How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

rRNA Gene Internal Transcribed Spacer 1 and 2 Sequences of Asexual, Anthropophilic Dermatophytes Related to Trichophyton rubrum

PubMed Central

Summerbell, R. C.; Haugland, R. A.; Li, A.; Gupta, A. K.

1999-01-01

The ribosomal region spanning the two internal transcribed spacer (ITS) regions and the 5.8S ribosomal DNA region was sequenced for asexual, anthropophilic dermatophyte species with morphological similarity to Trichophyton rubrum, as well as for members of the three previously delineated, related major clades in the T. mentagrophytes complex. Representative isolates of T. raubitschekii, T. fischeri, and T. kanei were found to have ITS sequences identical to that of T. rubrum. The ITS sequences of T. soudanense and T. megninii differed from that of T. rubrum by only a small number of base pairs. Their continued status as species, however, appears to meet criteria outlined in the population genetics-based cohesion species concept of A. R. Templeton. The ITS sequence of T. tonsurans differed from that of the biologically distinct T. equinum by only 1 bp, while the ITS sequence of the recently described species T. krajdenii had a sequence identical to that of T. mentagrophytes isolates related to the teleomorph Arthroderma vanbreuseghemii. PMID:10565922

Complete Genomic Sequence of “Thermofilum adornatus” Strain 1910bT, a Hyperthermophilic Anaerobic Organotrophic Crenarchaeon

PubMed Central

Dominova, I. N.; Kublanov, I. V.; Podosokorskaya, O. A.; Derbikova, K. S.; Patrushev, M. V.

2013-01-01

The complete genomic sequence of a novel hyperthermophilic crenarchaeon, strain 1910bT, was determined. The genome comprises a 1,750,259-bp circular chromosome containing single copies of 3 rRNA genes, 43 tRNA genes, and 1,896 protein-coding sequences. In silico genome-genome hybridization suggests the proposal of a novel species, “Thermofilum adornatus” strain 1910bT. PMID:24029764

The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

NASA Technical Reports Server (NTRS)

Luehrsen, K. R.; Fox, G. E.

1981-01-01

The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

msgbsR: An R package for analysing methylation-sensitive restriction enzyme sequencing data.

PubMed

Mayne, Benjamin T; Leemaqz, Shalem Y; Buckberry, Sam; Rodriguez Lopez, Carlos M; Roberts, Claire T; Bianco-Miotto, Tina; Breen, James

2018-02-01

Genotyping-by-sequencing (GBS) or restriction-site associated DNA marker sequencing (RAD-seq) is a practical and cost-effective method for analysing large genomes from high diversity species. This method of sequencing, coupled with methylation-sensitive enzymes (often referred to as methylation-sensitive restriction enzyme sequencing or MRE-seq), is an effective tool to study DNA methylation in parts of the genome that are inaccessible in other sequencing techniques or are not annotated in microarray technologies. Current software tools do not fulfil all methylation-sensitive restriction sequencing assays for determining differences in DNA methylation between samples. To fill this computational need, we present msgbsR, an R package that contains tools for the analysis of methylation-sensitive restriction enzyme sequencing experiments. msgbsR can be used to identify and quantify read counts at methylated sites directly from alignment files (BAM files) and enables verification of restriction enzyme cut sites with the correct recognition sequence of the individual enzyme. In addition, msgbsR assesses DNA methylation based on read coverage, similar to RNA sequencing experiments, rather than methylation proportion and is a useful tool in analysing differential methylation on large populations. The package is fully documented and available freely online as a Bioconductor package ( https://bioconductor.org/packages/release/bioc/html/msgbsR.html ).

Distinct human and mouse membrane trafficking systems for sweet taste receptors T1r2 and T1r3.

PubMed

Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

2014-01-01

The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system.

Draft genome sequence of the extremely halophilic archaeon Haladaptatus cibarius type strain D43(T) isolated from fermented seafood.

PubMed

Lee, Hae-Won; Kim, Dae-Won; Lee, Mi-Hwa; Kim, Byung-Yong; Cho, Yong-Joon; Yim, Kyung June; Song, Hye Seon; Rhee, Jin-Kyu; Seo, Myung-Ji; Choi, Hak-Jong; Choi, Jong-Soon; Lee, Dong-Gi; Yoon, Changmann; Nam, Young-Do; Roh, Seong Woon

2015-01-01

An extremely halophilic archaeon, Haladaptatus cibarius D43(T), was isolated from traditional Korean salt-rich fermented seafood. Strain D43(T) shows the highest 16S rRNA gene sequence similarity (98.7 %) with Haladaptatus litoreus RO1-28(T), is Gram-negative staining, motile, and extremely halophilic. Despite potential industrial applications of extremely halophilic archaea, their genome characteristics remain obscure. Here, we describe the whole genome sequence and annotated features of strain D43(T). The 3,926,724 bp genome includes 4,092 protein-coding and 57 RNA genes (including 6 rRNA and 49 tRNA genes) with an average G + C content of 57.76 %.

Genome Sequence of the Symbiotic Type Strain Rhizobium tibeticum CCBAU85039T

PubMed Central

Wibberg, Daniel; Winkler, Anika; Ormeño-Orrillo, Ernesto; Martínez-Romero, Esperanza; Niehaus, Karsten; Pühler, Alfred; Kalinowski, Jörn; Lagares, Antonio; Schlüter, Andreas; Pistorio, Mariano

2017-01-01

ABSTRACT Rhizobium tibeticum was originally isolated from root nodules of Trigonella archiducis-nicolai grown in Tibet, China. This species is also able to nodulate Medicago sativa and Phaseolus vulgaris. The whole-genome sequence of the type strain, R. tibeticum CCBAU85039T, is reported in this study. PMID:28126941

Classification of robust heteroclinic cycles for vector fields in {\\protect\\bb R}^3 with symmetry

NASA Astrophysics Data System (ADS)

Hawker, David; Ashwin, Peter

2005-09-01

We consider a classification of robust heteroclinic cycles in the positive octant of {\\bb R}^3 under the action of the symmetry group {{\\bb Z}_2}^3 . We introduce a coding system to represent different classes up to a topological equivalence, and produce a characterization of all types of robust heteroclinic cycle that can arise in this situation. These cycles may or may not contain the origin within the cycle. We proceed to find a connection between our problem and meandric numbers. We find a direct correlation between the number of classes of robust heteroclinic cycle that do not include the origin and the 'Mercedes-Benz' sequence of integers characterizing meanders through a 'Y-shaped' configuration. We investigate upper and lower bounds for the number of classes possible for robust cycles between n equilibria, one of which may be the origin.

Genome Sequence of the Symbiotic Type Strain Rhizobium tibeticum CCBAU85039T.

PubMed

Torres Tejerizo, Gonzalo; Wibberg, Daniel; Winkler, Anika; Ormeño-Orrillo, Ernesto; Martínez-Romero, Esperanza; Niehaus, Karsten; Pühler, Alfred; Kalinowski, Jörn; Lagares, Antonio; Schlüter, Andreas; Pistorio, Mariano

2017-01-26

Rhizobium tibeticum was originally isolated from root nodules of Trigonella archiducis-nicolai grown in Tibet, China. This species is also able to nodulate Medicago sativa and Phaseolus vulgaris The whole-genome sequence of the type strain, R. tibeticum CCBAU85039 T , is reported in this study. Copyright © 2017 Torres Tejerizo et al.

Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

2013-01-16

The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Integrated optimization of location assignment and sequencing in multi-shuttle automated storage and retrieval systems under modified 2n-command cycle pattern

NASA Astrophysics Data System (ADS)

Yang, Peng; Peng, Yongfei; Ye, Bin; Miao, Lixin

2017-09-01

This article explores the integrated optimization problem of location assignment and sequencing in multi-shuttle automated storage/retrieval systems under the modified 2n-command cycle pattern. The decision of storage and retrieval (S/R) location assignment and S/R request sequencing are jointly considered. An integer quadratic programming model is formulated to describe this integrated optimization problem. The optimal travel cycles for multi-shuttle S/R machines can be obtained to process S/R requests in the storage and retrieval request order lists by solving the model. The small-sized instances are optimally solved using CPLEX. For large-sized problems, two tabu search algorithms are proposed, in which the first come, first served and nearest neighbour are used to generate initial solutions. Various numerical experiments are conducted to examine the heuristics' performance and the sensitivity of algorithm parameters. Furthermore, the experimental results are analysed from the viewpoint of practical application, and a parameter list for applying the proposed heuristics is recommended under different real-life scenarios.

Complete Genome Sequence of the Hyperthermophilic Sulfate-Reducing Bacterium Thermodesulfobacterium geofontis OPF15T.

PubMed

Elkins, James G; Hamilton-Brehm, Scott D; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Goodwin, Lynne A; Pitluck, Sam; Peters, Lin; Mikhailova, Natalia; Davenport, Karen W; Detter, John C; Han, Cliff S; Tapia, Roxanne; Land, Miriam L; Hauser, Loren; Kyrpides, Nikos C; Ivanova, Natalia N; Pagani, Ioanna; Bruce, David; Woyke, Tanja; Cottingham, Robert W

2013-04-11

Thermodesulfobacterium geofontis OPF15(T) (ATCC BAA-2454, JCM 18567) was isolated from Obsidian Pool, Yellowstone National Park, and grows optimally at 83°C. The 1.6-Mb genome sequence was finished at the Joint Genome Institute and has been deposited for future genomic studies pertaining to microbial processes and nutrient cycles in high-temperature environments.

Complete Genome Sequence of the Hyperthermophilic Sulfate-Reducing Bacterium Thermodesulfobacterium geofontis OPF15T

PubMed Central

Hamilton-Brehm, Scott D.; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Goodwin, Lynne A.; Pitluck, Sam; Peters, Lin; Mikhailova, Natalia; Davenport, Karen W.; Detter, John C.; Han, Cliff S.; Tapia, Roxanne; Land, Miriam L.; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia N.; Pagani, Ioanna; Bruce, David; Woyke, Tanja; Cottingham, Robert W.

2013-01-01

Thermodesulfobacterium geofontis OPF15T (ATCC BAA-2454, JCM 18567) was isolated from Obsidian Pool, Yellowstone National Park, and grows optimally at 83°C. The 1.6-Mb genome sequence was finished at the Joint Genome Institute and has been deposited for future genomic studies pertaining to microbial processes and nutrient cycles in high-temperature environments. PMID:23580711

Draft genome sequence of type strain HBR26T and description of Rhizobium aethiopicum sp. nov.

DOE PAGES

Aserse, Aregu Amsalu; Woyke, Tanja; Kyrpides, Nikos C.; ...

2017-01-26

Rhizobium aethiopicum sp. nov. is a newly proposed species within the genus Rhizobium. This species includes six rhizobial strains; which were isolated from root nodules of the legume plant Phaseolus vulgaris growing in soils of Ethiopia. The species fixes nitrogen effectively in symbiosis with the host plant P. vulgaris, and is composed of aerobic, Gram-negative staining, rod-shaped bacteria. The genome of type strain HBR26 T of R. aethiopicum sp. nov. was one of the rhizobial genomes sequenced as a part of the DOE JGI 2014 Genomic Encyclopedia project designed for soil and plant-associated and newly described type strains. The genomemore » sequence is arranged in 62 scaffolds and consists of 6,557,588 bp length, with a 61% G + C content and 6221 protein-coding and 86 RNAs genes. The genome of HBR26 T contains repABC genes (plasmid replication genes) homologous to the genes found in five differen t Rhizobium etli CFN42 T plasmids, suggesting that HBR26 T may have five additional replicons other than the chromosome. In the genome of HBR26 T , the nodulation genes nodB, nodC, nodS, nodI, nodJ and nodD are located in the same module, and organized in a similar way as nod genes found in the genome of other known common bean-nodulating rhizobial species. nodA gene is found in a different scaffold, but it is also very similar to nodA genes of other bean-nodulating rhizobial strains. Though HBR26 T is distinct on the phylogenetic tree and based on ANI analysis (the highest value 90.2% ANI with CFN42 T ) from other bean-nodulating species, these nod genes and most nitrogen-fixing genes found in the genome of HBR26 T share high identity with the corresponding genes of known bean-nodulating rhizobial species (96-100% identity). This suggests that symbiotic genes might be shared between bean-nodulating rhizobia through horizontal gene transfer. R. aethiopicum sp. nov. was grouped into the genus Rhizobium but was distinct from all recognized species of that genus by

Draft genome sequence of type strain HBR26T and description of Rhizobium aethiopicum sp. nov.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aserse, Aregu Amsalu; Woyke, Tanja; Kyrpides, Nikos C.

Rhizobium aethiopicum sp. nov. is a newly proposed species within the genus Rhizobium. This species includes six rhizobial strains; which were isolated from root nodules of the legume plant Phaseolus vulgaris growing in soils of Ethiopia. The species fixes nitrogen effectively in symbiosis with the host plant P. vulgaris, and is composed of aerobic, Gram-negative staining, rod-shaped bacteria. The genome of type strain HBR26 T of R. aethiopicum sp. nov. was one of the rhizobial genomes sequenced as a part of the DOE JGI 2014 Genomic Encyclopedia project designed for soil and plant-associated and newly described type strains. The genomemore » sequence is arranged in 62 scaffolds and consists of 6,557,588 bp length, with a 61% G + C content and 6221 protein-coding and 86 RNAs genes. The genome of HBR26 T contains repABC genes (plasmid replication genes) homologous to the genes found in five differen t Rhizobium etli CFN42 T plasmids, suggesting that HBR26 T may have five additional replicons other than the chromosome. In the genome of HBR26 T , the nodulation genes nodB, nodC, nodS, nodI, nodJ and nodD are located in the same module, and organized in a similar way as nod genes found in the genome of other known common bean-nodulating rhizobial species. nodA gene is found in a different scaffold, but it is also very similar to nodA genes of other bean-nodulating rhizobial strains. Though HBR26 T is distinct on the phylogenetic tree and based on ANI analysis (the highest value 90.2% ANI with CFN42 T ) from other bean-nodulating species, these nod genes and most nitrogen-fixing genes found in the genome of HBR26 T share high identity with the corresponding genes of known bean-nodulating rhizobial species (96-100% identity). This suggests that symbiotic genes might be shared between bean-nodulating rhizobia through horizontal gene transfer. R. aethiopicum sp. nov. was grouped into the genus Rhizobium but was distinct from all recognized species of that genus by

Single-cell paired-end genome sequencing reveals structural variation per cell cycle

PubMed Central

Voet, Thierry; Kumar, Parveen; Van Loo, Peter; Cooke, Susanna L.; Marshall, John; Lin, Meng-Lay; Zamani Esteki, Masoud; Van der Aa, Niels; Mateiu, Ligia; McBride, David J.; Bignell, Graham R.; McLaren, Stuart; Teague, Jon; Butler, Adam; Raine, Keiran; Stebbings, Lucy A.; Quail, Michael A.; D’Hooghe, Thomas; Moreau, Yves; Futreal, P. Andrew; Stratton, Michael R.; Vermeesch, Joris R.; Campbell, Peter J.

2013-01-01

The nature and pace of genome mutation is largely unknown. Because standard methods sequence DNA from populations of cells, the genetic composition of individual cells is lost, de novo mutations in cells are concealed within the bulk signal and per cell cycle mutation rates and mechanisms remain elusive. Although single-cell genome analyses could resolve these problems, such analyses are error-prone because of whole-genome amplification (WGA) artefacts and are limited in the types of DNA mutation that can be discerned. We developed methods for paired-end sequence analysis of single-cell WGA products that enable (i) detecting multiple classes of DNA mutation, (ii) distinguishing DNA copy number changes from allelic WGA-amplification artefacts by the discovery of matching aberrantly mapping read pairs among the surfeit of paired-end WGA and mapping artefacts and (iii) delineating the break points and architecture of structural variants. By applying the methods, we capture DNA copy number changes acquired over one cell cycle in breast cancer cells and in blastomeres derived from a human zygote after in vitro fertilization. Furthermore, we were able to discover and fine-map a heritable inter-chromosomal rearrangement t(1;16)(p36;p12) by sequencing a single blastomere. The methods will expedite applications in basic genome research and provide a stepping stone to novel approaches for clinical genetic diagnosis. PMID:23630320

Molecular cloning and evolutionary analysis of captive forest musk deer bitter taste receptor gene T2R16.

PubMed

Zhao, G J; Wu, N; Li, D Y; Zeng, D J; Chen, Q; Lu, L; Feng, X L; Zhang, C L; Zheng, C L; Jie, H

2015-12-08

Sensing bitter tastes is crucial for most animals because it can prevent them from ingesting harmful food. This process is mainly mediated by the bitter taste receptors (T2R) that are largely expressed in the taste buds. Previous studies have identified some T2R gene repertoires. Marked variation in repertoire size has been noted among species. However, research on T2Rs is still limited and the mechanisms underlying the evolution of vertebrate T2Rs remain poorly understood. In the present study, we analyzed the structure and features of the protein encoded by the forest musk deer (Moschus berezovskii) T2R16 and submitted the gene sequence to NCBI GenBank. The results showed that the full coding DNA sequence (CDS) of musk deer T2R16 (GenBank accession No. KP677279) was 906 bp, encoding 301 amino acids, which contained ATG start codon and TGA stop codon, with a calculated molecular weight of 35.03 kDa and an isoelectric point of 9.56. The T2R16 protein receptor had seven conserved transmembrane regions. Hydrophobicity analysis showed that most amino acid residues in T2R16 protein were hydrophobic, and the grand average of hydrophobicity (GRAVY) was 0.657. Phylogenetic analysis based on this gene revealed that forest musk deer had the closest association with sheep (Ovis aries), as compared to cow (Bos taurus), Tursiops truncatus, and other species, whereas it was genetically farthest from humans (Homo sapiens). We hope these results would complement the existing data on T2R16 and encourage further research in this respect.

tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

PubMed

Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

2014-01-01

The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

Comparison of the aflR gene sequences of strains in Aspergillus section Flavi.

PubMed

Lee, Chao-Zong; Liou, Guey-Yuh; Yuan, Gwo-Fang

2006-01-01

Aflatoxins are polyketide-derived secondary metabolites produced by Aspergillus parasiticus, Aspergillus flavus, Aspergillus nomius and a few other species. The toxic effects of aflatoxins have adverse consequences for human health and agricultural economics. The aflR gene, a regulatory gene for aflatoxin biosynthesis, encodes a protein containing a zinc-finger DNA-binding motif. Although Aspergillus oryzae and Aspergillus sojae, which are used in fermented foods and in ingredient manufacture, have no record of producing aflatoxin, they have been shown to possess an aflR gene. This study examined 34 strains of Aspergillus section Flavi. The aflR gene of 23 of these strains was successfully amplified and sequenced. No aflR PCR products were found in five A. sojae strains or six strains of A. oryzae. These PCR results suggested that the aflR gene is absent or significantly different in some A. sojae and A. oryzae strains. The sequenced aflR genes from the 23 positive strains had greater than 96.6 % similarity, which was particularly conserved in the zinc-finger DNA-binding domain. The aflR gene of A. sojae has two obvious characteristics: an extra CTCATG sequence fragment and a C to T transition that causes premature termination of AFLR protein synthesis. Differences between A. parasiticus/A. sojae and A. flavus/A. oryzae aflR genes were also identified. Some strains of A. flavus as well as A. flavus var. viridis, A. oryzae var. viridis and A. oryzae var. effuses have an A. oryzae-type aflR gene. For all strains with the A. oryzae-type aflR gene, there was no evidence of aflatoxin production. It is suggested that for safety reasons, the aflR gene could be examined to assess possible aflatoxin production by Aspergillus section Flavi strains.

Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs.

PubMed

Hopper, A K; Schultz, L D; Shapiro, R A

1980-03-01

By using conditional loss of suppression an an assay, we have been successful in screening for a yeast mutant which is defective in tRNA processing. The los1-1 mutation causes an accumulation of a subset of precursor tRNAs at the nonpermissive temperature. These pre-tRNAs are like those which accumulate in the yeast mutant ts 136 (rna1) in that they have transcribed intervening sequences. The mutations at los1-1 and rna1 complement and segregate independently of each other. The los1-1 mutation affects the expression of all 8 tyrosine-inserting suppressor loci, but does not seem to affect rRNA or mRNA synthesis.

Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

PubMed

Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

2010-06-12

For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

Wormholes in R^2-gravity within the f( R, T) formalism

NASA Astrophysics Data System (ADS)

Sahoo, P. K.; Moraes, P. H. R. S.; Sahoo, Parbati

2018-01-01

We propose, as a novelty in the literature, the modeling of wormholes within a particular case of f( R, T) gravity, namely f(R,T)=R+α R2+λ T, with R and T being the Ricci scalar and trace of the energy-momentum tensor, respectively, while α and λ are constants. Although such a functional form application can be found in the literature, those concern compact astrophysical objects, such that no wormhole analysis has been done so far. The quadratic geometric and linear material corrections of this theory render the matter content of the wormhole remarkably able to obey the energy conditions.

Study of thermodynamic laws in f(R,T,R{sub μν}T{sup μν}) gravity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharif, M.; Zubair, M., E-mail: msharif.math@pu.edu.pk, E-mail: mzubairkk@gmail.com

2013-11-01

We study first and second laws of black hole thermodynamics at the apparent horizon of FRW spacetime in f(R,T,R{sub μν}T{sup μν}) gravity, where R, R{sub μν} are the Ricci scalar and Riemann tensor and T is the trace of the energy-momentum tensor T{sub μν}. We develop the Friedmann equations for any spatial curvature in this modified theory and show that these equations can be transformed to the form of Clausius relation T{sub h}S{sub eff} = δQ. Here T{sub h} is the horizon temperature, S{sub eff} is the entropy which contains contributions both from horizon entropy and additional entropy term introducedmore » due to the non-equilibrating description and δQ is the energy flux across the horizon. The generalized second law of thermodynamics is also established in a more comprehensive form and one can recover the corresponding results in Einstein, f(R) and f(R,T) gravities. We discuss GSLT in the locality of assumption that temperature of matter inside the horizon is similar to that of horizon. Finally, we consider particular models in this theory and generate constraints on the coupling parameter for the validity of GSLT.« less

Culture in cycles: considering H.T. Odum's 'information cycle'

NASA Astrophysics Data System (ADS)

Abel, Thomas

2014-01-01

'Culture' remains a conundrum in anthropology. When recast in the mold of 'information cycles,' culture is transformed. New fault lines appear. Information is splintered into parallel or nested forms. Dynamics becomes cycling. Energy is essential. And culture has function in a directional universe. The 'information cycle' is the crowning component of H.T. Odum's theory of general systems. What follows is an application of the information cycle to the cultural domains of discourse, social media, ritual, education, journalism, technology, academia, and law, which were never attempted by Odum. In information cycles, cultural information is perpetuated - maintained against Second Law depreciation. Conclusions are that culture is in fact a nested hierarchy of cultural forms. Each scale of information production is semi-autonomous, with its own evolutionary dynamics of production and selection in an information cycle. Simultaneously, each information cycle is channeled or entrained by its larger scale of information and ultimately human-ecosystem structuring.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Complete genome sequence of Paenibacillus riograndensis SBR5(T), a Gram-positive diazotrophic rhizobacterium.

PubMed

Brito, Luciana Fernandes; Bach, Evelise; Kalinowski, Jörn; Rückert, Christian; Wibberg, Daniel; Passaglia, Luciane M; Wendisch, Volker F

2015-08-10

Paenibacillus riograndensis is a Gram-positive rhizobacterium which exhibits plant growth promoting activities. It was isolated from the rhizosphere of wheat grown in the state of Rio Grande do Sul, Brazil. Here we announce the complete genome sequence of P. riograndensis strain SBR5(T). The genome of P. riograndensis SBR5(T) consists of a circular chromosome of 7,893,056bps. The genome was finished and fully annotated, containing 6705 protein coding genes, 87 tRNAs and 27 rRNAs. The knowledge of the complete genome helped to explain why P. riograndensis SBR5(T) can grow with the carbon sources arabinose and mannitol, but not myo-inositol, and to explain physiological features such as biotin auxotrophy and antibiotic resistances. The genome sequence will be valuable for functional genomics and ecological studies as well as for application of P. riograndensis SBR5(T) as plant growth-promoting rhizobacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

Kaluza-Klein cosmological model in f(R, T) gravity with Λ(T)

NASA Astrophysics Data System (ADS)

Sahoo, P. K.; Mishra, B.; Tripathy, S. K.

2016-04-01

A class of Kaluza-Klein cosmological models in $f(R,T)$ theory of gravity have been investigated. In the work, we have considered the functional $f(R,T)$ to be in the form $f(R,T)=f(R)+f(T)$ with $f(R)=\\lambda R$ and $f(T)=\\lambda T$. Such a choice of the functional $f(R,T)$ leads to an evolving effective cosmological constant $\\Lambda$ which depends on the stress energy tensor. The source of the matter field is taken to be a perfect cosmic fluid. The exact solutions of the field equations are obtained by considering a constant deceleration parameter which leads two different aspects of the volumetric expansion namely a power law and an exponential volumetric expansion. Keeping an eye on the accelerating nature of the universe in the present epoch, the dynamics and physical behaviour of the models have been discussed. From statefinder diagnostic pair we found that the model with exponential volumetric expansion behaves more like a $\\Lambda$CDM model.

Identification of trimannoside-recognizing peptide sequences from a T7 phage display screen using a QCM device.

PubMed

Nishiyama, Kazusa; Takakusagi, Yoichi; Kusayanagi, Tomoe; Matsumoto, Yuki; Habu, Shiori; Kuramochi, Kouji; Sugawara, Fumio; Sakaguchi, Kengo; Takahashi, Hideyo; Natsugari, Hideaki; Kobayashi, Susumu

2009-01-01

Here, we report on the identification of trimannoside-recognizing peptide sequences from a T7 phage display screen using a quartz-crystal microbalance (QCM) device. A trimannoside derivative that can form a self-assembled monolayer (SAM) was synthesized and used for immobilization on the gold electrode surface of a QCM sensor chip. After six sets of one-cycle affinity selection, T7 phage particles displaying PSVGLFTH (8-mer) and SVGLGLGFSTVNCF (14-mer) were found to be enriched at a rate of 17/44, 9/44, respectively, suggesting that these peptides specifically recognize trimannoside. Binding checks using the respective single T7 phage and synthetic peptide also confirmed the specific binding of these sequences to the trimannoside-SAM. Subsequent analysis revealed that these sequences correspond to part of the primary amino acid sequence found in many mannose- or hexose-related proteins. Taken together, these results demonstrate the effectiveness of our T7 phage display environment for affinity selection of binding peptides. We anticipate this screening result will also be extremely useful in the development of inhibitors or drug delivery systems targeting polysaccharides as well as further investigations into the function of carbohydrates in vivo.

Reclassification of strains MAFF 303099T and R7A into Mesorhizobiumjaponicum sp. nov.

PubMed

Martínez-Hidalgo, Pilar; Ramírez-Bahena, Martha Helena; Flores-Félix, José David; Igual, José M; Sanjuán, Juan; León-Barrios, Milagros; Peix, Alvaro; Velázquez, Encarna

2016-12-01

In this work we revise the taxonomic status of the Lotus-nodulating strains MAFF 303099T and R7A isolated in Japan and New Zealand, respectively. Their 16S rRNA gene sequences are identical and show 98.0, 99.7, 99.8 and 99.9 % similarity values with respect to Mesorhizobium loti NZP 2213T, M. jarvisii ATCC 33669T, M. huakuii USDA 4779T (=CCBAU 2609T) and M. erdmanii USDA 3471T, respectively. The analysis of recA and glnII gene sequeces showed that M. jarvisii ATCC 33669T and M. huakuii USDA 4779T (=CCBAU 2609T) are the most closely related strains to MAFF 303099T and R7A, with similarity values suggesting that these two strains belong to a different species for which MAFF 303099T is selected as the type strain. The DNA-DNA relatedness values between strain MAFF 303099T and its closest phylogenetic relatives ranged from 53 to 60 % in average. Strains MAFF 303099T and R7A presented slight differences in the proportions of C18 : 1ω7c 11-methyl and C19 : 0 cyclo ω8c fatty acids with respect to M. jarvisii ATCC 33669T and M. huakuii USDA 4779T, and also in several phenotypic characteristics. Therefore, we propose the reclassification of these two strains into a novel species named Mesorhizobium japonicum sp. nov., with the type strain being MAFF 303099T (=LMG 29417T=CECT 9101T).

Inhibition of IGF1-R overcomes IGFBP7-induced chemotherapy resistance in T-ALL.

PubMed

Bartram, Isabelle; Erben, Ulrike; Ortiz-Tanchez, Jutta; Blunert, Katja; Schlee, Cornelia; Neumann, Martin; Heesch, Sandra; Baldus, Claudia D

2015-10-08

T-cell acute lymphoblastic leukemia (T-ALL) is a genetically heterogeneous disease with the need for treatment optimization. Previously, high expression of Insulin-like growth factor binding protein 7 (IGFBP7), a member of the IGF system, was identified as negative prognostic factor in adult T-ALL patients. Since aberrant IGFBP7 expression was observed in a variety of neoplasia and was relevant for prognosis in T-ALL, we investigated the functional role of IGFBP7 in Jurkat and Molt-4 cells as in vitro models for T-ALL. Jurkat and Molt-4 cells were stably transfected with an IGFBP7 over-expression vector or the empty vector as control. Proliferation of the cells was assessed by WST-1 assays and cell cycle status was measured by flow-cytometry after BrDU/7-AAD staining. The effect of IGFBP7 over-expression on sensitivity to cytostatic drugs was determined in AnnexinV/7-AAD assays. IGF1-R protein expression was measured by Western Blot and flow-cytometric analysis. IGF1-R associated gene expression profiles were generated from microarray gene expression data of 86 T-ALL patients from the Microarrays Innovations in Leukemia (MILE) multicenter study. IGFBP7-transfected Jurkat cells proliferated less, leading to a longer survival in a nutrient-limited environment. Both IGFBP7-transfected Jurkat and Molt-4 cells showed an arrest in the G0/G1 cell cycle phase. Furthermore, Jurkat IGFBP7-transfected cells were resistant to vincristine and asparaginase treatment. Surface expression and whole protein measurement of IGF1-R protein expression showed a reduced abundance of the receptor after IGFBP7 transfection in Jurkat cells. Interestingly, combination of the IGF1-R inhibitor NPV-AEW541 restored sensitivity to vincristine in IGFBP7-transfected cells. Additionally, IGF1-R associated GEP revealed an up-regulation of important drivers of T-ALL pathogenesis and regulators of chemo-resistance and apoptosis such as NOTCH1, BCL-2, PRKCI, and TP53. This study revealed a proliferation

Analysis of Perioperative Chemotherapy in Resected Pancreatic Cancer: Identifying the Number and Sequence of Chemotherapy Cycles Needed to Optimize Survival.

PubMed

Epelboym, Irene; Zenati, Mazen S; Hamad, Ahmad; Steve, Jennifer; Lee, Kenneth K; Bahary, Nathan; Hogg, Melissa E; Zeh, Herbert J; Zureikat, Amer H

2017-09-01

Receipt of 6 cycles of adjuvant chemotherapy (AC) is standard of care in pancreatic cancer (PC). Neoadjuvant chemotherapy (NAC) is increasingly utilized; however, optimal number of cycles needed alone or in combination with AC remains unknown. We sought to determine the optimal number and sequence of perioperative chemotherapy cycles in PC. Single institutional review of all resected PCs from 2008 to 2015. The impact of cumulative number of chemotherapy cycles received (0, 1-5, and ≥6 cycles) and their sequence (NAC, AC, or NAC + AC) on overall survival was evaluated Cox-proportional hazard modeling, using 6 cycles of AC as reference. A total of 522 patients were analyzed. Based on sample size distribution, four combinations were evaluated: 0 cycles = 12.1%, 1-5 cycles of combined NAC + AC = 29%, 6 cycles of AC = 25%, and ≥6 cycles of combined NAC + AC = 34%, with corresponding survival. 13.1, 18.5, 37, and 36.8 months. On MVA (P < 0.0001), tumor stage [hazard ratio (HR) 1.35], LNR (HR 4.3), and R1 margins (HR 1.77) were associated with increased hazard of death. Compared with 6 cycles AC, receipt of 0 cycles [HR 3.57, confidence interval (CI) 2.47-5.18] or 1-5 cycles in any combination (HR 2.37, CI 1.73-3.23) was associated with increased hazard of death, whereas receipt of ≥6 cycles in any sequence was associated with optimal and comparable survival (HR 1.07, CI 0.78-1.47). Receipt of 6 or more perioperative cycles of chemotherapy either as combined neoadjuvant and adjuvant or adjuvant alone may be associated with optimal and comparable survival in resected PC.

Pseudo-simple heteroclinic cycles in R4

NASA Astrophysics Data System (ADS)

Chossat, Pascal; Lohse, Alexander; Podvigina, Olga

2018-06-01

We study pseudo-simple heteroclinic cycles for a Γ-equivariant system in R4 with finite Γ ⊂ O(4) , and their nearby dynamics. In particular, in a first step towards a full classification - analogous to that which exists already for the class of simple cycles - we identify all finite subgroups of O(4) admitting pseudo-simple cycles. To this end we introduce a constructive method to build equivariant dynamical systems possessing a robust heteroclinic cycle. Extending a previous study we also investigate the existence of periodic orbits close to a pseudo-simple cycle, which depends on the symmetry groups of equilibria in the cycle. Moreover, we identify subgroups Γ ⊂ O(4) , Γ ⊄ SO(4) , admitting fragmentarily asymptotically stable pseudo-simple heteroclinic cycles. (It has been previously shown that for Γ ⊂ SO(4) pseudo-simple cycles generically are completely unstable.) Finally, we study a generalized heteroclinic cycle, which involves a pseudo-simple cycle as a subset.

Shallowing-upward cyclic patterns within larger-scale transgressive-regressive (T-R) sedimentary sequences, St. Peter through Decorah Formations, Ordovician, Iowa area

DOE Office of Scientific and Technical Information (OSTI.GOV)

Witzke, B.J.

1993-03-01

Four large-scale (2--8 Ma) T-R sedimentary sequences of M. Ord. age (late Chaz.-Sherm.) were delimited by Witzke Kolata (1980) in the Iowa area, each bounded by local to regional unconformity/disconformity surfaces. These encompass both siliciclastic and carbonate intervals, in ascending order: (1) St. Peter-Glenwood fms., (2) Platteville Fm., (3) Decorah Fm., (4) Dunleith/upper Decorah fms. Finer-scale resolution of depth-related depositional features has led to regional recognition of smaller-scale shallowing-upward cyclicity contained within each large-scale sequence. Such smaller-scale cyclicity encompasses stratigraphic intervals of 1--10 m thickness, with estimated durations of 0.5--1.5 Ma. The St. Peter Sandst. has long been regarded asmore » a classic transgressive sheet sand. However, four discrete shallowing-upward packages characterize the St. Peter-Glenwood interval regionally (IA, MN, NB, KS), including western facies displaying coarsening-upward sandstone packages with condensed conodont-rich brown shale and phosphatic sediments in their lower part (local oolitic ironstone), commonly above pyritic hardgrounds. Regional continuity of small-scale cyclic patterns in M. Ord. strata of the Iowa area may suggest eustatic controls; this can be tested through inter-regional comparisons.« less

Identification of (R)-selective ω-aminotransferases by exploring evolutionary sequence space.

