses following FMDV infection. Three of the four CD4+ T-cell-depleted calves failed to generate an antibody response to the nonstructural polyprotein 3ABC but generated a neutralizing antibody response similar to that in the controls, including rapid isotype switching to immunoglobulin G antibody. We conclude that antibody responses to sites on the surface of the virus capsid are T cell independent, whereas those directed against the nonstructural proteins are T cell dependent. CD4 depletion was found to substantially inhibit antibody responses to the G-H peptide loop VP1135-156 on the viral capsid, indicating that responses to this particular site, which has a more mobile structure than other neutralizing sites on the virus capsid, are T cell dependent. The depletion of CD4+ T cells had no adverse effect on the magnitude or duration of clinical signs or clearance of virus from the circulation. Overall, we conclude that CD4+ T-cell-independent antibody responses play a major role in the resolution of foot-and-mouth disease in cattle. PMID:19176618
Antigen-Specific CD8+ T Cells and Protective Immunity to Tuberculosis
2017-01-01
The continuing HIV/AIDS epidemic and the spread of multi-drug resistant Mycobacterium tuberculosis has led to the perpetuation of the worldwide tuberculosis epidemic. While M. bovis BCG is widely used as a vaccine, it lacks efficacy in preventing pulmonary tuberculosis in adults [1]. To combat this ongoing scourge, vaccine development for tuberculosis is a global priority. Most infected individuals develop long-lived protective immunity, which controls and contains M. tuberculosis in a T cell-dependent manner. An effective T cells response determines whether the infection resolves or develops into clinically evident disease. Consequently, there is great interest in determining which T cells subsets mediate anti-mycobacterial immunity, delineating their effector functions, and evaluating whether vaccination can elicit these T cells subsets and induce protective immunity. CD4+ T cells are critical for resistance to M. tuberculosis in both humans and rodent models. CD4+ T cells are required to control the initial infection as well as to prevent recrudescence in both humans and mice [2]. While it is generally accepted that class II MHC-restricted CD4+ T cells are essential for immunity to tuberculosis, M. tuberculosis infection elicits CD8+ T cells responses in both people and in experimental animals. CD8+ T cells are also recruited to the lung during M. tuberculosis infection and are found in the granulomas of infected people. Thus, how CD8+ T cells contribute to overall immunity to tuberculosis and whether antigens recognized by CD8+ T cells would enhance the efficacy of vaccine strategies continue to be important questions. PMID:23468108
Köstlin, Natascha; Vogelmann, Margit; Spring, Bärbel; Schwarz, Julian; Feucht, Judith; Härtel, Christoph; Orlikowsky, Thorsten W; Poets, Christian F; Gille, Christian
2017-09-01
Infections are a leading cause of perinatal morbidity and mortality. The outstandingly high susceptibility to infections early in life is mainly attributable to the compromised state of the neonatal immune system. One important difference to the adult immune system is a bias towards T helper type 2 (Th2) responses in newborns. However, mechanisms regulating neonatal T-cell responses are incompletely understood. Granulocytic myeloid-derived suppressor cells (GR-MDSC) are myeloid cells with a granulocytic phenotype that suppress various functions of other immune cells and accumulate under physiological conditions during pregnancy in maternal and fetal blood. Although it has been hypothesized that GR-MDSC accumulation during fetal life could be important for the maintenance of maternal-fetal tolerance, the influence of GR-MDSC on the immunological phenotype of neonates is still unclear. Here, we investigated the impact of GR-MDSC isolated from cord blood (CB-MDSC) on the polarization of Th cells. We demonstrate that CB-MDSC inhibit Th1 responses and induced Th2 responses and regulatory T (Treg) cells. Th1 inhibition was cell-contact dependent and occurred independent of other cell types, while Th2 induction was mediated independently of cell contact through expression of ArgI and reactive oxygen species by CB-MDSC and partially needed the presence of monocytes. Treg cell induction by CB-MDSC also occurred cell-contact independently but was partially mediated through inducible nitric oxide synthase. These results point towards a role of MDSC in regulating neonatal immune responses. Targeting MDSC function in neonates could be a therapeutic opportunity to improve neonatal host defence. © 2017 John Wiley & Sons Ltd.
Determinants of public T cell responses.
Li, Hanjie; Ye, Congting; Ji, Guoli; Han, Jiahuai
2012-01-01
Historically, sharing T cell receptors (TCRs) between individuals has been speculated to be impossible, considering the dramatic discrepancy between the potential enormity of the TCR repertoire and the limited number of T cells generated in each individual. However, public T cell response, in which multiple individuals share identical TCRs in responding to a same antigenic epitope, has been extensively observed in a variety of immune responses across many species. Public T cell responses enable individuals within a population to generate similar antigen-specific TCRs against certain ubiquitous pathogens, leading to favorable biological outcomes. However, the relatively concentrated feature of TCR repertoire may limit T cell response in a population to some other pathogens. It could be a great benefit for human health if public T cell responses can be manipulated. Therefore, the mechanistic insight of public TCR generation is important to know. Recently, high-throughput DNA sequencing has revolutionized the study of immune receptor repertoires, which allows a much better understanding of the factors that determine the overlap of TCR repertoire among individuals. Here, we summarize the current knowledge on public T-cell response and discuss future challenges in this field.
Control of epithelial immune-response genes and implications for airway immunity and inflammation.
Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J
1998-01-01
A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.
T and B lymphocyte function in response to a protein-free diet.
Carlomagno, M A; Alito, A E; Almiron, D I; Gimeno, A
1982-01-01
Groups of female adult rats were fed either isocaloric protein-free or 18% protein diets for various intervals. Four days before sacrifice, the animals were immunized either with sheep erythrocytes or with a trinitrophenyl-lipopolysaccharide (TNP-LPS) conjugate. Spleen lymphoid cell populations, spleen plaque-forming cells, and serum hemolysins were measured. A persistent diminution, proportional to the duration of protein deprivation, was observed in all parameters studied after immunization with the T-dependent antigen, sheep erythrocytes. The immune dysfunction was more pronounced for hemolysin titers, which became undetectable after 15 days of protein-free diet. The response of the protein-free group to the T-independent antigen (TNP-LPS) after 15 days of diet was only 34% of the control. When a T-cell lymphokine, macrophage migration inhibitory factor, was measured, a normal response was observed in the protein-free group. Feeding a normal diet rapidly restored the spleen plaque-forming cell populations to 60% of normal after 4 days and to 100% after 6 days. Protein starvation influenced the production of antibodies more than it did the number of antibody-forming cells. The nutritional impairment of immunoglobulin synthesis appears to be reversible. PMID:6216214
Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response
Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.
2016-01-01
Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed
Anti-tumor immune response after photodynamic therapy
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.
2009-06-01
Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp
Prior Dengue Virus Exposure Shapes T Cell Immunity to Zika Virus in Humans
Grifoni, Alba; Pham, John; Sidney, John; O'Rourke, Patrick H.; Paul, Sinu; Peters, Bjoern; Martini, Sheridan R.; de Silva, Aruna D.; Ricciardi, Michael J.; Silveira, Cassia G. T.; Maestri, Alvino; Costa, Priscilla R.; de-Oliveira-Pinto, Luzia Maria; de Azeredo, Elzinandes Leal; Damasco, Paulo Vieira; Phillips, Elizabeth; Mallal, Simon; de Silva, Aravinda M.; Collins, Matthew; Durbin, Anna; Diehl, Sean A.; Cerpas, Cristhiam; Balmaseda, Angel; Kuan, Guillermina; Coloma, Josefina; Harris, Eva; Crowe, James E.; Stone, Mars; Busch, Michael; Vivanco-Cid, Hector; Cox, Josephine; Graham, Barney S.; Ledgerwood, Julie E.; Turtle, Lance; Solomon, Tom; Kallas, Esper G.; Watkins, David I.; Weiskopf, Daniela
2017-01-01
ABSTRACT While progress has been made in characterizing humoral immunity to Zika virus (ZIKV) in humans, little is known regarding the corresponding T cell responses to ZIKV. Here, we investigate the kinetics and viral epitopes targeted by T cells responding to ZIKV and address the critical question of whether preexisting dengue virus (DENV) T cell immunity modulates these responses. We find that memory T cell responses elicited by prior infection with DENV or vaccination with tetravalent dengue attenuated vaccines (TDLAV) recognize ZIKV-derived peptides. This cross-reactivity is explained by the sequence similarity of the two viruses, as the ZIKV peptides recognized by DENV-elicited memory T cells are identical or highly conserved in DENV and ZIKV. DENV exposure prior to ZIKV infection also influences the timing and magnitude of the T cell response. ZIKV-reactive T cells in the acute phase of infection are detected earlier and in greater magnitude in DENV-immune patients. Conversely, the frequency of ZIKV-reactive T cells continues to rise in the convalescent phase in DENV-naive donors but declines in DENV-preexposed donors, compatible with more efficient control of ZIKV replication and/or clearance of ZIKV antigen. The quality of responses is also influenced by previous DENV exposure, and ZIKV-specific CD8 T cells from DENV-preexposed donors selectively upregulated granzyme B and PD1, unlike DENV-naive donors. Finally, we discovered that ZIKV structural proteins (E, prM, and C) are major targets of both the CD4 and CD8 T cell responses, whereas DENV T cell epitopes are found primarily in nonstructural proteins. IMPORTANCE The issue of potential ZIKV and DENV cross-reactivity and how preexisting DENV T cell immunity modulates Zika T cell responses is of great relevance, as the two viruses often cocirculate and Zika virus has been spreading in geographical regions where DENV is endemic or hyperendemic. Our data show that memory T cell responses elicited by prior
Libraty, Daniel H.; Zhang, Lei; Woda, Marcia; Acosta, Luz P.; Obcena, AnaMae; Brion, Job D.; Capeding, Rosario Z.
2014-01-01
Neonatal Bacille Calmette Guérin (BCG) vaccination has been reported to have beneficial effects beyond preventing infantile tuberculous meningitis and miliary disease. We hypothesized that BCG vaccine given at birth would enhance T-helper 1 (Th1) immune responses to the first vaccines given later in infancy. We conducted a nested case-control study of neonatal BCG vaccination and its heterologous Th1 immune effects in 2–3 months old infants. BCG vaccination at birth was associated with an increased frequency of interferon-γ (IFN-γ) producing spot-forming cells (SFC) to tetanus toxoid 2–3 months later. The frequency of IFN-γ producing SFC to polioviruses 1–3 also trended higher among infants who received BCG vaccination at birth. The frequency of IFN-γ+/tumor necrosis factor-α (TNF-α)+CD45RO+CD4+ T-cells upon stimulation with phorbol myristate acetate (PMA)/Ionomycin was higher in 2–3 months old infants who received BCG vaccination at birth compared to those who did not. The circulating frequency of forkhead box P3 (FoxP3)+ CD45RO+ regulatory CD4+ T-cells also trended lower in these infants. Neonatal BCG vaccination is associated with heterologous Th1 immune effects 2–3 months later. PMID:24611083
Libraty, Daniel H; Zhang, Lei; Woda, Marcia; Acosta, Luz P; Obcena, Anamae; Brion, Job D; Capeding, Rosario Z
2014-01-01
Neonatal Bacille Calmette Guérin (BCG) vaccination has been reported to have beneficial effects beyond preventing infantile tuberculous meningitis and miliary disease. We hypothesized that BCG vaccine given at birth would enhance T-helper 1 (Th1) immune responses to the first vaccines given later in infancy. We conducted a nested case-control study of neonatal BCG vaccination and its heterologous Th1 immune effects in 2-3 months old infants. BCG vaccination at birth was associated with an increased frequency of interferon-γ (IFN-γ) producing spot-forming cells (SFC) to tetanus toxoid 2-3 months later. The frequency of IFN-γ producing SFC to polioviruses 1-3 also trended higher among infants who received BCG vaccination at birth. The frequency of IFN-γ+/tumor necrosis factor-α (TNF-α)+CD45RO+CD4+ T-cells upon stimulation with phorbol myristate acetate (PMA)/Ionomycin was higher in 2-3 months old infants who received BCG vaccination at birth compared to those who did not. The circulating frequency of forkhead box P3 (FoxP3)+ CD45RO+ regulatory CD4+ T-cells also trended lower in these infants. Neonatal BCG vaccination is associated with heterologous Th1 immune effects 2-3 months later.
Cellular immune response experiment MA-031
NASA Technical Reports Server (NTRS)
Criswell, B. S.
1976-01-01
Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.
Hardy, Kristine; Smith, Corey; Tu, Wen Juan; McCuaig, Robert; Panikkar, Archana; Dasari, Vijayendra; Wu, Fan; Tey, Siok-Keen; Hill, Geoffrey R; Khanna, Rajiv; Rao, Sudha
2018-03-27
Immune reconstitution following hematopoietic stem cell transplantation (HSCT) is critical in preventing harmful sequelae in recipients with cytomegalovirus (CMV) infection. To understand the molecular mechanisms underlying immune reconstitution kinetics, we profiled the transcriptome-chromatin accessibility landscape of CMV-specific CD8 + T cells from HCST recipients with different immune reconstitution efficiencies. CMV-specific T cells from HSCT recipients with stable antiviral immunity expressed higher levels of interferon/defense response and cell cycle genes in an interconnected network involving PI3KCG , STAT5B , NFAT , RBPJ , and lower HDAC6 , increasing chromatin accessibility at the enhancer regions of immune and T-cell receptor signaling pathway genes. By contrast, the transcriptional and epigenomic signatures of CMV-specific T cells from HSCT recipients with unstable immune reconstitution showed commonalities with T-cell responses in other nonresolving chronic infections. These signatures included higher levels of EGR and KLF factors that, along with lower JARID2 expression, maintained higher accessibility at promoter and CpG-rich regions of genes associated with apoptosis. Furthermore, epigenetic targeting via inhibition of HDAC6 or JARID2 enhanced the transcription of genes associated with differential responses, suggesting that drugs targeting epigenomic modifiers may have therapeutic potential for enhancing immune reconstitution in HSCT recipients. Taken together, these analyses demonstrate that transcription factors and chromatin modulators create different chromatin accessibility landscapes in T cells of HSCT recipients that not only affect immediate gene expression but also differentially prime cells for responses to additional signals. Epigenetic therapy may be a promising strategy to promote immune reconstitution in HSCT recipients. © 2018 by The American Society of Hematology.
Imaging Polarized Secretory Traffic at the Immune Synapse in Living T Lymphocytes.
Calvo, Víctor; Izquierdo, Manuel
2018-01-01
Immune synapse (IS) formation by T lymphocytes constitutes a crucial event involved in antigen-specific, cellular and humoral immune responses. After IS formation by T lymphocytes and antigen-presenting cells, the convergence of secretory vesicles toward the microtubule-organizing center (MTOC) and MTOC polarization to the IS are involved in polarized secretion at the synaptic cleft. This specialized mechanism appears to specifically provide the immune system with a fine strategy to increase the efficiency of crucial secretory effector functions of T lymphocytes, while minimizing non-specific, cytokine-mediated stimulation of bystander cells, target cell killing and activation-induced cell death. The molecular bases involved in the polarized secretory traffic toward the IS in T lymphocytes have been the focus of interest, thus different models and several imaging strategies have been developed to gain insights into the mechanisms governing directional secretory traffic. In this review, we deal with the most widely used, state-of-the-art approaches to address the molecular mechanisms underlying this crucial, immune secretory response.
Feinerman, Ofer; Jentsch, Garrit; Tkach, Karen E; Coward, Jesse W; Hathorn, Matthew M; Sneddon, Michael W; Emonet, Thierry; Smith, Kendall A; Altan-Bonnet, Grégoire
2010-01-01
Understanding how the immune system decides between tolerance and activation by antigens requires addressing cytokine regulation as a highly dynamic process. We quantified the dynamics of interleukin-2 (IL-2) signaling in a population of T cells during an immune response by combining in silico modeling and single-cell measurements in vitro. We demonstrate that IL-2 receptor expression levels vary widely among T cells creating a large variability in the ability of the individual cells to consume, produce and participate in IL-2 signaling within the population. Our model reveals that at the population level, these heterogeneous cells are engaged in a tug-of-war for IL-2 between regulatory (Treg) and effector (Teff) T cells, whereby access to IL-2 can either increase the survival of Teff cells or the suppressive capacity of Treg cells. This tug-of-war is the mechanism enforcing, at the systems level, a core function of Treg cells, namely the specific suppression of survival signals for weakly activated Teff cells but not for strongly activated cells. Our integrated model yields quantitative, experimentally validated predictions for the manipulation of Treg suppression. PMID:21119631
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.
Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar
2017-12-24
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.
Coplan, Paul M; Gupta, Swati B; Dubey, Sheri A; Pitisuttithum, Punnee; Nikas, Alex; Mbewe, Bernard; Vardas, Efthyia; Schechter, Mauro; Kallas, Esper G; Freed, Dan C; Fu, Tong-Ming; Mast, Christopher T; Puthavathana, Pilaipan; Kublin, James; Brown Collins, Kelly; Chisi, John; Pendame, Richard; Thaler, Scott J; Gray, Glenda; Mcintyre, James; Straus, Walter L; Condra, Jon H; Mehrotra, Devan V; Guess, Harry A; Emini, Emilio A; Shiver, John W
2005-05-01
The genetic diversity of human immunodeficiency virus type 1 (HIV-1) raises the question of whether vaccines that include a component to elicit antiviral T cell immunity based on a single viral genetic clade could provide cellular immune protection against divergent HIV-1 clades. Therefore, we quantified the cross-clade reactivity, among unvaccinated individuals, of anti-HIV-1 T cell responses to the infecting HIV-1 clade relative to other major circulating clades. Cellular immune responses to HIV-1 clades A, B, and C were compared by standardized interferon- gamma enzyme-linked immunospot assays among 250 unvaccinated individuals, infected with diverse HIV-1 clades, from Brazil, Malawi, South Africa, Thailand, and the United States. Cross-clade reactivity was evaluated by use of the ratio of responses to heterologous versus homologous (infecting) clades of HIV-1. Cellular immune responses were predominantly focused on viral Gag and Nef proteins. Cross-clade reactivity of cellular immune responses to HIV-1 clade A, B, and C proteins was substantial for Nef proteins (ratio, 0.97 [95% confidence interval, 0.89-1.05]) and lower for Gag proteins (ratio, 0.67 [95% confidence interval, 0.62-0.73]). The difference in cross-clade reactivity to Nef and Gag proteins was significant (P<.0001). Cross-clade reactivity of cellular immune responses can be substantial but varies by viral protein.
2013-01-01
Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half
Suarez, Guadalupe V; Angerami, Matías T; Vecchione, María B; Laufer, Natalia; Turk, Gabriela; Ruiz, Maria J; Mesch, Viviana; Fabre, Bibiana; Maidana, Patricia; Ameri, Diego; Cahn, Pedro; Sued, Omar; Salomón, Horacio; Bottasso, Oscar A; Quiroga, María F
2015-09-01
Tuberculosis (TB) is the leading cause of death among HIV-positive patients. The decreasing frequencies of terminal effector (TTE ) CD8(+) T cells may increase reactivation risk in persons latently infected with Mycobacterium tuberculosis (Mtb). We have previously shown that dehydroepiandrosterone (DHEA) increases the protective antitubercular immune responses in HIV-TB patients. Here, we aimed to study Mtb-specific cytotoxicity, IFN-γ secretion, memory status of CD8(+) T cells, and their modulation by DHEA during HIV-TB coinfection. CD8(+) T cells from HIV-TB patients showed a more differentiated phenotype with diminished naïve and higher effector memory and TTE T-cell frequencies compared to healthy donors both in total and Mtb-specific CD8(+) T cells. Notably, CD8(+) T cells from HIV-TB patients displayed higher Terminal Effector (TTE ) CD45RA(dim) proportions with lower CD45RA expression levels, suggesting a not fully differentiated phenotype. Also, PD-1 expression levels on CD8(+) T cells from HIV-TB patients increased although restricted to the CD27(+) population. Interestingly, DHEA plasma levels positively correlated with TTE in CD8(+) T cells and in vitro DHEA treatment enhanced Mtb-specific cytotoxic responses and terminal differentiation in CD8(+) T cells from HIV-TB patients. Our data suggest that HIV-TB coinfection promotes a deficient CD8(+) T-cell differentiation, whereas DHEA may contribute to improving antitubercular immunity by enhancing CD8(+) T-cell functions during HIV-TB coinfection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Martín-Gandul, Cecilia; Pérez-Romero, Pilar; Mena-Romo, Damián; Molina-Ortega, Alejandro; González-Roncero, Francisco M; Suñer, Marta; Bernal, Gabriel; Cordero, Elisa
2018-03-23
Some studies have suggested that rATG treatment may be associated with an increased incidence of CMV infection and delayed CMV immune response. However, the evidences supporting this matter are scarce. This study aims to characterize the kinetic of the CMV-specific T-cell immune response before and after rATG induction therapy and the relationship with the development of CMV infection in CMV-seropositive kidney transplant recipients. An observational prospective study of CMV-seropositive kidney transplant patients that received rATG induction therapy was performed. A pretransplant sample was obtained before the surgery to determine the CMV-specific immunity. CMV viral load (by PCR) and CMV-specific T-cell immune response (by flow cytometry) were determined during the follow-up at 0.5, 1, 2, 3, 6, and 12 months post transplantation. A total of 23 patients were included in the study. CMV prophylaxis was administrated for a media of 90 days after transplantation. At the end of follow-up, 18 (78.3%) patients had CMV-specific immunity with a median value of 0.31% CD8 + CD69 + INF-γ + T cells at a median of 16 weeks post transplantation. Five patients never acquired CMV-specific immunity. No statistically significant association between CMV infection and CMV-specific T-cell immune response (P = .086) was observed. However, patients with positive pretransplant CMV-specific immunity developed earlier immunity and achieved higher levels of CD8 + CD69 + INF-γ+ T-cell post-transplantation than patients with negative pretransplant immunity. CMV-specific immune monitoring in addition to CMV-serology may be useful to stratify patient's risk of CMV infection before transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Role of vitamin D in cytotoxic T lymphocyte immunity to pathogens and cancer.
Sarkar, Surojit; Hewison, Martin; Studzinski, George P; Li, Yan Chun; Kalia, Vandana
2016-01-01
The discovery of vitamin D receptor (VDR) expression in immune cells has opened up a new area of research into immunoregulation by vitamin D, a niche that is distinct from its classical role in skeletal health. Today, about three decades since this discovery, numerous cellular and molecular targets of vitamin D in the immune system have been delineated. Moreover, strong clinical associations between vitamin D status and the incidence/severity of many immune-regulated disorders (e.g. infectious diseases, cancers and autoimmunity) have prompted the idea of using vitamin D supplementation to manipulate disease outcome. While much is known about the effects of vitamin D on innate immune responses and helper T (T(H)) cell immunity, there has been relatively limited progress on the frontier of cytotoxic T lymphocyte (CTL) immunity--an arm of host cellular adaptive immunity that is crucial for the control of such intracellular pathogens as human immunodeficiency virus (HIV), tuberculosis (TB), malaria, and hepatitis C virus (HCV). In this review, we discuss the strong historical and clinical link between vitamin D and infectious diseases that involves cytotoxic T lymphocyte (CTL) immunity, present our current understanding as well as critical knowledge gaps in the realm of vitamin D regulation of host CTL responses, and highlight potential regulatory connections between vitamin D and effector and memory CD8 T cell differentiation events during infections.
Shah, Nishel Mohan; Herasimtschuk, Anna A.; Boasso, Adriano; Benlahrech, Adel; Fuchs, Dietmar; Imami, Nesrina; Johnson, Mark R.
2017-01-01
During pregnancy, the mother allows the immunologically distinct fetoplacental unit to develop and grow. Opinions are divided as to whether this represents a state of fetal-specific tolerance or of a generalized suppression of the maternal immune system. We hypothesized that antigen-specific T cell responses are modulated by an inhibitory T cell phenotype and modified dendritic cell (DC) phenotype in a gestation-dependent manner. We analyzed changes in surface markers of peripheral blood T cells, ex vivo antigen-specific T cell responses, indoleamine 2,3-dioxygenase (IDO) activity (kynurenine/tryptophan ratio, KTR), plasma neopterin concentration, and the in vitro expression of progesterone-induced blocking factor (PIBF) in response to peripheral blood mononuclear cell culture with progesterone. We found that mid gestation is characterized by reduced antigen-specific T cell responses associated with (1) predominance of effector memory over other T cell subsets; (2) upregulation of inhibitory markers (programmed death ligand 1); (3) heightened response to progesterone (PIBF); and (4) reduced proportions of myeloid DC and concurrent IDO activity (KTR). Conversely, antigen-specific T cell responses normalized in late pregnancy and were associated with increased markers of T cell activation (CD38, neopterin). However, these changes occur with a simultaneous upregulation of immune suppressive mechanisms including apoptosis (CD95), coinhibition (TIM-3), and immune regulation (IL-10) through the course of pregnancy. Together, our data suggest that immune tolerance dominates in the second trimester and that it is gradually reversed in the third trimester in association with immune activation as the end of pregnancy approaches. PMID:28966619
CARs: Driving T-cell specificity to enhance anti-tumor immunity
Kebriaei, Partow; Kelly, Susan S.; Manuri, Pallavi; Jena, Bipulendu; Jackson, Rineka; Shpall, Elizabeth; Champlin, Richard; Cooper, Laurence J. N.
2013-01-01
Adoptive transfer of antigen-specific T cells is a compelling tool to treat cancer. To overcome issues of immune tolerance which limits the endogenous adaptive immune response to tumor-associated antigens, robust systems for the genetic modification and characterization of T cells expressing chimeric antigen receptors (CARs) to redirect specificity have been produced. Refinements with regards to persistence and trafficking of the genetically modified T cells are underway to help improve the potency of genetically modified T cells. Clinical trials utilizing this technology demonstrate feasibility, and increasingly, antitumor activity, paving the way for multi-center trials to establish the efficacy of this novel T-cell therapy. PMID:22202074
Innate T cell responses in human gut.
Meresse, Bertrand; Cerf-Bensussan, Nadine
2009-06-01
One arm of the gut-associated immune system is represented by a vast collection of T lymphocytes which participate in the subtle interplay between innate and adaptive immune mechanisms and maintain homeostasis at the main body external surface. Mounting data are providing exciting new insight into the innate-like mechanisms which enable intestinal T cells to rapidly sense local conditions and which broaden the spectrum of their functions and regulation at this strategic location. Herein we discuss how innate-like T cell recognition by unconventional T cell subsets and expression of innate NK receptors might modulate immune T cell responses in the human normal or diseased intestine.
CD4(+) T-cell help amplifies innate signals for primary CD8(+) T-cell immunity.
Bedoui, Sammy; Heath, William R; Mueller, Scott N
2016-07-01
CD8(+) T cells provide an important component of protection against intracellular infections and cancer. Immune responses by these T cells involve a primary phase of effector expansion and differentiation, followed by a contraction phase leading to memory formation and, if antigen is re-encountered, a secondary expansion phase with more rapid differentiation. Both primary and secondary phases of CD8(+) T-cell immunity have been shown to depend on CD4(+) T-cell help, although during certain infections the primary phase is variable in this requirement. One explanation for such variability relates to the strength of associated inflammatory signals, with weak signals requiring help. Here, we focus on our studies that have dissected the requirements for help in the primary phase of the CTL response to herpes simplex virus, elucidating intricate interactions and communications between CD4(+) T cells, various dendritic cell subsets, and CD8(+) T cells. We place our studies in the context of others and describe a simple model of help where CD40 signaling amplifies innate signals to enable efficient CD8(+) T-cell expansion and differentiation. This model facilitates CTL induction to various different agents, without altering the qualitative innate signals that direct other important arms of immunity. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Adaptive Immune Responses following Senecavirus A Infection in Pigs.
Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G
2018-02-01
Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease
Loss of a Conserved tRNA Anticodon Modification Perturbs Plant Immunity
López, Ana; Castelló, María José; Gil, María José; Zheng, Bo; Chen, Peng; Vera, Pablo
2015-01-01
tRNA is the most highly modified class of RNA species, and modifications are found in tRNAs from all organisms that have been examined. Despite their vastly different chemical structures and their presence in different tRNAs, occurring in different locations in tRNA, the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s). Recent discoveries have revealed unprecedented complexity in the modification patterns of tRNA, their regulation and function, suggesting that each modified nucleoside in tRNA may have its own specific function. However, in plants, our knowledge on the role of individual tRNA modifications and how they are regulated is very limited. In a genetic screen designed to identify factors regulating disease resistance and activation of defenses in Arabidopsis, we identified SUPPRESSOR OF CSB3 9 (SCS9). Our results reveal SCS9 encodes a tRNA methyltransferase that mediates the 2´-O-ribose methylation of selected tRNA species in the anticodon loop. These SCS9-mediated tRNA modifications enhance during the course of infection with the bacterial pathogen Pseudomonas syringae DC3000, and lack of such tRNA modification, as observed in scs9 mutants, severely compromise plant immunity against the same pathogen without affecting the salicylic acid (SA) signaling pathway which regulates plant immune responses. Our results support a model that gives importance to the control of certain tRNA modifications for mounting an effective immune response in Arabidopsis, and therefore expands the repertoire of molecular components essential for an efficient disease resistance response. PMID:26492405
Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.
Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host
Moesta, Achim K; Cooke, Keegan; Piasecki, Julia; Mitchell, Petia; Rottman, James B; Fitzgerald, Karen; Zhan, Jinghui; Yang, Becky; Le, Tiep; Belmontes, Brian; Ikotun, Oluwatayo F; Merriam, Kim; Glaus, Charles; Ganley, Kenneth; Cordover, David H; Boden, Andrea M; Ponce, Rafael; Beers, Courtney; Beltran, Pedro J
2017-10-15
Purpose: Talimogene laherparepvec, a new oncolytic immunotherapy, has been recently approved for the treatment of melanoma. Using a murine version of the virus, we characterized local and systemic antitumor immune responses driving efficacy in murine syngeneic models. Experimental Design: The activity of talimogene laherparepvec was characterized against melanoma cell lines using an in vitro viability assay. Efficacy of OncoVEX mGM-CSF (talimogene laherparepvec with the mouse granulocyte-macrophage colony-stimulating factor transgene) alone or in combination with checkpoint blockade was characterized in A20 and CT-26 contralateral murine tumor models. CD8 + depletion, adoptive T-cell transfers, and Enzyme-Linked ImmunoSpot assays were used to study the mechanism of action (MOA) of systemic immune responses. Results: Treatment with OncoVEX mGM-CSF cured all injected A20 tumors and half of contralateral tumors. Viral presence was limited to injected tumors and was not responsible for systemic efficacy. A significant increase in T cells (CD3 + /CD8 + ) was observed in injected and contralateral tumors at 168 hours. Ex vivo analyses showed these cytotoxic T lymphocytes were tumor-specific. Increased neutrophils, monocytes, and chemokines were observed in injected tumors only. Importantly, depletion of CD8 + T cells abolished all systemic efficacy and significantly decreased local efficacy. In addition, immune cell transfer from OncoVEX mGM-CSF -cured mice significantly protected from tumor challenge. Finally, combination of OncoVEX mGM-CSF and checkpoint blockade resulted in increased tumor-specific CD8 + anti-AH1 T cells and systemic efficacy. Conclusions: The data support a dual MOA for OncoVEX mGM-CSF that involves direct oncolysis of injected tumors and activation of a CD8 + -dependent systemic response that clears injected and contralateral tumors when combined with checkpoint inhibition. Clin Cancer Res; 23(20); 6190-202. ©2017 AACR . ©2017 American Association
Calpe-Berdiel, Laura; Escolà-Gil, Joan Carles; Benítez, Sonia; Bancells, Cristina; González-Sastre, Francesc; Palomer, Xavier; Blanco-Vaca, Francisco
2007-05-01
Although most studies have focused on the cholesterol-lowering activity of phytosterols, other biological actions have been ascribed to these plant sterol compounds, one of which is a potential immune modulatory effect. To gain insight into this issue, we used a mouse model of acute, aseptic inflammation induced by a single subcutaneous turpentine injection. Hypercholesterolemic apolipoprotein E-deficient (apoE(-/-)) mice, fed with or without a 2% phytosterol supplement, were treated with turpentine or saline and euthanized 48 h later. No differences were observed in spleen lymphocyte subsets between phytosterol- and control-fed apoE(-/-) mice. However, cultured spleen lymphocytes of apoE(-/-) mice fed with phytosterols and treated with turpentine showed increased IL-2 and IFN-gamma secretion (T-helper type1, Th1 lymphocyte cytokines) compared with turpentine-treated, control-fed animals. In contrast, there was no change in Th2 cytokines IL-4 and IL-10. Phytosterols also inhibit intestinal cholesterol absorption in wild-type C57BL/6J mice but, in this case, without decreasing plasma cholesterol. Spleen lymphocytes of turpentine-treated C57BL/6J mice fed with phytosterols also showed increased IL-2 production, but IFN-gamma, IL-4 and IL-10 production was unchanged. The Th1/Th2 ratio was significantly increased both in phytosterol-fed apoE(-/-) and C57BL/6J mice. We conclude that phytosterols modulate the T-helper immune response in vivo, in part independently of their hypocholesterolemic effect in a setting of acute, aseptic inflammation. Further study of phytosterol effects on immune-based diseases characterized by an exacerbated Th2 response is thus of interest.
Song, Chanyoung; Noh, Young-Woock; Lim, Yong Taik
2016-01-01
Effective induction of an antigen-specific cytotoxic T lymphocyte (CTL) immune response is one of the key goals of cancer immunotherapy. We report the design and fabrication of polyethylenimine (PEI)-coated polymer nanoparticles (NPs) as efficient antigen-delivery carriers that can induce antigen cross-presentation and a strong CTL response. After synthesis of poly(d,l-lactide-co-glycolide) (PLGA) NPs containing ovalbumin (OVA) by the double-emulsion solvent-evaporation method, cationic-charged PLGA NPs were generated by coating them with PEI. In a methyl tetrazolium salt assay, no discernible cytotoxic effect of PEI-coated PLGA (OVA) NPs was observed. The capacity and mechanism of PEI-coated PLGA (OVA) NPs for antigen delivery and cross-presentation on dendritic cells (DCs) were determined by fluorescence microscopy and flow cytometry. PEI-coated PLGA (OVA) NPs were internalized efficiently via phagocytosis or macropinocytosis in DCs and induced efficient cross-presentation of the antigen on MHC class I molecules via both endosome escape and a lysosomal processing mechanism. The DCs treated with PEI-coated PLGA (OVA) NPs induced a release of IL-2 cytokine from OVA-specific CD8-OVA1.3 T cells more efficiently than DCs treated with PLGA (OVA) NPs. Therefore, the PEI-coated PLGA (OVA) NPs can induce antigen cross-presentation and are expected to be used for induction of a strong CTL immune response and for efficient anticancer immunotherapy. PMID:27540289
Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J
2011-03-01
The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.
Leptin, immune responses and autoimmune disease. Perspectives on the use of leptin antagonists.
Peelman, F; Iserentant, H; Eyckerman, S; Zabeau, L; Tavernier, J
2005-01-01
The pivotal role of leptin in regulating body weight and energy homeostasis is very well established. More recently, leptin also emerged as an important regulator of T-cell-dependent immunity. Reduced leptin levels, as observed during periods of starvation, correlate with an impaired cellular immune response, whereby especially the T(H)1 pro-inflammatory immune response appears to be affected. Physiologically, this could reflect the high energy demand of such processes, which are suppressed in animals or people with nutrient shortage. Several autoimmune diseases are T(H)1 T-cell dependent. In line with a pro-inflammatory role for leptin, animal models of leptin deficiency are markedly resistant to a variety of T-cell dependent autoimmune diseases. Here, we review the role of leptin in immune responses, with emphasis on autoimmune diseases. The design and potential use of leptin antagonists is also discussed.
Prior Dengue virus exposure shapes T cell immunity to Zika virus in humans.
Grifoni, Alba; Pham, John; Sidney, John; O'Rourke, Patrick H; Paul, Sinu; Peters, Bjoern; Martini, Sheridan R; de Silva, Aruna D; Ricciardi, Michael J; Magnani, Diogo M; Silveira, Cassia G T; Maestri, Alvino; Costa, Priscilla R; de-Oliveira-Pinto, Luzia Maria; de Azeredo, Elzinandes Leal; Damasco, Paulo Vieira; Phillips, Elizabeth; Mallal, Simon; de Silva, Aravinda M; Collins, Matthew; Durbin, Anna; Diehl, Sean A; Cerpas, Cristhiam; Balmaseda, Angel; Kuan, Guillermina; Coloma, Josefina; Harris, Eva; Crowe, James E; Stone, Mars; Norris, Phillip J; Busch, Michael; Vivanco-Cid, Hector; Cox, Josephine; Graham, Barney S; Ledgerwood, Julie E; Turtle, Lance; Solomon, Tom; Kallas, Esper G; Watkins, David I; Weiskopf, Daniela; Sette, Alessandro
2017-10-04
While progress has been made in characterizing humoral immunity to Zika virus (ZIKV) in humans, little is known regarding the corresponding T cell responses to ZIKV. Here we investigate the kinetics and viral epitopes targeted by T cells responding to ZIKV and address the critical question of whether pre-existing dengue virus (DENV) T cell immunity modulates these responses. We find that memory T cell responses elicited by prior infection with DENV or vaccination with Tetravalent Dengue Attenuated Vaccines (TDLAV) recognize ZIKV-derived peptides. This cross-reactivity is explained by the sequence similarity of the two viruses, as the ZIKV peptides recognized by DENV-elicited memory T cells are identical or highly conserved in DENV and ZIKV. DENV exposure prior to ZIKV infection also influences the timing and magnitude of the T cell response. ZIKV-reactive T cells in the acute phase of infection are detected earlier and in greater magnitude in DENV-immune patients. Conversely, the frequency of ZIKV-reactive T cells continues to rise in the convalescent phase in DENV-naive donors, but declines in DENV pre-exposed donors, compatible with more efficient control of ZIKV replication and/or clearance of ZIKV antigen. The quality of responses is also influenced by previous DENV exposure, and ZIKV-specific CD8 T cells form DENV pre-exposed donors selectively up-regulated granzyme B and PD1, as compared to DENV-naïve donors. Finally, we discovered that ZIKV structural proteins (E, prM and C) are major targets of both the CD4 and CD8 T cell responses, whereas DENV T cell epitopes are found primarily in nonstructural proteins. IMPORTANCE The issue of potential ZIKV and DENV cross-reactivity and how pre-existing DENV T cell immunity modulates ZIKA T cell responses is of great relevance as the two viruses often co-circulate and ZIKA virus has been spreading in geographical regions where DENV is endemic or hyper-endemic. Our data show that memory T cell responses elicited by
ZFP36 RNA-binding proteins restrain T-cell activation and anti-viral immunity.
Moore, Michael J; Blachere, Nathalie E; Fak, John J; Park, Christopher Y; Sawicka, Kirsty; Parveen, Salina; Zucker-Scharff, Ilana; Moltedo, Bruno; Rudensky, Alexander Y; Darnell, Robert B
2018-05-31
Dynamic post-transcriptional control of RNA expression by RNA-binding proteins (RBPs) is critical during immune response. ZFP36 RBPs are prominent inflammatory regulators linked to autoimmunity and cancer, but functions in adaptive immunity are less clear. We used HITS-CLIP to define ZFP36 targets in mouse T cells, revealing unanticipated actions in regulating T cell activation, proliferation, and effector functions. Transcriptome and ribosome profiling showed that ZFP36 represses mRNA target abundance and translation, notably through novel AU-rich sites in coding sequence. Functional studies revealed that ZFP36 regulates early T cell activation kinetics cell autonomously, by attenuating activation marker expression, limiting T cell expansion, and promoting apoptosis. Strikingly, loss of ZFP36 in vivo accelerated T cell responses to acute viral infection and enhanced anti-viral immunity. These findings uncover a critical role for ZFP36 RBPs in restraining T cell expansion and effector functions, and suggest ZFP36 inhibition as a strategy to enhance immune-based therapies. © 2018, Moore et al.
Role of T Cell TGF-β Signaling in Intestinal Cytokine Responses and Helminthic Immune Modulation
Ince, M. Nedim; Elliott, David E.; Setiawan, Tommy; Metwali, Ahmed; Blum, Arthur; Chen, Hung-lin; Urban, Joseph F.; Flavell, Richard A.; Weinstock, Joel V.
2010-01-01
Colonization with helminthic parasites induces mucosal regulatory cytokines, like IL-10 or TGF-β that are important in suppressing colitis. Helminths induce mucosal T cell IL-10 secretion and regulate lamina propria mononuclear cell Th1 cytokine generation in an IL-10 dependent manner in wild-type mice. Helminths also stimulate mucosal TGF-β release. As TGF-β exerts major regulatory effects on T lymphocytes, we investigated the role of T lymphocyte TGF-β signaling in helminthic modulation of intestinal immunity. T cell TGF-β signaling is interrupted in TGF-βRII DN mice by T cell-specific over-expression of a dominant negative TGF-β receptor II. We studied lamina propria mononuclear cell responses in wild-type and TGF-βRII DN mice that were uninfected or colonized with the nematode, Heligmosomoides polygyrus. Our results indicate an essential role of T cell TGF-β signaling in limiting mucosal Th1 and Th2 responses. Furthermore, we demonstrate that helminthic induction of intestinal T cell IL-10 secretion requires intact T cell TGF-β signaling pathway. Helminths fail to curtail robust, dysregulated intestinal Th1 cytokine production and chronic colitis in TGF-βRII DN mice. Thus, T cell TGF-β signaling is essential for helminthic stimulation of mucosal IL-10 production, helminthic modulation of intestinal interferon-γ generation and H. polygyrus-mediated suppression of chronic colitis. PMID:19544487
Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li
2013-02-18
The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses
Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.
2011-01-01
The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979
γδ T Cells Are a Component of Early Immunity against Preerythrocytic Malaria Parasites
McKenna, Kyle C.; Tsuji, Moriya; Sarzotti, Marcella; Sacci, John B.; Witney, Adam A.; Azad, Abdu F.
2000-01-01
We tested the hypothesis that γδ T cells are a component of an early immune response directed against preerythrocytic malaria parasites that are required for the induction of an effector αβ T-cell immune response generated by irradiated-sporozoite (irr-spz) immunization. γδ T-cell-deficient (TCRδ−/−) mice on a C57BL/6 background were challenged with Plasmodium yoelii (17XNL strain) sporozoites, and then liver parasite burden was measured at 42 h postchallenge. Liver parasite burden was measured by quantification of parasite-specific 18S rRNA in total liver RNA by quantitative-competitive reverse transcription-PCR and by an automated 5′ exonuclease PCR. Sporozoite-challenged TCRδ−/− mice showed a significant (P < 0.01) increase in liver parasite burden compared to similarly challenged immunocompetent mice. In support of this result, TCRδ−/− mice were also found to be more susceptible than immunocompetent mice to a sporozoite challenge when blood-stage parasitemia was used as a readout. A greater percentage of TCRδ−/− mice than of immunocompetent mice progressed to a blood-stage infection when challenged with five or fewer sporozoites (odds ratio = 2.35, P = 0.06). TCRδ−/− mice receiving a single irr-spz immunization showed percent inhibition of liver parasites comparable to that of immunized immunocompetent mice following a sporozoite challenge. These data support the hypothesis that γδ T cells are a component of early immunity directed against malaria preerythrocytic parasites and suggest that γδ T cells are not required for the induction of an effector αβ T-cell immune response generated by irr-spz immunization. PMID:10722623
Vaginal type-II mucosa is an inductive site for primary CD8+ T-cell mucosal immunity
Wang, Yichuan; Sui, Yongjun; Kato, Shingo; Hogg, Alison E.; Steel, Jason C.; Morris, John C.; Berzofsky, Jay A.
2014-01-01
The structured lymphoid tissues are considered the only inductive sites where primary T cell immune responses occur. The naïve T cells in structured lymphoid tissues, once being primed by antigen -bearing dendritic cells, differentiate into memory T cells and traffic back to the mucosal sites through the bloodstream. Contrary to this belief, here we show that the vaginal type-II mucosa itself, despite lack of structured lymphoid tissues, can act as an inductive site during primary CD8+ T cell immune responses. We provide evidence that the vaginal mucosa supports both the local immune priming of naïve CD8+ T cells and the local expansion of antigen-specific CD8+ T cells, thereby demonstrating a different paradigm for primary mucosal T cell immune induction. PMID:25600442
Innate immunity and HIV-1 infection.
Lehner, T; Wang, Y; Whittall, T; Seidl, T
2011-04-01
HIV-1 is predominantly transmitted through mucosal tissues, targeting CD4(+)CCR5(+) T cells, 50% of which are destroyed within 2 weeks of infection. Conventional vaccination strategies have so far failed to prevent HIV-1 infection. Neither antibodies nor cytotoxic lymphocytes are capable of mounting a sufficiently rapid immune response to prevent early destruction of these cells. However, innate immunity is an early-response system, largely independent of prior encounter with a pathogen. Innate immunity can be classified into cellular, extracellular, and intracellular components, each of which is exemplified in this review by γδ T cells, CC chemokines, and APOBEC3G, respectively. First, γδ T cells are found predominantly in mucosal tissues and produce cytokines, CC chemokines, and antiviral factors. Second, the CC chemokines CCL-3, CCL-4, and CCL-5 can be upregulated by immunization of macaques with SIVgp120 and gag p27, and these can bind and downmodulate CCR5, thereby inhibiting HIV-1 entry into the host cells. Third, APOBEC3G is generated and maintained following rectal mucosal immunization in rhesus macaques for over 17 weeks, and the innate anti-SIV factor is generated by CD4(+)CD95(+)CCR7(-) effector memory T cells. Thus, innate anti-HIV-1 or SIV immunity can be linked with immune memory, mediated by CD4(+) T cells generating APOBEC3G. The multiple innate functions may mount an early anti-HIV-1 response and either prevent viral transmission or contain the virus until an effective adaptive immune response develops.
NASA Astrophysics Data System (ADS)
Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.
1999-04-01
Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.
T lymphocytes from mice immunized with irradiated sporozoites eliminated malaria from hepatocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoffman, S.L.; Isenbarger, D.; Long, G.W.
When mice are immunized with radiation-attenuated sporozoites they are solidly protected against sporozoite challenge by an immune response that has been shown to require CD8+ lymphocytes in several strains of mice. The target of this CD8+ T-cell-dependent immunity has not been established. Immune BALB/c mice were shown to develop malaria-specific. CD8+ T-cell-dependent inflammatory infiltrates in their livers after challenge with Plasmodium berghei sporozoites. Spleen cells from immune BALB/c and C57BL/6 mice eliminated hepatocytes infected with the liver stage of P. berghei in vitro. The activity against infected hepatocytes is not inhibited by antibodies to interferon-y and is not present inmore » culture supernatants. It is generally restricted, an indication that malaria antigens on the hepatocyte surface are recognized by immune T-effector cells.« less
Host Immune Response to Influenza A Virus Infection.
Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long
2018-01-01
Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.
γδ T cell and other immune cells crosstalk in cellular immunity.
He, Ying; Wu, Kangni; Hu, Yongxian; Sheng, Lixia; Tie, Ruxiu; Wang, Binsheng; Huang, He
2014-01-01
γδ T cells have been recognized as effectors with immunomodulatory functions in cellular immunity. These abilities enable them to interact with other immune cells, thus having the potential for treatment of various immune-mediated diseases with adoptive cell therapy. So far, the interactions between γδ T cell and other immune cells have not been well defined. Here we will discuss the interactivities among them and the perspective on γδ T cells for their use in immunotherapy could be imagined. The understanding of the crosstalk among the immune cells in immunopathology might be beneficial for the clinical application of γδ T cell.
Kouo, Theodore; Huang, Lanqing; Pucsek, Alexandra B; Cao, Minwei; Solt, Sara; Armstrong, Todd; Jaffee, Elizabeth
2015-04-01
Galectin-3 is a 31-kDa lectin that modulates T-cell responses through several mechanisms, including apoptosis, T-cell receptor (TCR) cross-linking, and TCR downregulation. We found that patients with pancreatic ductal adenocarcinoma (PDA) who responded to a granulocyte-macrophage colony-stimulating factor-secreting allogeneic PDA vaccine developed neutralizing antibodies to galectin-3 after immunization. We show that galectin-3 binds activated antigen-committed CD8(+) T cells only in the tumor microenvironment. Galectin-3-deficient mice exhibit improved CD8(+) T-cell effector function and increased expression of several inflammatory genes. Galectin-3 binds to LAG-3, and LAG-3 expression is necessary for galectin-3-mediated suppression of CD8(+) T cells in vitro. Lastly, galectin-3-deficient mice have elevated levels of circulating plasmacytoid dendritic cells, which are superior to conventional dendritic cells in activating CD8(+) T cells. Thus, inhibiting galectin-3 in conjunction with CD8(+) T-cell-directed immunotherapies should enhance the tumor-specific immune response. ©2015 American Association for Cancer Research.
Follicular helper T cell in immunity and autoimmunity.
Mesquita, D; Cruvinel, W M; Resende, L S; Mesquita, F V; Silva, N P; Câmara, N O S; Andrade, L E C
2016-01-01
The traditional concept that effector T helper (Th) responses are mediated by Th1/Th2 cell subtypes has been broadened by the recent demonstration of two new effector T helper cells, the IL-17 producing cells (Th17) and the follicular helper T cells (Tfh). These new subsets have many features in common, such as the ability to produce IL-21 and to express the IL-23 receptor (IL23R), the inducible co-stimulatory molecule ICOS, and the transcription factor c-Maf, all of them essential for expansion and establishment of the final pool of both subsets. Tfh cells differ from Th17 by their ability to home to B cell areas in secondary lymphoid tissue through interactions mediated by the chemokine receptor CXCR5 and its ligand CXCL13. These CXCR5+ CD4+ T cells are considered an effector T cell type specialized in B cell help, with a transcriptional profile distinct from Th1 and Th2 cells. The role of Tfh cells and its primary product, IL-21, on B-cell activation and differentiation is essential for humoral immunity against infectious agents. However, when deregulated, Tfh cells could represent an important mechanism contributing to exacerbated humoral response and autoantibody production in autoimmune diseases. This review highlights the importance of Tfh cells by focusing on their biology and differentiation processes in the context of normal immune response to infectious microorganisms and their role in the pathogenesis of autoimmune diseases.
GENETIC CONTROL OF THE IMMUNE RESPONSE
Lonai, Peter; McDevitt, Hugh O.