PubMed

Kim, Eun-Mi; Park, Joon Ho; Kim, Byung-Gee; Seo, Joo-Hyun

2018-03-01

Several (R)-selective ω-aminotransferases (R-ωATs) have been reported. The existence of additional R-ωATs having different sequence characteristics from previous ones is highly expected. In addition, it is generally accepted that R-ωATs are variants of aminotransferase group III. Based on these backgrounds, sequences in RefSeq database were scored using family profiles of branched-chain amino acid aminotransferase (BCAT) and d-alanine aminotransferase (DAT) to predict and identify putative R-ωATs. Sequences with two profile analysis scores were plotted on two-dimensional score space. Candidates with relatively similar scores in both BCAT and DAT profiles (i.e., profile analysis score using BCAT profile was similar to profile analysis score using DAT profile) were selected. Experimental results for selected candidates showed that putative R-ωATs from Saccharopolyspora erythraea (R-ωAT_Sery), Bacillus cellulosilyticus (R-ωAT_Bcel), and Bacillus thuringiensis (R-ωAT_Bthu) had R-ωAT activity. Additional experiments revealed that R-ωAT_Sery also possessed DAT activity while R-ωAT_Bcel and R-ωAT_Bthu had BCAT activity. Selecting putative R-ωATs from regions with similar profile analysis scores identified potential R-ωATs. Therefore, R-ωATs could be efficiently identified by using simple family profile analysis and exploring evolutionary sequence space. Copyright © 2017 Elsevier Inc. All rights reserved.

IL-7 Receptor Mutations and Steroid Resistance in Pediatric T cell Acute Lymphoblastic Leukemia: A Genome Sequencing Study

PubMed Central

Stubbs, Andrew P.; Vroegindeweij, Eric M.; Smits, Willem K.; van Marion, Ronald; Dinjens, Winand N. M.; Horstmann, Martin; Kuiper, Roland P.; Zaman, Guido J. R.; van der Spek, Peter J.; Pieters, Rob; Meijerink, Jules P. P.

2016-01-01

Background Pediatric acute lymphoblastic leukemia (ALL) is the most common childhood cancer and the leading cause of cancer-related mortality in children. T cell ALL (T-ALL) represents about 15% of pediatric ALL cases and is considered a high-risk disease. T-ALL is often associated with resistance to treatment, including steroids, which are currently the cornerstone for treating ALL; moreover, initial steroid response strongly predicts survival and cure. However, the cellular mechanisms underlying steroid resistance in T-ALL patients are poorly understood. In this study, we combined various genomic datasets in order to identify candidate genetic mechanisms underlying steroid resistance in children undergoing T-ALL treatment. Methods and Findings We performed whole genome sequencing on paired pre-treatment (diagnostic) and post-treatment (remission) samples from 13 patients, and targeted exome sequencing of pre-treatment samples from 69 additional T-ALL patients. We then integrated mutation data with copy number data for 151 mutated genes, and this integrated dataset was tested for associations of mutations with clinical outcomes and in vitro drug response. Our analysis revealed that mutations in JAK1 and KRAS, two genes encoding components of the interleukin 7 receptor (IL7R) signaling pathway, were associated with steroid resistance and poor outcome. We then sequenced JAK1, KRAS, and other genes in this pathway, including IL7R, JAK3, NF1, NRAS, and AKT, in these 69 T-ALL patients and a further 77 T-ALL patients. We identified mutations in 32% (47/146) of patients, the majority of whom had a specific T-ALL subtype (early thymic progenitor ALL or TLX). Based on the outcomes of these patients and their prednisolone responsiveness measured in vitro, we then confirmed that these mutations were associated with both steroid resistance and poor outcome. To explore how these mutations in IL7R signaling pathway genes cause steroid resistance and subsequent poor outcome, we

Simian T Lymphotropic Virus 1 Infection of Papio anubis: tax Sequence Heterogeneity and T Cell Recognition.

PubMed

Termini, James M; Magnani, Diogo M; Maxwell, Helen S; Lauer, William; Castro, Iris; Pecotte, Jerilyn; Barber, Glen N; Watkins, David I; Desrosiers, Ronald C

2017-10-15

Baboons naturally infected with simian T lymphotropic virus (STLV) are a potentially useful model system for the study of vaccination against human T lymphotropic virus (HTLV). Here we expanded the number of available full-length baboon STLV-1 sequences from one to three and related the T cell responses that recognize the immunodominant Tax protein to the tax sequences present in two individual baboons. Continuously growing T cell lines were established from two baboons, animals 12141 and 12752. Next-generation sequencing (NGS) of complete STLV genome sequences from these T cell lines revealed them to be closely related but distinct from each other and from the baboon STLV-1 sequence in the NCBI sequence database. Overlapping peptides corresponding to each unique Tax sequence and to the reference baboon Tax sequence were used to analyze recognition by T cells from each baboon using intracellular cytokine staining (ICS). Individual baboons expressed more gamma interferon and tumor necrosis factor alpha in response to Tax peptides corresponding to their own STLV-1 sequence than in response to Tax peptides corresponding to the reference baboon STLV-1 sequence. Thus, our analyses revealed distinct but closely related STLV-1 genome sequences in two baboons, extremely low heterogeneity of STLV sequences within each baboon, no evidence for superinfection within each baboon, and a ready ability of T cells in each baboon to recognize circulating Tax sequences. While amino acid substitutions that result in escape from CD8 + T cell recognition were not observed, premature stop codons were observed in 7% and 56% of tax sequences from peripheral blood mononuclear cells from animals 12141 and 12752, respectively. IMPORTANCE It has been estimated that approximately 100,000 people suffer serious morbidity and 10,000 people die each year from the consequences associated with human T lymphotropic virus (HTLV) infection. There are no antiviral drugs and no preventive vaccine. A

Non-contiguous genome sequence of Mycobacterium simiae strain DSM 44165(T.).

PubMed

Sassi, Mohamed; Robert, Catherine; Raoult, Didier; Drancourt, Michel

2013-01-01

Mycobacterium simiae is a non-tuberculosis mycobacterium causing pulmonary infections in both immunocompetent and imunocompromized patients. We announce the draft genome sequence of M. simiae DSM 44165(T). The 5,782,968-bp long genome with 65.15% GC content (one chromosome, no plasmid) contains 5,727 open reading frames (33% with unknown function and 11 ORFs sizing more than 5000 -bp), three rRNA operons, 52 tRNA, one 66-bp tmRNA matching with tmRNA tags from Mycobacterium avium, Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium microti, Mycobacterium marinum, and Mycobacterium africanum and 389 DNA repetitive sequences. Comparing ORFs and size distribution between M. simiae and five other Mycobacterium species M. simiae clustered with M. abscessus and M. smegmatis. A 40-kb prophage was predicted in addition to two prophage-like elements, 7-kb and 18-kb in size, but no mycobacteriophage was seen after the observation of 10(6) M. simiae cells. Fifteen putative CRISPRs were found. Three genes were predicted to encode resistance to aminoglycosides, betalactams and macrolide-lincosamide-streptogramin B. A total of 163 CAZYmes were annotated. M. simiae contains ESX-1 to ESX-5 genes encoding for a type-VII secretion system. Availability of the genome sequence may help depict the unique properties of this environmental, opportunistic pathogen.

Complete genome sequence of Dehalogenimonas lykanthroporepellens type strain (BL-DC-9T) and comparison to Dehalococcoides strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siddaramappa, Shivakumara; Delano, Susana; Green, Lance D.

2012-01-01

Dehalogenimonas lykanthroporepellens is the type species of the genus Dehalogenimonas, which belongs to a deeply branching lineage within the phylum Chloroflexi. This strictly anaerobic, mesophilic, non spore forming, Gram negative staining bacterium was first isolated from chlorinated solvent contaminated groundwater at a Superfund site located near Baton Rouge, Louisiana, USA. D. lykanthroporepellens was of interest for genome sequencing for two reasons: (a) its unusual ability to couple growth with reductive dechlorination of environmentally important polychlorinated aliphatic alkanes and (b) its phylogenetic position distant from previously sequenced bacteria. The 1,686,510 bp circular chromosome of strain BL-DC-9{sup T} contains 1,720 predicted proteinmore » coding genes, 47 tRNA genes, a single large subunit rRNA (23S-5S) locus, and a single, orphan, small unit rRNA (16S) locus.« less

Study of isotropic compact stars in f(R,T,R_{μν}T^{μν}) gravity

NASA Astrophysics Data System (ADS)

Sharif, M.; Waseem, Arfa

2016-06-01

In this paper, we investigate physical behavior and stability of compact stars filled with isotropic fluid in f(R,T,R_{μν}T^{μν}) gravity. We consider the static spherically symmetric spacetime and choose the simplest model of this gravity, i.e., R+α R_{μν}T^{μν} . To examine the basic features of compact stars like Her X-1, SAX J 1808.4-3658 and 4U 1820-30, we apply analytic solutions of Krori and Barua metric using the mass-radius relation. We study the behavior of effective energy density, pressure, equation of state parameter and energy conditions in the interior of compact stars. We also explore the stability criteria of compact stars via the speed of sound. It is concluded that all the energy conditions are satisfied and the compact stars are found to be stable at the boundary for this particular model.

Project W.A.T.E.R.

ERIC Educational Resources Information Center

EnviroTeach, 1992

1992-01-01

Introduces networking projects for studying rivers and water quality. Describes two projects in South Africa (Project W.A.T.E.R and SWAP) associated with the international network, Global Rivers Environmental Education Network. Discusses water test kits and educational material developed through Project W.A.T.E.R. (Water Awareness through…

Genome sequence of the Thermotoga thermarum type strain (LA3(T)) from an African solfataric spring.

PubMed

Göker, Markus; Spring, Stefan; Scheuner, Carmen; Anderson, Iain; Zeytun, Ahmet; Nolan, Matt; Lucas, Susan; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Goodwin, Lynne A; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Rohde, Manfred; Detter, John C; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla

2014-06-15

Thermotoga thermarum Windberger et al. 1989 is a member to the genomically well characterized genus Thermotoga in the phylum 'Thermotogae'. T. thermarum is of interest for its origin from a continental solfataric spring vs. predominantly marine oil reservoirs of other members of the genus. The genome of strain LA3T also provides fresh data for the phylogenomic positioning of the (hyper-)thermophilic bacteria. T. thermarum strain LA3(T) is the fourth sequenced genome of a type strain from the genus Thermotoga, and the sixth in the family Thermotogaceae to be formally described in a publication. Phylogenetic analyses do not reveal significant discrepancies between the current classification of the group, 16S rRNA gene data and whole-genome sequences. Nevertheless, T. thermarum significantly differs from other Thermotoga species regarding its iron-sulfur cluster synthesis, as it contains only a minimal set of the necessary proteins. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,039,943 bp long chromosome with its 2,015 protein-coding and 51 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

Genome sequence of the Thermotoga thermarum type strain (LA 3 T) from an African solfataric spring

DOE PAGES

Goker, Markus; Spring, Stefan; Scheuner, Carmen; ...

2014-06-15

Thermotoga thermarum Windberger et al. 1989 is a member to the genomically well characterized genus Thermotoga in the phylum ' Thermotogae'. T. thermarum is of interest for its origin from a continental solfataric spring vs. predominantly marine oil reservoirs of other members of the genus. The genome of strain LA3T also provides fresh data for the phylogenomic positioning of the (hyper-)thermophilic bacteria. T. thermarum strain LA3 T is the fourth sequenced genome of a type strain from the genus Thermotoga, and the sixth in the family Thermotogaceae to be formally described in a publication. Phylogenetic analyses do not reveal significantmore » discrepancies between the current classification of the group, 16S rRNA gene data and whole-genome sequences. Nevertheless, T. thermarum significantly differs from other Thermotoga species regarding its iron-sulfur cluster synthesis, as it contains only a minimal set of the necessary proteins. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,039,943 bp long chromosome with its 2,015 protein-coding and 51 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less

Early Permian transgressive-regressive cycles: Sequence stratigraphic reappraisal of the coal-bearing Barakar Formation, Raniganj Basin, India

NASA Astrophysics Data System (ADS)

Bhattacharya, Biplab; Bhattacharjee, Joyeeta; Bandyopadhyay, Sandip; Banerjee, Sudipto; Adhikari, Kalyan

2018-03-01

The present research is an attempt to assess the Barakar Formation of the Raniganj Gondwana Basin, India, in the frame of fluvio-marine (estuarine) depositional systems using sequence stratigraphic elements. Analysis of predominant facies associations signify deposition in three sub-environments: (i) a river-dominated bay-head delta zone in the inner estuary, with transition from braided fluvial channels (FA-B1) to tide-affected meandering fluvial channels and flood plains (FA-B2) in the basal part of the succession; (ii) a mixed energy central basin zone, which consists of transitional fluvio-tidal channels (FA-B2), tidal flats, associated with tidal channels and bars (FA-B3) in the middle-upper part of the succession; and (iii) a wave-dominated outer estuary (coastal) zone (FA-B4 with FA-B3) in the upper part of the succession. Stacked progradational (P1, P2)-retrogradational (R1, R2) successions attest to one major base level fluctuation, leading to distinct transgressive-regressive (T-R) cycles with development of initial falling stage systems tract (FSST), followed by lowstand systems tract (LST) and successive transgressive systems tracts (TST-1 and TST-2). Shift in the depositional regime from regressive to transgressive estuarine system in the early Permian Barakar Formation is attributed to change in accommodation space caused by mutual interactions of (i) base level fluctuations in response to climatic amelioration and (ii) basinal tectonisms (exhumation/sagging) related to post-glacial isostatic adjustments in the riftogenic Gondwana basins.

Fucci2a: a bicistronic cell cycle reporter that allows Cre mediated tissue specific expression in mice.

PubMed

Mort, Richard Lester; Ford, Matthew Jonathan; Sakaue-Sawano, Asako; Lindstrom, Nils Olof; Casadio, Angela; Douglas, Adam Thomas; Keighren, Margaret Anne; Hohenstein, Peter; Miyawaki, Atsushi; Jackson, Ian James

2014-01-01

Markers of cell cycle stage allow estimation of cell cycle dynamics in cell culture and during embryonic development. The Fucci system incorporates genetically encoded probes that highlight G1 and S/G2/M phases of the cell cycle allowing live imaging. However the available mouse models that incorporate Fucci are beset by problems with transgene inactivation, varying expression level, lack of conditional potential and/or the need to maintain separate transgenes-there is no transgenic mouse model that solves all these problems. To address these shortfalls we re-engineered the Fucci system to create 2 bicistronic Fucci variants incorporating both probes fused using the Thosea asigna virus 2A (T2A) self cleaving peptide. We characterize these variants in stable 3T3 cell lines. One of the variants (termed Fucci2a) faithfully recapitulated the nuclear localization and cell cycle stage specific florescence of the original Fucci system. We go on to develop a conditional mouse allele (R26Fucci2aR) carefully designed for high, inducible, ubiquitous expression allowing investigation of cell cycle status in single cell lineages within the developing embryo. We demonstrate the utility of R26Fucci2aR for live imaging by using high resolution confocal microscopy of ex vivo lung, kidney and neural crest development. Using our 3T3 system we describe and validate a method to estimate cell cycle times from relatively short time-lapse sequences that we then apply to our neural crest data. The Fucci2a system and the R26Fucci2aR mouse model are compelling new tools for the investigation of cell cycle dynamics in cell culture and during mouse embryonic development.

3,3′-Diindolylmethane Ameliorates Experimental Autoimmune Encephalomyelitis by Promoting Cell Cycle Arrest and Apoptosis in Activated T Cells through MicroRNA Signaling Pathways

PubMed Central

Rouse, Michael; Rao, Roshni; Nagarkatti, Mitzi

2014-01-01

3,3′-Diindolylmethane (DIM) is a naturally derived indole found in cruciferous vegetables that has great potential as a novel and effective therapeutic agent. In the current study, we investigated the effects of DIM post-treatment on the regulation of activated T cells during the development of experimental autoimmune encephalomyelitis (EAE), a murine model of multiple sclerosis. We demonstrated that the administration of DIM 10 days after EAE induction was effective at ameliorating disease parameters, including inflammation and central nervous system cellular infiltration. MicroRNA (miRNA) microarray analysis revealed an altered miRNA profile in brain infiltrating CD4+ T cells following DIM post-treatment of EAE mice. Additionally, bioinformatics analysis suggested the involvement of DIM-induced miRNAs in pathways and processes that halt cell cycle progression and promote apoptosis. Additional studies confirmed that DIM impacted these cellular processes in activated T cells. Further evidence indicated that DIM treatment significantly upregulated several miRNAs (miR-200c, miR-146a, miR-16, miR-93, and miR-22) in brain CD4+ T cells during EAE while suppressing their associated target genes. Similarly, we found that overexpression of miR-16 in primary CD4+ T cells led to significant downregulation of both mRNA and protein levels of cyclin E1 and B-cell lymphoma-2, which play important roles in regulating cell cycle progression and apoptosis. Collectively, these studies demonstrate that DIM post-treatment leads to the amelioration of EAE development by suppressing T-cell responses through the induction of select miRNAs that control cell cycle progression and mediate apoptosis. PMID:24898268

f(T,R) theory of gravity

NASA Astrophysics Data System (ADS)

Salti, Mustafa; Korunur, Murat; Acikgoz, Irfan; Pirinccioglu, Nurettin; Binbay, Figen

We mainly focus on the idea that the dynamics of the whole universe may be understood by making use of torsion T and curvature R at the same time. The f(T,R)-gravity can be considered as a fundamental gravitational theory describing the evolution of the universe. The model can produce the unification of the general relativity (GR), teleparallel gravity (TPG), f(R)-gravity and f(T)-gravity theories. For this purpose, the corresponding Lagrangian density is written in terms of an arbitrary function of the torsion and curvature scalars. Furthermore, we use the absence/existence puzzle of relativistic neutron stars and thermodynamical laws as constraining tools for the new proposal.

t {r_arrow} cWW and WW {r_arrow} {anti t}c + t{anti c} in extended models

DOE Office of Scientific and Technical Information (OSTI.GOV)

David Atwood; Marc Sher

Jenkins has pointed out that the process t {r_arrow} cW{sup +}W{sup {minus}}is GIM suppressed in the standard model. In this note, the authors calculate the branching ratio for a wide range of models, in which the decay occurs at tree level through exchange of a scalar, fermion or vector. In the case of scalar exchange, a scalar mass between 2m{sub W} and 200 GeV leads to a resonant enhancement, giving a branching ratio as high as a few tenths of a percent. They then note that all of these models will also allow W{sup +}W{sup {minus}} {r_arrow} {anti t}c +more » t{anti c}, and they calculate the single-top/single-charm production rate at the LHC. The rates aren't negligibly small, but the background from single-top/single-bottom production will probably swamp the signal.« less

High quality draft genome sequence of Brachymonas chironomi AIMA4T (DSM 19884T) isolated from a Chironomus sp. egg mass

DOE PAGES

Laviad, Sivan; Lapidus, Alla; Han, James; ...

2015-05-27

Brachymonas chironomi strain AIMA4T (Halpern et al., 2009) is a Gram-negative, non-motile, aerobic, chemoorganotroph bacterium. B. chironomi is a member of the Comamonadaceae, a family within the class Betaproteobacteria. This species was isolated from a chironomid (Diptera; Chironomidae) egg mass, sampled from a waste stabilization pond in northern Israel. Phylogenetic analysis based on the 16S rRNA gene sequences placed strain AIMA4T in the genus Brachymonas. Here we describe the features of this organism, together with the complete genome sequence and annotation. We find the DNA GC content is 63.5%. The chromosome length is 2,509,395 bp. It encodes 2,382 proteins andmore » 68 RNA genes. Brachymonas chironomi genome is part of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project.« less

Does fat suppression via chemically selective saturation affect R2*-MRI for transfusional iron overload assessment? A clinical evaluation at 1.5T and 3T.

PubMed

Krafft, Axel J; Loeffler, Ralf B; Song, Ruitian; Bian, Xiao; McCarville, M Beth; Hankins, Jane S; Hillenbrand, Claudia M

2016-08-01

Fat suppression (FS) via chemically selective saturation (CHESS) eliminates fat-water oscillations in multiecho gradient echo (mGRE) R2*-MRI. However, for increasing R2* values as seen with increasing liver iron content (LIC), the water signal spectrally overlaps with the CHESS band, which may alter R2*. We investigated the effect of CHESS on R2* and developed a heuristic correction for the observed CHESS-induced R2* changes. Eighty patients [female, n = 49; male, n = 31; mean age (± standard deviation), 18.3 ± 11.7 y] with iron overload were scanned with a non-FS and a CHESS-FS mGRE sequence at 1.5T and 3T. Mean liver R2* values were evaluated using three published fitting approaches. Measured and model-corrected R2* values were compared and statistically analyzed. At 1.5T, CHESS led to a systematic R2* reduction (P < 0.001 for all fitting algorithms) especially toward higher R2*. Our model described the observed changes well and reduced the CHESS-induced R2* bias after correction (linear regression slopes: 1.032/0.927/0.981). No CHESS-induced R2* reductions were found at 3T. The CHESS-induced R2* bias at 1.5T needs to be considered when applying R2*-LIC biopsy calibrations for clinical LIC assessment, which were established without FS at 1.5T. The proposed model corrects the R2* bias and could therefore improve clinical iron overload assessment based on linear R2*-LIC calibrations. Magn Reson Med 76:591-601, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets

PubMed Central

Yu, Guoqin; Fadrosh, Doug; Goedert, James J.; Ravel, Jacques; Goldstein, Alisa M.

2015-01-01

Background Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. Results In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon’s index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Conclusions Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work

Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

PubMed

Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

2015-01-01

Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by

Costimulation dependent expression of miR-214 increases the ability of T cells to proliferate by targeting Pten

PubMed Central

Jindra, Peter T.; Bagley, Jessamyn; Godwin, Jonathan G.; Iacomini, John

2010-01-01

T cell activation requires signaling through the T cell receptor (TCR) and costimulatory molecules such as CD28. MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression post transcriptionally and are also known to be involved in lymphocyte development and function. Here we set out to examine potential roles of miRNAs in T cell activation by using genome-wide expression profiling to identify miRNAs differentially regulated following T cell activation. One of the miRNAs up-regulated after T cell activation, miR-214, was predicted to be capable of targeting Pten based on bioinformatics and reports suggesting that it targets Pten in ovarian tumor cells. Up-regulation of miR-214 in T cells inversely correlated with PTEN levels. In vivo, transcripts containing the 3' untranslated region (3' UTR) of Pten including the miR-214 target sequence were negatively regulated after T cell activation, and forced expression of miR-214 in T cells led to increased proliferation after stimulation. Blocking CD28 signaling in vivo prevented miR-214 up-regulation in alloreactive T cells. Stimulation of T cells through the TCR alone was not sufficient to result in upregulation of miR-214. Thus, costimulation dependent up-regulation of miR-214 promotes T cell activation by targeting the negative regulator Pten. Thus, the requirement for T cell costimulation is in part related to its ability to regulate expression of miRNAs that control T cell activation. PMID:20548023

Ultrahigh-resolution imaging of the human brain with phase-cycled balanced steady-state free precession at 7 T.

PubMed

Zeineh, Michael M; Parekh, Mansi B; Zaharchuk, Greg; Su, Jason H; Rosenberg, Jarrett; Fischbein, Nancy J; Rutt, Brian K

2014-05-01

The objectives of this study were to acquire ultra-high resolution images of the brain using balanced steady-state free precession (bSSFP) at 7 T and to identify the potential utility of this sequence. Eight volunteers participated in this study after providing informed consent. Each volunteer was scanned with 8 phase cycles of bSSFP at 0.4-mm isotropic resolution using 0.5 number of excitations and 2-dimensional parallel acceleration of 1.75 × 1.75. Each phase cycle required 5 minutes of scanning, with pauses between the phase cycles allowing short periods of rest. The individual phase cycles were aligned and then averaged. The same volunteers underwent scanning using 3-dimensional (3D) multiecho gradient recalled echo at 0.8-mm isotropic resolution, 3D Cube T2 at 0.7-mm isotropic resolution, and thin-section coronal oblique T2-weighted fast spin echo at 0.22 × 0.22 × 2.0-mm resolution for comparison. Two neuroradiologists assessed image quality and potential research and clinical utility. The volunteers generally tolerated the scan sessions well, and composite high-resolution bSSFP images were produced for each volunteer. Rater analysis demonstrated that bSSFP had a superior 3D visualization of the microarchitecture of the hippocampus, very good contrast to delineate the borders of the subthalamic nucleus, and relatively good B1 homogeneity throughout. In addition to an excellent visualization of the cerebellum, subtle details of the brain and skull base anatomy were also easier to identify on the bSSFP images, including the line of Gennari, membrane of Liliequist, and cranial nerves. Balanced steady-state free precession had a strong iron contrast similar to or better than the comparison sequences. However, cortical gray-white contrast was significantly better with Cube T2 and T2-weighted fast spin echo. Balanced steady-state free precession can facilitate ultrahigh-resolution imaging of the brain. Although total imaging times are long, the individually short

Draft Genome Sequence of Methanoculleus sediminis S3FaT, a Hydrogenotrophic Methanogen Isolated from a Submarine Mud Volcano in Taiwan.

PubMed

Chen, Sheng-Chung; Chen, Mei-Fei; Weng, Chieh-Yin; Lai, Mei-Chin; Wu, Sue-Yao

2016-04-21

Here, we announce the genome sequence of ITALIC! Methanoculleus sediminisS3Fa(T)(DSM 29354(T)), a strict anaerobic methanoarchaeon, which was isolated from sediments near the submarine mud volcano MV4 located offshore in southwestern Taiwan. The 2.49-Mb genome consists of 2,459 predicted genes, 3 rRNAs, 48 tRNAs, and 1 ncRNA. The sequence of this novel strain may provide more information for species delineation and the roles that this strain plays in the unique marine mud volcano habitat. Copyright © 2016 Chen et al.

TetR Family Regulator brpT Modulates Biofilm Formation in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Tang, Madison; Elrami, Fadi

2017-01-01

Biofilms are a key component in bacterial communities providing protection and contributing to infectious diseases. However, mechanisms involved in S. sanguinis biofilm formation have not been clearly elucidated. Here, we report the identification of a novel S. sanguinis TetR repressor, brpT (Biofilm Regulatory Protein TetR), involved in biofilm formation. Deletion of brpT resulted in a significant increase in biofilm formation. Interestingly, the mutant accumulated more water soluble and water insoluble glucans in its biofilm compared to the wild-type and the complemented mutant. The brpT mutation led to an altered biofilm morphology and structure exhibiting a rougher appearance, uneven distribution with more filaments bound to the chains. RNA-sequencing revealed that gtfP, the only glucosyltransferase present in S. sanguinis, was significantly up-regulated. In agreement with these findings, we independently observed that deletion of gtfP in S. sanguinis led to reduced biofilm and low levels of water soluble and insoluble glucans. These results suggest that brpT is involved in the regulation of the gtfP-mediated exopolysaccharide synthesis and controls S. sanguinis biofilm formation. The deletion of brpT may have a potential therapeutic application in regulating S. sanguinis colonization in the oral cavity and the prevention of dental caries. PMID:28046010

A Comprehensive Approach to Sequence-oriented IsomiR annotation (CASMIR): demonstration with IsomiR profiling in colorectal neoplasia.

PubMed

Wu, Chung Wah; Evans, Jared M; Huang, Shengbing; Mahoney, Douglas W; Dukek, Brian A; Taylor, William R; Yab, Tracy C; Smyrk, Thomas C; Jen, Jin; Kisiel, John B; Ahlquist, David A

2018-05-25

MicroRNA (miRNA) profiling is an important step in studying biological associations and identifying marker candidates. miRNA exists in isoforms, called isomiRs, which may exhibit distinct properties. With conventional profiling methods, limitations in assay and analysis platforms may compromise isomiR interrogation. We introduce a comprehensive approach to sequence-oriented isomiR annotation (CASMIR) to allow unbiased identification of global isomiRs from small RNA sequencing data. In this approach, small RNA reads are maintained as independent sequences instead of being summarized under miRNA names. IsomiR features are identified through step-wise local alignment against canonical forms and precursor sequences. Through customizing the reference database, CASMIR is applicable to isomiR annotation across species. To demonstrate its application, we investigated isomiR profiles in normal and neoplastic human colorectal epithelia. We also ran miRDeep2, a popular miRNA analysis algorithm to validate isomiRs annotated by CASMIR. With CASMIR, specific and biologically relevant isomiR patterns could be identified. We note that specific isomiRs are often more abundant than their canonical forms. We identify isomiRs that are commonly up-regulated in both colorectal cancer and advanced adenoma, and illustrate advantages in targeting isomiRs as potential biomarkers over canonical forms. Studying miRNAs at the isomiR level could reveal new insight into miRNA biology and inform assay design for specific isomiRs. CASMIR facilitates comprehensive annotation of isomiR features in small RNA sequencing data for isomiR profiling and differential expression analysis.

A systematic evaluation of three different cardiac T2-mapping sequences at 1.5 and 3T in healthy volunteers.

PubMed

Baeßler, Bettina; Schaarschmidt, Frank; Stehning, Christian; Schnackenburg, Bernhard; Maintz, David; Bunck, Alexander C

2015-11-01

Previous studies showed that myocardial T2 relaxation times measured by cardiac T2-mapping vary significantly depending on sequence and field strength. Therefore, a systematic comparison of different T2-mapping sequences and the establishment of dedicated T2 reference values is mandatory for diagnostic decision-making. Phantom experiments using gel probes with a range of different T1 and T2 times were performed on a clinical 1.5T and 3T scanner. In addition, 30 healthy volunteers were examined at 1.5 and 3T in immediate succession. In each examination, three different T2-mapping sequences were performed at three short-axis slices: Multi Echo Spin Echo (MESE), T2-prepared balanced SSFP (T2prep), and Gradient Spin Echo with and without fat saturation (GraSEFS/GraSE). Segmented T2-Maps were generated according to the AHA 16-segment model and statistical analysis was performed. Significant intra-individual differences between mean T2 times were observed for all sequences. In general, T2prep resulted in lowest and GraSE in highest T2 times. A significant variation with field strength was observed for mean T2 in phantom as well as in vivo, with higher T2 values at 1.5T compared to 3T, regardless of the sequence used. Segmental T2 values for each sequence at 1.5 and 3T are presented. Despite a careful selection of sequence parameters and volunteers, significant variations of the measured T2 values were observed between field strengths, MR sequences and myocardial segments. Therefore, we present segmental T2 values for each sequence at 1.5 and 3T with the inherent potential to serve as reference values for future studies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The transcriptional terminator sequences downstream of the covR gene terminate covR/S operon transcription to generate covR monocistronic transcripts in Streptococcus pyogenes.

PubMed

Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong

2008-12-31

CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.

Reversible and irreversible heat engine and refrigerator cycles

NASA Astrophysics Data System (ADS)

Leff, Harvey S.

2018-05-01

Although no reversible thermodynamic cycles exist in nature, nearly all cycles covered in textbooks are reversible. This is a review, clarification, and extension of results and concepts for quasistatic, reversible and irreversible processes and cycles, intended primarily for teachers and students. Distinctions between the latter process types are explained, with emphasis on clockwise (CW) and counterclockwise (CCW) cycles. Specific examples of each are examined, including Carnot, Kelvin and Stirling cycles. For the Stirling cycle, potentially useful task-specific efficiency measures are proposed and illustrated. Whether a cycle behaves as a traditional refrigerator or heat engine can depend on whether it is reversible or irreversible. Reversible and irreversible-quasistatic CW cycles both satisfy Carnot's inequality for thermal efficiency, η ≤ η C a r n o t . Irreversible CCW cycles with two reservoirs satisfy the coefficient of performance inequality K ≤ K C a r n o t . However, an arbitrary reversible cycle satisfies K ≥ K C a r n o t when compared with a reversible Carnot cycle operating between its maximum and minimum temperatures, a potentially counterintuitive result.

Cycle-time determination and process control of sequencing batch membrane bioreactors.

PubMed

Krampe, J

2013-01-01

In this paper a method to determine the cycle time for sequencing batch membrane bioreactors (SBMBRs) is introduced. One of the advantages of SBMBRs is the simplicity of adapting them to varying wastewater composition. The benefit of this flexibility can only be fully utilised if the cycle times are optimised for the specific inlet load conditions. This requires either proactive and ongoing operator adjustment or active predictive instrument-based control. Determination of the cycle times for conventional sequencing batch reactor (SBR) plants is usually based on experience. Due to the higher mixed liquor suspended solids concentrations in SBMBRs and the limited experience with their application, a new approach to calculate the cycle time had to be developed. Based on results from a semi-technical pilot plant, the paper presents an approach for calculating the cycle time in relation to the influent concentration according to the Activated Sludge Model No. 1 and the German HSG (Hochschulgruppe) Approach. The approach presented in this paper considers the increased solid contents in the reactor and the resultant shortened reaction times. This allows for an exact calculation of the nitrification and denitrification cycles with a tolerance of only a few minutes. Ultimately the same approach can be used for a predictive control strategy and for conventional SBR plants.

Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

PubMed

Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

2004-01-01

In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

Preoperative detection of malignant liver tumors: Comparison of 3D-T2-weighted sequences with T2-weighted turbo spin-echo and single shot T2 at 1.5 T.

PubMed

Barat, Maxime; Soyer, Philippe; Dautry, Raphael; Pocard, Marc; Lo-Dico, Rea; Najah, Haythem; Eveno, Clarisse; Cassinotto, Christophe; Dohan, Anthony

2018-03-01

To assess the performances of three-dimensional (3D)-T2-weighted sequences compared to standard T2-weighted turbo spin echo (T2-TSE), T2-half-Fourier acquisition single-shot turbo spin-echo (T2-HASTE), diffusion weighted imaging (DWI) and 3D-T1-weighted VIBE sequences in the preoperative detection of malignant liver tumors. From 2012 to 2015, all patients of our institution undergoing magnetic resonance imaging (MRI) examination for suspected malignant liver tumors were prospectively included. Patients had contrast-enhanced 3D-T1-weighted, DWI, 3D-T2-SPACE, T2-HASTE and T2-TSE sequences. Imaging findings were compared with those obtained at follow-up, surgery and histopathological analysis. Sensitivities for the detection of malignant liver tumors were compared for each sequence using McNemar test. A subgroup analysis was conducted for HCCs. Image artifacts were analyzed and compared using Wilcoxon paired signed rank-test. Thirty-three patients were included: 13 patients had 40 hepatocellular carcinomas (HCC) and 20 had 54 liver metastases. 3D-T2-weighted sequences had a higher sensitivity than T2-weighted TSE sequences for the detection of malignant liver tumors (79.8% versus 68.1%; P < 0.001). The difference did not reach significance for HCC. T1-weighted VIBE and DWI had a higher sensitivity than T2-weighted sequences. 3D-T2-weighted-SPACE sequences showed significantly less artifacts than T2-weitghted TSE. 3D-T2-weighted sequences show very promising performances for the detection of liver malignant tumors compared to T2-weighted TSE sequences. Copyright © 2018 Elsevier B.V. All rights reserved.

Can T1 w/T2 w ratio be used as a myelin-specific measure in subcortical structures? Comparisons between FSE-based T1 w/T2 w ratios, GRASE-based T1 w/T2 w ratios and multi-echo GRASE-based myelin water fractions.

PubMed

Uddin, Md Nasir; Figley, Teresa D; Marrie, Ruth Ann; Figley, Chase R

2018-03-01

Given the growing popularity of T 1 -weighted/T 2 -weighted (T 1 w/T 2 w) ratio measurements, the objective of the current study was to evaluate the concordance between T 1 w/T 2 w ratios obtained using conventional fast spin echo (FSE) versus combined gradient and spin echo (GRASE) sequences for T 2 w image acquisition, and to compare the resulting T 1 w/T 2 w ratios with histologically validated myelin water fraction (MWF) measurements in several subcortical brain structures. In order to compare these measurements across a relatively wide range of myelin concentrations, whole-brain T 1 w magnetization prepared rapid acquisition gradient echo (MPRAGE), T 2 w FSE and three-dimensional multi-echo GRASE data were acquired from 10 participants with multiple sclerosis at 3 T. Then, after high-dimensional, non-linear warping, region of interest (ROI) analyses were performed to compare T 1 w/T 2 w ratios and MWF estimates (across participants and brain regions) in 11 bilateral white matter (WM) and four bilateral subcortical grey matter (SGM) structures extracted from the JHU_MNI_SS 'Eve' atlas. Although the GRASE sequence systematically underestimated T 1 w/T 2 w values compared to the FSE sequence (revealed by Bland-Altman and mountain plots), linear regressions across participants and ROIs revealed consistently high correlations between the two methods (r 2 = 0.62 for all ROIs, r 2 = 0.62 for WM structures and r 2 = 0.73 for SGM structures). However, correlations between either FSE-based or GRASE-based T 1 w/T 2 w ratios and MWFs were extremely low in WM structures (FSE-based, r 2 = 0.000020; GRASE-based, r 2 = 0.0014), low across all ROIs (FSE-based, r 2 = 0.053; GRASE-based, r 2 = 0.029) and moderate in SGM structures (FSE-based, r 2 = 0.20; GRASE-based, r 2 = 0.17). Overall, our findings indicated a high degree of correlation (but not equivalence) between FSE-based and GRASE-based T 1 w/T 2 w ratios, and low correlations between T 1 w/T 2 w ratios and MWFs. This

Detection of maltodextrin and its discrimination from sucrose are independent of the T1R2 + T1R3 heterodimer.

PubMed

Smith, Kimberly R; Spector, Alan C

2017-10-01

Maltodextrins, such as Maltrin and Polycose, are glucose polymer mixtures of varying chain lengths that are palatable to rodents. Although glucose and other sugars activate the T1R2 + T1R3 "sweet" taste receptor, recent evidence from T1R2- or T1R3-knockout (KO) mice suggests that maltodextrins, despite their glucose polymer composition, activate a separate receptor mechanism to generate a taste percept qualitatively distinguishable from that of sweeteners. However, explicit discrimination of maltodextrins from prototypical sweeteners has not yet been psychophysically tested in any murine model. Therefore, mice lacking T1R2 + T1R3 and wild-type controls were tested in a two-response taste discrimination task to determine whether maltodextrins are 1 ) detectable when both receptor subunits are absent and 2 ) perceptually distinct from that of sucrose irrespective of viscosity, intensity, and hedonics. Most KO mice displayed similar Polycose sensitivity as controls. However, some KO mice were only sensitive to the higher Polycose concentrations, implicating potential allelic variation in the putative polysaccharide receptor or downstream pathways unmasked by the absence of T1R2 + T1R3. Varied Maltrin and sucrose concentrations of approximately matched viscosities were then presented to render the oral somatosensory features, intensity, and hedonic value of the solutions irrelevant. Although both genotypes competently discriminated Maltrin from sucrose, performance was apparently driven by the different orosensory percepts of the two stimuli in control mice and the presence of a Maltrin but not sucrose orosensory cue in KO mice. These data support the proposed presence of an orosensory receptor mechanism that gives rise to a qualitatively distinguishable sensation from that of sucrose. Copyright © 2017 the American Physiological Society.

Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

PubMed

Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

2016-11-01

Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

Complete genome sequence of Rhodospirillum rubrum type strain (S1T)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munk, Christine; Copeland, A; Lucas, Susan

2011-01-01

Rhodospirillum rubrum (Esmarch 1887) Molisch 1907 is the type species of the genus Rho- dospirillum, which is the type genus of the family Rhodospirillaceae in the class Alphaproteo- bacteria. The species is of special interest because it is an anoxygenic phototroph that pro- duces extracellular elemental sulfur (instead of oxygen) while harvesting light. It contains one of the most simple photosynthetic systems currently known, lacking light harvesting complex 2. Strain S1T can grow on carbon monoxide as sole energy source. With currently over 1,750 PubMed entries, R. rubrum is one of the most intensively studied microbial species, in partic- ularmore » for physiological and genetic studies. Next to R. centenum strain SW, the genome se- quence of strain S1T is only the second genome of a member of the genus Rhodospirillum to be published, but the first type strain genome from the genus. The 4,352,825 bp long chro- mosome and 53,732 bp plasmid with a total of 3,850 protein-coding and 83 RNA genes were sequenced as part of the DOE Joint Genome Institute Program DOEM 2002.« less

Evaluation of MRI sequences for quantitative T1 brain mapping

NASA Astrophysics Data System (ADS)

Tsialios, P.; Thrippleton, M.; Glatz, A.; Pernet, C.

2017-11-01

T1 mapping constitutes a quantitative MRI technique finding significant application in brain imaging. It allows evaluation of contrast uptake, blood perfusion, volume, providing a more specific biomarker of disease progression compared to conventional T1-weighted images. While there are many techniques for T1-mapping there is a wide range of reported T1-values in tissues, raising the issue of protocols reproducibility and standardization. The gold standard for obtaining T1-maps is based on acquiring IR-SE sequence. Widely used alternative sequences are IR-SE-EPI, VFA (DESPOT), DESPOT-HIFI and MP2RAGE that speed up scanning and fitting procedures. A custom MRI phantom was used to assess the reproducibility and accuracy of the different methods. All scans were performed using a 3T Siemens Prisma scanner. The acquired data processed using two different codes. The main difference was observed for VFA (DESPOT) which grossly overestimated T1 relaxation time by 214 ms [126 270] compared to the IR-SE sequence. MP2RAGE and DESPOT-HIFI sequences gave slightly shorter time than IR-SE (~20 to 30ms) and can be considered as alternative and time-efficient methods for acquiring accurate T1 maps of the human brain, while IR-SE-EPI gave identical result, at a cost of a lower image quality.

The T1R2/T1R3 sweet receptor and TRPM5 ion channel taste targets with therapeutic potential.

PubMed

Sprous, Dennis; Palmer, Kyle R

2010-01-01

Taste signaling is a critical determinant of ingestive behaviors and thereby linked to obesity and related metabolic dysfunctions. Recent evidence of taste signaling pathways in the gut suggests the link to be more direct, raising the possibility that taste receptor systems could be regarded as therapeutic targets. T1R2/T1R3, the G protein coupled receptor that mediates sweet taste, and the TRPM5 ion channel have been the focus of discovery programs seeking novel compounds that could be useful in modifying taste. We review in this chapter the hypothesis of gastrointestinal taste signaling and discuss the potential for T1R2/T1R3 and TRPM5 as targets of therapeutic intervention in obesity and diabetes. Critical to the development of a drug discovery program is the creation of libraries that enhance the likelihood of identifying novel compounds that modulate the target of interest. We advocate a computer-based chemoinformatic approach for assembling natural and synthetic compound libraries as well as for supporting optimization of structure activity relationships. Strategies for discovering modulators of T1R2/T1R3 and TRPM5 using methods of chemoinformatics are presented herein. Copyright 2010 Elsevier Inc. All rights reserved.

RISC RNA sequencing for context-specific identification of in vivo miR targets

PubMed Central

Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

2010-01-01

Rationale MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. Objective To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). Methods and Results We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias, and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1,645 mRNAs consistently targeted to mouse cardiac RISCs. We employed this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing ‘seed’ sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. Conclusions RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context, and is applicable to any tissue and any disease state. Summary MicroRNAs (miRs) are key regulators of mRNA translation in health and disease. While bioinformatic predictions suggest that a single miR may target hundreds of mRNAs, the number of experimentally verified targets of miRs is low. To enable comprehensive, unbiased examination of miR targets, we have performed deep RNA sequencing of cardiac transcriptomes in parallel with cardiac RNA-induced silencing complex

Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

PubMed

Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

2016-03-01

Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Genome sequence of the pink to light reddish-pigmented Rubellimicrobium mesophilum type strain (DSM 19309(T)), a representative of the Roseobacter group isolated from soil, and emended description of the species.

PubMed

Riedel, Thomas; Spring, Stefan; Fiebig, Anne; Petersen, Jörn; Göker, Markus; Klenk, Hans-Peter

2014-06-15

Rubellimicrobium mesophilum Dastager et al. 2008 is a mesophilic and light reddish-pigmented representative of the Roseobacter group within the alphaproteobacterial family Rhodobacteraceae. Representatives of the Roseobacter group play an important role in the marine biogeochemical cycles and were found in a broad variety of marine environments associated with algal blooms, different kinds of sediments, and surfaces of invertebrates and vertebrates. Roseobacters were shown to be widely distributed, especially within the total bacterial community found in coastal waters, as well as in mixed water layers of the open ocean. Here we describe the features of R. mesophilum strain MSL-20(T) together with its genome sequence and annotation generated from a culture of DSM 19309(T). The 4,927,676 bp genome sequence consists of one chromosome and probably one extrachromosomal element. It contains 5,082 protein-coding genes and 56 RNA genes. As previously reported, the G+C content is significantly different from the actual genome sequence-based G+C content and as the type strain tests positively for oxidase, the species description is emended accordingly. The genome was sequenced as part of the activities of the Transregional Collaborative Research Centre 51 (TRR51) funded by the German Research Foundation (DFG).

Microbial Culturomics Application for Global Health: Noncontiguous Finished Genome Sequence and Description of Pseudomonas massiliensis Strain CB-1T sp. nov. in Brazil.

PubMed

Bardet, Lucie; Cimmino, Teresa; Buffet, Clémence; Michelle, Caroline; Rathored, Jaishriram; Tandina, Fatalmoudou; Lagier, Jean-Christophe; Khelaifia, Saber; Abrahão, Jônatas; Raoult, Didier; Rolain, Jean-Marc

2018-02-01

Culturomics is a new postgenomics field that explores the microbial diversity of the human gut coupled with taxono-genomic strategy. Culturomics, and the microbiome science more generally, are anticipated to transform global health diagnostics and inform the ways in which gut microbial diversity contributes to human health and disease, and by extension, to personalized medicine. Using culturomics, we report in this study the description of strain CB1 T ( = CSUR P1334 = DSM 29075), a new species isolated from a stool specimen from a 37-year-old Brazilian woman. This description includes phenotypic characteristics and complete genome sequence and annotation. Strain CB1 T is a gram-negative aerobic and motile bacillus, exhibits neither catalase nor oxidase activities, and presents a 98.3% 16S rRNA sequence similarity with Pseudomonas putida. The 4,723,534 bp long genome contains 4239 protein-coding genes and 74 RNA genes, including 15 rRNA genes (5 16S rRNA, 4 23S rRNA, and 6 5S rRNA) and 59 tRNA genes. Strain CB1 T was named Pseudomonas massiliensis sp. nov. and classified into the family Pseudomonadaceae. This study demonstrates the usefulness of microbial culturomics in exploration of human microbiota in diverse geographies and offers new promise for incorporating new omics technologies for innovation in diagnostic medicine and global health.

Direct Measurement of T Cell Receptor Affinity and Sequence from Naïve Anti-Viral T Cells

PubMed Central

Zhang, Shuqi; Parker, Patricia; Ma, Keyue; He, Chenfeng; Shi, Qian; Cui, Zhonghao; Williams, Chad; Wendel, Ben S.; Meriwether, Amanda; Salazar, Mary A.; Jiang, Ning

2016-01-01

T cells recognize and kill a myriad of pathogen-infected or cancer cells using a diverse set of T cell receptors (TCR). The affinity of TCR to cognate antigen is of high interest in adoptive T cell transfer immunotherapy and antigen-specific T cell repertoire immune profiling because it is widely known to correlate with downstream T cell responses. Here, we introduce the in situ TCR affinity and sequence test (iTAST) for simultaneous measurement of TCR affinity and sequence from single primary CD8+ T cells in human blood. We demonstrate that the repertoire of primary antigen-specific T cells from pathogen inexperienced individuals has a surprisingly broad affinity range of 1000-fold composed of diverse TCR sequences. Within this range, samples from older individuals contained a reduced frequency of high affinity T cells compared to young individuals, demonstrating an age-related effect of T cell attrition that could cause holes in the repertoire. iTAST should enable the rapid selection of high affinity TCRs ex vivo for adoptive immunotherapy and measurement of T cell response for immune monitoring applications. PMID:27252176

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

PubMed

Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

2014-12-01

Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. Copyright © 2014 the American Physiological Society.

Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon

PubMed Central

Kendig, Derek M.; Hurst, Norman R.; Bradley, Zachary L.; Mahavadi, Sunila; Kuemmerle, John F.; Lyall, Vijay; DeSimone, John; Murthy, Karnam S.

2014-01-01

Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5′-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1−/− mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

Distinct Contributions of T1R2 and T1R3 Taste Receptor Subunits to the Detection of Sweet Stimuli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nie,Y.; Vigues, S.; Hobbs, J.

2005-01-01

The molecular mechanisms by which G protein-coupled receptor (GPCR)-type chemosensory receptors of animals selectively interact with their cognate ligands remain poorly understood. There is growing evidence that many chemosensory receptors exist in multimeric complexes, though little is known about the relative contributions of individual subunits to receptor functions. This study showed that each of the two subunits in the mammalian heteromeric T1R2:T1R3 sweet taste receptor binds sweet stimuli, though with distinct affinities and conformational changes. Furthermore, ligand affinities for T1R3 are drastically reduced by the introduction of a single amino acid change associated with decreased sweet taste sensitivity in mice.more » Thus, individual T1R subunits increase the receptive range of the sweet taste receptor, offering a functional mechanism for phenotypic variations in sweet taste.« less

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

NASA Technical Reports Server (NTRS)

Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

1995-01-01

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

Complete genome sequence of the Phaeobacter gallaeciensis type strain CIP 105210(T) (= DSM 26640(T) = BS107(T)).

PubMed

Frank, Oliver; Pradella, Silke; Rohde, Manfred; Scheuner, Carmen; Klenk, Hans-Peter; Göker, Markus; Petersen, Jörn

2014-06-15

Phaeobacter gallaeciensis CIP 105210(T) (= DSM 26640(T) = BS107(T)) is the type strain of the species Phaeobacter gallaeciensis. The genus Phaeobacter belongs to the marine Roseobacter group (Rhodobacteraceae, Alphaproteobacteria). Phaeobacter species are effective colonizers of marine surfaces, including frequent associations with eukaryotes. Strain BS107(T) was isolated from a rearing of the scallop Pecten maximus. Here we describe the features of this organism, together with the complete genome sequence, comprising eight circular replicons with a total of 4,448 genes. In addition to a high number of extrachromosomal replicons, the genome contains six genomic island and three putative prophage regions, as well as a hybrid between a plasmid and a circular phage. Phylogenomic analyses confirm previous results, which indicated that the originally reported P. gallaeciensis type-strain deposit DSM 17395 belongs to P. inhibens and that CIP 105210(T) (= DSM 26640(T)) is the sole genome-sequenced representative of P. gallaeciensis.

High-efficiency L-band T/R Module: Development Results

NASA Technical Reports Server (NTRS)

Edelstein, Wendy N.; Andricos, Constantine; Wang, Feiyu; Rutled, David B.

2005-01-01

Future interferometric synthetic aperture radar (InSAR) systems require electronically scanned phased-array antennas, where the transmit/receive (T/R) module is a key component. The T/R module efficiency is a critical figure of merit and has direct implications on the power dissipation and power generation requirements of the system. Significant improvements in the efficiency of the T/R module will make SAR missions more feasible and affordable. The results of two high-efficiency T/R modules are presented, each based on different power amplifier technologies. One module uses a 30W GaAs Class-AlB power amplifier and the second module uses a 70W LD-MOS Class-ElF power amplifier, where both modules use a common low power section. Each module operates over an 80MHz bandwidth at L-band (1.2GHz) with an overall module efficiency greater than 58%. We will present the results of these two T/R modules that have been designed, built and tested.

Tracking global changes induced in the CD4 T-cell receptor repertoire by immunization with a complex antigen using short stretches of CDR3 protein sequence.

PubMed

Thomas, Niclas; Best, Katharine; Cinelli, Mattia; Reich-Zeliger, Shlomit; Gal, Hilah; Shifrut, Eric; Madi, Asaf; Friedman, Nir; Shawe-Taylor, John; Chain, Benny

2014-11-15

The clonal theory of adaptive immunity proposes that immunological responses are encoded by increases in the frequency of lymphocytes carrying antigen-specific receptors. In this study, we measure the frequency of different T-cell receptors (TcR) in CD4 + T cell populations of mice immunized with a complex antigen, killed Mycobacterium tuberculosis, using high throughput parallel sequencing of the TcRβ chain. Our initial hypothesis that immunization would induce repertoire convergence proved to be incorrect, and therefore an alternative approach was developed that allows accurate stratification of TcR repertoires and provides novel insights into the nature of CD4 + T-cell receptor recognition. To track the changes induced by immunization within this heterogeneous repertoire, the sequence data were classified by counting the frequency of different clusters of short (3 or 4) continuous stretches of amino acids within the antigen binding complementarity determining region 3 (CDR3) repertoire of different mice. Both unsupervised (hierarchical clustering) and supervised (support vector machine) analyses of these different distributions of sequence clusters differentiated between immunized and unimmunized mice with 100% efficiency. The CD4 + TcR repertoires of mice 5 and 14 days postimmunization were clearly different from that of unimmunized mice but were not distinguishable from each other. However, the repertoires of mice 60 days postimmunization were distinct both from naive mice and the day 5/14 animals. Our results reinforce the remarkable diversity of the TcR repertoire, resulting in many diverse private TcRs contributing to the T-cell response even in genetically identical mice responding to the same antigen. However, specific motifs defined by short stretches of amino acids within the CDR3 region may determine TcR specificity and define a new approach to TcR sequence classification. The analysis was implemented in R and Python, and source code can be found in

Taste responses in mice lacking taste receptor subunit T1R1

PubMed Central

Kusuhara, Yoko; Yoshida, Ryusuke; Ohkuri, Tadahiro; Yasumatsu, Keiko; Voigt, Anja; Hübner, Sandra; Maeda, Katsumasa; Boehm, Ulrich; Meyerhof, Wolfgang; Ninomiya, Yuzo

2013-01-01

The T1R1 receptor subunit acts as an umami taste receptor in combination with its partner, T1R3. In addition, metabotropic glutamate receptors (brain and taste variants of mGluR1 and mGluR4) are thought to function as umami taste receptors. To elucidate the function of T1R1 and the contribution of mGluRs to umami taste detection in vivo, we used newly developed knock-out (T1R1−/−) mice, which lack the entire coding region of the Tas1r1 gene and express mCherry in T1R1-expressing cells. Gustatory nerve recordings demonstrated that T1R1−/− mice exhibited a serious deficit in inosine monophosphate-elicited synergy but substantial residual responses to glutamate alone in both chorda tympani and glossopharyngeal nerves. Interestingly, chorda tympani nerve responses to sweeteners were smaller in T1R1−/− mice. Taste cell recordings demonstrated that many mCherry-expressing taste cells in T1R1+/− mice responded to sweet and umami compounds, whereas those in T1R1−/− mice responded to sweet stimuli. The proportion of sweet-responsive cells was smaller in T1R1−/− than in T1R1+/− mice. Single-cell RT-PCR demonstrated that some single mCherry-expressing cells expressed all three T1R subunits. Chorda tympani and glossopharyngeal nerve responses to glutamate were significantly inhibited by addition of mGluR antagonists in both T1R1−/− and T1R1+/− mice. Conditioned taste aversion tests demonstrated that both T1R1−/− and T1R1+/− mice were equally capable of discriminating glutamate from other basic taste stimuli. Avoidance conditioned to glutamate was significantly reduced by addition of mGluR antagonists. These results suggest that T1R1-expressing cells mainly contribute to umami taste synergism and partly to sweet sensitivity and that mGluRs are involved in the detection of umami compounds. PMID:23339178

Conifer R2R3-MYB transcription factors: sequence analyses and gene expression in wood-forming tissues of white spruce (Picea glauca)

PubMed Central

Bedon, Frank; Grima-Pettenati, Jacqueline; Mackay, John

2007-01-01

Background Several members of the R2R3-MYB family of transcription factors act as regulators of lignin and phenylpropanoid metabolism during wood formation in angiosperm and gymnosperm plants. The angiosperm Arabidopsis has over one hundred R2R3-MYBs genes; however, only a few members of this family have been discovered in gymnosperms. Results We isolated and characterised full-length cDNAs encoding R2R3-MYB genes from the gymnosperms white spruce, Picea glauca (13 sequences), and loblolly pine, Pinus taeda L. (five sequences). Sequence similarities and phylogenetic analyses placed the spruce and pine sequences in diverse subgroups of the large R2R3-MYB family, although several of the sequences clustered closely together. We searched the highly variable C-terminal region of diverse plant MYBs for conserved amino acid sequences and identified 20 motifs in the spruce MYBs, nine of which have not previously been reported and three of which are specific to conifers. The number and length of the introns in spruce MYB genes varied significantly, but their positions were well conserved relative to angiosperm MYB genes. Quantitative RTPCR of MYB genes transcript abundance in root and stem tissues revealed diverse expression patterns; three MYB genes were preferentially expressed in secondary xylem, whereas others were preferentially expressed in phloem or were ubiquitous. The MYB genes expressed in xylem, and three others, were up-regulated in the compression wood of leaning trees within 76 hours of induction. Conclusion Our survey of 18 conifer R2R3-MYB genes clearly showed a gene family structure similar to that of Arabidopsis. Three of the sequences are likely to play a role in lignin metabolism and/or wood formation in gymnosperm trees, including a close homolog of the loblolly pine PtMYB4, shown to regulate lignin biosynthesis in transgenic tobacco. PMID:17397551

RGC-32 is a novel regulator of the T-lymphocyte cell cycle.

PubMed

Tegla, Cosmin A; Cudrici, Cornelia D; Nguyen, Vinh; Danoff, Jacob; Kruszewski, Adam M; Boodhoo, Dallas; Mekala, Armugam P; Vlaicu, Sonia I; Chen, Ching; Rus, Violeta; Badea, Tudor C; Rus, Horea

2015-06-01

We have previously shown that RGC-32 is involved in cell cycle regulation in vitro. To define the in vivo role of RGC-32, we generated RGC-32 knockout mice. These mice developed normally and did not spontaneously develop overt tumors. To assess the effect of RGC-32 deficiency on cell cycle activation in T cells, we determined the proliferative rates of CD4(+) and CD8(+) T cells from the spleens of RGC-32(-/-) mice, as compared to wild-type (WT, RGC-32(+/+)) control mice. After stimulation with anti-CD3/anti-CD28, CD4(+) T cells from RGC-32(-/-) mice displayed a significant increase in [(3)H]-thymidine incorporation when compared to WT mice. In addition, both CD4(+) and CD8(+) T cells from RGC-32(-/-) mice displayed a significant increase in the proportion of proliferating Ki67(+) cells, indicating that in T cells, RGC-32 has an inhibitory effect on cell cycle activation induced by T-cell receptor/CD28 engagement. Furthermore, Akt and FOXO1 phosphorylation induced in stimulated CD4(+) T-cells from RGC-32(-/-) mice were significantly higher, indicating that RGC-32 inhibits cell cycle activation by suppressing FOXO1 activation. We also found that IL-2 mRNA and protein expression were significantly increased in RGC-32(-/-) CD4(+) T cells when compared to RGC-32(+/+) CD4(+) T cells. In addition, the effect of RGC-32 on the cell cycle and IL-2 expression was inhibited by pretreatment of the samples with LY294002, indicating a role for phosphatidylinositol 3-kinase (PI3K). Thus, RGC-32 is involved in controlling the cell cycle of T cells in vivo, and this effect is mediated by IL-2 in a PI3K-dependent fashion. Copyright © 2015 Elsevier Inc. All rights reserved.

Taste information derived from T1R-expressing taste cells in mice.

PubMed

Yoshida, Ryusuke; Ninomiya, Yuzo

2016-03-01

The taste system of animals is used to detect valuable nutrients and harmful compounds in foods. In humans and mice, sweet, bitter, salty, sour and umami tastes are considered the five basic taste qualities. Sweet and umami tastes are mediated by G-protein-coupled receptors, belonging to the T1R (taste receptor type 1) family. This family consists of three members (T1R1, T1R2 and T1R3). They function as sweet or umami taste receptors by forming heterodimeric complexes, T1R1+T1R3 (umami) or T1R2+T1R3 (sweet). Receptors for each of the basic tastes are thought to be expressed exclusively in taste bud cells. Sweet (T1R2+T1R3-expressing) taste cells were thought to be segregated from umami (T1R1+T1R3-expressing) taste cells in taste buds. However, recent studies have revealed that a significant portion of taste cells in mice expressed all T1R subunits and responded to both sweet and umami compounds. This suggests that sweet and umami taste cells may not be segregated. Mice are able to discriminate between sweet and umami tastes, and both tastes contribute to behavioural preferences for sweet or umami compounds. There is growing evidence that T1R3 is also involved in behavioural avoidance of calcium tastes in mice, which implies that there may be a further population of T1R-expressing taste cells that mediate aversion to calcium taste. Therefore the simple view of detection and segregation of sweet and umami tastes by T1R-expressing taste cells, in mice, is now open to re-examination. © 2016 Authors; published by Portland Press Limited.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

RNA versatility governs tRNA function: Why tRNA flexibility is essential beyond the translation cycle.

PubMed

Kuhn, Claus-D

2016-05-01

tRNAs undergo multiple conformational changes during the translation cycle that are required for tRNA translocation and proper communication between the ribosome and translation factors. Recent structural data on how destabilized tRNAs utilize the CCA-adding enzyme to proofread themselves put a spotlight on tRNA flexibility beyond the translation cycle. In analogy to tRNA surveillance, this review finds that other processes also exploit versatile tRNA folding to achieve, amongst others, specific aminoacylation, translational regulation by riboswitches or a block of bacterial translation. tRNA flexibility is thereby not restricted to the hinges utilized during translation. In contrast, the flexibility of tRNA is distributed all over its L-shape and is actively exploited by the tRNA-interacting partners to discriminate one tRNA from another. Since the majority of tRNA modifications also modulate tRNA flexibility it seems that cells devote enormous resources to tightly sense and regulate tRNA structure. This is likely required for error-free protein synthesis. © 2016 WILEY Periodicals, Inc.

Draft genome sequence of Bradyrhizobium paxllaeri LMTR 21T isolated from Lima bean (Phaseolus lunatus) in Peru.

PubMed

Ormeño-Orrillo, Ernesto; Rey, Luis; Durán, David; Canchaya, Carlos A; Rogel, Marco A; Zúñiga-Dávila, Doris; Imperial, Juan; Ruiz-Argüeso, Tomás; Martínez-Romero, Esperanza

2017-09-01

Bradyrhizobium paxllaeri is a prevalent species in root nodules of the Lima bean ( Phaseolus lunatus ) in Peru. LMTR 21 T is the type strain of the species and was isolated from a root nodule collected in an agricultural field in the Peruvian central coast. Its 8.29 Mbp genome encoded 7635 CDS, 71 tRNAs and 3 rRNAs genes. All genes required to stablish a nitrogen-fixing symbiosis with its host were present. The draft genome sequence and annotation have been deposited at GenBank under the accession number MAXB00000000.

Impact of sequencing depth and read length on single cell RNA sequencing data of T cells.

PubMed

Rizzetto, Simone; Eltahla, Auda A; Lin, Peijie; Bull, Rowena; Lloyd, Andrew R; Ho, Joshua W K; Venturi, Vanessa; Luciani, Fabio

2017-10-06

Single cell RNA sequencing (scRNA-seq) provides great potential in measuring the gene expression profiles of heterogeneous cell populations. In immunology, scRNA-seq allowed the characterisation of transcript sequence diversity of functionally relevant T cell subsets, and the identification of the full length T cell receptor (TCRαβ), which defines the specificity against cognate antigens. Several factors, e.g. RNA library capture, cell quality, and sequencing output affect the quality of scRNA-seq data. We studied the effects of read length and sequencing depth on the quality of gene expression profiles, cell type identification, and TCRαβ reconstruction, utilising 1,305 single cells from 8 publically available scRNA-seq datasets, and simulation-based analyses. Gene expression was characterised by an increased number of unique genes identified with short read lengths (<50 bp), but these featured higher technical variability compared to profiles from longer reads. Successful TCRαβ reconstruction was achieved for 6 datasets (81% - 100%) with at least 0.25 millions (PE) reads of length >50 bp, while it failed for datasets with <30 bp reads. Sufficient read length and sequencing depth can control technical noise to enable accurate identification of TCRαβ and gene expression profiles from scRNA-seq data of T cells.

Image quality assessment of silent T2 PROPELLER sequence for brain imaging in infants.

PubMed

Kim, Hyun Gi; Choi, Jin Wook; Yoon, Soo Han; Lee, Sieun

2018-02-01

Infants are vulnerable to high acoustic noise. Acoustic noise generated by MR scanning can be reduced by a silent sequence. The purpose of this study is to compare the image quality of the conventional and silent T2 PROPELLER sequences for brain imaging in infants. A total of 36 scans were acquired from 24 infants using a 3 T MR scanner. Each patient underwent both conventional and silent T2 PROPELLER sequences. Acoustic noise level was measured. Quantitative and qualitative assessments were performed with the images taken with each sequence. The sound pressure level of the conventional T2 PROPELLER imaging sequence was 92.1 dB and that of the silent T2 PROPELLER imaging sequence was 73.3 dB (reduction of 20%). On quantitative assessment, the two sequences (conventional vs silent T2 PROPELLER) did not show significant difference in relative contrast (0.069 vs 0.068, p value = 0.536) and signal-to-noise ratio (75.4 vs 114.8, p value = 0.098). Qualitative assessment of overall image quality (p value = 0.572), grey-white differentiation (p value = 0.986), shunt-related artefact (p value > 0.999), motion artefact (p value = 0.801) and myelination degree in different brain regions (p values ≥ 0.092) did not show significant difference between the two sequences. The silent T2 PROPELLER sequence reduces acoustic noise and generated comparable image quality to that of the conventional sequence. Advances in knowledge: This is the first report to compare silent T2 PROPELLER images with that of conventional T2 PROPELLER images in children.

The evolution processes of DNA sequences, languages and carols

NASA Astrophysics Data System (ADS)

Hauck, Jürgen; Henkel, Dorothea; Mika, Klaus

2001-04-01

The sequences of bases A, T, C and G of about 100 enolase, secA and cytochrome DNA were analyzed for attractive or repulsive interactions by the numbers T 1,T 2,T 3; r of nearest, next-nearest and third neighbor bases of the same kind and the concentration r=other bases/analyzed base. The area of possible T1, T2 values is limited by the linear borders T 2=2T 1-2, T 2=0 or T1=0 for clustering, attractive or repulsive interactions and the border T2=-2 T1+2(2- r) for a variation from repulsive to attractive interactions at r⩽2. Clustering is preferred by most bases in sequences of enolases and secA’ s. Major deviations with repulsive interactions of some bases are observed for archaea bacteria in secA and for highly developed animals and the human species in enolase sequences. The borders of the structure map for enthalpy stabilized structures with maximum interactions are approached in few cases. Most letters of the natural languages and some music notes are at the borders of the structure map.

Study of stellar structures in f(R,T) gravity

NASA Astrophysics Data System (ADS)

Sharif, M.; Siddiqa, Aisha

This paper is devoted to study the compact objects whose pressure and density are related through polytropic equation-of-state (EoS) and MIT bag model (for quark stars) in the background of f(R,T) gravity. We solve the field equations together with the hydrostatic equilibrium equation numerically for the model f(R,T) = R + αR2 + λT and discuss physical properties of the resulting solution. It is observed that for both types of stars (polytropic and quark stars), the effects of model parameters α and λ remain the same. We also obtain that the energy conditions are satisfied and stellar configurations are stable for both EoS.

Bouncing cosmological solutions from f(R,T) gravity

NASA Astrophysics Data System (ADS)

Shabani, Hamid; Ziaie, Amir Hadi

2018-05-01

In this work we study classical bouncing solutions in the context of f(R,T)=R+h(T) gravity in a flat FLRW background using a perfect fluid as the only matter content. Our investigation is based on introducing an effective fluid through defining effective energy density and pressure; we call this reformulation as the " effective picture". These definitions have been already introduced to study the energy conditions in f(R,T) gravity. We examine various models to which different effective equations of state, corresponding to different h(T) functions, can be attributed. It is also discussed that one can link between an assumed f(R,T) model in the effective picture and the theories with generalized equation of state ( EoS). We obtain cosmological scenarios exhibiting a nonsingular bounce before and after which the Universe lives within a de-Sitter phase. We then proceed to find general solutions for matter bounce and investigate their properties. We show that the properties of bouncing solution in the effective picture of f(R,T) gravity are as follows: for a specific form of the f(R,T) function, these solutions are without any future singularities. Moreover, stability analysis of the nonsingular solutions through matter density perturbations revealed that except two of the models, the parameters of scalar-type perturbations for the other ones have a slight transient fluctuation around the bounce point and damp to zero or a finite value at late times. Hence these bouncing solutions are stable against scalar-type perturbations. It is possible that all energy conditions be respected by the real perfect fluid, however, the null and the strong energy conditions can be violated by the effective fluid near the bounce event. These solutions always correspond to a maximum in the real matter energy density and a vanishing minimum in the effective density. The effective pressure varies between negative values and may show either a minimum or a maximum.