1974-01-01
In vitro antigen-induced tritiated thymidine uptake has been used to study the response of sensitized lymphocytes to (T,G)-A--L, (H,G)-A--L, and (Phe,G)-A--L in responder and nonresponder strains of mice. The reaction is T-cell and macrophage dependent. Highly purified T cells (91% Thy 1.2 positive) are also responsive, suggesting that this in vitro lymphocyte transformation system is not B-cell dependent. Lymphocytes from high and low responder mice stimulated in vitro react as responders and nonresponders in a pattern identical to that seen with in vivo immunization. Stimulation occurs only if soluble antigen is added at physiological temperatures; antigen exposure at 4°C followed by washing and incubation at 37°C fails to induce lymphocyte transformation. Stimulation is specific for the immunizing antigen and does not exhibit the serologic cross-reactivity which is characteristic of these three antigens and their respective antisera. The reaction can be inhibited by anti-H-2 sera but not by anti-immunoglobulin sera. The anti-immunoglobulin sera did, however, inhibit lipopolysaccharide or pokeweed mitogen stimulation. These results suggest that the Ir-1A gene(s) are expressed in T cells, and that there are fundamental physiologic differences between T- and B-cell antigen recognition. PMID:4547782
Rahman, Sayma; Gudetta, Berhanu; Fink, Joshua; Granath, Anna; Ashenafi, Senait; Aseffa, Abraham; Derbew, Milliard; Svensson, Mattias; Andersson, Jan; Brighenti, Susanna Grundström
2009-06-01
Immune responses were assessed at the single-cell level in lymph nodes from children with tuberculous lymphadenitis. Tuberculosis infection was associated with tissue remodeling of lymph nodes as well as altered cellular composition. Granulomas were significantly enriched with CD68+ macrophages expressing the M. tuberculosis complex-specific protein antigen MPT64 and inducible nitric oxide synthase. There was a significant increase in CD8+ cytolytic T cells surrounding the granuloma; however, CD8+ T cells expressed low levels of the cytolytic and antimicrobial effector molecules perforin and granulysin in the granulomatous lesions. Quantitative real-time mRNA analysis revealed that interferon-gamma, tumor necrosis factor-alpha, and interleukin-17 were not up-regulated in infected lymph nodes, but there was a significant induction of both transforming growth factor-beta and interleukin-13. In addition, granulomas contained an increased number of CD4+FoxP3+ T cells co-expressing the immunoregulatory cytotoxic T-lymphocyte antigen-4 and glucocorticoid-induced tumor necrosis factor receptor molecules. Low numbers of CD8+ T cells in the lesions correlated with high levels of transforming growth factor-beta and FoxP3+ regulatory T cells, suggesting active immunosuppression at the local infection site. Compartmentalization and skewing of the immune response toward a regulatory phenotype may result in an uncoordinated effector T-cell response that reduces granule-mediated killing of M. tuberculosis-infected cells and subsequent disease control.
Mitsuya, H; Jarrett, R F; Cossman, J; Cohen, O J; Kao, C S; Guo, H G; Reitz, M S; Broder, S
1986-01-01
Human T lymphotropic virus-I (HTLV-I)-specific T cell lines were established and cloned. K5, an OKT8+ clone bearing multiple proviral integration sites, retained its HTLV-I-specific cytotoxicity and a normal dependence on interleukin 2 (IL-2), indicating that there is a finite number of transforming integration sites. R2, an OKT4+ HTLV-I-infected clone, initially mounted a proliferative response to HTLV-I; but then its IL-2-independent proliferation increased and the antigen specificity was lost. All HTLV-I-infected clones tested including K7, another OKT8+ transformed cytotoxic clone that had lost its reactivity, expressed comparable levels of T cell receptor beta-chain (TCR-beta) messenger (m)RNA. Although clones K5 and K7 had different functional properties, they had the same rearrangement of the TCR-beta gene, suggesting that they had the same clonal origin. These data indicate that HTLV-I-specific T cells retain their immune reactivity for variable periods of time following infection, but then usually lose it; in some cases, however, no alteration in function can be detected. The data also suggest that different consequences can take place in the same clone depending on the pattern of retroviral infection. Images PMID:2877011
Regulatory role of Vγ1 γδ T cells in tumor immunity through IL-4 production.
Hao, Jianlei; Dong, Siyuan; Xia, Siyuan; He, Weifeng; Jia, Hao; Zhang, Song; Wei, Jun; O'Brien, Rebecca L; Born, Willi K; Wu, Zhenzhou; Wang, Puyue; Han, Jihong; Hong, Zhangyong; Zhao, Liqing; Yin, Zhinan
2011-11-15
It has been demonstrated that the two main subsets of peripheral γδ T cells, Vγ1 and Vγ4, have divergent functions in many diseases models. Recently, we reported that Vγ4 γδ T cells played a protective role in tumor immunity through eomesodermin-controlled mechanisms. However, the precise roles of Vγ1 γδ T cells in tumor immunity, especially whether Vγ1 γδ T cells have any interaction with Vγ4 γδ T cells, remain unknown. We demonstrated in this paper that Vγ1 γδ T cells suppressed Vγ4 γδ T cell-mediated antitumor function both in vitro and in vivo, and this suppression was cell contact independent. Using neutralizing anti-IL-4 Ab or IL-4(-/-) mice, we determined the suppressive factor derived from Vγ1 γδ T cells was IL-4. Indeed, treatment of Vγ4 γδ T cells with rIL-4 significantly reduced expression levels of NKG2D, perforin, and IFN-γ. Finally, Vγ1 γδ T cells produced more IL-4 and expressed significantly higher level of GATA-3 upon Th2 priming in comparison with Vγ4 γδ T cells. Therefore, to our knowledge, our results established for the first time a negative regulatory role of Vγ1 γδ T cells in Vγ4 γδ T cell-mediated antitumor immunity through cell contact-independent and IL-4-mediated mechanisms. Selective depletion of this suppressive subset of γδ T cells may be beneficial for tumor immune therapy.
Immune Response to Dengue and Zika.
Ngono, Annie Elong; Shresta, Sujan
2018-04-26
Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.
Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.
Luu, L; Coombes, J L
2015-03-01
Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.
Effects of chemotherapy on immune responses in dogs with cancer.
Walter, Claudia U; Biller, Barbara J; Lana, Susan E; Bachand, Annette M; Dow, Steven W
2006-01-01
Chemotherapy is assumed to be immunosuppressive; yet to the authors' knowledge, the effects of common chemotherapy protocols on adaptive immune responses in dogs with cancer have not been fully evaluated. Therefore, a study was conducted to evaluate the effects of 2 common chemotherapy protocols on T- and B-cell numbers and humoral immune responses to de novo vaccination in dogs with cancer. Twenty-one dogs with cancer (12 with lymphoma, 9 with osteosarcoma) were enrolled in a prospective study to assess effects of doxorubicin versus multi-drug chemotherapy on adaptive immunity. Numbers of circulating T and B cells were assessed by flow cytometry, and antibody responses to de novo vaccination were assessed before, during, and after chemotherapy. The T- and B-cell numbers before treatment also were compared with those of healthy, age-matched, control dogs. Prior to treatment, dogs with cancer had significantly fewer (P < .05) CD4+ T cells and CD8+ T cells than did healthy dogs. Doxorubicin treatment did not cause a significant decrease in T- or B-cell numbers, whereas treatment with combination chemotherapy caused a significant and persistent decrease in B-cell numbers. Antibody titers after vaccination were not significantly different between control and chemotherapy-treated dogs. These findings suggest that chemotherapy may have less impact on T-cell numbers and ability to mount antibody responses in dogs with cancer than was previously anticipated, though dogs with lymphoma or osteosarcoma appear to be relatively T-cell deficient before initiation of chemotherapy.
Synthetic RORγt Agonists Enhance Protective Immunity
Chang, Mi Ra; Dharmarajan, Venkatasubramanian; Doebelin, Christelle; Garcia-Ordonez, Ruben D.; Novick, Scott J.; Kuruvilla, Dana S.; Kamenecka, Theodore M.; Griffin, Patrick R.
2016-01-01
The T cell specific RORγ isoform RORγt has been shown to be the key lineage-defining transcription factor to initiate the differentiation program of TH17 and Tc17 cells, cells that have demonstrated anti-tumor efficacy. RORγt controls gene networks that enhance immunity including increased IL17 production and decreased immune suppression. Both synthetic and putative endogenous agonists of RORγt have been shown to increase the basal activity of RORγt enhancing TH17 cell proliferation. Here we show that activation of RORγt using synthetic agonists drives proliferation of TH17 cells while decreasing levels of the immune checkpoint protein PD-1, a mechanism that should enhance anti-tumor immunity while blunting tumor associated adaptive immune resistance. Interestingly, putative endogenous agonists drive proliferation of TH17 cells but do not repress PD-1. These findings suggest that synthetic agonists of RORγt should activate TC17/TH17 cells (with concomitant reduction in the Tregs population), repress PD-1, and produce IL17 in situ (a factor associated with good prognosis in cancer). Enhanced immunity and blockage of immune checkpoints has transformed cancer treatment, thus such a molecule would provide a unique approach for the treatment of cancer. PMID:26785144
Anti-gluten immune response following Toxoplasma gondii infection in mice.
Severance, Emily G; Kannan, Geetha; Gressitt, Kristin L; Xiao, Jianchun; Alaedini, Armin; Pletnikov, Mikhail V; Yolken, Robert H
2012-01-01
Gluten sensitivity may affect disease pathogenesis in a subset of individuals who have schizophrenia, bipolar disorder or autism. Exposure to Toxoplasma gondii is a known risk factor for the development of schizophrenia, presumably through a direct pathological effect of the parasite on brain and behavior. A co-association of antibodies to wheat gluten and to T. gondii in individuals with schizophrenia was recently uncovered, suggesting a coordinated gastrointestinal means by which T. gondii and dietary gluten might generate an immune response. Here, we evaluated the connection between these infectious- and food-based antigens in mouse models. BALB/c mice receiving a standard wheat-based rodent chow were infected with T. gondii via intraperitoneal, peroral and prenatal exposure methods. Significant increases in the levels of anti-gluten IgG were documented in all infected mice and in offspring from chronically infected dams compared to uninfected controls (repetitive measures ANOVAs, two-tailed t-tests, all p≤0.00001). Activation of the complement system accompanied this immune response (p≤0.002-0.00001). Perorally-infected females showed higher levels of anti-gluten IgG than males (p≤0.009) indicating that T. gondii-generated gastrointestinal infection led to a significant anti-gluten immune response in a sex-dependent manner. These findings support a gastrointestinal basis by which two risk factors for schizophrenia, T. gondii infection and sensitivity to dietary gluten, might be connected to produce the immune activation that is becoming an increasingly recognized pathology of psychiatric disorders.
1988-01-01
T cells primed specifically for the envelope glycoprotein of Friend murine leukemia helper virus (F-MuLV) were prepared by immunizing mice with a recombinant vaccinia virus that expressed the entire env gene of F-MuLV. Significant proliferative responses of F-MuLV envelope- specific, H-2a/b T cells were observed when the T cells were stimulated with antigen-pulsed peritoneal exudate cells (PEC) having the b allele at the K, A beta, A alpha, and E beta loci of the H-2. On the other hand, PEC having only the kappa allele at these loci did not induce the envelope-specific T cell proliferation, even when the PEC had the b allele at the E alpha, S, or D loci. F-MuLV envelope-specific proliferation of H-2a/b T cells under the stimulation of antigen- pulsed, H-2a/b PEC was specifically blocked with anti-I-Ab and anti-I- Ek mAbs but not with anti-Kb, anti-Kk, or anti-I-Ak mAbs. Moreover, (B10.MBR x A/WySn)F1 mice that have the b allele only at the K locus but not in I-A subregion were nonresponders to the envelope glycoprotein, and the bm12 mutation at the A beta locus completely abolished the T cell responsiveness to this antigen. These results indicate that proliferative T cells recognize a limited number of epitopes on F-MuLV envelope protein in the context of I-Ab, hybrid I- Ak/b, and/or hybrid I-Ek/b class II MHC molecules but fail to recognize the same envelope protein in the context of I-Ak or I-Ek molecules. This influence of the H-2I region on T cell recognition of the envelope glycoprotein appeared to control in vivo induction of protective immunity against Friend virus complex after immunization with the vaccinia-F-MuLV env vaccine. Thus, these results provide, for the first time, direct evidence for Ir gene-controlled responder/nonresponder phenotypes influencing the immune response to a pathogenic virus of mice. PMID:3141552
Peng, Shiwen; Trimble, Cornelia; Alvarez, Ronald D.; Huh, Warner K.; Lin, Zhenhua; Monie, Archana; Hung, Chien-Fu; Wu, T.-C.
2010-01-01
Intradermal administration of DNA vaccines via a gene gun represents a feasible strategy to deliver DNA directly into the professional antigen-presenting cells (APCs) in the skin. This helps to facilitate the enhancement of DNA vaccine potency via strategies that modify the properties of APCs. We have previously demonstrated that DNA vaccines encoding human papillomavirus type 16 (HPV-16) E7 antigen linked to calreticulin (CRT) are capable of enhancing the E7-specific CD8+ T cell immune responses and antitumor effects against E7-expressing tumors. It has also been shown that cluster (short-interval) DNA vaccination regimen generates potent immune responses in a minimal timeframe. Thus, in the current study we hypothesize that the cluster intradermal CRT/E7 DNA vaccination will generate significant antigen-specific CD8+ T cell infiltrates in E7-expressing tumors in tumor-bearing mice, leading to an increase in apoptotic tumor cell death. We found that cluster intradermal CRT/E7 DNA vaccination is capable of rapidly generating a significant number of E7-specific CD8+ T cells, resulting in significant therapeutic antitumor effects in vaccinated mice. We also observed that cluster intradermal CRT/E7 DNA vaccination in the presence of tumor generates significantly higher E7-specific CD8+ T cell immune responses in the systemic circulation as well as in the tumors. In addition, this vaccination regimen also led to significantly lower levels of CD4+Foxp3+ T regulatory cells and myeloid suppressor cells compared to vaccination with CRT DNA in peripheral blood and in tumor infiltrating lymphocytes, resulting in an increase in apoptotic tumor cell death. Thus, our study has significant potential for future clinical translation. PMID:18401437
2013-01-01
Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to
Gamma delta T cells and the immune response to respiratory syncytial virus infection
USDA-ARS?s Scientific Manuscript database
'd T cells are a subset of nonconventional T cells that play a critical role in bridging the innate and adaptive arms of the immune system. 'd T cells are particularly abundant in ruminant species and may constitute of up 60% of the circulating lymphocyte pool in young cattle. The frequency of circ...
Multiscale modeling of mucosal immune responses
2015-01-01
Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut
Multiscale modeling of mucosal immune responses.
Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep
2015-01-01
Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T
Activated T cells sustain myeloid-derived suppressor cell-mediated immune suppression
Damuzzo, Vera; Francescato, Samuela; Pozzuoli, Assunta; Berizzi, Antonio; Mocellin, Simone; Rossi, Carlo Riccardo; Bronte, Vincenzo; Mandruzzato, Susanna
2016-01-01
The expansion of myeloid derived suppressor cells (MDSCs), a suppressive population able to hamper the immune response against cancer, correlates with tumor progression and overall survival in several cancer types. We have previously shown that MDSCs can be induced in vitro from precursors present in the bone marrow and observed that these cells are able to actively proliferate in the presence of activated T cells, whose activation level is critical to drive the suppressive activity of MDSCs. Here we investigated at molecular level the mechanisms involved in the interplay between MDSCs and activated T cells. We found that activated T cells secrete IL-10 following interaction with MDSCs which, in turn, activates STAT3 phosphorylation on MDSCs then leading to B7-H1 expression. We also demonstrated that B7-H1+ MDSCs are responsible for immune suppression through a mechanism involving ARG-1 and IDO expression. Finally, we show that the expression of ligands B7-H1 and MHC class II both on in vitro-induced MDSCs and on MDSCs in the tumor microenvironment of cancer patients is paralleled by an increased expression of their respective receptors PD-1 and LAG-3 on T cells, two inhibitory molecules associated with T cell dysfunction. These findings highlight key molecules and interactions responsible for the extensive cross-talk between MDSCs and activated T cells that are at the basis of immune suppression. PMID:26700461
Age-associated Epstein–Barr virus-specific T cell responses in seropositive healthy adults
Cárdenas Sierra, D; Vélez Colmenares, G; Orfao de Matos, A; Fiorentino Gómez, S; Quijano Gómez, S M
2014-01-01
Epstein–Barr virus (EBV) is present in 95% of the world's adult population. The immune response participates in immune vigilance and persistent infection control, and this condition is maintained by both a good quality (functionality) and quantity of specific T cells throughout life. In the present study, we evaluated EBV-specific CD4+ and CD8+ T lymphocyte responses in seropositive healthy individuals younger and older than 50 years of age. The assessment comprised the frequency, phenotype, functionality and clonotypic distribution of T lymphocytes. We found that in both age groups a similar EBV-specific T cell response was found, with overlapping numbers of tumour necrosis factor (TNF)-α+ T lymphocytes (CD4+ and CD8+) within the memory and effector cell compartments, in addition to monofunctional and multi-functional T cells producing interleukin (IL)-2 and/or interferon (IFN)-γ. However, individuals aged more than 50 years showed significantly higher frequencies of IL-2-producing CD4+ T lymphocytes in association with greater production of soluble IFN-γ, TNF-α and IL-6 than subjects younger than 50 years. A polyclonal T cell receptor (TCR)-variable beta region (Vβ) repertoire exists in both age groups under basal conditions and in response to EBV; the major TCR families found in TNF-α+/CD4+ T lymphocytes were Vβ1, Vβ2, Vβ17 and Vβ22 in both age groups, and the major TCR family in TNF-α+/CD8+ T cells was Vβ13·1 for individuals younger than 50 years and Vβ9 for individuals aged more than 50 years. Our findings suggest that the EBV-specific T cell response (using a polyclonal stimulation model) is distributed throughout several T cell differentiation compartments in an age-independent manner and includes both monofunctional and multi-functional T lymphocytes. PMID:24666437
Peixoto, António; Evaristo, César; Munitic, Ivana; Monteiro, Marta; Charbit, Alain; Rocha, Benedita; Veiga-Fernandes, Henrique
2007-01-01
To study in vivo CD8 T cell differentiation, we quantified the coexpression of multiple genes in single cells throughout immune responses. After in vitro activation, CD8 T cells rapidly express effector molecules and cease their expression when the antigen is removed. Gene behavior after in vivo activation, in contrast, was quite heterogeneous. Different mRNAs were induced at very different time points of the response, were transcribed during different time periods, and could decline or persist independently of the antigen load. Consequently, distinct gene coexpression patterns/different cell types were generated at the various phases of the immune responses. During primary stimulation, inflammatory molecules were induced and down-regulated shortly after activation, generating early cells that only mediated inflammation. Cytotoxic T cells were generated at the peak of the primary response, when individual cells simultaneously expressed multiple killer molecules, whereas memory cells lost killer capacity because they no longer coexpressed killer genes. Surprisingly, during secondary responses gene transcription became permanent. Secondary cells recovered after antigen elimination were more efficient killers than cytotoxic T cells present at the peak of the primary response. Thus, primary responses produced two transient effector types. However, after boosting, CD8 T cells differentiate into long-lived killer cells that persist in vivo in the absence of antigen. PMID:17485515
Nogueira, Raquel Tayar; Nogueira, Alanderson Rocha; Pereira, Mirian Claudia Souza; Rodrigues, Maurício Martins; Neves, Patrícia Cristina da Costa; Galler, Ricardo; Bonaldo, Myrna Cristina
2013-01-01
Chagas’ disease is a major public health problem affecting nearly 10 million in Latin America. Despite several experimental vaccines have shown to be immunogenic and protective in mouse models, there is not a current vaccine being licensed for humans or in clinical trial against T. cruzi infection. Towards this goal, we used the backbone of Yellow Fever (YF) 17D virus, one of the most effective and well-established human vaccines, to express an immunogenic fragment derived from T. cruzi Amastigote Surface Protein 2 (ASP-2). The cDNA sequence of an ASP-2 fragment was inserted between E and NS1 genes of YF 17D virus through the construction of a recombinant heterologous cassette. The replication ability and genetic stability of recombinant YF virus (YF17D/ENS1/Tc) was confirmed for at least six passages in Vero cells. Immunogenicity studies showed that YF17D/ENS1/Tc virus elicited neutralizing antibodies and gamma interferon (IFN-γ) producing-cells against the YF virus. Also, it was able to prime a CD8+ T cell directed against the transgenic T. cruzi epitope (TEWETGQI) which expanded significantly as measured by T cell-specific production of IFN-γ before and after T. cruzi challenge. However, most important for the purposes of vaccine development was the fact that a more efficient protective response could be seen in mice challenged after vaccination with the YF viral formulation consisting of YF17D/ENS1/Tc and a YF17D recombinant virus expressing the TEWETGQI epitope at the NS2B-3 junction. The superior protective immunity observed might be due to an earlier priming of epitope-specific IFN-γ-producing T CD8+ cells induced by vaccination with this viral formulation. Our results suggest that the use of viral formulations consisting of a mixture of recombinant YF 17D viruses may be a promising strategy to elicit protective immune responses against pathogens, in general. PMID:23527169
Nogueira, Raquel Tayar; Nogueira, Alanderson Rocha; Pereira, Mirian Claudia Souza; Rodrigues, Maurício Martins; Neves, Patrícia Cristina da Costa; Galler, Ricardo; Bonaldo, Myrna Cristina
2013-01-01
Chagas' disease is a major public health problem affecting nearly 10 million in Latin America. Despite several experimental vaccines have shown to be immunogenic and protective in mouse models, there is not a current vaccine being licensed for humans or in clinical trial against T. cruzi infection. Towards this goal, we used the backbone of Yellow Fever (YF) 17D virus, one of the most effective and well-established human vaccines, to express an immunogenic fragment derived from T. cruzi Amastigote Surface Protein 2 (ASP-2). The cDNA sequence of an ASP-2 fragment was inserted between E and NS1 genes of YF 17D virus through the construction of a recombinant heterologous cassette. The replication ability and genetic stability of recombinant YF virus (YF17D/ENS1/Tc) was confirmed for at least six passages in Vero cells. Immunogenicity studies showed that YF17D/ENS1/Tc virus elicited neutralizing antibodies and gamma interferon (IFN-γ) producing-cells against the YF virus. Also, it was able to prime a CD8(+) T cell directed against the transgenic T. cruzi epitope (TEWETGQI) which expanded significantly as measured by T cell-specific production of IFN-γ before and after T. cruzi challenge. However, most important for the purposes of vaccine development was the fact that a more efficient protective response could be seen in mice challenged after vaccination with the YF viral formulation consisting of YF17D/ENS1/Tc and a YF17D recombinant virus expressing the TEWETGQI epitope at the NS2B-3 junction. The superior protective immunity observed might be due to an earlier priming of epitope-specific IFN-γ-producing T CD8(+) cells induced by vaccination with this viral formulation. Our results suggest that the use of viral formulations consisting of a mixture of recombinant YF 17D viruses may be a promising strategy to elicit protective immune responses against pathogens, in general.
Chirkova, T V; Naykhin, A N; Petukhova, G D; Korenkov, D A; Donina, S A; Mironov, A N; Rudenko, L G
2011-10-01
Cellular immune responses of both CD4 and CD8 memory/effector T cells were evaluated in healthy young adults who received two doses of live attenuated influenza A (H5N2) vaccine. The vaccine was developed by reassortment of nonpathogenic avian A/Duck/Potsdam/1402-6/68 (H5N2) and cold-adapted A/Leningrad/134/17/57 (H2N2) viruses. T-cell responses were measured by standard methods of intracellular cytokine staining of gamma interferon (IFN-γ)-producing cells and a novel T-cell recognition of antigen-presenting cells by protein capture (TRAP) assay based on the trogocytosis phenomenon, namely, plasma membrane exchange between interacting immune cells. TRAP enables the detection of activated trogocytosis-positive T cells after virus stimulation. We showed that two doses of live attenuated influenza A (H5N2) vaccine promoted both CD4 and CD8 T-memory-cell responses in peripheral blood of healthy young subjects in the clinical study. Significant differences in geometric mean titers (GMTs) of influenza A (H5N2)-specific IFN-γ(+) cells were observed at day 42 following the second vaccination, while peak levels of trogocytosis(+) T cells were detected earlier, on the 21st day after the second vaccination. The inverse correlation of baseline levels compared to postvaccine fold changes in GMTs of influenza-specific CD4 and CD8 T cells demonstrated that baseline levels of these specific cells could be considered a predictive factor of vaccine immunogenicity.
KAWAI, K.; MEYDANI, S. N.; URASSA, W.; WU, D.; MUGUSI, F. M.; SAATHOFF, E.; BOSCH, R. J.; VILLAMOR, E.; SPIEGELMAN, D.; FAWZI, W. W.
2017-01-01
SUMMARY Limited studies exist regarding whether incorporating micronutrient supplements during tuberculosis (TB) treatment may improve cell-mediated immune response. We examined the effect of micronutrient supplementation on lymphocyte proliferation response to mycobacteria or T-cell mitogens in a randomized trial conducted on 423 patients with pulmonary TB. Eligible participants were randomly assigned to receive a daily dose of micronutrients (vitamins A, B-complex, C, E, and selenium) or placebo at the time of initiation of TB treatment. We found no overall effect of micronutrient supplements on lymphocyte proliferative responses to phytohaemagglutinin or purified protein derivatives in HIV-negative and HIV-positive TB patients. Of HIV-negative TB patients, the micronutrient group tended to show higher proliferative responses to concanavalin A than the placebo group, although the clinical relevance of this finding is not readily notable. The role of nutritional intervention in this vulnerable population remains an important area of future research. PMID:24093552
Adnan, Sama; Reeves, R Keith; Gillis, Jacqueline; Wong, Fay E; Yu, Yi; Camp, Jeremy V; Li, Qingsheng; Connole, Michelle; Li, Yuan; Piatak, Michael; Lifson, Jeffrey D; Li, Wenjun; Keele, Brandon F; Kozlowski, Pamela A; Desrosiers, Ronald C; Haase, Ashley T; Johnson, R Paul
2016-12-01
Defining the correlates of immune protection conferred by SIVΔnef, the most effective vaccine against SIV challenge, could enable the design of a protective vaccine against HIV infection. Here we provide a comprehensive assessment of immune responses that protect against SIV infection through detailed analyses of cellular and humoral immune responses in the blood and tissues of rhesus macaques vaccinated with SIVΔnef and then vaginally challenged with wild-type SIV. Despite the presence of robust cellular immune responses, animals at 5 weeks after vaccination displayed only transient viral suppression of challenge virus, whereas all macaques challenged at weeks 20 and 40 post-SIVΔnef vaccination were protected, as defined by either apparent sterile protection or significant suppression of viremia in infected animals. Multiple parameters of CD8 T cell function temporally correlated with maturation of protection, including polyfunctionality, phenotypic differentiation, and redistribution to gut and lymphoid tissues. Importantly, we also demonstrate the induction of a tissue-resident memory population of SIV-specific CD8 T cells in the vaginal mucosa, which was dependent on ongoing low-level antigenic stimulation. Moreover, we show that vaginal and serum antibody titers inversely correlated with post-challenge peak viral load, and we correlate the accumulation and affinity maturation of the antibody response to the duration of the vaccination period as well as to the SIVΔnef antigenic load. In conclusion, maturation of SIVΔnef-induced CD8 T cell and antibody responses, both propelled by viral persistence in the gut mucosa and secondary lymphoid tissues, results in protective immune responses that are able to interrupt viral transmission at mucosal portals of entry as well as potential sites of viral dissemination.
Chakera, A; Bennett, S; Lawrence, S; Morteau, O; Mason, P D; O'Callaghan, C A; Cornall, R J
2011-01-01
Infection with the polyoma virus BK (BKV) is a major cause of morbidity following renal transplantation. Limited understanding of the anti-viral immune response has prevented the design of a strategy that balances treatment with the preservation of graft function. The proven utility of interferon-gamma enzyme-linked immunospot (ELISPOT) assays to measure T cell responses in immunocompetent hosts was the basis for trying to develop a rational approach to the management of BKV following renal transplantation. In a sample of transplant recipients and healthy controls, comparisons were made between T cell responses to the complete panel of BKV antigens, the Epstein–Barr virus (EBV) antigens, BZLF1 and EBNA1, and the mitogen phytohaemagglutinin (PHA). Correlations between responses to individual antigens and immunosuppressive regimens were also analysed. Antigen-specific T cell responses were a specific indicator of recent or ongoing recovery from BKV infection (P < 0·05), with responses to different BKV antigens being highly heterogeneous. Significant BKV immunity was undetectable in transplant patients with persistent viral replication or no history of BKV reactivation. Responses to EBV antigens and mitogen were reduced in patients with BKV reactivation, but these differences were not statistically significant. The T cell response to BKV antigens is a useful and specific guide to recovery from BKV reactivation in renal transplant recipients, provided that the full range of antigenic responses is measured. PMID:21671906
The Multifaceted Role of T-Helper Responses in Host Defense against Aspergillus fumigatus.
Dewi, Intan M W; van de Veerdonk, Frank L; Gresnigt, Mark S
2017-10-04
The ubiquitous opportunistic fungal pathogen Aspergillus fumigatus rarely causes infections in immunocompetent individuals. A healthy functional innate immune system plays a crucial role in preventing Aspergillus -infection. This pivotal role for the innate immune system makes it a main research focus in studying the pathogenesis of aspergillosis. Although sometimes overshadowed by the innate immune response, the adaptive immune response, and in particular T-helper responses, also represents a key player in host defense against Aspergillus . Virtually all T-helper subsets have been described to play a role during aspergillosis, with the Th1 response being crucial for fungal clearance. However; morbidity and mortality of aspergillosis can also be partly attributed to detrimental immune responses resulting from adaptive immune activation. Th2 responses benefit fungal persistence; and are the foundation of allergic forms of aspergillosis. The Th17 response has two sides; although crucial for granulocyte recruitment, it can be involved in detrimental immunopathology. Regulatory T-cells, the endogenous regulators of inflammatory responses, play a key role in controlling detrimental inflammatory responses during aspergillosis. The current knowledge of the adaptive immune response against A. fumigatus is summarized in this review. A better understanding on how T-helper responses facilitate clearance of Aspergillus -infection and control inflammation can be the fundamental basis for understanding the pathogenesis of aspergillosis and for the development of novel host-directed therapies.
CD4+ T-cell responses to foot-and-mouth disease virus in vaccinated cattle.
Carr, B Veronica; Lefevre, Eric A; Windsor, Miriam A; Inghese, Cristina; Gubbins, Simon; Prentice, Helen; Juleff, Nicholas D; Charleston, Bryan
2013-01-01
We have performed a series of studies to investigate the role of CD4(+) T-cells in the immune response to foot-and-mouth disease virus (FMDV) post-vaccination. Virus neutralizing antibody titres (VNT) in cattle vaccinated with killed FMD commercial vaccine were significantly reduced and class switching delayed as a consequence of rigorous in vivo CD4(+) T-cell depletion. Further studies were performed to examine whether the magnitude of T-cell proliferative responses correlated with the antibody responses. FMD vaccination was found to induce T-cell proliferative responses, with CD4(+) T-cells responding specifically to the FMDV antigen. In addition, gamma interferon (IFN-γ) was detected in the supernatant of FMDV antigen-stimulated PBMC and purified CD4(+) T-cells from vaccinated cattle. Similarly, intracellular IFN-γ could be detected specifically in purified CD4(+) T-cells after restimulation. It was not possible to correlate in vitro proliferative responses or IFN-γ production of PBMC with VNT, probably as a consequence of the induction of T-independent and T-dependent antibody responses and antigen non-specific T-cell responses. However, our studies demonstrate the importance of stimulating CD4(+) T-cell responses for the induction of optimum antibody responses to FMD-killed vaccines.
Immune response and immunopathology during toxoplasmosis1
Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.
2012-01-01
Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326
Mathematical modeling provides kinetic details of the human immune response to vaccination
Le, Dustin; Miller, Joseph D.; Ganusov, Vitaly V.
2015-01-01
With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data. PMID:25621280
Mathematical modeling provides kinetic details of the human immune response to vaccination.
Le, Dustin; Miller, Joseph D; Ganusov, Vitaly V
2014-01-01
With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.
Patiño, Pablo J; Caraballo, Domingo I; Szewczyk, Katarzyna; Quintana, Juan C; Bedoya, Lady R; Ramírez, Beatriz E; Jaramillo, Andrés
2017-09-29
Exercise-induced stress induces considerable changes in the immune system. To better understand the mechanisms related to these immune changes during acute and chronic physical stress, we studied the effects of aerobic physical training (APT) on several parameters of the immune system. Previously untrained males (18-25 years of age) were divided into a group that was subjected to 6 months of APT (n=10) and a sedentary control group (n=7). The subjects performed a cardiopulmonary exercise test (CET) at 0, 3, and 6 months of the APT program. B cell (CD19+), T cell (CD4+ and CD8+), and natural killer cell (CD56+) levels, and mitogen-induced T cell proliferation and cytokine production (interleukin-1, interleukin-4, interleukin-12, and interferon-) were evaluated before and at 30 seconds and 24 hours after the CET. There was a significant increase in CD4+ T cells and natural killer cells and a significant reduction in T cell proliferation in both groups 30 seconds after the CET at 3 and 6 months of the APT program. Of note, the trained group showed significantly lower resting T cell proliferation (before and 24 hour after the CET) than the sedentary control group at 3 and 6 months of the APT program. There were no significant differences in cytokine production after the CET between both groups at any time point of the APT program. These data show that APT does not condition against strenuous exercise induced immune changes but significantly modulates T cell proliferative responses.
Lindsten, T; Yaffe, L J; Thompson, C B; Guelde, G; Berning, A; Scher, I; Kenny, J J
1985-05-01
Both complement receptor positive (CR+) and complement receptor negative (CR-) B cells have been shown to be involved in the primary immune response to PC-Hy (phosphocholine conjugated hemocyanin), a thymus dependent (TD) antigen which preferentially induces antibody secretion in Lyb-5+ B cells during a primary adoptive transfer assay. CR+ and CR- B cells also responded in a primary adoptive transfer assay to TNP-Ficoll, a thymus independent type 2 (TI-2) antigen which activates only Lyb-5+ B cells. When the secondary immune response to PC-Hy and TNP-Ficoll were analyzed, it was found that most of the immune memory to both antigens was present in the CR- B cell subset. The CR- B cell subset also dominated the secondary immune response to PC-Hy in immune defective (CBA/N X DBA/2N)F1 male mice. These data indicate that CR- B cells dominate the memory response in both the Lyb-5+ and Lyb-5- B cell subsets of normal and xid immune defective mice and suggest that Lyb-5+ and Lyb-5- B cells can be subdivided into CR+ and CR- subsets.
Scurr, Martin; Pembroke, Tom; Bloom, Anja; Roberts, David; Thomson, Amanda; Smart, Kathryn; Bridgeman, Hayley; Adams, Richard; Brewster, Alison; Jones, Robert; Gwynne, Sarah; Blount, Daniel; Harrop, Richard; Wright, Melissa; Hills, Robert; Gallimore, Awen; Godkin, Andrew
2017-10-12
treatment (20.09 [7.20] RU). Cyclophosphamide depleted regulatory T cells in 24 of 27 patients receiving MVA-5T4, independently prolonging PFS (5.0 vs 2.5 months; hazard ratio [HR], 0.48; 95% CI, 0.21-1.11; P = .09). MVA-5T4 doubled baseline anti-5T4 responses in 16 of 35 patients, resulting in significantly prolonged PFS (5.6 vs 2.4 months; HR, 0.21; 95% CI, 0.09-0.47; P < .001) and OS (20.0 vs 10.3 months; HR, 0.32; 95% CI, 0.14-0.74; P = .008). No grade 3 or 4 adverse events were observed. This initial randomized clinical immunotherapy study demonstrates a significant survival benefit in mCRC. Prior depletion of regulatory T cells by cyclophosphamide did not increase immune responses generated by MVA-5T4 vaccination; however, cyclophosphamide and MVA-5T4 each independently induced beneficial antitumor immune responses, resulting in prolonged survival without toxic effects. Larger clinical trials are planned to further validate these data. isrctn.org Identifier: ISRCTN54669986.
USDA-ARS?s Scientific Manuscript database
We have shown that in cattle previously immunized with outer membrane proteins, infection with Anaplasma marginale induces a functionally exhausted CD4 T-cell response to the A. marginale immunogen. Furthermore, T-cell responses following infection in nonimmunized cattle had a delayed onset and were...
Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke
2017-02-06
In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.
Spaceflight and immune responses of rhesus monkeys
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald; Morton, Darla S.; Swiggett, Jeanene P.; Hakenewerth, Anne M.; Fowler, Nina A.
1995-01-01
The effects of restraint on immunological parameters was determined in an 18 day ARRT (adult rhesus restraint test). The monkeys were restrained for 18 days in the experimental station for the orbiting primate (ESOP), the chair of choice for Space Shuttle experiments. Several immunological parameters were determined using peripheral blood, bone marrow, and lymph node specimens from the monkeys. The parameters included: response of bone marrow cells to GM-CSF (granulocyte-macrophage colony stimulating factor), leukocyte subset distribution, and production of IFN-a (interferon-alpha) and IFN-gamma (interferon-gamma). The only parameter changed after 18 days of restraint was the percentage of CD8+ T cells. No other immunological parameters showed changes due to restraint. Handling and changes in housing prior to the restraint period did apparently result in some restraint-independent immunological changes. Handling must be kept to a minimum and the animals allowed time to recover prior to flight. All experiments must be carefully controlled. Restraint does not appear to be a major issue regarding the effects of space flight on immune responses.
Anti-Gluten Immune Response following Toxoplasma gondii Infection in Mice
Severance, Emily G.; Kannan, Geetha; Gressitt, Kristin L.; Xiao, Jianchun; Alaedini, Armin; Pletnikov, Mikhail V.; Yolken, Robert H.
2012-01-01
Gluten sensitivity may affect disease pathogenesis in a subset of individuals who have schizophrenia, bipolar disorder or autism. Exposure to Toxoplasma gondii is a known risk factor for the development of schizophrenia, presumably through a direct pathological effect of the parasite on brain and behavior. A co-association of antibodies to wheat gluten and to T. gondii in individuals with schizophrenia was recently uncovered, suggesting a coordinated gastrointestinal means by which T. gondii and dietary gluten might generate an immune response. Here, we evaluated the connection between these infectious- and food-based antigens in mouse models. BALB/c mice receiving a standard wheat-based rodent chow were infected with T. gondii via intraperitoneal, peroral and prenatal exposure methods. Significant increases in the levels of anti-gluten IgG were documented in all infected mice and in offspring from chronically infected dams compared to uninfected controls (repetitive measures ANOVAs, two-tailed t-tests, all p≤0.00001). Activation of the complement system accompanied this immune response (p≤0.002–0.00001). Perorally-infected females showed higher levels of anti-gluten IgG than males (p≤0.009) indicating that T. gondii-generated gastrointestinal infection led to a significant anti-gluten immune response in a sex-dependent manner. These findings support a gastrointestinal basis by which two risk factors for schizophrenia, T. gondii infection and sensitivity to dietary gluten, might be connected to produce the immune activation that is becoming an increasingly recognized pathology of psychiatric disorders. PMID:23209841
Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids
Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe
2016-01-01
The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406
Luque, Yosu; Cathelin, Dominique; Vandermeersch, Sophie; Xu, Xiaoli; Sohier, Julie; Placier, Sandrine; Xu-Dubois, Yi-Chun; Louis, Kevin; Hertig, Alexandre; Bories, Jean-Christophe; Vasseur, Florence; Campagne, Fabien; Di Santo, James P; Vosshenrich, Christian; Rondeau, Eric; Mesnard, Laurent
2017-05-01
Crescentic glomerulonephritis is a life-threatening renal disease that has been extensively studied by the experimental anti-glomerular basement membrane glomerulonephritis (anti-GBM-GN) model. Although T cells have a significant role in this model, athymic/nude mice and rats still develop severe renal disease. Here we further explored the contribution of intrinsic renal cells in the development of T-cell-independent GN lesions. Anti-GBM-GN was induced in three strains of immune-deficient mice (Rag2 -/- , Rag2 -/- Il2rg -/- , and Rag2 -/- Il2rb -/- ) that are devoid of either T/B cells or T/B/NK cells. The Rag2 -/- Il2rg -/- or Rag2 -/- Il2rb -/- mice harbor an additional deletion of either the common gamma chain (γC) or the interleukin-2 receptor β subunit (IL-2Rβ), respectively, impairing IL-15 signaling in particular. As expected, all these strains developed severe anti-GBM-GN. Additionally, bone marrow replenishment experiments allowed us to deduce a protective role for the glomerular-expressed γC during anti-GBM-GN. Given that IL-15 has been found highly expressed in nephritic kidneys despite the absence of lymphocytes, we then studied this cytokine in vitro on primary cultured podocytes from immune-deficient mice (Rag2 -/- Il2rg -/- and Rag2 -/- Il2rb -/- ) compared to controls. IL-15 induced downstream activation of JAK1/3 and SYK in primary cultured podocytes. IL-15-dependent JAK/SYK induction was impaired in the absence of γC or IL-2Rβ. We found γC largely induced on podocytes during human glomerulonephritis. Thus, renal lesions are indeed modulated by intrinsic glomerular cells through the γC/IL-2Rβ receptor response, to date classically described only in immune cells. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.
Griffin, Diane E
2016-10-12
Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.
Genetic Adjuvantation of Recombinant MVA with CD40L Potentiates CD8 T Cell Mediated Immunity
Lauterbach, Henning; Pätzold, Juliane; Kassub, Ronny; Bathke, Barbara; Brinkmann, Kay; Chaplin, Paul; Suter, Mark; Hochrein, Hubertus
2013-01-01
Modified vaccinia Ankara (MVA) is a safe and promising viral vaccine vector that is currently investigated in several clinical and pre-clinical trials. In contrast to inactivated or sub-unit vaccines, MVA is able to induce strong humoral as well as cellular immune responses. In order to further improve its CD8 T cell inducing capacity, we genetically adjuvanted MVA with the coding sequence of murine CD40L, a member of the tumor necrosis factor superfamily. Immunization of mice with this new vector led to strongly enhanced primary and memory CD8 T cell responses. Concordant with the enhanced CD8 T cell response, we could detect stronger activation of dendritic cells and higher systemic levels of innate cytokines (including IL-12p70) early after immunization. Interestingly, acquisition of memory characteristics (i.e., IL-7R expression) was accelerated after immunization with MVA-CD40L in comparison to non-adjuvanted MVA. Furthermore, the generated cytotoxic T-lymphocytes (CTLs) also showed improved functionality as demonstrated by intracellular cytokine staining and in vivo killing activity. Importantly, the superior CTL response after a single MVA-CD40L immunization was able to protect B cell deficient mice against a fatal infection with ectromelia virus. Taken together, we show that genetic adjuvantation of MVA can change strength, quality, and functionality of innate and adaptive immune responses. These data should facilitate a rational vaccine design with a focus on rapid induction of large numbers of CD8 T cells able to protect against specific diseases. PMID:23986761
Hashemi, Hamidreza; Pouyanfard, Somayeh; Bandehpour, Mojgan; Noroozbabaei, Zahra; Kazemi, Bahram; Saelens, Xavier; Mokhtari-Azad, Talat
2012-01-01
Considering the emergence of highly pathogenic influenza viruses and threat of worldwide pandemics, there is an urgent need to develop broadly-protective influenza vaccines. In this study, we demonstrate the potential of T7 bacteriophage-based nanoparticles with genetically fused ectodomain of influenza A virus M2 protein (T7-M2e) as a candidate universal flu vaccine. Immunization of mice with non-adjuvanted T7-M2e elicited M2e-specific serum antibody responses that were similar in magnitude to those elicited by M2e peptide administered in Freund’s adjuvant. Comparable IgG responses directed against T7 phage capsomers were induced following vaccination with wild type T7 or T7-M2e. T7-M2e immunization induced balanced amounts of IgG1 and IgG2a antibodies and these antibodies specifically recognized native M2 on the surface of influenza A virus-infected mammalian cells. The frequency of IFN-γ-secreting T cells induced by T7-M2e nanoparticles was comparable to those elicited by M2e peptide emulsified in Freund’s adjuvant. Emulsification of T7-M2e nanoparticles in Freund’s adjuvant, however, induced a significantly stronger T cell response. Furthermore, T7-M2e-immunized mice were protected against lethal challenge with an H1N1 or an H3N2 virus, implying the induction of hetero-subtypic immunity in our mouse model. T7-M2e-immunized mice displayed considerable weight loss and had significantly reduced viral load in their lungs compared to controls. We conclude that display of M2e on the surface of T7 phage nanoparticles offers an efficient and economical opportunity to induce cross-protective M2e-based immunity against influenza A. PMID:23029232
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
PTPROt maintains T cell immunity in the microenvironment of hepatocellular carcinoma.
Hou, Jiajie; Deng, Lei; Zhuo, Han; Lin, Zhe; Chen, Yun; Jiang, Runqiu; Chen, Dianyu; Zhang, Xudong; Huang, Xingxu; Sun, Beicheng
2015-08-01
Intratumoral T cells play a central role in anti-tumor immunity, and the balance between T effector cells (Teff) and regulatory T cells (Treg) affects the prognosis of cancer patients. However, educated by tumor microenvironment, T cells frequently fail in their responsibility. In this study, we aimed to investigate the role of truncated isoform of protein tyrosine phosphatase receptor-type O (PTPROt) in T cell-mediated anti-tumor immunity. We recruited 70 hepatocellular carcinoma (HCC) patients and 30 healthy volunteers for clinical investigation, and analyzed cellular tumor immunity by using ptpro(-/-) C57BL/6 mice and NOD/SCID mice. PTPROt expression was significantly downregulated in human HCC-infiltrating T cells due to the hypoxia microenvironment; PTPROt expression highly correlated with the intratumoral Teff/Treg ratio and clinicopathologic characteristics. Moreover, PTPROt deficiency attenuated T cell-mediated anti-tumor immunity and remarkably promoted mouse HCC growth. Mechanistically, deletion of PTPROt decreased Teff quantity and quality through phosphorylation of lymphocyte-specific tyrosine kinase, but increased Treg differentiation through phosphorylation of signal transducer and activator of transcription 5. In support of the Teff/Treg homeostasis, PTPROt serves as an important tumor suppressor in HCC microenvironment. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bursuker, I.; Pearce, M.T.
1990-02-01
The state of active immunity to Meth A fibrosarcoma in mice immunized with an admixture of Meth A cells and Propionibacterium acnes is associated with possession by the host of spleen cells capable of producing interferon-gamma (IFN-gamma) upon in vitro restimulation with irradiated tumor cells. The ability of spleen cells from immunized mice to produce IFN-gamma in response to irradiated Meth A cells decays as active antitumor immunity is replaced by a state of immunological memory. The IFN-producing cells are L3T4+Ly2+, cyclophosphamide-sensitive and radiosensitive T cells, as determined by their sensitivity to corresponding monoclonal antibodies and complement. The induction ofmore » IFN-gamma production by in vivo tumor-sensitized T cells is tumor specific, in that spleen cells from mice immunized against Meth A fibrosarcoma can produce IFN in response to irradiated Meth A cells but not in response to another syngeneic tumor M109 lung carcinoma.« less
Kangassalo, Katariina; Valtonen, Terhi M; Sorvari, Jouni; Kecko, Sanita; Pölkki, Mari; Krams, Indrikis; Krama, Tatjana; Rantala, Markus J
2018-06-29
Organisms in the wild are likely to face multiple immune challenges as well as additional ecological stressors, yet their interactive effects on immune function are poorly understood. Insects are found to respond to cues of increased infection risk by enhancing their immune capacity. However, such adaptive plasticity in immune function may be limited by physiological and environmental constraints. Here, we investigated the effects of two environmental stressors - poor larval diet and an artificial parasite-like immune challenge at the pupal stage - on adult immune function, growth and development in the greater wax moth (Galleria mellonella). Males whose immune system was activated with an artificial parasite-like immune challenge had weaker immune response - measured as strength of encapsulation response - as adults compared to the control groups, but only when raised in high-nutrition larval diet. Immune activation did not negatively affect adult immune response in males reared in low-nutrition larval diet, indicating that poor larval diet improved the capacity of the insects to respond to repeated immune challenges. Low-nutrition larval diet also had a positive independent effect on immune capacity in females, yet it negatively affected development time and adult body mass in both sexes. As in the nature immune challenges are rarely isolated, and adverse nutritional environment may indicate an elevated risk of infection, resilience to repeated immune challenges as a response to poor nutritional environment could provide a significant fitness advantage. The present study highlights the importance of considering environmental context when investigating effects of immune activation in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Immune activation alters cellular and humoral responses to yellow fever 17D vaccine.
Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S; Rowe, Dawne K; Smith, Michaela J; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie; Gaucher, Denis
2014-07-01
Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. We showed that YF-17D-induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D-neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Registration is not required for observational studies. This study was funded by Canada's Global Health Research Initiative, Defense Threat Reduction Agency, National Institute of Allergy and Infectious Diseases
Immune activation alters cellular and humoral responses to yellow fever 17D vaccine
Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S.; Rowe, Dawne K.; Smith, Michaela J.; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H.; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K.; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie
2014-01-01
Background. Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. Methods. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. Results. We showed that YF-17D–induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D–neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Conclusion. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Trial registration. Registration is not required for observational studies. Funding. This study was funded by Canada’s Global Health Research Initiative, Defense
Whelan, Jarrett T.; Chen, Jianming; Miller, Jabin; Morrow, Rebekah L.; Lingo, Joshuah D.; Merrell, Kaitlin; Shaikh, Saame Raza; Bridges, Lance C.
2012-01-01
Retinoids are essential in the proper establishment and maintenance of immunity. Although retinoids are implicated in immune related processes, their role in immune cell adhesion has not been well established. In this study, the effect of 9-cis-retinoic acid (9-cis-RA) on human hematopoietic cell adhesion was investigated. 9-cis-RA treatment specifically induced cell adhesion of the human immune cell lines HuT-78, NB4, RPMI 8866, and U937. Due to the prominent role of integrin receptors in mediating immune cell adhesion, we sought to evaluate if cell adhesion was integrin-dependent. By employing a variety of integrin antagonist including function-blocking antibodies and EDTA, we establish that 9-cis-RA prompts immune cell adhesion through established integrin receptors in addition to a novel integrin-independent process. The novel integrin-independent adhesion required the presence of retinoid and was attenuated by treatment with synthetic corticosteroids. Finally, we demonstrate that 9-cis-RA treatment of primary murine B-cells induces ex vivo adhesion that persists in the absence of integrin function. Our study is the first to demonstrate that 9-cis-retinoic acid influences immune cell adhesion through at least two functionally distinct mechanisms. PMID:22925918
Deng, Shu-xuan; Cai, Ming-sheng; Cui, Wei; Huang, Jin-lu; Li, Mei-li
2014-01-01
Goose parvovirus (GPV) is a highly contagious and deadly disease for goslings and Muscovy ducklings. To compare the differences in immune response of geese immunized with GPV-VP1 DNA-based and live attenuated vaccines. Shitou geese were immunized once with either 20 μg pcDNA-GPV-VP1 DNA gene vaccine by gene gun bombardment via intramuscular injection, or 300 μg by i.m. injection, or 300 μL live attenuated vaccine by i.m. injection, whereas 300 μg pcDNA3.1 (+) i.m. or 300 μL saline i.m. were used as positive and negative controls, respectively. Each group comprised 28 animals. Peripheral blood samples were collected from 2-210 days after immunization and the proliferation of T lymphocytes, the number of CD4(+) and CD8(+) T cells and the level of IgG assessed. Statistical analysis was performed using a one-way analysis of variance with group multiple comparisons via Tukey's test. The pcDNA-GPV-VP1 DNA and attenuated vaccine induced cellular and humoral responses, and there were no differences between the 20 and 300 μg group in the responses of proliferation of T lymphocyte and the CD8(+) T-cell. However, as to CD4(+) T-cell response and humoral immunity, the 20 μg group performed better than the 300 μg group, which induced better cellular and humoral immunity than live attenuated vaccine. This study showed that it is possible to induce both cellular and humoral response using DNA-based vaccines and that the pcDNA-GPV-VP1 DNA gene vaccine induced better cellular and humoral immunity than live attenuated vaccine.
Induction of the immune response suppression in mice inoculated with Candida albicans.
Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G
1986-03-01
There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).