Draft Genome Sequence of Vibrio mimicus Strain CAIM 602T

PubMed Central

Guardiola-Avila, Iliana; Acedo-Felix, Evelia; Yepiz-Plascencia, Gloria; Sifuentes-Romero, Itzel

2013-01-01

Vibrio mimicus is a Gram-negative bacterium associated with gastrointestinal diseases in humans around the world. We report the complete genome sequence of the Vibrio mimicus strain CAIM 602T (CDC1721-77, LMG 7896T, ATCC 33653T). PMID:23516211

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

From small sweeteners to sweet proteins: anatomy of the binding sites of the human T1R2_T1R3 receptor.

PubMed

Morini, Gabriella; Bassoli, Angela; Temussi, Piero A

2005-08-25

The sweet taste receptor, a heterodimeric G protein coupled receptor (GPCR) protein, formed by the T1R2 and T1R3 subunits, recognizes several sweet compounds including carbohydrates, amino acids, peptides, proteins, and synthetic sweeteners. Its similarity with the metabotropic glutamate mGluR1 receptor allowed us to build homology models. All possible dimers formed by combinations of the human T1R2 and T1R3 subunits, modeled on the A (closed) or B (open) chains of the extracellular ligand binding domain of the mGluR1 template, yield four ligand binding sites for low-molecular-weight sweeteners. These sites were probed by docking a set of molecules representative of all classes of sweet compounds and calculating the free energy of ligand binding. These sites are not easily accessible to sweet proteins, but docking experiments in silico showed that sweet proteins can bind to a secondary site without entering the deep cleft. Our models account for many experimental observations on the tastes of sweeteners, including sweetness synergy, and can help to design new sweeteners.

Complete genome sequence of the fish pathogen Flavobacterium psychrophilum ATCC 49418(T.).

PubMed

Wu, Anson Kk; Kropinski, Andrew M; Lumsden, John S; Dixon, Brian; MacInnes, Janet I

2015-01-01

Flavobacterium psychrophilum is the causative agent of bacterial cold water disease and rainbow trout fry mortality syndrome in salmonid fishes and is associated with significant losses in the aquaculture industry. The virulence factors and molecular mechanisms of pathogenesis of F. psychrophilum are poorly understood. Moreover, at the present time, there are no effective vaccines and control using antimicrobial agents is problematic due to growing antimicrobial resistance and the fact that sick fish don't eat. In the hopes of identifying vaccine and therapeutic targets, we sequenced the genome of the type strain ATCC 49418 which was isolated from the kidney of a Coho salmon (Oncorhychus kisutch) in Washington State (U.S.A.) in 1989. The genome is 2,715,909 bp with a G+C content of 32.75%. It contains 6 rRNA operons, 49 tRNA genes, and is predicted to encode 2,329 proteins.

Complete genome sequence of the fish pathogen Flavobacterium psychrophilum ATCC 49418T

PubMed Central

2015-01-01

Flavobacterium psychrophilum is the causative agent of bacterial cold water disease and rainbow trout fry mortality syndrome in salmonid fishes and is associated with significant losses in the aquaculture industry. The virulence factors and molecular mechanisms of pathogenesis of F. psychrophilum are poorly understood. Moreover, at the present time, there are no effective vaccines and control using antimicrobial agents is problematic due to growing antimicrobial resistance and the fact that sick fish don’t eat. In the hopes of identifying vaccine and therapeutic targets, we sequenced the genome of the type strain ATCC 49418 which was isolated from the kidney of a Coho salmon (Oncorhychus kisutch) in Washington State (U.S.A.) in 1989. The genome is 2,715,909 bp with a G+C content of 32.75%. It contains 6 rRNA operons, 49 tRNA genes, and is predicted to encode 2,329 proteins. PMID:25685258

Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

PubMed Central

Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony

2015-01-01

Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.

PubMed

Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony

2015-09-01

Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. Copyright © 2015 the American Physiological Society.

Automated two-point dixon screening for the evaluation of hepatic steatosis and siderosis: comparison with R2-relaxometry and chemical shift-based sequences.

PubMed

Henninger, B; Zoller, H; Rauch, S; Schocke, M; Kannengiesser, S; Zhong, X; Reiter, G; Jaschke, W; Kremser, C

2015-05-01

To evaluate the automated two-point Dixon screening sequence for the detection and estimated quantification of hepatic iron and fat compared with standard sequences as a reference. One hundred and two patients with suspected diffuse liver disease were included in this prospective study. The following MRI protocol was used: 3D-T1-weighted opposed- and in-phase gradient echo with two-point Dixon reconstruction and dual-ratio signal discrimination algorithm ("screening" sequence); fat-saturated, multi-gradient-echo sequence with 12 echoes; gradient-echo T1 FLASH opposed- and in-phase. Bland-Altman plots were generated and correlation coefficients were calculated to compare the sequences. The screening sequence diagnosed fat in 33, iron in 35 and a combination of both in 4 patients. Correlation between R2* values of the screening sequence and the standard relaxometry was excellent (r = 0.988). A slightly lower correlation (r = 0.978) was found between the fat fraction of the screening sequence and the standard sequence. Bland-Altman revealed systematically lower R2* values obtained from the screening sequence and higher fat fraction values obtained with the standard sequence with a rather high variability in agreement. The screening sequence is a promising method with fast diagnosis of the predominant liver disease. It is capable of estimating the amount of hepatic fat and iron comparable to standard methods. • MRI plays a major role in the clarification of diffuse liver disease. • The screening sequence was introduced for the assessment of diffuse liver disease. • It is a fast and automated algorithm for the evaluation of hepatic iron and fat. • It is capable of estimating the amount of hepatic fat and iron.

Single-Cell Genome and Group-Specific dsrAB Sequencing Implicate Marine Members of the Class Dehalococcoidia (Phylum Chloroflexi) in Sulfur Cycling

PubMed Central

Cooper, Myriel; Schreiber, Lars; Lloyd, Karen G.; Baker, Brett J.; Petersen, Dorthe G.; Jørgensen, Bo Barker; Stepanauskas, Ramunas; Reinhardt, Richard; Schramm, Andreas; Loy, Alexander; Adrian, Lorenz

2016-01-01

ABSTRACT The marine subsurface sediment biosphere is widely inhabited by bacteria affiliated with the class Dehalococcoidia (DEH), phylum Chloroflexi, and yet little is known regarding their metabolisms. In this report, genomic content from a single DEH cell (DEH-C11) with a 16S rRNA gene that was affiliated with a diverse cluster of 16S rRNA gene sequences prevalent in marine sediments was obtained from sediments of Aarhus Bay, Denmark. The distinctive gene content of this cell suggests metabolic characteristics that differ from those of known DEH and Chloroflexi. The presence of genes encoding dissimilatory sulfite reductase (Dsr) suggests that DEH could respire oxidized sulfur compounds, although Chloroflexi have never been implicated in this mode of sulfur cycling. Using long-range PCR assays targeting DEH dsr loci, dsrAB genes were amplified and sequenced from various marine sediments. Many of the amplified dsrAB sequences were affiliated with the DEH Dsr clade, which we propose equates to a family-level clade. This provides supporting evidence for the potential for sulfite reduction by diverse DEH species. DEH-C11 also harbored genes encoding reductases for arsenate, dimethyl sulfoxide, and halogenated organics. The reductive dehalogenase homolog (RdhA) forms a monophyletic clade along with RdhA sequences from various DEH-derived contigs retrieved from available metagenomes. Multiple facts indicate that this RdhA may not be a terminal reductase. The presence of other genes indicated that nutrients and energy may be derived from the oxidation of substituted homocyclic and heterocyclic aromatic compounds. Together, these results suggest that marine DEH play a previously unrecognized role in sulfur cycling and reveal the potential for expanded catabolic and respiratory functions among subsurface DEH. PMID:27143384

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

PubMed

Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

2015-01-01

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

Sequence conservation predicts T cell reactivity against ragweed allergens.

PubMed

Pham, J; Oseroff, C; Hinz, D; Sidney, J; Paul, S; Greenbaum, J; Vita, R; Phillips, E; Mallal, S; Peters, B; Sette, A

2016-09-01

Ragweed is a major cause of seasonal allergy, affecting millions of people worldwide. Several allergens have been defined based on IgE reactivity, but their relative immunogenicity in terms of T cell responses has not been studied. We comprehensively characterized T cell responses from atopic, ragweed-allergic subjects to Amb a 1, Amb a 3, Amb a 4, Amb a 5, Amb a 6, Amb a 8, Amb a 9, Amb a 10, Amb a 11, and Amb p 5 and examined their correlation with serological reactivity and sequence conservation in other allergens. Peripheral blood mononuclear cells (PBMCs) from donors positive for IgE towards ragweed extracts after in vitro expansion for secretion of IL-5 (a representative Th2 cytokine) and IFN-γ (Th1) in response to a panel of overlapping peptides spanning the above-listed allergens were assessed. Three previously identified dominant T cell epitopes (Amb a 1 176-191, 200-215, and 344-359) were confirmed, and three novel dominant epitopes (Amb a 1 280-295, 304-319, and 320-335) were identified. Amb a 1, the dominant IgE allergen, was also the dominant T cell allergen, but dominance patterns for T cell and IgE responses for the other ragweed allergens did not correlate. Dominance for T cell responses correlated with conservation of ragweed epitopes with sequences of other well-known allergens. These results provide the first assessment of the hierarchy of T cell reactivity in ragweed allergens, which is distinct from that observed for IgE reactivity and influenced by T cell epitope sequence conservation. The results suggest that ragweed allergens associated with lesser IgE reactivity and significant T cell reactivity may be targeted for T cell immunotherapy, and further support the development of immunotherapies against epitopes conserved across species to generate broad reactivity against many common allergens. © 2016 John Wiley & Sons Ltd.

Sequence Characterization of the MC1R Gene in Yak (Poephagus grunniens) Breeds with Different Coat Colors

PubMed Central

Chen, Shi-Yi; Huang, Yi; Zhu, Qing; Fontanesi, Luca; Yao, Yong-Gang; Liu, Yi-Ping

2009-01-01

Melanocortin 1 receptor (MC1R) gene plays a key role in determining coat color in several species, including the cattle. However, up to now there is no report regarding the MC1R gene and the potential association of its mutations with coat colors in yak (Poephagus grunniens). In this study, we sequenced the encoding region of the MC1R gene in three yak breeds with completely white (Tianzhu breed) or black coat color (Jiulong and Maiwa breeds). The predicted coding region of the yak MC1R gene resulted of 954 bp, the same to that of the wild-type cattle sequence, with >99% identity. None of the mutation events reported in cattle was found. Comparing the yak obtained sequences, five nucleotide substitutions were detected, which defined three haplotypes (EY1, EY2, and EY3). Of the five mutations, two, characterizing the EY1 haplotype, were nonsynonymous substitutions (c.340C>A and c.871G>A) causing amino acid changes located in the first extracellular loop (p.Q114K) and in the seventh transmembrane region (p.A291T). In silico prediction might indicate a functional effect of the latter substitution. However, all three haplotypes were present in the three yak breeds with relatively consistent frequency distribution, despite of their distinguished coat colors, which suggested that there was no across-breed association between haplotypes or genotypes and black/white phenotypes, at least in the investigated breeds. Other genes may be involved in affecting coat color in the analyzed yaks. PMID:19584942

Contrast-enhanced Magnetic Resonance Imaging of Pelvic Bone Metastases at 3.0 T: Comparison Between 3-dimensional T1-weighted CAIPIRINHA-VIBE Sequence and 2-dimensional T1-weighted Turbo Spin-Echo Sequence.

PubMed

Yoon, Min A; Hong, Suk-Joo; Lee, Kyu-Chong; Lee, Chang Hee

2018-06-12

This study aimed to compare 3-dimensional T1-weighted gradient-echo sequence (CAIPIRINHA-volumetric interpolated breath-hold examination [VIBE]) with 2-dimensional T1-weighted turbo spin-echo sequence for contrast-enhanced magnetic resonance imaging (MRI) of pelvic bone metastases at 3.0 T. Thirty-one contrast-enhanced MRIs of pelvic bone metastases were included. Two contrast-enhanced sequences were evaluated for the following parameters: overall image quality, sharpness of pelvic bone, iliac vessel clarity, artifact severity, and conspicuity and edge sharpness of the smallest metastases. Quantitative analysis was performed by calculating signal-to-noise ratio and contrast-to-noise ratio of the smallest metastases. Significant differences between the 2 sequences were assessed. CAIPIRINHA-VIBE had higher scores for overall image quality, pelvic bone sharpness, iliac vessel clarity, and edge sharpness of the metastatic lesions, and had less artifacts (all P < 0.05). There was no significant difference in conspicuity, signal-to-noise ratio, or contrast-to-noise ratio of the smallest metastases (P > 0.05). Our results suggest that CAIPIRINHA-VIBE may be superior to turbo spin-echo for contrast-enhanced MRI of pelvic bone metastases at 3.0 T.

Static spherical wormhole models in f (R, T) gravity

NASA Astrophysics Data System (ADS)

Yousaf, Z.; Ilyas, M.; Zaeem-ul-Haq Bhatti, M.

2017-06-01

This paper explores the possibility of the existence of wormhole geometries coupled with relativistic matter configurations by taking a particular model of f(R,T) gravity (where T is the trace of energy-momentum tensor). For this purpose, we take the static form of spherically symmetric spacetime and after assuming a specific form of matter and combinations of shape function, the validity of energy conditions is checked. We have discussed our results through graphical representation and studied the equilibrium background of wormhole models by taking an anisotropic fluid. The extra curvature quantities coming from f(R,T) gravity could be interpreted as a gravitational entity supporting these non-standard astrophysical wormhole models. We have shown that in the context of anisotropic fluid and R+α R^2+λ T gravity, wormhole models could possibly exist in few zones in the space of parameters without the need for exotic matter.

Prospective Environmental Life Cycle Assessment of Nanosilver T-Shirts

PubMed Central

2011-01-01

A cradle-to-grave life cycle assessment (LCA) is performed to compare nanosilver T-shirts with conventional T-shirts with and without biocidal treatment. For nanosilver production and textile incorporation, we investigate two processes: flame spray pyrolysis (FSP) and plasma polymerization with silver co-sputtering (PlaSpu). Prospective environmental impacts due to increased nanosilver T-shirt commercialization are estimated with six scenarios. Results show significant differences in environmental burdens between nanoparticle production technologies: The “cradle-to-gate” climate footprint of the production of a nanosilver T-shirt is 2.70 kg of CO2-equiv (FSP) and 7.67–166 kg of CO2-equiv (PlaSpu, varying maturity stages). Production of conventional T-shirts with and without the biocide triclosan has emissions of 2.55 kg of CO2-equiv (contribution from triclosan insignificant). Consumer behavior considerably affects the environmental impacts during the use phase. Lower washing frequencies can compensate for the increased climate footprint of FSP nanosilver T-shirt production. The toxic releases from washing and disposal in the life cycle of T-shirts appear to be of minor relevance. By contrast, the production phase may be rather significant due to toxic silver emissions at the mining site if high silver quantities are required. PMID:21506582

Prospective environmental life cycle assessment of nanosilver T-shirts.

PubMed

Walser, Tobias; Demou, Evangelia; Lang, Daniel J; Hellweg, Stefanie

2011-05-15

A cradle-to-grave life cycle assessment (LCA) is performed to compare nanosilver T-shirts with conventional T-shirts with and without biocidal treatment. For nanosilver production and textile incorporation, we investigate two processes: flame spray pyrolysis (FSP) and plasma polymerization with silver co-sputtering (PlaSpu). Prospective environmental impacts due to increased nanosilver T-shirt commercialization are estimated with six scenarios. Results show significant differences in environmental burdens between nanoparticle production technologies: The "cradle-to-gate" climate footprint of the production of a nanosilver T-shirt is 2.70 kg of CO(2)-equiv (FSP) and 7.67-166 kg of CO(2)-equiv (PlaSpu, varying maturity stages). Production of conventional T-shirts with and without the biocide triclosan has emissions of 2.55 kg of CO(2)-equiv (contribution from triclosan insignificant). Consumer behavior considerably affects the environmental impacts during the use phase. Lower washing frequencies can compensate for the increased climate footprint of FSP nanosilver T-shirt production. The toxic releases from washing and disposal in the life cycle of T-shirts appear to be of minor relevance. By contrast, the production phase may be rather significant due to toxic silver emissions at the mining site if high silver quantities are required.

High-throughput analysis of T-DNA location and structure using sequence capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

High-throughput analysis of T-DNA location and structure using sequence capture

DOE PAGES

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

2015-10-07

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

The effects of stacking sequence and thermal cycling on the flexural properties of laminate composites of aluminium-epoxy/basalt-glass fibres

NASA Astrophysics Data System (ADS)

Abdollahi Azghan, Mehdi; Eslami-Farsani, Reza

2018-02-01

The current study aimed at investigating the effects of different stacking sequences and thermal cycling on the flexural properties of fibre metal laminates (FMLs). FMLs were composed of two aluminium alloy 2024-T3 sheets and epoxy polymer-matrix composites that have four layers of basalt and/or glass fibres with five different stacking sequences. For FML samples the thermal cycle time was about 6 min for temperature cycles from 25 °C to 115 °C. Flexural properties of samples evaluated after 55 thermal cycles and compared to non-exposed samples. Surface modification of aluminium performed by electrochemical treatment (anodizing) method and aluminium surfaces have been examined by scanning electron microscopy (SEM). Also, the flexural failure mechanisms investigated by the optical microscope study of fractured surfaces. SEM images indicated that the porosity of the aluminium surface increased after anodizing process. The findings of the present study showed that flexural modulus were maximum for basalt fibres based FML, minimum for glass fibres based FML while basalt/glass fibres based FML lies between them. Due to change in the failure mechanism of basalt/glass fibres based FMLs that have glass fibres at outer layer of the polymer composite, the flexural strength of this FML is lower than glass and basalt fibres based FML. After thermal cycling, due to the good thermal properties of basalt fibres, flexural properties of basalt fibres based FML structures decreased less than other composites.

VisRseq: R-based visual framework for analysis of sequencing data

PubMed Central

2015-01-01

Background Several tools have been developed to enable biologists to perform initial browsing and exploration of sequencing data. However the computational tool set for further analyses often requires significant computational expertise to use and many of the biologists with the knowledge needed to interpret these data must rely on programming experts. Results We present VisRseq, a framework for analysis of sequencing datasets that provides a computationally rich and accessible framework for integrative and interactive analyses without requiring programming expertise. We achieve this aim by providing R apps, which offer a semi-auto generated and unified graphical user interface for computational packages in R and repositories such as Bioconductor. To address the interactivity limitation inherent in R libraries, our framework includes several native apps that provide exploration and brushing operations as well as an integrated genome browser. The apps can be chained together to create more powerful analysis workflows. Conclusions To validate the usability of VisRseq for analysis of sequencing data, we present two case studies performed by our collaborators and report their workflow and insights. PMID:26328469

VisRseq: R-based visual framework for analysis of sequencing data.

PubMed

Younesy, Hamid; Möller, Torsten; Lorincz, Matthew C; Karimi, Mohammad M; Jones, Steven J M

2015-01-01

Several tools have been developed to enable biologists to perform initial browsing and exploration of sequencing data. However the computational tool set for further analyses often requires significant computational expertise to use and many of the biologists with the knowledge needed to interpret these data must rely on programming experts. We present VisRseq, a framework for analysis of sequencing datasets that provides a computationally rich and accessible framework for integrative and interactive analyses without requiring programming expertise. We achieve this aim by providing R apps, which offer a semi-auto generated and unified graphical user interface for computational packages in R and repositories such as Bioconductor. To address the interactivity limitation inherent in R libraries, our framework includes several native apps that provide exploration and brushing operations as well as an integrated genome browser. The apps can be chained together to create more powerful analysis workflows. To validate the usability of VisRseq for analysis of sequencing data, we present two case studies performed by our collaborators and report their workflow and insights.

Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

PubMed

Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

2018-02-02

Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene

Sequence stratigraphy and high-frequency cycles: New aspects for a quantitative evaluation of the Gulf of Suez basin, Egypt

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nio, S.D.; Yang, C.S.; Tewfik, N.

1993-09-01

A new development in the application of sequence stratigraphic concepts in marine as well as continental basins is the recognition of high-frequency cyclic patterns in rock successions in the subsurface. Studies of six wells from the northern, central, and southern parts of the Gulf of Suez show the presence of well-preserved, high-frequency cycles with periodicities similar to the orbitally forced Malankovitch parameters. Subsurface rock successions, third-order sequences, and high-frequency cycles were compared with outcrops. After establishing the biostratigraphic framework for the above-mentioned wells, a sequence analysis was performed. Sequence boundaries and maximum flooding positions in each well were calibrated withmore » the occurrences and evaluation of the high-frequency cycles. It became obvious that there is an intimate relationship between these high-frequency Milankovitch cycles and sequence organization. In addition, a close relationship can be observed in the subsurface as well as in outcrops between high-frequency climatic changes (connected to the Milankovitch cycles) and (litho)facies variability. Quantitative evaluations of each sequence and/or systems tract can be computed with the International Geoservices' cyclicity analysis tool (MILABAR). The results are summarized in a well composite chart, rate (NAR), and ratio of preserved time. In correlations between the wells, an accuracy of 500-100 Ka can be obtained. The quantitative evaluation of the sequence and high-frequency cycle analysis gave some new aspects concerning the (litho)facies and geodynamic development during the pre- as well as the synrift stages of the Gulf of Suez Basin.« less

Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

PubMed

Hoshino, Tatsuhiko; Inagaki, Fumio

2017-01-01

Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and

Complete genome sequence of "Thiodictyon syntrophicum" sp. nov. strain Cad16T, a photolithoautotrophic purple sulfur bacterium isolated from the alpine meromictic Lake Cadagno.

PubMed

Luedin, Samuel M; Pothier, Joël F; Danza, Francesco; Storelli, Nicola; Frigaard, Niels-Ulrik; Wittwer, Matthias; Tonolla, Mauro

2018-01-01

" Thiodictyon syntrophicum" sp. nov. strain Cad16 T is a photoautotrophic purple sulfur bacterium belonging to the family of Chromatiaceae in the class of Gammaproteobacteria . The type strain Cad16 T was isolated from the chemocline of the alpine meromictic Lake Cadagno in Switzerland. Strain Cad16 T represents a key species within this sulfur-driven bacterial ecosystem with respect to carbon fixation. The 7.74-Mbp genome of strain Cad16 T has been sequenced and annotated. It encodes 6237 predicted protein sequences and 59 RNA sequences. Phylogenetic comparison based on 16S rRNA revealed that Thiodictyon elegans strain DSM 232 T the most closely related species. Genes involved in sulfur oxidation, central carbon metabolism and transmembrane transport were found. Noteworthy, clusters of genes encoding the photosynthetic machinery and pigment biosynthesis are found on the 0.48 Mb plasmid pTs485. We provide a detailed insight into the Cad16 T genome and analyze it in the context of the microbial ecosystem of Lake Cadagno.

Sequencing and functional validation of the JGI Brachypodium distachyon T-DNA collection

USDA-ARS?s Scientific Manuscript database

Brachypodium distachyon is a powerful experimental model for the grasses with a large and growing collection of genomic and experimental resources. We have added to these resources by greatly expanding the number of sequence-indexed T-DNA lines. We sequenced 21,165 T-DNA lines, 15,569 of which were ...

Generalized second law of thermodynamics in f(R,T) theory of gravity

NASA Astrophysics Data System (ADS)

Momeni, D.; Moraes, P. H. R. S.; Myrzakulov, R.

2016-07-01

We present a study of the generalized second law of thermodynamics in the scope of the f(R,T) theory of gravity, with R and T representing the Ricci scalar and trace of the energy-momentum tensor, respectively. From the energy-momentum tensor equation for the f(R,T)=R+f(T) case, we calculate the form of the geometric entropy in such a theory. Then, the generalized second law of thermodynamics is quantified and some relations for its obedience in f(R,T) gravity are presented. Those relations depend on some cosmological quantities, as the Hubble and deceleration parameters, and also on the form of f(T).

Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

PubMed Central

Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K.; Maitra, S. S.

2015-01-01

Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

Methionine Regulates mTORC1 via the T1R1/T1R3-PLCβ-Ca2+-ERK1/2 Signal Transduction Process in C2C12 Cells.

PubMed

Zhou, Yuanfei; Ren, Jiao; Song, Tongxing; Peng, Jian; Wei, Hongkui

2016-10-11

The mammalian target of rapamycin complex 1 (mTORC1) integrates amino acid (AA) availability to support protein synthesis and cell growth. Taste receptor type 1 member (T1R) is a G protein-coupled receptor that functions as a direct sensor of extracellular AA availability to regulate mTORC1 through Ca 2+ stimulation and extracellular signal-regulated kinases 1 and 2 (ERK1/2) activation. However, the roles of specific AAs in T1R1/T1R3-regulated mTORC1 are poorly defined. In this study, T1R1 and T1R3 subunits were expressed in C2C12 myotubes, and l-AA sensing was accomplished by T1R1/T1R3 to activate mTORC1. In response to l-AAs, such as serine (Ser), arginine (Arg), threonine (Thr), alanine (Ala), methionine (Met), glutamine (Gln), and glycine (Gly), Met induced mTORC1 activation and promoted protein synthesis. Met also regulated mTORC1 via T1R1/T1R3-PLCβ-Ca 2+ -ERK1/2 signal transduction. Results revealed a new role for Met-regulated mTORC1 via an AA receptor. Further studies should be performed to determine the role of T1R1/T1R3 in mediating extracellular AA to regulate mTOR signaling and to reveal its mechanism.

Complete genome sequence of Jiangella gansuensis strain YIM 002T (DSM 44835T), the type species of the genus Jiangella and source of new antibiotic compounds

DOE PAGES

Jiao, Jian-Yu; Carro, Lorena; Liu, Lan; ...

2017-02-03

Jiangella gansuensis strain YIM 002 T is the type strain of the type species of the genus Jiangella, which is at the present time composed of five species, and was isolated from desert soil sample in Gansu Province (China). The five strains of this genus are clustered in a monophyletic group when closer actinobacterial genera are used to infer a 16S rRNA gene sequence phylogeny. The study of this genome is part of the Genomic Encyclopedia of Bacteria and Archaea project, and here we describe the complete genome sequence and annotation of this taxon. The genome of J. gansuensis strainmore » YIM 002T contains a single scaffold of size 5,585,780 bp, which involves 149 pseudogenes, 4905 protein-coding genes and 50 RNA genes, including 2520 hypothetical proteins and 4 rRNA genes. From the investigation of genome sizes of Jiangella species, J. gansuensis shows a smaller size, which indicates this strain might have discarded too much genetic information to adapt to desert environment. Seven new compounds from this bacterium have recently been described; however, its potential should be higher, as secondary metabolite gene cluster analysis predicted 60 gene clusters, including the potential to produce the pristinamycin.« less

Complete genome sequence of Jiangella gansuensis strain YIM 002T (DSM 44835T), the type species of the genus Jiangella and source of new antibiotic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiao, Jian-Yu; Carro, Lorena; Liu, Lan

Jiangella gansuensis strain YIM 002 T is the type strain of the type species of the genus Jiangella, which is at the present time composed of five species, and was isolated from desert soil sample in Gansu Province (China). The five strains of this genus are clustered in a monophyletic group when closer actinobacterial genera are used to infer a 16S rRNA gene sequence phylogeny. The study of this genome is part of the Genomic Encyclopedia of Bacteria and Archaea project, and here we describe the complete genome sequence and annotation of this taxon. The genome of J. gansuensis strainmore » YIM 002T contains a single scaffold of size 5,585,780 bp, which involves 149 pseudogenes, 4905 protein-coding genes and 50 RNA genes, including 2520 hypothetical proteins and 4 rRNA genes. From the investigation of genome sizes of Jiangella species, J. gansuensis shows a smaller size, which indicates this strain might have discarded too much genetic information to adapt to desert environment. Seven new compounds from this bacterium have recently been described; however, its potential should be higher, as secondary metabolite gene cluster analysis predicted 60 gene clusters, including the potential to produce the pristinamycin.« less

Draft Genome Sequence of Lactobacillus pobuzihii E100301T.

PubMed

Chiu, Chi-Ming; Chang, Chi-Huan; Pan, Shwu-Fen; Wu, Hui-Chung; Li, Shiao-Wen; Chang, Chuan-Hsiung; Lee, Yun-Shien; Chiang, Chih-Ming; Chen, Yi-Sheng

2013-05-09

Lactobacillus pobuzihii E100301(T) is a novel Lactobacillus species previously isolated from pobuzihi (fermented cummingcordia) in Taiwan. Phylogenetically, this strain is closest to Lactobacillus acidipiscis, but its phenotypic characteristics can be clearly distinguished from those of L. acidipiscis. We present the draft genome sequence of strain L. pobuzihii E100301(T).

Cardiorespiratory Kinetics Determined by Pseudo-Random Binary Sequences - Comparisons between Walking and Cycling.

PubMed

Koschate, J; Drescher, U; Thieschäfer, L; Heine, O; Baum, K; Hoffmann, U

2016-12-01

This study aims to compare cardiorespiratory kinetics as a response to a standardised work rate protocol with pseudo-random binary sequences between cycling and walking in young healthy subjects. Muscular and pulmonary oxygen uptake (V̇O 2 ) kinetics as well as heart rate kinetics were expected to be similar for walking and cycling. Cardiac data and V̇O 2 of 23 healthy young subjects were measured in response to pseudo-random binary sequences. Kinetics were assessed applying time series analysis. Higher maxima of cross-correlation functions between work rate and the respective parameter indicate faster kinetics responses. Muscular V̇O 2 kinetics were estimated from heart rate and pulmonary V̇O 2 using a circulatory model. Muscular (walking vs. cycling [mean±SD in arbitrary units]: 0.40±0.08 vs. 0.41±0.08) and pulmonary V̇O 2 kinetics (0.35±0.06 vs. 0.35±0.06) were not different, although the time courses of the cross-correlation functions of pulmonary V̇O 2 showed unexpected biphasic responses. Heart rate kinetics (0.50±0.14 vs. 0.40±0.14; P=0.017) was faster for walking. Regarding the biphasic cross-correlation functions of pulmonary V̇O 2 during walking, the assessment of muscular V̇O 2 kinetics via pseudo-random binary sequences requires a circulatory model to account for cardio-dynamic distortions. Faster heart rate kinetics for walking should be considered by comparing results from cycle and treadmill ergometry. © Georg Thieme Verlag KG Stuttgart · New York.

Complete genome sequence of Staphylothermus hellenicus P8T

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Iain; Wirth, Reinhard; Lucas, Susan

2011-01-01

Staphylothermus hellenicus belongs to the order Desulfurococcales within the archaeal phy- lum Crenarchaeota. Strain P8T is the type strain of the species and was isolated from a shal- low hydrothermal vent system at Palaeochori Bay, Milos, Greece. It is a hyperthermophilic, anaerobic heterotroph. Here we describe the features of this organism together with the com- plete genome sequence and annotation. The 1,580,347 bp genome with its 1,668 protein- coding and 48 RNA genes was sequenced as part of a DOE Joint Genome Institute (JGI) La- boratory Sequencing Program (LSP) project.

The Role of HuR in the Post-Transcriptional Regulation of Interleukin-3 in T Cells

PubMed Central

González-Feliciano, José A.; Hernández-Pérez, Marimar; Estrella, Luis A.; Colón-López, Daisy D.; López, Armando; Martínez, Marina; Maurás-Rivera, Kirla R.; Lasalde, Clarivel; Martínez, Daviana; Araujo-Pérez, Félix; González, Carlos I.

2014-01-01

Human Interleukin-3 (IL-3) is a lymphokine member of a class of transiently expressed mRNAs harboring Adenosine/Uridine-Rich Elements (ARE) in their 3' untranslated regions (3'-UTRs). The regulatory effects of AREs are often mediated by specific ARE-binding proteins (ARE-BPs). In this report, we show that the human IL-3 3'-UTR plays a post-transcriptional regulation role in two human transformed cell lines. More specifically, we demonstrate that the hIL-3 3'-UTR represses the translation of a luciferase reporter both in HeLa and Jurkat T-cells. These results also revealed that the hIL-3 3'-UTR-mediated translational repression is exerted by an 83 nt region comprised mainly by AREs and some non-ARE sequences. Moreover, electrophoretic mobility shift assays (EMSAs) and UV-crosslinking analysis show that this hIL-3 ARE-rich region recruits five specific protein complexes, including the ARE-BPs HuR and TIA-1. HuR binding to this ARE-rich region appears to be spatially modulated during T-cell activation. Together, these results suggest that HuR recognizes the ARE-rich region and plays a role in the IL-3 3'-UTR-mediated post-transcriptional control in T-cells. PMID:24658545

Draft Genome Sequence of Lactobacillus pobuzihii E100301T

PubMed Central

Chiu, Chi-ming; Chang, Chi-huan; Pan, Shwu-fen; Wu, Hui-chung; Li, Shiao-wen; Chang, Chuan-hsiung; Lee, Yun-shien; Chiang, Chih-ming

2013-01-01

Lactobacillus pobuzihii E100301T is a novel Lactobacillus species previously isolated from pobuzihi (fermented cummingcordia) in Taiwan. Phylogenetically, this strain is closest to Lactobacillus acidipiscis, but its phenotypic characteristics can be clearly distinguished from those of L. acidipiscis. We present the draft genome sequence of strain L. pobuzihii E100301T. PMID:23661478

Complete genome sequence of Parvibaculum lavamentivorans type strain (DS-1(T)).

PubMed

Schleheck, David; Weiss, Michael; Pitluck, Sam; Bruce, David; Land, Miriam L; Han, Shunsheng; Saunders, Elizabeth; Tapia, Roxanne; Detter, Chris; Brettin, Thomas; Han, James; Woyke, Tanja; Goodwin, Lynne; Pennacchio, Len; Nolan, Matt; Cook, Alasdair M; Kjelleberg, Staffan; Thomas, Torsten

2011-12-31

Parvibaculum lavamentivorans DS-1(T) is the type species of the novel genus Parvibaculum in the novel family Rhodobiaceae (formerly Phyllobacteriaceae) of the order Rhizobiales of Alphaproteobacteria. Strain DS-1(T) is a non-pigmented, aerobic, heterotrophic bacterium and represents the first tier member of environmentally important bacterial communities that catalyze the complete degradation of synthetic laundry surfactants. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,914,745 bp long genome with its predicted 3,654 protein coding genes is the first completed genome sequence of the genus Parvibaculum, and the first genome sequence of a representative of the family Rhodobiaceae.

Study of charged stellar structures in f(R, T) gravity

NASA Astrophysics Data System (ADS)

Sharif, M.; Siddiqa, Aisha

2017-12-01

This paper explores charged stellar structures whose pressure and density are related through polytropic equation of state ( p=ωρ^{σ}; ω is polytropic constant, p is pressure, ρ denotes density and σ is polytropic exponent) in the scenario of f(R,T) gravity (where R is the Ricci scalar and T is the trace of energy-momentum tensor). The Einstein-Maxwell field equations are solved together with the hydrostatic equilibrium equation for f(R,T)=R+2λ T where λ is the coupling constant, also called model parameter. We discuss different features of such configurations (like pressure, mass and charge) using graphical behavior for two values of σ. It is found that the effects of model parameter λ on different quantities remain the same for both cases. The energy conditions are satisfied and stellar configurations are stable in each case.

Assessment of cerebral venous sinus thrombosis using T2*-weighted gradient echo magnetic resonance imaging sequences

PubMed Central

Bidar, Fatemeh; Faeghi, Fariborz; Ghorbani, Askar

2016-01-01

Background: The purpose of this study is to demonstrate the advantages of gradient echo (GRE) sequences in the detection and characterization of cerebral venous sinus thrombosis compared to conventional magnetic resonance sequences. Methods: A total of 17 patients with cerebral venous thrombosis (CVT) were evaluated using different magnetic resonance imaging (MRI) sequences. The MRI sequences included T1-weighted spin echo (SE) imaging, T*2-weighted turbo SE (TSE), fluid attenuated inversion recovery (FLAIR), T*2-weighted conventional GRE, and diffusion weighted imaging (DWI). MR venography (MRV) images were obtained as the golden standard. Results: Venous sinus thrombosis was best detectable in T*2-weighted conventional GRE sequences in all patients except in one case. Venous thrombosis was undetectable in DWI. T*2-weighted GRE sequences were superior to T*2-weighted TSE, T1-weighted SE, and FLAIR. Enhanced MRV was successful in displaying the location of thrombosis. Conclusion: T*2-weighted conventional GRE sequences are probably the best method for the assessment of cerebral venous sinus thrombosis. The mentioned method is non-invasive; therefore, it can be employed in the clinical evaluation of cerebral venous sinus thrombosis. PMID:27326365

Genetic diversity among Babesia rossi detected in naturally infected dogs in Abeokuta, Nigeria, based on 18S rRNA gene sequences.

PubMed

Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O

2017-03-01

Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.

Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

PubMed

Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

2016-05-15

A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. Copyright © 2016 Elsevier B.V. All rights reserved.

High-quality-draft genome sequence of the fermenting bacterium Anaerobium acetethylicum type strain GluBS11T (DSM 29698)

DOE PAGES

Patil, Yogita; Müller, Nicolai; Schink, Bernhard; ...

2017-02-20

Anaerobium acetethylicum strain GluBS11 T belongs to the family Lachnospiraceae within the order Clostridiales. It is a Gram-positive, non-motile and strictly anaerobic bacterium isolated from biogas slurry that was originally enriched with gluconate as carbon source (Patil, et al., Int J Syst Evol Microbiol 65:3289-3296, 2015). Here we describe the draft genome sequence of strain GluBS11 T and provide a detailed insight into its physiological and metabolic features. The draft genome sequence generated 4,609,043 bp, distributed among 105 scaffolds assembled using the SPAdes genome assembler method. It comprises in total 4,132 genes, of which 4,008 were predicted to be proteinmore » coding genes, 124 RNA genes and 867 pseudogenes. The content was 43.51 mol %. The annotated genome of strain GluBS11 T contains putative genes coding for the pentose phosphate pathway, the Embden-Meyerhoff-Parnas pathway, the Entner-Doudoroff pathway and the tricarboxylic acid cycle. The genome revealed the presence of most of the necessary genes required for the fermentation of glucose and gluconate to acetate, ethanol, and hydrogen gas. However, a candidate gene for production of formate was not identified.« less

High-quality-draft genome sequence of the fermenting bacterium Anaerobium acetethylicum type strain GluBS11T (DSM 29698)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patil, Yogita; Müller, Nicolai; Schink, Bernhard

Anaerobium acetethylicum strain GluBS11 T belongs to the family Lachnospiraceae within the order Clostridiales. It is a Gram-positive, non-motile and strictly anaerobic bacterium isolated from biogas slurry that was originally enriched with gluconate as carbon source (Patil, et al., Int J Syst Evol Microbiol 65:3289-3296, 2015). Here we describe the draft genome sequence of strain GluBS11 T and provide a detailed insight into its physiological and metabolic features. The draft genome sequence generated 4,609,043 bp, distributed among 105 scaffolds assembled using the SPAdes genome assembler method. It comprises in total 4,132 genes, of which 4,008 were predicted to be proteinmore » coding genes, 124 RNA genes and 867 pseudogenes. The content was 43.51 mol %. The annotated genome of strain GluBS11 T contains putative genes coding for the pentose phosphate pathway, the Embden-Meyerhoff-Parnas pathway, the Entner-Doudoroff pathway and the tricarboxylic acid cycle. The genome revealed the presence of most of the necessary genes required for the fermentation of glucose and gluconate to acetate, ethanol, and hydrogen gas. However, a candidate gene for production of formate was not identified.« less

Genome Sequence of Microbulbifer mangrovi DD-13T Reveals Its Versatility to Degrade Multiple Polysaccharides.

PubMed

Imran, Md; Pant, Poonam; Shanbhag, Yogini P; Sawant, Samir V; Ghadi, Sanjeev C

2017-02-01

Microbulbifer mangrovi strain DD-13 T is a novel-type species isolated from the mangroves of Goa, India. The draft genome sequence of strain DD-13 comprised 4,528,106 bp with G+C content of 57.15%. Out of 3479 open reading frames, functions for 3488 protein coding sequences were predicted on the basis of similarity with the cluster of orthologous groups. In addition to protein coding sequences, 34 tRNA genes and 3 rRNA genes were detected. Analysis of nucleotide sequence of predicted gene using a Carbohydrate-Active Enzymes (CAZymes) Analysis Toolkit indicates that strain DD-13 encodes a large set of CAZymes including 255 glycoside hydrolases, 76 carbohydrate esterases, 17 polysaccharide lyases, and 113 carbohydrate-binding modules (CBMs). Many genes from strain DD-13 were annotated as carbohydrases specific for degradation of agar, alginate, carrageenan, chitin, xylan, pullulan, cellulose, starch, β-glucan, pectin, etc. Some of polysaccharide-degrading genes were highly modular and were appended at least with one CBM indicating the versatility of strain DD-13 to degrade complex polysaccharides. The cell growth of strain DD-13 was validated using pure polysaccharides such as agarose or alginate as carbon source as well as by using red and brown seaweed powder as substrate. The homologous carbohydrase produced by strain DD-13 during growth degraded the polysaccharide, ensuring the production of metabolizable reducing sugars. Additionally, several other polysaccharides such as carrageenan, xylan, pullulan, pectin, starch, and carboxymethyl cellulose were also corroborated as growth substrate for strain DD-13 and were associated with concomitant production of homologous carbohydrase.

Induction of an interleukin-1 receptor (IL-1R) on monocytic cells. Evidence that the receptor is not encoded by a T cell-type IL-1R mRNA.

PubMed

Spriggs, M K; Lioubin, P J; Slack, J; Dower, S K; Jonas, U; Cosman, D; Sims, J E; Bauer, J

1990-12-25

Primary human monocytes and the human monocytic cell line THP-1 were induced to express receptors for interleukin-1 alpha (IL-1 alpha) and IL-1 beta. Treatment of primary monocytes with dexamethasone resulted in a 10-fold increase in receptor number over untreated cells, to approximately 2,000 receptors/cell. Treatment of THP-1 cells with phorbol ester followed by prostaglandin E2 and dexamethasone resulted in the expression of approximately 30,000 receptors/cell. Competitive binding assays on THP-1 cells showed that both IL-1 alpha and IL-1 beta bind to the same receptor. The monocyte IL-1R is significantly smaller (63 kDa) than the T cell IL-1R (80 kDa) and is immunologically distinct. However, induction of monocytes and monocytic cell lines leads to the appearance of an abundant mRNA of approximately 5,000 bases which hybridizes to a cDNA probe from the T cell-type IL-1R. Sequence data obtained from a cDNA clone of this mRNA indicate that the message is identical to the T cell IL-1R mRNA throughout the coding region. A smaller mRNA, also homologous to the T cell IL-1R mRNA, accumulated in induced THP-1 cells and has a shorter 3'-untranslated region than the larger. Data are presented which suggest that neither form of this message encodes the 63-kDa IL-1R, but rather that this protein is the product of a separate nonhomologous mRNA.

Three-Dimensional Isotropic Fat-Suppressed Proton Density-Weighted MRI at 3 Tesla Using a T/R-Coil Can Replace Multiple Plane Two-Dimensional Sequences in Knee Imaging.

PubMed

Homsi, R; Gieseke, J; Luetkens, J A; Kupczyk, P; Maedler, B; Kukuk, G M; Träber, F; Agha, B; Rauch, M; Rajakaruna, N; Willinek, W; Schild, H H; Hadizadeh, D R

2016-10-01

To evaluate whether a 3 D proton density-weighted fat-suppressed sequence (PDwFS) of the knee is able to replace multiplanar 2D-PDwFS. 52 patients (26 men, mean age: 41.9 ± 14.5years) underwent magnetic resonance imaging (MRI) of the knee at 3.0 Tesla using a T/R-coil. The imaging protocol included 3 planes of 2D-PDwFS (acquisition time (AT): 6:40 min; voxel sizes: 0.40 - 0.63 × 0.44 - 0.89 × 3mm³) and a 3D-PDwFS (AT: 6:31 min; voxel size: 0.63 × 0.68 × 0.63mm³). Homogeneity of fat suppression (HFS), artifacts, and image sharpness (IS) were evaluated on a 5-point scale (5[excellent] - 1[non-diagnostic]). The sum served as a measure for the overall image quality (OIQ). Contrast ratios (CR) compared to popliteal muscle were calculated for the meniscus (MEN), anterior (ACL) and posterior cruciate ligaments (PCL). In 13 patients who underwent arthroscopic knee surgery, two radiologists evaluated the presence of meniscal, ligamental and cartilage lesions to estimate the sensitivity and specificity of lesion detection. The CR was higher in the ACL, PCL and MEN in 3D- PDwFS compared to 2D-PDwFS (p < 0.01 for ACL and PCL; p = 0.07 for MEN). Compared to 2 D images, the OIQ was rated higher in 3D-PDwFS images (p < 0.01) due to fewer artifacts and HFS despite the lower IS (p < 0.01). The sensitivity and specificity of lesion detection in 3D- and 2D-PDwFS were similar. Compared to standard multiplanar 2D-PDwFS knee imaging, isotropic high spatial resolution 3D-PDwFS of the knee at 3.0 T can be acquired with high image quality in a reasonable scan time. Multiplanar reformations in arbitrary planes may serve as an additional benefit of 3D-PDwFS. • 3D-PDwFS of the knee is acquired with high image quality• 3D-PDwFS can be achieved in only one measurement with a reasonable scan time• 3D-PDwFS with the advantage of multiplanar reformation may replace 2D-PD-weighted knee MRI Citation Format: • Homsi R, Gieseke

Lindamood Phonemic Sequencing (LiPS) [R]. What Works Clearinghouse Intervention Report

ERIC Educational Resources Information Center

What Works Clearinghouse, 2008

2008-01-01

The Lindamood Phonemic Sequencing (LiPS)[R] program (formerly called the Auditory Discrimination in Depth[R] [ADD] program) is designed to teach students skills to decode words and to identify individual sounds and blends in words. The program is individualized to meet student needs and is often used with students who have learning disabilities or…

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Complete genome sequence of Hirschia baltica type strain (IFAM 1418T)

PubMed Central

Chertkov, Olga; Brown, Pamela J.B.; Kysela, David T.; de Pedro, Miguel A.; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Del Rio, Tijana Glavina; Tice, Hope; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Detter, John C.; Han, Cliff; Larimer, Frank; Chang, Yun-juan; Jeffries, Cynthia D.; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Ovchinnikova, Galina; Tindall, Brian J.; Göker, Markus; Klenk, Hans-Peter; Brun, Yves V.

2011-01-01

The family Hyphomonadaceae within the Alphaproteobacteria is largely comprised of bacteria isolated from marine environments with striking morphologies and an unusual mode of cell growth. Here, we report the complete genome sequence Hirschia baltica, which is only the second a member of the Hyphomonadaceae with a published genome sequence. H. baltica is of special interest because it has a dimorphic life cycle and is a stalked, budding bacterium. The 3,455,622 bp long chromosome and 84,492 bp plasmid with a total of 3,222 protein-coding and 44 RNA genes were sequenced as part of the DOE Joint Genome Institute Program CSP 2008. PMID:22675580

Role of nutrient-sensing taste 1 receptor (T1R) family members in gastrointestinal chemosensing.

PubMed

Shirazi-Beechey, Soraya P; Daly, Kristian; Al-Rammahi, Miran; Moran, Andrew W; Bravo, David

2014-06-01

Luminal nutrient sensing by G-protein-coupled receptors (GPCR) expressed on the apical domain of enteroendocrine cells activates intracellular pathways leading to secretion of gut hormones that control vital physiological processes such as digestion, absorption, food intake and glucose homeostasis. The taste 1 receptor (T1R) family of GPCR consists of three members: T1R1; T1R2; T1R3. Expression of T1R1, T1R2 and T1R3 at mRNA and protein levels has been demonstrated in the intestinal tissue of various species. It has been shown that T1R2-T1R3, in association with G-protein gustducin, is expressed in intestinal K and L endocrine cells, where it acts as the intestinal glucose (sweet) sensor. A number of studies have demonstrated that activation of T1R2-T1R3 by natural sugars and artificial sweeteners leads to secretion of glucagon-like peptides 1&2 (GLP-1 and GLP-2) and glucose dependent insulinotropic peptide (GIP). GLP-1 and GIP enhance insulin secretion; GLP-2 increases intestinal growth and glucose absorption. T1R1-T1R3 combination co-expressed on the apical domain of cholecystokinin (CCK) expressing cells is a luminal sensor for a number of L-amino acids; with amino acid-activation of the receptor eliciting CCK secretion. This article focuses on the role of the gut-expressed T1R1, T1R2 and T1R3 in intestinal sweet and L-amino acid sensing. The impact of exploiting T1R2-T1R3 as a nutritional target for enhancing intestinal glucose absorption and gut structural maturity in young animals is also highlighted.

miRNA profiling of human naive CD4 T cells links miR-34c-5p to cell activation and HIV replication.

PubMed

Amaral, Andreia J; Andrade, Jorge; Foxall, Russell B; Matoso, Paula; Matos, Ana M; Soares, Rui S; Rocha, Cheila; Ramos, Christian G; Tendeiro, Rita; Serra-Caetano, Ana; Guerra-Assunção, José A; Santa-Marta, Mariana; Gonçalves, João; Gama-Carvalho, Margarida; Sousa, Ana E

2017-02-01

Cell activation is a vital step for T-cell memory/effector differentiation as well as for productive HIV infection. To identify novel regulators of this process, we used next-generation sequencing to profile changes in microRNA expression occurring in purified human naive CD4 T cells in response to TCR stimulation and/or HIV infection. Our results demonstrate, for the first time, the transcriptional up-regulation of miR-34c-5p in response to TCR stimulation in naive CD4 T cells. The induction of this miR was further consistently found to be reduced by both HIV-1 and HIV-2 infections. Overexpression of miR-34c-5p led to changes in the expression of several genes involved in TCR signaling and cell activation, confirming its role as a novel regulator of naive CD4 T-cell activation. We additionally show that miR-34c-5p promotes HIV-1 replication, suggesting that its down-regulation during HIV infection may be part of an anti-viral host response. © 2016 The Authors.

Strange stars in f(R,Script T) gravity

NASA Astrophysics Data System (ADS)

Deb, Debabrata; Rahaman, Farook; Ray, Saibal; Guha, B. K.

2018-03-01

In this article we try to present spherically symmetric isotropic strange star model under the framework of f(R,Script T) theory of gravity. To this end, we consider that the Lagrangian density is a linear function of the Ricci scalar R and the trace of the energy momentum tensor Script T given as f(R,Script T)=R+2χ Script T. We also assume that the quark matter distribution is governed by the simplest form of the MIT bag model equation of state (EOS) as p=1/3(ρ‑4B), where B is the bag constant. We have obtained an exact solution of the modified form of the Tolman-Oppenheimer-Volkoff (TOV) equation in the framework of f(R,Script T) gravity theory and have studied the dependence of different physical properties, viz., the total mass, radius, energy density and pressure for the chosen values of χ. Further, to examine physical acceptability of the proposed stellar model, we have conducted different tests in detail, viz., the energy conditions, modified TOV equation, mass-radius relation, causality condition etc. We have precisely explained the effects arising due to the coupling of the matter and geometry on the compact stellar system. For a chosen value of the bag constant, we have predicted numerical values of the different physical parameters in tabular form for the different strange star candidates. It is found that as the factor χ decreases the strange star candidates become gradually massive and larger in size with less dense stellar configuration. However, when χ increases the stars shrink gradually and become less massive to turn into a more compact stellar system. Hence for χ>0 our proposed model is suitable to explain the ultra-dense compact stars well within the observational limits and for χ<0 case allows to represent the recent massive pulsars and super-Chandrasekhar stars. For χ=0 we retrieve as usual the standard results of the general relativity (GR).

The impact of cerebellar transcranial direct current stimulation (tDCS) on learning fine-motor sequences

PubMed Central

Wu, Allan D.; Samra, Jasmine K.

2017-01-01

The cerebellum has been shown to be important for skill learning, including the learning of motor sequences. We investigated whether cerebellar transcranial direct current stimulation (tDCS) would enhance learning of fine motor sequences. Because the ability to generalize or transfer to novel task variations or circumstances is a crucial goal of real world training, we also examined the effect of tDCS on performance of novel sequences after training. In Study 1, participants received either anodal, cathodal or sham stimulation while simultaneously practising three eight-element key press sequences in a non-repeating, interleaved order. Immediately after sequence practice with concurrent tDCS, a transfer session was given in which participants practised three interleaved novel sequences. No stimulation was given during transfer. An inhibitory effect of cathodal tDCS was found during practice, such that the rate of learning was slowed in comparison to the anodal and sham groups. In Study 2, participants received anodal or sham stimulation and a 24 h delay was added between the practice and transfer sessions to reduce mental fatigue. Although this consolidation period benefitted subsequent transfer for both tDCS groups, anodal tDCS enhanced transfer performance. Together, these studies demonstrate polarity-specific effects on fine motor sequence learning and generalization. This article is part of the themed issue ‘New frontiers for statistical learning in the cognitive sciences’. PMID:27872369

The impact of cerebellar transcranial direct current stimulation (tDCS) on learning fine-motor sequences.

PubMed

Shimizu, Renee E; Wu, Allan D; Samra, Jasmine K; Knowlton, Barbara J

2017-01-05

The cerebellum has been shown to be important for skill learning, including the learning of motor sequences. We investigated whether cerebellar transcranial direct current stimulation (tDCS) would enhance learning of fine motor sequences. Because the ability to generalize or transfer to novel task variations or circumstances is a crucial goal of real world training, we also examined the effect of tDCS on performance of novel sequences after training. In Study 1, participants received either anodal, cathodal or sham stimulation while simultaneously practising three eight-element key press sequences in a non-repeating, interleaved order. Immediately after sequence practice with concurrent tDCS, a transfer session was given in which participants practised three interleaved novel sequences. No stimulation was given during transfer. An inhibitory effect of cathodal tDCS was found during practice, such that the rate of learning was slowed in comparison to the anodal and sham groups. In Study 2, participants received anodal or sham stimulation and a 24 h delay was added between the practice and transfer sessions to reduce mental fatigue. Although this consolidation period benefitted subsequent transfer for both tDCS groups, anodal tDCS enhanced transfer performance. Together, these studies demonstrate polarity-specific effects on fine motor sequence learning and generalization.This article is part of the themed issue 'New frontiers for statistical learning in the cognitive sciences'. © 2016 The Author(s).

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

16S-23S rRNA gene internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Porphyromonas.

PubMed

Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C

2005-03-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.

Targeted reconstruction of T cell receptor sequence from single cell RNA-seq links CDR3 length to T cell differentiation state

PubMed Central

Yates, Kathleen B.; Bi, Kevin; Darko, Samuel; Godec, Jernej; Gerdemann, Ulrike; Swadling, Leo; Douek, Daniel C.; Klenerman, Paul; Barnes, Eleanor J.; Sharpe, Arlene H.

2017-01-01

Abstract The T cell compartment must contain diversity in both T cell receptor (TCR) repertoire and cell state to provide effective immunity against pathogens. However, it remains unclear how differences in the TCR contribute to heterogeneity in T cell state. Single cell RNA-sequencing (scRNA-seq) can allow simultaneous measurement of TCR sequence and global transcriptional profile from single cells. However, current methods for TCR inference from scRNA-seq are limited in their sensitivity and require long sequencing reads, thus increasing the cost and decreasing the number of cells that can be feasibly analyzed. Here we present TRAPeS, a publicly available tool that can efficiently extract TCR sequence information from short-read scRNA-seq libraries. We apply it to investigate heterogeneity in the CD8+ T cell response in humans and mice, and show that it is accurate and more sensitive than existing approaches. Coupling TRAPeS with transcriptome analysis of CD8+ T cells specific for a single epitope from Yellow Fever Virus (YFV), we show that the recently described ‘naive-like’ memory population have significantly longer CDR3 regions and greater divergence from germline sequence than do effector-memory phenotype cells. This suggests that TCR usage is associated with the differentiation state of the CD8+ T cell response to YFV. PMID:28934479

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

Dynamical behavior of the Tolman metrics in f (R ,T ) gravity

NASA Astrophysics Data System (ADS)

Hansraj, Sudan; Banerjee, Ayan

2018-05-01

We analyze the behavior of well-known stellar models within the context of f (R ,T ) modified theory of gravity, in which the gravitational Lagrangian is given by an arbitrary function of the Ricci scalar R and the trace of the energy-momentum tensor T , namely f (R ,T )=R +2 χ T for some constant χ . The equation of pressure isotropy in this theory is identical to that of the standard Einstein theory therefore all known metric potentials solving Einstein's equations are valid here. However, the pressure and energy density profiles are markedly different due to the presence of the term 2 χ T . The exact solutions to the corresponding static spherically symmetric field equations with a perfect fluid source are the well known Tolman solutions [Phys. Rev. 55, 364 (1939), 10.1103/PhysRev.55.364] in general relativity. To support the theoretical results, graphical representation are employed to investigate the physical viability of compact stars. Specifically we study the density and pressure profiles, the sound speed behavior as well as the energy conditions and mass behavior where appropriate. It is found that in some cases the f (R ,T ) model displays more pleasing behavior than its Einstein counterpart while in other cases the behavior is similar. In no case does the 2 χ T addition negatively impact the model's behavior.

SOCS1 and SOCS3 Are Targeted by Hepatitis C Virus Core/gC1qR Ligation To Inhibit T-Cell Function

PubMed Central

Yao, Zhi Qiang; Waggoner, Stephen N.; Cruise, Michael W.; Hall, Caroline; Xie, Xuefang; Oldach, David W.; Hahn, Young S.

2005-01-01

T cells play an important role in the control of hepatitis C virus (HCV) infection. We have previously demonstrated that the HCV core inhibits T-cell responses through interaction with gC1qR. We show here that core proteins from chronic and resolved HCV patients differ in sequence, gC1qR-binding ability, and T-cell inhibition. Specifically, chronic core isolates bind to gC1qR more efficiently and inhibit T-cell proliferation as well as gamma interferon (IFN-γ) production more profoundly than resolved core isolates. This inhibition is mediated by the disruption of STAT phosphorylation through the induction of SOCS molecules. Silencing either SOCS1 or SOCS3 by small interfering RNA dramatically augments the production of IFN-γ in T cells, thereby abrogating the inhibitory effect of core. Additionally, the ability of core proteins from patients with chronic infections to induce SOCS proteins and suppress STAT activation greatly exceeds that of core proteins from patients with resolved infections. These results suggest that the HCV core/gC1qR-induced T-cell dysfunction involves the induction of SOCS, a powerful inhibitor of cytokine signaling, which represents a novel mechanism by which a virus usurps the host machinery for persistence. PMID:16306613

Construct and content validity of the Turkish Birth Satisfaction Scale - Revised (T-BSS-R).

PubMed

Göncü Serhatlıoğlu, Seda; Karahan, Nazan; Hollins Martin, Caroline J; Martin, Colin R

2018-07-01

The Birth Satisfaction Scale - Revised (BSS-R) is a valid and reliable scale designed to assess women's experiences of labour and childbirth. To assess factor structure, validity, and reliability of the Turkish Birth Satisfaction Scale - Revised (T-BSS-R) using data collected from a Turkish population. Istanbul Ministry of Health Zeynep Kamil Women's and Children's Training and Research Hospital. A convenience sample of healthy child-bearing women (n = 120) who had experienced a spontaneous vertex delivery at full term. A survey was conducted post backtranslating the T-BSS-R, with survey data analysed using confirmatory factor analysis. Factor modelling found three subscales embedded in the T-BSS-R, which indicated a good model fit, χ 2 = 44.67, CFI = .94; RMSEA = .057; SRMR = .075. A Chi-square value of 1.33 also indicated a good fit. Means for the T-BSS-R subdimensions (1) Stress Experienced (T-BSS-SE-R) = 6.86 ± 3.10, (2) Women's Attributes (T-BSS-WA-R) = 2.84 ± 1.89, (3) Quality of Care (T-BSS-QC-R) = 10.69 ± 3.19 and total scale = 20.39 ± 5.98. The Cronbach alpha coefficient for total scale = 0.71 and for subdimensions T-BSS-SE-R = 0.55, T-BSS-WA-R = 0.44 and T-BSS-QC-R = -0.74. Data analysis determined that the T-BSS-R is a valid and reliable instrument to measure birth satisfaction in a population of Turkish women. The T-BSS-R is available for use from c.hollinsmartin@napier.ac.uk .

Improved stereoselective bioreduction of t-butyl 6-cyano-(5R)-hydroxy-3-oxohexanoate by Rhodotorula glutinis through heat treatment.

PubMed

Luo, Xi; Wang, Ya-Jun; Zheng, Yu-Guo

2016-11-01

Optically pure t-butyl 6-cyano-(3R, 5R)-dihydroxyhexanoate ((R)-1b) is the key precursor for atorvastatin calcium, the most widely used cholesterol-lowering drug. In this work, a strain ZJB-09224 capable of asymmetrically reducing t-butyl 6-cyano-(5R)-hydroxy-3-oxohexanoate (1a) to corresponding optically pure (R)-1b was successfully isolated from soil sample, identified belonging to Rhodotorula glutinis based on the morphology, physiological tests, and the 18S rDNA sequence analysis. It was found that heat treatment of cell suspension at 45 °C for 25 Min significantly improved R. glutinis ZJB-09224 stereoselectivity. The asymmetric bioreduction of 1a was most efficient at pH 7.5, 35 °C, 50 mM (15.0 g L -1 ) substrate concentration, 40.0 g DCW L -1 cell loading size, 0.54 M (60.0 g L -1 ) sodium lactate acting as co-substrate. Under these optimal conditions, 0.046 M (R)-1b was produced with de (diastereomeric excess) value of 99.2% after 40 H conversion. Moreover, R. glutinis ZJB-09224 has a broad substrate spectrum, making it a potential tool for some valuable chiral alcohol pharmaceutical intermediates synthesis. © 2015 International Union of Biochemistry and Molecular Biology, Inc.

Non-water-suppressed 1 H FID-MRSI at 3T and 9.4T.

PubMed

Chang, Paul; Nassirpour, Sahar; Avdievitch, Nikolai; Henning, Anke

2018-08-01

This study investigates metabolite concentrations using metabolite-cycled 1 H free induction decay (FID) magnetic resonance spectroscopic imaging (MRSI) at ultra-high fields. A non-lipid-suppressed and slice-selective ultra-short echo time (TE) 1 H FID MRSI sequence was combined with a low-specific absorption rate (SAR) asymmetric inversion adiabatic pulse to enable non-water-suppressed metabolite mapping using metabolite-cycling at 9.4T. The results were compared to a water-suppressed FID MRSI sequence, and the same study was performed at 3T for comparison. The scan times for performing single-slice metabolite mapping with a nominal voxel size of 0.4 mL were 14 and 17.5 min on 3T and 9.4T, respectively. The low-SAR asymmetric inversion adiabatic pulse enabled reliable non-water-suppressed metabolite mapping using metabolite cycling at both 3T and 9.4T. The spectra and maps showed good agreement with the water-suppressed FID MRSI ones at both field strengths. A quantitative analysis of metabolite ratios with respect to N-acetyl aspartate (NAA) was performed. The difference in Cre/NAA was statistically significant, ∼0.1 higher for the non-water-suppressed case than for water suppression (from 0.73 to 0.64 at 3T and from 0.69 to 0.59 at 9.4T). The difference is likely because of chemical exchange effects of the water suppression pulses. Small differences in mI/NAA were also statistically significant, however, are they are less reliable because the metabolite peaks are close to the water peak that may be affected by the water suppression pulses or metabolite-cycling inversion pulse. We showed the first implementation of non-water-suppressed metabolite-cycled 1 H FID MRSI at ultra-high fields. An increase in Cre/NAA was seen for the metabolite-cycled case. The same methodology was further applied at 3T and similar results were observed. Magn Reson Med 80:442-451, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Genome sequences of Alicycliphilus denitrificans strain BC and K601(T)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oosterkamp, Margreet J.; Veuskens, Teun; Plugge, Caroline M.

2011-01-01

Alicycliphilus denitrificans strain BC and A. denitrificans strain K601T degrade cyclic hydrocarbons. These strains have been isolated from a mixture of wastewater treatment plant material and benzene-polluted soil and from a wastewater treatment plant, respectively, suggesting their role in bioremediation of soil and water. Although the strains are phylogenetically closely related, there are some clear physiological differences. The hydrocarbon cyclohexanol, for example, can be degraded by strain K601T but not by strain BC. Furthermore, both strains can use nitrate and oxygen as an electron acceptor, but only strain BC can use chlorate as electron acceptor. To better understand the nitratemore » and chlorate reduction mechanisms coupled to the oxidation of cyclic compounds, the genomes of A. denitrificans strains BC and K601T were sequenced. Here, we report the complete genome sequences of A. denitrificans strains BC and K601T.« less

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

Expression of bitter taste receptors of the T2R family in the gastrointestinal tract and enteroendocrine STC-1 cells.

PubMed

Wu, S Vincent; Rozengurt, Nora; Yang, Moon; Young, Steven H; Sinnett-Smith, James; Rozengurt, Enrique

2002-02-19

Although a role for the gastric and intestinal mucosa in molecular sensing has been known for decades, the initial molecular recognition events that sense the chemical composition of the luminal contents has remained elusive. Here we identified putative taste receptor gene transcripts in the gastrointestinal tract. Our results, using reverse transcriptase-PCR, demonstrate the presence of transcripts corresponding to multiple members of the T2R family of bitter taste receptors in the antral and fundic gastric mucosa as well as in the lining of the duodenum. In addition, cDNA clones of T2R receptors were detected in a rat gastric endocrine cell cDNA library, suggesting that these receptors are expressed, at least partly, in enteroendocrine cells. Accordingly, expression of multiple T2R receptors also was found in STC-1 cells, an enteroendocrine cell line. The expression of alpha subunits of G proteins implicated in intracellular taste signal transduction, namely Galpha(gust), and Galpha(t)-(2), also was demonstrated in the gastrointestinal mucosa as well as in STC-1 cells, as revealed by reverse transcriptase-PCR and DNA sequencing, immunohistochemistry, and Western blotting. Furthermore, addition of compounds widely used in bitter taste signaling (e.g., denatonium, phenylthiocarbamide, 6-n-propil-2-thiouracil, and cycloheximide) to STC-1 cells promoted a rapid increase in intracellular Ca(2+) concentration. These results demonstrate the expression of bitter taste receptors of the T2R family in the mouse and rat gastrointestinal tract.

Phylogenetic tree of 16s rRNA sequences from sulfate-reducing bacteria in a sandy marine sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devereux, R.; Mundfrom, G.W.

1994-01-01

Phylogenetic divergence among sulfate-reducing bateria in an estuarine sediment sample was investigated by PCR amplification and comparison of partial 16S rDNA sequences. Twenty unique 16S rDNA sequences were found, 12 from delta subclass bacteria based on overall sequence similarity (82-91%). Two successive PCR amplifications were used to obtain and clone the 16S rDNA. The first reaction used templates derived from phosphate-buffered saline washed sediment with primers designed to amplify nearly full-length bacterial domain 16S rDNA. A produce from a first reaction was used as template in a second reaction with primers designed to selectivity amplify a region of 16S rDNAmore » genes of sulfate-reducing bacteria. A phylogenetic tree incorporating the cloned sequences suggests the presence of yet to be cultivated lines of sulfate-reducing bacteria within the sediment sample.« less

Nuclear targeting of the maize R protein requires two nuclear localization sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shieh, M.W.; Raikhel, N.V.; Wessler, S.R.

1993-02-01

Previous genetic and structural evidence indicates that the maize R gene encodes a nuclear transcriptional activating factor. In-frame carboxyl- and amino-terminal fusions of the R gene to the reporter gene encoding [beta]-glucuronidase (GUS) were sufficient to direct GUS to the nucleus of the transiently transformed onion (Allium cepa) epidermal cells. Further analysis of chimeric constructs containing regions of the R gene fused to the GUS cDNA revealed three specific nuclear localization sequences (NLSs) that were capable of redirecting the GUS protein to the nucleus. Amino-terminal NLS-A (amino acids 100-109, GDRRAAPARP) contained several arginine residues; a similar localization signal is foundmore » in only a few viral proteins. The medial NLS-M (amino acids 419-428, MSERKRREKL) is a simian virus 40 large T antigen-type NLS, and the carboxyl-terminal NLS-C (amino acids 598-610, MISESLRKAIGKR) is a mating type [alpha]2 type. NLSs M and C are independently sufficient to direct the GUS protein to the nucleus when it is fused at the amino terminus of GUS, whereas NLS-A fused to GUS partitioned between the nucleus and cytoplasm. Similar partitioning was observed when localization signals NLS-A and NLS-C were independently fused to the carboxy-terminal portion of GUS. A sequential deletion of the localization signals indicated that the amino-terminal and carboxyl-terminal fusions of R and GUS were redirected to the nucleus only when both NLS-A and -M, or NLS-C and -M, were present. These results indicate that multiple localization signals are necessary for nuclear targeting of this protein. The conservation of the localization signals within the alleles of R and similar proteins from other organisms is also discussed. 45 refs., 6 figs.« less

Trauma simulation in bilingual Canada: Insurmountable barrier or unexpected strength? Insights from the first bilingual S.T.A.R.T.T. course.