Legey, A P; Pinho, A P; Chagas Xavier, S C; Leon, L L; Jansen, A M
1999-01-01
Philander opossum and Didelphis marsupialis considered the most ancient mammals and an evolutionary success, maintain parasitism by Trypanosoma cruzi without developing any apparent disease or important tissue lesion. In order to elucidate this well-balanced interaction, we decided to compare the humoral immune response kinetics of the two didelphids naturally and experimentally infected with T. cruzi and immunized by different schedules of parasite antigens, employing an indirect fluorescence antibody test (IFAT). Both didelphids responded with high serological titers to different immunization routes, while the earliest response occurred with the intradermic route. Serological titers of naturally infected P. opossum showed a significant individual variation, while those of D. marsupialis remained stable during the entire follow-up period. The serological titers of the experimentally infected animals varied according to the inoculated strain. Our data suggest that (1) IFAT was sensitive for follow-up of P. opossum in natural and experimental T. cruzi infections; (2) both P. opossum and D. marsupialis are able to mount an efficient humoral immune response as compared to placental mammals; (3) experimentally infected P. opossum and D. marsupialis present distinct patterns of infection, depending on the subpopulation of T. cruzi, (4) the differences observed in the humoral immune responses between P. opossum and D. marsupialis, probably, reflect distinct strategies selected by these animals during their coevolution with T. cruzi.
The T Cell Response to Staphylococcus aureus
Bröker, Barbara M.; Mrochen, Daniel; Péton, Vincent
2016-01-01
Staphylococcus aureus (S. aureus) is a dangerous pathogen and a leading cause of both nosocomial and community acquired bacterial infection worldwide. However, on the other hand, we are all exposed to this bacterium, often within the first hours of life, and usually manage to establish equilibrium and coexist with it. What does the adaptive immune system contribute toward lifelong control of S. aureus? Will it become possible to raise or enhance protective immune memory by vaccination? While in the past the S. aureus-specific antibody response has dominated this discussion, the research community is now coming to appreciate the role that the cellular arm of adaptive immunity, the T cells, plays. There are numerous T cell subsets, each with differing functions, which together have the ability to orchestrate the immune response to S. aureus and hence to tip the balance between protection and pathology. This review summarizes the state of the art in this dynamic field of research. PMID:26999219
Stress proteins and the immune response.
Moseley, P
2000-07-25
, 243-282.]. This importance in immune regulation is best addressed using Matzinger's model of the immune response - The Danger Theory of Immunity [Matzinger, P., Fuchs, E.J., 1996. Beyond self and non-self: immunity is a conversation, not a war. J. NIH Res. 8, 35-39.]. Matzinger suggests that an immune system model based on the differentiation between "self and non-self" does not easily account for the changes that occur in the organism with growth and development. Why, for example does an organism not self-destruct when the immune system encounters the myriad of new peptides generated at puberty? Instead, she proposes a model of immune function based on the ability to detect and address dangers. This model states that the basic function of all cells of the organism is appropriately timed death "from natural causes". This type of cell death, or apoptosis, generates no stress signals. If, on the other hand, a cell is "murdered" by an infectious agent or dies an untimely death due to necrosis or ischemia, the cell undergoes a stress response with the liberation of stress protein-peptide complexes into the extracellular environment upon cell lysis. Not only do they serve as a "danger signal" to alert the immune system to the death of a cell under stress, but their role as protein carriers allows the immune effector cells to survey the peptides released by this stressed cell and to activate against new or unrecognized peptides carried by the stress protein. Matzinger bases the Danger Theory of Immunity on three "Laws of Lymphotics". These laws state that: (1) resting T lymphocytes require both antigen stimulation by an antigen-presenting cell (APC) and co-stimulation with a danger signal to become activated; (2) the co-stimulatory signal must be received through the APC; and (3) T cells receiving only antigen stimulation without the co-stimulatory signal undergo apoptosis. The Danger Theory gives a simple model for both tolerance and activation. (ABSTRACT TRUNCATED)
Bliska, James B; Wang, Xiaoying; Viboud, Gloria I; Brodsky, Igor E
2013-10-01
The innate immune system of mammals responds to microbial infection through detection of conserved molecular determinants called 'pathogen-associated molecular patterns' (PAMPs). Pathogens use virulence factors to counteract PAMP-directed responses. The innate immune system can in turn recognize signals generated by virulence factors, allowing for a heightened response to dangerous pathogens. Many Gram-negative bacterial pathogens encode type III secretion systems (T3SSs) that translocate effector proteins, subvert PAMP-directed responses and are critical for infection. A plasmid-encoded T3SS in the human-pathogenic Yersinia species translocates seven effectors into infected host cells. Delivery of effectors by the T3SS requires plasma membrane insertion of two translocators, which are thought to form a channel called a translocon. Studies of the Yersinia T3SS have provided key advances in our understanding of how innate immune responses are generated by perturbations in plasma membrane and other signals that result from translocon insertion. Additionally, studies in this system revealed that effectors function to inhibit innateimmune responses resulting from insertion of translocons into plasma membrane. Here, we review these advances with the goal of providing insight into how a T3SS can activate and inhibit innate immune responses, allowing a virulent pathogen to bypass host defences. © 2013 John Wiley & Sons Ltd.
Lee, Kyung-Yil; Rhim, Jung-Woo; Kang, Jin-Han
2011-01-01
It has been believed that acute lung injury in influenza virus infections is caused by a virus-induced cytopathy; viruses that have multiplied in the upper respiratory tract spread to lung tissues along the lower respiratory tract. However, some experimental and clinical studies have suggested that the pathogenesis of acute lung injury in influenza virus infections is associated with excessive host response including a cell-mediated immune reaction. During the pandemic H1N1 2009 influenza A virus infections in Korea, we experienced a dramatic effect of immune-modulators (corticosteroids) on the patients with severe pneumonia who had significant respiratory distress at presentation and those who showed rapidly progressive pneumonia during oseltamivir treatment. We also found that the pneumonia patients treated with corticosteroids showed the lowest lymphocyte differential and that the severity of pneumonia was associated with the lymphocyte count at presentation. From our findings and previous experimental and clinical studies, we postulated that hyperactive immune cells (T cells) may be involved in the acute lung injury of influenza virus infections, using a hypothesis of 'protein homeostasis system'; the inducers of the cell-mediated immune response are initially produced at the primary immune sites by the innate immune system. These substances reach the lung cells, the main target organ, via the systemic circulation, and possibly the cells of other organs, including myocytes or central nerve system cells, leading to extrapulmonary symptoms (e.g., myalgia and rhabdomyolysis, and encephalopathy). To control these substances that may be possibly toxic to host cells, the adaptive immune reaction may be operated by immune cells, mainly lymphocytes. Hyperimmune reaction of immune cells produces higher levels of cytokines which may be associated with acute lung injury, and may be controlled by early use of immune-modulators. Early initiation and proper dosage of immune
Yuan, Yujie; Ren, Jianan; Cao, Shougen; Zhang, Weiwei; Li, Jieshou
2012-01-01
The role of complement system in bridging innate and adaptive immunity has been confirmed in various invasive pathogens. It is still obscure how complement proteins promote T cell-mediated immune response during sepsis. The aim of this study is to investigate the role of exogenous C3 protein in the T-cell responses to sepsis. Sepsis was induced by colon ascendens stent peritonitis (CASP) in wild-type C57BL/6 mice, sham-operated mice for control. Human purified C3 protein (HuC3, 1 mg) was intraperitoneally injected at 6 h post-surgery, with 200 μl phosphate-buffered saline as control. The levels of C3 and cytokines, the expression of FOXP3 and NF-κB, and the percentages of CD4(+) T-cell subsets were compared among the groups at given time points. The polymicrobial sepsis produced considerable release of TNF-α and IL-10, and caused complement C3 exhaustion. Exogenous C3 administration markedly improved the 48 h survival rate, as compared with nontreatment (40% vs. 5%, P<0.01). The expression of FOXP3 protein was increased during sepsis, but can be suppressed by HuC3 administration. A single injection of HuC3 postponed the decline of differentiated Th1 cells, and depressed the activation of Th2/Th17 cells. Besides, the Th1-Th2 shift in late stage of sepsis can be controlled under C3 supplementation. The suppression of NF-κB pathway might be related to the appearance of immunocompromise. The study confirmed the important role of exogenous C3 in up-regulation of adaptive immune response to sepsis. The complement pathway would be a pivotal target for severe sepsis management. Copyright © 2011 Elsevier B.V. All rights reserved.
Eickhoff, Christopher S; Zhang, Xiuli; Vasconcelos, Jose R; Motz, R Geoffrey; Sullivan, Nicole L; O'Shea, Kelly; Pozzi, Nicola; Gohara, David W; Blase, Jennifer R; Di Cera, Enrico; Hoft, Daniel F
2016-09-01
Trypanosoma cruzi infection is controlled but not eliminated by host immunity. The T. cruzi trans-sialidase (TS) gene superfamily encodes immunodominant protective antigens, but expression of altered peptide ligands by different TS genes has been hypothesized to promote immunoevasion. We molecularly defined TS epitopes to determine their importance for protection versus parasite persistence. Peptide-pulsed dendritic cell vaccination experiments demonstrated that one pair of immunodominant CD4+ and CD8+ TS peptides alone can induce protective immunity (100% survival post-lethal parasite challenge). TS DNA vaccines have been shown by us (and others) to protect BALB/c mice against T. cruzi challenge. We generated a new TS vaccine in which the immunodominant TS CD8+ epitope MHC anchoring positions were mutated, rendering the mutant TS vaccine incapable of inducing immunity to the immunodominant CD8 epitope. Immunization of mice with wild type (WT) and mutant TS vaccines demonstrated that vaccines encoding enzymatically active protein and the immunodominant CD8+ T cell epitope enhance subdominant pathogen-specific CD8+ T cell responses. More specifically, CD8+ T cells from WT TS DNA vaccinated mice were responsive to 14 predicted CD8+ TS epitopes, while T cells from mutant TS DNA vaccinated mice were responsive to just one of these 14 predicted TS epitopes. Molecular and structural biology studies revealed that this novel costimulatory mechanism involves CD45 signaling triggered by enzymatically active TS. This enhancing effect on subdominant T cells negatively regulates protective immunity. Using peptide-pulsed DC vaccination experiments, we have shown that vaccines inducing both immunodominant and subdominant epitope responses were significantly less protective than vaccines inducing only immunodominant-specific responses. These results have important implications for T. cruzi vaccine development. Of broader significance, we demonstrate that increasing breadth of T
Innate Immune Responses in Leprosy
Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes
2018-01-01
Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852
Ikebuchi, Ryoyo; Teraguchi, Shunsuke; Vandenbon, Alexis; Honda, Tetsuya; Shand, Francis H W; Nakanishi, Yasutaka; Watanabe, Takeshi; Tomura, Michio
2016-10-19
Foxp3 + regulatory T cells (Tregs) migrating from the skin to the draining lymph node (dLN) have a strong immunosuppressive effect on the cutaneous immune response. However, the subpopulations responsible for their inhibitory function remain unclear. We investigated single-cell gene expression heterogeneity in Tregs from the dLN of inflamed skin in a contact hypersensitivity model. The immunosuppressive genes Ctla4 and Tgfb1 were expressed in the majority of Tregs. Although Il10-expressing Tregs were rare, unexpectedly, the majority of Il10-expressing Tregs co-expressed Gzmb and displayed Th1-skewing. Single-cell profiling revealed that CD43 + CCR5 + Tregs represented the main subset within the Il10/Gzmb-expressing cell population in the dLN. Moreover, CD43 + CCR5 + CXCR3 - Tregs expressed skin-tropic chemokine receptors, were preferentially retained in inflamed skin and downregulated the cutaneous immune response. The identification of a rare Treg subset co-expressing multiple immunosuppressive molecules and having tissue-remaining capacity offers a novel strategy for the control of skin inflammatory responses.
Hypercholesterolemia induces T cell expansion in humanized immune mice.
Proto, Jonathan D; Doran, Amanda C; Subramanian, Manikandan; Wang, Hui; Zhang, Mingyou; Sozen, Erdi; Rymond, Christina C; Kuriakose, George; D'Agati, Vivette; Winchester, Robert; Sykes, Megan; Yang, Yong-Guang; Tabas, Ira
2018-06-01
Emerging data suggest that hypercholesterolemia has stimulatory effects on adaptive immunity and that these effects can promote atherosclerosis and perhaps other inflammatory diseases. However, research in this area has relied primarily on inbred strains of mice whose adaptive immune system can differ substantially from that of humans. Moreover, the genetically induced hypercholesterolemia in these models typically results in plasma cholesterol levels that are much higher than those in most humans. To overcome these obstacles, we studied human immune system-reconstituted mice (hu-mice) rendered hypercholesterolemic by treatment with adeno-associated virus 8-proprotein convertase subtilisin/kexin type 9 (AAV8-PCSK9) and a high-fat/high-cholesterol Western-type diet (WD). These mice had a high percentage of human T cells and moderate hypercholesterolemia. Compared with hu-mice that had lower plasma cholesterol, the PCSK9-WD mice developed a T cell-mediated inflammatory response in the lung and liver. Human CD4+ and CD8+ T cells bearing an effector memory phenotype were significantly elevated in the blood, spleen, and lungs of PCSK9-WD hu-mice, whereas splenic and circulating regulatory T cells were reduced. These data show that moderately high plasma cholesterol can disrupt human T cell homeostasis in vivo. This process may not only exacerbate atherosclerosis, but also contribute to T cell-mediated inflammatory diseases in the hypercholesterolemia setting.
T Cell-Mediated Immunity towards Yellow Fever Virus and Useful Animal Models.
Watson, Alan M; Klimstra, William B
2017-04-11
The 17D line of yellow fever virus vaccines is among the most effective vaccines ever created. The humoral and cellular immunity elicited by 17D has been well characterized in humans. Neutralizing antibodies have long been known to provide protection against challenge with a wild-type virus. However, a well characterized T cell immune response that is robust, long-lived and polyfunctional is also elicited by 17D. It remains unclear whether this arm of immunity is protective following challenge with a wild-type virus. Here we introduce the 17D line of yellow fever virus vaccines, describe the current state of knowledge regarding the immunity directed towards the vaccines in humans and conclude with a discussion of animal models that are useful for evaluating T cell-mediated immune protection to yellow fever virus.
Dodd, Kimberly A; McElroy, Anita K; Jones, Tara L; Zaki, Sherif R; Nichol, Stuart T; Spiropoulou, Christina F
2014-06-01
Rift Valley fever virus (RVFV) causes outbreaks of severe disease in livestock and humans throughout Africa and the Arabian Peninsula. In people, RVFV generally causes a self-limiting febrile illness but in a subset of individuals, it progresses to more serious disease. One manifestation is a delayed-onset encephalitis that can be fatal or leave the afflicted with long-term neurologic sequelae. In order to design targeted interventions, the basic pathogenesis of RVFV encephalitis must be better understood. To characterize the host immune responses and viral kinetics associated with fatal and nonfatal infections, mice were infected with an attenuated RVFV lacking NSs (ΔNSs) that causes lethal disease only when administered intranasally (IN). Following IN infection, C57BL/6 mice developed severe neurologic disease and succumbed 7-9 days post-infection. In contrast, inoculation of ΔNSs virus subcutaneously in the footpad (FP) resulted in a subclinical infection characterized by a robust immune response with rapid antibody production and strong T cell responses. IN-inoculated mice had delayed antibody responses and failed to clear virus from the periphery. Severe neurological signs and obtundation characterized end stage-disease in IN-inoculated mice, and within the CNS, the development of peak virus RNA loads coincided with strong proinflammatory responses and infiltration of activated T cells. Interestingly, depletion of T cells did not significantly alter survival, suggesting that neurologic disease is not a by-product of an aberrant immune response. Comparison of fatal (IN-inoculated) and nonfatal (FP-inoculated) ΔNSs RVFV infections in the mouse model highlighted the role of the host immune response in controlling viral replication and therefore determining clinical outcome. There was no evidence to suggest that neurologic disease is immune-mediated in RVFV infection. These results provide important insights for the future design of vaccines and therapeutic
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fogg, Mark; Murphy, John R.; Lorch, Jochen
Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, asmore » well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. - Highlights: • Viral proteins are tumor antigens in Epstein–Barr virus associated Nasopharyngeal Carcinoma. • CD8+ T cell responses against EBV proteins EBNA-1 and LMP2 are suppressed in NPC patients. • T regulatory cells are responsible for suppressing EBV immunity in NPC patients. • Depletion of Tregs with Ontak can rescue EBV-specific CD8+ T cell responses in NPC patients. • This clinically approved drug may be effective for enhancing anti-tumor immunity in NPC patients.« less
Nico, Dirlei; Claser, Carla; Borja-Cabrera, Gulnara P.; Travassos, Luiz R.; Palatnik, Marcos; da Silva Soares, Irene; Rodrigues, Mauricio Martins; Palatnik-de-Sousa, Clarisa B.
2010-01-01
Nucleoside hydrolases (NHs) show homology among parasite protozoa, fungi and bacteria. They are vital protagonists in the establishment of early infection and, therefore, are excellent candidates for the pathogen recognition by adaptive immune responses. Immune protection against NHs would prevent disease at the early infection of several pathogens. We have identified the domain of the NH of L. donovani (NH36) responsible for its immunogenicity and protective efficacy against murine visceral leishmaniasis (VL). Using recombinant generated peptides covering the whole NH36 sequence and saponin we demonstrate that protection against L. chagasi is related to its C-terminal domain (amino-acids 199–314) and is mediated mainly by a CD4+ T cell driven response with a lower contribution of CD8+ T cells. Immunization with this peptide exceeds in 36.73±12.33% the protective response induced by the cognate NH36 protein. Increases in IgM, IgG2a, IgG1 and IgG2b antibodies, CD4+ T cell proportions, IFN-γ secretion, ratios of IFN-γ/IL-10 producing CD4+ and CD8+ T cells and percents of antibody binding inhibition by synthetic predicted epitopes were detected in F3 vaccinated mice. The increases in DTH and in ratios of TNFα/IL-10 CD4+ producing cells were however the strong correlates of protection which was confirmed by in vivo depletion with monoclonal antibodies, algorithm predicted CD4 and CD8 epitopes and a pronounced decrease in parasite load (90.5–88.23%; p = 0.011) that was long-lasting. No decrease in parasite load was detected after vaccination with the N-domain of NH36, in spite of the induction of IFN-γ/IL-10 expression by CD4+ T cells after challenge. Both peptides reduced the size of footpad lesions, but only the C-domain reduced the parasite load of mice challenged with L. amazonensis. The identification of the target of the immune response to NH36 represents a basis for the rationale development of a bivalent vaccine against leishmaniasis and for
Chaves, Ana Thereza; de Assis Silva Gomes Estanislau, Juliana; Fiuza, Jacqueline Araújo; Carvalho, Andréa Teixeira; Ferreira, Karine Silvestre; Fares, Rafaelle Christine Gomes; Guimarães, Pedro Henrique Gazzinelli; de Souza Fagundes, Elaine Maria; Morato, Maria José; Fujiwara, Ricardo Toshio; da Costa Rocha, Manoel Otávio; Correa-Oliveira, Rodrigo
2016-04-30
Chronic Chagas disease presents different clinical manifestations ranging from asymptomatic (namely indeterminate) to severe cardiac and/or digestive. Previous results have shown that the immune response plays an important role, although no all mechanisms are understood. Immunoregulatory mechanisms such as apoptosis are important for the control of Chagas disease, possibly affecting the morbidity in chronic clinical forms. Apoptosis has been suggested to be an important mechanism of cellular response during T. cruzi infection. We aimed to further understand the putative role of apoptosis in Chagas disease and its relation to the clinical forms of the disease. Apoptosis of lymphocytes, under antigenic stimuli (soluble T. cruzi antigens - TcAg) where compared to that of non-stimulated cells. Apoptosis was evaluated using the expression of annexin and caspase 3(+) by T cells and the percentage of cells positive evaluated by flow cytometry. In addition activation and T cell markers were used for the identification of TCD4(+) and TCD8(+) subpopulations. The presence of intracellular and plasma cytokines were also evaluated. Analysis of the activation status of the peripheral blood cells showed that patients with Chagas disease presented higher levels of activation determined by the expression of activation markers, after TcAg stimulation. PCR array were used to evaluate the contribution of this mechanism in specific cell populations from patients with different clinical forms of human Chagas disease. Our results showed a reduced proliferative response associated a high expression of T CD4(+)CD62L(-) cells in CARD patients when compared with IND group and NI individuals. We also observed that both groups of patients presented a significant increase of CD4(+) and CD8(+) T cell subsets in undergoing apoptosis after in vitro stimulation with T. cruzi antigens. In CARD patients, both CD4(+) and CD8(+) T cells expressing TNF-α were highly susceptible to undergo apoptosis
Sedgmen, B. J.; Papalia, L.; Wang, L.; Dyson, A. R.; McCallum, H. A.; Simson, C. M.; Pearse, M. J.; Maraskovsky, E.; Hung, D.; Eomois, P. P.; Hartel, G.; Barnden, M. J.; Rockman, S. P.
2013-01-01
The measurement of vaccine-induced humoral and CD4+ and CD8+ cellular immune responses represents an important correlate of vaccine efficacy. Accurate and reliable assays evaluating such responses are therefore critical during the clinical development phase of vaccines. T cells play a pivotal role both in coordinating the adaptive and innate immune responses and as effectors. During the assessment of cell-mediated immunity (CMI) in subjects participating in a large-scale influenza vaccine trial, we identified the expansion of an IFN-γ-producing CD3+CD4−CD8− γδ + T cell population in the peripheral blood of 90/610 (15%) healthy subjects. The appearance of CD3+CD4−CD8− γδ + T cells in the blood of subjects was transient and found to be independent of the study cohort, vaccine group, subject gender and ethnicity, and ex vivo restimulation conditions. Although the function of this population and relevance to vaccination are unclear, their inclusion in the total vaccine-specific T-cell response has the potential to confound data interpretation. It is thus recommended that when evaluating the induction of IFN-γ-producing CD4+ and CD8+ immune responses following vaccination, the CD3+CD4−CD8− γδ + T cells are either excluded or separately enumerated from the overall frequency determination. PMID:24066003
T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4⁺ T cells.
Arbore, Giuseppina; West, Erin E; Spolski, Rosanne; Robertson, Avril A B; Klos, Andreas; Rheinheimer, Claudia; Dutow, Pavel; Woodruff, Trent M; Yu, Zu Xi; O'Neill, Luke A; Coll, Rebecca C; Sher, Alan; Leonard, Warren J; Köhl, Jörg; Monk, Pete; Cooper, Matthew A; Arno, Matthew; Afzali, Behdad; Lachmann, Helen J; Cope, Andrew P; Mayer-Barber, Katrin D; Kemper, Claudia
2016-06-17
The NLRP3 inflammasome controls interleukin-1β maturation in antigen-presenting cells, but a direct role for NLRP3 in human adaptive immune cells has not been described. We found that the NLRP3 inflammasome assembles in human CD4(+) T cells and initiates caspase-1-dependent interleukin-1β secretion, thereby promoting interferon-γ production and T helper 1 (T(H)1) differentiation in an autocrine fashion. NLRP3 assembly requires intracellular C5 activation and stimulation of C5a receptor 1 (C5aR1), which is negatively regulated by surface-expressed C5aR2. Aberrant NLRP3 activity in T cells affects inflammatory responses in human autoinflammatory disease and in mouse models of inflammation and infection. Our results demonstrate that NLRP3 inflammasome activity is not confined to "innate immune cells" but is an integral component of normal adaptive T(H)1 responses. Copyright © 2016, American Association for the Advancement of Science.
He, Kun; Liu, Ping; Xu, Lisa X
2017-03-23
Tumor metastasis is a major concern in tumor therapy. In our previous studies, a novel tumor therapeutic modality of the cryo-thermal therapy has been presented, highlighting its effect on the suppression of distal metastasis and leading to long-term survival in 4T1 murine mammary carcinoma model. To demonstrate the therapeutic efficacy in other aggressive tumor models and further investigate the mechanism of long-term survival induced, in this study, spontaneous metastatic murine B16F10 melanoma model was used. The cryo-thermal therapy induced regression of implanted melanoma and prolonged long-term survival while inhibiting lung metastasis. It also promoted the activation of CD4 + CD25 - conventional T cells, while reduced the percentage of CD4 + CD25 + regulatory T cells (Tregs) and myeloid-derived suppressor cells (MDSCs) in the spleen, lung and blood. Furthermore, the cryo-thermal therapy enhanced the cytolytic function of CD8 + T cells and induced differentiation of CD8 + T cells into memory stem T cell (T SCM ), and differentiation of CD4 + T cells into dominant CD4-CTL, Th1 and Tfh subsets in the spleen for 90 days after the treatment. It was found that good therapeutic effect was mainly dependent on CD4 + T cells providing a durable memory antitumor immune response. At the same time, significant increase of serum IFN-γ was also observed to provide an ideal microenvironment of antitumor immunity. Further study showed that the rejection of re-challenge of B16F10 but not GL261 tumor in the treated mice in 45 or 60 days after the treatment, implied a strong systemic and melanoma-specific memory antitumor immunity induced by the treatment. Thus the cryo-thermal therapy would be considered as a new therapeutic strategy to prevent tumor recurrence and metastasis with potential clinical applications in the near future.
Lode, Holger N.; Xiang, Rong; Duncan, Steven R.; Theofilopoulos, Argyrios N.; Gillies, Stephen D.; Reisfeld, Ralph A.
1999-01-01
Induction, maintenance, and amplification of tumor-protective immunity after cytokine gene therapy is essential for the clinical success of immunotherapeutic approaches. We investigated whether this could be achieved by single-chain IL-12 (scIL-12) gene therapy followed by tumor-targeted IL-2 using a fusion protein containing a tumor-specific recombinant anti-ganglioside GD2 antibody and IL-2 (ch14.18-IL-2) in a poorly immunogenic murine neuroblastoma model. Herein, we demonstrate the absence of liver and bone marrow metastases after a lethal challenge with NXS2 wild-type cells only in mice (five of six animals) vaccinated with scIL-12-producing NXS2 cells and given a booster injection of low-dose ch14.18-IL-2 fusion protein. This tumor-protective immunity was effective 3 months after initial vaccination, in contrast to control animals treated with a nonspecific fusion protein or an equivalent mixture of antibody and IL-2. Only vaccinated mice receiving the tumor-specific ch14.18-IL-2 fusion protein revealed a reactivation of CD8+ T cells and subsequent MHC class I-restricted tumor target cell lysis in vitro. The sequential increase in the usage of TCR chains Vβ11 and -13 in mouse CD8+ T cells after vaccination and amplification with ch14.18-IL-2 suggests that the initial polyclonal CD8+ T cell response is effectively boosted by targeted IL-2. In conclusion, we demonstrate that a successful boost of a partially protective memory T cell immune response that is induced by scIL-12 gene therapy could be generated by tumor-specific targeting of IL-2 with a ch14.18-IL-2 fusion protein. This approach could increase success rates of clinical cancer vaccine trials. PMID:10411920
Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata
2018-01-01
Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4+ T cells
Spolski, Rosanne; Robertson, Avril A. B.; Klos, Andreas; Rheinheimer, Claudia; Dutow, Pavel; Woodruff, Trent M.; Yu, Zu Xi; O'Neill, Luke A.; Coll, Rebecca C.; Sher, Alan; Leonard, Warren J.; Köhl, Jörg; Monk, Pete; Cooper, Matthew A.; Arno, Matthew; Afzali, Behdad; Lachmann, Helen J.; Cope, Andrew P.; Mayer-Barber, Katrin D.; Kemper, Claudia
2016-01-01
The NLRP3 inflammasome controls interleukin-1β maturation in antigen-presenting cells, but a direct role for NLRP3 in human adaptive immune cells has not been described. We found that the NLRP3 inflammasome assembles in human CD4+ T cells and initiates caspase-1–dependent interleukin-1β secretion, thereby promoting interferon-γ production and T helper 1 (TH1) differentiation in an autocrine fashion. NLRP3 assembly requires intracellular C5 activation and stimulation of C5a receptor 1 (C5aR1), which is negatively regulated by surface-expressed C5aR2. Aberrant NLRP3 activity in T cells affects inflammatory responses in human autoinflammatory disease and in mouse models of inflammation and infection. Our results demonstrate that NLRP3 inflammasome activity is not confined to “innate immune cells” but is an integral component of normal adaptive TH1 responses. PMID:27313051
Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E
2016-10-01
Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights
Arginine and Citrulline and the Immune Response in Sepsis
Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn
2015-01-01
Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985
Inflammatory cytokines in the brain: does the CNS shape immune responses?
Owens, T; Renno, T; Taupin, V; Krakowski, M
1994-12-01
Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.
Identifying Regulators of the Immune Response to Dying Cells | Center for Cancer Research
Cytotoxic T cells are responsible for carrying out antigen-mediated immune responses against virally-infected and malignant cells. In both cases, cytotoxic T cells are stimulated by interacting with antigen presenting cells, such as dendritic cells (DCs). Infected cells produce virus-specific antigens and pathogen associated molecular patterns, which are recognized by DCs and lead to robust T cell activation. Dead or dying uninfected cells, on the other hand, release damage associated molecular patterns, but their release does not always appear to be sufficient to induce cytotoxic T cell activity. Tim Greten, M.D., of CCR’s Medical Oncology Branch, and a group of international collaborators set out to understand how immune responses against dying cancer cells are regulated. These processes are likely to be important for improving the efficacy of cancer treatment vaccines, which induce an immune reaction against a patient’s cancer cells.
Myeloid IKKβ Promotes Antitumor Immunity by Modulating CCL11 and the Innate Immune Response
Yang, Jinming; Hawkins, Oriana E.; Barham, Whitney; Gilchuk, Pavlo; Boothby, Mark; Ayers, Gregory D.; Joyce, Sebastian; Karin, Michael; Yull, Fiona E.; Richmond, Ann
2015-01-01
Myeloid cells are capable of promoting or eradicating tumor cells and the nodal functions that contribute to their different roles are still obscure. Here, we show that mice with myeloid-specific genetic loss of the NF-κB pathway regulatory kinase IKKβ exhibit more rapid growth of cutaneous and lung melanoma tumors. In a BRAFV600E/PTEN−/− allograft model, IKKβ loss in macrophages reduced recruitment of myeloid cells into the tumor, lowered expression of MHC class II molecules, and enhanced production of the chemokine CCL11, thereby negatively regulating dendritic-cell maturation. Elevated serum and tissue levels of CCL11 mediated suppression of dendritic-cell differentiation/maturation within the tumor microenvironment, skewing it toward a Th2 immune response and impairing CD8+ T cell–mediated tumor cell lysis. Depleting macrophages or CD8+ T cells in mice with wild-type IKKβ myeloid cells enhanced tumor growth, where the myeloid cell response was used to mediate antitumor immunity against melanoma tumors (with less dependency on a CD8+ T-cell response). In contrast, myeloid cells deficient in IKKβ were compromised in tumor cell lysis, based on their reduced ability to phagocytize and digest tumor cells. Thus, mice with continuous IKKβ signaling in myeloid-lineage cells (IKKβCA) exhibited enhanced antitumor immunity and reduced melanoma outgrowth. Collectively, our results illuminate new mechanisms through which NF-κB signaling in myeloid cells promotes innate tumor surveillance. PMID:25336190
Role of muscarinic receptors in the regulation of immune and inflammatory responses
Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.
2008-01-01
Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972
Spitz, Charlotte; Winkels, Holger; Bürger, Christina; Weber, Christian; Lutgens, Esther; Hansson, Göran K; Gerdes, Norbert
2016-03-01
Atherosclerosis is a chronic inflammatory disease that is mediated by innate and adaptive immune responses. The disease is characterized by sub-endothelial accumulation and modification of lipids in the artery wall triggering an inflammatory reaction which promotes lesion progression and eventual plaque rupture, thrombus formation, and the respective clinical sequelae such as myocardial infarction or stroke. During the past decade, T-cell-mediated immune responses, especially control of pro-inflammatory signals by regulatory T cells (Tregs), have increasingly attracted the interest of experimental and clinical researchers. By suppression of T cell proliferation and secretion of anti-inflammatory cytokines, such as interleukin-10 (IL-10) and transforming growth factor-β, Tregs exert their atheroprotective properties. Atherosclerosis-prone, hyperlipidemic mice harbor systemically less Tregs compared to wild-type mice, suggesting an imbalance of immune cells which affects local and systemic inflammatory and potentially metabolic processes leading to atherogenesis. Restoring or increasing Treg frequency and enhancing their suppressive capacity by various modulations may pose a promising approach for treating inflammatory conditions such as cardiovascular diseases. In this review, we briefly summarize the immunological basics of atherosclerosis and introduce the role and contribution of different subsets of T cells. We then discuss experimental data and current knowledge pertaining to Tregs in atherosclerosis and perspectives on manipulating the adaptive immune system to alleviate atherosclerosis and cardiovascular disease.
Fairley, Stacie J; Singh, Shree R; Yilma, Abebayehu N; Waffo, Alain B; Subbarayan, Praseetha; Dixit, Saurabh; Taha, Murtada A; Cambridge, Chino D; Dennis, Vida A
2013-01-01
We recently demonstrated by in vitro experiments that PLGA (poly D, L-lactide-co-glycolide) potentiates T helper 1 (Th1) immune responses induced by a peptide derived from the recombinant major outer membrane protein (rMOMP) of Chlamydia trachomatis, and may be a promising vaccine delivery system. Herein we evaluated the immune-potentiating potential of PLGA by encapsulating the full-length rMOMP (PLGA-rMOMP), characterizing it in vitro, and investigating its immunogenicity in vivo. Our hypothesis was that PLGA-rMOMP triggers Th1 immune responses in mice, which are desirable prerequisites for a C. trachomatis candidate nanovaccine. Physical-structural characterizations of PLGA-rMOMP revealed its size (approximately 272 nm), zeta potential (-14.30 mV), apparent spherical smooth morphology, and continuous slow release pattern. PLGA potentiated the ability of encapsulated rMOMP to trigger production of cytokines and chemokines by mouse J774 macrophages. Flow cytometric analyses revealed that spleen cells from BALB/c mice immunized with PLGA-rMOMP had elevated numbers of CD4+ and CD8+ T cell subsets, and secreted more rMOMP-specific interferon-gamma (Th1) and interleukin (IL)-12p40 (Th1/Th17) than IL-4 and IL-10 (Th2) cytokines. PLGA-rMOMP-immunized mice produced higher serum immunoglobulin (Ig)G and IgG2a (Th1) than IgG1 (Th2) rMOMP-specific antibodies. Notably, sera from PLGA-rMOMP-immunized mice had a 64-fold higher Th1 than Th2 antibody titer, whereas mice immunized with rMOMP in Freund's adjuvant had only a four-fold higher Th1 than Th2 antibody titer, suggesting primarily induction of a Th1 antibody response in PLGA-rMOMP-immunized mice. Our data underscore PLGA as an effective delivery system for a C. trachomatis vaccine. The capacity of PLGA-rMOMP to trigger primarily Th1 immune responses in mice promotes it as a highly desirable candidate nanovaccine against C. trachomatis.
Discovering naturally processed antigenic determinants that confer protective T cell immunity
Gilchuk, Pavlo; Spencer, Charles T.; Conant, Stephanie B.; Hill, Timothy; Gray, Jennifer J.; Niu, Xinnan; Zheng, Mu; Erickson, John J.; Boyd, Kelli L.; McAfee, K. Jill; Oseroff, Carla; Hadrup, Sine R.; Bennink, Jack R.; Hildebrand, William; Edwards, Kathryn M.; Crowe, James E.; Williams, John V.; Buus, Søren; Sette, Alessandro; Schumacher, Ton N.M.; Link, Andrew J.; Joyce, Sebastian
2013-01-01
CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection — information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I–transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences. PMID:23543059
Discovering naturally processed antigenic determinants that confer protective T cell immunity.
Gilchuk, Pavlo; Spencer, Charles T; Conant, Stephanie B; Hill, Timothy; Gray, Jennifer J; Niu, Xinnan; Zheng, Mu; Erickson, John J; Boyd, Kelli L; McAfee, K Jill; Oseroff, Carla; Hadrup, Sine R; Bennink, Jack R; Hildebrand, William; Edwards, Kathryn M; Crowe, James E; Williams, John V; Buus, Søren; Sette, Alessandro; Schumacher, Ton N M; Link, Andrew J; Joyce, Sebastian
2013-05-01
CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection - information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I-transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences.
Finn, Jonathan D; Bassett, Jennifer; Millar, James B; Grinshtein, Natalie; Yang, Teng Chih; Parsons, Robin; Evelegh, Carole; Wan, Yonghong; Parks, Robin J; Bramson, Jonathan L
2009-12-01
Previous studies determined that the CD8(+) T-cell response elicited by recombinant adenovirus exhibited a protracted contraction phase that was associated with long-term presentation of antigen. To gain further insight into this process, a doxycycline-regulated adenovirus was constructed to enable controlled extinction of transgene expression in vivo. We investigated the impact of premature termination of transgene expression at various time points (day 3 to day 60) following immunization. When transgene expression was terminated before the maximum response had been attained, overall expansion was attenuated, yielding a small memory population. When transgene expression was terminated between day 13 and day 30, the memory population was not sustained, demonstrating that the early memory population was antigen dependent. Extinction of transgene expression at day 60 had no obvious impact on memory maintenance, indicating that maintenance of the memory population may ultimately become independent of transgene expression. Premature termination of antigen expression had significant but modest effects on the phenotype and cytokine profile of the memory population. These results offer new insights into the mechanisms of memory CD8(+) T-cell maintenance following immunization with a recombinant adenovirus.
T Cell-Mediated Immunity towards Yellow Fever Virus and Useful Animal Models
Watson, Alan M.; Klimstra, William B.
2017-01-01
The 17D line of yellow fever virus vaccines is among the most effective vaccines ever created. The humoral and cellular immunity elicited by 17D has been well characterized in humans. Neutralizing antibodies have long been known to provide protection against challenge with a wild-type virus. However, a well characterized T cell immune response that is robust, long-lived and polyfunctional is also elicited by 17D. It remains unclear whether this arm of immunity is protective following challenge with a wild-type virus. Here we introduce the 17D line of yellow fever virus vaccines, describe the current state of knowledge regarding the immunity directed towards the vaccines in humans and conclude with a discussion of animal models that are useful for evaluating T cell-mediated immune protection to yellow fever virus. PMID:28398253
Tetranychus urticae mites do not mount an induced immune response against bacteria
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E.; Zélé, Flore; Riga, Maria; Leitão, Alexandre B.; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara
2017-01-01
The genome of the spider mite Tetranychus urticae, a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae, infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila. Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei, a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae. This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei. We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum. Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. PMID:28592670
Tetranychus urticae mites do not mount an induced immune response against bacteria.
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio
2017-06-14
The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.
Fazal, Nadeem
2013-01-01
Co-stimulatory molecules expressed on Dendritic Cells (DCs) function to coordinate an efficient immune response by T cells in the peripheral lymph nodes. We hypothesized that CD4+ T cell-mediated immune suppression following burn injury may be related to dysfunctional DCs residing in gut associated lymphoid tissues (GALT), such as Mesenteric Lymph Nodes (MLN). Therefore, we studied co-stimulatory molecules expressed on burn rat MLN DCs as an index of functional DCs that would mount an effective normal CD4+ T cell immune response. In a rat model of 30% Total Body Surface Area (TBSA) scald burn, OX62+OX6+OX35+ DCs and CD4+ T cells were isolated from MLN of day 3 post-burn and sham control rats. DCs were tested for their expression of co-stimulatory molecules, and prime CD4+ T cell (DC:CD4+T cell co-culture assays) to determine an effector immune response such as CD4+ T cell proliferation. The surface receptor expressions of MLN DCs co-stimulatory molecules, i.e., MHC-II, CD40, CD80 (B7-1), and CD86 (B7-2) were determined by Flow cytometry (quantitatively) and confocal microscopy (qualitatively). Tritiated thymidine and CFDA-SE determined CD4+ T cell proliferation following co-incubation with DCs. Cytokine milieu of MLN (IL-12 and IL-10) was assessed by mRNA determination by RT-PCR. The results showed down-regulated expressions of co-stimulatory markers (CD80, CD86, CD40 and MHC-II) of MLN DCs obtained from burn-injured rats, as well as lack of ability of these burn-induced DCs to stimulate CD4+ T cell proliferation in co-culture assays, as compared to the sham rats. Moreover, anti-CD40 stimulation of affected burn MLN DCs did not reverse this alteration. Furthermore, a marked up-regulation of mRNA IL-10 and down-regulation of mRNA IL-12 in burn MLN as compared to sham animals was also observed. To surmise, the data indicated that dysfunctional OX62+OX6+OX35+ rat MLN DCs may contribute to CD4+ T-cell-mediated immune suppression observed following acute burn injury.
Fazal, Nadeem
2013-01-01
Co-stimulatory molecules expressed on Dendritic Cells (DCs) function to coordinate an efficient immune response by T cells in the peripheral lymph nodes. We hypothesized that CD4+ T cell-mediated immune suppression following burn injury may be related to dysfunctional DCs residing in gut associated lymphoid tissues (GALT), such as Mesenteric Lymph Nodes (MLN). Therefore, we studied co-stimulatory molecules expressed on burn rat MLN DCs as an index of functional DCs that would mount an effective normal CD4+ T cell immune response. In a rat model of 30% Total Body Surface Area (TBSA) scald burn, OX62+OX6+OX35+ DCs and CD4+ T cells were isolated from MLN of day 3 post-burn and sham control rats. DCs were tested for their expression of co-stimulatory molecules, and prime CD4+ T cell (DC:CD4+T cell co-culture assays) to determine an effector immune response such as CD4+ T cell proliferation. The surface receptor expressions of MLN DCs co-stimulatory molecules, i.e., MHC-II, CD40, CD80 (B7-1), and CD86 (B7-2) were determined by Flow cytometry (quantitatively) and confocal microscopy (qualitatively). Tritiated thymidine and CFDA-SE determined CD4+ T cell proliferation following co-incubation with DCs. Cytokine milieu of MLN (IL-12 and IL-10) was assessed by mRNA determination by RT-PCR. The results showed down-regulated expressions of co-stimulatory markers (CD80, CD86, CD40 and MHC-II) of MLN DCs obtained from burn-injured rats, as well as lack of ability of these burn-induced DCs to stimulate CD4+ T cell proliferation in co-culture assays, as compared to the sham rats. Moreover, anti-CD40 stimulation of affected burn MLN DCs did not reverse this alteration. Furthermore, a marked up-regulation of mRNA IL-10 and down-regulation of mRNA IL-12 in burn MLN as compared to sham animals was also observed. To surmise, the data indicated that dysfunctional OX62+OX6+OX35+ rat MLN DCs may contribute to CD4+ T-cell-mediated immune suppression observed following acute burn injury
Wieten, R W; Goorhuis, A; Jonker, E F F; de Bree, G J; de Visser, A W; van Genderen, P J J; Remmerswaal, E B M; Ten Berge, I J M; Visser, L G; Grobusch, M P; van Leeuwen, E M M
2016-06-01
The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen patients using different immunosuppressive drugs and 30 healthy individuals vaccinated 0-22 years ago were included. The serological response was measured using the plaque reduction neutralization test (PRNT). CD8(+) and CD4(+) T-cell responses were measured following proliferation and re-stimulation with YFV peptide pools. Phenotypic characteristics and cytokine responses of CD8(+) T-cells were determined using class I tetramers. The geometric mean titre of neutralizing antibodies was not different between the groups (p = 0.77). The presence of YFV-specific CD4(+) and CD8(+) T-cell did not differ between patients and healthy individuals (15/15, 100.0% vs. 29/30, 96.7%, p = 0.475). Time since vaccination correlated negatively with the number of YFV-specific CD8(+) T-cells (r = -0.66, p = 0.0045). Percentages of early-differentiated memory cells increased (r = 0.67, p = 0.017) over time. These results imply that YF vaccination is effective despite certain immunosuppressive drug regimens. An early-differentiated memory-like phenotype persisted, which is associated with effective expansion upon re-encounter with antigen, suggesting a potent memory T-cell pool remains. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Discovery of stimulation-responsive immune enhancers with CRISPR activation.
Simeonov, Dimitre R; Gowen, Benjamin G; Boontanrart, Mandy; Roth, Theodore L; Gagnon, John D; Mumbach, Maxwell R; Satpathy, Ansuman T; Lee, Youjin; Bray, Nicolas L; Chan, Alice Y; Lituiev, Dmytro S; Nguyen, Michelle L; Gate, Rachel E; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M; Mitros, Therese; Ray, Graham J; Curie, Gemma L; Naddaf, Nicki; Chu, Julia S; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R; Schumann, Kathrin; Daly, Mark J; Farh, Kyle K; Ansel, K Mark; Ye, Chun J; Greenleaf, William J; Anderson, Mark S; Bluestone, Jeffrey A; Chang, Howard Y; Corn, Jacob E; Marson, Alexander
2017-09-07
The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (T H 17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.
APRIL modulates B and T cell immunity
Stein, Jens V.; López-Fraga, Marta; Elustondo, Fernando A.; Carvalho-Pinto, Carla E.; Rodríguez, Dolores; Gómez-Caro, Ruth; de Jong, Joan; Martínez-A, Carlos; Medema, Jan Paul; Hahne, Michael
2002-01-01
The TNF-like ligands APRIL and BLyS are close relatives and share the capacity to bind the receptors TACI and BCMA. BLyS has been shown to play an important role in B cell homeostasis and autoimmunity, but the biological role of APRIL remains less well defined. Analysis of T cells revealed an activation-dependent increase in APRIL mRNA expression. We therefore generated mice expressing APRIL as a transgene in T cells. These mice appeared normal and showed no signs of B cell hyperplasia. Transgenic T cells revealed a greatly enhanced survival in vitro as well as enhanced survival of staphylococcal enterotoxin B–reactive CD4+ T cells in vivo, which both directly correlate with elevated Bcl-2 levels. Analysis of humoral responses to T cell–dependent antigens in the transgenic mice indicated that APRIL affects only IgM but not IgG responses. In contrast, T cell–independent type 2 (TI-2) humoral response was enhanced in APRIL transgenic mice. As TACI was previously reported to be indispensable for TI-2 antibody formation, these results suggest a role for APRIL/TACI interactions in the generation of this response. Taken together, our data indicate that APRIL is involved in the induction and/or maintenance of T and B cell responses. PMID:12070306
Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.
Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura
2011-10-13
Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Immune Responses in Rhinovirus-Induced Asthma Exacerbations.
Steinke, John W; Borish, Larry
2016-11-01
Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.
Movement Limitation and Immune Responses of Rhesus Monkeys
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald; Morton, Darla S.; Swiggett, Jeanene P.; Hakenewerth, Anne M.; Fowler, Nina A.
1993-01-01
The effects of restraint on immunological parameters was determined in an 18 day ARRT (adult rhesus restraint test). The monkeys were restrained for 18 days in the experimental station for the orbiting primate (ESOP), the chair of choice for Space Shuttle experiments. Several immunological parameters were determined using peripheral blood, bone marrow, and lymph node specimens from the monkeys. The parameters included: response of bone marrow cells to GM-CSF (granulocyte-macrophage colony stimulating factor), leukocyte subset distribution, and production of IFN-alpha (interferon-alpha) and IFN-gamma (interferon-gamma). The only parameter changed after 18 days of restraint was the percentage of CDB+ T cells. No other immunological parameters showed changes due to restraint. Handling and changes in housing prior to the restraint period did apparently result in some restraint-independent immunological changes. Handling must be kept to a minimum and the animals allowed time to recover prior to flight. All experiments must be carefully controlled. Restraint does not appear to be a major issue regarding the effects of space flight on immune responses.
Kaplan, Barbara L F; Springs, Alison E B; Kaminski, Norbert E
2008-09-15
Cannabidiol (CBD) is a cannabinoid compound derived from Cannabis Sativa that does not possess high affinity for either the CB1 or CB2 cannabinoid receptors. Similar to other cannabinoids, we demonstrated previously that CBD suppressed interleukin-2 (IL-2) production from phorbol ester plus calcium ionophore (PMA/Io)-activated murine splenocytes. Thus, the focus of the present studies was to further characterize the effect of CBD on immune function. CBD also suppressed IL-2 and interferon-gamma (IFN-gamma) mRNA expression, proliferation, and cell surface expression of the IL-2 receptor alpha chain, CD25. While all of these observations support the fact that CBD suppresses T cell function, we now demonstrate that CBD suppressed IL-2 and IFN-gamma production in purified splenic T cells. CBD also suppressed activator protein-1 (AP-1) and nuclear factor of activated T cells (NFAT) transcriptional activity, which are critical regulators of IL-2 and IFN-gamma. Furthermore, CBD suppressed the T cell-dependent anti-sheep red blood cell immunoglobulin M antibody forming cell (anti-sRBC IgM AFC) response. Finally, using splenocytes derived from CB1(-/-)/CB2(-/-) mice, it was determined that suppression of IL-2 and IFN-gamma and suppression of the in vitro anti-sRBC IgM AFC response occurred independently of both CB1 and CB2. However, the magnitude of the immune response to sRBC was significantly depressed in CB1(-/-)/CB2(-/-) mice. Taken together, these data suggest that CBD suppresses T cell function and that CB1 and/or CB2 play a critical role in the magnitude of the in vitro anti-sRBC IgM AFC response.
Berg, Michael G; Adams, Robert J; Gambhira, Ratish; Siracusa, Mark C; Scott, Alan L; Roden, Richard B S; Ketner, Gary
2014-09-01
Immunization with human papillomavirus (HPV) L1 virus-like particles (VLPs) prevents infection with HPV. However, the expense and logistical demands of current VLP vaccines will limit their widespread use in resource-limited settings, where most HPV-induced cervical cancer occurs. Live oral adenovirus vaccines have properties that are well-suited for use in such settings. We have described a live recombinant adenovirus vaccine prototype that produces abundant HPV16 L1 protein from the adenovirus major late transcriptional unit and directs the assembly of HPV16 VLPs in tissue culture. Recombinant-derived VLPs potently elicit neutralizing antibodies in mice. Here, we characterize the immune response to the recombinant after dual oral and intranasal immunization of pigtail macaques, in which the virus replicates as it would in immunized humans. The immunization of macaques induced vigorous humoral responses to adenovirus capsid and nonstructural proteins, although, surprisingly, not against HPV L1. In contrast, immunization elicited strong T-cell responses to HPV VLPs as well as adenovirus virions. T-cell responses arose immediately after the primary immunization and were boosted by a second immunization with recombinant virus. T-cell immunity contributes to protection against a wide variety of pathogens, including many viruses. The induction of a strong cellular response by the recombinant indicates that live adenovirus recombinants have potential as vaccines for those agents. These studies encourage and will inform the continued development of viable recombinant adenovirus vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381
Zhong, Ming-Chao; Veillette, André
2013-03-01
Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (T(FH)) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gambhir, Lokesh; Checker, Rahul; Sharma, Deepak
Withaferin A (WA), a steroidal lactone isolated from ayurvedic medicinal plant Withania somnifera, was shown to inhibit tumor growth by inducing oxidative stress and suppressing NF-κB pathway. However, its effect on T-cell mediated adaptive immune responses and the underlying mechanism has not been investigated. Since both T-cell responses and NF-κB pathway are known to be redox sensitive, the present study was undertaken to elucidate the effect of WA on adaptive immune responses in vitro and in vivo. WA inhibited mitogen induced T-cell and B-cell proliferation in vitro without inducing any cell death. It inhibited upregulation of T-cell (CD25, CD69, CD71more » and CD54) and B-cell (CD80, CD86 and MHC-II) activation markers and secretion of Th1 and Th2 cytokines. WA induced oxidative stress by increasing the basal ROS levels and the immunosuppressive effects of WA were abrogated only by thiol anti-oxidants. The redox modulatory effects of WA in T-cells were attributed to its ability to directly interact with free thiols. WA inhibited NF-κB nuclear translocation in lymphocytes and prevented the direct binding of nuclear NF-κB to its consensus sequence. MALDI-TOF analysis using a synthetic NF-κB-p50 peptide containing Cys-62 residue suggested that WA can modify the cysteine residue of NF-κB. The pharmacokinetic studies for WA were also carried out and in vivo efficacy of WA was studied using mouse model of Graft-versus-host disease. In conclusion, WA is a potent inhibitor of T-cell responses and acts via a novel thiol dependent mechanism and inhibition of NF-κB pathway. - Highlights:: • Withaferin A (WA) inhibited T-cell and B-cell mediated immune responses. • WA increased basal ROS levels in lymphocytes. • WA directly interacted with GSH as studied using spectrophotometry and HPLC. • WA inhibited NF-κB nuclear translocation and binding of nuclear NF-κB to DNA. • WA inhibited induction of the graft-versus-host disease in mice.« less
Muñoz-Carrillo, J L; Contreras-Cordero, J F; Muñoz-López, J L; Maldonado-Tapia, C H; Muñoz-Escobedo, J J; Moreno-García, M A
2017-09-01
In the early stage of the intestinal phase of Trichinella spiralis infection, the host triggers a Th1-type immune response with the aim of eliminating the parasite. However, this response damages the host which favours the survival of the parasite. In the search for novel pharmacological strategies that inhibit the Th1 immune response and assist the host against T. spiralis infection, a recent study showed that resiniferatoxin had anti-inflammatory activity contributed to the host in T. spiralis infection. In this study, we evaluated whether RTX modulates the host immune response through the inhibition of Th1 cytokines in the intestinal phase. In addition, it was determined whether the treatment with RTX affects the infectivity of T. spiralis-L1 and the development of the T. spiralis life cycle. Our results show that RTX decreased serum levels of IL-12, INF-γ, IL-1β, TNF-α and parasite burden on muscle tissue. It was observed that T. spiralis-L1 treated with RTX decreased their infectivity affecting the development of the T. spiralis life cycle in mouse. These results demonstrate that RTX is able to inhibit the production of Th1 cytokines, contributing to the defence against T. spiralis, which places it as a potential drug modulator of the immune response. © 2017 John Wiley & Sons Ltd.