PubMed

Gillman, Lawrence M; Widder, Sandy; Clément, Julien; Engels, Paul T; Paton-Gay, John Damian; Brindley, Peter G

2016-04-01

The Standardized Trauma and Resuscitation Team Training (S.T.A.R.T.T.) course focuses on training multidisciplinary trauma teams: surgeons/physicians, registered nurses (RNs), respiratory therapists (RTs) and, most recently, prehospital personnel. The S.T.A.R.T.T. curriculum highlights crisis management (CRM) skills: communication, teamwork, leadership, situational awareness and resource utilization. This commentary outlines the modifications made to the course curriculum in order to satisfy the learning needs of a bilingual audience. The results suggest that bilingual multidisciplinary CRM courses are feasible, are associated with high participant satisfaction and have no clear detriments.

Impaired tRNA nuclear export links DNA damage and cell-cycle checkpoint.

PubMed

Ghavidel, Ata; Kislinger, Thomas; Pogoutse, Oxana; Sopko, Richelle; Jurisica, Igor; Emili, Andrew

2007-11-30

In response to genotoxic stress, cells evoke a plethora of physiological responses collectively aimed at enhancing viability and maintaining the integrity of the genome. Here, we report that unspliced tRNA rapidly accumulates in the nuclei of yeast Saccharomyces cerevisiae after DNA damage. This response requires an intact MEC1- and RAD53-dependent signaling pathway that impedes the nuclear export of intron-containing tRNA via differential relocalization of the karyopherin Los1 to the cytoplasm. The accumulation of unspliced tRNA in the nucleus signals the activation of Gcn4 transcription factor, which, in turn, contributes to cell-cycle arrest in G1 in part by delaying accumulation of the cyclin Cln2. The regulated nucleocytoplasmic tRNA trafficking thus constitutes an integral physiological adaptation to DNA damage. These data further illustrate how signal-mediated crosstalk between distinct functional modules, namely, tRNA nucleocytoplasmic trafficking, protein synthesis, and checkpoint execution, allows for functional coupling of tRNA biogenesis and cell-cycle progression.

Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Susceptibility of Hep3B cells in different phases of cell cycle to tBid.

PubMed

Ma, Shi-Hong; Chen, George G; Ye, Caiguo; Leung, Billy C S; Ho, Rocky L K; Lai, Paul B S

2011-01-01

tBid is a pro-apoptotic molecule. Apoptosis inducers usually act in a cell cycle-specific fashion. The aim of this study was to elucidate whether effect of tBid on hepatocellular carcinoma (HCC) Hep3B cells was cell cycle phase specific. We synchronized Hep3B cells at G0/G1, S or G2/M phases by chemicals or flow sorting and tested the susceptibility of the cells to recombinant tBid. Cell viability was measured by MTT assay and apoptosis by TUNEL. The results revealed that tBid primarily targeted the cells at G0/G1 phase of cell cycle, and it also increased the cells at the G2/M phase. 5-Fluorouracil (5-FU), on the other hand, arrested Hep3B cells at the G0/G1 phase, but significantly reduced cells at G2/M phase. The levels of cell cycle-related proteins and caspases were altered in line with the change in the cell cycle. The combination of tBid with 5-FU caused more cells to be apoptotic than either agent alone. Therefore, the complementary effect of tBid and 5-FU on different phases of the cell cycle may explain their synergistric effect on Hep3B cells. The elucidation of the phase-specific effect of tBid points to a possible therapeutic option that combines different phase specific agents to overcome resistance of HCC. Copyright © 2010 Elsevier B.V. All rights reserved.

MiR-9-5p and miR-106a-5p dysregulated in CD4+ T-cells of multiple sclerosis patients and targeted essential factors of T helper17/regulatory T-cells differentiation

PubMed Central

Majd, Maryam; Hosseini, Aref; Ghaedi, Kamran; Kiani-Esfahani, Abbas; Tanhaei, Somayeh; Shiralian-Esfahani, Hanieh; Rahnamaee, Seyed Yahya; Mowla, Seyed Javad; Nasr-Esfahani, Mohammad Hossein

2018-01-01

Objective(s): Multiple sclerosis (MS) is considered as a chronic type of an inflammatory disease characterized by loss of myelin of CNS. Recent evidence indicates that Interleukin 17 (IL-17)-producing T helper cells (Th17 cells) population are increased and regulatory T cells (Treg cells) are decreased in MS. Despite extensive research in understanding the mechanism of Th17 and Treg differentiation, the role of microRNAs in MS is not completely understood. Thereby, as a step closer, we analyzed the expression profile of miR-9-5p and miR-106a-5p, and protein level of retinoic acid receptor (RAR)-related orphan receptor C (RORC; Th17 master transcription factor) as direct target of miR-106a-5p and forkhead box P3 (FOXP3; Treg master transcription factor) as indirect target of miR-9-5p in CD4+ T cells in two groups of relapsing and remitting in our relapsing-remitting MS (RR-MS) patients. Materials and Methods: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was utilized to assess the expression of miRNAs and mRNAs, in 40 RR-MS patients and 11 healthy individuals. Thus, FOXP3 and RAR-related orphan receptor γt (RORγt) was assessed in CD4+T-cells by flow cytometry. We also investigated the role of these miRNAs in Th17/Treg differentiation pathway through bioinformatics tools. Results: An up-regulation of miR-9-5p and down-regulation of miR-106a-5p in relapsing phase of MS patients were observed compared to healthy controls. RORC and FOXP3 were up-regulated in relapsing and remitting phases of MS, respectively. Conclusion: Expression pattern of miR-9-5p and miR-106a-5p and their targets suggest a possible inducing role of miR-9-5p and suppressing role of miR-106a-5p in differentiation pathway of Th17 cells during MS pathogenesis. PMID:29511494

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Statistical inference of the generation probability of T-cell receptors from sequence repertoires.

PubMed

Murugan, Anand; Mora, Thierry; Walczak, Aleksandra M; Callan, Curtis G

2012-10-02

Stochastic rearrangement of germline V-, D-, and J-genes to create variable coding sequence for certain cell surface receptors is at the origin of immune system diversity. This process, known as "VDJ recombination", is implemented via a series of stochastic molecular events involving gene choices and random nucleotide insertions between, and deletions from, genes. We use large sequence repertoires of the variable CDR3 region of human CD4+ T-cell receptor beta chains to infer the statistical properties of these basic biochemical events. Because any given CDR3 sequence can be produced in multiple ways, the probability distribution of hidden recombination events cannot be inferred directly from the observed sequences; we therefore develop a maximum likelihood inference method to achieve this end. To separate the properties of the molecular rearrangement mechanism from the effects of selection, we focus on nonproductive CDR3 sequences in T-cell DNA. We infer the joint distribution of the various generative events that occur when a new T-cell receptor gene is created. We find a rich picture of correlation (and absence thereof), providing insight into the molecular mechanisms involved. The generative event statistics are consistent between individuals, suggesting a universal biochemical process. Our probabilistic model predicts the generation probability of any specific CDR3 sequence by the primitive recombination process, allowing us to quantify the potential diversity of the T-cell repertoire and to understand why some sequences are shared between individuals. We argue that the use of formal statistical inference methods, of the kind presented in this paper, will be essential for quantitative understanding of the generation and evolution of diversity in the adaptive immune system.

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Expression of miR-155, miR-146a, and miR-326 in T1D patients from Chile: relationship with autoimmunity and inflammatory markers.

PubMed

García-Díaz, Diego F; Pizarro, Carolina; Camacho-Guillén, Patricia; Codner, Ethel; Soto, Néstor; Pérez-Bravo, Francisco

2018-02-01

Objective The aim of this research was to analyze the expression profile of miR-155, miR-146a, and miR-326 in peripheral blood mononuclear cells (PBMC) of 47 patients with type 1 diabetes mellitus (T1D) and 39 control subjects, as well as the possible association with autoimmune or inflammatory markers. Subjects and methods Expression profile of miRs by means of qPCR using TaqMan probes. Autoantibodies and inflammatory markers by ELISA. Statistical analysis using bivariate correlation. Results The analysis of the results shows an increase in the expression of miR-155 in T1D patients in basal conditions compared to the controls (p < 0.001) and a decreased expression level of miR-326 (p < 0.01) and miR-146a (p < 0.05) compared T1D patients to the controls. miR-155 was the only miRs associated with autoinmmunity (ZnT8) and inflammatory status (vCAM). Conclusion Our data show a possible role of miR-155 related to autoimmunity and inflammation in Chilean patients with T1D.

Defining Differential Genetic Signatures in CXCR4- and the CCR5-Utilizing HIV-1 Co-Linear Sequences

PubMed Central

Aiamkitsumrit, Benjamas; Dampier, Will; Martin-Garcia, Julio; Nonnemacher, Michael R.; Pirrone, Vanessa; Ivanova, Tatyana; Zhong, Wen; Kilareski, Evelyn; Aldigun, Hazeez; Frantz, Brian; Rimbey, Matthew; Wojno, Adam; Passic, Shendra; Williams, Jean W.; Shah, Sonia; Blakey, Brandon; Parikh, Nirzari; Jacobson, Jeffrey M.; Moldover, Brian; Wigdahl, Brian

2014-01-01

The adaptation of human immunodeficiency virus type-1 (HIV-1) to an array of physiologic niches is advantaged by the plasticity of the viral genome, encoded proteins, and promoter. CXCR4-utilizing (X4) viruses preferentially, but not universally, infect CD4+ T cells, generating high levels of virus within activated HIV-1-infected T cells that can be detected in regional lymph nodes and peripheral blood. By comparison, the CCR5-utilizing (R5) viruses have a greater preference for cells of the monocyte-macrophage lineage; however, while R5 viruses also display a propensity to enter and replicate in T cells, they infect a smaller percentage of CD4+ T cells in comparison to X4 viruses. Additionally, R5 viruses have been associated with viral transmission and CNS disease and are also more prevalent during HIV-1 disease. Specific adaptive changes associated with X4 and R5 viruses were identified in co-linear viral sequences beyond the Env-V3. The in silico position-specific scoring matrix (PSSM) algorithm was used to define distinct groups of X4 and R5 sequences based solely on sequences in Env-V3. Bioinformatic tools were used to identify genetic signatures involving specific protein domains or long terminal repeat (LTR) transcription factor sites within co-linear viral protein R (Vpr), trans-activator of transcription (Tat), or LTR sequences that were preferentially associated with X4 or R5 Env-V3 sequences. A number of differential amino acid and nucleotide changes were identified across the co-linear Vpr, Tat, and LTR sequences, suggesting the presence of specific genetic signatures that preferentially associate with X4 or R5 viruses. Investigation of the genetic relatedness between X4 and R5 viruses utilizing phylogenetic analyses of complete sequences could not be used to definitively and uniquely identify groups of R5 or X4 sequences; in contrast, differences in the genetic diversities between X4 and R5 were readily identified within these co-linear sequences in

Sequence of neuron origin and neocortical laminar fate: relation to cell cycle of origin in the developing murine cerebral wall

NASA Technical Reports Server (NTRS)

Takahashi, T.; Goto, T.; Miyama, S.; Nowakowski, R. S.; Caviness, V. S. Jr

1999-01-01

Neurons destined for each region of the neocortex are known to arise approximately in an "inside-to-outside" sequence from a pseudostratified ventricular epithelium (PVE). This sequence is initiated rostrolaterally and propagates caudomedially. Moreover, independently of location in the PVE, the neuronogenetic sequence in mouse is divisible into 11 cell cycles that occur over a 6 d period. Here we use a novel "birth hour" method that identifies small cohorts of neurons born during a single 2 hr period, i.e., 10-20% of a single cell cycle, which corresponds to approximately 1.5% of the 6 d neuronogenetic period. This method shows that neurons arising with the same cycle of the 11 cycle sequence in mouse have common laminar fates even if they arise from widely separated positions on the PVE (neurons of fields 1 and 40) and therefore arise at different embryonic times. Even at this high level of temporal resolution, simultaneously arising cells occupy more than one cortical layer, and there is substantial overlap in the distributions of cells arising with successive cycles. We demonstrate additionally that the laminar representation of cells arising with a given cycle is little if at all modified over the early postnatal interval of histogenetic cell death. We infer from these findings that cell cycle is a neuronogenetic counting mechanism and that this counting mechanism is integral to subsequent processes that determine cortical laminar fate.

The full mitochondrial genome sequence of Raillietina tetragona from chicken (Cestoda: Davaineidae).

PubMed

Liang, Jian-Ying; Lin, Rui-Qing

2016-11-01

In the present study, the complete mitochondrial DNA (mtDNA) sequence of Raillietina tetragona was sequenced and its gene contents and genome organizations was compared with that of other tapeworm. The complete mt genome sequence of R. tetragona is 14,444 bp in length. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and two non-coding region. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T of the complete mt genome are 71.4% for R. tetragona. The R. tetragona mt genome sequence provides novel mtDNA marker for studying the molecular epidemiology and population genetics of Raillietina and has implications for the molecular diagnosis of chicken cestodosis caused by Raillietina.

poRe: an R package for the visualization and analysis of nanopore sequencing data.

PubMed

Watson, Mick; Thomson, Marian; Risse, Judith; Talbot, Richard; Santoyo-Lopez, Javier; Gharbi, Karim; Blaxter, Mark

2015-01-01

The Oxford Nanopore MinION device represents a unique sequencing technology. As a mobile sequencing device powered by the USB port of a laptop, the MinION has huge potential applications. To enable these applications, the bioinformatics community will need to design and build a suite of tools specifically for MinION data. Here we present poRe, a package for R that enables users to manipulate, organize, summarize and visualize MinION nanopore sequencing data. As a package for R, poRe has been tested on Windows, Linux and MacOSX. Crucially, the Windows version allows users to analyse MinION data on the Windows laptop attached to the device. poRe is released as a package for R at http://sourceforge.net/projects/rpore/. A tutorial and further information are available at https://sourceforge.net/p/rpore/wiki/Home/. © The Author 2014. Published by Oxford University Press.

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

High resolution chronology of late Cretaceous-early Tertiary events determined from 21,000 yr orbital-climatic cycles in marine sediments

NASA Technical Reports Server (NTRS)

Herbert, Timothy D.; Dhondt, Steven

1988-01-01

A number of South Atlantic sites cored by the Deep Sea Drilling Project (DSDP) recovered late Cretaceous and early Tertiary sediments with alternating light-dark, high-low carbonate content. The sedimentary oscillations were turned into time series by digitizing color photographs of core segments at a resolution of about 5 points/cm. Spectral analysis of these records indicates prominent periodicity at 25 to 35 cm in the Cretaceous intervals, and about 15 cm in the early Tertiary sediments. The absolute period of the cycles that is determined from paleomagnetic calibration at two sites is 20,000 to 25,000 yr, and almost certainly corresponds to the period of the earth's precessional cycle. These sequences therefore contain an internal chronometer to measure events across the K/T extinction boundary at this scale of resolution. The orbital metronome was used to address several related questions: the position of the K/T boundary within magnetic chron 29R, the fluxes of biogenic and detrital material to the deep sea immediately before and after the K/T event, the duration of the Sr anomaly, and the level of background climatic variability in the latest Cretaceous time. The carbonate/color cycles that were analyzed contain primary records of ocean carbonate productivity and chemistry, as evidenced by bioturbational mixing of adjacent beds and the weak lithification of the rhythmic sequences. It was concluded that sedimentary sequences that contain orbital cyclicity are capable of providing resolution of dramatic events in earth history with much greater precision than obtainable through radiometric methods. The data show no evidence for a gradual climatic deterioration prior to the K/T extinction event, and argue for a geologically rapid revolution at this horizon.

Characterization of Trichuris trichiura from humans and T. suis from pigs in China using internal transcribed spacers of nuclear ribosomal DNA.

PubMed

Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q

2014-03-01

Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.

ENOS, ET-1 and ETB-R immunoreactivities in the porcine mesometrial lymphatics during the estrous cycle.

PubMed

Doboszyńska, Teresa; Andronowska, Aneta

2002-01-01

Abstract: Immunohistochemical localization and distribution of nitric oxide synthase (eNOS), endothelin (ET-1) and endothelin beta receptor (ETB-R) were investigated in precollector and collector lymph vessels in the broad ligament of the uterus during different phases of the estrous cycle in pigs. The polyclonal antibody for ET-1 and ETB-R and monoclonal antibody for eNOS isoform were used to perform observations on the light microscopic level. Immunoreactivities to ET-1, ETB-R and eNOS were observed in the endothelium of precollector and collector lymphangions but not in smooth muscle cells of the lymphatics examined. The staining for eNOS in the endothelial cells of all studied lymphatic vessels was stronger comparing to ET-1 and ETB-R. During the estrous cycle, only eNOS showed the correlation with the particular phases of the estrous cycle. The differences between ET-1 and ETB-R immunoreactivities were very slight and rather independent of the size or type of the lymphatic lymphangions and estrous cycle. The highest immunoreactivity level for eNOS was displayed by collector lymphangions with widened lumen in the follicular phase comparing to the precollector ones. During the luteal phase, a slight decrease in the reaction intensity was observed. The immunoreactivities for ET-1 in the endothelium of the studied vessels was not comparable with the presence or with the reactivity level of ETB-R. Optically stronger immunoreaction for ETB-R was observed in the cytoplasm of collector lymphangions in the follicular phase. eNOS, ET-1 and ETB-R were also present in the cytoplasm of the lymphatic valves. These results suggest that ET-1 and eNOS can play a role in the mechanisms regulating the vascular contractile activity, promoting lymph flow during the estrous cycle in the porcine broad ligament.

Complete Genome Sequence of Komagataeibacter hansenii LMG 23726T

PubMed Central

Santos, Richard; Ebels, Marcus; Bordbar, Darius

2017-01-01

ABSTRACT This study reports the release of the complete nucleotide sequence of Komagataeibacter hansenii LMG 23726T. This organism is a cellulose producer, and its genome may provide more information to aid in the understanding of the genes necessary for cellulose biosynthesis. PMID:28408680

Draft Genome Sequence of a Hexachlorocyclohexane-Degrading Bacterium, Sphingobium baderi Strain LL03T

PubMed Central

Kaur, Jasvinder; Verma, Helianthous; Tripathi, Charu; Khurana, J. P.

2013-01-01

Sphingobium baderi strain LL03T was isolated from hexachlorocyclohexane (HCH)-contaminated soil from Spolana, Czech Republic. Strain LL03T is a mutant that is deficient in linB and linC (genes that encode hexachlorocyclohexane haloalkane dehalogenase and dehydrogenase, respectively). The draft genome sequence of LL03T (~4.85 Mb) consists of 92 contigs and 4,914 coding sequences, with a G+C content of 63.5%. PMID:24051322

Stellar equilibrium configurations of white dwarfs in the f( R, T) gravity

NASA Astrophysics Data System (ADS)

Carvalho, G. A.; Lobato, R. V.; Moraes, P. H. R. S.; Arbañil, José D. V.; Otoniel, E.; Marinho, R. M.; Malheiro, M.

2017-12-01

In this work we investigate the equilibrium configurations of white dwarfs in a modified gravity theory, namely, f( R, T) gravity, for which R and T stand for the Ricci scalar and trace of the energy-momentum tensor, respectively. Considering the functional form f(R,T)=R+2λ T, with λ being a constant, we obtain the hydrostatic equilibrium equation for the theory. Some physical properties of white dwarfs, such as: mass, radius, pressure and energy density, as well as their dependence on the parameter λ are derived. More massive and larger white dwarfs are found for negative values of λ when it decreases. The equilibrium configurations predict a maximum mass limit for white dwarfs slightly above the Chandrasekhar limit, with larger radii and lower central densities when compared to standard gravity outcomes. The most important effect of f( R, T) theory for massive white dwarfs is the increase of the radius in comparison with GR and also f( R) results. By comparing our results with some observational data of massive white dwarfs we also find a lower limit for λ , namely, λ >- 3× 10^{-4}.

Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

PubMed

Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

2015-01-01

Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

PubMed Central

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-01-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA. PMID:8943327

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

PubMed

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-12-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

Overexpression of miR-26b-5p regulates the cell cycle by targeting CCND2 in GC-2 cells under exposure to extremely low frequency electromagnetic fields.

PubMed

Liu, Yong; Liu, Wen-Bin; Liu, Kai-Jun; Ao, Lin; Cao, Jia; Zhong, Julia Li; Liu, Jin-Yi

2016-01-01

The increasing prevalence of extremely low frequency electromagnetic fields (ELF-EMFs) exposure has raised considerable public concern regarding the potential hazardous effects of ELF-EMFs on male reproductive function. Increasing evidence indicates that miRNAs are necessary for spermatogenesis and male fertility. However, the regulation of miRNA expression and the roles of miRNAs in response to ELF-EMFs remain unclear. In our study, mouse spermatocyte-derived GC-2 cells were intermittently exposed to a 50 Hz ELF-EMF for 72 h (5 min on/10 min off) at magnetic field intensities of 1 mT, 2 mT and 3 mT. MiR-26b-5p was differentially expressed in response to different magnetic field intensities of ELF-EMFs. The host gene CTDSP1 showed an unmethylation status in GC-2 cells at different magnetic field intensities of ELF-EMF exposure. MiR-26b-5p had no significant, obvious influence on the cell viability, apoptosis or cell cycle of GC-2 cells. However, the overexpression of miR-26b-5p significantly decreased the percentage of G0/G1 phase cells and slightly increased the percentage of S phase cells compared to the sham group that was exposed to a 50 Hz ELF-EMF. Computational algorithms identified Cyclin D2 (CCND2) as a direct target of miR-26b-5p. MiR-26b-5p and a 50 Hz ELF-EMF altered the expression of CCND2 at both the mRNA and protein levels. Overexpressed miR-26b-5p in GC-2 cells can change the mRNA expression of CCND2 following 50 Hz ELF-EMF at 3 mT. These findings demonstrate that miR-26b-5p could serve as a potential biomarker following 50 Hz ELF-EMF exposure, and miR-26b-5p-CCND2-mediated cell cycle regulation might play a pivotal role in the biological effects of ELF-EMFs.

Observations on the T lnR term in the quark-antiquark free energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiskis, J.

1986-06-15

Consider the response of a pure gauge theory at temperature T to an external quark-antiquark pair separated by R. In the confining phase, the leading term in the free energy at large R is sigmaR. A string-model calculation has given T lnR for the next-to-leading term. In this paper, the origin of the T lnR term is considered in a more general context that includes the analog spin model and the lattice gauge theory at strong coupling. The connection with transverse fluctuations is emphasized.

The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

PubMed Central

Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

Induced miR-99a expression represses Mtor cooperatively with miR-150 to promote regulatory T-cell differentiation

PubMed Central

Warth, Sebastian C; Hoefig, Kai P; Hiekel, Anian; Schallenberg, Sonja; Jovanovic, Ksenija; Klein, Ludger; Kretschmer, Karsten; Ansel, K Mark; Heissmeyer, Vigo

2015-01-01

Peripheral induction of regulatory T (Treg) cells provides essential protection from inappropriate immune responses. CD4+ T cells that lack endogenous miRNAs are impaired to differentiate into Treg cells, but the relevant miRNAs are unknown. We performed an overexpression screen with T-cell-expressed miRNAs in naive mouse CD4+ T cells undergoing Treg differentiation. Among 130 candidates, the screen identified 29 miRNAs with a negative and 10 miRNAs with a positive effect. Testing reciprocal Th17 differentiation revealed specific functions for miR-100, miR-99a and miR-10b, since all of these promoted the Treg and inhibited the Th17 program without impacting on viability, proliferation and activation. miR-99a cooperated with miR-150 to repress the expression of the Th17-promoting factor mTOR. The comparably low expression of miR-99a was strongly increased by the Treg cell inducer “retinoic acid”, and the abundantly expressed miR-150 could only repress Mtor in the presence of miR-99a. Our data suggest that induction of Treg cell differentiation is regulated by a miRNA network, which involves cooperation of constitutively expressed as well as inducible miRNAs. PMID:25712478

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

PubMed

Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

2014-04-01

Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

Applying Agrep to r-NSA to solve multiple sequences approximate matching.

PubMed

Ni, Bing; Wong, Man-Hon; Lam, Chi-Fai David; Leung, Kwong-Sak

2014-01-01

This paper addresses the approximate matching problem in a database consisting of multiple DNA sequences, where the proposed approach applies Agrep to a new truncated suffix array, r-NSA. The construction time of the structure is linear to the database size, and the computations of indexing a substring in the structure are constant. The number of characters processed in applying Agrep is analysed theoretically, and the theoretical upper-bound can approximate closely the empirical number of characters, which is obtained through enumerating the characters in the actual structure built. Experiments are carried out using (synthetic) random DNA sequences, as well as (real) genome sequences including Hepatitis-B Virus and X-chromosome. Experimental results show that, compared to the straight-forward approach that applies Agrep to multiple sequences individually, the proposed approach solves the matching problem in much shorter time. The speed-up of our approach depends on the sequence patterns, and for highly similar homologous genome sequences, which are the common cases in real-life genomes, it can be up to several orders of magnitude.

Agreement between T2 and haste sequences in the evaluation of thoracolumbar intervertebral disc disease in dogs.

PubMed

Mankin, Joseph M; Hecht, Silke; Thomas, William B

2012-01-01

The purpose of this study was to compare half-Fourier-acquisition single-shot turbo spin-echo (HASTE) and T2-weighted (T2-W) sequences in dogs with thoracolumbar disc extrusion. MRI studies in 60 dogs (767 individual intervertebral disc spaces) were evaluated. Agreement between T2-W and HASTE sequences was assessed for two criteria: presence of an extradural lesion and treatment recommendation. There was moderate agreement between T2-W and HASTE sequences as to presence of an extradural lesion (kappa = 0.575). HASTE was in agreement in 96.1% of the sites where no extradural lesion was identified on T2-W images, but only in 58.1% of the sites where extradural lesions were identified on T2-W images. There was also moderate agreement between T2-W and HASTE sequences as to treatment recommendations (kappa = 0.476). HASTE was in agreement in 98.4% of the sites where a lesion was considered nonsurgical on T2 but only 82.1% of sites a lesion was considered surgical on T2. In 1.0% of sites considered not surgical and in 9.8% of sites considered equivocal based on T2-W images, a surgical lesion was identified on HASTE. Acquisition of a HASTE sequence in addition to conventional sequences may be beneficial in determining the severity of spinal cord compression in some cases when evaluating the canine spine.

Genome Sequence of Novosphingobium lindaniclasticum LE124T, Isolated from a Hexachlorocyclohexane Dumpsite

PubMed Central

Saxena, Anjali; Nayyar, Namita; Sangwan, Naseer; Kumari, Rashmi; Khurana, J. P.

2013-01-01

Novosphingobium lindaniclasticum LE124T is a hexachlorocyclohexane (HCH)-degrading bacterium isolated from a high-dosage-point HCH dumpsite (450 mg HCH/g soil) located in Lucknow, India (27°00′N and 81°09′E). Here, we present the annotated draft genome sequence of strain LE124T, which has an estimated size of 4.86 Mb and is comprised of 4,566 coding sequences. PMID:24029761

78 FR 28719 - Special Conditions: Cessna Aircraft Company, Model J182T; Diesel Cycle Engine Installation

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-16

...; Special Conditions No. 23-259-SC] Special Conditions: Cessna Aircraft Company, Model J182T; Diesel Cycle..., air cooled, diesel cycle engine that uses turbine (jet) fuel. The Model No. J182T, which is a... engine airplane with a cantilever high wing, with the SMA SR305- 230E-C1 diesel cycle engine and...

A novel ultra high-throughput 16S rRNA gene amplicon sequencing library preparation method for the Illumina HiSeq platform.

PubMed

de Muinck, Eric J; Trosvik, Pål; Gilfillan, Gregor D; Hov, Johannes R; Sundaram, Arvind Y M

2017-07-06

Advances in sequencing technologies and bioinformatics have made the analysis of microbial communities almost routine. Nonetheless, the need remains to improve on the techniques used for gathering such data, including increasing throughput while lowering cost and benchmarking the techniques so that potential sources of bias can be better characterized. We present a triple-index amplicon sequencing strategy to sequence large numbers of samples at significantly lower c ost and in a shorter timeframe compared to existing methods. The design employs a two-stage PCR protocol, incorpo rating three barcodes to each sample, with the possibility to add a fourth-index. It also includes heterogeneity spacers to overcome low complexity issues faced when sequencing amplicons on Illumina platforms. The library preparation method was extensively benchmarked through analysis of a mock community in order to assess biases introduced by sample indexing, number of PCR cycles, and template concentration. We further evaluated the method through re-sequencing of a standardized environmental sample. Finally, we evaluated our protocol on a set of fecal samples from a small cohort of healthy adults, demonstrating good performance in a realistic experimental setting. Between-sample variation was mainly related to batch effects, such as DNA extraction, while sample indexing was also a significant source of bias. PCR cycle number strongly influenced chimera formation and affected relative abundance estimates of species with high GC content. Libraries were sequenced using the Illumina HiSeq and MiSeq platforms to demonstrate that this protocol is highly scalable to sequence thousands of samples at a very low cost. Here, we provide the most comprehensive study of performance and bias inherent to a 16S rRNA gene amplicon sequencing method to date. Triple-indexing greatly reduces the number of long custom DNA oligos required for library preparation, while the inclusion of variable length

AhR activation increases IL-2 production by alloreactive CD4+ T cells initiating the differentiation of mucosal-homing Tim3+ Lag3+ Tr1 cells.

PubMed

Ehrlich, Allison K; Pennington, Jamie M; Tilton, Susan; Wang, Xisheng; Marshall, Nikki B; Rohlman, Diana; Funatake, Castle; Punj, Sumit; O'Donnell, Edmond; Yu, Zhen; Kolluri, Siva K; Kerkvliet, Nancy I

2017-11-01

Activation of the aryl hydrocarbon receptor (AhR) by immunosuppressive ligands promotes the development of regulatory T (Treg) cells. Although AhR-induced Foxp3 + Treg cells have been well studied, much less is known about the development and fate of AhR-induced Type 1 Treg (AhR-Tr1) cells. In the current study, we identified the unique transcriptional and functional changes in murine CD4 + T cells that accompany the differentiation of AhR-Tr1 cells during the CD4 + T-cell-dependent phase of an allospecific cytotoxic T lymphocyte (allo-CTL) response. AhR activation increased the expression of genes involved in T-cell activation, immune regulation and chemotaxis, as well as a global downregulation of genes involved in cell cycling.  Increased IL-2 production was responsible for the early AhR-Tr1 activation phenotype previously characterized as CD25 + CTLA4 + GITR + on day 2. The AhR-Tr1 phenotype was further defined by the coexpression of the immunoregulatory receptors Lag3 and Tim3 and non-overlapping expression of CCR4 and CCR9. Consistent with the increased expression of CCR9, real-time imaging showed enhanced migration of AhR-Tr1 cells to the lamina propria of the small intestine and colon. The discovery of mucosal imprinting of AhR-Tr1 cells provides an additional mechanism by which therapeutic AhR ligands can control immunopathology. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Real-time tracking of cell cycle progression during CD8+ effector and memory T-cell differentiation

PubMed Central

Kinjyo, Ichiko; Qin, Jim; Tan, Sioh-Yang; Wellard, Cameron J.; Mrass, Paulus; Ritchie, William; Doi, Atsushi; Cavanagh, Lois L.; Tomura, Michio; Sakaue-Sawano, Asako; Kanagawa, Osami; Miyawaki, Atsushi; Hodgkin, Philip D.; Weninger, Wolfgang

2015-01-01

The precise pathways of memory T-cell differentiation are incompletely understood. Here we exploit transgenic mice expressing fluorescent cell cycle indicators to longitudinally track the division dynamics of individual CD8+ T cells. During influenza virus infection in vivo, naive T cells enter a CD62Lintermediate state of fast proliferation, which continues for at least nine generations. At the peak of the anti-viral immune response, a subpopulation of these cells markedly reduces their cycling speed and acquires a CD62Lhi central memory cell phenotype. Construction of T-cell family division trees in vitro reveals two patterns of proliferation dynamics. While cells initially divide rapidly with moderate stochastic variations of cycling times after each generation, a slow-cycling subpopulation displaying a CD62Lhi memory phenotype appears after eight divisions. Phenotype and cell cycle duration are inherited by the progeny of slow cyclers. We propose that memory precursors cell-intrinsically modulate their proliferative activity to diversify differentiation pathways. PMID:25709008

Real-time tracking of cell cycle progression during CD8+ effector and memory T-cell differentiation.

PubMed

Kinjyo, Ichiko; Qin, Jim; Tan, Sioh-Yang; Wellard, Cameron J; Mrass, Paulus; Ritchie, William; Doi, Atsushi; Cavanagh, Lois L; Tomura, Michio; Sakaue-Sawano, Asako; Kanagawa, Osami; Miyawaki, Atsushi; Hodgkin, Philip D; Weninger, Wolfgang

2015-02-24

The precise pathways of memory T-cell differentiation are incompletely understood. Here we exploit transgenic mice expressing fluorescent cell cycle indicators to longitudinally track the division dynamics of individual CD8(+) T cells. During influenza virus infection in vivo, naive T cells enter a CD62L(intermediate) state of fast proliferation, which continues for at least nine generations. At the peak of the anti-viral immune response, a subpopulation of these cells markedly reduces their cycling speed and acquires a CD62L(hi) central memory cell phenotype. Construction of T-cell family division trees in vitro reveals two patterns of proliferation dynamics. While cells initially divide rapidly with moderate stochastic variations of cycling times after each generation, a slow-cycling subpopulation displaying a CD62L(hi) memory phenotype appears after eight divisions. Phenotype and cell cycle duration are inherited by the progeny of slow cyclers. We propose that memory precursors cell-intrinsically modulate their proliferative activity to diversify differentiation pathways.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

Surface curvature singularities of polytropic spheres in Palatini f (R ,T ) gravity

NASA Astrophysics Data System (ADS)

Barrientos O., José; Rubilar, Guillermo F.

2016-01-01

We consider Palatini f (R ,T ) gravity models, similar to those introduced by Harko et al. (2012), where the gravitational Lagrangian is given by an arbitrary function of the curvature scalar R and of the trace of the energy-momentum tensor T . Interior spherical static solutions are studied considering the model of matter given by a perfect fluid configuration and a polytropic equation of state. We analyze the curvature singularities found previously for Palatini f (R ) gravity and discuss the possibility to remove them in some particular f (R ,T ) models. We show that it is possible to construct a restricted family of models for which these singularities are not present.

Complete genome sequence of Clavibacter michiganensis subsp. insidiosus R1-1 using PacBio single-molecule real-time technology

USDA-ARS?s Scientific Manuscript database

We report the complete genome sequence of Clavibacter michiganensis subsp. insidiosus R1-1 isolated in Minnesota, USA. The R1-1 genome, generated by de novo assembly of PacBio sequencing data, is the first complete genome sequence available for this subspecies....