Regulatory T cells and the immune pathogenesis of prenatal infection
Rowe, Jared H.; Ertelt, James M.; Xin, Lijun; Way, Sing Sing
2013-01-01
Pregnancy in placental mammals offers exceptional comprehensive benefits of in utero protection, nutrition, and elimination of metabolic waste for the developing fetus. However, these advantages also require durable strategies to mitigate maternal rejection of fetal tissue expressing foreign paternal antigens. Since the initial postulate of expanded maternal immune tolerance by Sir Peter Medawar 60 years ago, an amazingly elaborate assortment of molecular and cellular modifications acting both locally at the maternal placental interface and systemically have been shown to silence potentially detrimental maternal immune responses. In turn, simultaneously maintaining host defense against the infinite array of potential pathogens during pregnancy is equally important. Fortunately, resistance against most infections is preserved seamlessly throughout gestation. On the other hand, recent studies on pathogens with unique predisposition for prenatal infection have uncovered distinctive holes in host defense associated with the reproductive process. Using these infections to probe the response during pregnancy, the immune suppressive regulatory subset of maternal CD4 T cells has been increasingly shown to dictate the inter-workings between prenatal infection susceptibility and pathogenesis of ensuing pregnancy complications. Herein, the recent literature suggesting a necessity for maternal regulatory T cells in pregnancy induced immunological shifts that sustain fetal tolerance is reviewed. Additional discussion is focused on how expansion of maternal regulatory T cell suppression may become exploited by pathogens that cause prenatal infection, and the perilous potential of infection induced immune activation that may mitigate fetal tolerance and inadvertently inject hostility into the protective in utero environment. PMID:23929902
Role of Innate Immunity in a Model of Histidyl-tRNA Synthetase (Jo-1)-mediated Myositis
Soejima, Makoto; Kang, Eun Ha; Gu, Xinyan; Katsumata, Yasuhiro; Clemens, Paula R.; Ascherman, Dana P.
2010-01-01
Objectives Previous work in humans and in animal models supports a key role for histidyl-tRNA synthetase (HRS=Jo-1) in the pathogenesis of idiopathic inflammatory myopathy. While most investigations have focused on the ability of HRS to trigger adaptive immune responses, in vitro studies clearly indicate that HRS possesses intrinsic chemokine-like properties capable of activating the innate immune system. The purpose of this study was therefore to examine the ability of HRS to direct innate immune responses in a murine model of myositis. Methods Following intramuscular immunization with soluble HRS in the absence of exogenous adjuvant, selected strains of mice were evaluated at different time points for histopathologic evidence of myositis. ELISA-based assessment of autoantibody formation and CFSE proliferation studies provided complementary measures of B and T cell responses triggered by HRS immunization. Results Compared to appropriate control proteins, a murine HRS fusion protein induced robust, statistically significant muscle inflammation in multiple congenic strains of C57BL/6 and NOD mice. Time course experiments revealed that this inflammatory response occurred as early as 7 days post immunization and persisted for up to 7 weeks. Parallel immunization strategies in DO11.10/Rag2−/− and C3H/HeJ (TLR4−/−) mice indicated that the ability of murine HRS to drive muscle inflammation was not dependent on B cell receptor or T cell receptor recognition and did not require TLR4 signaling. Conclusion Collectively, these experiments support a model in which HRS can trigger both innate and adaptive immune responses which culminate in severe muscle inflammation that is the hallmark of idiopathic inflammatory myopathy. PMID:21280002
Pandya, Kalgi D; Palomo-Caturla, Isabel; Walker, Justin A; K Sandilya, Vijay; Zhong, Zhijiu; Alugupalli, Kishore R
2018-06-15
T cell-dependent B cell responses typically develop in germinal centers. Abs generated during such responses are isotype switched and have a high affinity to the Ag because of somatic hypermutation of Ab genes. B cell responses to purified polysaccharides are T cell independent and do not result in the formation of bona fide germinal centers, and the dominant Ab isotype produced during such responses is IgM with very few or no somatic mutations. Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and Ig isotype switching in humans and mice. To test the extent to which unmutated polysaccharide-specific IgM confers protective immunity, we immunized wildtype and AID -/- mice with either heat-killed Salmonella enterica serovar Typhi ( S. Typhi) or purified Vi polysaccharide (ViPS). We found that wildtype and AID -/- mice immunized with heat-killed S. Typhi generated similar anti-ViPS IgM responses. As expected, wildtype, but not AID -/- mice generated ViPS-specific IgG. However, the differences in the Ab-dependent killing of S. Typhi mediated by the classical pathway of complement activation were not statistically significant. In ViPS-immunized wildtype and AID -/- mice, the ViPS-specific IgM levels and S. Typhi bactericidal Ab titers at 7 but not at 28 d postimmunization were also comparable. To test the protective immunity conferred by these immunizations, mice were challenged with a chimeric S. Typhimurium strain expressing ViPS. Compared with their naive counterparts, immunized wildtype and AID -/- mice exhibited significantly reduced bacterial burden regardless of the route of infection. These data indicate that an unmutated IgM response to ViPS contributes to protective immunity to S. Typhi. Copyright © 2018 by The American Association of Immunologists, Inc.
Indoleamine 2,3-dioxygenase specific, cytotoxic T cells as immune regulators.
Sørensen, Rikke Baek; Hadrup, Sine Reker; Svane, Inge Marie; Hjortsø, Mads Christian; Thor Straten, Per; Andersen, Mads Hald
2011-02-17
Indoleamine 2,3-dioxygenase (IDO) is an immunoregulatory enzyme that is implicated in suppressing T-cell immunity in normal and pathologic settings. Here, we describe that spontaneous cytotoxic T-cell reactivity against IDO exists not only in patients with cancer but also in healthy persons. We show that the presence of such IDO-specific CD8(+) T cells boosted T-cell immunity against viral or tumor-associated antigens by eliminating IDO(+) suppressive cells. This had profound effects on the balance between interleukin-17 (IL-17)-producing CD4(+) T cells and regulatory T cells. Furthermore, this caused an increase in the production of the proinflammatory cytokines IL-6 and tumor necrosis factor-α while decreasing the IL-10 production. Finally, the addition of IDO-inducing agents (ie, the TLR9 ligand cytosine-phosphate-guanosine, soluble cytotoxic T lymphocyte-associated antigen 4, or interferon γ) induced IDO-specific T cells among peripheral blood mononuclear cells from patients with cancer as well as healthy donors. In the clinical setting, IDO may serve as an important and widely applicable target for immunotherapeutic strategies in which IDO plays a significant regulatory role. We describe for the first time effector T cells with a general regulatory function that may play a vital role for the mounting or maintaining of an effective adaptive immune response. We suggest terming such effector T cells "supporter T cells."
Tite, J P; Morrison, C A; Taylor, R B
1981-01-01
The photosensitive affinity label NAP (4-azido-2-nitrophenyl) was used to make a stable covalent-bonded monomeric immune complex (Ag2Ab) between rabbit anti-NAP antibody and a bihaptenic compound containing NAP linked to fluorescein (NAP-aminocaproyl-lysyl-Fl). This complex injected into mice had marked effects on their subsequent response to fluorescein coupled to a thymus-independent carrier (Fl-ficoll). Depending on the time at which the complex was administered relative to challenge, it was possible to obtain either enhancing or suppressive effects. The enhancing but not the suppressive effect of complex was dependent on immune recognition of the rabbit IgG carrier. While the suppressive effect probably results from complex-mediated inactivation of T-independent B cells, it is suggested that the enhancing effect results from priming of the T-dependent B cells by Fl-Ficoll followed by their triggering into antibody production by rabbit IgG-specific helper cells. PMID:7007223
Cytomegalovirus infection enhances the immune response to influenza.
Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M
2015-04-01
Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.
Intrahepatic T cell receptor β immune repertoire is essential for liver regeneration.
Liang, Qing; Liu, Zeyuan; Zhu, Chao; Wang, Bin; Liu, Xiaoke; Yang, Yanan; Lv, Xue; Mu, Haiyu; Wang, Kejia
2018-04-27
T lymphocytes synergize with the cellular immune system to promote hepatocyte regeneration. The T cell receptor (TCR) immune repertoire is closely associated with the host immune response and regenerative proliferation. High-throughput sequencing of TCR provides deep insight into monitoring the immune microenvironment. Here, we aimed to determine the role of the TCRβ immune repertoire in liver regeneration. We investigated the hepatic regeneration in TCRβ chain-deficient (Tcrb -/- ) mice by two-thirds partial hepatectomy (PHx) method. Our results demonstrated that Tcrb -/- mice revealed a reduced capacity for liver regeneration, which was characterized by impaired hepatocyte proliferation and enhanced hepatocyte apoptosis. Dysregulation of inflammatory signalling activation and inflammatory factors was observed in regenerated Tcrb -/- livers. Simultaneously, significantly altered immunocyte levels and aberrant cytokine levels were observed during hepatic regeneration. In addition, we first determined the profile of the TCRβ immune repertoire during liver regeneration, indicating that PHx resulted in remarkably lower TCRβ diversity in intrahepatic T lymphocytes. Taken together, our data suggest that TCRβ deficiency gives a rise to aberrant intrahepatic immune microenvironment that impairs liver regeneration, and the TCRβ reconstitution is required for hepatic immunocyte recruitment and activation during liver regeneration. This article is protected by copyright. All rights reserved. © 2018 by the American Association for the Study of Liver Diseases.
Potential Suppressive Effects of Two C60 Fullerene Derivatives on Acquired Immunity
NASA Astrophysics Data System (ADS)
Hirai, Toshiro; Yoshioka, Yasuo; Udaka, Asako; Uemura, Eiichiro; Ohe, Tomoyuki; Aoshima, Hisae; Gao, Jian-Qing; Kokubo, Ken; Oshima, Takumi; Nagano, Kazuya; Higashisaka, Kazuma; Mashino, Tadahiko; Tsutsumi, Yasuo
2016-10-01
The therapeutic effects of fullerene derivatives on many models of inflammatory disease have been demonstrated. The anti-inflammatory mechanisms of these nanoparticles remain to be elucidated, though their beneficial roles in allergy and autoimmune diseases suggest their suppressive potential in acquired immunity. Here, we evaluated the effects of C60 pyrrolidine tris-acid (C60-P) and polyhydroxylated fullerene (C60(OH)36) on the acquired immune response in vitro and in vivo. In vitro, both C60 derivatives had dose-dependent suppressive effects on T cell receptor-mediated activation of T cells and antibody production by B cells under anti-CD40/IL-4 stimulation, similar to the actions of the antioxidant N-acetylcysteine. In addition, C60-P suppressed ovalbumin-specific antibody production and ovalbumin-specific T cell responses in vivo, although T cell-independent antibodies responses were not affected by C60-P. Together, our data suggest that fullerene derivatives can suppress acquired immune responses that require T cells.
Genotype-Specific Regulation of Oral Innate Immunity by T2R38 Taste Receptor
Gil, Sucheol; Coldwell, Susan; Drury, Jeanie L.; Arroyo, Fabiola; Phi, Tran; Saadat, Sanaz; Kwong, Danny; Chung, Whasun Oh
2015-01-01
The bitter taste receptor T2R38 has been shown to regulate mucosal innate immune responses in the upper airway epithelium. Furthermore, SNPs in T2R38 influence the sensitivity to 6-n-propylthiouracil (PROP) and are associated with caries risk/protection. However, no study has been reported on the role of T2R38 in the innate immune responses to oral bacteria. We hypothesize that T2R38 regulates oral innate immunity and that this regulation is genotype-specific. Primary gingival epithelial cells carrying three common genotypes, PAV/PAV (PROP super-taster), AVI/PAV (intermediate) and AVI/AVI (non-taster) were stimulated with cariogenic bacteria Streptococcus mutans, periodontal pathogen Porphyromonas gingivalis or non-pathogen Fusobacterium nucleatum. QRT-PCR analyzed T2R38 mRNA, and T2R38-specific siRNA and ELISA were utilized to evaluate induction of hBD-2 (antimicrobial peptide), IL-1α and IL-8 in various donor-lines. Experiments were set up in duplicate and repeated three times. T2R38 mRNA induction in response to S. mutans was highest in PAV/PAV (4.3-fold above the unstimulated controls; p<0.05), while lowest in AVI/AVI (1.2-fold). In PAV/PAV, hBD-2 secretion in response to S. mutans was decreased by 77% when T2R38 was silenced. IL-1α secretion was higher in PAV/PAV compared to AVI/PAV or AVI/AVI with S. mutans stimulation, but it was reduced by half when T2R38 was silenced (p<0.05). In response to P. gingivalis, AVI/AVI showed 4.4-fold increase (p<0.05) in T2R38 expression, whereas the levels in PAV/PAV and AVI/PAV remained close to that of the controls. Secretion levels of IL-1α and IL-8 decreased in AVI/AVI in response to P. gingivalis when T2R38 was silenced (p<0.05), while the changes were not significant in PAV/PAV. Our data suggest that the regulation of gingival innate immunity by T2R38 is genotype-dependent and that the ability to induce a high level of hBD-2 by PAV/PAV carriers may be a reason for protection against caries in this group. PMID
Dendritic Cells: A Double-Edged Sword in Immune Responses during Chagas Disease
Gil-Jaramillo, Natalia; Motta, Flávia N.; Favali, Cecília B. F.; Bastos, Izabela M. D.; Santana, Jaime M.
2016-01-01
Dendritic cells (DCs) are the most important member of the antigen presenting cells group due to their ability to recognize antigen at the infection site and their high specialized antigen internalization capacity. These cells have central role in connecting the innate and adaptive immune responses against Trypanosoma cruzi, the causative agent of Chagas disease. These first line defense cells modulate host immune response depending on type, maturation level, cytokine milieu and DC receptor involved in the interactions with T. cruzi, influencing the development of the disease clinic forms. Here, we present a review of DCs–T. cruzi interactions both in human and murine models, pointing out the parasite ability to manipulate DCs activity for the purpose of evading innate immune response and assuring its own survival and persistence. PMID:27471496
Perillyl alcohol suppresses antigen-induced immune responses in the lung
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide
Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less
da Silva, Tatiana Pereira; Giacoia-Gripp, Carmem Beatriz Wagner; Schmaltz, Carolina A; Sant'Anna, Flavia Marinho; Saad, Maria Helena; Matos, Juliana Arruda de; de Lima E Silva, Julio Castro Alves; Rolla, Valeria Cavalcanti; Morgado, Mariza Gonçalves
2017-09-06
Little is known regarding the restoration of the specific immune response after combined antiretroviral therapy (cART) and anti-tuberculosis (TB) therapy introduction among TB-HIV patients. In this study, we examined the immune response of TB-HIV patients to Mycobacterium tuberculosis (Mtb) antigens to evaluate the response dynamics to different antigens over time. Moreover, we also evaluated the influence of two different doses of efavirenz and the factors associated with immune reconstitution. This is a longitudinal study nested in a clinical trial, where cART was initiated during the baseline visit (D0), which occurred 30 ± 10 days after the introduction of anti-TB therapy. Follow-up visits were performed at 30, 60, 90 and 180 days after cART initiation. The production of IFN-γ upon in vitro stimulation with Mtb antigens purified protein derivative (PPD), ESAT-6 and 38 kDa/CFP-10 using ELISpot was examined at baseline and follow-up visits. Sixty-one patients, all ART-naïve, were selected and included in the immune reconstitution analysis; seven (11.5%) developed Immune Reconstitution Inflammatory Syndrome (IRIS). The Mtb specific immune response was higher for the PPD antigen followed by 38 kDa/CFP-10 and increased in the first 60 days after cART initiation. In multivariate analysis, the variables independently associated with increased IFN-γ production in response to PPD antigen were CD4 + T cell counts <200 cells/mm 3 at baseline, age, site of tuberculosis, 800 mg efavirenz dose and follow-up CD4 + T cell counts. Moreover, the factors associated with the production of IFN-γ in response to 38 kDa/CFP-10 were detectable HIV viral load (VL) and CD4 + T cell counts at follow-up visits of ≥200 cells/mm 3 . These findings highlight the differences in immune response according to the specificity of the Mtb antigen, which contributes to a better understanding of TB-HIV immunopathogenesis. IFN-γ production elicited by PPD and 38 kDa/CFP-10 antigens
Multi-scale modeling of the CD8 immune response
NASA Astrophysics Data System (ADS)
Barbarroux, Loic; Michel, Philippe; Adimy, Mostafa; Crauste, Fabien
2016-06-01
During the primary CD8 T-Cell immune response to an intracellular pathogen, CD8 T-Cells undergo exponential proliferation and continuous differentiation, acquiring cytotoxic capabilities to address the infection and memorize the corresponding antigen. After cleaning the organism, the only CD8 T-Cells left are antigen-specific memory cells whose role is to respond stronger and faster in case they are presented this very same antigen again. That is how vaccines work: a small quantity of a weakened pathogen is introduced in the organism to trigger the primary response, generating corresponding memory cells in the process, giving the organism a way to defend himself in case it encounters the same pathogen again. To investigate this process, we propose a non linear, multi-scale mathematical model of the CD8 T-Cells immune response due to vaccination using a maturity structured partial differential equation. At the intracellular scale, the level of expression of key proteins is modeled by a delay differential equation system, which gives the speeds of maturation for each cell. The population of cells is modeled by a maturity structured equation whose speeds are given by the intracellular model. We focus here on building the model, as well as its asymptotic study. Finally, we display numerical simulations showing the model can reproduce the biological dynamics of the cell population for both the primary response and the secondary responses.
Current understanding of HIV-1 and T-cell adaptive immunity: progress to date.
Mohan, Teena; Bhatnagar, Santwana; Gupta, Dablu L; Rao, D N
2014-08-01
The cellular immune response to human immunodeficiency virus (HIV) has different components originating from both the adaptive and innate immune systems. HIV cleverly utilizes the host machinery to survive by its intricate nature of interaction with the host immune system. HIV evades the host immune system at innate ad adaptive, allows the pathogen to replicate and transmit from one host to another. Researchers have shown that HIV has multipronged effects especially on the adaptive immunity, with CD4(+) cells being the worst effect T-cell populations. Various analyses have revealed that, the exposure to HIV results in clonal expansion and excessive activation of the immune system. Also, an abnormal process of differentiation has been observed suggestive of an alteration and blocks in the maturation of various T-cell subsets. Additionally, HIV has shown to accelerate immunosenescence and exhaustion of the overtly activated T-cells. Apart from causing phenotypic changes, HIV has adverse effects on the functional aspect of the immune system, with evidences implicating it in the loss of the capacity of T-cells to secrete various antiviral cytokines and chemokines. However, there continues to be many aspects of the immune- pathogenesis of HIV that are still unknown and thus required further research in order to convert the malaise of HIV into a manageable epidemic. Copyright © 2014 Elsevier Ltd. All rights reserved.
Moody, J L; Jirik, F R
2004-01-01
Tight regulation of the phosphatidylinositiol 3-kinase (PI3K) pathway is essential not only for normal immune system development and responsiveness, but also in the prevention of immunopathology. Indeed, unchecked activation of the PI3K pathway in T cells induces lymphoproliferation and systemic autoimmunity. Evaluating the importance of threshold levels of two key PI3K pathway phosphoinositol phosphatases, we previously reported that mice heterozygous for both Pten and SHIP develop a more rapid progression of a lymphoproliferative autoimmune syndrome than do Pten+\\− mice. Investigating the basis for this difference, we now describe a quantitative and qualitative difference in the antibody responses of C57BL\\6 Pten+\\− SHIP+\\− mice upon challenge with a T-dependent antigen. Suspecting that this phenotypic difference might be the result, at least in part, of a T-helper cell defect, an in vitro analysis of anti-CD3/interleukin (IL)-2-expanded CD4+ T cells was performed. After stimulation with anti-CD3, cells from mice heterozygous for both Pten and SHIP exhibited a striking increase in IL-4 secretion (> 10-fold), without a corresponding increase in T helper 2 (Th2) cell numbers being evident by intracellular staining for this cytokine. Modest increases were also seen for both IL-13 and IFN-γ. Perhaps in keeping with this abnormal in vitro cytokine profile, IgG1 serum levels were significantly elevated in young C57BL\\6 Pten+\\− SHIP+\\− mice. Thus, the relative levels of Pten and SHIP appear to be key variables in CD4+ T-cell function, primarily via their ability to regulate IL-4 production. PMID:15196208
Heal, K G; Sheikh, N A; Hollingdale, M R; Morrow, W J; Taylor-Robinson, A W
2001-07-20
We have recently demonstrated that the novel glycoalkaloid tomatine, derived from leaves of the wild tomato Lycopersicon pimpinellifolium, can act as a powerful adjuvant for the elicitation of antigen-specific CD8+ T cell responses. Here, we have extended our previous investigation with the model antigen ovalbumin to an established malaria infection system in mice and evaluated the cellular immune response to a major preerythrocytic stage malaria vaccine candidate antigen when administered with tomatine. The defined MHC H-2kd class I-binding 9-mer peptide (amino acids 252-260) from Plasmodium berghei circumsporozoite (CS) protein was prepared with tomatine to form a molecular aggregate formulation and this used to immunise BALB/c (H-2kd) mice. Antigen-specific IFN-gamma secretion and cytotoxic T lymphocyte activity in vitro were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunised control mice. Moreover, when challenged with P. berghei sporozoites, mice immunised with the CS 9-mer-tomatine preparation had a significantly delayed onset of erythrocytic infection compared to controls. The data presented validate the use of tomatine to potentiate a cellular immune response to antigenic stimulus by testing in an important biologically relevant system. Specifically, the processing of the P. berghei CS 9-mer as an exogenous antigen and its presentation via MHC class I molecules to CD8+ T cells led to an immune response that is an in vitro correlate of protection against preerythrocytic malaria. This was confirmed by the protective capacity of the 9-mer-tomatine combination upon in vivo immunisation. These findings merit further work to optimise the use of tomatine as an adjuvant in malaria vaccine development.
Persistence and Adaptation in Immunity: T Cells Balance the Extent and Thoroughness of Search
Fricke, G. Matthew; Letendre, Kenneth A.; Moses, Melanie E.; Cannon, Judy L.
2016-01-01
Effective search strategies have evolved in many biological systems, including the immune system. T cells are key effectors of the immune response, required for clearance of pathogenic infection. T cell activation requires that T cells encounter antigen-bearing dendritic cells within lymph nodes, thus, T cell search patterns within lymph nodes may be a crucial determinant of how quickly a T cell immune response can be initiated. Previous work suggests that T cell motion in the lymph node is similar to a Brownian random walk, however, no detailed analysis has definitively shown whether T cell movement is consistent with Brownian motion. Here, we provide a precise description of T cell motility in lymph nodes and a computational model that demonstrates how motility impacts T cell search efficiency. We find that both Brownian and Lévy walks fail to capture the complexity of T cell motion. Instead, T cell movement is better described as a correlated random walk with a heavy-tailed distribution of step lengths. Using computer simulations, we identify three distinct factors that contribute to increasing T cell search efficiency: 1) a lognormal distribution of step lengths, 2) motion that is directionally persistent over short time scales, and 3) heterogeneity in movement patterns. Furthermore, we show that T cells move differently in specific frequently visited locations that we call “hotspots” within lymph nodes, suggesting that T cells change their movement in response to the lymph node environment. Our results show that like foraging animals, T cells adapt to environmental cues, suggesting that adaption is a fundamental feature of biological search. PMID:26990103
Sedegah, Martha; Hollingdale, Michael R.; Farooq, Fouzia; Ganeshan, Harini; Belmonte, Maria; Kim, Yohan; Peters, Bjoern; Sette, Alessandro; Huang, Jun; McGrath, Shannon; Abot, Esteban; Limbach, Keith; Shi, Meng; Soisson, Lorraine; Diggs, Carter; Chuang, Ilin; Tamminga, Cindy; Epstein, Judith E.; Villasante, Eileen; Richie, Thomas L.
2014-01-01
Background Fifteen volunteers were immunized with three doses of plasmid DNA encoding P. falciparum circumsporozoite protein (CSP) and apical membrane antigen-1 (AMA1) and boosted with human adenovirus-5 (Ad) expressing the same antigens (DNA/Ad). Four volunteers (27%) demonstrated sterile immunity to controlled human malaria infection and, overall, protection was statistically significantly associated with ELISpot and CD8+ T cell IFN-γ activities to AMA1 but not CSP. DNA priming was required for protection, as 18 additional subjects immunized with Ad alone (AdCA) did not develop sterile protection. Methodology/Principal Findings We sought to identify correlates of protection, recognizing that DNA-priming may induce different responses than AdCA alone. Among protected volunteers, two and three had higher ELISpot and CD8+ T cell IFN-γ responses to CSP and AMA1, respectively, than non-protected volunteers. Unexpectedly, non-protected volunteers in the AdCA trial showed ELISpot and CD8+ T cell IFN-γ responses to AMA1 equal to or higher than the protected volunteers. T cell functionality assessed by intracellular cytokine staining for IFN-γ, TNF-α and IL-2 likewise did not distinguish protected from non-protected volunteers across both trials. However, three of the four protected volunteers showed higher effector to central memory CD8+ T cell ratios to AMA1, and one of these to CSP, than non-protected volunteers for both antigens. These responses were focused on discrete regions of CSP and AMA1. Class I epitopes restricted by A*03 or B*58 supertypes within these regions of AMA1 strongly recalled responses in three of four protected volunteers. We hypothesize that vaccine-induced effector memory CD8+ T cells recognizing a single class I epitope can confer sterile immunity to P. falciparum in humans. Conclusions/Significance We suggest that better understanding of which epitopes within malaria antigens can confer sterile immunity and design of vaccine approaches
B-Cell and T-Cell Immune Responses to Experimental Helicobacter pylori Infection in Humans
Nurgalieva, Zhannat Z.; Conner, Margaret E.; Opekun, Antone R.; Zheng, Carl Q.; Elliott, Susan N.; Ernst, Peter B.; Osato, Michael; Estes, Mary K.; Graham, David Y.
2005-01-01
The acute antibody and T-cell immune response to Helicobacter pylori infection in humans has not been studied systematically. Serum from H. pylori-naive volunteers challenged with H. pylori and cured after 4 or 12 weeks was tested by enzyme-linked immunosorbent assays for anti-H. pylori-specific immunoglobulin M (IgM) and IgA established using bacterial lysates from homologous (the infecting strain) and heterologous H. pylori. Proteins recognized by IgM antibody were identified by mass spectrometry of immunoreactive bands separated by two-dimensional gel electrophoresis. Mucosal T-cell subsets (CD4, CD8, CD3, and CD30 cells) were assessed by immunohistochemistry. All 18 infected volunteers developed H. pylori-specific IgM responses to both homologous or heterologous H. pylori antigens. H. pylori antigens reacted with IgM antibody at 4 weeks postinfection. IgM Western blotting showed immunoreactivity of postinfection serum samples to multiple H. pylori proteins with molecular weights ranging between 9,000 (9K) to 150K with homologous strains but only a 70K band using heterologous antigens. Two-dimensional electrophoresis demonstrated that production of H. pylori-specific IgM antibodies was elicited by H. pylori flagellins A and B, urease B, ABC transporter binding protein, heat shock protein 70 (DnaK), and alkyl hydroperoxide reductase. Mucosal CD3, CD4, and CD8 T-cell numbers increased following infection. IgM antibody responses were detected to a range of homologous H. pylori antigens 2 to 4 weeks postchallenge. The majority of H. pylori proteins were those involved in motility and colonization and may represent targets for vaccine development. PMID:15845507
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Yufeng; Zhang, Xueshu; Zhao, Tuo
Highlights: •CD8{sup +}25{sup +} regulatory T cells secrete tolerogenic exosomes. •CD8{sup +}25{sup +} regulatory T cell-derived exosomes exhibit immunosuppressive effect. •CD8{sup +}25{sup +} regulatory T cell-derived exosomes inhibit antitumor immunity. -- Abstract: Natural CD4{sup +}25{sup +} and CD8{sup +}25{sup +} regulatory T (Tr) cells have been shown to inhibit autoimmune diseases. Immune cells secrete exosomes (EXOs), which are crucial for immune regulation. However, immunomodulatory effect of natural Tr cell-secreted EXOs is unknown. In this study, we purified natural CD8{sup +}25{sup +} Tr cells from C57BL/6 mouse naive CD8{sup +} T cells, and in vitro amplified them with CD3/CD28 beads. EXOsmore » (EXO{sub Tr}) were purified from Tr cell’s culture supernatants by differential ultracentrifugation and analyzed by electron microscopy, Western blot and flow cytometry. Our data showed that EXO{sub Tr} had a “saucer” or round shape with 50–100 nm in diameter, contained EXO-associated markers LAMP-1 and CD9, and expressed natural Tr cell markers CD25 and GITR. To assess immunomodulatory effect, we i.v. immunized C57BL/6 mice with ovalbumin (OVA)-pulsed DCs (DC{sub OVA}) plus Tr cells or EXO{sub Tr}, and then assessed OVA-specific CD8{sup +} T cell responses using PE-H-2K{sup b}/OVA tetramer and FITC-anti-CD8 antibody staining by flow cytometry and antitumor immunity in immunized mice with challenge of OVA-expressing BL6–10{sub OVA} melanoma cells. We demonstrated that DC{sub OVA}-stimulated CD8{sup +} T cell responses and protective antitumor immunity significantly dropped from 2.52% to 1.08% and 1.81% (p < 0.05), and from 8/8 to 2/8 and 5/8 mice DC{sub OVA} (p < 0.05) in immunized mice with co-injection of Tr cells and EXO{sub Tr}, respectively. Our results indicate that natural CD8{sup +}25{sup +} Tr cell-released EXOs, alike CD8{sup +}25{sup +} Tr cells, can inhibit CD8{sup +} T cell responses and antitumor immunity. Therefore, EXOs
Independently evolved virulence effectors converge onto hubs in a plant immune system network.
Mukhtar, M Shahid; Carvunis, Anne-Ruxandra; Dreze, Matija; Epple, Petra; Steinbrenner, Jens; Moore, Jonathan; Tasan, Murat; Galli, Mary; Hao, Tong; Nishimura, Marc T; Pevzner, Samuel J; Donovan, Susan E; Ghamsari, Lila; Santhanam, Balaji; Romero, Viviana; Poulin, Matthew M; Gebreab, Fana; Gutierrez, Bryan J; Tam, Stanley; Monachello, Dario; Boxem, Mike; Harbort, Christopher J; McDonald, Nathan; Gai, Lantian; Chen, Huaming; He, Yijian; Vandenhaute, Jean; Roth, Frederick P; Hill, David E; Ecker, Joseph R; Vidal, Marc; Beynon, Jim; Braun, Pascal; Dangl, Jeffery L
2011-07-29
Plants generate effective responses to infection by recognizing both conserved and variable pathogen-encoded molecules. Pathogens deploy virulence effector proteins into host cells, where they interact physically with host proteins to modulate defense. We generated an interaction network of plant-pathogen effectors from two pathogens spanning the eukaryote-eubacteria divergence, three classes of Arabidopsis immune system proteins, and ~8000 other Arabidopsis proteins. We noted convergence of effectors onto highly interconnected host proteins and indirect, rather than direct, connections between effectors and plant immune receptors. We demonstrated plant immune system functions for 15 of 17 tested host proteins that interact with effectors from both pathogens. Thus, pathogens from different kingdoms deploy independently evolved virulence proteins that interact with a limited set of highly connected cellular hubs to facilitate their diverse life-cycle strategies.
2013-01-01
Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (TFH) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway. PMID:23319045
Sex-dependent genetic effects on immune responses to a parasitic nematode.
Hayes, Kelly S; Hager, Reinmar; Grencis, Richard K
2014-03-14
Many disease aetiologies have sex specific effects, which have important implications for disease management. It is now becoming increasingly evident that such effects are the result of the differential expression of autosomal genes rather than sex-specific genes. Such sex-specific variation in the response to Trichuris muris, a murine parasitic nematode infection and model for the human parasitic nematode T. trichiura, has been well documented, however, the underlying genetic causes of these differences have been largely neglected. We used the BXD mouse set of recombinant inbred strains to identify sex-specific loci that contribute to immune phenotypes in T. muris infection. Response phenotypes to T. muris infection were found to be highly variable between different lines of BXD mice. A significant QTL on chromosome 5 (TM5) associated with IFN-γ production was found in male mice but not in female mice. This QTL was in the same location as a suggestive QTL for TNF-α and IL-6 production in male mice suggesting a common control of these pro-inflammatory cytokines. A second QTL was identified on chromosome 4 (TM4) affecting worm burden in both male and female cohorts. We have identified several genes as potential candidates for modifying responses to T. muris infection. We have used the largest mammalian genetic model system, the BXD mouse population, to identify candidate genes with sex-specific effects in immune responses to T. muris infection. Some of these genes may be differentially expressed in male and female mice leading to the difference in immune response between the sexes reported in previous studies. Our study further highlights the importance of considering sex as an important factor in investigations of immune response at the genome-wide level, in particular the bias that can be introduced when generalizing results obtained from only one sex or a mixed sex population. Rather, analyses of interaction effects between sex and genotype should be part of
EVOLUTION OF THE IMMUNE RESPONSE
Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.
1964-01-01
1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that
CTLA-4 blockade plus adoptive T cell transfer promotes optimal melanoma immunity in mice
Mahvi, David A.; Meyers, Justin V.; Tatar, Andrew J.; Contreras, Amanda; Suresh, M.; Leverson, Glen E.; Sen, Siddhartha; Cho, Clifford S.
2014-01-01
Immunotherapeutic approaches to the treatment of advanced melanoma have relied on strategies that augment the responsiveness of endogenous tumor-specific T cell populations (e.g., CTLA-4 blockade-mediated checkpoint inhibition) or introduce exogenously-prepared tumor-specific T cell populations (e.g., adoptive cell transfer). Although both approaches have shown considerable promise, response rates to these therapies remain suboptimal. We hypothesized that a combinatorial approach to immunotherapy using both CTLA-4 blockade and non-lymphodepletional adoptive cell transfer could offer additive therapeutic benefit. C57BL/6 mice were inoculated with syngeneic B16F10 melanoma tumors transfected to express low levels of the lymphocytic choriomeningitis virus peptide GP33 (B16GP33), and treated with no immunotherapy, CTLA-4 blockade, adoptive cell transfer, or combination immunotherapy of CTLA-4 blockade with adoptive cell transfer. Combination immunotherapy resulted in optimal control of B16GP33 melanoma tumors. Combination immunotherapy promoted a stronger local immune response reflected by enhanced tumor-infiltrating lymphocyte populations, as well as a stronger systemic immune responses reflected by more potent tumor antigen-specific T cell activity in splenocytes. In addition, whereas both CTLA-4 blockade and combination immunotherapy were able to promote long-term immunity against B16GP33 tumors, only combination immunotherapy was capable of promoting immunity against parental B16F10 tumors as well. Our findings suggest that a combinatorial approach using CTLA-4 blockade with non-lymphodepletional adoptive cell transfer may promote additive endogenous and exogenous T cell activities that enable greater therapeutic efficacy in the treatment of melanoma. PMID:25658614
The new numerology of immunity mediated by virus-specific CD8(+) T cells.
Doherty, P C
1998-08-01
Our understanding of virus-specific CD8(+) T cell responses is currently being revolutionized by peptide-based assay systems that allow flow cytometric analysis of effector and memory cytotoxic T lymphocyte populations. These techniques are, for the first time, putting the analysis of T-cell-mediated immunity on a quantitative basis.
Characterization of an adaptive immune response in microsatellite-instable colorectal cancer
Boissière-Michot, Florence; Lazennec, Gwendal; Frugier, Hélène; Jarlier, Marta; Roca, Lise; Duffour, Jacqueline; Du Paty, Emilie; Laune, Daniel; Blanchard, France; Le Pessot, Florence; Sabourin, Jean-Christophe; Bibeau, Frédéric
2014-01-01
Sporadic or hereditary colorectal cancer (CRC) with microsatellite instability (MSI) is frequently characterized by inflammatory lymphocytic infiltration and tends to be associated with a better outcome than microsatellite stable (MSS) CRC, probably reflecting a more effective immune response. We investigated inflammatory mechanisms in 48 MSI CRCs and 62 MSS CRCs by analyzing: (1) the expression of 48 cytokines using Bio-Plex multiplex cytokine assays, and (2) the in situ immune response by immunohistochemical analysis with antibodies against CD3 (T lymphocytes), CD8 (cytotoxic T lymphocytes), CD45RO (memory T lymphocytes), T-bet (Th1 CD4 cells), and FoxP3 (regulatory T cells). MSI CRC exhibited significantly higher expression of CCL5 (RANTES), CXCL8 (IL-8), CXCL9 (MIG), IL-1β, CXCL10 (IP-10), IL-16, CXCL1 (GROα), and IL-1ra, and lower expression of MIF, compared with MSS CRC. Immunohistochemistry combined with image analysis indicated that the density of CD3+, CD8+, CD45RO+, and T-bet+ T lymphocytes was higher in MSI CRC than in MSS CRC, whereas the number of regulatory T cells (FoxP3+) was not statistically different between the groups. These results indicate that MSI CRC is associated with a specific cytokine expression profile that includes CCL5, CXCL10, and CXCL9, which are involved in the T helper type 1 (Th1) response and in the recruitment of memory CD45RO+ T cells. Our findings highlight the major role of adaptive immunity in MSI CRC and provide a possible explanation for the more favorable prognosis of this CRC subtype. PMID:25101223
Morrison, W I
2007-08-19
The evolution of antigenically distinct pathogen strains that fail to cross-protect is well documented for pathogens controlled primarily by humoral immune responses. Unlike antibodies, which recognise native proteins, protective T cells can potentially recognise epitopes in a variety of proteins that are not necessarily displayed on the pathogen surface. Moreover, individual hosts of different MHC genotypes generally respond to different sets of epitopes. It is therefore less easy to envisage how strain restricted immunity can arise for pathogens controlled by T cell responses, particularly in antigenically complex parasites. Nevertheless, strain restricted immunity is clearly a feature of a number of parasitic infections, where immunity is known to be mediated by T cell responses. One such parasite is Theileria parva which induces potent CD8 T cell responses that play an important role in immunity. CD8 T cells specific for parasitized lymphoblasts exhibit strain specificity, which appears to correlate with the ability of parasite strains to cross-protect. Studies using recently identified T. parva antigens recognised by CD8 T cells have shown that the strain restricted nature of immunity is a consequence of the CD8 T cell response in individual animals being focused on a limited number of dominant polymorphic antigenic determinants. Responses in animals of different MHC genotypes are often directed to different parasite antigens, indicating that, at the host population level, a larger number of parasite proteins can serve as targets for the protective T cell response. Nevertheless, the finding that parasite strains show overlapping antigenic profiles, probably as a consequence of sexual recombination, suggests that induction of responses to an extended but limited set of antigens in individual animals may overcome the strain restricted nature of immunity.
Ubiquitin enzymes in the regulation of immune responses.
Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo
2017-08-01
Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.
Chachu, Karen A.; LoBue, Anna D.; Strong, David W.; Baric, Ralph S.; Virgin, Herbert W.
2008-01-01
Two cardinal manifestations of viral immunity are efficient clearance of acute infection and the capacity to vaccinate against secondary viral exposure. For noroviruses, the contributions of T cells to viral clearance and vaccination have not been elucidated. We report here that both CD4 and CD8 T cells are required for efficient clearance of primary murine norovirus (MNV) infection from the intestine and intestinal lymph nodes. Further, long-lasting protective immunity was generated by oral live virus vaccination. Systemic vaccination with the MNV capsid protein also effectively protected against mucosal challenge, while vaccination with the capsid protein of the distantly related human Lordsdale virus provided partial protection. Fully effective vaccination required a broad immune response including CD4 T cells, CD8 T cells, and B cells, but the importance of specific immune cell types varied between the intestine and intestinal lymph nodes. Perforin, but not interferon gamma, was required for clearance of MNV infection by adoptively transferred T lymphocytes from vaccinated hosts. These studies prove the feasibility of both mucosal and systemic vaccination against mucosal norovirus infection, demonstrate tissue specificity of norovirus immune cells, and indicate that efficient vaccination strategies should induce potent CD4 and CD8 T cell responses. PMID:19079577
Fasting suppresses T cell-mediated immunity in female Mongolian gerbils (Meriones unguiculatus).
Xu, De-Li; Wang, De-Hua
2010-01-01
Immune defense is important for organisms' survival and fitness. Small mammals in temperate zone often face seasonal food shortages. Generally fasting can suppress immune function in laboratory rodents and little information is available for wild rodents. The present study tested the hypothesis that Mongolian gerbils (Meriones unguiculatus) could inhibit T cell-mediated immunity to adapt to acute fasting. Forty-two females were divided into the fed and fasted groups, in which the latter was deprived of food for 3days. After 66h fasting, half of the gerbils in each group were injected with phosphate buffered saline or phytohaemagglutinin (PHA) solution. T cell-mediated immunity assessed by PHA response was suppressed in the fasted gerbils compared with the fed gerbils. The fasted gerbils had lower body fat mass, wet and dry thymus mass, dry spleen mass, white blood cells, serum leptin and blood glucose concentrations, but higher corticosterone concentrations than those of the controls. Moreover, PHA response was positively correlated with body fat mass and serum leptin levels in the immunochallenged groups. Taken together, acute fasting leads to immunosuppression, which might be caused by low body fat mass and low serum leptin concentrations in female Mongolian gerbils.
Immune Responses to HIV and SIV in Mucosal Tissues: “Location, Location, Location”
Shacklett, Barbara L.
2010-01-01
Purpose of review This review summarizes research literature regarding mucosal immunity to HIV and SIV, with an emphasis on work published within the past 18 months. Recent findings Notable recent studies have focused on the pivotal events occurring within mucosal tissues during acute HIV/SIV infection that serve to establish a balance between detrimental immune activation and beneficial adaptive responses. In cervicovaginal mucosa, an early inflammatory response leads to recruitment of susceptible target cells. At this acute stage, the in vivo ratio between CD8+ effector cells and infected CD4+ T-cells may be critical for limiting viral dissemination. Acute infection is also accompanied by loss of germinal center architecture and T/B cell apoptosis in Peyer’s patches of the gastrointestinal tract. During chronic infection, mucosal CD8+ T-cells may play a role in immune control, as suggested by studies of elite controllers. Summary Mucosal tissues serve as the major portal of entry for HIV, and house a majority of the body’s lymphocytes, including CD4+ T-cells that are targets for infection. Recent studies have focused renewed attention on events occurring immediately after transmission, and underscore the concept that the balance between inflammation and protective immunity is established by host responses in mucosal tissues. PMID:20543589
Pathogenesis of graft-versus-host disease: innate immunity amplifying acute alloimmune responses.
Maeda, Yoshinobu
2013-09-01
In addition to reduced-intensity conditioning, which has expanded the eligibility for hematopoietic cell transplantation (HCT) to older patients, increased availability of alternative donors, including HLA-mismatched unrelated donors, has increased access to allogeneic HCT for more patients. However, acute graft-versus-host disease (GVHD) remains a lethal complication, even in HLA-matched donor-recipient pairs. The pathophysiology of GVHD depends on aspects of adaptive immunity and interactions between donor T-cells and host dendritic cells (DCs). Recent work has revealed that the role of other immune cells and endothelial cells and components of the innate immune response are also important. Tissue damage caused by the conditioning regimen leads to the release of exogenous and endogenous "danger signals". Exogenous danger signals called pathogen-associated molecular patterns and endogenous noninfectious molecules known as damage-associated molecular patterns (DAMPs) are responsible for initiating or amplifying acute GVHD by enhancing DC maturation and alloreactive T-cell responses. A significant association of innate immune receptor polymorphisms with outcomes, including GVHD severity, was observed in patients receiving allogeneic HCT. Understanding of the role of innate immunity in acute GVHD might offer new therapeutic approaches.
Hernández Del Pino, Rodrigo E.; Pellegrini, Joaquín M.; Rovetta, Ana I.; Peña, Delfina; Álvarez, Guadalupe I.; Rolandelli, Agustín; Musella, Rosa M.; Palmero, Domingo J.; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E.
2017-01-01
Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T and B cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype. PMID:28546549
Hernández Del Pino, Rodrigo E; Pellegrini, Joaquín M; Rovetta, Ana I; Peña, Delfina; Álvarez, Guadalupe I; Rolandelli, Agustín; Musella, Rosa M; Palmero, Domingo J; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E
2017-09-01
Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T- and B-cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25 high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T-cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype.
Deppisch, Nina; Ruf, Peter; Eißler, Nina; Lindhofer, Horst; Mocikat, Ralph
2017-01-01
Combinatorial approaches of immunotherapy hold great promise for the treatment of malignant disease. Here, we examined the potential of combining an immune checkpoint inhibitor and trifunctional bispecific antibodies (trAbs) in a preclinical melanoma mouse model using surrogate antibodies of Ipilimumab and Catumaxomab, both of which have already been approved for clinical use. The specific binding arms of trAbs redirect T cells to tumor cells and trigger direct cytotoxicity, while the Fc region activates accessory cells eventually giving rise to a long-lasting immunologic memory. We show here that T cells redirected to tumor cells by trAbs strongly upregulate CTLA-4 expression in vitro and in vivo. This suggested that blocking of CTLA-4 in combination with trAb treatment enhances T-cell activation in a tumor-selective manner. However, when mice were challenged with melanoma cells and subsequently treated with antibodies, there was only a moderate beneficial effect of the combinatorial approach in vivo with regard to direct tumor destruction in comparison to trAb therapy alone. By contrast, a significantly improved vaccination effect was obtained by CTLA-4 blocking during trAb-dependent immunization. This resulted in enhanced rejection of melanoma cells given after pre-immunization. The improved immunologic memory induced by the combinatorial approach correlated with an increased humoral antitumor response as measured in the sera and an expansion of CD4+ memory T cells found in the spleens. PMID:27966460
Deppisch, Nina; Ruf, Peter; Eißler, Nina; Lindhofer, Horst; Mocikat, Ralph
2017-01-17
Combinatorial approaches of immunotherapy hold great promise for the treatment of malignant disease. Here, we examined the potential of combining an immune checkpoint inhibitor and trifunctional bispecific antibodies (trAbs) in a preclinical melanoma mouse model using surrogate antibodies of Ipilimumab and Catumaxomab, both of which have already been approved for clinical use. The specific binding arms of trAbs redirect T cells to tumor cells and trigger direct cytotoxicity, while the Fc region activates accessory cells eventually giving rise to a long-lasting immunologic memory. We show here that T cells redirected to tumor cells by trAbs strongly upregulate CTLA-4 expression in vitro and in vivo. This suggested that blocking of CTLA-4 in combination with trAb treatment enhances T-cell activation in a tumor-selective manner. However, when mice were challenged with melanoma cells and subsequently treated with antibodies, there was only a moderate beneficial effect of the combinatorial approach in vivo with regard to direct tumor destruction in comparison to trAb therapy alone. By contrast, a significantly improved vaccination effect was obtained by CTLA-4 blocking during trAb-dependent immunization. This resulted in enhanced rejection of melanoma cells given after pre-immunization. The improved immunologic memory induced by the combinatorial approach correlated with an increased humoral antitumor response as measured in the sera and an expansion of CD4+ memory T cells found in the spleens.
Brackett, Craig M.; Kojouharov, Bojidar; Veith, Jean; Greene, Kellee F.; Burdelya, Lyudmila G.; Gollnick, Sandra O.; Abrams, Scott I.; Gudkov, Andrei V.
2016-01-01
Activation of an anticancer innate immune response is highly desirable because of its inherent ability to generate an adaptive antitumor T-cell response. However, insufficient safety of innate immune modulators limits clinical use to topical applications. Toll-like receptor 5 (TLR5) agonists are favorably positioned as potential systemic immunotherapeutic agents because of unusual tissue specificity of expression, uniquely safe profile of induced cytokines, and antitumor efficacy demonstrated in a number of animal models. Here, we decipher the molecular and cellular events underlying the metastasis suppressive activity of entolimod, a clinical stage TLR5 agonist that activates NF-κB–, AP-1–, and STAT3–driven immunomodulatory signaling pathways specifically within the liver. Used as a single agent in murine colon and mammary metastatic cancer models, entolimod rapidly induces CXCL9 and -10 that support homing of blood-borne CXCR3-expressing NK cells to the liver predominantly through an IFN-γ signaling independent mechanism. NK cell-dependent activation of dendritic cells is followed by stimulation of a CD8+ T-cell response, which exert both antimetastatic effect of entolimod and establishment of tumor-specific and durable immune memory. These results define systemically administered TLR5 agonists as organ-specific immunoadjuvants, enabling efficient antitumor vaccination that does not depend on identification of tumor-specific antigens. PMID:26831100
De Rosa, Stephen C.; Thomas, Evan P.; Bui, John; Huang, Yunda; deCamp, Allan; Morgan, Cecilia; Kalams, Spyros; Tomaras, Georgia D.; Akondy, Rama; Ahmed, Rafi; Lau, Chuen-Yen; Graham, Barney S.; Nabel, Gary J.; McElrath, M. Juliana
2011-01-01
Many candidate HIV vaccines are designed to primarily elicit T-cell responses. Although repeated immunization with the same vaccine boosts antibody responses, the benefit for T-cell responses is ill-defined. We compared two immunization regimens that include the same recombinant adenoviral serotype 5 (rAd5) boost. Repeated homologous rAd5 immunization fails to increase T-cell responses, but increases gp140 antibody responses ten-fold. DNA prime, as compared with rAd5 prime, directs long-term memory CD8+ T cells toward a terminally differentiated effector memory phenotype with cytotoxic potential. Based on the kinetics of activated cells measured directly ex vivo, the DNA vaccination primes for both CD4+ and CD8+ T cells, despite the lack of detection of the latter until after the boost. These results suggest that heterologous prime-boost combinations have distinct immunological advantages over homologous prime-boosts, and suggest that the effect of DNA on subsequent boosting may not be easily detectable directly after the DNA vaccination. PMID:21844392
Multi-scale modeling of the CD8 immune response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbarroux, Loic, E-mail: loic.barbarroux@doctorant.ec-lyon.fr; Ecole Centrale de Lyon, 36 avenue Guy de Collongue, 69134 Ecully; Michel, Philippe, E-mail: philippe.michel@ec-lyon.fr
During the primary CD8 T-Cell immune response to an intracellular pathogen, CD8 T-Cells undergo exponential proliferation and continuous differentiation, acquiring cytotoxic capabilities to address the infection and memorize the corresponding antigen. After cleaning the organism, the only CD8 T-Cells left are antigen-specific memory cells whose role is to respond stronger and faster in case they are presented this very same antigen again. That is how vaccines work: a small quantity of a weakened pathogen is introduced in the organism to trigger the primary response, generating corresponding memory cells in the process, giving the organism a way to defend himself inmore » case it encounters the same pathogen again. To investigate this process, we propose a non linear, multi-scale mathematical model of the CD8 T-Cells immune response due to vaccination using a maturity structured partial differential equation. At the intracellular scale, the level of expression of key proteins is modeled by a delay differential equation system, which gives the speeds of maturation for each cell. The population of cells is modeled by a maturity structured equation whose speeds are given by the intracellular model. We focus here on building the model, as well as its asymptotic study. Finally, we display numerical simulations showing the model can reproduce the biological dynamics of the cell population for both the primary response and the secondary responses.« less
Immune signatures of protective spleen memory CD8 T cells.
Brinza, Lilia; Djebali, Sophia; Tomkowiak, Martine; Mafille, Julien; Loiseau, Céline; Jouve, Pierre-Emmanuel; de Bernard, Simon; Buffat, Laurent; Lina, Bruno; Ottmann, Michèle; Rosa-Calatrava, Manuel; Schicklin, Stéphane; Bonnefoy, Nathalie; Lauvau, Grégoire; Grau, Morgan; Wencker, Mélanie; Arpin, Christophe; Walzer, Thierry; Leverrier, Yann; Marvel, Jacqueline
2016-11-24
Memory CD8 T lymphocyte populations are remarkably heterogeneous and differ in their ability to protect the host. In order to identify the whole range of qualities uniquely associated with protective memory cells we compared the gene expression signatures of two qualities of memory CD8 T cells sharing the same antigenic-specificity: protective (Influenza-induced, Flu-TM) and non-protective (peptide-induced, TIM) spleen memory CD8 T cells. Although Flu-TM and TIM express classical phenotypic memory markers and are polyfunctional, only Flu-TM protects against a lethal viral challenge. Protective memory CD8 T cells express a unique set of genes involved in migration and survival that correlate with their unique capacity to rapidly migrate within the infected lung parenchyma in response to influenza infection. We also enlighten a new set of poised genes expressed by protective cells that is strongly enriched in cytokines and chemokines such as Ccl1, Ccl9 and Gm-csf. CCL1 and GM-CSF genes are also poised in human memory CD8 T cells. These immune signatures are also induced by two other pathogens (vaccinia virus and Listeria monocytogenes). The immune signatures associated with immune protection were identified on circulating cells, i.e. those that are easily accessible for immuno-monitoring and could help predict vaccines efficacy.
Discovery of stimulation-responsive immune enhancers with CRISPR activation
Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander
2017-01-01
The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues1–3. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption4–6, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa)7 to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs. PMID:28854172
Discovery of stimulation-responsive immune enhancers with CRISPR activation
NASA Astrophysics Data System (ADS)
Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K.; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander
2017-09-01
The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.
Rowntree, Louise C; Nguyen, Thi H O; Halim, Hanim; Purcell, Anthony W; Rossjohn, Jamie; Gras, Stephanie; Kotsimbos, Tom C; Mifsud, Nicole A
2018-06-15
Human memory T cells that cross-react with epitopes from unrelated viruses can potentially modulate immune responses to subsequent infections by a phenomenon termed heterologous immunity. However, it is unclear whether similarities in structure rather than sequence underpin heterologous T cell cross-reactivity. In this study, we aimed to explore the mechanism of heterologous immunity involving immunodominant epitopes derived from common viruses restricted to high-frequency HLA allotypes (HLA-A*02:01, -B*07:02, and -B*08:01). We examined EBV-specific memory T cells for their ability to cross-react with CMV or influenza A virus-derived epitopes. Following T cell immunoassays to determine phenotype and function, complemented with biophysical and structural investigations of peptide/HLA complexes, we did not detect cross-reactivity of EBV-specific memory T cells toward either CMV or influenza A virus epitopes presented by any of the selected HLA allomorphs. Thus, despite the ubiquitous nature of these human viruses and the dominant immune response directed toward the selected epitopes, heterologous virus-specific T cell cross-reactivity was not detected. This suggests that either heterologous immunity is not as common as previously reported, or that it requires a very specific biological context to develop and be clinically relevant. Copyright © 2018 by The American Association of Immunologists, Inc.
Plasmid DNA vaccination using skin electroporation promotes poly-functional CD4 T-cell responses.
Bråve, Andreas; Nyström, Sanna; Roos, Anna-Karin; Applequist, Steven E
2011-03-01
Plasmid DNA vaccination using skin electroporation (EP) is a promising method able to elicit robust humoral and CD8(+) T-cell immune responses while limiting invasiveness of delivery. However, there is still only limited data available on the induction of CD4(+) T-cell immunity using this method. Here, we compare the ability of homologous prime/boost DNA vaccinations by skin EP and intramuscular (i.m.) injection to elicit immune responses by cytokine enzyme-linked immunosorbent spot (ELISPOT) assay, as well as study the complexity of CD4(+) T-cell responses to the human immunodeficiency virus antigen Gag, using multiparamater flow cytometry. We find that DNA vaccinations by skin EP and i.m. injection are capable of eliciting both single- and poly-functional vaccine-specific CD4(+) T cells. However, although DNA delivered by skin EP was administered at a five-fold lower dose it elicited significant increases in the magnitude of multiple-cytokine producers compared with i.m. immunization suggesting that the skin EP could provide greater poly-functional T-cell help, a feature associated with successful immune defense against infectious agents.
Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis
2017-02-01
Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.
Béland, Kathie; Lapierre, Pascal; Djilali-Saiah, Idriss; Alvarez, Fernando
2012-01-01
The liver must keep equilibrium between immune tolerance and immunity in order to protect itself from pathogens while maintaining tolerance to food antigens. An imbalance between these two states could result in an inflammatory liver disease. The aims of this study were to identify factors responsible for a break of tolerance and characterize the subsequent restoration of liver immune homeostasis. A pro-inflammatory environment was created in the liver by the co-administration of TLR ligands CpG and Poly(I:C) in presence or absence of activated liver-specific autoreactive CD8+ T cells. Regardless of autoreactive CD8+ T cells, mice injected with CpG and Poly(I:C) showed elevated serum ALT levels and a transient liver inflammation. Both CpG/Poly(I:C) and autoreactive CD8+T cells induced expression of TLR9 and INF-γ by the liver, and an up-regulation of homing and adhesion molecules CXCL9, CXCL10, CXCL16, ICAM-1 and VCAM-1. Transferred CFSE-labeled autoreactive CD8+ T cells, in presence of TLR3 and 9 ligands, were recruited by the liver and spleen and proliferated. This population then contracted by apoptosis through intrinsic and extrinsic pathways. Up-regulation of FasL and PD-L1 in the liver was observed. In conclusion, TLR-mediated activation of the innate immune system results in a pro-inflammatory environment that promotes the recruitment of lymphocytes resulting in bystander hepatitis. Despite this pro-inflammatory environment, the presence of autoreactive CD8+ T cells is not sufficient to sustain an autoimmune response against the liver and immune homeostasis is rapidly restored through the apoptosis of T cells. PMID:23110209
Transcriptome profiling reveals the immune response of goose T cells under selenium stimuli.
Cao, Nan; Li, Wanyan; Li, Bingxin; Tian, Yunbo; Xu, Danning
2017-12-01
The goose is an economically important poultry species and a principal natural host of avian viruses. This study aimed to determine the effects of selenium on the immune response of geese. Under selenium stimulation, gene expression profiling was investigated using transcriptome sequencing. The selenoproteins were promoted by selenium stimulation, while the heat shock proteins, interleukin and interferons were mainly down-regulated. After comparison, 2228 differentially expressed genes were primarily involved in immune and environmental response, and infectious disease and genetic information processing related pathways were identified. Specifically, the enzymes of the lysosomes which acted as a safeguard in preventing pathogens were mostly up-regulated and six randomly selected differentially expressed genes were validated by quantitative polymerase chain reaction. In addition, the most proportional increased transcription factor family basic helix-loop-helix (bHLH) located in the 5' flank of selenoprotein P-like protein for selenium metabolism was identified by response to the selenium stimulation in this study. These analyses show that selenium can promote immune function by activating selenoproteins, transcript factors and lysosome pathway related genes, while weakening cytokine content genes in geese. © 2017 Japanese Society of Animal Science.
HogenEsch, Harm; Thompson, Steven; Dunham, Anisa; Ceddia, Michael; Hayek, Michael
2004-01-01
The evaluation of anti-aging intervention strategies in dogs would benefit from reliable quantitative biomarkers of aging. In the present study, the expression of various immune parameters was measured in young and old dogs to identify potential biomarkers of aging. The second goal of the study was to determine the effect of age on the immune response to vaccines. The immune function, including the antibody response to vaccines, was determined in 32 young adult (3.15+/-0.8 years of age) and 33 old dogs (12.1+/-1.3 years of age) of various breeds. Old dogs had a significantly lower lymphocyte proliferative response and a lower percentage of CD4+ T cells and CD45R+/CD4+ T cells, and a higher percentage of CD8+ T cells and a higher concentration of serum and salivary IgA. The most significant differences (P<0.001) occurred in the lymphocyte proliferative responses to ConA and PHA, the CD4:CD8 ratio, and the percentage of CD45R+/CD4+ T cells suggesting that these parameters are potential biomarkers of aging. There was no difference in the percentage of total T and B lymphocytes and the concentration of serum IgM and IgG. Both groups of dogs had protective titers against distemper virus, parvovirus and rabies virus before annual revaccination. The pre-vaccination titer against rabies virus was higher in the old dogs than in the young dogs, and there were no differences in post-vaccination titers against any of the viruses. This suggests that annual vaccination protocols provide adequate protection for old dogs.
Enamorado, Michel; Iborra, Salvador; Priego, Elena; Cueto, Francisco J.; Quintana, Juan A.; Martínez-Cano, Sarai; Mejías-Pérez, Ernesto; Esteban, Mariano; Melero, Ignacio; Hidalgo, Andrés; Sancho, David
2017-01-01
The goal of successful anti-tumoural immunity is the development of long-term protective immunity to prevent relapse. Infiltration of tumours with CD8+ T cells with a resident memory (Trm) phenotype correlates with improved survival. However, the interplay of circulating CD8+ T cells and Trm cells remains poorly explored in tumour immunity. Using different vaccination strategies that fine-tune the generation of Trm cells or circulating memory T cells, here we show that, while both subsets are sufficient for anti-tumour immunity, the presence of Trm cells improves anti-tumour efficacy. Transferred central memory T cells (Tcm) generate Trm cells following viral infection or tumour challenge. Anti-PD-1 treatment promotes infiltration of transferred Tcm cells within tumours, improving anti-tumour immunity. Moreover, Batf3-dependent dendritic cells are essential for reactivation of circulating memory anti-tumour response. Our findings show the plasticity, collaboration and requirements for reactivation of memory CD8+ T cells subsets needed for optimal tumour vaccination and immunotherapy. PMID:28714465
Immune response of patients with recurrent aphthous stomatitis challenged with a symbiotic.
Mimura, Maria Angela Martins; Borra, Ricardo Carneiro; Hirata, Cleonice Hitomi Watashi; de Oliveira Penido, Norma
2017-10-01
There are indications that Th1 polarization of immune response plays an important role in the pathogenesis of recurrent aphthous stomatitis (RAS), and that the use of probiotics can stimulate immune regulatory activity, influencing the course of the disease. The aim of this study was to characterize the initial immune profile of RAS patients and evaluate clinical and serological response following a challenge with symbiotic treatment containing fructooligosaccharide, Lactobacillus, and Bifidobacterium. The immune responses of the 45 patients with RAS, submitted to symbiotic or placebo for 120 days, in relation to 30 RAS-free controls, were evaluated over a period of 6 months. Peripheral blood was collected from all patients at 0 (T0), 120 (T4), and 180 days (T6) after the start of treatment and Th1 (IL12-p70, IFN-γ), Th2 (IL-4), Treg (IL-10), Th17 (IL-17A), inflammatory (TNF-α, IL-6)-associated cytokines, and clinical parameters were quantified. At T0, significant differences were found in the serological levels of the IFN-γ, IL-4, and IL-6 cytokines of the RAS patients in comparison with the controls. It was observed that the cytokine profile of the RAS group was comprised of 2 distinct clusters: a pure Th2 and a Mixed (Th1/Th2) subtype and that symbiotic treatment induced an improvement in pain and an increase in IFN-γ levels, producing a reduction in Th2 response. In RAS, symbiotic treatment based on a fructooligosaccharide, Lactobacillus, and Bifidobacterium composition produced an alteration in the Th2 serological immune profile in the direction of Th1 and improved pain symptomatology. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Miyauchi, Kosuke
The lung is an important line of defense that is exposed to respiratory infectious pathogens, including viruses. Lung epithelial cells and/or alveolar macrophages are initially targeted by respiratory viruses. Once respiratory viruses invade the cells of the lung, innate immunity is activated to inhibit viral replication. Innate immune signaling also activates virus-specific adaptive immune responses. The helper T cells play pivotal roles in the humoral and cellular adaptive immune responses. Helper T cells are categorized into several distinct subsets (e.g., T H 1, T H 2, T FH , T H 17, and Treg), differentiated by their corresponding signature cytokine production profiles. Helper T cells migrate into the airways and the lung after respiratory virus infections. The behavior of the helper T cells differs with each respiratory virus-in some cases, the response is beneficial; in other cases, it is harmful. Here, the general mechanisms underlying helper T cell responses to viral infections are summarized, and functions and reactions of the helper T cells against some respiratory viral infections are discussed. In influenza virus infections, T H 1 cells, which regulate the cytotoxic T lymphocytes and IgG2 responses, are efficiently activated. T FH cells required for highly specific and memory humoral responses are also activated on influenza infections. In infections with respiratory syncytial virus and rhinovirus, T H 2 cells develop in the lung and contribute to pathogenesis. In many cases, Treg cells inhibit excessive virus-specific T cell responses that can contribute to viral pathogenicity.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E
2000-04-01
Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.
Wartenberg, Martin; Zlobec, Inti; Perren, Aurel; Koelzer, Viktor Hendrik; Gloor, Beat; Lugli, Alessandro; Eva, Karamitopoulou
2015-01-01
Here we explore the role of the interplay between host immune response and epithelial-mesenchymal-transition (EMT)-Type tumor-budding on the outcome of pancreatic adenocarcinoma (PDAC). CD4+, CD8+, and FOXP3+T-cells as well as iNOS+ (M1) and CD163+-macrophages (M2) were assessed on multipunch tissue-microarrays containing 120 well-characterized PDACs, precursor lesions (PanINs) and corresponding normal tissue. Counts were normalized for the percentage of tumor/spot and associated with the clinico-pathological features, including peritumoral (PTB) and intratumoral (ITB) EMT-Type tumor-budding and outcome. Increased FOXP3+T-cell-counts and CD163-macrophages and decreased CD8+T-cell-counts were observed in PDACs compared with normal tissues and PanINs (p < 0.0001). Increased peritumoral FOXP3+T-cell-counts correlated significantly with venous invasion, distant metastasis, R1-status, high-grade ITB, PTB and independently with reduced survival. Increased intratumoral FOXP3+T-cells correlated with lymphatic invasion, N1-stage, PTB and marginally with adverse outcome. High peritumoral CD163-counts correlated with venous invasion, PTB and ITB. High intratumoral CD163-counts correlated with higher T-stage and PTB. PDAC-microenvironment displays a tumor-favoring immune-cell composition especially in the immediate environment of the tumor-buds that promotes further growth and indicates a close interaction of the immune response with the EMT-process. Increased peritumoral FOXP3+T-cell density is identified as an independent adverse prognostic factor in PDAC. Patients with phenotypically aggressive PDACs may profit from targeted immunotherapy against FOXP3. PMID:25669968
Fogg, Mark; Murphy, John R.; Lorch, Jochen; Posner, Marshall; Wang, Fred
2013-01-01
Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, as well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. PMID:23601786
Ubiquitin enzymes in the regulation of immune responses
Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo
2017-01-01
Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749
Simi, S; Peter, Valsa S; Peter, M C Subhash
2017-09-15
Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
Griffiths, Gareth D; Telford, Gary; Hooi, Doreen S W; Cook, David L; Wilkinson, Lucy J; Green, Christopher A; Pritchard, David I
2005-03-01
Immune regulation, either via the autonomic nervous system or by a proposed "non-neuronal" cholinergic system, suggests that the immune system may be susceptible to perturbation by compounds affecting cholinergic function. Here, the current UK and US nerve agent pre-treatment, pyridostigmine bromide (PB) and the related anti-acetylcholinesterase (AChE) compounds physostigmine (PHY) and BW284c51 were tested for their ability to affect mouse splenocyte function in vitro. In addition, PB, at a dose equivalent to that received during pre-treatment for nerve agent poisoning, was tested for its effect on a T-cell-dependent humoral response to antigen in vivo in the mouse. None of the anti-AChEs tested affected concanavalin A (Con A)-, anti-CD3- or lipopolysaccharide LPS-driven splenocyte proliferation, in vitro, at concentrations expected to give effective nerve agent pre-treatment. However, higher concentrations (>100 microM) particularly of PHY caused some inhibition of the proliferative responses. In vivo, PB or saline was administered via 28-day mini-osmotic pumps to give a 25-40% inhibition of whole blood AChE in the PB-treated animals. During PB or saline administration, primary and secondary doses (i.p.) of sheep red blood cells (SRBC) were given and the humoral response determined by monitoring anti-SRBC IgM and IgG levels. Splenocytes isolated from the experimental animals were also examined for their proliferative and cytokine responses to stimulation. No remarkable effects of PB were seen during the period of AChE inhibition on the humoral immune response. However, a modest elevation in IL-2 and IFN(gamma) in Con A-stimulated lymphocytes was seen in PB-treated animals following pump removal. Overall these data suggest that, in vivo, the SRBC stimulated T-cell-dependent immune response is unaffected by the administration of PB at pre-treatment doses.
Immune responses to mumps vaccine in adults who were vaccinated in childhood.
Hanna-Wakim, Rima; Yasukawa, Linda L; Sung, Phillip; Arvin, Ann M; Gans, Hayley A
2008-06-15
In a mumps outbreak in the United States, many infected individuals were adults who had received 2 doses of mumps vaccine. The persistence of cellular immunity to mumps vaccine has not been defined. This was an observational, nonrandomized cohort study evaluating cell-mediated and humoral immunity to mumps in 10 vaccinated and 10 naturally immune adults. Mumps-specific T cell activation and interferon (IFN)-gamma production were measured using lymphoproliferative and flow cytometry assays, and mumps immunoglobulin (Ig) G was measured using enzyme-linked immunosorbent assay. T cell immunity to mumps was high in both groups; 70% of vaccinated and 80% of naturally immune individuals had a positive (> or =3) stimulation index (SI) (P = 1.0). The mean percentages of mumps-specific CD4+ T cells that expressed CD69 and produced IFN-gamma were equivalent in the 2 groups: 0.06% and 0.12%, respectively (P = .11). The mean SIs in the groups were also equivalent, although IFN-gamma concentrations from cultures stimulated with mumps antigen were higher in naturally immune adults than in vaccinated adults (P < or = .01). All adults were positive for mumps IgG. T and B cell immunity to mumps was detected in adults at least 10 years after immunization. Except for IFN-gamma release, responses in vaccinated adults paralleled those observed in naturally immune individuals.
Immune Responses to Mumps Vaccine in Adults Who Were Vaccinated in Childhood
Hanna-Wakim, Rima; Yasukawa, Linda L.; Sung, Phillip; Arvin, Ann M.; Gans, Hayley A.
2008-01-01
Background In a mumps outbreak in the United States, many infected individuals were adults who had received 2 doses of mumps vaccine. The persistence of cellular immunity to mumps vaccine has not been defined. Methods This was an observational, nonrandomized cohort study evaluating cell-mediated and humoral immunity to mumps in 10 vaccinated and 10 naturally immune adults. Mumps-specific T cell activation and interferon (IFN)–γ production were measured using lymphoproliferative and flow cytometry assays, and mumps immunoglobulin (Ig) G was measured using enzyme-linked immunosorbent assay. Results T cell immunity to mumps was high in both groups; 70% of vaccinated and 80% of naturally immune individuals had a positive (≥3) stimulation index (SI) (P = 1.0). The mean percentages of mumps-specific CD4+ T cells that expressed CD69 and produced IFN-γ were equivalent in the 2 groups: 0.06% and 0.12%, respectively (P = .11). The mean SIs in the groups were also equivalent, although IFN-γ concentrations from cultures stimulated with mumps antigen were higher in naturally immune adults than in vaccinated adults (P ≤ .01). All adults were positive for mumps IgG. Conclusion T and B cell immunity to mumps was detected in adults at least 10 years after immunization. Except for IFN-γ release, responses in vaccinated adults paralleled those observed in naturally immune individuals. PMID:18419345
Public clonotype usage identifies protective Gag-specific CD8+ T cell responses in SIV infection
Asher, Tedi E.; Wilson, Nancy A.; Nason, Martha C.; Brenchley, Jason M.; Metzler, Ian S.; Venturi, Vanessa; Gostick, Emma; Chattopadhyay, Pratip K.; Roederer, Mario; Davenport, Miles P.; Watkins, David I.; Douek, Daniel C.
2009-01-01
Despite the pressing need for an AIDS vaccine, the determinants of protective immunity to HIV remain concealed within the complexity of adaptive immune responses. We dissected immunodominant virus-specific CD8+ T cell populations in Mamu-A*01+ rhesus macaques with primary SIV infection to elucidate the hallmarks of effective immunity at the level of individual constituent clonotypes, which were identified according to the expression of distinct T cell receptors (TCRs). The number of public clonotypes, defined as those that expressed identical TCR β-chain amino acid sequences and recurred in multiple individuals, contained within the acute phase CD8+ T cell population specific for the biologically constrained Gag CM9 (CTPYDINQM; residues 181–189) epitope correlated negatively with the virus load set point. This independent molecular signature of protection was confirmed in a prospective vaccine trial, in which clonotype engagement was governed by the nature of the antigen rather than the context of exposure and public clonotype usage was associated with enhanced recognition of epitope variants. Thus, the pattern of antigen-specific clonotype recruitment within a protective CD8+ T cell population is a prognostic indicator of vaccine efficacy and biological outcome in an AIDS virus infection. PMID:19349463
Maternal Milk T Cells Drive Development of Transgenerational Th1 Immunity in Offspring Thymus.
Ghosh, Mrinal K; Nguyen, Virginia; Muller, H Konrad; Walker, Ameae M
2016-09-15
Using multiple murine foster-nursing protocols, thereby eliminating placental transfer and allowing a distinction between dam- and pup-derived cells, we show that foster nursing by an immunized dam results in development of CD8(+) T cells in nonimmunized foster pups that are specific for Ags against which the foster dam was immunized (Mycobacterium tuberculosis or Candida albicans). We have dubbed this process "maternal educational immunity" to distinguish it from passive cellular immunity. Of the variety of maternal immune cells present in milk, only T cells were detected in pup tissues. Maternal T cells, a substantial percentage of which were CD4(+)MHC class II(+), accumulated in the pup thymus and spleen during the nursing period. Further analysis of maternal cells in the pup thymus showed that a proportion was positive for maternal immunogen-specific MHC class II tetramers. To determine the outcome of Ag presentation in the thymus, the maternal or foster pup origin of immunogen-responding CD8(+) cells in foster pup spleens was assessed. Whereas ∼10% were maternally derived in the first few weeks after weaning, all immunogen-responding CD8(+) T cells were pup derived by 12 wk of age. Pup-derived immunogen-responsive CD8(+) cells persisted until at least 1 y of age. Passive cellular immunity is well accepted and has been demonstrated in the human population. In this study, we show an arguably more important role for transferred immune cells: the direction of offspring T cell development. Harnessing maternal educational immunity through prepregnancy immunization programs has potential for improvement of infant immunity. Copyright © 2016 by The American Association of Immunologists, Inc.
Santana, Vinicius C; Diniz, Mariana O; Cariri, Francisco A M O; Ventura, Armando M; Cunha-Neto, Edécio; Almeida, Rafael R; Campos, Marco A; Lima, Graciela K; Ferreira, Luís C S
2013-01-01
Millions of people worldwide are currently infected with human papillomavirus (HPV), herpes simplex virus (HSV) or human immunodeficiency virus (HIV). For this enormous contingent of people, the search for preventive and therapeutic immunological approaches represents a hope for the eradication of latent infection and/or virus-associated cancer. To date, attempts to develop vaccines against these viruses have been mainly based on a monovalent concept, in which one or more antigens of a virus are incorporated into a vaccine formulation. In the present report, we designed and tested an immunization strategy based on DNA vaccines that simultaneously encode antigens for HIV, HSV and HPV. With this purpose in mind, we tested two bicistronic DNA vaccines (pIRES I and pIRES II) that encode the HPV-16 oncoprotein E7 and the HIV protein p24 both genetically fused to the HSV-1 gD envelope protein. Mice i.m. immunized with the DNA vaccines mounted antigen-specific CD8⁺ T cell responses, including in vivo cytotoxic responses, against the three antigens. Under experimental conditions, the vaccines conferred protective immunity against challenges with a vaccinia virus expressing the HIV-derived protein Gag, an HSV-1 virus strain and implantation of tumor cells expressing the HPV-16 oncoproteins. Altogether, our results show that the concept of a trivalent HIV, HSV, and HPV vaccine capable to induce CD8⁺ T cell-dependent responses is feasible and may aid in the development of preventive and/or therapeutic approaches for the control of diseases associated with these viruses.
Altered Innate and Lymphocytic Immune Responses in Mouse Splenocytes Post-Flight
NASA Technical Reports Server (NTRS)
Hwang, ShenAn; Crucian, Brian E.; Sams, Clarence F.; Actor, Jeffrey K.
2011-01-01
Space flight is known to affect immune responses of astronauts and animals, decreasing lymphocytic responses to mitogenic stimuli, delayed typed hypersensitivity reactions, and T-cell activation. Despite changes in immune suppression, there are no reports of consistent adverse clinical events post flight. To further investigate the spectrum of affected immune responses, murine splenocytes were stimulated immediately post-shuttle flight (14 days on STS-135) with T-cell stimulators or toll-like receptor agonists. Comparisons were made to ground control splenocytes from age-matched mice. Cell phenotypes were assessed, as well as activation markers and associated cytokine production. The CD4+ population decreased with no concurrent decrease in CD8+ cells from shuttle mice post flight compared to ground controls. Regarding antigen presenting cell populations, the number of CD11c+ cells were slightly elevated post flight, compared to ground controls, with increased MHC Class I expression (I-A(sup b)) and no change in Class II expression (H-2K(sup b)). CD86+ populations were also significantly diminished. However, the decreased markers did not correlate with activity. Stimulation of splenocytes post flight showed significant increase in bead uptake, increased Class I expression, increased TNF-alpha and IL-6 production in response to TLR-2 (zymosan) and TLR-4 (LPS) agonists. While most activated (ConA or anti-CD3/anti-CD28) CD4+ cells showed markedly diminished responses (reduced IL-2 production), non-specific T cell responses to superantigen (SEA/SEB) increased post flight as determined by expression of early activation markers. Production of additional cytokines was also dysregulated postflight. Overall, persistent immune changes during space flight could represent unique clinical risks for exploration class missions. The consequences of pathogenic encounter remain an important concern that should be addressed.
Extending antigen release from particulate vaccines results in enhanced antitumor immune response.
Kapadia, Chintan H; Tian, Shaomin; Perry, Jillian L; Sailer, David; Christopher Luft, J; DeSimone, Joseph M
2018-01-10
Tumor-specific CD8 + cytotoxic T lymphocytes (CTLs) play a critical role in an anti-tumor immune response. However, vaccination intended to elicit a potent CD8 + T cell responses employing tumor-associated peptide antigens, are typically ineffective due to poor immunogenicity. Previously, we engineered a polyethylene glycol (PEG) hydrogel-based subunit vaccine for the delivery of an antigenic peptide and CpG (adjuvant) to elicit potent CTLs. In this study, we further examined the effect of antigen release kinetics on their induced immune responses. A CD8 + T cell epitope peptide from OVA (CSIINFEKL) and CpG were co-conjugated to nanoparticles utilizing either a disulfide or a thioether linkage. Subsequent studies comparing peptide release rates as a function of linker, determined that the thioether linkage provided sustained release of peptide over 72h. Ability to control the release of peptide resulted in both higher and prolonged antigen presentation when compared to disulfide-linked peptide. Both NP vaccine formulations resulted in activation and maturation of bone marrow derived dendritic cells (BMDCs) and induced potent CD8 + T cell responses when compared to soluble antigen and soluble CpG. Immunization with either disulfide or thioether linked vaccine constructs effectively inhibited EG7-OVA tumor growth in mice, however only treatment with the thioether linked vaccine construct resulted in enhanced survival. Copyright © 2017. Published by Elsevier B.V.
Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric
2015-10-21
Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.
Larsen, Jeppe Madura; Brix, Susanne; Thysen, Anna Hammerich; Birch, Sune; Rasmussen, Morten Arendt; Bisgaard, Hans
2014-04-01
Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonization of neonatal airways with the pathogenic bacterial strains Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. The Copenhagen Prospective Studies on Asthma in Childhood birth cohort was followed prospectively, and asthma was diagnosed at age 7 years. The immune response to H influenzae, M catarrhalis, and S pneumoniae was analyzed in 292 infants using PBMCs isolated and stored since the age of 6 months. The immune response was assessed based on the pattern of cytokines produced and T-cell activation. The immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17 (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. Children with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic bacteria colonizing the airways in early life might lead to chronic airway inflammation and childhood asthma. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Mwangi, Duncan M.; Mahan, Suman M.; Nyanjui, John K.; Taracha, Evans L. N.; McKeever, Declan J.
1998-01-01
Peripheral blood mononuclear cells (PBMC) from immune cattle proliferate in the presence of autologous Cowdria ruminantium-infected endothelial cells and monocytes. Endothelial cells required treatment with T-cell growth factors to induce class II major histocompatibility complex expression prior to infection and use as stimulators. Proliferative responses to both infected autologous endothelial cells and monocytes were characterized by expansion of a mixture of CD4+, CD8+, and γδ T cells. However, γδ T cells dominated following several restimulations. Reverse transcription-PCR analysis of cytokine expression by C. ruminantium-specific T-cell lines and immune PBMC revealed weak interleukin-2 (IL-2), IL-4, and gamma interferon (IFN-γ) transcripts at 3 to 24 h after stimulation. Strong expression of IFN-γ, tumor necrosis factor alpha (TNF-α), TNF-β, and IL-2 receptor α-chain mRNA was detected in T-cell lines 48 h after antigen stimulation. Supernatants from these T-cell cultures contained IFN-γ protein. Our findings suggest that in immune cattle a C. ruminantium-specific T-cell response is induced and that infected endothelial cells and monocytes may present C. ruminantium antigens to specific T lymphocytes in vivo during infection and thereby play a role in induction of protective immune responses to the pathogen. PMID:9573061
Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun
2015-10-01
Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Genomic correlates of response to immune checkpoint therapies in clear cell renal cell carcinoma.
Miao, Diana; Margolis, Claire A; Gao, Wenhua; Voss, Martin H; Li, Wei; Martini, Dylan J; Norton, Craig; Bossé, Dominick; Wankowicz, Stephanie M; Cullen, Dana; Horak, Christine; Wind-Rotolo, Megan; Tracy, Adam; Giannakis, Marios; Hodi, Frank Stephen; Drake, Charles G; Ball, Mark W; Allaf, Mohamad E; Snyder, Alexandra; Hellmann, Matthew D; Ho, Thai; Motzer, Robert J; Signoretti, Sabina; Kaelin, William G; Choueiri, Toni K; Van Allen, Eliezer M
2018-02-16
Immune checkpoint inhibitors targeting the programmed cell death 1 receptor (PD-1) improve survival in a subset of patients with clear cell renal cell carcinoma (ccRCC). To identify genomic alterations in ccRCC that correlate with response to anti-PD-1 monotherapy, we performed whole-exome sequencing of metastatic ccRCC from 35 patients. We found that clinical benefit was associated with loss-of-function mutations in the PBRM1 gene ( P = 0.012), which encodes a subunit of the PBAF switch-sucrose nonfermentable (SWI/SNF) chromatin remodeling complex. We confirmed this finding in an independent validation cohort of 63 ccRCC patients treated with PD-1 or PD-L1 (PD-1 ligand) blockade therapy alone or in combination with anti-CTLA-4 (cytotoxic T lymphocyte-associated protein 4) therapies ( P = 0.0071). Gene-expression analysis of PBAF-deficient ccRCC cell lines and PBRM1 -deficient tumors revealed altered transcriptional output in JAK-STAT (Janus kinase-signal transducers and activators of transcription), hypoxia, and immune signaling pathways. PBRM1 loss in ccRCC may alter global tumor-cell expression profiles to influence responsiveness to immune checkpoint therapy. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Khattar, Sunil K; Palaniyandi, Senthilkumar; Samal, Sweety; LaBranche, Celia C; Montefiori, David C; Zhu, Xiaoping; Samal, Siba K
2015-01-01
The combination of multiple HIV antigens in a vaccine can broaden antiviral immune responses. In this study, we used NDV vaccine strain LaSota to generate rNDV (rLaSota/optGag) expressing human codon optimized p55 Gag protein of HIV-1. We examined the effect of co-immunization of rLaSota/optGag with rNDVs expressing different forms of Env protein gp160, gp120, gp140L [a version of gp140 that lacked cytoplasmic tail and contained complete membrane-proximal external region (MPER)] and gp140S (a version of gp140 that lacked cytoplasmic tail and distal half of MPER) on magnitude and breadth of humoral, mucosal and cellular immune responses in guinea pigs and mice. Our results showed that inclusion of rLaSota/optGag with rNDVs expressing different forms of Env HIV Gag did not affect the Env-specific humoral and mucosal immune responses in guinea pigs and that the potent immune responses generated against Env persisted for at least 13 weeks post immunization. The highest Env-specific humoral and mucosal immune responses were observed with gp140S+optGag group. The neutralizing antibody responses against HIV strains BaL.26 and MN.3 induced by gp140S+optGag and gp160+optGag were higher than those elicited by other groups. Inclusion of Gag with gp160, gp140S and gp140L enhanced the level of Env-specific IFN-γ-producing CD8+ T cells in mice. Inclusion of Gag with gp160 and gp140L also resulted in increased Env-specific CD4+ T cells. The level of Gag-specific CD8+ and CD4+ T cells was also enhanced in mice immunized with Gag along with gp140S and gp120. These results indicate lack of antigen interference in a vaccine containing rNDVs expressing Env and Gag proteins. PMID:25695657
Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J
1999-03-05
DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.
Notch Signaling in Myeloid Cells as a Regulator of Tumor Immune Responses
Hossain, Fokhrul; Majumder, Samarpan; Ucar, Deniz A.; Rodriguez, Paulo C.; Golde, Todd E.; Minter, Lisa M.; Osborne, Barbara A.; Miele, Lucio
2018-01-01
Cancer immunotherapy, which stimulates or augments host immune responses to treat malignancies, is the latest development in the rapidly advancing field of cancer immunology. The basic principles of immunotherapies are either to enhance the functions of specific components of the immune system or to neutralize immune-suppressive signals produced by cancer cells or tumor microenvironment cells. When successful, these approaches translate into long-term survival for patients. However, durable responses are only seen in a subset of patients and so far, only in some cancer types. As for other cancer treatments, resistance to immunotherapy can also develop. Numerous research groups are trying to understand why immunotherapy is effective in some patients but not others and to develop strategies to enhance the effectiveness of immunotherapy. The Notch signaling pathway is involved in many aspects of tumor biology, from angiogenesis to cancer stem cell maintenance to tumor immunity. The role of Notch in the development and modulation of the immune response is complex, involving an intricate crosstalk between antigen-presenting cells, T-cell subpopulations, cancer cells, and other components of the tumor microenvironment. Elegant studies have shown that Notch is a central mediator of tumor-induced T-cell anergy and that activation of Notch1 in CD8 T-cells enhances cancer immunotherapy. Tumor-infiltrating myeloid cells, including myeloid-derived suppressor cells, altered dendritic cells, and tumor-associated macrophages along with regulatory T cells, are major obstacles to the development of successful cancer immunotherapies. In this article, we focus on the roles of Notch signaling in modulating tumor-infiltrating myeloid cells and discuss implications for therapeutic strategies that modulate Notch signaling to enhance cancer immunotherapy.
Tang, Chun-Lian; Liu, Zhi-Ming; Gao, Yan Ru; Xiong, Fei
2018-01-01
Studies on parasite-induced immunoregulatory mechanisms could contribute to the development of new therapies for inflammatory diseases such as type 2 diabetes (T2D), which is a chronic inflammatory disease characterized by persistent elevated glucose levels due to insulin resistance. The association between previous Schistosoma infection and T2D has been confirmed—Schistosoma infection and Schistosoma-derived products modulate the immune system, including innate and acquired immune responses, contributing to T2D disease control. Schistosoma infections and Schistosoma-derived molecules affect the immune cell composition in adipose tissue, dampening inflammation and improving glucose tolerance. This protective role includes the polarization of immune cells to alternatively activated macrophages, dendritic cells, eosinophils, and group 2 innate lymphoid cells. Furthermore, Schistosoma infection and Schistosoma products are effective for the treatment of T2D, as they increase the number of type 2 helper T cells (Th2) and regulatory T cells (Tregs) and decrease type 1 helper T cells (Th1) and type 17 helper T cells (Th17) cells. Thus, our aim was to comprehensively review the mechanism through which Schistosoma infection and Schistosoma products modulate the immune response against T2D. PMID:29387059
Tang, Chun-Lian; Liu, Zhi-Ming; Gao, Yan Ru; Xiong, Fei
2017-01-01
Studies on parasite-induced immunoregulatory mechanisms could contribute to the development of new therapies for inflammatory diseases such as type 2 diabetes (T2D), which is a chronic inflammatory disease characterized by persistent elevated glucose levels due to insulin resistance. The association between previous Schistosoma infection and T2D has been confirmed- Schistosoma infection and Schistosoma -derived products modulate the immune system, including innate and acquired immune responses, contributing to T2D disease control. Schistosoma infections and Schistosoma -derived molecules affect the immune cell composition in adipose tissue, dampening inflammation and improving glucose tolerance. This protective role includes the polarization of immune cells to alternatively activated macrophages, dendritic cells, eosinophils, and group 2 innate lymphoid cells. Furthermore, Schistosoma infection and Schistosoma products are effective for the treatment of T2D, as they increase the number of type 2 helper T cells (Th2) and regulatory T cells (Tregs) and decrease type 1 helper T cells (Th1) and type 17 helper T cells (Th17) cells. Thus, our aim was to comprehensively review the mechanism through which Schistosoma infection and Schistosoma products modulate the immune response against T2D.
Boltaña, Sebastian; Sanchez, Marcos; Valenzuela, Valentina; Gallardo-Escárate, Cristian
2016-12-01
Sea lice infestations are a particular concern in the salmonid aquaculture industry due to damaging effects on fish growth, disease/infection susceptibility, and survival. Despite the impacts of sea lice parasitism, few studies have determined corresponding physiological thresholds, or the quantity of sea lice that can trigger measurable effects in the host immune response. The present study evaluated the mRNA expressions of immune-related genes in Salmo salar (Atlantic salmon) under infestation challenges with contrasting loads of the sea louse Caligus rogercresseyi. Specifically, two groups of S. salar were infected with either 35 (i.e. low parasitic load) or 100 (i.e. high parasitic load) copepodids per fish. At 14 days post-infestation, the mRNA levels of immune-related genes (e.g. related to oxidative stress, pro- and inflammatory responses, and the adaptive T H 1/T H 2 pathways) were assessed through RT-qPCR. Significant differences were found in relation to parasitic load, suggesting density-dependent effects that activated the S. salar immune system. Higher parasitic load promoted strong inflammatory and oxidative stress responses that were correlated with the T H 1 immune response. This study highlights the molecular signatures for distinct parasitic loads, providing new perspectives towards fully understanding parasite-host interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle
2006-03-06
Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.
Antigen localization controls T cell-mediated tumor immunity.
Zeelenberg, Ingrid S; van Maren, Wendy W C; Boissonnas, Alexandre; Van Hout-Kuijer, Maaike A; Den Brok, Martijn H M G M; Wagenaars, Jori A L; van der Schaaf, Alie; Jansen, Eric J R; Amigorena, Sebastian; Théry, Clotilde; Figdor, Carl G; Adema, Gosse J
2011-08-01
Effective antitumor immunotherapy requires the identification of suitable target Ags. Interestingly, many of the tumor Ags used in clinical trials are present in preparations of secreted tumor vesicles (exosomes). In this study, we compared T cell responses elicited by murine MCA101 fibrosarcoma tumors expressing a model Ag at different localizations within the tumor cell in association with secreted vesicles (exosomes), as a nonsecreted cell-associated protein, or as secreted soluble protein. Remarkably, we demonstrated that only the tumor-secreting vesicle-bound Ag elicited a strong Ag-specific CD8(+) T cell response, CD4(+) T cell help, Ag-specific Abs, and a decrease in the percentage of immunosuppressive regulatory T cells in the tumor. Moreover, in a therapeutic tumor model of cryoablation, only in tumors secreting vesicle-bound Ag could Ag-specific CD8(+) T cells still be detected up to 16 d after therapy. We concluded that the localization of an Ag within the tumor codetermines whether a robust immunostimulatory response is elicited. In vivo, vesicle-bound Ag clearly skews toward a more immunogenic phenotype, whereas soluble or cell-associated Ag expression cannot prevent or even delay outgrowth and results in tumor tolerance. This may explain why particular immunotherapies based on these vesicle-bound tumor Ags are potentially successful. Therefore, we conclude that this study may have significant implications in the discovery of new tumor Ags suitable for immunotherapy and that their location should be taken into account to ensure a strong antitumor immune response.
Surface receptor Toso controls B cell-mediated regulation of T cell immunity.
Yu, Jinbo; Duong, Vu Huy Hoang; Westphal, Katrin; Westphal, Andreas; Suwandi, Abdulhadi; Grassl, Guntram A; Brand, Korbinian; Chan, Andrew C; Föger, Niko; Lee, Kyeong-Hee
2018-05-01
The immune system is tightly controlled by regulatory processes that allow for the elimination of invading pathogens, while limiting immunopathological damage to the host. In the present study, we found that conditional deletion of the cell surface receptor Toso on B cells unexpectedly resulted in impaired proinflammatory T cell responses, which led to impaired immune protection in an acute viral infection model and was associated with reduced immunopathological tissue damage in a chronic inflammatory context. Toso exhibited its B cell-inherent immunoregulatory function by negatively controlling the pool of IL-10-competent B1 and B2 B cells, which were characterized by a high degree of self-reactivity and were shown to mediate immunosuppressive activity on inflammatory T cell responses in vivo. Our results indicate that Toso is involved in the differentiation/maintenance of regulatory B cells by fine-tuning B cell receptor activation thresholds. Furthermore, we showed that during influenza A-induced pulmonary inflammation, the application of Toso-specific antibodies selectively induced IL-10-competent B cells at the site of inflammation and resulted in decreased proinflammatory cytokine production by lung T cells. These findings suggest that Toso may serve as a novel therapeutic target to dampen pathogenic T cell responses via the modulation of IL-10-competent regulatory B cells.
Górski, A; Castronovo, V; Stepień-Sopniewska, B; Grieb, P; Ryba, M; Mrowiec, T; Korczak-Kowalska, G; Wierzbicki, P; Matysiak, W; Dybowska, B
1994-07-01
Although T cells infiltrate malignant tumors, the local immune response is usually inefficient and tumors escape destruction. While extracellular matrix proteins strongly costimulate T cell responses in normal individuals, our studies indicate that peripheral blood T cells from cancer patients and tumor infiltrating cells respond poorly or are resistant to stimulative signals mediated by collagen I and IV and fibronectin. Moreover, the adhesive properties of cancer T cells are markedly depressed. Those functional deficiencies are paralleled by variable deficits in integrin and non-integrin T cell receptors for extracellular matrix. Immunotherapy with BCG causes a dramatic but transient increase in T cell: ECM interactions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choi, Jin Kyeong; Molecular Immunology Section, Laboratory of Immunology, National Eye Institute, National Institutes of Health, Bethesda, MD 20892; Kim, Sung-Wan
ABSTRACT: Rheumatoid arthritis (RA) is a chronic autoimmune disease associated with a combination of synovium joint inflammation, synovium hyperplasia, and destruction of cartilage and bone. Oleanolic acid acetate (OAA), a compound isolated from Vigna angularis, has been known to possess pharmacological activities, including anti-inflammation and anti-bone destruction. In this study, we investigated the effects of OAA on RA and the underlying mechanisms of action by using a type-II collagen-induced arthritis (CIA) mouse model and tumor necrosis factor (TNF)-α-stimulated RA synovial fibroblasts. Oral administration of OAA decreased the clinical arthritis symptoms, paw thickness, histologic and radiologic changes, and serum total andmore » anti-type II collagen IgG, IgG1, and IgG2a levels. OAA administration reduced Th1/Th17 phenotype CD4{sup +} T lymphocyte expansions and inflammatory cytokine productions in T cell activated draining lymph nodes and spleen. OAA reduced the expression and production of inflammatory mediators, such as cytokines and matrix metalloproteinase (MMP)-1/3, in the ankle joint tissue and RA synovial fibroblasts by down-regulating Akt, mitogen-activated protein kinases, and nuclear factor-κB. Our results clearly support that OAA plays a therapeutic role in RA pathogenesis by modulating helper T cell immune responses and matrix-degrading enzymes. The immunosuppressive effects of OAA were comparable to dexamethasone and ketoprofen. We provide evidences that OAA could be a potential therapeutic candidate for RA. - Highlights: • OAA attenuated chronic CIA symptoms. • OAA had a regulating effect on the T helper cell immune reaction for CIA. • The effect of OAA on the RA was comparable to the dexamethasone or ketoprofen. • OAA might be a candidate for the treatment of arthritic diseases.« less
Understanding the T cell immune response in SARS coronavirus infection
Janice Oh, Hsueh-Ling; Ken-En Gan, Samuel; Bertoletti, Antonio; Tan, Yee-Joo
2012-01-01
The severe acute respiratory syndrome (SARS) epidemic started in late 2002 and swiftly spread across 5 continents with a mortality rate of around 10%. Although the epidemic was eventually controlled through the implementation of strict quarantine measures, there continues a need to investigate the SARS coronavirus (SARS-CoV) and develop interventions should it re-emerge. Numerous studies have shown that neutralizing antibodies against the virus can be found in patients infected with SARS-CoV within days upon the onset of illness and lasting up to several months. In contrast, there is little data on the kinetics of T cell responses during SARS-CoV infection and little is known about their role in the recovery process. However, recent studies in mice suggest the importance of T cells in viral clearance during SARS-CoV infection. Moreover, a growing number of studies have investigated the memory T cell responses in recovered SARS patients. This review covers the available literature on the emerging importance of T cell responses in SARS-CoV infection, particularly on the mapping of cytotoxic T lymphocyte (CTL) epitopes, longevity, polyfunctionality and human leukocyte antigen (HLA) association as well as their potential implications on treatment and vaccine development. PMID:26038429
Understanding the T cell immune response in SARS coronavirus infection.
Janice Oh, Hsueh-Ling; Ken-En Gan, Samuel; Bertoletti, Antonio; Tan, Yee-Joo
2012-09-01
The severe acute respiratory syndrome (SARS) epidemic started in late 2002 and swiftly spread across 5 continents with a mortality rate of around 10%. Although the epidemic was eventually controlled through the implementation of strict quarantine measures, there continues a need to investigate the SARS coronavirus (SARS-CoV) and develop interventions should it re-emerge. Numerous studies have shown that neutralizing antibodies against the virus can be found in patients infected with SARS-CoV within days upon the onset of illness and lasting up to several months. In contrast, there is little data on the kinetics of T cell responses during SARS-CoV infection and little is known about their role in the recovery process. However, recent studies in mice suggest the importance of T cells in viral clearance during SARS-CoV infection. Moreover, a growing number of studies have investigated the memory T cell responses in recovered SARS patients. This review covers the available literature on the emerging importance of T cell responses in SARS-CoV infection, particularly on the mapping of cytotoxic T lymphocyte (CTL) epitopes, longevity, polyfunctionality and human leukocyte antigen (HLA) association as well as their potential implications on treatment and vaccine development.
Wang, Raymond M; Johnson, Todd D; He, Jingjin; Rong, Zhili; Wong, Michelle; Nigam, Vishal; Behfar, Atta; Xu, Yang; Christman, Karen L
2017-06-01
Current assessment of biomaterial biocompatibility is typically implemented in wild type rodent models. Unfortunately, different characteristics of the immune systems in rodents versus humans limit the capability of these models to mimic the human immune response to naturally derived biomaterials. Here we investigated the utility of humanized mice as an improved model for testing naturally derived biomaterials. Two injectable hydrogels derived from decellularized porcine or human cadaveric myocardium were compared. Three days and one week after subcutaneous injection, the hydrogels were analyzed for early and mid-phase immune responses, respectively. Immune cells in the humanized mouse model, particularly T-helper cells, responded distinctly between the xenogeneic and allogeneic biomaterials. The allogeneic extracellular matrix derived hydrogels elicited significantly reduced total, human specific, and CD4 + T-helper cell infiltration in humanized mice compared to xenogeneic extracellular matrix hydrogels, which was not recapitulated in wild type mice. T-helper cells, in response to the allogeneic hydrogel material, were also less polarized towards a pro-remodeling Th2 phenotype compared to xenogeneic extracellular matrix hydrogels in humanized mice. In both models, both biomaterials induced the infiltration of macrophages polarized towards a M2 phenotype and T-helper cells polarized towards a Th2 phenotype. In conclusion, these studies showed the importance of testing naturally derived biomaterials in immune competent animals and the potential of utilizing this humanized mouse model for further studying human immune cell responses to biomaterials in an in vivo environment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Akt signaling is critical for memory CD8+ T-cell development and tumor immune surveillance.
Rogel, Anne; Willoughby, Jane E; Buchan, Sarah L; Leonard, Henry J; Thirdborough, Stephen M; Al-Shamkhani, Aymen
2017-02-14
Memory CD8 + T cells confer long-term immunity against tumors, and anticancer vaccines therefore should maximize their generation. Multiple memory CD8 + T-cell subsets with distinct functional and homing characteristics exist, but the signaling pathways that regulate their development are ill defined. Here we examined the role of the serine/threonine kinase Akt in the generation of protective immunity by CD8 + T cells. Akt is known to be activated by the T-cell antigen receptor and the cytokine IL-2, but its role in T-cell immunity in vivo has not been explored. Using CD8 + T cells from pdk1 K465E/K465E knockin mice, we found that decreased Akt activity inhibited the survival of T cells during the effector-to-memory cell transition and abolished their differentiation into C-X-C chemokine receptor 3 (CXCR3) lo CD43 lo effector-like memory cells. Consequently, antitumor immunity by CD8 + T cells that display defective Akt signaling was substantially diminished during the memory phase. Reduced memory T-cell survival and altered memory cell differentiation were associated with up-regulation of the proapoptotic protein Bim and the T-box transcription factor eomesodermin, respectively. These findings suggest an important role for effector-like memory CD8 + T cells in tumor immune surveillance and identify Akt as a key signaling node in the development of protective memory CD8 + T-cell responses.