Coronal Activity in the R CrA T Association

NASA Technical Reports Server (NTRS)

Patten, Brian M.; Oliversen, Ronald J. (Technical Monitor)

2005-01-01

Brian Patten is the Principal Investigator of the NASA ROSS-ADP project Coronal Activity in the R CrA T Association. For this project we have extracted net counts and variability information for all of the X-ray sources found in 23 archival ROSAT PSPC and HRI images in the region of the R CrA T association. These data have been merged with an extensive database of optical and near-infrared photometry, optical spectroscopy, and parallax data. These data have been used to (1) identify new association members and clarify the membership status of a number of previously suspected members of the association, and (2) derive, for the first time, an accurate coronal luminosity function for the T Tauri members of this T association and make direct comparisons between the coronal luminosity functions for other T associations and those of large clusters. We have used our survey data to assess (a) the importance of the star-formation environment in initial coronal activity levels, (b) the effects of PMS evolution on dynamo activity as a function of mass and age, and (c) the level of contamination by field post-T Tauri stars on association membership surveys.

The importance of the presence of a 5'-ribonucleotide and the contribution of the T1R1 + T1R3 heterodimer and an additional low-affinity receptor in the taste detection of L-glutamate as assessed psychophysically.

PubMed

Smith, Kimberly R; Spector, Alan C

2014-09-24

The molecular receptors underlying the purported "umami" taste quality commonly associated with l-glutamate have been controversial. Evidence supports the involvement of the T1R1 + T1R3 heterodimer, a GPCR broadly tuned to l-amino acids, but variants of two mGluRs expressed in taste buds have also been implicated. Using a rigorous psychophysical taste-testing paradigm, we demonstrated impaired, if not eliminated, detection of MSG in WT and T1R1, T1R2, T1R3, and T1R2 + T1R3 KO mice when the contribution of sodium was minimized by the epithelial sodium channel blocker amiloride. When inosine 5'-monophosphate (IMP), a ribonucleotide that potentiates the l-glutamate signal through the T1R1 + T1R3 heterodimer, was added, the WT and T1R2 KO mice were able to detect the compound stimulus across all MSG (+amiloride) concentrations due, in part, to the taste of IMP. In contrast, mice lacking T1R1 or T1R3 could not detect IMP alone, yet some were able to detect MSG + amiloride + IMP, but only at the higher MSG concentrations. Interestingly, the sensitivity of T1R1 KO mice to another l-amino acid, lysine, was unimpaired, suggesting that some l-amino acids can be detected through T1R1 + T1R3-independent receptors without sensitivity loss. Given that IMP is not thought to affect mGluRs, behavioral detection of l-glutamate appears to require the contribution of the T1R1 + T1R3 receptor. However, the partial competence observed in some T1R1 and T1R3 KO mice when MSG + amiloride + IMP was tested suggests that a T1R1 or T1R3 homodimer or an unidentified protein, perhaps in conjunction with T1R1 or T1R3, can serve as a low-affinity taste receptor for l-glutamate in the presence of IMP. Copyright © 2014 the authors 0270-6474/14/3413234-12$15.00/0.

Bioinformatics analysis of plant orthologous introns: identification of an intronic tRNA-like sequence.

PubMed

Akkuratov, Evgeny E; Walters, Lorraine; Saha-Mandal, Arnab; Khandekar, Sushant; Crawford, Erin; Zirbel, Craig L; Leisner, Scott; Prakash, Ashwin; Fedorova, Larisa; Fedorov, Alexei

2014-09-10

Orthologous introns have identical positions relative to the coding sequence in orthologous genes of different species. By analyzing the complete genomes of five plants we generated a database of 40,512 orthologous intron groups of dicotyledonous plants, 28,519 orthologous intron groups of angiosperms, and 15,726 of land plants (moss and angiosperms). Multiple sequence alignments of each orthologous intron group were obtained using the Mafft algorithm. The number of conserved regions in plant introns appeared to be hundreds of times fewer than that in mammals or vertebrates. Approximately three quarters of conserved intronic regions among angiosperms and dicots, in particular, correspond to alternatively-spliced exonic sequences. We registered only a handful of conserved intronic ncRNAs of flowering plants. However, the most evolutionarily conserved intronic region, which is ubiquitous for all plants examined in this study, including moss, possessed multiple structural features of tRNAs, which caused us to classify it as a putative tRNA-like ncRNA. Intronic sequences encoding tRNA-like structures are not unique to plants. Bioinformatics examination of the presence of tRNA inside introns revealed an unusually long-term association of four glycine tRNAs inside the Vac14 gene of fish, amniotes, and mammals. Copyright © 2014 Elsevier B.V. All rights reserved.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

i-rDNA: alignment-free algorithm for rapid in silico detection of ribosomal gene fragments from metagenomic sequence data sets.

PubMed

Mohammed, Monzoorul Haque; Ghosh, Tarini Shankar; Chadaram, Sudha; Mande, Sharmila S

2011-11-30

Obtaining accurate estimates of microbial diversity using rDNA profiling is the first step in most metagenomics projects. Consequently, most metagenomic projects spend considerable amounts of time, money and manpower for experimentally cloning, amplifying and sequencing the rDNA content in a metagenomic sample. In the second step, the entire genomic content of the metagenome is extracted, sequenced and analyzed. Since DNA sequences obtained in this second step also contain rDNA fragments, rapid in silico identification of these rDNA fragments would drastically reduce the cost, time and effort of current metagenomic projects by entirely bypassing the experimental steps of primer based rDNA amplification, cloning and sequencing. In this study, we present an algorithm called i-rDNA that can facilitate the rapid detection of 16S rDNA fragments from amongst millions of sequences in metagenomic data sets with high detection sensitivity. Performance evaluation with data sets/database variants simulating typical metagenomic scenarios indicates the significantly high detection sensitivity of i-rDNA. Moreover, i-rDNA can process a million sequences in less than an hour on a simple desktop with modest hardware specifications. In addition to the speed of execution, high sensitivity and low false positive rate, the utility of the algorithmic approach discussed in this paper is immense given that it would help in bypassing the entire experimental step of primer-based rDNA amplification, cloning and sequencing. Application of this algorithmic approach would thus drastically reduce the cost, time and human efforts invested in all metagenomic projects. A web-server for the i-rDNA algorithm is available at http://metagenomics.atc.tcs.com/i-rDNA/

Human CD4 T cell epitopes selective for Vaccinia versus Variola virus.

PubMed

Probst, Alicia; Besse, Aurore; Favry, Emmanuel; Imbert, Gilles; Tanchou, Valérie; Castelli, Florence Anne; Maillere, Bernard

2013-04-01

Due to the high degree of sequence identity between Orthopoxvirus species, the specific B and T cell responses raised against these viruses are largely cross-reactive and poorly selective. We therefore searched for CD4 T cell epitopes present in the conserved parts of the Vaccinia genome (VACV) but absent from Variola viruses (VARV), with a view to identifying immunogenic sequences selective for VACV. We identified three long peptide fragments from the B7R, B10R and E7R proteins by in silico comparisons of the poxvirus genomes, and evaluated the recognition of these fragments by VACV-specific T cell lines derived from healthy donors. For the 12 CD4 T cell epitopes identified, we assessed their binding to common HLA-DR allotypes and their capacity to induce peptide-specific CD4 T-cell lines. Four peptides from B7R and B10R displayed a broad binding specificity for HLA-DR molecules and induced multiple T cell lines from healthy donors. Besides their absence from VARV, the two B10R peptide sequences were mutated in the Cowpox virus and completely absent from the Monkeypox genome. This work contributes to the development of differential diagnosis of poxvirus infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server

PubMed Central

Cannone, Jamie J.; Sweeney, Blake A.; Petrov, Anton I.; Gutell, Robin R.; Zirbel, Craig L.; Leontis, Neocles

2015-01-01

The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.

PubMed Central

Benslimane, A A; Dron, M; Hartmann, C; Rode, A

1986-01-01

Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553

The glycan-specific sulfotransferase (R77W)GalNAc-4-ST1 putatively responsible for peeling skin syndrome has normal properties consistent with a simple sequence polymorphisim.

PubMed

Fiete, Dorothy; Mi, Yiling; Beranek, Mary; Baenziger, Nancy L; Baenziger, Jacques U

2017-05-01

Expanded access to DNA sequencing now fosters ready detection of site-specific human genome alterations whose actual significance requires in-depth functional study to rule in or out disease-causing mutations. This is a particular concern for genomic sequence differences in glycosyltransferases, whose implications are often difficult to assess. A recent whole-exome sequencing study identifies (c.229 C > T) in the GalNAc-4-ST1 glycosyltransferase (CHST8) as a disease-causing missense R77W mutation yielding the genodermatosis peeling skin syndrome (PSS) when homozygous. Cabral et al. (Genomics. 2012;99:202-208) cite this sequence change as reducing keratinocyte GalNAc-4-ST1 activity, thus decreasing glycosaminoglycan sulfation, as the mechanism for this blistering disorder. Such an identification could point toward potential clinical and/or prenatal diagnosis of a harmful medical condition. However, GalNAc-4-ST1 has minimal activity toward glycosaminoglycans, instead modifying terminal β1,4-linked GalNAc on N- and O-linked oligosaccharides on specific glycoproteins. We find expression, processing and catalytic activity of GalNAc-4-ST1 completely equivalent between wild type and (R77W) sulfotransferases. Moreover, keratinocytes have little or no GalNAc-4-ST1 mRNA, indicating that they do not express GalNAc-4-ST1. In addition, loss-of-function of GalNAc-4-ST1 primarily presents as reproductive system aberrations rather than skin effects. These findings, an allele frequency of 0.004357, and a 10-fold difference in prevalence of CHST8 (c.299 C > T, R77W) across different ethnic groups, suggest that this sequence represents a "passenger" distributed polymorphism, a simple sequence variant form of the enzyme having normal activity, rather than a "driver" disease-causing mutation that accounts for PSS. This study presents an example for guiding biomedical research initiatives, as well as medical and personal/family perspectives, regarding newly-identified genomic sequence

The Large Subunit rDNA Sequence of Plasmodiophora brassicae Does not Contain Intra-species Polymorphism

PubMed Central

Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid

2016-01-01

Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. PMID:27750174

Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

USGS Publications Warehouse

Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

2003-01-01

The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

PubMed Central

2018-01-01

Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

Key amino acid residues involved in multi-point binding interactions between brazzein, a sweet protein, and the T1R2-T1R3 human sweet receptor

PubMed Central

Assadi-Porter, Fariba M.; Maillet, Emeline L.; Radek, James T.; Quijada, Jeniffer; Markley, John L.; Max, Marianna

2010-01-01

The sweet protein brazzein activates the human sweet receptor, a heterodimeric G-protein coupled receptor (GPCR) composed of subunits T1R2 and T1R3. In order to elucidate the key amino acid(s) responsible for this interaction, we mutated residues in brazzein and each of the two subunits of the receptor. The effects of brazzein mutations were assayed by a human taste panel and by an in vitro assay involving receptor subunits expressed recombinantly in human embryonic kidney cells; the effects of the receptor mutations were assayed by the in vitro assay. We mutated surface residues of brazzein at three putative interaction sites: Site 1 (Loop43), Site 2 (N- and C-terminus and adjacent Glu36, Loop33), and Site 3 (Loop9–19). Basic residues in Site 1 and acidic residues in Site 2 were essential for positive responses from each assay. Mutation of Y39A (Site 1) greatly reduced positive responses. A bulky side chain at position 54 (Site 2), rather than a side chain with hydrogen bonding potential, was required for positive responses as was the presence of the native disulfide bond in Loop 9–19 (Site 3). Results from mutagenesis and chimeras of the receptor indicated that brazzein interacts with both T1R2 and T1R3 and that the Venus fly trap module of T1R2 is important for brazzein agonism. With one exception, all mutations of receptor residues at putative interaction sites predicted by wedge models failed to yield the expected decrease in the brazzein response. The exception, hT1R2:R217A-hT1R3, which contained a substitution in lobe 2 at the interface between the two subunits, exhibited a small selective decrease in brazzein activity. However, because the mutation was found to increase the positive cooperativity of binding by multiple ligands proposed to bind both T1R subunits (brazzein, monellin, and sucralose) but not those that bind to a single subunit (neotame and cyclamate), we suggest that this site in involved in subunit-subunit interaction rather than direct

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

miR-29a-3p/T-bet Regulatory Circuit Is Altered in T Cells of Patients With Hashimoto's Thyroiditis.

PubMed

Tokić, Stana; Štefanić, Mario; Glavaš-Obrovac, Ljubica; Kishore, Amit; Navratilova, Zdenka; Petrek, Martin

2018-01-01

Hashimoto's thyroiditis (HT) is a common autoimmune thyroid disorder that frequently evolves from asymptomatic, T-cell mediated chronic inflammation toward overt hypothyroidism. Previously, we have demonstrated a role for T-bet, a T helper 1/CD8 + T cell transcription factor (TF), and FoxP3, a regulatory T cell TF, in disease progression and severity, but the basis behind their altered mRNA expression remains unknown. In this study, we aimed to leverage the role for microRNAs, representing negative transcriptional regulators, across the spectrum of HT clinical presentations using the same, well-characterized RNA sample cohort. Ten hypothyroid, untreated patients (hypoHT), 10 hypothyroid cases rendered euthyroid by l-thyroxine therapy (substHT), 11 spontaneously euthyroid HT subjects (euHT), and 10 healthy controls (ctrl) were probed for three candidate immunoregulatory miRNA (miR-9-5p, miR-29a-3p, and miR-210-3p) using quantitative real-time PCR measurements. Data were normalized to U6snRNA and fold difference in expression calculated by the efficiency corrected 2 -ΔΔCt model. Compared to healthy controls, peripheral blood (PB) T cells of HT patients exhibited significantly diminished miR-29a-3p expression levels [median expression levels (IQR), HT vs CTRL, 0.62 (0.44-1.01) vs 1.373 (0.63-2.7), P  = 0.046], and a similar, but not significant decline in miR-210-3p abundance [HT vs CTRL, 0.64 (0.39-1.31) vs 1.2 (0.5-2.56), P  = 0.24, Wilcoxon test]. A significant inverse correlation was observed between the two differentially expressed transcripts, T-bet mRNA and miR-29a-3p. Moreover, altered miR-29a-3p/T-bet expression in T cells of untreated HT patients was related to low serum FT4, high serum thyrotropin, and decreased thyroid volumes. Of note, miR-210-3p expression was positively correlated to HIF1α, and inversely to FoxP3 mRNA levels, but no evidence of differential expression for any of these miRNA-mRNA pairs was observed. Finally, miR-9-5p

Complete genome sequence of the aerobic, heterotroph Marinithermus hydrothermalis type strain (T1T) from a deep-sea hydrothermal vent chimney

PubMed Central

Copeland, Alex; Gu, Wei; Yasawong, Montri; Lapidus, Alla; Lucas, Susan; Deshpande, Shweta; Pagani, Ioanna; Tapia, Roxanne; Cheng, Jan-Fang; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Pan, Chongle; Brambilla, Evelyne-Marie; Rohde, Manfred; Tindall, Brian J.; Sikorski, Johannes; Göker, Markus; Detter, John C.; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Woyke, Tanja

2012-01-01

Marinithermus hydrothermalis Sako et al. 2003 is the type species of the monotypic genus Marinithermus. M. hydrothermalis T1T was the first isolate within the phylum “Thermus-Deinococcus” to exhibit optimal growth under a salinity equivalent to that of sea water and to have an absolute requirement for NaCl for growth. M. hydrothermalis T1T is of interest because it may provide a new insight into the ecological significance of the aerobic, thermophilic decomposers in the circulation of organic compounds in deep-sea hydrothermal vent ecosystems. This is the first completed genome sequence of a member of the genus Marinithermus and the seventh sequence from the family Thermaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,269,167 bp long genome with its 2,251 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:22675595

FLRW cosmological models with quark and strange quark matters in f(R,T) gravity

NASA Astrophysics Data System (ADS)

Nagpal, Ritika; Singh, J. K.; Aygün, S.

2018-06-01

In this paper, we have studied the magnetized quark matter (QM) and strange quark matter (SQM) distributions in the presence of f(R,T) gravity in the background of Friedmann-Lemaître-Robertson-Walker (FLRW) metric. To get exact solutions of modified field equations we have used f(R,T ) = R + 2 f(T) model given by Harko et al. with two different parametrization of geometrical parameters i.e. the parametrization of the deceleration parameter q , and the scale factor a in hybrid expansion form. Also, we have obtained Einstein Static Universe (ESU) solutions for QM and SQM distributions in f(R,T) gravity and General Relativity (GR). All models in f(R,T) gravity and GR for FRW and ESU Universes with QM also SQM distributions, we get zero magnetic field. These results agree with the solutions of Aktaş and Aygün in f(R,T) gravity. However, we have also discussed the physical consequences of our obtained models.

Harnessing endogenous miR-181a to segregate transgenic antigen receptor expression in developing versus post-thymic T cells in murine hematopoietic chimeras.

PubMed

Papapetrou, Eirini P; Kovalovsky, Damian; Beloeil, Laurent; Sant'angelo, Derek; Sadelain, Michel

2009-01-01

MicroRNAs (miRNAs) are small, noncoding RNAs that regulate gene expression by targeting complementary sequences, referred to as miRNA recognition elements (MREs), typically located in the 3' untranslated region of mRNAs. miR-181a is highly expressed in developing thymocytes and markedly downregulated in post-thymic T cells. We investigated whether endogenous miR-181a can be harnessed to segregate expression of chimeric antigen receptors (CARs) and TCRs between developing and mature T cells. Lentiviral-encoded antigen receptors were tagged with a miR-181a-specific MRE and transduced into mouse BM cells that were used to generate hematopoietic chimeras. Expression of a CAR specific for human CD19 (hCD19) was selectively suppressed in late double-negative and double-positive thymocytes, coinciding with the peak in endogenous miR-181a expression. Receptor expression was fully restored in post-thymic resting and activated T cells, affording protection against a subsequent challenge with hCD19+ tumors. Hematopoietic mouse chimeras engrafted with a conalbumin-specific TCR prone to thymic clonal deletion acquired peptide-specific T cell responsiveness only when the vector-encoded TCR transcript was similarly engineered to be subject to regulation by miR-181a. These results demonstrate the potential of miRNA-regulated transgene expression in stem cell-based therapies, including cancer immunotherapy.

Whole-genome sequence of “Candidatus Liberibacter solanacearum” strain R1 from California

USDA-ARS?s Scientific Manuscript database

The draft whole-genome sequence of “Candidatus Liberibacter solanacearum” strain R1, isolated from a tomato plant in California, United States, is reported. The R1 strain genome is 1,204,257 bp in size (G+C content of 35.3%), encoding 1,101 open reading frames and 57 RNA genes....

Complete Genome Sequence of Clavibacter michiganensis subsp. insidiosus R1-1 Using PacBio Single-Molecule Real-Time Technology

PubMed Central

Lu, You; Samac, Deborah A.; Glazebrook, Jane

2015-01-01

We report here the complete genome sequence of Clavibacter michiganensis subsp. insidiosus R1-1, isolated in Minnesota, USA. The R1-1 genome, generated by a de novo assembly of PacBio sequencing data, is the first complete genome sequence available for this subspecies. PMID:25953184

VR/LE engine with a variable R/L during a single cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rychter, T.J.; Teodorczyk, A.

1985-01-01

A new concept of an engine, called a Variable R/L Engine (VR/LE) is presented. The main feature of the engine is the continuous change of the crank-radius to connecting-rod-length ratio (R/L) during the single engine cycle. The variations of the phase angle result in changes of all the engine stroke lengths and also-they are causing the changes of the thermodynamic cycle of the engine. Therefore the phase angle variations make it possible to regulate continuously the compression ratio and the displacement volume of the engine within the range which depends on the engine mechanism geometry. The presented concept can bemore » applied to all the types of the IC piston engines, independently of their size and operation principle.« less

Integrated genomic sequencing reveals mutational landscape of T-cell prolymphocytic leukemia

PubMed Central

Kiel, Mark J.; Velusamy, Thirunavukkarasu; Rolland, Delphine; Sahasrabuddhe, Anagh A.; Chung, Fuzon; Bailey, Nathanael G.; Schrader, Alexandra; Li, Bo; Li, Jun Z.; Ozel, Ayse B.; Betz, Bryan L.; Miranda, Roberto N.; Medeiros, L. Jeffrey; Zhao, Lili; Herling, Marco

2014-01-01

The comprehensive genetic alterations underlying the pathogenesis of T-cell prolymphocytic leukemia (T-PLL) are unknown. To address this, we performed whole-genome sequencing (WGS), whole-exome sequencing (WES), high-resolution copy-number analysis, and Sanger resequencing of a large cohort of T-PLL. WGS and WES identified novel mutations in recurrently altered genes not previously implicated in T-PLL including EZH2, FBXW10, and CHEK2. Strikingly, WGS and/or WES showed largely mutually exclusive mutations affecting IL2RG, JAK1, JAK3, or STAT5B in 38 of 50 T-PLL genomes (76.0%). Notably, gain-of-function IL2RG mutations are novel and have not been reported in any form of cancer. Further, high-frequency mutations in STAT5B have not been previously reported in T-PLL. Functionally, IL2RG-JAK1-JAK3-STAT5B mutations led to signal transducer and activator of transcription 5 (STAT5) hyperactivation, transformed Ba/F3 cells resulting in cytokine-independent growth, and/or enhanced colony formation in Jurkat T cells. Importantly, primary T-PLL cells exhibited constitutive activation of STAT5, and targeted pharmacologic inhibition of STAT5 with pimozide induced apoptosis in primary T-PLL cells. These results for the first time provide a portrait of the mutational landscape of T-PLL and implicate deregulation of DNA repair and epigenetic modulators as well as high-frequency mutational activation of the IL2RG-JAK1-JAK3-STAT5B axis in the pathogenesis of T-PLL. These findings offer opportunities for novel targeted therapies in this aggressive leukemia. PMID:24825865

Integrated genomic sequencing reveals mutational landscape of T-cell prolymphocytic leukemia.

PubMed

Kiel, Mark J; Velusamy, Thirunavukkarasu; Rolland, Delphine; Sahasrabuddhe, Anagh A; Chung, Fuzon; Bailey, Nathanael G; Schrader, Alexandra; Li, Bo; Li, Jun Z; Ozel, Ayse B; Betz, Bryan L; Miranda, Roberto N; Medeiros, L Jeffrey; Zhao, Lili; Herling, Marco; Lim, Megan S; Elenitoba-Johnson, Kojo S J

2014-08-28

The comprehensive genetic alterations underlying the pathogenesis of T-cell prolymphocytic leukemia (T-PLL) are unknown. To address this, we performed whole-genome sequencing (WGS), whole-exome sequencing (WES), high-resolution copy-number analysis, and Sanger resequencing of a large cohort of T-PLL. WGS and WES identified novel mutations in recurrently altered genes not previously implicated in T-PLL including EZH2, FBXW10, and CHEK2. Strikingly, WGS and/or WES showed largely mutually exclusive mutations affecting IL2RG, JAK1, JAK3, or STAT5B in 38 of 50 T-PLL genomes (76.0%). Notably, gain-of-function IL2RG mutations are novel and have not been reported in any form of cancer. Further, high-frequency mutations in STAT5B have not been previously reported in T-PLL. Functionally, IL2RG-JAK1-JAK3-STAT5B mutations led to signal transducer and activator of transcription 5 (STAT5) hyperactivation, transformed Ba/F3 cells resulting in cytokine-independent growth, and/or enhanced colony formation in Jurkat T cells. Importantly, primary T-PLL cells exhibited constitutive activation of STAT5, and targeted pharmacologic inhibition of STAT5 with pimozide induced apoptosis in primary T-PLL cells. These results for the first time provide a portrait of the mutational landscape of T-PLL and implicate deregulation of DNA repair and epigenetic modulators as well as high-frequency mutational activation of the IL2RG-JAK1-JAK3-STAT5B axis in the pathogenesis of T-PLL. These findings offer opportunities for novel targeted therapies in this aggressive leukemia. © 2014 by The American Society of Hematology.

LRS Bianchi Type-I Bulk Viscous Cosmological Models in f( R, T) Gravity

NASA Astrophysics Data System (ADS)

Sahoo, P.; Reddy, R.

2018-03-01

We have studied the locally rotationally symmetric (LRS) Bianchi type-I cosmological model in f ( R, T) gravity (R is the Ricci scalar and T is the trace of the stress energy tensor) with bulk viscous fluid as matter content. The model is constructed for the linear form f ( R, T) = R + 2 f ( T). The exact solution of the field equations is obtained by using a time varying deceleration parameter q for a suitable choice of the function f ( T). In this case, the bulk viscous pressure \\overline{p} is found to be negative and the energy density ρ is found to be positive. The obtained model is anisotropic, accelerating, and compatible with the results of astronomical observations. Also, some important features of physical parameters of this model have been discussed.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

PubMed Central

Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

2017-01-01

Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

Rapid alterations of cell cycle control proteins in human T lymphocytes in microgravity

PubMed Central

2012-01-01

In our study we aimed to identify rapidly reacting gravity-responsive mechanisms in mammalian cells in order to understand if and how altered gravity is translated into a cellular response. In a combination of experiments using "functional weightlessness" provided by 2D-clinostats and real microgravity provided by several parabolic flight campaigns and compared to in-flight-1g-controls, we identified rapid gravity-responsive reactions inside the cell cycle regulatory machinery of human T lymphocytes. In response to 2D clinorotation, we detected an enhanced expression of p21 Waf1/Cip1 protein within minutes, less cdc25C protein expression and enhanced Ser147-phosphorylation of cyclinB1 after CD3/CD28 stimulation. Additionally, during 2D clinorotation, Tyr-15-phosphorylation occurred later and was shorter than in the 1 g controls. In CD3/CD28-stimulated primary human T cells, mRNA expression of the cell cycle arrest protein p21 increased 4.1-fold after 20s real microgravity in primary CD4+ T cells and 2.9-fold in Jurkat T cells, compared to 1 g in-flight controls after CD3/CD28 stimulation. The histone acetyltransferase (HAT) inhibitor curcumin was able to abrogate microgravity-induced p21 mRNA expression, whereas expression was enhanced by a histone deacetylase (HDAC) inhibitor. Therefore, we suppose that cell cycle progression in human T lymphocytes requires Earth gravity and that the disturbed expression of cell cycle regulatory proteins could contribute to the breakdown of the human immune system in space. PMID:22273506

DECIPHER, a Search-Based Approach to Chimera Identification for 16S rRNA Sequences

PubMed Central

Wright, Erik S.; Yilmaz, L. Safak

2012-01-01

DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu). PMID:22101057

Chromosomal rearrangements involving telomeric DNA sequences in Balb/3T3 cells transfected with the Ha-ras oncogene.

PubMed

Peitl, Paulo; Mello, Stephano S; Camparoto, Marjori L; Passos, Geraldo A S; Hande, Manoor P; Cardoso, Renato S; Sakamoto-Hojo, Elza T

2002-01-01

Chromosomal instability involving telomeric DNA sequences was studied in mouse Balb/3T3 fibroblasts transfected with a mutated human c-Ha-ras-1 gene (B61 cells) and spontaneously immortalized normal parental cells (A31 cells), using fluorescence in situ hybridization (FISH). FISH analysis with a telomeric probe revealed high frequencies of chromosome alterations involving telomeric regions, mainly stable and unstable Robertsonian fusion-like configurations (RLC) (0.25 and 1.95/cell in A31 and B61 cells, respectively) and chromosome ends lacking telomeric signals in one (LTS') or both chromatids (LTS") (5.9 and 17.5/cell for A31 and B61 cells, respectively). Interstitial telomeric sequences (ITS) were also detected at both non-telomeric sites and in the centromeres of RLC. The frequencies of RLCs with ITS located in the centromeres were 3-fold higher in B61 compared with A31 cells. We demonstrated a high level of chromosome instability involving telomeric DNA sequences in ras-transfected cells overexpressing ras mRNA, which could be a consequence of rapid cell cycle progression associated with a deficient telomere capping mechanism.

Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

PubMed

Yassin, Atteyet F; Langenberg, Stefan; Huntemann, Marcel; Clum, Alicia; Pillay, Manoj; Palaniappan, Krishnaveni; Varghese, Neha; Mikhailova, Natalia; Mukherjee, Supratim; Reddy, T B K; Daum, Chris; Shapiro, Nicole; Ivanova, Natalia; Woyke, Tanja; Kyrpides, Nikos C

2017-01-01

The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA) pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS) were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM) systems, type II toxin-antitoxin (TA), CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA) and topisomerase IV (ParC) enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH-flavin oxidoreductase.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite

Genotype-Specific Regulation of Oral Innate Immunity by T2R38 Taste Receptor

PubMed Central

Gil, Sucheol; Coldwell, Susan; Drury, Jeanie L.; Arroyo, Fabiola; Phi, Tran; Saadat, Sanaz; Kwong, Danny; Chung, Whasun Oh

2015-01-01

The bitter taste receptor T2R38 has been shown to regulate mucosal innate immune responses in the upper airway epithelium. Furthermore, SNPs in T2R38 influence the sensitivity to 6-n-propylthiouracil (PROP) and are associated with caries risk/protection. However, no study has been reported on the role of T2R38 in the innate immune responses to oral bacteria. We hypothesize that T2R38 regulates oral innate immunity and that this regulation is genotype-specific. Primary gingival epithelial cells carrying three common genotypes, PAV/PAV (PROP super-taster), AVI/PAV (intermediate) and AVI/AVI (non-taster) were stimulated with cariogenic bacteria Streptococcus mutans, periodontal pathogen Porphyromonas gingivalis or non-pathogen Fusobacterium nucleatum. QRT-PCR analyzed T2R38 mRNA, and T2R38-specific siRNA and ELISA were utilized to evaluate induction of hBD-2 (antimicrobial peptide), IL-1α and IL-8 in various donor-lines. Experiments were set up in duplicate and repeated three times. T2R38 mRNA induction in response to S. mutans was highest in PAV/PAV (4.3-fold above the unstimulated controls; p<0.05), while lowest in AVI/AVI (1.2-fold). In PAV/PAV, hBD-2 secretion in response to S. mutans was decreased by 77% when T2R38 was silenced. IL-1α secretion was higher in PAV/PAV compared to AVI/PAV or AVI/AVI with S. mutans stimulation, but it was reduced by half when T2R38 was silenced (p<0.05). In response to P. gingivalis, AVI/AVI showed 4.4-fold increase (p<0.05) in T2R38 expression, whereas the levels in PAV/PAV and AVI/PAV remained close to that of the controls. Secretion levels of IL-1α and IL-8 decreased in AVI/AVI in response to P. gingivalis when T2R38 was silenced (p<0.05), while the changes were not significant in PAV/PAV. Our data suggest that the regulation of gingival innate immunity by T2R38 is genotype-dependent and that the ability to induce a high level of hBD-2 by PAV/PAV carriers may be a reason for protection against caries in this group. PMID

The Importance of the Presence of a 5′-Ribonucleotide and the Contribution of the T1R1 + T1R3 Heterodimer and an Additional Low-Affinity Receptor in the Taste Detection of l-Glutamate as Assessed Psychophysically

PubMed Central

Smith, Kimberly R.

2014-01-01

The molecular receptors underlying the purported “umami” taste quality commonly associated with l-glutamate have been controversial. Evidence supports the involvement of the T1R1 + T1R3 heterodimer, a GPCR broadly tuned to l-amino acids, but variants of two mGluRs expressed in taste buds have also been implicated. Using a rigorous psychophysical taste-testing paradigm, we demonstrated impaired, if not eliminated, detection of MSG in WT and T1R1, T1R2, T1R3, and T1R2 + T1R3 KO mice when the contribution of sodium was minimized by the epithelial sodium channel blocker amiloride. When inosine 5′-monophosphate (IMP), a ribonucleotide that potentiates the l-glutamate signal through the T1R1 + T1R3 heterodimer, was added, the WT and T1R2 KO mice were able to detect the compound stimulus across all MSG (+amiloride) concentrations due, in part, to the taste of IMP. In contrast, mice lacking T1R1 or T1R3 could not detect IMP alone, yet some were able to detect MSG + amiloride + IMP, but only at the higher MSG concentrations. Interestingly, the sensitivity of T1R1 KO mice to another l-amino acid, lysine, was unimpaired, suggesting that some l-amino acids can be detected through T1R1 + T1R3-independent receptors without sensitivity loss. Given that IMP is not thought to affect mGluRs, behavioral detection of l-glutamate appears to require the contribution of the T1R1 + T1R3 receptor. However, the partial competence observed in some T1R1 and T1R3 KO mice when MSG + amiloride + IMP was tested suggests that a T1R1 or T1R3 homodimer or an unidentified protein, perhaps in conjunction with T1R1 or T1R3, can serve as a low-affinity taste receptor for l-glutamate in the presence of IMP. PMID:25253867

T2-weighted MRI of the upper abdomen: comparison of four fat-suppressed T2-weighted sequences including PROPELLER (BLADE) technique.

PubMed

Bayramoglu, Sibel; Kilickesmez, Ozgür; Cimilli, Tan; Kayhan, Arda; Yirik, Gülseren; Islim, Filiz; Alibek, Sedat

2010-03-01

The aim of this study was to compare four different fat-suppressed T2-weighted sequences with different techniques with regard to image quality and lesion detection in upper abdominal magnetic resonance imaging (MRI) scans. Thirty-two consecutive patients referred for upper abdominal MRI for the evaluation of various suspected pathologies were included in this study. Different T2-weighted sequences (free-breathing navigator-triggered turbo spin-echo [TSE], free-breathing navigator-triggered TSE with restore pulse (RP), breath-hold TSE with RP, and free-breathing navigator-triggered TSE with RP using the periodically rotated overlapping parallel lines with enhanced reconstruction technique [using BLADE, a Siemens implementation of this technique]) were used on all patients. All images were assessed independently by two radiologists. Assessments of motion artifacts; the edge sharpness of the liver, pancreas, and intrahepatic vessels; depictions of the intrahepatic vessels; and overall image quality were performed qualitatively. Quantitative analysis was performed by calculation of the signal-to-noise ratios for liver tissue and gallbladder as well as contrast-to-noise ratios of liver to spleen. Liver and gallbladder signal-to-noise ratios as well as liver to spleen contrast-to-noise ratios were significantly higher (P < .05) for the BLADE technique compared to all other sequences. In qualitative analysis, the severity of motion artifacts was significantly lower with T2-weighted free-breathing navigator-triggered BLADE sequences compared to other sequences (P < .01). The edge sharpness of the liver, pancreas, and intrahepatic vessels; depictions of the intrahepatic vessels; and overall image quality were significantly better with the BLADE sequence (P < .05). The T2-weighted free-breathing navigator-triggered TSE sequence with the BLADE technique is a promising approach for reducing motion artifacts and improving image quality in upper abdominal MRI scans.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

The simplest non-minimal matter-geometry coupling in the f( R, T) cosmology

NASA Astrophysics Data System (ADS)

Moraes, P. H. R. S.; Sahoo, P. K.