Akt signaling is critical for memory CD8+ T-cell development and tumor immune surveillance
Rogel, Anne; Willoughby, Jane E.; Buchan, Sarah L.; Leonard, Henry J.; Thirdborough, Stephen M.; Al-Shamkhani, Aymen
2017-01-01
Memory CD8+ T cells confer long-term immunity against tumors, and anticancer vaccines therefore should maximize their generation. Multiple memory CD8+ T-cell subsets with distinct functional and homing characteristics exist, but the signaling pathways that regulate their development are ill defined. Here we examined the role of the serine/threonine kinase Akt in the generation of protective immunity by CD8+ T cells. Akt is known to be activated by the T-cell antigen receptor and the cytokine IL-2, but its role in T-cell immunity in vivo has not been explored. Using CD8+ T cells from pdk1K465E/K465E knockin mice, we found that decreased Akt activity inhibited the survival of T cells during the effector-to-memory cell transition and abolished their differentiation into C-X-C chemokine receptor 3 (CXCR3)loCD43lo effector-like memory cells. Consequently, antitumor immunity by CD8+ T cells that display defective Akt signaling was substantially diminished during the memory phase. Reduced memory T-cell survival and altered memory cell differentiation were associated with up-regulation of the proapoptotic protein Bim and the T-box transcription factor eomesodermin, respectively. These findings suggest an important role for effector-like memory CD8+ T cells in tumor immune surveillance and identify Akt as a key signaling node in the development of protective memory CD8+ T-cell responses. PMID:28137869
Kulkarni, Shruti P; Thanapati, Subrat; Arankalle, Vidya A; Tripathy, Anuradha S
2016-11-21
Liposome encapsulated neutralizing epitope protein of Hepatitis E virus (HEV), rNEp, our Hepatitis E vaccine candidate, was shown to be immunogenic and safe in pregnant and non-pregnant mice and yielded sterilizing immunity in rhesus monkeys. The current study in Balb/c mice assessed the levels and persistence of anti-HEV IgG antibodies by ELISA, frequencies of B, memory B, T and memory T cells by flow cytometry and HEV-specific IgG secreting memory B cells by ELISPOT till 420days post immunization (PI) with 5?g rNEp encapsulated in liposome based adjuvant (2 doses, 4weeks apart). Mice immunized with a lower dose (1?g) were assessed only for anamnestic response post booster dose. Vaccine candidate immunized mice (5?g dose) elicited strong anti-HEV IgG response that was estimated to persist for lifetime. At day 120 PI, frequency of memory B cells was higher in immunized mice than those receiving adjuvant alone. Anti-HEV IgG titers were lower in mice immunized with 1?g dose. A booster dose yielded a heightened antibody response in mice with both high (>800GMT, 5?g) and low (?100GMT, 1?g) anti-HEV IgG titers. At day 6th post booster dose, HEV-specific antibody secreting plasma cells (ASCs) were detected in 100% and 50% of mice with high and low anti-HEV IgG titers, respectively, whereas the frequencies of CD4 + central and effector memory T cells were high in mice with high anti-HEV IgG titers only. Taken together, the vaccine candidate effectively generates persistent and anamnestic antibody response, elicits participation of CD4 + memory T cells and triggers memory B cells to differentiate into ASCs upon boosting. This approach of assessing the immunogenicity of vaccine candidate could be useful to explore the longevity of HEV-specific memory response in future HEV vaccine trials in human. Copyright © 2016. Published by Elsevier Ltd.
Response of γδ T cells to plant-derived tannins
Holderness, Jeff; Hedges, Jodi F.; Daughenbaugh, Katie; Kimmel, Emily; Graff, Jill; Freedman, Brett; Jutila, Mark A.
2008-01-01
Many pharmaceutical drugs are isolated from plants used in traditional medicines. Through screening plant extracts, both traditional medicines and compound libraries, new pharmaceutical drugs continue to be identified. Currently, two plant-derived agonists for γδ T cells are described. These plant-derived agonists impart innate effector functions upon distinct γδ T cell subsets. Plant tannins represent one class of γδ T cell agonist and preferentially activate the mucosal population. Mucosal γδ T cells function to modulate tissue immune responses and induce epithelium repair. Select tannins, isolated from apple peel, rapidly induce immune gene transcription in γδ T cells, leading to cytokine production and increased responsiveness to secondary signals. Activity of these tannin preparations tracks to the procyanidin fraction, with the procyanidin trimer (C1) having the most robust activity defined to date. The response to the procyanidins is evolutionarily conserved in that responses are seen with human, bovine, and murine γδ T cells. Procyanidin-induced responses described in this review likely account for the expansion of mucosal γδ T cells seen in mice and rats fed soluble extracts of tannins. Procyanidins may represent a novel approach for treatment of tissue damage, chronic infection, and autoimmune therpies. PMID:19166386
Radiation-induced immune responses: mechanisms and therapeutic perspectives.
Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One
2016-09-01
Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.
Role of T cell death in maintaining immune tolerance during persistent viral hepatitis.
Larrubia, Juan Ramón; Lokhande, Megha Uttam; García-Garzón, Silvia; Miquel, Joaquín; Subirá, Dolores; Sanz-de-Villalobos, Eduardo
2013-03-28
Virus-specific T cells play an important role in the resolution of hepatic infection. However, during chronic hepatitis infection these cells lack their effector functions and fail to control the virus. Hepatitis B virus and hepatitis C virus have developed several mechanisms to generate immune tolerance. One of these strategies is the depletion of virus-specific T cells by apoptosis. The immunotolerogenic liver has unique property to retain and activate naïve T cell to avoid the over reactivation of immune response against antigens which is exploited by hepatotropic viruses to persist. The deletion of the virus-specific T cells occurs by intrinsic (passive) apoptotic mechanism. The pro-apoptotic molecule Bcl-2 interacting mediator (Bim) has attracted increasing attention as a pivotal involvement in apoptosis, as a regulator of tissue homeostasis and an enhancer for the viral persistence. Here, we reviewed our current knowledge on the evidence showing critical role of Bim in viral-specific T cell death by apoptotic pathways and helps in the immune tolerance.
Immune and inflammatory responses in pigs infected with Trichuris suis and Oesophagostomum dentatum.
Andreasen, Annette; Petersen, Heidi H; Kringel, Helene; Iburg, Tine M; Skovgaard, Kerstin; Dawson, Harry; Urban, Joseph F; Thamsborg, Stig M
2015-01-30
The aim of the present study was to investigate parasite induced immune responses in pigs co-infected with Trichuris suis and Oesophagostomum dentatum as compared to mono-species infected pigs. T. suis is known to elicit a strong immune response leading to rapid expulsion, and a strong antagonistic effect on O. dentatum populations has been observed in co-infected pigs. Forty-eight helminth naïve pigs were allocated into 4 groups in a 2-factorial design. Two groups were trickle inoculated with either 10 T. suis eggs/kg/day (Group T) or 20 O. dentatum L3/kg/day (Group O). Group OT was infected with same levels of both T. suis and O. dentatum (Group OT) and Group C remained uninfected. In each group, six pigs were necropsied after 35 days and the remaining pigs after 71 days. Parasite E/S-antigen specific serum antibodies were quantified by an in-direct ELISA. qPCR was used to measure the expression of immune function related genes in the mucosa of proximal colon and the draining lymph node. Highly significant interactions were identified for O. dentatum specific IgG1 (p<0.0001) and IgG2 (p<0.0006) antibodies with a remarkable 2-fold higher antibody response in group OT pigs as compared to group O. These findings indicated that T. suis enhanced the antibody response against O. dentatum in Group OT. The gene expression data confirmed a strong Type 2 response to T. suis (e.g. marked increase in IL-13, ARG1 and CCL11) and clearly weaker in amplitude and/or delayed onset response to O. dentatum in the single infected group. Interactions were found between the two nematodes with regard to several cytokines, e.g. the increase in IL-13 observed in Group T was absent in Group OT (p=0.06, proximal colon mucosa, 35 and 71 p.i.). Some of these immune response-related interactions may support, or even partially explain, the observed interactions between the two worm populations in co-infected pigs. Copyright © 2014 Elsevier B.V. All rights reserved.
Xie, Y; Chen, Y; Ahmed, K A; Li, W; Ahmed, S; Sami, A; Chibbar, R; Tang, X; Tao, M; Xu, J; Xiang, J
2013-10-01
One of the major obstacles in human epidermal growth factor receptor (HER)-2/neu-specific trastuzumab immunotherapy of HER2/neu-positive breast cancer is the development of trastuzumab resistance, warranting the search for other therapeutic strategies. Although dendritic cell (DC) vaccines have been extensively applied in clinical trials for cancer treatment, the vaccination efficacy is still limited, mostly because DC vaccines are not sufficient to break tumor-associated antigen-specific self-immune tolerance in cancer patients. P30 (FNNFTVSFWLRVPKVSASHLE) derived from tetanus toxin is a universally potent CD4(+) T helper epitope capable of enhancing CD8(+) cytotoxic T-lymphocyte (CTL) responses. In this study, we constructed two recombinant adenoviral vectors (AdVs), AdVOVA-P30 and AdVHER2/neu-P30, expressing ovalbumin (OVA)-P30 and HER2/neu-P30. In order to enhance DC vaccine efficacy, we transfected mouse bone marrow (BM)-derived DCs with AdVOVA-P30 and AdVHER2/neu-P30 to generate engineered DCOVA-P30 and DCHER2/neu-P30 vaccines, respectively. We, then, compared CD4(+) and CD8(+) T-cell responses and antitumor immunity derived from DCOVA-P30 and DCHER2/neu-P30 vaccination in wild-type C57BL/6 and transgenic FVBneuN mice, respectively. We demonstrate that engineered DCOVA-P30 vaccine stimulates more efficient CD4(+) and CD8(+) T-cell responses than DCOVA in C57BL/6 mice. Interestingly, the increased DCOVA-P30-induced CTL responses are mainly contributed by enhanced CD4(+) T-cell-stimulated CTL proliferation. We show that DCOVA-P30 vaccine also stimulates more efficient therapeutic immunity against OVA-expressing BL6-10OVA melanoma than DCOVA in C57BL/6 mice. In addition, we demonstrate that DCHER2/neu-P30 vaccine stimulates more efficient CD4(+) and CD8(+) T-cell responses and protective immunity against HER2/neu-expressing Tg1-1 breast cancer than DCHER2/neu in transgenic FVBneuN mice with HER2/neu-specific self-immune tolerance. Therefore, the engineered DCHER
Hartman, Zachary C.; Osada, Takuya; Glass, Oliver; Yang, Xiao Y.; Lei, Gang-jun; Lyerly, H. Kim; Clay, Timothy M.
2010-01-01
Although critical for initiating and regulating immune responses, the therapeutic use of individual cytokines as anti-cancer immunotherapeutic agents has achieved only modest clinical success. Consequently, many current strategies have focused on the use of specific immunotherapeutic agonists that engage individual receptors of innate immune networks, such as the Toll Like-Receptor (TLR) system, each resulting in specific patterns of gene expression, cytokine production and inflammatory outcome. However, these immunotherapeutics are constrained by variable cellular TLR expression and responsiveness to particular TLR agonists, as well as the specific cellular context of different tumors. We hypothesized that overexpression of MyD88, a pivotal regulator of multiple TLR signaling pathways, could circumvent these constraints and mimic coordinated TLR signaling across all cell types in a ligand independent fashion. To explore this hypothesis, we generated an adenoviral vector expressing MyD88 and demonstrate that Ad-MyD88 infection elicits extensive Th1-specific transcriptional and secreted cytokine signatures in all murine and human cell types tested in vitro and in vivo. Importantly, in vivo intratumoral injection of Ad-MyD88 into established tumor masses enhanced adaptive immune responses and inhibited local tumor immunosuppression, resulting in significantly inhibited local and systemic growth of multiple tumor types. Finally, Ad-MyD88 infection of primary human dendritic cells, tumor associated fibroblasts, and colorectal carcinoma cells elicited significant Th1-type cytokine responses, resulting in enhanced tumor cell lysis and expansion of human tumor antigen-specific T-cells. Thus, Ad-MyD88 initiated robust anti-tumor activity in established murine tumor microenvironments and in human contexts, suggesting its potential effectiveness as a clinical immunotherapeutic strategy. PMID:20823152
Wu, Junjie; Waxman, David J
2015-01-01
Cancer chemotherapy using cytotoxic drugs can induce immunogenic tumor cell death; however, dosing regimens and schedules that enable single-agent chemotherapy to induce adaptive immune-dependent ablation of large, established tumors with activation of long-term immune memory have not been identified. Here, we investigate this issue in a syngeneic, implanted GL261 glioma model in immune-competent mice given cyclophosphamide on a 6-day repeating metronomic schedule. Two cycles of metronomic cyclophosphamide treatment induced sustained upregulation of tumor-associated CD8+ cytotoxic T lymphocyte (CTL) cells, natural killer (NK) cells, macrophages, and other immune cells. Expression of CTL- and NK–cell-shared effectors peaked on Day 6, and then declined by Day 9 after the second cyclophosphamide injection and correlated inversely with the expression of the regulatory T cell (Treg) marker Foxp3. Sustained tumor regression leading to tumor ablation was achieved after several cyclophosphamide treatment cycles. Tumor ablation required CD8+ T cells, as shown by immunodepletion studies, and was associated with immunity to re-challenge with GL261 glioma cells, but not B16-F10 melanoma or Lewis lung carcinoma cells. Rejection of GL261 tumor re-challenge was associated with elevated CTLs in blood and increased CTL infiltration in tumors, consistent with the induction of long-term, specific CD8+ T-cell anti-GL261 tumor memory. Co-depletion of CD8+ T cells and NK cells did not inhibit tumor regression beyond CD8+ T-cell depletion alone, suggesting that the metronomic cyclophosphamide-activated NK cells function via CD8a+ T cells. Taken together, these findings provide proof-of-concept that single-agent chemotherapy delivered on an optimized metronomic schedule can eradicate large, established tumors and induce long-term immune memory. PMID:26137402
Zhao, X; Sun, G; Sun, X; Tian, D; Liu, K; Liu, T; Cong, M; Xu, H; Li, X; Shi, W; Tian, Y; Yao, J; Guo, H; Zhang, D
2016-01-01
CD4+ T lymphocytes are key players in the adaptive immune system and can differentiate into a variety of effector and regulatory T cells. Here, we provide evidence that a novel differentiation pathway of CD4+ T cells shifts the balance from a destructive T-cell response to one that favors regulation in an immune-mediated liver injury model. Peripheral CD4−CD8−NK1.1− double-negative T cells (DNT) was increased following Concanavalin A administration in mice. Adoptive transfer of DNT led to significant protection from hepatocyte necrosis by direct inhibition on the activation of lymphocytes, a process that occurred primarily through the perforin-granzyme B route. These DNT converted from CD4+ rather than CD8+ T cells, a process primarily regulated by OX40. DNT migrated to the liver through the CXCR3-CXCL9/CXCL10 interaction. In conclusion, we elucidated a novel differentiation pathway from activated CD4+ T cells to regulatory DNT cells for maintaining homeostasis of the immune system in vivo, and provided key evidence that utilizing this novel differentiation pathway has potential application in the prevention and treatment of autoimmune diseases. PMID:27077809
Da-Cruz, Alda Maria; Bittar, Rita; Mattos, Marise; Oliveira-Neto, Manuel P.; Nogueira, Ricardo; Pinho-Ribeiro, Vanessa; Azeredo-Coutinho, Rilza Beatriz; Coutinho, Sergio G.
2002-01-01
T-cell immune responses in patients with cutaneous leishmaniasis (CL) and mucosal leishmaniasis (ML) were studied during the active disease, at the end of therapy, and 1 to 17 years posttherapy (long-term follow-up). Lymphocyte proliferative responses, phenotypic characterization of CD4+ and CD8+ Leishmania-reactive T cells, and cytokine production were assayed. Patients with active ML and CL showed higher proportions of CD4+ than CD8+ T cells. In CL, the healing process was associated with a decrease of CD4+ and an increase of CD8+, leading to similar CD4+ and CD8+ proportions. This pattern was only seen in ML after long-term therapy. Long-term follow-up of patients with CL showed a positive CD4+/CD8+ ratio as observed during the active disease, although the percentages of these T cell subsets were significantly lower. Patients with CL did not show significant differences between gamma interferon (IFN-γ) and interleukin-5 (IL-5) production during the period of study. Patients with active ML presented higher IFN-γ and IL-5 levels compared to patients with active CL. IL-4 was only detected during active disease. Patients long term after cure from ML showed increasing production of IFN-γ, significant decrease of IL-5, and no IL-4 production. Two apparently beneficial immunological parameters were detected in tegumentary leishmaniasis: (i) decreasing proportions of CD4+ Leishmania-reactive T cells in the absence of IL-4 production associated with cure of CL and ML and (ii) decreasing levels of IL-5 long after cure, better detected in patients with ML. The observed T-cell responses maintained for a long period in healed patients could be relevant for immunoprotection against reinfection and used as a parameter for determining the prognosis of patients and selecting future vaccine preparations. PMID:11874860
Mahan, C. Scott; Zalwango, Sarah; Thiel, Bonnie A.; Malone, LaShaunda L.; Chervenak, Keith A.; Baseke, Joy; Dobbs, Dennis; Stein, Catherine M.; Mayanja, Harriet; Joloba, Moses; Whalen, Christopher C.; Boom, W. Henry
2012-01-01
Contacts of active pulmonary tuberculosis (TB) patients are at risk for Mycobacterium tuberculosis (MTB) infection. Because most infections are controlled, studies during MTB infection provide insight into protective immunity. We compared immune responses of adult household contacts that did and did not convert the tuberculin skin test (TST). Innate and adaptive immune responses were measured by whole blood assay. Responses of TST converters (TSTC) were compared with persistently TST negative contacts (PTST–) and contacts who were TST+ at baseline (TST+). TLR-2, TLR-4, and IFN-γR responses to IFN-γ did not differ between the groups, nor did γδ T cell responses. T cell responses to MTB antigens differed markedly among TSTC, PTST–, and TST+ contacts. Thus, no differences in innate responses were found among the three household contact groups. However, adaptive T cell responses to MTB antigens did differ before and during MTB infection among PTST–, TSTC, and TST+ contacts. PMID:22492155
Immune oncology, immune responsiveness and the theory of everything.
Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue
2018-06-05
Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.
Bain, Christine; Parroche, Peggy; Lavergne, Jean Pierre; Duverger, Blandine; Vieux, Claude; Dubois, Valérie; Komurian-Pradel, Florence; Trépo, Christian; Gebuhrer, Lucette; Paranhos-Baccala, Glaucia; Penin, François; Inchauspé, Geneviève
2004-01-01
In vitro studies have described the synthesis of an alternative reading frame form of the hepatitis C virus (HCV) core protein that was named F protein or ARFP (alternative reading frame protein) and includes a domain coded by the +1 open reading frame of the RNA core coding region. The expression of this protein in HCV-infected patients remains controversial. We have analyzed peripheral blood from 47 chronically or previously HCV-infected patients for the presence of T lymphocytes and antibodies specific to the ARFP. Anti-ARFP antibodies were detected in 41.6% of the patients infected with various HCV genotypes. Using a specific ARFP 99-amino-acid polypeptide as well as four ARFP predicted class I-restricted 9-mer peptides, we show that 20% of the patients display specific lymphocytes capable of producing gamma interferon, interleukin-10, or both cytokines. Patients harboring three different viral genotypes (1a, 1b, and 3) carried T lymphocytes reactive to genotype 1b-derived peptides. In longitudinal analysis of patients receiving therapy, both core and ARFP-specific T-cell- and B-cell-mediated responses were documented. The magnitude and kinetics of the HCV antigen-specific responses differed and were not linked with viremia or therapy outcome. These observations provide strong and new arguments in favor of the synthesis, during natural HCV infection, of an ARFP derived from the core sequence. Moreover, the present data provide the first demonstration of the presence of T-cell-mediated immune responses directed to this novel HCV antigen. PMID:15367612
Lee, JangEun; Ling, Changying; Kosmalski, Michelle M.; Hulseberg, Paul; Schreiber, Heidi A.; Sandor, Matyas; Fabry, Zsuzsanna
2010-01-01
To study whether cerebral mycobacterial infection induces granuloma and protective immunity similar to systemic infection, we intracerebrally infected mice with Mycobacterium bovis bacilli Calmette-Guerin. Granuloma and IFN-γ+CD4+ T cell responses are induced in the central nervous system (CNS) similar to periphery, but the presence of IFN-γIL-17 double-positive CD4+ T cells is unique to the CNS. The major CNS source of TNF-α is microglia, with modest production by CD4+ T cells and macrophage. Protective immunity is accompanied by accumulation of Foxp3+CD4+ T cells and PD-L2+ dendritic cells, suggesting that both inflammatory and anti-inflammatory responses develop in the CNS following mycobacterial infection. PMID:19535154
Campisi, Jay; Sharkey, Craig; Johnson, John D; Asea, Alexzander; Maslanik, Thomas; Bernstein-Hanley, Isaac; Fleshner, Monika
2012-11-01
Activation of the in vivo stress response can facilitate antibacterial host defenses. One possible mechanism for this effect is stress-induced release of heat shock protein 72 (Hsp72) into the extracellular environment. Hsp72 is a ubiquitous cellular protein that is up-regulated in response to cellular stress, and modulates various aspects of immune function including macrophage inflammatory/bactericidal responses and T-cell function when found in the extracellular environment. The current study tested the hypothesis that in vivo extracellular Hsp72 (eHsp72) at the site of inflammation contributes to stress-induced restricted development of bacteria, and facilitated recovery from bacteria-induced inflammation, and that this effect is independent of alpha beta (αβ) T cells. Male F344 rats were exposed to either inescapable electrical tail-shocks or no stress, and subcutaneously injected with Escherichia coli (ATCC 15746). The role of eHsp72 was investigated by Hsp72-immunoneutralization at the inflammatory site. The potential contribution of T cells was examined by testing male athymic (rnu/rnu) nude rats lacking mature αβ T cells and heterozygous thymic intact control (rnu/+) rats. The results were that stressor exposure increased plasma concentrations of eHsp72 and facilitated recovery from bacterial inflammation. Immunoneutralization of eHsp72 at the inflammatory site attenuated this effect. Stressor exposure impacted bacterial inflammation and eHsp72 equally in both athymic and intact control rats. These results support the hypothesis that eHsp72 at the site of inflammation, and not αβ T cells, contributes to the effect of stressor exposure on subcutaneous bacterial inflammation.
Leptin Metabolically Licenses T Cells for Activation to Link Nutrition and Immunity
Saucillo, Donte C.; Gerriets, Valerie A.; Sheng, John; Rathmell, Jeffrey C.; MacIver, Nancie J.
2013-01-01
Immune responses are highly energy dependent processes. Activated T cells increase glucose uptake and aerobic glycolysis to survive and function. Malnutrition and starvation limit nutrients and are associated with immune deficiency and increased susceptibility to infection. While it is clear that immunity is suppressed in times of nutrient stress, mechanisms that link systemic nutrition to T cell function are poorly understood. We show here that fasting leads to persistent defects in T cell activation and metabolism, as T cells from fasted animals had low glucose uptake and decreased ability to produce inflammatory cytokines, even when stimulated in nutrient-rich media. To explore the mechanism of this long-lasting T cell metabolic defect, we examined leptin, an adipokine reduced in fasting that regulates systemic metabolism and promotes effector T cell function. We show leptin is essential for activated T cells to upregulate glucose uptake and metabolism. This effect was cell-intrinsic and specific to activated effector T cells, as naïve T cells and Treg did not require leptin for metabolic regulation. Importantly, either leptin addition to cultured T cells from fasted animals or leptin injections to fasting animals was sufficient to rescue both T cell metabolic and functional defects. Leptin-mediated metabolic regulation was critical, as transgenic expression of the glucose transporter Glut1 rescued cytokine production of T cells from fasted mice. Together, these data demonstrate that induction of T cell metabolism upon activation is dependent on systemic nutritional status, and leptin links adipocytes to metabolically license activated T cells in states of nutritional sufficiency. PMID:24273001
POLE Proofreading Mutations Elicit an Antitumor Immune Response in Endometrial Cancer.
van Gool, Inge C; Eggink, Florine A; Freeman-Mills, Luke; Stelloo, Ellen; Marchi, Emanuele; de Bruyn, Marco; Palles, Claire; Nout, Remi A; de Kroon, Cor D; Osse, Elisabeth M; Klenerman, Paul; Creutzberg, Carien L; Tomlinson, Ian Pm; Smit, Vincent Thbm; Nijman, Hans W; Bosse, Tjalling; Church, David N
2015-07-15
Recent studies have shown that 7% to 12% of endometrial cancers are ultramutated due to somatic mutation in the proofreading exonuclease domain of the DNA replicase POLE. Interestingly, these tumors have an excellent prognosis. In view of the emerging data linking mutation burden, immune response, and clinical outcome in cancer, we investigated whether POLE-mutant endometrial cancers showed evidence of increased immunogenicity. We examined immune infiltration and activation according to tumor POLE proofreading mutation in a molecularly defined endometrial cancer cohort including 47 POLE-mutant tumors. We sought to confirm our results by analysis of RNAseq data from the TCGA endometrial cancer series and used the same series to examine whether differences in immune infiltration could be explained by an enrichment of immunogenic neoepitopes in POLE-mutant endometrial cancers. Compared with other endometrial cancers, POLE mutants displayed an enhanced cytotoxic T-cell response, evidenced by increased numbers of CD8(+) tumor-infiltrating lymphocytes and CD8A expression, enrichment for a tumor-infiltrating T-cell gene signature, and strong upregulation of the T-cell cytotoxic differentiation and effector markers T-bet, Eomes, IFNG, PRF, and granzyme B. This was accompanied by upregulation of T-cell exhaustion markers, consistent with chronic antigen exposure. In silico analysis confirmed that POLE-mutant cancers are predicted to display more antigenic neoepitopes than other endometrial cancers, providing a potential explanation for our findings. Ultramutated POLE proofreading-mutant endometrial cancers are characterized by a robust intratumoral T-cell response, which correlates with, and may be caused by an enrichment of antigenic neopeptides. Our study provides a plausible mechanism for the excellent prognosis of these cancers. ©2015 American Association for Cancer Research.
Anipindi, Varun C.; Dizzell, Sara E.; Nguyen, Philip V.; Shaler, Christopher R.; Chu, Derek K.; Jiménez-Saiz, Rodrigo; Liang, Hong; Swift, Stephanie; Nazli, Aisha; Kafka, Jessica K.; Bramson, Jonathan; Xing, Zhou; Jordana, Manel; Wan, Yonghong; Snider, Denis P.; Stampfli, Martin R.; Kaushic, Charu
2016-01-01
Clinical and experimental studies have shown that estradiol (E2) confers protection against HIV and other sexually transmitted infections. Here, we investigated the underlying mechanism. Better protection in E2-treated mice, immunized against genital HSV-2, coincided with earlier recruitment and higher proportions of Th1 and Th17 effector cells in the vagina post-challenge, compared to placebo-treated controls. Vaginal APCs isolated from E2-treated mice induced 10-fold higher Th17 and Th1 responses, compared to APCs from progesterone-treated, placebo-treated, and estradiol-receptor knockout mice in APC-T cell co-cultures. CD11c+ DCs in the vagina were the predominant APC population responsible for priming these Th17 responses, and a potent source of IL-6 and IL-1β, important factors for Th17 differentiation. Th17 responses were abrogated in APC-T cell co-cultures containing IL-1β KO, but not IL-6 KO vaginal DCs, showing that IL-1β is a critical factor for Th17 induction in the genital tract. E2 treatment in vivo directly induced high expression of IL-1β in vaginal DCs, and addition of IL-1β restored Th17 induction by IL-1β KO APCs in co-cultures. Finally, we examined the role of IL-17 in anti-HSV-2 memory T cell responses. IL-17 KO mice were more susceptible to intravaginal HSV-2 challenge, compared to WT controls, and vaginal DCs from these mice were defective at priming efficient Th1 responses in vitro, indicating that IL-17 is important for the generation of efficient anti-viral memory responses. We conclude that the genital mucosa has a unique microenvironment whereby E2 enhances CD4+ T cell anti-viral immunity by priming vaginal DCs to induce Th17 responses through an IL-1-dependent pathway. PMID:27148737
Metcalf, Talibah U; Cubas, Rafael A; Ghneim, Khader; Cartwright, Michael J; Grevenynghe, Julien Van; Richner, Justin M; Olagnier, David P; Wilkinson, Peter A; Cameron, Mark J; Park, Byung S; Hiscott, John B; Diamond, Michael S; Wertheimer, Anne M; Nikolich-Zugich, Janko; Haddad, Elias K
2015-01-01
Aging leads to dysregulation of multiple components of the immune system that results in increased susceptibility to infections and poor response to vaccines in the aging population. The dysfunctions of adaptive B and T cells are well documented, but the effect of aging on innate immunity remains incompletely understood. Using a heterogeneous population of peripheral blood mononuclear cells (PBMCs), we first undertook transcriptional profiling and found that PBMCs isolated from old individuals (≥ 65 years) exhibited a delayed and altered response to stimulation with TLR4, TLR7/8, and RIG-I agonists compared to cells obtained from adults (≤ 40 years). This delayed response to innate immune agonists resulted in the reduced production of pro-inflammatory and antiviral cytokines and chemokines including TNFα, IL-6, IL-1β, IFNα, IFNγ, CCL2, and CCL7. While the major monocyte and dendritic cell subsets did not change numerically with aging, activation of specific cell types was altered. PBMCs from old subjects also had a lower frequency of CD40+ monocytes, impaired up-regulation of PD-L1 on monocytes and T cells, and increased expression of PD-L2 and B7-H4 on B cells. The defective immune response to innate agonists adversely affected adaptive immunity as TLR-stimulated PBMCs (minus CD3 T cells) from old subjects elicited significantly lower levels of adult T-cell proliferation than those from adult subjects in an allogeneic mixed lymphocyte reaction (MLR). Collectively, these age-associated changes in cytokine, chemokine and interferon production, as well as co-stimulatory protein expression could contribute to the blunted memory B- and T-cell immune responses to vaccines and infections. PMID:25728020
Gilchuk, Pavlo; Knight, Frances C; Wilson, John T; Joyce, Sebastian
2017-01-01
CD8+ cytotoxic T lymphocytes confer protection against infectious diseases caused by viruses, bacteria, and parasites. Hence, significant efforts have been invested into devising ways to generate CD8+ T cell-targeted vaccines. Generation of microbe-free protein subunit vaccines requires a thorough knowledge of protective target antigens. Such antigens are proteolytically processed peptides presented by MHC class I molecules. To induce a robust antigen-specific CD8+ T cell response through vaccination, it is essential to formulate the antigen with an effective adjuvant. Here, we describe a versatile method for generating high-frequency antigen-specific CD8+ T cells through immunization of mice using the invariant natural killer T cell agonist α-galactosylceramide as the adjuvant.
Phenytoin promotes Th2 type immune response in mice
Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U
2001-01-01
The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401
Pre-existing immunity against Ad vectors: humoral, cellular, and innate response, what's important?.
Fausther-Bovendo, Hugues; Kobinger, Gary P
2014-01-01
Pre-existing immunity against human adenovirus (HAd) serotype 5 derived vector in the human population is widespread, thus hampering its clinical use. Various components of the immune system, including neutralizing antibodies (nAbs), Ad specific T cells and type I IFN activated NK cells, contribute to dampening the efficacy of Ad vectors in individuals with pre-existing Ad immunity. In order to circumvent pre-existing immunity to adenovirus, numerous strategies, such as developing alternative Ad serotypes, varying immunization routes and utilizing prime-boost regimens, are under pre-clinical or clinical phases of development. However, these strategies mainly focus on one arm of pre-existing immunity. Selection of alternative serotypes has been largely driven by the absence in the human population of nAbs against them with little attention paid to cross-reactive Ad specific T cells. Conversely, varying the route of immunization appears to mainly rely on avoiding Ad specific tissue-resident T cells. Finally, prime-boost regimens do not actually circumvent pre-existing immunity but instead generate immune responses of sufficient magnitude to confer protection despite pre-existing immunity. Combining the above strategies and thus taking into account all components regulating pre-existing Ad immunity will help further improve the development of Ad vectors for animal and human use.
Sedlik, C; Dridi, A; Deriaud, E; Saron, M F; Rueda, P; Sarraseca, J; Casal, J I; Leclerc, C
1999-04-01
We previously demonstrated that chimeric porcine parvovirus-like particles (PPV:VLP) carrying heterologous epitopes, when injected intraperitoneally into mice without adjuvant, activate strong CD4(+) and CD8(+) T-cell responses specific for the foreign epitopes. In the present study, we investigated the immunogenicity of PPV:VLP carrying a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus (LCMV) administered by mucosal routes. Mice immunized intranasally with recombinant PPV:VLP, in the absence of adjuvant, developed high levels of PPV-specific immunoglobulin G (IgG) and/or IgA in their serum, as well as in mucosal sites such as the bronchoalveolar and intestinal fluids. Antibodies in sera from mice immunized parenterally or intranasally with PPV:VLP were strongly neutralizing in vitro. Intranasal immunization with PPV:VLP carrying the LCMV CD8(+) T-cell epitope also elicited a strong peptide-specific cytotoxic-T-cell (CTL) response. In contrast, mice orally immunized with recombinant PPV:VLP did not develop any antibody or CTL responses. We also showed that mice primed with PPV:VLP are still able to develop strong CTL responses after subsequent immunization with chimeric PPV:VLP carrying a foreign CD8(+) T-cell epitope. These results highlight the attractive potential of PPV:VLP as a safe, nonreplicating antigen carrier to stimulate systemic and mucosal immunity after nasal administration.
Sedlik, C.; Dridi, A.; Deriaud, E.; Saron, M. F.; Rueda, P.; Sarraseca, J.; Casal, J. I.; Leclerc, C.
1999-01-01
We previously demonstrated that chimeric porcine parvovirus-like particles (PPV:VLP) carrying heterologous epitopes, when injected intraperitoneally into mice without adjuvant, activate strong CD4+ and CD8+ T-cell responses specific for the foreign epitopes. In the present study, we investigated the immunogenicity of PPV:VLP carrying a CD8+ T-cell epitope from the lymphocytic choriomeningitis virus (LCMV) administered by mucosal routes. Mice immunized intranasally with recombinant PPV:VLP, in the absence of adjuvant, developed high levels of PPV-specific immunoglobulin G (IgG) and/or IgA in their serum, as well as in mucosal sites such as the bronchoalveolar and intestinal fluids. Antibodies in sera from mice immunized parenterally or intranasally with PPV:VLP were strongly neutralizing in vitro. Intranasal immunization with PPV:VLP carrying the LCMV CD8+ T-cell epitope also elicited a strong peptide-specific cytotoxic-T-cell (CTL) response. In contrast, mice orally immunized with recombinant PPV:VLP did not develop any antibody or CTL responses. We also showed that mice primed with PPV:VLP are still able to develop strong CTL responses after subsequent immunization with chimeric PPV:VLP carrying a foreign CD8+ T-cell epitope. These results highlight the attractive potential of PPV:VLP as a safe, nonreplicating antigen carrier to stimulate systemic and mucosal immunity after nasal administration. PMID:10074120
Predictors of responses to immune checkpoint blockade in advanced melanoma.
Jacquelot, N; Roberti, M P; Enot, D P; Rusakiewicz, S; Ternès, N; Jegou, S; Woods, D M; Sodré, A L; Hansen, M; Meirow, Y; Sade-Feldman, M; Burra, A; Kwek, S S; Flament, C; Messaoudene, M; Duong, C P M; Chen, L; Kwon, B S; Anderson, A C; Kuchroo, V K; Weide, B; Aubin, F; Borg, C; Dalle, S; Beatrix, O; Ayyoub, M; Balme, B; Tomasic, G; Di Giacomo, A M; Maio, M; Schadendorf, D; Melero, I; Dréno, B; Khammari, A; Dummer, R; Levesque, M; Koguchi, Y; Fong, L; Lotem, M; Baniyash, M; Schmidt, H; Svane, I M; Kroemer, G; Marabelle, A; Michiels, S; Cavalcanti, A; Smyth, M J; Weber, J S; Eggermont, A M; Zitvogel, L
2017-09-19
Immune checkpoint blockers (ICB) have become pivotal therapies in the clinical armamentarium against metastatic melanoma (MMel). Given the frequency of immune related adverse events and increasing use of ICB, predictors of response to CTLA-4 and/or PD-1 blockade represent unmet clinical needs. Using a systems biology-based approach to an assessment of 779 paired blood and tumor markers in 37 stage III MMel patients, we analyzed association between blood immune parameters and the functional immune reactivity of tumor-infiltrating cells after ex vivo exposure to ICB. Based on this assay, we retrospectively observed, in eight cohorts enrolling 190 MMel patients treated with ipilimumab, that PD-L1 expression on peripheral T cells was prognostic on overall and progression-free survival. Moreover, detectable CD137 on circulating CD8 + T cells was associated with the disease-free status of resected stage III MMel patients after adjuvant ipilimumab + nivolumab (but not nivolumab alone). These biomarkers should be validated in prospective trials in MMel.The clinical management of metastatic melanoma requires predictors of the response to checkpoint blockade. Here, the authors use immunological assays to identify potential prognostic/predictive biomarkers in circulating blood cells and in tumor-infiltrating lymphocytes from patients with resected stage III melanoma.
Gu, Ai-Di; Zhang, Song; Wang, Yunqi; Xiong, Hui; Curtis, Thomas A.; Wan, Yisong Y.
2014-01-01
Summary Transforming growth factor-beta (TGF-β) suppresses T cell function to maintain self-tolerance and to promote tumor immune evasion. Yet how Smad4, a transcription factor component of TGF-β signaling, regulates T cell function remains unclear. Here we have demonstrated an essential role for Smad4 in promoting T cell function during autoimmunity and anti-tumor immunity. Smad4 deletion rescued the lethal autoimmunity resulting from transforming growth factor-beta receptor (TGF-βR) deletion and compromised T-cell-mediated tumor rejection. While Smad4 was dispensable for T cell generation, homeostasis and effector function, it was essential for T cell proliferation following activation in vitro and in vivo. The transcription factor Myc was identified to mediate Smad4-controlled T cell proliferation. This study thus reveals a requirement of Smad4 for T-cell-mediated autoimmunity and tumor rejection, which is beyond the current paradigm. It highlights a TGF-βR-independent role for Smad4 in promoting T cell function, autoimmunity and anti-tumor immunity. PMID:25577439
Ballet, Romain; Emre, Yalin; Jemelin, Stéphane; Charmoy, Mélanie; Tacchini-Cottier, Fabienne; Imhof, Beat A.
2014-01-01
The recruitment of dendritic cells to sites of infections and their migration to lymph nodes is fundamental for antigen processing and presentation to T cells. In the present study, we showed that antibody blockade of junctional adhesion molecule C (JAM-C) on endothelial cells removed JAM-C away from junctions and increased vascular permeability after L. major infection. This has multiple consequences on the output of the immune response. In resistant C57BL/6 and susceptible BALB/c mice, we found higher numbers of innate immune cells migrating from blood to the site of infection. The subsequent migration of dendritic cells (DCs) from the skin to the draining lymph node was also improved, thereby boosting the induction of the adaptive immune response. In C57BL/6 mice, JAM-C blockade after L. major injection led to an enhanced IFN-γ dominated T helper 1 (Th1) response with reduced skin lesions and parasite burden. Conversely, anti JAM-C treatment increased the IL-4-driven T helper 2 (Th2) response in BALB/c mice with disease exacerbation. Overall, our results show that JAM-C blockade can finely-tune the innate cell migration and accelerate the consequent immune response to L. major without changing the type of the T helper cell response. PMID:25474593
2012-01-01
Background Merkel cell carcinoma (MCC) is a relatively new addition to the expanding category of oncovirus-induced cancers. Although still comparably rare, the number of cases has risen dramatically in recent years. Further complicating this trend is that MCC is an extremely aggressive neoplasm with poor patient prognosis and limited treatment options for advanced disease. The causative agent of MCC has been identified as the merkel cell polyomavirus (MCPyV). The MCPyV-encoded large T (LT) antigen is an oncoprotein that is theorized to be essential for virus-mediated tumorigenesis and is therefore, an excellent MCC antigen for the generation of antitumor immune responses. As a foreign antigen, the LT oncoprotein avoids the obstacle of immune tolerance, which normally impedes the development of antitumor immunity. Ergo, it is an excellent target for anti-MCC immunotherapy. Since tumor-specific CD8+ T cells lead to better prognosis for MCC and numerous other cancers, we have generated a DNA vaccine that is capable of eliciting LT-specific CD8+ T cells. The DNA vaccine (pcDNA3-CRT/LT) encodes the LT antigen linked to a damage-associated molecular pattern, calreticulin (CRT), as it has been demonstrated that the linkage of CRT to antigens promotes the induction of antigen-specific CD8+ T cells. Results The present study shows that DNA vaccine-induced generation of LT-specific CD8+ T cells is augmented by linking CRT to the LT antigen. This is relevant since the therapeutic effects of the pcDNA3-CRT/LT DNA vaccine is mediated by LT-specific CD8+ T cells. Mice vaccinated with the DNA vaccine produced demonstrably more LT-specific CD8+ T cells. The DNA vaccine was also able to confer LT-specific CD8+ T cell-mediated protective and therapeutic effects to prolong the survival of mice with LT-expressing tumors. In the interest of determining the LT epitope which most MCC-specific CD8+ T cells recognize, we identified the amino acid sequence of the immunodominant LT epitope
Rindsjö, E; Joerink, M; Johansson, C; Bremme, K; Malmström, V; Scheynius, A
2010-07-01
It is hypothesized that the in utero environment in allergic mothers can affect the neonatal immune responses. The aim of this study was to analyse the effect of maternal allergic disease on cord blood mononuclear cell (CBMC) phenotype and proliferative responses upon allergen stimulation. Peripheral blood mononuclear cells (PBMC) from 12 allergic and 14 nonallergic mothers and CBMC from their children were analysed. In the mothers, we determined cell proliferation, production of IL-4 and expression of FOXP3 in response to allergen stimulation. In the children, we evaluated cell proliferation and FOXP3 expression following allergen stimulation. Furthermore, expression of different homing markers on T cells and regulatory T cells and maturity of the T cells and B cell subsets were evaluated directly ex vivo. The timothy- and birch-allergic mothers responded with increased proliferation and/or IL-4 production towards timothy and birch extract, respectively, when compared to nonallergic mothers. This could not be explained by impairment of FOXP3(+) regulatory T cells in the allergic mothers. CBMC proliferation and FOXP3 expression in response to allergens were not affected by the allergic status of the mother. Also, phenotype of T cells, FOXP3(+) regulatory T cells and B cells was not affected by the allergic status of the mother. Our results suggest that maternal allergic disease has no effect on the neonatal response to allergens or the phenotype of neonatal lymphocytes. The factors studied here could, however, still affect later development of allergy.
Boddupalli, Chandra Sekhar; Bar, Noffar; Kadaveru, Krishna; Krauthammer, Michael; Pornputtapong, Natopol; Ariyan, Stephan; Narayan, Deepak; Kluger, Harriet; Deng, Yanhong; Verma, Rakesh; Das, Rituparna; Bacchiocchi, Antonella; Halaban, Ruth; Sznol, Mario; Dhodapkar, Madhav V.; Dhodapkar, Kavita M.
2016-01-01
Heterogeneity of tumor cells and their microenvironment can affect outcome in cancer. Blockade of immune checkpoints (ICPs) expressed only on a subset of immune cells leads to durable responses in advanced melanoma. Tissue-resident memory T (TRM) cells have recently emerged as a distinct subset of memory T cells in nonlymphoid tissues. Here, we show that functional properties and expression of ICPs within tumor-infiltrating lymphocytes (TILs) differ from those of blood T cells. TILs secrete less IL-2, IFN-γ, and TNF-α compared with circulating counterparts, and expression of VEGF correlated with reduced TIL infiltration. Within tumors, ICPs are particularly enriched within T cells with phenotype and genomic features of TRM cells and the CD16+ subset of myeloid cells. Concurrent T cell receptor (TCR) and tumor exome sequencing of individual metastases in the same patient revealed that interlesional diversity of TCRs exceeded differences in mutation/neoantigen load in tumor cells. These findings suggest that the TRM subset of TILs may be the major target of ICP blockade and illustrate interlesional diversity of tissue-resident TCRs within individual metastases, which did not equilibrate between metastases and may differentially affect the outcome of immune therapy at each site. PMID:28018970
Ondondo, Beatrice Omusiro
2014-01-01
Excessive immune responses directed against foreign pathogens, self-antigens, or commensal microflora can cause cancer establishment and progression if the execution of tight immuno-regulatory mechanisms fails. On the other hand, induction of potent tumor antigen-specific immune responses together with stimulation of the innate immune system is a pre-requisite for effective anti-tumor immunity, and if suppressed by the strong immuno-regulatory mechanisms can lead to cancer progression. Therefore, it is crucial that the inevitable co-existence of these fundamental, yet conflicting roles of immune-regulatory cells is carefully streamlined as imbalances can be detrimental to the host. Infection with chronic persistent viruses is characterized by severe immune dysfunction resulting in T cell exhaustion and sometimes deletion of antigen-specific T cells. More often, this is due to increased immuno-regulatory processes, which are triggered to down-regulate immune responses and limit immunopathology. However, such heightened levels of immune disruption cause a concomitant loss of tumor immune-surveillance and create a permissive microenvironment for cancer establishment and progression, as demonstrated by increased incidences of cancer in immunosuppressed hosts. Paradoxically, while some cancers arise as a consequence of increased immuno-regulatory mechanisms that inhibit protective immune responses and impinge on tumor surveillance, other cancers arise due to impaired immuno-regulatory mechanisms and failure to limit pathogenic inflammatory responses. This intricate complexity, where immuno-regulatory cells can be beneficial in certain immune settings but detrimental in other settings underscores the need for carefully formulated interventions to equilibrate the balance between immuno-stimulatory and immuno-regulatory processes. PMID:24639678
Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira
2016-01-01
ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel
Sánchez-Sampedro, L; Mejías-Pérez, E; S Sorzano, Carlos Óscar; Nájera, J L; Esteban, M
2016-07-15
The NYVAC poxvirus vector is used as vaccine candidate for HIV and other diseases, although there is only limited experimental information on its immunogenicity and effectiveness for use against human pathogens. Here we defined the selective advantage of NYVAC vectors in a mouse model by comparing the immune responses and protection induced by vectors that express the LACK (Leishmania-activated C-kinase antigen), alone or with insertion of the viral host range gene C7L that allows the virus to replicate in human cells. Using DNA prime/virus boost protocols, we show that replication-competent NYVAC-LACK that expresses C7L (NYVAC-LACK-C7L) induced higher-magnitude polyfunctional CD8(+) and CD4(+) primary adaptive and effector memory T cell responses (IFNγ, TNFα, IL-2, CD107a) to LACK antigen than non-replicating NYVAC-LACK. Compared to NYVAC-LACK, the NYVAC-LACK-C7L-induced CD8(+) T cell population also showed higher proliferation when stimulated with LACK antigen. After a challenge by subcutaneous Leishmania major metacyclic promastigotes, NYVAC-LACK-C7L-vaccinated mouse groups showed greater protection than the NYVAC-LACK-vaccinated group. Our results indicate that the type and potency of immune responses induced by LACK-expressing NYVAC vectors is improved by insertion of the C7L gene, and that a replication-competent vector as a vaccine renders greater protection against a human pathogen than a non-replicating vector. Copyright © 2016 Elsevier B.V. All rights reserved.
Sheng, Jian Rong; Muthusamy, Thiruppathi; Prabahakar, Bellur S.; Meriggioli, Matthew N.
2011-01-01
We and others have demonstrated the ability of granulocyte-macrophage colony-stimulating factor (GM-CSF) to suppress autoimmunity by increasing the number of CD4+CD25+ regulatory T cells (Tregs). In the current study, we have explored the critical role of induced antigen specific Tregs in the therapeutic effects of GM-CSF in murine experimental autoimmune myasthenia gravis (EAMG). Specifically, we show that Tregs from GM-CSF treated EAMG mice (GM-CSF/AChR-induced-Tregs) adoptively transferred into animals with EAMG suppressed clinical disease more potently than equal numbers of Tregs from either GM-CSF untreated EAMG mice or healthy mice treated with GM-CSF. In addition, GM-CSF/AChR-induced-Tregs selectively suppressed antigen specific T cell proliferation induced by AChR relative to that induced by an irrelevant self antigen, (thyroglobulin) and failed to significantly alter T cell proliferation in response to an exogenous antigen (ovalbumin). These results are consistent with the hypothesized mechanism of action of GM-CSF involving the mobilization of tolerogenic dendritic cell precursors which, upon antigen (AChR) capture, suppress the anti-AChR immune response through the induction/expansion of AChR-specific Tregs. PMID:22099723
Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A
2004-12-01
The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid
Toll immune signal activates cellular immune response via eicosanoids.
Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun
2018-07-01
Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Mesenchymal stem cells: a double-edged sword in regulating immune responses
Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y
2012-01-01
Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969
Adaptive immune education by gut microbiota antigens.
Zhao, Qing; Elson, Charles O
2018-05-01
Host-microbiota mutualism has been established during long-term co-evolution. A diverse and rich gut microbiota plays an essential role in the development and maturation of the host immune system. Education of the adaptive immune compartment by gut microbiota antigens is important in establishing immune balance. In particular, a critical time frame immediately after birth provides a 'window of opportunity' for the development of lymphoid structures, differentiation and maturation of T and B cells and, most importantly, establishment of immune tolerance to gut commensals. Depending on the colonization niche, antigen type and metabolic property of different gut microbes, CD4 T-cell responses vary greatly, which results in differentiation into distinct subsets. As a consequence, certain bacteria elicit effector-like immune responses by promoting the production of pro-inflammatory cytokines such as interferon-γ and interleukin-17A, whereas other bacteria favour the generation of regulatory CD4 T cells and provide help with gut homeostasis. The microbiota have profound effects on B cells also. Gut microbial exposure leads to a continuous diversification of B-cell repertoire and the production of T-dependent and -independent antibodies, especially IgA. These combined effects of the gut microbes provide an elegant educational process to the adaptive immune network. Contrariwise, failure of this process results in a reduced homeostasis with the gut microbiota, and an increased susceptibility to various immune disorders, both inside and outside the gut. With more definitive microbial-immune relations waiting to be discovered, modulation of the host gut microbiota has a promising future for disease intervention. © 2018 John Wiley & Sons Ltd.
APRIL:TACI axis is dispensable for the immune response to rabies vaccination.
Haley, Shannon L; Tzvetkov, Evgeni P; Lytle, Andrew G; Alugupalli, Kishore R; Plummer, Joseph R; McGettigan, James P
2017-08-01
There is significant need to develop a single-dose rabies vaccine to replace the current multi-dose rabies vaccine regimen and eliminate the requirement for rabies immune globulin in post-exposure settings. To accomplish this goal, rabies virus (RABV)-based vaccines must rapidly activate B cells to secrete antibodies which neutralize pathogenic RABV before it enters the CNS. Increased understanding of how B cells effectively respond to RABV-based vaccines may improve efforts to simplify post-exposure prophylaxis (PEP) regimens. Several studies have successfully employed the TNF family cytokine a proliferation-inducing ligand (APRIL) as a vaccine adjuvant. APRIL binds to the receptors TACI and B cell maturation antigen (BCMA)-expressed by B cells in various stages of maturation-with high affinity. We discovered that RABV-infected primary murine B cells upregulate APRIL ex vivo. Cytokines present at the time of antigen exposure affect the outcome of vaccination by influencing T and B cell activation and GC formation. Therefore, we hypothesized that the presence of APRIL at the time of RABV-based vaccine antigen exposure would support the generation of protective antibodies against RABV glycoprotein (G). In an effort to improve the response to RABV vaccination, we constructed and characterized a live recombinant RABV-based vaccine vector which expresses murine APRIL (rRABV-APRIL). Immunogenicity testing in mice demonstrated that expressing APRIL from the RABV genome does not impact the primary antibody response against RABV G compared to RABV alone. In order to evaluate the necessity of APRIL for the response to rabies vaccination, we compared the responses of APRIL-deficient and wild-type mice to immunization with rRABV. APRIL deficiency does not affect the primary antibody response to vaccination. Furthermore, APRIL expression by the vaccine did not improve the generation of long-lived antibody-secreting plasma cells (PCs) as serum antibody levels were equivalent
Identifying Regulators of the Immune Response to Dying Cells | Center for Cancer Research
Cytotoxic T cells are responsible for carrying out antigen-mediated immune responses against virally-infected and malignant cells. In both cases, cytotoxic T cells are stimulated by interacting with antigen presenting cells, such as dendritic cells (DCs). Infected cells produce virus-specific antigens and pathogen associated molecular patterns, which are recognized by DCs and
Characterization of cytotoxic immune response in skin and mucosal lesions of paracoccidioidomycosis.
Pagliari, Carla; Pereira, Naiura Vieira; Kanashiro, Luciane; Stegun, Felipe Weisshaupt; Croda, Julio; Duarte, Maria Irma Seixas; Sotto, Mirian Nacagami
2010-05-01
CD8+ T cells and natural killer (NK) cells are involved in the immune response against some pathogens. For this purpose, we investigated the in situ paracoccidioidomycosis (PCM) immune response addressing the participation of NK cells, CD8+ T cells, perforin and granzyme B expression. Sixty biopsies of PCM skin and mucosa were classified according to the presence of compact granulomas (G1), poorly organized granulomas (G2) and both kinds in the same lesion (G3). CD8+ T cells, NK cells, perforin and granzyme B were showed by immunohistochemistry. CD8+ T cells were increased over NK cells in cutaneous G1 and G2 lesions. There was no difference regarding such cells in G3 lesions, although they were abundant in such lesions. In mucosa, CD8+ T cells were increased in number over NK cells in all groups. Granzyme B in skin increased in G2 and G3. The number of granzyme did not differ in mucosal lesions in the three groups. CD8+ T cells and NK cells play a role in PCM cutaneous and mucosal lesions. The predominance of CD8+ T cells over NK cells may represent an effective response against the fungi. Moreover, the high number of granzyme B expressing cells corroborates this possibility.
2014-01-01
Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively
Straßburger, David; Glaffig, Markus; Stergiou, Natascha; Bialas, Sabrina; Besenius, Pol; Schmitt, Edgar; Kunz, Horst
2018-04-06
The endothelial glycoprotein MUC1 is known to underlie alterations in cancer by means of aberrant glycosylation accompanied by changes in morphology. The heavily shortened glycans induce a collapse of the peptide backbone and enable accessibility of the latter to immune cells, rendering it a tumor-associated antigen. Synthetic vaccines based on MUC1 tandem repeat motifs, comprising tumor-associated 2,3-sialyl-T antigen, conjugated to the immunostimulating tetanus toxoid, are reported herein. Immunization with these vaccines in a simple water/oil emulsion produced a strong immune response in mice to which stimulation with complete Freund's adjuvant (CFA) was not superior. In both cases, high levels of IgG1 and IgG2a/b were induced in C57BL/6 mice. Additional glycosylation in the immunodominant PDTRP domain led to improved binding of the induced antisera to MCF-7 breast tumor cells, compared with that of the monoglycosylated peptide vaccine. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Weinberg, Adriana; Schamder, Kenneth; Johnson, Michael; Popmihajlov, Zoran; Tovar-Salazar, Adriana; Caldas, Yupanqui; Pang, Lei; Cho, Alice; Levin, Myron
2017-01-01
Abstract Background ZV confers protection against herpes zoster by increasing the cell-mediated immunity (CMI) to varicella-zoster virus (VZV). ZV immunogenicity and protection decrease with increasing age. We investigated effects of age and immune senescence on ZV immunogenicity. Methods 399 adults ≥50 years had VZV T-cell helper 1 (Th1) CMI measured by ex vivo VZV-stimulated IL2/IFNg ELISPOT and blood T-cell nonspecific immune senescence by flow cytometric characterization of FOXP3, CD25, IL10, TGFb, PD1, CD28, CD57 and CD31 expression before and at 1, 6 and 52 weeks after ZV. In a subset of 95 vaccinees, VZV-stimulated T cell expression of CD107, Granzyme B, FOXP3, CD25, IL10, TGFb, CD39 and PD1 were also measured. Multivariate regression analysis was used to identify independent effects of age and immune senescence on VZV Th1 CMI (P < 0.025). Results IL2+ and IL2+IFNg+ Th1 memory VZV CMI peaked at 6 weeks after ZV and remained elevated at 1 year. Effectors, including VZV-specific IFNg+ Th1, and CD8+CD107+% and CD4+/CD8+Granzyme B+% cytotoxic T lymphocytes (CTL), peaked at 1 week, but only the IFNg+ Th1 effectors remained elevated at 1 year. There was also a transient increase in blood CD8+PD1+% exhausted T cells 1 week after ZV. Independent positive effects on peak memory Th1 VZV CMI included the baseline CMI and negative effects included blood CD4+FOXP3+% T regulatory (Treg) and CD8+PD1+% T exhausted cells. Independent positive effects on peak effector Th1 VZV CMI included baseline CMI and negative effects included blood CD8+CD25+FOXP3+% Treg. Age did not have an independent effect on peak CMI. Independent positive effects on persistent (1 year) memory Th1 included baseline CMI and negative effects included age, blood CD4+FOXP3+% Treg and CD8+PD1+% T exhausted cells. Persistent effector Th1 CMI was negatively affected by age only. Conclusion ZV generated VZV-specific Th1 and CTL responses. The early increase of CD8+ exhausted T cells in blood suggested that
Human influenza viruses and CD8(+) T cell responses.
Grant, Emma J; Quiñones-Parra, Sergio M; Clemens, E Bridie; Kedzierska, Katherine
2016-02-01
Influenza A viruses (IAVs) cause significant morbidity and mortality worldwide, despite new strain-specific vaccines being available annually. As IAV-specific CD8(+) T cells promote viral control in the absence of neutralizing antibodies, and can mediate cross-reactive immunity toward distinct IAVs to drive rapid recovery from both mild and severe influenza disease, there is great interest in developing a universal T cell vaccine. However, despite detailed studies in mouse models of influenza virus infection, there is still a paucity of data on human epitope-specific CD8(+) T cell responses to IAVs. This review focuses on our current understanding of human CD8(+) T cell immunity against distinct IAVs and discusses the possibility of achieving a CD8(+) T cell mediated-vaccine that protects against multiple, distinct IAV strains across diverse human populations. We also review the importance of CD8(+) T cell immunity in individuals highly susceptible to severe influenza infection, including those hospitalised with influenza, the elderly and Indigenous populations. Copyright © 2016 Elsevier B.V. All rights reserved.
Immune cell changes in response to a swimming training session during a 24-h recovery period.
Morgado, José P; Monteiro, Cristina P; Teles, Júlia; Reis, Joana F; Matias, Catarina; Seixas, Maria T; Alvim, Marta G; Bourbon, Mafalda; Laires, Maria J; Alves, Francisco
2016-05-01
Understanding the impact of training sessions on the immune response is crucial for the adequate periodization of training, to prevent both a negative influence on health and a performance impairment of the athlete. This study evaluated acute systemic immune cell changes in response to an actual swimming session, during a 24-h recovery period, controlling for sex, menstrual cycle phases, maturity, and age group. Competitive swimmers (30 females, 15 ± 1.3 years old; and 35 males, 16.5 ± 2.1 years old) performed a high-intensity training session. Blood samples were collected before, immediately after, 2 h after, and 24 h after exercise. Standard procedures for the assessment of leukogram by automated counting (Coulter LH 750, Beckman) and lymphocytes subsets by flow cytometry (FACS Calibur BD, Biosciences) were used. Subjects were grouped according to competitive age groups and pubertal Tanner stages. Menstrual cycle phase was monitored. The training session induced neutrophilia, lymphopenia, and a low eosinophil count, lasting for at least 2 h, independent of sex and maturity. At 24 h postexercise, the acquired immunity of juniors (15-17 years old), expressed by total lymphocytes and total T lymphocytes (CD3(+)), was not fully recovered. This should be accounted for when planning a weekly training program. The observed lymphopenia suggests a lower immune surveillance at the end of the session that may depress the immunity of athletes, highlighting the need for extra care when athletes are exposed to aggressive environmental agents such as swimming pools.
Effects of fenbendazole on routine immune response parameters of BALB/c mice.
Cray, Carolyn; Villar, David; Zaias, Julia; Altman, Norman H
2008-11-01
Fenbendazole (FBZ) is an anthelmintic drug widely used to treat and prevent pinworm outbreaks in laboratory rodents. Although data in nonrodent species indicate possible effects of fenbendazole on the bone marrow and lymphocyte proliferation and function, little has been reported regarding possible effects on the rodent immune system. The purpose of the current study was to determine the effects of a therapeutic regimen of FBZ on immune parameters in BALB/c mice. Both 9-wk on-off and 5-wk continuous medicated feed protocols were assessed. No significant differences between normal and FBZ diet treated mice were observed in the following parameters: complete blood count, blood chemistry, quantitation of major T and B cell markers in spleen, quantitation of T cell markers in the thymus, spleen cell proliferation to T and B cell mitogens, bone marrow colony-forming cell assays, skin graft rejection, and primary and secondary humoral immune responses. These data indicate that FBZ treatment does not affect many standard broad measures of immune function.
Maggioli, Mayara F.; Palmer, Mitchell V.; Thacker, Tyler C.; Vordermeier, H. Martin; Waters, W. Ray
2015-01-01
Cultured IFN-γ ELISPOT assays are primarily a measure of central memory T cell (Tcm) responses with humans; however, this important subset of lymphocytes is poorly characterized in cattle. Vaccine-elicited cultured IFN-γ ELISPOT responses correlate with protection against bovine tuberculosis in cattle. However, whether this assay measures cattle Tcm responses or not is uncertain. The objective of the present study was to characterize the relative contribution of Tcm (CCR7+, CD62Lhi, CD45RO+), T effector memory (Tem, defined as: CCR7-, CD62Llow/int, CD45RO+), and T effector cells (CCR7-, CD62L-/low, CD45RO-), in the immune response to Mycobacterium bovis. Peripheral blood mononuclear cells (PBMC) from infected cattle were stimulated with a cocktail of M. bovis purified protein derivative, rTb10.4 and rAg85A for 13 days with periodic addition of fresh media and rIL-2. On day 13, cultured PBMC were re-stimulated with medium alone, rESAT-6:CFP10 or PPDb with fresh autologous adherent cells for antigen presentation. Cultured cells (13 days) or fresh PBMCs (ex vivo response) from the same calves were analyzed for IFN-γ production, proliferation, and CD4, CD45RO, CD62L, CD44, and CCR7 expression via flow cytometry after overnight stimulation. In response to mycobacterial antigens, ~75% of CD4+ IFN-γ+ cells in long-term cultures expressed a Tcm phenotype while less than 10% of the ex vivo response consisted of Tcm cells. Upon re-exposure to antigen, long-term cultured cells were highly proliferative, a distinctive characteristic of Tcm, and the predominant phenotype within the long-term cultures switched from Tcm to Tem. These findings suggest that proliferative responses of Tcm cells to some extent occurs simultaneously with reversion to effector phenotypes (mostly Tem). The present study characterizes Tcm cells of cattle and their participation in the response to M. bovis infection. PMID:25879774
Induction and function of virus-specific CD4+ T cell responses
Whitmire, Jason K.
2010-01-01
CD4+ T cells -- often referred to as T-helper cells -- play a central role in immune defense and pathogenesis. Virus infections and vaccines stimulate and expand populations of antigen-specific CD4+ T cells in mice and in man. These virus-specific CD4+ T cells are extremely important in antiviral protection: deficiencies in CD4+ T cells are associated with virus reactivation, generalized susceptibility to opportunistic infections, and poor vaccine efficacy. As described below, CD4+ T cells influence effector and memory CD8+ T cell responses, humoral immunity, and the antimicrobial activity of macrophages and are involved in recruiting cells to sites of infection. This review summarizes a few key points about the dynamics of the CD4+ T cell response to virus infection, the positive role of pro-inflammatory cytokines in the differentiation of virus-specific CD4+ T cells, and new areas of investigation to improve vaccines against virus infection. PMID:21236461
HP-1γ Controls High-Affinity Antibody Response to T-Dependent Antigens
Ha, Ngoc; Pham, Duc-Hung; Shahsafaei, Aliakbar; Naruse, Chie; Asano, Masahide; Thai, To-Ha
2014-01-01
In vitro observations suggest a role for the mouse heterochromatin protein 1γ (HP-1γ) in the immune system. However, it has not been shown if and how HP-1γ contributes to immunity in vivo. Here we show that in mice, HP-1γ positively regulates the germinal center reaction and high-affinity antibody response to thymus (T)-dependent antigens by limiting the size of CD8+ regulatory T-cell (Treg) compartment without affecting progenitor B- or T-cell-development. Moreover, HP-1γ does not control cell proliferation or class switch recombination. Haploinsufficiency of cbx-3 (gene encoding HP-1γ) is sufficient to expand the CD8+ Treg population and impair the immune response in mice despite the presence of wild-type HP-1α and HP-1β. This is the first in vivo evidence demonstrating the non-redundant role of HP-1γ in immunity. PMID:24971082
Immune responses in space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1998-01-01
Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological
Wang, Yang; Zhong, Huiling; Xie, Xiaodan; Chen, Crystal Y.; Huang, Dan; Shen, Ling; Zhang, Hui; Chen, Zheng W.; Zeng, Gucheng
2015-01-01
Molecular mechanisms for T-cell immune responses modulated by T cell-inhibitory molecules during tuberculosis (TB) infection remain unclear. Here, we show that active human TB infection up-regulates CD244 and CD244 signaling-associated molecules in CD8+ T cells and that blockade of CD244 signaling enhances production of IFN-γ and TNF-α. CD244 expression/signaling in TB correlates with high levels of a long noncoding RNA (lncRNA)-BC050410 [named as lncRNA-AS-GSTT1(1-72) or lncRNA-CD244] in the CD244+CD8+ T-cell subpopulation. CD244 signaling drives lncRNA-CD244 expression via sustaining a permissive chromatin state in the lncRNA-CD244 locus. By recruiting polycomb protein enhancer of zeste homolog 2 (EZH2) to infg/tnfa promoters, lncRNA-CD244 mediates H3K27 trimethylation at infg/tnfa loci toward repressive chromatin states and inhibits IFN-γ/TNF-α expression in CD8+ T cells. Such inhibition can be reversed by knock down of lncRNA-CD244. Interestingly, adoptive transfer of lncRNA-CD244–depressed CD8+ T cells to Mycobacterium tuberculosis (MTB)-infected mice reduced MTB infection and TB pathology compared with lncRNA-CD244–expressed controls. Thus, this work uncovers previously unidentified mechanisms in which T cell-inhibitory signaling and lncRNAs regulate T-cell responses and host defense against TB infection. PMID:26150504
Shah, Javeed A; Musvosvi, Munyaradzi; Shey, Muki; Horne, David J; Wells, Richard D; Peterson, Glenna J; Cox, Jeffery S; Daya, Michelle; Hoal, Eileen G; Lin, Lin; Gottardo, Raphael; Hanekom, Willem A; Scriba, Thomas J; Hatherill, Mark; Hawn, Thomas R
2017-08-15
The molecular mechanisms that regulate tuberculosis susceptibility and bacillus Calmette-Guérin (BCG)-induced immunity are mostly unknown. However, induction of the adaptive immune response is a critical step in host control of Mycobacterium tuberculosis. Toll-interacting protein (TOLLIP) is a ubiquitin-binding protein that regulates innate immune responses, including Toll-like receptor signaling, which initiate adaptive immunity. TOLLIP variation is associated with susceptibility to tuberculosis, but the mechanism by which it regulates tuberculosis immunity is poorly understood. To identify functional TOLLIP variants and evaluate the role of TOLLIP variation on innate and adaptive immune responses to mycobacteria and susceptibility to tuberculosis. We used human cellular immunology approaches to characterize the role of a functional TOLLIP variant on monocyte mRNA expression and M. tuberculosis-induced monocyte immune functions. We also examined the association of TOLLIP variation with BCG-induced T-cell responses and susceptibility to latent tuberculosis infection. We identified a functional TOLLIP promoter region single-nucleotide polymorphism, rs5743854, which was associated with decreased TOLLIP mRNA expression in infant monocytes. After M. tuberculosis infection, TOLLIP-deficient monocytes demonstrated increased IL-6, increased nitrite, and decreased bacterial replication. The TOLLIP-deficiency G/G genotype was associated with decreased BCG-specific IL-2 + CD4 + T-cell frequency and proliferation. This genotype was also associated with increased susceptibility to latent tuberculosis infection. TOLLIP deficiency is associated with decreased BCG-specific T-cell responses and increased susceptibility to tuberculosis. We hypothesize that the heightened antibacterial monocyte responses after vaccination of TOLLIP-deficient infants are responsible for decreased BCG-specific T-cell responses. Activating TOLLIP may provide a novel adjuvant strategy for BCG
Immune response to measles vaccine in Peruvian children.
Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.
2001-01-01
OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811
Ranasinghe, C; Trivedi, S; Stambas, J; Jackson, R J
2013-11-01
We have established that mucosal immunization can generate high-avidity human immunodeficiency virus (HIV)-specific CD8(+) T cells compared with systemic immunization, and interleukin (IL)-13 is detrimental to the functional avidity of these T cells. We have now constructed two unique recombinant HIV-1 vaccines that co-express soluble or membrane-bound forms of the IL-13 receptor α2 (IL-13Rα2), which can "transiently" block IL-13 activity at the vaccination site causing wild-type animals to behave similar to an IL-13 KO animal. Following intranasal/intramuscular prime-boost immunization, these IL-13Rα2-adjuvanted vaccines have shown to induce (i) enhanced HIV-specific CD8(+) T cells with higher functional avidity, with broader cytokine/chemokine profiles and greater protective immunity using a surrogate mucosal HIV-1 challenge, and also (ii) excellent multifunctional mucosal CD8(+) T-cell responses, in the lung, genito-rectal nodes (GN), and Peyer's patch (PP). Data revealed that intranasal delivery of these IL-13Rα2-adjuvanted HIV vaccines recruited large numbers of unique antigen-presenting cell subsets to the lung mucosae, ultimately promoting the induction of high-avidity CD8(+) T cells. We believe our novel IL-13R cytokine trap vaccine strategy offers great promise for not only HIV-1, but also as a platform technology against range of chronic infections that require strong sustained high-avidity mucosal/systemic immunity for protection.
Ornamental comb colour predicts T-cell-mediated immunity in male red grouse Lagopus lagopus scoticus
NASA Astrophysics Data System (ADS)
Mougeot, Francois
2008-02-01
Sexual ornaments might reliably indicate the ability to cope with parasites and diseases, and a better ability to mount a primary inflammatory response to a novel challenge. Carotenoid-based ornaments are amongst the commonest sexual signals of birds and often influence mate choice. Because carotenoids are immuno-stimulants, signallers may trade-off allocating these to ornamental colouration or using them for immune responses, so carotenoid-based ornaments might be particularly useful as honest indicators of immuno-compentence. Tetraonid birds, such as the red grouse Lagopus lagopus scoticus, exhibit supra-orbital yellow red combs, a conspicuous ornament which functions in intra- and inter-sexual selection. The colour of combs is due to epidermal pigmentation by carotenoids, while their size is testosterone-dependent. In this study, I investigated whether comb characteristics, and in particular, comb colour, indicated immuno-competence in free-living male red grouse. I assessed T-cell-mediated immunity using a standardised challenge with phytohaemagglutinin. Red grouse combs reflect in the red and in the ultraviolet spectrum of light, which is not visible to humans but that grouse most likely see, so I measured comb colour across the whole bird visible spectrum (300 700 nm) using a reflectance spectrometer. I found that males with bigger and redder combs, but with less ultraviolet reflectance, had greater T-cell-mediated immune response. Comb colour predicted T-cell-mediated immune response better than comb size, indicating that the carotenoid-based colouration of this ornament might reliably signal this aspect of male quality.
Cairo, Cristiana; Propp, Nadia; Auricchio, Giovanni; Armstrong, Cheryl L.; Abimiku, Alash’le; Mancino, Giorgio; Colizzi, Vittorio; Blattner, William; Pauza, C. David
2008-01-01
Infectious diseases during pregnancy can impact the development of fetal immunity, leading to reduced neonatal resistance to infection and decreased responses to pediatric vaccines. P. falciparum causes placental infection in low parity pregnant women and is among the pathogens that affect fetal immunity. Recognizing the relationship between malaria and γδ T lymphocytes in adults, we asked whether neonatal γδ T cells would be altered in malaria-endemic regions as a marker for changes in fetal immunity. Our initial studies compared cord blood γδ T cells from deliveries to HIV- mothers in Jos (Nigeria) where malaria is endemic, or in Rome (Italy). We noted substantial differences in the Vγ2 repertoire for cord blood collected in Jos or Rome; differences were consistent with a negative selection mechanism operating on the fetal Vγ2 chain repertoire in neonates from Jos. A specific disruption affected the fraction of γδ T cells that we expect will respond to Bacille Calmette-Guerin (BCG). Fetal γδ T cell depletion might be a mechanism for impaired neonatal immunity and lowered responses to pediatric vaccines. PMID:18440637
Qi, Chunjian; Cai, Yihua; Gunn, Lacey; Ding, Chuanlin; Li, Bing; Kloecker, Goetz; Qian, Keqing; Vasilakos, John; Saijo, Shinobu; Iwakura, Yoichiro; Yannelli, John R.
2011-01-01
β-glucans have been reported to function as a potent adjuvant to stimulate innate and adaptive immune responses. However, β-glucans from different sources are differential in their structure, conformation, and thus biologic activity. Different preparations of β-glucans, soluble versus particulate, further complicate their mechanism of action. Here we show that yeast-derived particulate β-glucan activated dendritic cells (DCs) and macrophages via a C-type lectin receptor dectin-1 pathway. Activated DCs by particulate β-glucan promoted Th1 and cytotoxic T-lymphocyte priming and differentiation in vitro. Treatment of orally administered yeast-derived particulate β-glucan elicited potent antitumor immune responses and drastically down-regulated immunosuppressive cells, leading to the delayed tumor progression. Deficiency of the dectin-1 receptor completely abrogated particulate β-glucan–mediated antitumor effects. In contrast, yeast-derived soluble β-glucan bound to DCs and macrophages independent of the dectin-1 receptor and did not activate DCs. Soluble β-glucan alone had no therapeutic effect but significantly augmented antitumor monoclonal antibody-mediated therapeutic efficacy via a complement activation pathway but independent of dectin-1 receptor. These findings reveal the importance of different preparations of β-glucans in the adjuvant therapy and allow for the rational design of immunotherapeutic protocols usable in clinical trials. PMID:21531981
Innate immune response to Burkholderia mallei.
Saikh, Kamal U; Mott, Tiffany M
2017-06-01
Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.
Innate immune response to Burkholderia mallei
Saikh, Kamal U.; Mott, Tiffany M.
2017-01-01
Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960
Rojas-Caraballo, Jose; López-Abán, Julio; Pérez del Villar, Luis; Vizcaíno, Carolina; Vicente, Belén; Fernández-Soto, Pedro; del Olmo, Esther; Patarroyo, Manuel Alfonso; Muro, Antonio
2014-01-01
Fasciolosis is considered the most widespread trematode disease affecting grazing animals around the world; it is currently recognised by the World Health Organisation as an emergent human pathogen. Triclabendazole is still the most effective drug against this disease; however, resistant strains have appeared and developing an effective vaccine against this disease has increasingly become a priority. Several bioinformatics tools were here used for predicting B- and T-cell epitopes according to the available data for Fasciola hepatica protein amino acid sequences. BALB/c mice were immunised with the synthetic peptides by using the ADAD vaccination system and several immune response parameters were measured (antibody titres, cytokine levels, T-cell populations) to evaluate their ability to elicit an immune response. Based on the immunogenicity results so obtained, seven peptides were selected to assess their protection-inducing ability against experimental infection with F. hepatica metacercariae. Twenty-four B- or T-epitope-containing peptides were predicted and chemically synthesised. Immunisation of mice with peptides so-called B1, B2, B5, B6, T14, T15 and T16 induced high levels of total IgG, IgG1 and IgG2a (p<0.05) and a mixed Th1/Th2/Th17/Treg immune response, according to IFN-γ, IL-4, IL-17 and IL-10 levels, accompanied by increased CD62L+ T-cell populations. A high level of protection was obtained in mice vaccinated with peptides B2, B5, B6 and T15 formulated in the ADAD vaccination system with the AA0029 immunomodulator. The bioinformatics approach used in the present study led to the identification of seven peptides as vaccine candidates against the infection caused by Fasciola hepatica (a liver-fluke trematode). However, vaccine efficacy must be evaluated in other host species, including those having veterinary importance. PMID:25122166
Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Ko, Eun-Ju; Lee, Youri; Kwon, Young-Man; Kang, Sang-Moo
2017-11-01
Formalin inactivated respiratory syncytial virus (FI-RSV) vaccination caused vaccine-enhanced respiratory disease (ERD) upon exposure to RSV in children. Virus-like particles presenting RSV F fusion protein (F VLP) are known to increase T helper type-1 (Th1) immune responses and avoid ERD in animal models. We hypothesized that F VLP would prime immune responses preventing ERD upon subsequent exposure to ERD-prone FI-RSV. Here, we demonstrated that heterologous F VLP priming and FI-RSV boosting of mice prevented FI-RSV vaccine-enhanced lung inflammation and eosinophilia upon RSV challenge. F VLP priming redirected pulmonary T cells toward effector CD8 T cells producing Th1 cytokines and significantly suppressed pulmonary Th2 cytokines. This study suggests that RSV F VLP priming would modulate and shift immune responses to subsequent exposure to ERD-prone FI-RSV vaccine and RSV infection, suppressing Th2 immune-mediated pulmonary histopathology and eosinophilia. Copyright © 2017. Published by Elsevier Inc.
Pattacini, Laura; Baeten, Jared M.; Thomas, Katherine K.; Fluharty, Tayler R.; Murnane, Pamela M.; Donnell, Deborah; Bukusi, Elizabeth; Ronald, Allan; Mugo, Nelly; Lingappa, Jairam R.; Celum, Connie; McElrath, M. Juliana; Lund, Jennifer M.
2015-01-01
Objective Two distinct hypotheses have been proposed for T-cell involvement in protection from HIV-1 acquisition. First, HIV-1-specific memory T-cell responses generated upon HIV-1 exposure could mount an efficient response to HIV-1 and inhibit the establishment of an infection. Second, a lower level of immune activation could reduce the numbers of activated, HIV-1-susceptible CD4+ T-cells, thereby diminishing the likelihood of infection. Methods To test these hypotheses, we conducted a prospective study among high-risk heterosexual men and women, and tested peripheral blood samples from individuals who subsequently acquired HIV-1 during follow-up (cases) and from a subset of those who remained HIV-1 uninfected (controls). Results We found no difference in HIV-1-specific immune responses between cases and controls, but Treg frequency was higher in controls as compared to cases and was negatively associated with frequency of effector memory CD4+ T-cells. Conclusions Our findings support the hypothesis that low immune activation assists in protection from HIV-1 infection. PMID:26656786
Shin, Hye Jin; Kim, Chonsaeng; Cho, Sungchan
2018-04-20
Nucleoside analogs have been frequently identified as antiviral agents. In recent years, gemcitabine, a cytidine analog in clinical use for the treatment of many solid tumors, was also shown to have antiviral activity against a broad range of viruses. Nucleoside analogs generally interfere with cellular nucleos(t)ide synthesis pathways, resulting in the depletion or imbalance of (d)NTP pools. Intriguingly, a few recent reports have shown that some nucleoside analogs, including gemcitabine, activated innate immunity, inducing the expression of interferon-stimulated genes, through nucleos(t)ide synthesis inhibition. The precise crosstalk between these two independent processes remains to be determined. Nonetheless, we summarize the current knowledge of nucleos(t)ide synthesis inhibition-related innate immunity and propose it as a newly emerging antiviral mechanism of nucleoside analogs.
Vaginal Immunization to Elicit Primary T-Cell Activation and Dissemination
Pettini, Elena; Prota, Gennaro; Ciabattini, Annalisa; Boianelli, Alessandro; Fiorino, Fabio; Pozzi, Gianni; Vicino, Antonio; Medaglini, Donata
2013-01-01
Primary T-cell activation at mucosal sites is of utmost importance for the development of vaccination strategies. T-cell priming after vaginal immunization, with ovalbumin and CpG oligodeoxynucleotide adjuvant as model vaccine formulation, was studied in vivo in hormone-synchronized mice and compared to the one induced by the nasal route. Twenty-four hours after both vaginal or nasal immunization, antigen-loaded dendritic cells were detected within the respective draining lymph nodes. Vaginal immunization elicited a strong recruitment of antigen-specific CD4+ T cells into draining lymph nodes that was more rapid than the one observed following nasal immunization. T-cell clonal expansion was first detected in iliac lymph nodes, draining the genital tract, and proliferated T cells disseminated towards distal lymph nodes and spleen similarly to what observed following nasal immunization. T cells were indeed activated by the antigen encounter and acquired homing molecules essential to disseminate towards distal lymphoid organs as confirmed by the modulation of CD45RB, CD69, CD44 and CD62L marker expression. A multi-type Galton Watson branching process, previously used for in vitro analysis of T-cell proliferation, was applied to model in vivo CFSE proliferation data in draining lymph nodes 57 hours following immunization, in order to calculate the probabilistic decision of a cell to enter in division, rest in quiescence or migrate/die. The modelling analysis indicated that the probability of a cell to proliferate was higher following vaginal than nasal immunization. All together these data show that vaginal immunization, despite the absence of an organized mucosal associated inductive site in the genital tract, is very efficient in priming antigen-specific CD4+ T cells and inducing their dissemination from draining lymph nodes towards distal lymphoid organs. PMID:24349003
Dynamics of the cytotoxic T cell response to a model of acute viral infection.
DeWitt, William S; Emerson, Ryan O; Lindau, Paul; Vignali, Marissa; Snyder, Thomas M; Desmarais, Cindy; Sanders, Catherine; Utsugi, Heidi; Warren, Edus H; McElrath, Juliana; Makar, Karen W; Wald, Anna; Robins, Harlan S
2015-04-01
A detailed characterization of the dynamics and breadth of the immune response to an acute viral infection, as well as the determinants of recruitment to immunological memory, can greatly contribute to our basic understanding of the mechanics of the human immune system and can ultimately guide the design of effective vaccines. In addition to neutralizing antibodies, T cells have been shown to be critical for the effective resolution of acute viral infections. We report the first in-depth analysis of the dynamics of the CD8(+) T cell repertoire at the level of individual T cell clonal lineages upon vaccination of human volunteers with a single dose of YF-17D. This live attenuated yellow fever virus vaccine yields sterile, long-term immunity and has been previously used as a model to understand the immune response to a controlled acute viral infection. We identified and enumerated unique CD8(+) T cell clones specifically induced by this vaccine through a combined experimental and statistical approach that included high-throughput sequencing of the CDR3 variable region of the T cell receptor β-chain and an algorithm that detected significantly expanded T cell clones. This allowed us to establish that (i) on average, ∼ 2,000 CD8(+) T cell clones were induced by YF-17D, (ii) 5 to 6% of the responding clones were recruited to long-term memory 3 months postvaccination, (iii) the most highly expanded effector clones were preferentially recruited to the memory compartment, and (iv) a fraction of the YF-17D-induced clones could be identified from peripheral blood lymphocytes solely by measuring clonal expansion. The exhaustive investigation of pathogen-induced effector T cells is essential to accurately quantify the dynamics of the human immune response. The yellow fever vaccine (YFV) has been broadly used as a model to understand how a controlled, self-resolving acute viral infection induces an effective and long-term protective immune response. Here, we extend this
Dynamics of the Cytotoxic T Cell Response to a Model of Acute Viral Infection
DeWitt, William S.; Emerson, Ryan O.; Lindau, Paul; Vignali, Marissa; Snyder, Thomas M.; Desmarais, Cindy; Sanders, Catherine; Utsugi, Heidi; Warren, Edus H.; McElrath, Juliana; Makar, Karen W.; Wald, Anna
2015-01-01
ABSTRACT A detailed characterization of the dynamics and breadth of the immune response to an acute viral infection, as well as the determinants of recruitment to immunological memory, can greatly contribute to our basic understanding of the mechanics of the human immune system and can ultimately guide the design of effective vaccines. In addition to neutralizing antibodies, T cells have been shown to be critical for the effective resolution of acute viral infections. We report the first in-depth analysis of the dynamics of the CD8+ T cell repertoire at the level of individual T cell clonal lineages upon vaccination of human volunteers with a single dose of YF-17D. This live attenuated yellow fever virus vaccine yields sterile, long-term immunity and has been previously used as a model to understand the immune response to a controlled acute viral infection. We identified and enumerated unique CD8+ T cell clones specifically induced by this vaccine through a combined experimental and statistical approach that included high-throughput sequencing of the CDR3 variable region of the T cell receptor β-chain and an algorithm that detected significantly expanded T cell clones. This allowed us to establish that (i) on average, ∼2,000 CD8+ T cell clones were induced by YF-17D, (ii) 5 to 6% of the responding clones were recruited to long-term memory 3 months postvaccination, (iii) the most highly expanded effector clones were preferentially recruited to the memory compartment, and (iv) a fraction of the YF-17D-induced clones could be identified from peripheral blood lymphocytes solely by measuring clonal expansion. IMPORTANCE The exhaustive investigation of pathogen-induced effector T cells is essential to accurately quantify the dynamics of the human immune response. The yellow fever vaccine (YFV) has been broadly used as a model to understand how a controlled, self-resolving acute viral infection induces an effective and long-term protective immune response. Here, we
Best, Simon R.; Peng, Shiwen; Juang, Chi-Mou; Hung, Chien-Fu; Hannaman, Drew; Saunders, John R.; Wu, T.-C.; Pai, Sara I.
2009-01-01
DNA vaccines are an attractive approach to eliciting antigen-specific immunity. Intracellular targeting of tumor antigens through its linkage to immunostimulatory molecules such as calreticulin (CRT) can improve antigen processing and presentation through the MHC Class I pathway and increase cytotoxic CD8+ T cell production. However, even with these enhancements, the efficacy of such immunotherapeutic strategies is dependent on the identification of an effective route and method of DNA administration. Electroporation and gene gun-mediated particle delivery are leading methods of DNA vaccine delivery that can generate protective and therapeutic levels of immune responses in experimental models. In this study, we perform a head-to-head comparison of three methods of vaccination – conventional intramuscular injection, electroporation mediated intramuscular delivery, and epidermal gene gun-mediated particle delivery - in the ability to generate antigen specific cytotoxic CD8+ T cell responses as well as anti-tumor immune responses against an HPV-16 E7 expressing tumor cell line using the pNGVL4a-CRT/E7(detox) DNA vaccine. Vaccination via electroporation generated the highest number of E7-specific cytotoxic CD8+ T cells, which correlated to improved outcomes in the treatment of growing tumors. In addition, we demonstrate that electroporation results in significantly higher levels of circulating protein compared to gene gun or intramuscular vaccination, which likely enhances calreticulin’s role as a local tumor anti-angiogenesis agent. We conclude that electroporation is a promising method for delivery of HPV DNA vaccines and should be considered for DNA vaccine delivery in human clinical trials. PMID:19622402
Mizukami, Yoshihisa; Abe, Tomoyuki; Shibata, Hiroaki; Makimura, Yukitoshi; Fujishiro, Shuh-hei; Yanase, Kimihide; Hishikawa, Shuji; Kobayashi, Eiji; Hanazono, Yutaka
2014-01-01
Recent studies have revealed negligible immunogenicity of induced pluripotent stem (iPS) cells in syngeneic mice and in autologous monkeys. Therefore, human iPS cells would not elicit immune responses in the autologous setting. However, given that human leukocyte antigen (HLA)-matched allogeneic iPS cells would likely be used for medical applications, a more faithful model system is needed to reflect HLA-matched allogeneic settings. Here we examined whether iPS cells induce immune responses in the swine leukocyte antigen (SLA)-matched setting. iPS cells were generated from the SLA-defined C1 strain of Clawn miniature swine, which were confirmed to develop teratomas in mice, and transplanted into the testes (n = 4) and ovary (n = 1) of C1 pigs. No teratomas were found in pigs on 47 to 125 days after transplantation. A Mixed lymphocyte reaction revealed that T-cell responses to the transplanted MHC-matched (C1) iPS cells were significantly lower compared to allogeneic cells. The humoral immune responses were also attenuated in the C1-to-C1 setting. More importantly, even MHC-matched iPS cells were susceptible to innate immunity, NK cells and serum complement. iPS cells lacked the expression of SLA class I and sialic acids. The in vitro cytotoxic assay showed that C1 iPS cells were targeted by NK cells and serum complement of C1. In vivo, the C1 iPS cells developed larger teratomas in NK-deficient NOG (T-B-NK-) mice (n = 10) than in NK-competent NOD/SCID (T-B-NK+) mice (n = 8) (p<0.01). In addition, C1 iPS cell failed to form teratomas after incubation with the porcine complement-active serum. Taken together, MHC-matched iPS cells can attenuate cellular and humoral immune responses, but still susceptible to innate immunity in pigs.
Regulation of vesicular traffic at the T cell immune synapse: lessons from the primary cilium.
Finetti, Francesca; Onnis, Anna; Baldari, Cosima T
2015-03-01
The signals that orchestrate the process of T cell activation are coordinated at the specialized interface that forms upon contact with an antigen presenting cell displaying a specific MHC-associated peptide ligand, known as the immune synapse. The central role of vesicular traffic in the assembly of the immune synapse has emerged only in recent years with the finding that sustained T-cell receptor (TCR) signaling involves delivery of TCR/CD3 complexes from an intracellular pool associated with recycling endosomes. A number of receptors as well as membrane-associated signaling mediators have since been demonstrated to exploit this process to localize to the immune synapse. Here, we will review our current understanding of the mechanisms responsible for TCR recycling, with a focus on the intraflagellar transport system, a multimolecular complex that is responsible for the assembly and function of the primary cilium which we have recently implicated in polarized endosome recycling to the immune synapse. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Cellular Factors Targeting APCs to Modulate Adaptive T Cell Immunity
Do, Jeongsu; Min, Booki
2014-01-01
The fate of adaptive T cell immunity is determined by multiple cellular and molecular factors, among which the cytokine milieu plays the most important role in this process. Depending on the cytokines present during the initial T cell activation, T cells become effector cells that produce different effector molecules and execute adaptive immune functions. Studies thus far have primarily focused on defining how these factors control T cell differentiation by targeting T cells themselves. However, other non-T cells, particularly APCs, also express receptors for the factors and are capable of responding to them. In this review, we will discuss how APCs, by responding to those cytokines, influence T cell differentiation and adaptive immunity. PMID:25126585
Osthole promotes anti-tumor immune responses in tumor-bearing mice with hepatocellular carcinoma.
Zhang, Lurong; Jiang, Guorong; Yao, Fei; Liang, Guoqiang; Wang, Fei; Xu, Heng; Wu, Yan; Yu, Xiao; Liu, Haiyan
2015-06-01
Osthole, a natural coumarin derivative, has been shown to have anti-tumor and anti-inflammatory activity. However, the effect of osthole on anti-tumor immune responses in tumor-bearing mice has not yet been reported. In the present study, osthole treatment did not affect the weight and the coefficient of thymus and spleen in tumor-bearing mice with hepatocellular carcinoma (HCC). However, osthole administration significantly elevated the proportion and number of the splenic CD8(+) T cells, the proportion of CD4(+) T and CD8(+) T cells in tumor tissues, and the levels of IL-2 and TNF-α in the serum of HCC tumor-bearing mice. Our results suggested that osthole could promote the activation of the tumor-infiltrating CD4(+) T and CD8(+) T cells, and elevate the proportion of CD4(+) and CD8(+) effector T cells. Osthole treatment also significantly decreased the proportion of CD4(+)CD25(+)Foxp3(+) regulatory T cells in the spleen. Taken together, osthole could enhance the T cell mediated anti-tumor immune responses in the tumor-bearing mice with HCC.
Tilapia show immunization response against Ich
USDA-ARS?s Scientific Manuscript database
This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...
Akondy, Rama S; Johnson, Philip L F; Nakaya, Helder I; Edupuganti, Srilatha; Mulligan, Mark J; Lawson, Benton; Miller, Joseph D; Pulendran, Bali; Antia, Rustom; Ahmed, Rafi
2015-03-10
CD8 T cells are a potent tool for eliminating intracellular pathogens and tumor cells. Thus, eliciting robust CD8 T-cell immunity is the basis for many vaccines under development. However, the relationship between antigen load and the magnitude of the CD8 T-cell response is not well-described in a human immune response. Here we address this issue by quantifying viral load and the CD8 T-cell response in a cohort of 80 individuals immunized with the live attenuated yellow fever vaccine (YFV-17D) by sampling peripheral blood at days 0, 1, 2, 3, 5, 7, 9, 11, 14, 30, and 90. When the virus load was below a threshold (peak virus load < 225 genomes per mL, or integrated virus load < 400 genome days per mL), the magnitude of the CD8 T-cell response correlated strongly with the virus load (R(2) ∼ 0.63). As the virus load increased above this threshold, the magnitude of the CD8 T-cell responses saturated. Recent advances in CD8 T-cell-based vaccines have focused on replication-incompetent or single-cycle vectors. However, these approaches deliver relatively limited amounts of antigen after immunization. Our results highlight the requirement that T-cell-based vaccines should deliver sufficient antigen during the initial period of the immune response to elicit a large number of CD8 T cells that may be needed for protection.
Pulmonary arterial remodeling induced by a Th2 immune response
Daley, Eleen; Emson, Claire; Guignabert, Christophe; de Waal Malefyt, Rene; Louten, Jennifer; Kurup, Viswanath P.; Hogaboam, Cory; Taraseviciene-Stewart, Laimute; Voelkel, Norbert F.; Rabinovitch, Marlene; Grunig, Ekkehard; Grunig, Gabriele
2008-01-01
Pulmonary arterial remodeling characterized by increased vascular smooth muscle density is a common lesion seen in pulmonary arterial hypertension (PAH), a deadly condition. Clinical correlation studies have suggested an immune pathogenesis of pulmonary arterial remodeling, but experimental proof has been lacking. We show that immunization and prolonged intermittent challenge via the airways with either of two different soluble antigens induced severe muscularization in small- to medium-sized pulmonary arteries. Depletion of CD4+ T cells, antigen-specific T helper type 2 (Th2) response, or the pathogenic Th2 cytokine interleukin 13 significantly ameliorated pulmonary arterial muscularization. The severity of pulmonary arterial muscularization was associated with increased numbers of epithelial cells and macrophages that expressed a smooth muscle cell mitogen, resistin-like molecule α, but surprisingly, there was no correlation with pulmonary hypertension. Our data are the first to provide experimental proof that the adaptive immune response to a soluble antigen is sufficient to cause severe pulmonary arterial muscularization, and support the clinical observations in pediatric patients and in companion animals that muscularization represents one of several injurious events to the pulmonary artery that may collectively contribute to PAH. PMID:18227220
Li, Li; Wang, Wei; Pan, Hong; Ma, Ge; Shi, Xinyi; Xie, Hui; Liu, Xiaoan; Ding, Qiang; Zhou, Wenbin; Wang, Shui
2017-01-31
Minimally invasive therapies, such as microwave ablation (MWA), are widely used for the treatment of solid tumors. Previous studies suggest that MWA is feasible for the treatment of small breast cancer, and thermal ablation may induce adaptive antitumor immunity. However, the induced immune responses are mostly weak, and the immunomodulation effects of MWA in breast cancer are unclear. Immunostimulant OK-432 can induce tumor-specific T-cell responses and may augment the immunity induced by MWA. We treated 4T1 breast cancer bearing BALB/c mice with MWA, OK-432, MWA plus OK-432, or left without treatment. Survival time was evaluated with the Kaplan-Meyer method comparing survival curves by log-rank test. On day 25 after ablation, surviving mice received tumor rechallenge, and the rechallenged tumor volumes were calculated every 5 days. Immunohistochemistry and flow cytometry were used to evaluate the T-cell immune responses in ablated tissues and spleens. The tumor-specific immunity was assessed by enzyme-linked immunospot assays. Besides, the cytokine patterns were identified from enzyme-linked immunosorbent assay. Microwave ablation plus OK-432 resulted in longer survival than single treatment and protect most surviving mice from tumor rechallenge. Both local and systemic T-cell responses were induced by MWA and were further enhanced by subsequent administration of OK-432. Moreover, the combination of MWA and OK-432 induced stronger tumor-specific immune responses than MWA alone. In addition, OK-432 and MWA synergistically promoted the production of Th1-type but not Th2-type cytokines, and polarized T-cell responses to Th1-dominant state. The T-cell immune responses were activated by MWA in breast cancer. Furthermore, the combination of MWA and OK-432 induced Th1-type response and elicited specific antitumor immunity.
Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying
2007-01-01
BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844
Liu, Zuqiang; Falo, Louis D; You, Zhaoyang
2011-07-01
Although high mobility group box 1 (HMGB1) in tumor cells is involved in many aspects of tumor progression, its role in tumor immune suppression remains elusive. Host cell-derived IL-10 suppressed a naturally acquired CD8 T cell-dependent antitumor response. The suppressive activity of tumor-associated Foxp3(+)CD4(+)CD25(+) regulatory T cells (Treg) was IL-10 dependent. Neutralizing HMGB1 impaired tumor cell-promoted IL-10 production by Treg. Short hairpin RNA-mediated knockdown of HMGB1 (HMGB1 KD) in tumor cells did not affect tumor cell growth but uncovered naturally acquired long-lasting tumor-specific IFN-γ- or TNF-α-producing CD8 T cell responses and attenuated their ability to induce Treg, leading to naturally acquired CD8 T cell- or IFN-γ-dependent tumor rejection. The data suggest that tumor cell-derived HMGB1 may suppress naturally acquired CD8 T cell-dependent antitumor immunity via enhancing Treg to produce IL-10, which is necessary for Treg-mediated immune suppression.
In situ immune response after neoadjuvant chemotherapy for breast cancer predicts survival.
Ladoire, Sylvain; Mignot, Grégoire; Dabakuyo, Sandrine; Arnould, Laurent; Apetoh, Lionel; Rébé, Cedric; Coudert, Bruno; Martin, Francois; Bizollon, Marie Hélène; Vanoli, André; Coutant, Charles; Fumoleau, Pierre; Bonnetain, Franck; Ghiringhelli, François
2011-07-01
Accumulating preclinical evidence suggests that anticancer immune responses contribute to the success of chemotherapy. However, the predictive value of tumour-infiltrating lymphocytes after neoadjuvant chemotherapy for breast cancer remains unknown. We hypothesized that the nature of the immune infiltrate following neoadjuvant chemotherapy would predict patient survival. In a series of 111 consecutive HER2- and a series of 51 non-HER2-overexpressing breast cancer patients treated by neoadjuvant chemotherapy, we studied by immunohistochemistry tumour infiltration by FOXP3 and CD8 T lymphocytes before and after chemotherapy. Kaplan-Meier analysis and Cox modelling were used to assess relapse-free survival (RFS) and overall survival (OS). A predictive scoring system using American Joint Committee on Cancer (AJCC) pathological staging and immunological markers was created. Association of high CD8 and low FOXP3 cell infiltrates after chemotherapy was significantly associated with improved RFS (p = 0.02) and OS (p = 0.002), and outperformed classical predictive factors in multivariate analysis. A combined score associating CD8/FOXP3 ratio and pathological AJCC staging isolated a subgroup of patients with a long-term overall survival of 100%. Importantly, this score also identified patients with a favourable prognosis in an independent cohort of HER2-negative breast cancer patients. These results suggest that immunological CD8 and FOXP3 cell infiltrate after treatment is an independent predictive factor of survival in breast cancer patients treated with neoadjuvant chemotherapy and provides new insights into the role of the immune milieu and cancer. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Jacobson, Lee S.; Lima, Heriberto; Goldberg, Michael F.; Gocheva, Vasilena; Tsiperson, Vladislav; Sutterwala, Fayyaz S.; Joyce, Johanna A.; Gapp, Bianca V.; Blomen, Vincent A.; Chandran, Kartik; Brummelkamp, Thijn R.; Diaz-Griffero, Felipe; Brojatsch, Jürgen
2013-01-01
Immunologic adjuvants are critical components of vaccines, but it remains unclear how prototypical adjuvants enhance the adaptive immune response. Recent studies have shown that necrotic cells could trigger an immune response. Although most adjuvants have been shown to be cytotoxic, this activity has traditionally been considered a side effect. We set out to test the role of adjuvant-mediated cell death in immunity and found that alum, the most commonly used adjuvant worldwide, triggers a novel form of cell death in myeloid leukocytes characterized by cathepsin-dependent lysosome-disruption. We demonstrated that direct lysosome-permeabilization with a soluble peptide, Leu-Leu-OMe, mimics the alum-like form of necrotic cell death in terms of cathepsin dependence and cell-type specificity. Using a combination of a haploid genetic screen and cathepsin-deficient cells, we identified specific cathepsins that control lysosome-mediated necrosis. We identified cathepsin C as critical for Leu-Leu-OMe-induced cell death, whereas cathepsins B and S were required for alum-mediated necrosis. Consistent with a role of necrotic cell death in adjuvant effects, Leu-Leu-OMe replicated an alum-like immune response in vivo, characterized by dendritic cell activation, granulocyte recruitment, and production of Th2-associated antibodies. Strikingly, cathepsin C deficiency not only blocked Leu-Leu-OMe-mediated necrosis but also impaired Leu-Leu-OMe-enhanced immunity. Together our findings suggest that necrotic cell death is a powerful mediator of a Th2-associated immune response. PMID:23297415
Cyclooxygenase-1 and -2 Play Contrasting Roles in Listeria-Stimulated Immunity.
Theisen, Erin; McDougal, Courtney E; Nakanishi, Masako; Stevenson, David M; Amador-Noguez, Daniel; Rosenberg, Daniel W; Knoll, Laura J; Sauer, John-Demian
2018-06-01
Nonsteroidal anti-inflammatory drugs (NSAIDs) inhibit cyclooxygenase (COX) activity and are commonly used for pain relief and fever reduction. NSAIDs are used following childhood vaccinations and cancer immunotherapies; however, how NSAIDs influence the development of immunity following these therapies is unknown. We hypothesized that NSAIDs would modulate the development of an immune response to Listeria monocytogenes -based immunotherapy. Treatment of mice with the nonspecific COX inhibitor indomethacin impaired the generation of cell-mediated immunity. This phenotype was due to inhibition of the inducible COX-2 enzyme, as treatment with the COX-2-selective inhibitor celecoxib similarly inhibited the development of immunity. In contrast, loss of COX-1 activity improved immunity to L. monocytogenes Impairments in immunity were independent of bacterial burden, dendritic cell costimulation, or innate immune cell infiltrate. Instead, we observed that PGE 2 production following L. monocytogenes is critical for the formation of an Ag-specific CD8 + T cell response. Use of the alternative analgesic acetaminophen did not impair immunity. Taken together, our results suggest that COX-2 is necessary for optimal CD8 + T cell responses to L. monocytogenes , whereas COX-1 is detrimental. Use of pharmacotherapies that spare COX-2 activity and the production of PGE 2 like acetaminophen will be critical for the generation of optimal antitumor responses using L. monocytogenes . Copyright © 2018 by The American Association of Immunologists, Inc.
Vallejo, Alejandro; Monge-Maillo, Begoña; Gutiérrez, Carolina; Norman, Francesca F; López-Vélez, Rogelio; Pérez-Molina, José A
2016-12-01
Symptomatic chronic Chagas disease affects up to 40% of patients infected with Trypanosoma cruzi. The lack of reliable early markers of cure after therapy hinders disease management and clinical trials with new drugs. We performed a study with 18 months of follow-up to compare changes in immune parameters and T. cruzi-specific immune responses as surrogate markers of response to therapy between patients treated with benznidazole and untreated patients. This was a pilot, open-label, randomised clinical trial of treatment with benznidazole versus no treatment in patients with indeterminate chronic T. cruzi infection. In both groups we investigated changes in T-cell activation, T-cell subpopulations, regulatory T-cell counts, IL6, and sCD14 levels, and T. cruzi-specific immune responses (Th1, Th2, and Th17 responses). Fourteen patients were included in the study (seven in each group). Median age was 35 years (P 25-75 31-43), 57% were female, and 93% were Bolivian. Benznidazole was administered at 5mg/kg/day for 60days. Three patients discontinued benznidazole owing to adverse reactions and were not evaluated. At the end of the follow-up period, treated patients showed significantly less immune activation and lower regulatory T-cell counts, with an increased Th17 and Th1 response. This randomised pilot clinical trial administering benznidazole to patients with indeterminate chronic Chagas disease brings about changes in the adaptive immunity, leading to a general decrease in inflammatory status. This apparently beneficial response could act as the basis for monitoring new antiparasitic drugs. Copyright © 2016 Elsevier B.V. All rights reserved.
Wiedermann, U; Hanson, L A; Kahu, H; Dahlgren, U I
1993-01-01
We have previously reported that vitamin A deficiency resulted in a reduced IgA antibody response to cholera toxin (CT) after per-oral immunization. In the present investigation we have studied the in vivo and in vitro immune response in vitamin A-deficient rats to two parenterally applied antigens, beta-lactoglobulin (beta-LG) and picrylsulphonic acid (TNP)-Ficoll. The serum IgG and IgM antibody responses to the T-cell dependent antigen beta-LG were significantly lower in the vitamin A-deficient rats than in the pair-fed control rats. No such differences were seen with the IgG and IgM responses to the T-cell independent antigen TNP-Ficoll. However, the biliary IgA and the serum IgE antibodies against both antigens were decreased in the vitamin A-deficient rats. In vitro lymphocyte stimulation with concanavalin A (Con A) or beta-LG gave higher T-cell proliferation rates in the vitamin A-deficient than in the control rats. Interleukin-2 (IL-2) and interferon-gamma (IFN-gamma) levels in supernatants from Con A-stimulated mesenteric lymph node cells were also higher in the vitamin A-deficient rats, while IL-6 levels were decreased, which is consistent with an up-regulated Th1 activity. Proliferation studies on purified accessory cells and T cells from the deficient and the control rats, mixed in different combinations, showed that the T cells, but not the accessory cells, were disturbed in the vitamin A-deficient rats. Despite the increased T-cell activity in vitro the vitamin A-deficient rats had a lower delayed-type hypersensitivity (DTH) reaction than the pair-fed control rats. In conclusion, the increased IL-2 and IFN-gamma levels may reflect an up-regulation of Th1 cell function, while the decreased IgA, IgE and IL-6 levels indicate a suppression of Th2 cells. The disturbed T-lymphocyte function is manifested in vivo as a decreased DTH reaction and suppressed antibody production, the latter possibly due to a lack of B-cell switching and proliferation factors in
Lim, Kian-Lam; Jazayeri, Seyed Davoud; Yeap, Swee Keong; Mohamed Alitheen, Noorjahan Banu; Bejo, Mohd Hair; Ideris, Aini; Omar, Abdul Rahman
2013-12-01
We had examined the immunogenicity of a series of plasmid DNAs which include neuraminidase (NA) and nucleoprotein (NP) genes from avian influenza virus (AIV). The interleukin-15 (IL-15) and interleukin-18 (IL-18) as genetic adjuvants were used for immunization in combination with the N1 and NP AIV genes. In the first trial, 8 groups of chickens were established with 10 specific-pathogen-free (SPF) chickens per group while, in the second trial 7 SPF chickens per group were used. The overall N1 enzyme-linked immunosorbent assay (ELISA) titer in chickens immunized with the pDis/N1+pDis/IL-15 was higher compared to the chickens immunized with the pDis/N1 and this suggesting that chicken IL-15 could play a role in enhancing the humoral immune response. Besides that, the chickens that were immunized at 14-day-old (Trial 2) showed a higher N1 antibody titer compared to the chickens that were immunized at 1-day-old (Trial 1). Despite the delayed in NP antibody responses, the chickens co-administrated with IL-15 were able to induce earlier and higher antibody response compared to the pDis/NP and pDis/NP+pDis/IL-18 inoculated groups. The pDis/N1+pDis/IL-15 inoculated chickens also induced higher CD8+ T cells increase than the pDis/N1 group in both trials (P<0.05). The flow cytometry results from both trials demonstrated that the pDis/N1+pDis/IL-18 groups were able to induce CD4+ T cells higher than the pDis/N1 group (P<0.05). Meanwhile, pDis/N1+pDis/IL-18 group was able to induce CD8+ T cells higher than the pDis/N1 group (P<0.05) in Trial 2 only. In the present study, pDis/NP was not significant (P>0.05) in inducing CD4+ and CD8+ T cells when co-administered with the pDis/IL-18 in both trials in comparison to the pDis/NP. Our data suggest that the pDis/N1+pDis/IL-15 combination has the potential to be used as a DNA vaccine against AIV in chickens. Copyright © 2013 Elsevier Ltd. All rights reserved.
Perruccio, Katia; Topini, Fabiana; Tosti, Antonella; Gazzola, Maria Vittoria; Messina, Chiara; Martelli, Massimo F; Caniglia, Maurizio; Velardi, Andrea; Cesaro, Simone
2015-12-01
After hematopoietic stem cell transplantation, invasive aspergillosis remains one of the most lethal infections. Susceptibility may be due to prophylaxis and treatment of graft-vs.-host disease in T-cell-replete transplants, and delayed immune rebuilding due to T-cell depletion in haploidentical transplantation. We monitored CD4(+) T-cell recovery and anti-Aspergillus immune competence in pediatric recipients of T-cell-replete matched transplants and of prevalently adult recipients of T-cell-depleted matched or haploidentical transplants for hematological malignancies. Although CD4(+) T-cell counts were higher in T-cell-replete transplant recipients at all post-transplant time points, Aspergillus-specific T cells were first detected 15-18 months after T-cell-replete matched, 7-9 months after T-cell-depleted matched, and 9-12 months after haploidentical transplantation, respectively. Incidence of invasive aspergillosis was 22% with 10% mortality after T-cell-replete transplants, 0% after T-cell-depleted matched, and 7% with 4% mortality after haploidentical transplants. Although T-cell counts were significantly higher after T-cell-replete transplants, post-transplant immune suppression/GvHD appeared to impair their function. Specific Aspergillus immune competence recovered faster after T-cell-depleted transplants, whether matched or haploidentical. T-cell-replete transplants were associated with a higher incidence of invasive aspergillosis and Aspergillus-related deaths. These results showed that T-cell depletion without post-transplant immunosuppression is associated to a faster immune recovery than T-cell-replete transplantation. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Immune responses in humans after 60 days of confinement
NASA Technical Reports Server (NTRS)
Schmitt, D. A.; Peres, C.; Sonnenfeld, G.; Tkackzuk, J.; Arquier, M.; Mauco, G.; Ohayon, E.
1995-01-01
A confinement experiment in a normobaric diving chamber was undertaken to better understand the effect of confinement and isolation on human psychology and physiology. Pre- and postconfinement blood samples were obtained from four test subjects and control donors to analyze immune responses. No modification in the levels of CD2+, CD3+, CD4+, CD8+, CD19+, and CD56+ cells was observed after confinement. Mitogen-induced T-lymphocyte proliferation and interleukin-2 receptor expression were not altered significantly. Whole blood interferon-alpha and gamma-induction and plasma cortisol levels were also unchanged, as was natural killer cell activity. These data suggest that in humans, no specific components of the immune response are affected by a 2-month isolation and confinement of a small group.
POLE proofreading mutations elicit an anti-tumor immune response in endometrial cancer
van Gool, Inge C; Eggink, Florine A; Freeman-Mills, Luke; Stelloo, Ellen; Marchi, Emanuele; de Bruyn, Marco; Palles, Claire; Nout, Remi A; de Kroon, Cor D; Osse, Elisabeth M; Klenerman, Paul; Creutzberg, Carien L; Tomlinson, Ian PM; Smit, Vincent THBM; Nijman, Hans W
2015-01-01
Purpose Recent studies have shown that 7-12% of endometrial cancers (ECs) are ultramutated due to somatic mutation in the proofreading exonuclease domain of the DNA replicase POLE. Interestingly, these tumors have an excellent prognosis. In view of the emerging data linking mutation burden, immune response and clinical outcome in cancer, we investigated whether POLE-mutant ECs showed evidence of increased immunogenicity. Experimental design We examined immune infiltration and activation according to tumor POLE proofreading mutation in a molecularly defined EC cohort including 47 POLE-mutant tumors. We sought to confirm our results by analysis of RNAseq data from the TCGA EC series and used the same series to examine whether differences in immune infiltration could be explained by an enrichment of immunogenic neoepitopes in POLE-mutant ECs. Results Compared to other ECs, POLE-mutants displayed an enhanced cytotoxic T cell response, evidenced by increased numbers of CD8+ tumor infiltrating lymphocytes and CD8A expression, enrichment for a tumor-infiltrating T cell gene signature, and strong upregulation of the T cell cytotoxic differentiation and effector markers T-bet, Eomes, IFNG, PRF and granzyme B. This was accompanied by upregulation of T cell exhaustion markers, consistent with chronic antigen exposure. In-silico analysis confirmed that POLE-mutant cancers are predicted to display more antigenic neo-epitopes than other ECs, providing a potential explanation for our findings. Conclusions Ultramutated POLE proofreading-mutant ECs are characterized by a robust intratumoral T cell response, which correlates with, and may be caused by an enrichment of antigenic neo-peptides. Our study provides a plausible mechanism for the excellent prognosis of these cancers. PMID:25878334
Woodruff, Matthew C.; Heesters, Balthasar A.; Herndon, Caroline N.; Groom, Joanna R.; Thomas, Paul G.; Luster, Andrew D.; Turley, Shannon J.
2014-01-01
Dendritic cells (DCs) are well established as potent antigen-presenting cells critical to adaptive immunity. In vaccination approaches, appropriately stimulating lymph node–resident DCs (LNDCs) is highly relevant to effective immunization. Although LNDCs have been implicated in immune response, their ability to directly drive effective immunity to lymph-borne antigen remains unclear. Using an inactive influenza vaccine model and whole node imaging approaches, we observed surprising responsiveness of LNDC populations to vaccine arrival resulting in a transnodal repositioning into specific antigen collection sites within minutes after immunization. Once there, LNDCs acquired viral antigen and initiated activation of viral specific CD4+ T cells, resulting in germinal center formation and B cell memory in the absence of skin migratory DCs. Together, these results demonstrate an unexpected stimulatory role for LNDCs where they are capable of rapidly locating viral antigen, driving early activation of T cell populations, and independently establishing functional immune response. PMID:25049334
Paramyxovirus activation and inhibition of innate immune responses.
Parks, Griffith D; Alexander-Miller, Martha A
2013-12-13
Paramyxoviruses represent a remarkably diverse family of enveloped nonsegmented negative-strand RNA viruses, some of which are the most ubiquitous disease-causing viruses of humans and animals. This review focuses on paramyxovirus activation of innate immune pathways, the mechanisms by which these RNA viruses counteract these pathways, and the innate response to paramyxovirus infection of dendritic cells (DC). Paramyxoviruses are potent activators of extracellular complement pathways, a first line of defense that viruses must face during natural infections. We discuss mechanisms by which these viruses activate and combat complement to delay neutralization. Once cells are infected, virus replication drives type I interferon (IFN) synthesis that has the potential to induce a large number of antiviral genes. Here we describe four approaches by which paramyxoviruses limit IFN induction: by limiting synthesis of IFN-inducing aberrant viral RNAs, through targeted inhibition of RNA sensors, by providing viral decoy substrates for cellular kinase complexes, and through direct blocking of the IFN promoter. In addition, paramyxoviruses have evolved diverse mechanisms to disrupt IFN signaling pathways. We describe three general mechanisms, including targeted proteolysis of signaling factors, sequestering cellular factors, and upregulation of cellular inhibitors. DC are exceptional cells with the capacity to generate adaptive immunity through the coupling of innate immune signals and T cell activation. We discuss the importance of innate responses in DC following paramyxovirus infection and their consequences for the ability to mount and maintain antiviral T cells. © 2013.
Paramyxovirus Activation and Inhibition of Innate Immune Responses
Parks, Griffith D.; Alexander-Miller, Martha A.
2014-01-01
Paramyxoviruses represent a remarkably diverse family of enveloped nonsegmented negative-strand RNA viruses, some of which are the most ubiquitous disease-causing viruses of humans and animals. This review focuses on paramyxovirus activation of innate immune pathways, the mechanisms by which these RNA viruses counteract these pathways, and the innate response to paramyxovirus infection of dendritic cells (DC). Paramyxoviruses are potent activators of extracellular complement pathways, a first line of defense that viruses must face during natural infections. We discuss mechanisms by which these viruses activate and combat complement to delay neutralization. Once cells are infected, virus replication drives type I interferon (IFN) synthesis that has the potential to induce a large number of antiviral genes. Here we describe four approaches by which paramyxoviruses limit IFN induction: by limiting synthesis of IFN-inducing aberrant viral RNAs, through targeted inhibition of RNA sensors, by providing viral decoy substrates for cellular kinase complexes, and through direct blocking of the IFN promoter. In addition, paramyxoviruses have evolved diverse mechanisms to disrupt IFN signaling pathways. We describe three general mechanisms, including targeted proteolysis of signaling factors, sequestering cellular factors, and upregulation of cellular inhibitors. DC are exceptional cells with the capacity to generate adaptive immunity through the coupling of innate immune signals and T cell activation. We discuss the importance of innate responses in DC following paramyxovirus infection and their consequences for the ability to mount and maintain antiviral T cells. PMID:24056173
Universal immunity to influenza must outwit immune evasion
Quiñones-Parra, Sergio; Loh, Liyen; Brown, Lorena E.; Kedzierska, Katherine; Valkenburg, Sophie A.
2014-01-01
Although an influenza vaccine has been available for 70 years, influenza virus still causes seasonal epidemics and worldwide pandemics. Currently available vaccines elicit strain-specific antibody (Ab) responses to the surface haemagglutinin (HA) and neuraminidase (NA) proteins, but these can be ineffective against serologically-distinct viral variants and novel subtypes. Thus, there is a great need for cross-protective or “universal” influenza vaccines to overcome the necessity for annual immunization against seasonal influenza and to provide immunity to reduce the severity of infection with pandemic or outbreak viruses. It is well established that natural influenza infection can provide cross-reactive immunity that can reduce the impact of infection with distinct influenza type A strains and subtypes, including H1N1, H3N2, H2N2, H5N1, and H7N9. The key to generating universal influenza immunity through vaccination is to target functionally-conserved regions of the virus, which include epitopes on the internal proteins for cross-reactive T cell immunity or on the HA stem for broadly reactive Ab responses. In the wake of the 2009 H1N1 pandemic, broadly neutralizing antibodies (bnAbs) have been characterized and isolated from convalescent and vaccinated individuals, inspiring development of new vaccination techniques to elicit such responses. Induction of influenza-specific T cell responses through vaccination has also been recently examined in clinical trials. Strong evidence is available from human and animal models of influenza to show that established influenza-specific T cell memory can reduce viral shedding and symptom severity. However, the published evidence also shows that CD8+ T cells can efficiently select immune escape mutants early after influenza virus infection. Here, we discuss universal immunity to influenza viruses mediated by both cross-reactive T cells and Abs, the mechanisms of immune evasion in influenza, and propose how to counteract
Vallejo, Abbe N.; Mueller, Robert G.; Hamel, David L.; Way, Amanda; Dvergsten, Jeffrey A.; Griffin, Patricia; Newman, Anne B.
2010-01-01
As the repertoire of αβT cell receptors (TCR) contracts with advancing age, there is an associated age-dependent accumulation of oligoclonal T cells expressing of a variety of receptors (NKR), normally expressed on natural killer (NK) cells. Evidences for differential regulation of expression of particular NKRs between T cells and NK cells suggest that NKR expression on T cells is physiologically programmed rather than a random event of the aging process. Experimental studies show NKRs on aged αβT cells may function either as independent receptors, and/or as costimulatory receptors to the TCR. Considering the reported deficits of conventional αβTCR-driven activation and also functional deficits of classical NK cells, NKR+ αβT cells likely represent novel immune effectors that are capable of combining innate and adaptive functions. Inasmuch as immunity is a determinant of individual fitness, the type and density of NKRs could be important contributing factors to the wide heterogeneity of health characteristics of older adults, ranging from institutionalized frail elders who are unable to mount immune responses to functionally independent community-dwelling elders who exhibit protective immunity. Understanding the biology of NKR+ αβT cells could lead to new avenues for age-specific intervention to improve protective immunity. PMID:20932941
Humoral and Cellular Immune Response in Canine Hypothyroidism.
Miller, J; Popiel, J; Chełmońska-Soyta, A
2015-07-01
Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response. Copyright © 2015 Elsevier Ltd. All rights reserved.
Alterations in the human immune response to the hepatitis B vaccine among the elderly.
Cook, J M; Gualde, N; Hessel, L; Mounier, M; Michel, J P; Denis, F; Ratinaud, M H
1987-10-01
The specific binding of hepatitis B (HBs) antigen by lymphocytes from old people immunized with hepatitis B vaccine was explored. For that purpose HBs antigen was combined with fluorescent microspheres, and labeled antigen was allowed to react with lymphocytes from HBs vaccine-responsive or unresponsive people. Lymphocytes from 10 responders and 14 nonresponders were tested for their antigen-binding ability. For controls, lymphocytes were incubated with microspheres bearing human albumin. Lymphocytes from 8 out of 10 responders were able to recognize HBs antigen; for the nonresponders the ratio was 9 out of 14. HBs-binding lymphocytes were B cells but not T lymphocytes. B and T cells from responders and nonresponders were combined and cultivated for 8 days in the presence of HBs antigen, and antibody-producing cells were counted. Neither B cells alone nor B cells plus T cells from nonresponders were able to produce antibody. On the other hand B cells from unresponsive old people produced antibodies when they were cultivated in the presence of HBs antigen and T cells from responsive old people. These data suggest that some elderly individuals who do not produce antibody after in vivo immunization by HBs vaccine do have antibody-producing cells. Instead of a gap in their immune repertoire, these people are suffering from immune dysfunction.
Yersinia type III effectors perturb host innate immune responses
Pha, Khavong; Navarro, Lorena
2016-01-01
The innate immune system is the first line of defense against invading pathogens. Innate immune cells recognize molecular patterns from the pathogen and mount a response to resolve the infection. The production of proinflammatory cytokines and reactive oxygen species, phagocytosis, and induced programmed cell death are processes initiated by innate immune cells in order to combat invading pathogens. However, pathogens have evolved various virulence mechanisms to subvert these responses. One strategy utilized by Gram-negative bacterial pathogens is the deployment of a complex machine termed the type III secretion system (T3SS). The T3SS is composed of a syringe-like needle structure and the effector proteins that are injected directly into a target host cell to disrupt a cellular response. The three human pathogenic Yersinia spp. (Y. pestis, Y. enterocolitica, and Y. pseudotuberculosis) are Gram-negative bacteria that share in common a 70 kb virulence plasmid which encodes the T3SS. Translocation of the Yersinia effector proteins (YopE, YopH, YopT, YopM, YpkA/YopO, and YopP/J) into the target host cell results in disruption of the actin cytoskeleton to inhibit phagocytosis, downregulation of proinflammatory cytokine/chemokine production, and induction of cellular apoptosis of the target cell. Over the past 25 years, studies on the Yersinia effector proteins have unveiled tremendous knowledge of how the effectors enhance Yersinia virulence. Recently, the long awaited crystal structure of YpkA has been solved providing further insights into the activation of the YpkA kinase domain. Multisite autophosphorylation by YpkA to activate its kinase domain was also shown and postulated to serve as a mechanism to bypass regulation by host phosphatases. In addition, novel Yersinia effector protein targets, such as caspase-1, and signaling pathways including activation of the inflammasome were identified. In this review, we summarize the recent discoveries made on Yersinia
A Deeper Look into Type 1 Diabetes – Imaging Immune Responses during Onset of Disease
Christoffersson, Gustaf; von Herrath, Matthias G.
2016-01-01
Cytotoxic T lymphocytes execute the killing of insulin-producing beta cells during onset of type 1 diabetes mellitus (T1D). The research community has come far in dissecting the major events in the development of this disease, but still the trigger and high-resolved information of the immunological events leading up to beta cell loss are missing. During the past decades, intravital imaging of immune responses has led to significant scientific breakthroughs in diverse models of disease, including T1D. Dynamic imaging of immune cells at the pancreatic islets during T1D onset has been made possible through the development of both advanced microscopes, and animal models that allow long-term immobilization of the pancreas. The use of these modalities has revealed a milling microenvironment at the pancreatic islets during disease onset with a plethora of active players. Clues to answering the remaining questions in this disease may lie in intravital imaging, including how key immune cells traffic to and from the pancreas, and how cells interact at this target tissue. This review highlights and discusses recent studies, models, and techniques focused to understand the immune responses during T1D onset through intravital imaging. PMID:27574523
Goessling, Jeffrey M; Guyer, Craig; Mendonça, Mary T
Organisms possess a range of thermoregulatory strategies that may vary in response to sickness, thereby driving important life-history consequences. Because the immune system is vital to maintaining organism function, understanding the suite of immune responses to infection indicates basic costs and benefits of physiological strategies. Here, we assessed consequences of thermoregulation and seasonality on immune function in both immunologically stimulated and nonstimulated gopher tortoises (Gopherus polyphemus). An ectothermic vertebrate was used as an experimental model because the effects of thermoregulation on immunity remain understudied and are of increasing importance in light of anthropogenic alterations to thermal environments. We found that G. polyphemus increased body temperature (T b ) at 1 h after injection with lipopolysaccharide (LPS) when compared with saline controls (P = 0.04), consistent with behavioral fever. LPS increased plasma bactericidal ability (BA; P = 0.006), reduced plasma iron concentration (P = 0.041), and increased heterophil∶lymphocyte ratios (P < 0.001). In nonstimulated animals, thermoregulatory strategy had a strong effect on innate immunity, which demonstrated that individuals have the ability to facultatively adjust immune function when infection burden is low; this relationship was not present in LPS-injected animals, which suggested that animals stimulated with LPS maximize bactericidal ability independently of temperature. Seasonal acclimation state did not influence responses to LPS, although baseline plasma iron was significantly lower in animals acclimated to winter. These results support that a trade-off exists between immunity and other conflicting physiological interests. Moreover, these results clearly demonstrate the ability of individuals to modulate immune function as a direct result of thermoregulatory decisions.
Asano, Kazunobu; Wu, Zhiliang; Srinontong, Piyarat; Ikeda, Takahide; Nagano, Isao; Morita, Hirokuyi
2016-01-01
Infectious microorganisms often modify host immunity to escape from immune elimination. Trichinella is a unique nematode of the helminth family, whose members parasitize the muscle cells inside the host without robust eliminative reactions. There are several species of Trichinella; some develop in muscle cells that become encapsulated (e.g., Trichinella spiralis) and others in cells that do not encapsulate (e.g., Trichinella pseudospiralis). It has already been established that Trichinella infection affects host immune responses in several experimental immune diseases in animal models; however, most of those studies were done using T. spiralis infection. As host immune responses to T. spiralis and T. pseudospiralis infections have been reported to be different, it is necessary to clarify how T. pseudospiralis infection influences the host immune responses. In this study, we investigated the influence on host humoral immunity in T. pseudospiralis-infected mice. We demonstrated that T. pseudospiralis infection decreased antigen-specific IgG2a and IgG2b antibody (Ab) production in mice immunized with a model antigen. This selective decrease in gamma interferon (IFN-γ)-dependent Ab production was not due to a decrease in IFN-γ production, and we instead found impaired follicular helper T (Tfh) cell differentiation. The affinity maturation of antigen-specific Ab tended to be delayed but was not significant in T. pseudospiralis-infected mice. We also observed that CD11b+ spleen cells in T. pseudospiralis-infected mice expressed CD206 and PD-L2, the phenotype of which was M2 macrophages with weak production of interleukin-6 (IL-6), possibly resulting in impaired Tfh differentiation. Taken together, our results indicate that nonencapsulated Trichinella infection induces selective dampening in humoral immunity with the suppression of Tfh differentiation. PMID:27736779
Asano, Kazunobu; Wu, Zhiliang; Srinontong, Piyarat; Ikeda, Takahide; Nagano, Isao; Morita, Hirokuyi; Maekawa, Yoichi
2016-12-01
Infectious microorganisms often modify host immunity to escape from immune elimination. Trichinella is a unique nematode of the helminth family, whose members parasitize the muscle cells inside the host without robust eliminative reactions. There are several species of Trichinella; some develop in muscle cells that become encapsulated (e.g., Trichinella spiralis) and others in cells that do not encapsulate (e.g., Trichinella pseudospiralis). It has already been established that Trichinella infection affects host immune responses in several experimental immune diseases in animal models; however, most of those studies were done using T. spiralis infection. As host immune responses to T. spiralis and T. pseudospiralis infections have been reported to be different, it is necessary to clarify how T. pseudospiralis infection influences the host immune responses. In this study, we investigated the influence on host humoral immunity in T. pseudospiralis-infected mice. We demonstrated that T. pseudospiralis infection decreased antigen-specific IgG2a and IgG2b antibody (Ab) production in mice immunized with a model antigen. This selective decrease in gamma interferon (IFN-γ)-dependent Ab production was not due to a decrease in IFN-γ production, and we instead found impaired follicular helper T (Tfh) cell differentiation. The affinity maturation of antigen-specific Ab tended to be delayed but was not significant in T. pseudospiralis-infected mice. We also observed that CD11b + spleen cells in T. pseudospiralis-infected mice expressed CD206 and PD-L2, the phenotype of which was M2 macrophages with weak production of interleukin-6 (IL-6), possibly resulting in impaired Tfh differentiation. Taken together, our results indicate that nonencapsulated Trichinella infection induces selective dampening in humoral immunity with the suppression of Tfh differentiation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Plasmacytoid Dendritic Cells: Neglected Regulators of the Immune Response to Staphylococcus aureus
Bekeredjian-Ding, Isabelle; Greil, Johann; Ammann, Sandra; Parcina, Marijo
2014-01-01
Plasmacytoid dendritic cells (pDC) are a rare subset of leukocytes equipped with Fcγ and Fcε receptors, which exert contrary effects on sensing of microbial nucleic acids by endosomal Toll-like receptors. In this article, we explain how pDC contribute to the immune response to Staphylococcus aureus. Under normal circumstances the pDC participates in the memory response to the pathogen: pDC activation is initiated by uptake of staphylococcal immune complexes with IgG or IgE. However, protein A-expressing S. aureus strains additionally trigger pDC activation in the absence of immunoglobulin. In this context, staphylococci exploit the pDC to induce antigen-independent differentiation of IL-10 producing plasmablasts, an elegant means to propagate immune evasion. We further discuss the role of type I interferons in infection with S. aureus and the implications of these findings for the development of immune based therapies and vaccination. PMID:24904586
Chew, Valerie; Lee, Yun Hua; Pan, Lu; Nasir, Nurul J M; Lim, Chun Jye; Chua, Camillus; Lai, Liyun; Hazirah, Sharifah Nur; Lim, Tony Kiat Hon; Goh, Brian K P; Chung, Alexander; Lo, Richard H G; Ng, David; Filarca, Rene L F; Albani, Salvatore; Chow, Pierce K H
2018-02-13
Yttrium-90 (Y90)-radioembolisation (RE) significantly regresses locally advanced hepatocellular carcinoma and delays disease progression. The current study is designed to deeply interrogate the immunological impact of Y90-RE, which elicits a sustained therapeutic response. Time-of-flight mass cytometry and next-generation sequencing (NGS) were used to analyse the immune landscapes of tumour-infiltrating leucocytes (TILs), tumour tissues and peripheral blood mononuclear cells (PBMCs) at different time points before and after Y90-RE. TILs isolated after Y90-RE exhibited signs of local immune activation: higher expression of granzyme B (GB) and infiltration of CD8 + T cells, CD56 + NK cells and CD8 + CD56 + NKT cells. NGS confirmed the upregulation of genes involved in innate and adaptive immune activation in Y90-RE-treated tumours. Chemotactic pathways involving CCL5 and CXCL16 correlated with the recruitment of activated GB + CD8 + T cells to the Y90-RE-treated tumours. When comparing PBMCs before and after Y90-RE, we observed an increase in tumour necrosis factor-α on both the CD8 + and CD4 + T cells as well as an increase in percentage of antigen-presenting cells after Y90-RE, implying a systemic immune activation. Interestingly, a high percentage of PD-1 + /Tim-3 + CD8 + T cells coexpressing the homing receptors CCR5 and CXCR6 denoted Y90-RE responders. A prediction model was also built to identify sustained responders to Y90-RE based on the immune profiles from pretreatment PBMCs. High-dimensional analysis of tumour and systemic immune landscapes identified local and systemic immune activation that corresponded to the sustained response to Y90-RE. Potential biomarkers associated with a positive clinical response were identified and a prediction model was built to identify sustained responders prior to treatment. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is
Zilker, Claudia; Kozlova, Diana; Sokolova, Viktoriya; Yan, Huimin; Epple, Matthias; Überla, Klaus; Temchura, Vladimir
2017-01-01
Induction of an appropriate type of humoral immune response during vaccination is essential for protection against viral and bacterial infections. We recently observed that biodegradable calcium phosphate (CaP) nanoparticles coated with proteins efficiently targeted and activated naïve antigen-specific B-cells in vitro. We now compared different administration routes for CaP-nanoparticles and demonstrated that intramuscular immunization with such CaP-nanoparticles induced stronger immune responses than immunization with monovalent antigen. Additional functionalization of the CaP-nanoparticles with TRL-ligands allowed modulating the IgG subtype response and the level of mucosal IgA antibodies. CpG-containing CaP-nanoparticles were as immunogenic as a virus-like particle vaccine. Functionalization of CaP-nanoparticles with T-helper cell epitopes or CpG also allowed overcoming lack of T-cell help. Thus, our results indicate that CaP-nanoparticle-based B-cell targeting vaccines functionalized with TLR-ligands can serve as a versatile platform for efficient induction and modulation of humoral immune responses in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.
Matucci, Andrea; Maggi, Enrico; Vultaggio, Alessandra
2014-05-01
In this review, recent insights into innate and adaptive cellular and humoral immune response to Mycobacterium tuberculosis (Mtb) are discussed and the role of specific cytokines such as tumor necrosis factor-α (TNF-α) is highlighted. According to recent findings, the immune system plays a key role in avoiding mycobacteria dissemination. The importance of different cell types (macrophages, dendritic cells, interferon-γ-producing T cells) as well as the production of proinflammatory cytokines such as interleukin 6 (IL-6), IL-12, and IL-23/IL-17 have been demonstrated. Alveolar macrophages are considered the first cells infected by Mtb during respiratory infection. Mtb proliferates within alveolar macrophages and dendritic cells and induces the release of cytokines such as TNF-α, IL-1, IL-6, and IL-12. Toll-like receptors-stimulated dendritic cells link innate and adaptive immunity by promoting polarization of effector T cells. The efficient induction of Th1 immunity is decisive in defense against Mtb. In fact, host effector immune response against Mtb is related to the presence of a Th1 response. The definition of the cellular and molecular mechanisms involved in the immune response to Mtb can be helpful in developing new preventive strategies to avoid infection relapse, particularly in patients treated with biological agents.
Carbo, Adria; Bassaganya-Riera, Josep; Pedragosa, Mireia; Viladomiu, Monica; Marathe, Madhav; Eubank, Stephen; Wendelsdorf, Katherine; Bisset, Keith; Hoops, Stefan; Deng, Xinwei; Alam, Maksudul; Kronsteiner, Barbara; Mei, Yongguo; Hontecillas, Raquel
2013-01-01
T helper (Th) cells play a major role in the immune response and pathology at the gastric mucosa during Helicobacter pylori infection. There is a limited mechanistic understanding regarding the contributions of CD4+ T cell subsets to gastritis development during H. pylori colonization. We used two computational approaches: ordinary differential equation (ODE)-based and agent-based modeling (ABM) to study the mechanisms underlying cellular immune responses to H. pylori and how CD4+ T cell subsets influenced initiation, progression and outcome of disease. To calibrate the model, in vivo experimentation was performed by infecting C57BL/6 mice intragastrically with H. pylori and assaying immune cell subsets in the stomach and gastric lymph nodes (GLN) on days 0, 7, 14, 30 and 60 post-infection. Our computational model reproduced the dynamics of effector and regulatory pathways in the gastric lamina propria (LP) in silico. Simulation results show the induction of a Th17 response and a dominant Th1 response, together with a regulatory response characterized by high levels of mucosal Treg) cells. We also investigated the potential role of peroxisome proliferator-activated receptor γ (PPARγ) activation on the modulation of host responses to H. pylori by using loss-of-function approaches. Specifically, in silico results showed a predominance of Th1 and Th17 cells in the stomach of the cell-specific PPARγ knockout system when compared to the wild-type simulation. Spatio-temporal, object-oriented ABM approaches suggested similar dynamics in induction of host responses showing analogous T cell distributions to ODE modeling and facilitated tracking lesion formation. In addition, sensitivity analysis predicted a crucial contribution of Th1 and Th17 effector responses as mediators of histopathological changes in the gastric mucosa during chronic stages of infection, which were experimentally validated in mice. These integrated immunoinformatics approaches characterized the
Effects of Fenbendazole on Routine Immune Response Parameters of BALB/c Mice
Cray, Carolyn; Villar, David; Zaias, Julia; Altman, Norman H
2008-01-01
Fenbendazole (FBZ) is an anthelmintic drug widely used to treat and prevent pinworm outbreaks in laboratory rodents. Although data in nonrodent species indicate possible effects of fenbendazole on the bone marrow and lymphocyte proliferation and function, little has been reported regarding possible effects on the rodent immune system. The purpose of the current study was to determine the effects of a therapeutic regimen of FBZ on immune parameters in BALB/c mice. Both 9-wk on–off and 5-wk continuous medicated feed protocols were assessed. No significant differences between normal and FBZ diet treated mice were observed in the following parameters: complete blood count, blood chemistry, quantitation of major T and B cell markers in spleen, quantitation of T cell markers in the thymus, spleen cell proliferation to T and B cell mitogens, bone marrow colony-forming cell assays, skin graft rejection, and primary and secondary humoral immune responses. These data indicate that FBZ treatment does not affect many standard broad measures of immune function. PMID:19049250
Soulard, Valérie; Amadoudji Zin, Martin; Fitting, Catherine; Ibitokou, Samad; Oesterholt, Mayke; Luty, Adrian J. F.; Perrin, René-Xavier; Massougbodji, Achille; Deloron, Philippe; Bandeira, Antonio; Fievet, Nadine
2011-01-01
In areas where Plasmodium falciparum is endemic, pregnancy is associated with accumulation of infected red blood cells (RBCs) in the placenta, a condition referred to as placental malaria (PM). Infants born to PM-positive mothers are at an increased risk of malaria, which is putatively related to the transplacental passage of parasite-derived antigens, with consequent tolerization of the fetal immune system. Here we addressed the impact of PM on the regulation of neonatal T cell responses. We found that the frequency of regulatory CD25+ CD127−/low Foxp3+ CD4+ T cells was significantly decreased in neonates born to mothers with high levels of P. falciparum-induced placental inflammation, consisting mainly of primigravid mothers. However, at the individual level, the ratio between regulatory and effector (CD25+ CD127+ Foxp3−) CD4+ T cells was unaffected by PM. In addition, parasite-induced CD4+ T cell activation and production of interleukin-6 (IL-6), tumor necrosis factor alpha (TNF-α), and IL-10 were strongly reduced in neonates born to PM-positive mothers. Thus, our results show that active PM at delivery is associated with a marked suppression of P. falciparum-specific cellular neonatal immune responses, affecting secretion of both pro- and anti-inflammatory cytokines. Additionally, our results suggest that, as in adults, effector and regulatory CD4+ T cell populations are tightly coregulated in all neonates, irrespective of the maternal infection status. PMID:21518782
Gu, Ai-Di; Zhang, Song; Wang, Yunqi; Xiong, Hui; Curtis, Thomas A; Wan, Yisong Y
2015-01-20
Transforming growth factor-beta (TGF-β) suppresses T cell function to maintain self-tolerance and to promote tumor immune evasion. Yet how Smad4, a transcription factor component of TGF-β signaling, regulates T cell function remains unclear. Here we have demonstrated an essential role for Smad4 in promoting T cell function during autoimmunity and anti-tumor immunity. Smad4 deletion rescued the lethal autoimmunity resulting from transforming growth factor-beta receptor (TGF-βR) deletion and compromised T-cell-mediated tumor rejection. Although Smad4 was dispensable for T cell generation, homeostasis, and effector function, it was essential for T cell proliferation after activation in vitro and in vivo. The transcription factor Myc was identified to mediate Smad4-controlled T cell proliferation. This study thus reveals a requirement of Smad4 for T-cell-mediated autoimmunity and tumor rejection, which is beyond the current paradigm. It highlights a TGF-βR-independent role for Smad4 in promoting T cell function, autoimmunity, and anti-tumor immunity. Copyright © 2015 Elsevier Inc. All rights reserved.
Kongsgaard, Michael; Bassi, Maria R; Rasmussen, Michael; Skjødt, Karsten; Thybo, Søren; Gabriel, Mette; Hansen, Morten Bagge; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup; Buus, Soren; Stryhn, Anette
2017-04-06
Outbreaks of Yellow Fever occur regularly in endemic areas of Africa and South America frequently leading to mass vaccination campaigns straining the availability of the attenuated Yellow Fever vaccine, YF-17D. The WHO has recently decided to discontinue regular booster-vaccinations since a single vaccination is deemed to confer life-long immune protection. Here, we have examined humoral (neutralizing antibody) and cellular (CD8 and CD4 T cell) immune responses in primary and booster vaccinees (the latter spanning 8 to 36 years after primary vaccination). After primary vaccination, we observed strong cellular immune responses with T cell activation peaking ≈2 weeks and subsiding to background levels ≈ 4 weeks post-vaccination. The number of antigen-specific CD8+ T cells declined over the following years. In >90% of vaccinees, in vitro expandable T cells could still be detected >10 years post-vaccination. Although most vaccinees responded to a booster vaccination, both the humoral and cellular immune responses observed following booster vaccination were strikingly reduced compared to primary responses. This suggests that pre-existing immunity efficiently controls booster inoculums of YF-17D. In a situation with epidemic outbreaks, one could argue that a more efficient use of a limited supply of the vaccine would be to focus on primary vaccinations.
Specificity, Privacy, and Degeneracy in the CD4 T Cell Receptor Repertoire Following Immunization
Sun, Yuxin; Best, Katharine; Cinelli, Mattia; Heather, James M.; Reich-Zeliger, Shlomit; Shifrut, Eric; Friedman, Nir; Shawe-Taylor, John; Chain, Benny
2017-01-01
T cells recognize antigen using a large and diverse set of antigen-specific receptors created by a complex process of imprecise somatic cell gene rearrangements. In response to antigen-/receptor-binding-specific T cells then divide to form memory and effector populations. We apply high-throughput sequencing to investigate the global changes in T cell receptor sequences following immunization with ovalbumin (OVA) and adjuvant, to understand how adaptive immunity achieves specificity. Each immunized mouse contained a predominantly private but related set of expanded CDR3β sequences. We used machine learning to identify common patterns which distinguished repertoires from mice immunized with adjuvant with and without OVA. The CDR3β sequences were deconstructed into sets of overlapping contiguous amino acid triplets. The frequencies of these motifs were used to train the linear programming boosting (LPBoost) algorithm LPBoost to classify between TCR repertoires. LPBoost could distinguish between the two classes of repertoire with accuracies above 80%, using a small subset of triplet sequences present at defined positions along the CDR3. The results suggest a model in which such motifs confer degenerate antigen specificity in the context of a highly diverse and largely private set of T cell receptors. PMID:28450864
Stranavova, L; Hruba, P; Girmanova, E; Tycova, I; Slavcev, A; Fronek, J; Slatinska, J; Reinke, P; Volk, H-D; Viklicky, O
2018-05-04
Cytomegalovirus (CMV) infection influences both short and long term outcomes in immunosuppressed organ transplant recipients. The aim of this study was to evaluate the effect of different induction immunosuppression regimens on CMV specific T cell response in patients with already established CMV immunity. In 24 seropositive living donor kidney recipients, the frequency of CMV specific T cells was determined by ELISPOT (Enzyme-Linked ImmunoSpot) assay prior and 6 months after transplantation. Recipients' peripheral blood mononuclear cells were stimulated with immediate-early (IE1) and phosphoprotein 65 (pp65) CMV-derived peptide pools and the number of cells producing interferon gamma (IFN-gamma) was assessed. Patients received quadruple immunosuppression based either on depletive rabbit antithymocyte globulin (rATG) or non-depletive basiliximab induction and tacrolimus/mycophenolate mofetil/steroids. Patients with rATG induction received valgancyclovir prophylaxis. No effects of different induction agents on CMV specific T cell immunity were found at sixth month after kidney transplantation. There were no associations among dialysis vintage, pretransplant CMV specific T cell immunity, and later CMV DNAemia. Similarly, no effect of CMV prophylaxis on CMV specific T cell immunity was revealed. This study shows no effect of posttransplant immunosuppression on CMV specific T cell immunity in living donor kidney transplant recipients with CMV immunity already established, regardless of lymphocyte depletion and CMV prophylaxis.
Ishibashi, Mariko; Yamaguchi, Hiromi; Hirotani, Yukari; Sakurada, Akihisa; Endo, Toshihide; Sugitani, Masahiko; Takayama, Tadatoshi; Makishima, Makoto; Esumi, Mariko
2018-04-01
We found a HLA class II histocompatibility antigen gene, DQ alpha 1 chain (HLA-DQA1), that was expressed more than 9-fold higher in high-load hepatitis C virus (HCV) livers than low-load HCV livers using transcriptomics of chronic HCV-infected livers. To further investigate this finding, we examined which cells were positive for HLA-DQA1 and what liver immune responses were different between HCV-high and -low livers. HLA-DQA1-positive cells were significantly increased in the HCV-high group, and most positive cells were identified as non-parenchymal sinusoid cells and lymphocytic infiltrates in the portal area. Parenchymal hepatocytes were negative for HLA-DQA1. HLA-DQA1-positive cells in the liver sinusoid were positive for CD68 (macrophages or Kupffer cells); those in the lymphocytic infiltrates were positive for CD20 (B cells) or CD3 (T cells). mRNA levels of antigen-presenting cell (APC) markers such as CD68 and CD11c were significantly upregulated in the HCV-high group and were correlated with HLA-DQA mRNA levels. CD8B mRNA (CD8 + T cells) was upregulated in both HCV-positive livers compared with HCV-negative livers, whereas CD154 mRNA (CD4 + T helper cell) was upregulated in the HCV-high group compared with the HCV-low group. The immune regulatory molecules FOXP3 mRNA (regulatory T cell, T reg) and programmed cell death ligand-1 (PD-L1) mRNA were significantly increased in the HCV-high group. HCV-high livers had two molecular immune responses: increased APC numbers and adaptive immunity and the induction of immune tolerance. The local hepatic imbalance of contradictory immune responses might be responsible for high HCV loads.
Liu, Boning; Guo, Huaizu; Xu, Jin; Qin, Ting; Guo, Qingcheng; Gu, Nana; Zhang, Dapeng; Qian, Weizhu; Dai, Jianxin; Hou, Sheng; Wang, Hao; Guo, Yajun
The host immune system generally serves as a barrier against tumor formation. Programmed death-ligand 1 (PD-L1) is a critical "don't find me" signal to the adaptive immune system, whereas CD47 transmits an anti-phagocytic signal, known as the "don't eat me" signal, to the innate immune system. These and similar immune checkpoints are often overexpressed on human tumors. Thus, dual targeting both innate and adaptive immune checkpoints would likely maximize anti-tumor therapeutic effect and elicit more durable responses. Herein, based on the variable region of atezolizumab and consensus variant 1 (CV1) monomer, we constructed a dual-targeting fusion protein targeting both CD47 and PD-L1 using "Knobs-into-holes" technology, denoted as IAB. It was effective in inducing phagocytosis of tumor cells, stimulating T-cell activation and mediating antibody-dependent cell-mediated cytotoxicity in vitro. No obvious sign of hematological toxicity was observed in mice administered IAB at a dose of 100 mg/kg, and IAB exhibited potent antitumor activity in an immune-competent mouse model of MC38. Additionally, the anti-tumor effect of IAB was impaired by anti-CD8 antibody or clodronate liposomes, which implied that both CD8+ T cells and macrophages were required for the anti-tumor efficacy of IAB and IAB plays an essential role in the engagement of innate and adaptive immune responses. Collectively, these results demonstrate the capacity of an elicited endogenous immune response against tumors and elucidate essential characteristics of synergistic innate and adaptive immune response, and indicate dual blockade of CD47 and PD-L1 by IAB may be a synergistic therapy that activates both innate and adaptive immune response against tumors.
Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.
Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A
2013-04-01
A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.
Hou, Jue; Wang, Shuhui; Jia, Manxue; Li, Dan; Liu, Ying; Li, Zhengpeng; Zhu, Hong; Xu, Huifang; Sun, Meiping; Lu, Li; Zhou, Zhinan; Peng, Hong; Zhang, Qichen; Fu, Shihong; Liang, Guodong; Yao, Lena; Yu, Xuesong; Carpp, Lindsay N; Huang, Yunda; McElrath, Julie; Self, Steve; Shao, Yiming
2017-08-15
In this study, we used a systems vaccinology approach to identify temporal changes in immune response signatures to the yellow fever (YF)-17D vaccine, with the aim of comprehensively characterizing immune responses associated with protective immunity. We conducted a cohort study in which 21 healthy subjects in China were administered one dose of the YF-17D vaccine; PBMCs were collected at 0 h and then at 4 h and days 1, 2, 3, 5, 7, 14, 28, 84, and 168 postvaccination, and analyzed by transcriptional profiling and immunological assays. At 4 h postvaccination, genes associated with innate cell differentiation and cytokine pathways were dramatically downregulated, whereas receptor genes were upregulated, compared with their baseline levels at 0 h. Immune response pathways were primarily upregulated on days 5 and 7, accompanied by the upregulation of the transcriptional factors JUP, STAT1, and EIF2AK2. We also observed robust activation of innate immunity within 2 d postvaccination and a durable adaptive response, as assessed by transcriptional profiling. Coexpression network analysis indicated that lysosome activity and lymphocyte proliferation were associated with dendritic cell (DC) and CD4 + T cell responses; FGL2, NFAM1, CCR1, and TNFSF13B were involved in these associations. Moreover, individuals who were baseline-seropositive for Abs against another flavivirus exhibited significantly impaired DC, NK cell, and T cell function in response to YF-17D vaccination. Overall, our findings indicate that YF-17D vaccination induces a prompt innate immune response and DC activation, a robust Ag-specific T cell response, and a persistent B cell/memory B cell response. Copyright © 2017 by The American Association of Immunologists, Inc.
A sestrin-dependent Erk/Jnk/p38 MAPK activation complex inhibits immunity during ageing
Lanna, Alessio; Gomes, Daniel C O; Muller-Durovic, Bojana; McDonnell, Thomas; Escors, David; Gilroy, Derek W; Lee, Jun Hee; Karin, Michael; Akbar, Arne N
2016-01-01
Mitogen activated protein kinases (MAPKs) including Erk, Jnk and p38 regulate diverse cellular functions, and are thought to be controlled by independent upstream activation cascades. Here we show that the sestrins bind to and co-ordinate simultaneous Erk, Jnk and p38 MAPK activation in T lymphocytes within a new immune-inhibitory complex (sestrin-MAPK Activation Complex; sMAC). Whereas sestrin ablation resulted in broad reconstitution of immune function in stressed T cells, inhibition of individual MAPKs only allowed partial functional recovery. T cells from old humans and mice were more likely to form the sMAC, and disruption of this complex restored antigen-specific functional responses in these cells. Correspondingly, sestrin deficiency or simultaneous inhibition of all three MAPKs enhanced vaccine responsiveness in old mice. Thus, disruption of sMAC provides a foundation for rejuvenating immunity during ageing. PMID:28114291
Eichmann, Klaus; Braun, Dietmar G.; Krause, Richard M.
1971-01-01
Selective breeding of rabbits immunized with Group C and Group A streptococcal vaccines was employed to reveal genetic influences on the magnitude and on the restriction in heterogeneity of the immune response to the group-specific carbohydrates. After two generations of selective breeding, complete segregation was achieved between a high-response population (>18 mg precipitins/ml serum, average 33 mg/ml) and a low-response population (<13 mg precipitins/ml serum, average 7.5 mg/ml) to Group C carbohydrate. This suggests that a limited number of genes controls the magnitude of the immune response to this antigen. Selective breeding of rabbits which were representative of heterogeneous, restricted, and monoclonal responses revealed that the degree of antibody heterogeneity in the parental rabbits is reflected in the offspring. More than 95% of the offspring derived from rabbits which had a heterogeneous immune response developed heterogeneous antibodies. 33% of the offspring derived from rabbits which had restricted and monoclonal immune responses developed monoclonal antibodies. This suggests that the degree of heterogeneity of the antibody response to the streptococcal carbohydrates is under genetic control. The degree of heterogeneity and the magnitude of the immune response appear to be independent variables. PMID:5558071
Intrinsic and extrinsic contributors to defective CD8+ T cell responses with aging.
Jergović, Mladen; Smithey, Megan J; Nikolich-Žugich, Janko
2018-05-01
Aging has a profound effect on the immune system, and both innate and adaptive arms of the immune system show functional decline with age. In response to infection with intracellular microorganisms, old animals mobilize decreased numbers of antigen-specific CD8+ T cells with reduced production of effector molecules and impaired cytolytic activity. However, the CD8+ T cell-intrinsic contribution to, and molecular mechanisms behind, these defects remain unclear. In this review we will discuss the mechanistic contributions of age related changes in the CD8+ T cell pool and the relative roles of intrinsic functional defects in aged CD8+ T cells vs. defects in the aged environment initiating the CD8+ T cell response. Copyright © 2018 Elsevier Inc. All rights reserved.