2017-07-01

f( R, T) gravity is an extended theory of gravity in which the gravitational action contains general terms of both the Ricci scalar R and the trace of the energy-momentum tensor T. In this way, f( R, T) models are capable of describing a non-minimal coupling between geometry (through terms in R) and matter (through terms in T). In this article we construct a cosmological model from the simplest non-minimal matter-geometry coupling within the f( R, T) gravity formalism, by means of an effective energy-momentum tensor, given by the sum of the usual matter energy-momentum tensor with a dark energy contribution, with the latter coming from the matter-geometry coupling terms. We apply the energy conditions to our solutions in order to obtain a range of values for the free parameters of the model which yield a healthy and well-behaved scenario. For some values of the free parameters which are submissive to the energy conditions application, it is possible to predict a transition from a decelerated period of the expansion of the universe to a period of acceleration (dark energy era). We also propose further applications of this particular case of the f( R, T) formalism in order to check its reliability in other fields, rather than cosmology.

Analytical general solutions for static wormholes in f(R,T) gravity

NASA Astrophysics Data System (ADS)

Moraes, P. H. R. S.; Correa, R. A. C.; Lobato, R. V.

2017-07-01

Originally proposed as a tool for teaching the general theory of relativity, wormholes are today approached in many different ways and are seeing as an efficient alternative for interstellar and time travel. Attempts to achieve observational signatures of wormholes have been growing as the subject has become more and more popular. In this article we investigate some f(R,T) theoretical predictions for static wormholes, i.e., wormholes whose throat radius can be considered a constant. Since the T-dependence in f(R,T) gravity is due to the consideration of quantum effects, a further investigation of wormholes in such a theory is well motivated. We obtain the energy conditions of static wormholes in f(R,T) gravity and apply an analytical approach to find their physical and geometrical solutions. We highlight that our results are in agreement with previous solutions and assumptions presented in the literature.

Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

PubMed

Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

2013-10-01

According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

The HIV-1 Tat protein modulates CD4 expression in human T cells through the induction of miR-222.

PubMed

Orecchini, Elisa; Doria, Margherita; Michienzi, Alessandro; Giuliani, Erica; Vassena, Lia; Ciafrè, Silvia Anna; Farace, Maria Giulia; Galardi, Silvia

2014-01-01

Several cellular microRNAs show substantial changes in expression during HIV-1 infection and their active role in the viral life cycle is progressively emerging. In the present study, we found that HIV-1 infection of Jurkat T cells significantly induces the expression of miR-222. We show that this induction depends on HIV-1 Tat protein, which is able to increase the transcriptional activity of NFkB on miR-222 promoter. Moreover, we demonstrate that miR-222 directly targets CD4, a key receptor for HIV-1, thus reducing its expression. We propose that Tat, by inducing miR-222 expression, complements the CD4 downregulation activity exerted by other viral proteins (i.e., Nef, Vpu, and Env), and we suggest that this represents a novel mechanism through which HIV-1 efficiently represses CD4 expression in infected cells.

Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.

PubMed

Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A

1991-06-01

The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.

The Functional Role of the T1R Family of Receptors in Sweet Taste and Feeding

PubMed Central

Treesukosol, Yada; Smith, Kimberly R.; Spector, Alan C.

2011-01-01

The discovery of the T1R family of Class C G protein-coupled receptors in the peripheral gustatory system a decade ago has been a tremendous advance for taste research, and its conceptual reach has extended to other organ systems. There are three proteins in the family, T1R1, T1R2, and T1R3, encoded by their respective genes, Tas1r1, Tas1r2, and Tas1r3. T1R2 combines with T1R3 to form a heterodimer that binds with sugars and other sweeteners. T1R3 also combines with T1R1 to form a heterodimer that binds with L-amino acids. These proteins are expressed not only in taste bud cells, but one or more of these T1Rs have also been identified in the nasal epithelium, gut, pancreas, liver, kidney, testes and brain in various mammalian species. Here we review current perspectives regarding the functional role of these receptors, concentrating on sweet taste and feeding. We also discuss behavioral findings suggesting that a glucose polymer mixture, Polycose, which rodents avidly prefer, appears to activate a receptor that does not depend on the combined expression of T1R2 and T1R3. In addition, although the T1Rs have been implicated as playing a role in glucose sensing, T1R2 knock-out (KO) and T1R3 KO mice display normal chow and fluid intake as well as normal body weight compared with same-sex littermate wild type (WT) controls. Moreover, regardless of whether they are fasted or not, these KO mice do not differ from their WT counterparts in their Polycose intake across a broad range of concentrations in 30-min intake tests. The functional implications of these results and those in the literature are considered. PMID:21376068

R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

PubMed

Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

2015-07-01

The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Complete Genome Sequence of Clavibacter michiganensis subsp. insidiosus R1-1 Using PacBio Single-Molecule Real-Time Technology.

PubMed

Lu, You; Samac, Deborah A; Glazebrook, Jane; Ishimaru, Carol A

2015-05-07

We report here the complete genome sequence of Clavibacter michiganensis subsp. insidiosus R1-1, isolated in Minnesota, USA. The R1-1 genome, generated by a de novo assembly of PacBio sequencing data, is the first complete genome sequence available for this subspecies. Copyright © 2015 Lu et al.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

[Parametrial infiltration of cervix carcinoma: diagnostic value of contrast-enhanced fat-suppressed T1-weighted SE sequences at 1.5 tesla].

PubMed

Scheidler, J; Heuck, A; Wencke, K; Kimmig, R; Müller-Lisse, U; Reiser, M

1997-04-01

To determine whether contrast-enhanced and fat-suppressed sequences contribute to the MR imaging diagnosis of parametrial invasion. 21 patients with carcinoma of the cervix were prospectively examined with a phased-array coil and a 1.5T MR-scanner using the following sequences: transverse T2-weighted turbo spin echo (T2-TSE), T1-weighted spin echo (T1-SE) and fat suppressed T1-weighted SE sequences before and after Gd-DTPA. The sequences were evaluated separately for the presence of parametrial invasion. Image quality and diagnostic confidence were classified on a scale of 0-10 (nondiagnostic-excellent). Findings were compared to the results of the pathohistological examination. Sensitivity, specificity and diagnostic accuracy were highest for T2-TSE sequences (100%, 79% and 86%, respectively). Contrast-enhanced T1-SE sequences with fat-suppression (71%, 79%, and 76%) showed no improvement compared to T2-TSE. Unenhanced fat-suppressed T1-SE (100%, 30%, and 56%) and unenhanced T1-SE (100%, 7%, and 38%) as well as contrast-enhanced T1-SE (86%, 20%, and 47%) were significantly worse than T2-TSE. With similar image quality (p < 0.05) diagnostic confidence was higher on T2-TSE than on any of the other sequences (p < 0.001). Considering the cost-effectiveness of the examination, for the MR diagnosis of parametrial invasion the use of fat-suppressed contrast-enhanced sequences can be abandoned in favour of T2-weighted TSE sequences.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

Cosmic transit and anisotropic models in f(R,T) gravity

NASA Astrophysics Data System (ADS)

Sahu, S. K.; Tripathy, S. K.; Sahoo, P. K.; Nath, A.

2017-06-01

Accelerating cosmological models are constructed in a modified gravity theory dubbed as $f(R,T)$ gravity at the backdrop of an anisotropic Bianchi type-III universe. $f(R,T)$ is a function of the Ricci scalar $R$ and the trace $T$ of the energy-momentum tensor and it replaces the Ricci scalar in the Einstein-Hilbert action of General Relativity. The models are constructed for two different ways of modification of the Einstein-Hilbert action. Exact solutions of the field equations are obtained by a novel method of integration. We have explored the behaviour of the cosmic transit from an decelerated phase of expansion to an accelerated phase to get the dynamical features of the universe. Within the formalism of the present work, it is found that, the modification of the Einstein-Hilbert action does not affect the scale factor. However the dynamics of the effective dark energy equation of state is significantly affected.

Wideband Arrhythmia-Insensitive-Rapid (AIR) Pulse Sequence for Cardiac T1 mapping without Image Artifacts induced by ICD

PubMed Central

Hong, KyungPyo; Jeong, Eun-Kee; Wall, T. Scott; Drakos, Stavros G.; Kim, Daniel

2015-01-01

Purpose To develop and evaluate a wideband arrhythmia-insensitive-rapid (AIR) pulse sequence for cardiac T1 mapping without image artifacts induced by implantable-cardioverter-defibrillator (ICD). Methods We developed a wideband AIR pulse sequence by incorporating a saturation pulse with wide frequency bandwidth (8.9 kHz), in order to achieve uniform T1 weighting in the heart with ICD. We tested the performance of original and “wideband” AIR cardiac T1 mapping pulse sequences in phantom and human experiments at 1.5T. Results In 5 phantoms representing native myocardium and blood and post-contrast blood/tissue T1 values, compared with the control T1 values measured with an inversion-recovery pulse sequence without ICD, T1 values measured with original AIR with ICD were considerably lower (absolute percent error >29%), whereas T1 values measured with wideband AIR with ICD were similar (absolute percent error <5%). Similarly, in 11 human subjects, compared with the control T1 values measured with original AIR without ICD, T1 measured with original AIR with ICD was significantly lower (absolute percent error >10.1%), whereas T1 measured with wideband AIR with ICD was similar (absolute percent error <2.0%). Conclusion This study demonstrates the feasibility of a wideband pulse sequence for cardiac T1 mapping without significant image artifacts induced by ICD. PMID:25975192

MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

PubMed

Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

2010-11-01

MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

Bianchi type string cosmological models in f(R,T) gravity

NASA Astrophysics Data System (ADS)

Sahoo, P. K.; Mishra, B.; Sahoo, Parbati; Pacif, S. K. J.

2016-09-01

In this work we have studied Bianchi-III and - VI 0 cosmological models with string fluid source in f( R, T) gravity (T. Harko et al., Phys. Rev. D 84, 024020 (2011)), where R is the Ricci scalar and T the trace of the stress energy-momentum tensor in the context of late time accelerating expansion of the universe as suggested by the present observations. The exact solutions of the field equations are obtained by using a time-varying deceleration parameter. The universe is anisotropic and free from initial singularity. Our model initially shows acceleration for a certain period of time and then decelerates consequently. Several dynamical and physical behaviors of the model are also discussed in detail.

Phylogeny of the family Moraxellaceae by 16S rDNA sequence analysis, with special emphasis on differentiation of Moraxella species.

PubMed

Pettersson, B; Kodjo, A; Ronaghi, M; Uhlén, M; Tønjum, T

1998-01-01

Thirty-three strains previously classified into 11 species in the bacterial family Moraxellaceae were subjected to phylogenetic analysis based on 16S rRNA sequences. The family Moraxellaceae formed a distinct clade consisting of four phylogenetic groups as judged from branch lengths, bootstrap values and signature nucleotides. Group I contained the classical moraxellae and strains of the coccal moraxellae, previously known as Branhamella, with 16S rRNA similarity of > or = 95%. A further division of group I into five tentative clusters is discussed. Group II consisted of two strains representing Moraxella atlantae and Moraxella osloensis. These strains were only distantly related to each other (93.4%) and also to the other members of the Moraxellaceae (< or = 93%). Therefore, reasons for reclassification of these species into separate and new genera are discussed. Group III harboured strains of the genus Psychrobacter and strain 752/52 of [Moraxella] phenylpyruvica. This strain of [M.] phenylpyruvica formed an early branch from the group III line of descent. Interestingly, a distant relationship was found between Psychrobacter phenylpyruvicus strain ATCC 23333T (formerly classified as [M.] phenylpyruvica) and [M.] phenylpyruvica strain 752/52, exhibiting less than 96% nucleotide similarity between their 16S rRNA sequences. The establishment of a new genus for [M.] phenylpyruvica strain 752/52 is therefore suggested. Group IV contained only two strains of the genus Acinetobacter. Strategies for the development of diagnostic probes and distinctive sequences for 16S rRNA-based species-specific assays within group I are suggested. Although these findings add to the classificatory placements within the Moraxellaceae, analysis of a more comprehensive selection of strains is still needed to obtain a complete classification system within this family.

Complete genome sequence of Pseudomonas rhizosphaerae IH5T (=DSM 16299T), a phosphate-solubilizing rhizobacterium for bacterial biofertilizer.

PubMed

Kwak, Yunyoung; Jung, Byung Kwon; Shin, Jae-Ho

2015-01-10

Pseudomonas rhizosphaerae IH5(T) (=DSM 16299(T)), isolated from the rhizospheric soil of grass growing in Spain, has been reported as a novel species of the genus Pseudomonas harboring insoluble phosphorus solubilizing activity. To understanding the multifunctional biofertilizer better, we report the complete genome sequence of P. rhizosphaerae IH5(T). Copyright © 2014 Elsevier B.V. All rights reserved.

Analytical general solutions for static wormholes in f ( R , T ) gravity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moraes, P.H.R.S.; Correa, R.A.C.; Lobato, R.V., E-mail: moraes.phrs@gmail.com, E-mail: fis04132@gmail.com, E-mail: ronaldo.lobato@icranet.org

Originally proposed as a tool for teaching the general theory of relativity, wormholes are today approached in many different ways and are seeing as an efficient alternative for interstellar and time travel. Attempts to achieve observational signatures of wormholes have been growing as the subject has become more and more popular. In this article we investigate some f ( R , T ) theoretical predictions for static wormholes, i.e., wormholes whose throat radius can be considered a constant. Since the T -dependence in f ( R , T ) gravity is due to the consideration of quantum effects, a furthermore » investigation of wormholes in such a theory is well motivated. We obtain the energy conditions of static wormholes in f ( R , T ) gravity and apply an analytical approach to find their physical and geometrical solutions. We highlight that our results are in agreement with previous solutions and assumptions presented in the literature.« less

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

The Large Subunit rDNA Sequence of Plasmodiophora brassicae Does not Contain Intra-species Polymorphism.

PubMed

Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid

2016-12-01

Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

Targeted Exome Sequencing of Krebs Cycle Genes Reveals Candidate Cancer-Predisposing Mutations in Pheochromocytomas and Paragangliomas.

PubMed

Remacha, Laura; Comino-Méndez, Iñaki; Richter, Susan; Contreras, Laura; Currás-Freixes, María; Pita, Guillermo; Letón, Rocío; Galarreta, Antonio; Torres-Pérez, Rafael; Honrado, Emiliano; Jiménez, Scherezade; Maestre, Lorena; Moran, Sebastian; Esteller, Manel; Satrústegui, Jorgina; Eisenhofer, Graeme; Robledo, Mercedes; Cascón, Alberto

2017-10-15

Purpose: Mutations in Krebs cycle genes are frequently found in patients with pheochromocytomas/paragangliomas. Disruption of SDH, FH or MDH2 enzymatic activities lead to accumulation of specific metabolites, which give rise to epigenetic changes in the genome that cause a characteristic hypermethylated phenotype. Tumors showing this phenotype, but no alterations in the known predisposing genes, could harbor mutations in other Krebs cycle genes. Experimental Design: We used downregulation and methylation of RBP1, as a marker of a hypermethylation phenotype, to select eleven pheochromocytomas and paragangliomas for targeted exome sequencing of a panel of Krebs cycle-related genes. Methylation profiling, metabolite assessment and additional analyses were also performed in selected cases. Results: One of the 11 tumors was found to carry a known cancer-predisposing somatic mutation in IDH1 A variant in GOT2 , c.357A>T, found in a patient with multiple tumors, was associated with higher tumor mRNA and protein expression levels, increased GOT2 enzymatic activity in lymphoblastic cells, and altered metabolite ratios both in tumors and in GOT2 knockdown HeLa cells transfected with the variant. Array methylation-based analysis uncovered a somatic epigenetic mutation in SDHC in a patient with multiple pheochromocytomas and a gastrointestinal stromal tumor. Finally, a truncating germline IDH3B mutation was found in a patient with a single paraganglioma showing an altered α-ketoglutarate/isocitrate ratio. Conclusions: This study further attests to the relevance of the Krebs cycle in the development of PCC and PGL, and points to a potential role of other metabolic enzymes involved in metabolite exchange between mitochondria and cytosol. Clin Cancer Res; 23(20); 6315-24. ©2017 AACR . ©2017 American Association for Cancer Research.

Investigating core genetic-and-epigenetic cell cycle networks for stemness and carcinogenic mechanisms, and cancer drug design using big database mining and genome-wide next-generation sequencing data.

PubMed

Li, Cheng-Wei; Chen, Bor-Sen

2016-10-01

Recent studies have demonstrated that cell cycle plays a central role in development and carcinogenesis. Thus, the use of big databases and genome-wide high-throughput data to unravel the genetic and epigenetic mechanisms underlying cell cycle progression in stem cells and cancer cells is a matter of considerable interest. Real genetic-and-epigenetic cell cycle networks (GECNs) of embryonic stem cells (ESCs) and HeLa cancer cells were constructed by applying system modeling, system identification, and big database mining to genome-wide next-generation sequencing data. Real GECNs were then reduced to core GECNs of HeLa cells and ESCs by applying principal genome-wide network projection. In this study, we investigated potential carcinogenic and stemness mechanisms for systems cancer drug design by identifying common core and specific GECNs between HeLa cells and ESCs. Integrating drug database information with the specific GECNs of HeLa cells could lead to identification of multiple drugs for cervical cancer treatment with minimal side-effects on the genes in the common core. We found that dysregulation of miR-29C, miR-34A, miR-98, and miR-215; and methylation of ANKRD1, ARID5B, CDCA2, PIF1, STAMBPL1, TROAP, ZNF165, and HIST1H2AJ in HeLa cells could result in cell proliferation and anti-apoptosis through NFκB, TGF-β, and PI3K pathways. We also identified 3 drugs, methotrexate, quercetin, and mimosine, which repressed the activated cell cycle genes, ARID5B, STK17B, and CCL2, in HeLa cells with minimal side-effects.

Bacterial taxa abundance pattern in an industrial wastewater treatment system determined by the full rRNA cycle approach.

PubMed

Figuerola, Eva L M; Erijman, Leonardo

2007-07-01

The description of the diversity and structure of microbial communities through quantification of the constituent populations is one of the major objectives in environmental microbiology. The implications of models for community assembly are practical as well as theoretical, because the extent of biodiversity is thought to influence the function of ecosystems. Current attempts to predict species diversity in different environments derive the numbers of individuals for each operational taxonomic unit (OTU) from the frequency of clones in 16S rDNA gene libraries, which are subjected to a number of inherent biases and artefacts. We show that diversity of the bacterial community present in a complex microbial ensemble can be estimated by fitting the data of the full-cycle rRNA approach to a model of species abundance distribution. Sequences from a 16S rDNA gene library from activated sludge were reliably assigned to OTUs at a genetic distance of 0.04. A group of 17 newly designed rRNA-targeted oligonucleotide probes were used to quantify by fluorescence in situ hybridization, OTUs represented with more than three clones in the 16S rDNA clone library. Cell abundance distribution was best described by a geometric series, after the goodness of fit was evaluated by the Kolmogorov-Smirnov test. Although a complete mechanistic understanding of all the ecological processes involved is still not feasible, describing the distribution pattern of a complex bacterial assemblage model can shed light on the way bacterial communities operate.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

PubMed

Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

2017-02-28

High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Evading the non-continuity equation in the f( R, T) cosmology

NASA Astrophysics Data System (ADS)

Moraes, P. H. R. S.; Correa, R. A. C.; Ribeiro, G.

2018-03-01

We present a new approach for the f( R, T) gravity formalism, by thoroughly exploring the extra terms of its effective energy-momentum tensor T_{μ ν }^eff, which we name \\tilde{T}_{μ ν }, so that T_{μ ν }^eff=T_{μ ν }+\\tilde{T}_{μ ν }, with T_{μ ν } being the usual energy-momentum tensor of matter. Purely from the Bianchi identities, we obtain the conservation of both parts of the effective energy-momentum tensor, rather than the non-conservation of T_{μ ν }, originally occurring in the f( R, T) theories. In this way, the intriguing scenario of matter creation, which still lacks observational evidence, is evaded. One is left, then, with two sets of cosmological equations to be solved: the Friedmann-like equations along with the conservation of T_{μ ν } and along with the conservation of \\tilde{T}_{μ ν }. We present a physical interpretation for the conservation of \\tilde{T}_{μ ν }, which can be related to the presence of stiff matter in the universe. The cosmological consequences of this approach are presented and discussed as well as the benefits of evading the matter energy-momentum tensor non-conservation.

Human T-lymphotropic virus type-1 p30 alters cell cycle G2 regulation of T lymphocytes to enhance cell survival

PubMed Central

Datta, Antara; Silverman, Lee; Phipps, Andrew J; Hiraragi, Hajime; Ratner, Lee; Lairmore, Michael D

2007-01-01

Background Human T-lymphotropic virus type-1 (HTLV-1) causes adult T-cell leukemia/lymphoma and is linked to a number of lymphocyte-mediated disorders. HTLV-1 contains both regulatory and accessory genes in four pX open reading frames. pX ORF-II encodes two proteins, p13 and p30, whose roles are still being defined in the virus life cycle and in HTLV-1 virus-host cell interactions. Proviral clones of HTLV-1 with pX ORF-II mutations diminish the ability of the virus to maintain viral loads in vivo. p30 expressed exogenously differentially modulates CREB and Tax-responsive element-mediated transcription through its interaction with CREB-binding protein/p300 and while acting as a repressor of many genes including Tax, in part by blocking tax/rex RNA nuclear export, selectively enhances key gene pathways involved in T-cell signaling/activation. Results Herein, we analyzed the role of p30 in cell cycle regulation. Jurkat T-cells transduced with a p30 expressing lentivirus vector accumulated in the G2-M phase of cell cycle. We then analyzed key proteins involved in G2-M checkpoint activation. p30 expression in Jurkat T-cells resulted in an increase in phosphorylation at serine 216 of nuclear cell division cycle 25C (Cdc25C), had enhanced checkpoint kinase 1 (Chk1) serine 345 phosphorylation, reduced expression of polo-like kinase 1 (PLK1), diminished phosphorylation of PLK1 at tyrosine 210 and reduced phosphorylation of Cdc25C at serine 198. Finally, primary human lymphocyte derived cell lines immortalized by a HTLV-1 proviral clone defective in p30 expression were more susceptible to camptothecin induced apoptosis. Collectively these data are consistent with a cell survival role of p30 against genotoxic insults to HTLV-1 infected lymphocytes. Conclusion Collectively, our data are the first to indicate that HTLV-1 p30 expression results in activation of the G2-M cell cycle checkpoint, events that would promote early viral spread and T-cell survival. PMID:17634129

Regulation of cell cycle checkpoint kinase WEE1 by miR-195 in malignant melanoma.

PubMed

Bhattacharya, A; Schmitz, U; Wolkenhauer, O; Schönherr, M; Raatz, Y; Kunz, M

2013-06-27

WEE1 kinase has been described as a major gate keeper at the G2 cell cycle checkpoint and to be involved in tumour progression in different malignant tumours. Here we analysed the expression levels of WEE1 in a series of melanoma patient samples and melanoma cell lines using immunoblotting, quantitative real-time PCR and immunohistochemistry. WEE1 expression was significantly downregulated in patient samples of metastatic origin as compared with primary melanomas and in melanoma cell lines of high aggressiveness as compared with cell lines of low aggressiveness. Moreover, there was an inverse correlation between the expression of WEE1 and WEE1-targeting microRNA miR-195. Further analyses showed that transfection of melanoma cell lines with miR-195 indeed reduced WEE1 mRNA and protein expression in these cells. Reporter gene analysis confirmed direct targeting of the WEE1 3' untranslated region (3'UTR) by miR-195. Overexpression of miR-195 in SK-Mel-28 melanoma cells was accompanied by WEE1 reduction and significantly reduced stress-induced G2-M cell cycle arrest, which could be restored by stable overexpression of WEE1. Moreover, miR-195 overexpression and WEE1 knockdown, respectively, increased melanoma cell proliferation. miR-195 overexpression also enhanced migration and invasiveness of melanoma cells. Taken together, the present study shows that WEE1 expression in malignant melanoma is directly regulated by miR-195. miR-195-mediated downregulation of WEE1 in metastatic lesions may help to overcome cell cycle arrest under stress conditions in the local tissue microenvironment to allow unrestricted growth of tumour cells.

Chaotic evolution of the long-period Milankovitch cycle during the early Mesozoic: independent evidences from the Newark lacustrine sequence (North America) and the pelagic bedded chert sequence (Japan)

NASA Astrophysics Data System (ADS)

Ikeda, M.; Olsen, P. E.; Tada, R.

2012-12-01

The correlation of Earth's orbital parameters with climatic variations has been used to generate astronomically calibrated geologic time scales of high accuracy. However, because of the chaotic behavior of the solar planets, the orbital models have a large uncertainty beyond several tens of million years in the past. This chaotic behavior also causes the long-period astronomical cycles (> 0.5 Myr periodicity) to modulate their frequency and amplitude. In other words, their modulation patterns could be potential constraints for the orbital models. Here we report the first geologic constraints on the timing of frequency transition and amplitude modulation of the ~ 2 Myr long eccentricity cycles during the early Mesozoic. We examined the lake level records of the early Mesozoic Newark lacustrine sequence in North America and the biogenic silica burial rate of the pelagic bedded chert sequence in the Inuyama area, Japan, which are proven to be reflect the astronomical cycle (Olsen, 1986; Olsen and Kent, 1996; Ikeda et al., 2010). The time scales of the two sequences were orbitally calibrated with the end-Triassic mass extinction interval as the age anchor, covering ~ 30 Myr and ~ 65 Myr, respectively (Olsen et al., 2011; Ikeda et al., 2010, in prep). We find that the frequency modulation of ~ 2 Myr cycle between 2.4 Myr to 1.6 Myr cycle have occurred at least the Middle to Late Triassic. In addition, the ~ 2 Myr cycle modulate its amplitude with ~ 10 Myr periodicity with in-phase relation between the two. Similar modulation patterns of ~ 2 Myr cycles from the two independent geologic records indicate convincing evidences for the chaotic behavior of the Solar planets. Because these modulation patterns are different from the results of the orbital models by Laskar et al. (2004, 2011), our records will provide the new and challenging constraints for the orbital models in terms of chaotic behavior of Solar planets.

Single-Cell RNA Sequencing of Human T Cells.

PubMed

Villani, Alexandra-Chloé; Shekhar, Karthik

2017-01-01

Understanding how populations of human T cells leverage cellular heterogeneity, plasticity, and diversity to achieve a wide range of functional flexibility, particularly during dynamic processes such as development, differentiation, and antigenic response, is a core challenge that is well suited for single-cell analysis. Hypothesis-free evaluation of cellular states and subpopulations by transcriptional profiling of single T cells can identify relationships that may be obscured by targeted approaches such as FACS sorting on cell-surface antigens, or bulk expression analysis. While this approach is relevant to all cell types, it is of particular interest in the study of T cells for which classical phenotypic criteria are now viewed as insufficient for distinguishing different T cell subtypes and transitional states, and defining the changes associated with dysfunctional T cell states in autoimmunity and tumor-related exhaustion. This unit describes a protocol to generate single-cell transcriptomic libraries of human blood CD4 + and CD8 + T cells, and also introduces the basic bioinformatic steps to process the resulting sequence data for further computational analysis. We show how cellular subpopulations can be identified from transcriptional data, and derive characteristic gene expression signatures that distinguish these states. We believe single-cell RNA-seq is a powerful technique to study the cellular heterogeneity in complex tissues, a paradigm that will be of great value for the immune system.

Complete genome sequence of Sulfurimonas autotrophica type strain (OK10T)

PubMed Central

Sikorski, Johannes; Munk, Christine; Lapidus, Alla; Ngatchou Djao, Olivier Duplex; Lucas, Susan; Glavina Del Rio, Tijana; Nolan, Matt; Tice, Hope; Han, Cliff; Cheng, Jan-Fang; Tapia, Roxanne; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Sims, David; Meincke, Linda; Brettin, Thomas; Detter, John C.; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D.; Rohde, Manfred; Lang, Elke; Spring, Stefan; Göker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

2010-01-01

Sulfurimonas autotrophica Inagaki et al. 2003 is the type species of the genus Sulfurimonas. This genus is of interest because of its significant contribution to the global sulfur cycle as it oxidizes sulfur compounds to sulfate and by its apparent habitation of deep-sea hydrothermal and marine sulfidic environments as potential ecological niche. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the second complete genome sequence of the genus Sulfurimonas and the 15th genome in the family Helicobacteraceae. The 2,153,198 bp long genome with its 2,165 protein-coding and 55 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:21304749

Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

PubMed

Kanhayuwa, Lakkhana; Coutts, Robert H A

2016-01-01

Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

TCRmodel: high resolution modeling of T cell receptors from sequence.

PubMed

Gowthaman, Ragul; Pierce, Brian G

2018-05-22

T cell receptors (TCRs), along with antibodies, are responsible for specific antigen recognition in the adaptive immune response, and millions of unique TCRs are estimated to be present in each individual. Understanding the structural basis of TCR targeting has implications in vaccine design, autoimmunity, as well as T cell therapies for cancer. Given advances in deep sequencing leading to immune repertoire-level TCR sequence data, fast and accurate modeling methods are needed to elucidate shared and unique 3D structural features of these molecules which lead to their antigen targeting and cross-reactivity. We developed a new algorithm in the program Rosetta to model TCRs from sequence, and implemented this functionality in a web server, TCRmodel. This web server provides an easy to use interface, and models are generated quickly that users can investigate in the browser and download. Benchmarking of this method using a set of nonredundant recently released TCR crystal structures shows that models are accurate and compare favorably to models from another available modeling method. This server enables the community to obtain insights into TCRs of interest, and can be combined with methods to model and design TCR recognition of antigens. The TCRmodel server is available at: http://tcrmodel.ibbr.umd.edu/.

High-throughput sequencing of TCR repertoires in multiple sclerosis reveals intrathecal enrichment of EBV-reactive CD8+ T cells.

PubMed

Lossius, Andreas; Johansen, Jorunn N; Vartdal, Frode; Robins, Harlan; Jūratė Šaltytė, Benth; Holmøy, Trygve; Olweus, Johanna

2014-11-01

Epstein-Barr virus (EBV) has long been suggested as a pathogen in multiple sclerosis (MS). Here, we used high-throughput sequencing to determine the diversity, compartmentalization, persistence, and EBV-reactivity of the T-cell receptor (TCR) repertoires in MS. TCR-β genes were sequenced in paired samples of cerebrospinal fluid (CSF) and blood from patients with MS and controls with other inflammatory neurological diseases. The TCR repertoires were highly diverse in both compartments and patient groups. Expanded T-cell clones, represented by TCR-β sequences >0.1%, were of different identity in CSF and blood of MS patients, and persisted for more than a year. Reference TCR-β libraries generated from peripheral blood T cells reactive against autologous EBV-transformed B cells were highly enriched for public EBV-specific sequences and were used to quantify EBV-reactive TCR-β sequences in CSF. TCR-β sequences of EBV-reactive CD8+ T cells, including several public EBV-specific sequences, were intrathecally enriched in MS patients only, whereas those of EBV-reactive CD4+ T cells were also enriched in CSF of controls. These data provide evidence for a clonally diverse, yet compartmentalized and persistent, intrathecal T-cell response in MS. The presented strategy links TCR sequence to intrathecal T-cell specificity, demonstrating enrichment of EBV-reactive CD8+ T cells in MS. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Length and sequence heterogeneity in 5S rDNA of Populus deltoides.

PubMed

Negi, Madan S; Rajagopal, Jyothi; Chauhan, Neeti; Cronn, Richard; Lakshmikumaran, Malathi

2002-12-01

The 5S rRNA genes and their associated non-transcribed spacer (NTS) regions are present as repeat units arranged in tandem arrays in plant genomes. Length heterogeneity in 5S rDNA repeats was previously identified in Populus deltoides and was also observed in the present study. Primers were designed to amplify the 5S rDNA NTS variants from the P. deltoides genome. The PCR-amplified products from the two accessions of P. deltoides (G3 and G48) suggested the presence of length heterogeneity of 5S rDNA units within and among accessions, and the size of the spacers ranged from 385 to 434 bp. Sequence analysis of the non-transcribed spacer (NTS) revealed two distinct classes of 5S rDNA within both accessions: class 1, which contained GAA trinucleotide microsatellite repeats, and class 2, which lacked the repeats. The class 1 spacer shows length variation owing to the microsatellite, with two clones exhibiting 10 GAA repeat units and one clone exhibiting 16 such repeat units. However, distance analysis shows that class 1 spacer sequences are highly similar inter se, yielding nucleotide diversity (pi) estimates that are less than 0.15% of those obtained for class 2 spacers (pi = 0.0183 vs. 0.1433, respectively). The presence of microsatellite in the NTS region leading to variation in spacer length is reported and discussed for the first time in P. deltoides.

Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

PubMed

Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

2013-11-01

Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

Pulse sequences for efficient multi-cycle terahertz generation in periodically poled lithium niobate.

PubMed

Ravi, Koustuban; Schimpf, Damian N; Kärtner, Franz X

2016-10-31

The use of laser pulse sequences to drive the cascaded difference frequency generation of high energy, high peak-power and multi-cycle terahertz pulses in cryogenically cooled (100 K) periodically poled Lithium Niobate is proposed and studied. Detailed simulations considering the coupled nonlinear interaction of terahertz and optical waves (or pump depletion), show that unprecedented optical-to-terahertz energy conversion efficiencies > 5%, peak electric fields of hundred(s) of mega volts/meter at terahertz pulse durations of hundred(s) of picoseconds can be achieved. The proposed methods are shown to circumvent laser induced damage limitations at Joule-level pumping by 1µm lasers to enable multi-cycle terahertz sources with pulse energies > 10 milli-joules. Various pulse sequence formats are proposed and analyzed. Numerical calculations for periodically poled structures accounting for cascaded difference frequency generation, self-phase-modulation, cascaded second harmonic generation and laser induced damage are introduced. The physics governing terahertz generation using pulse sequences in this high conversion efficiency regime, limitations and practical considerations are discussed. It is shown that varying the poling period along the crystal length and further reduction of absorption can lead to even higher energy conversion efficiencies >10%. In addition to numerical calculations, an analytic formulation valid for arbitrary pulse formats and closed-form expressions for important cases are presented. Parameters optimizing conversion efficiency in the 0.1-1 THz range, the corresponding peak electric fields, crystal lengths and terahertz pulse properties are furnished.

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

Psychometric properties of the English Food Cravings Questionnaire-Trait-reduced (FCQ-T-r).

PubMed

Hormes, Julia M; Meule, Adrian

2016-01-01

Food cravings have been implicated in the development and maintenance of a range of eating- and weight-related pathology. The rapid and accurate assessment of food cravings is thus critical in clinical and research settings. Existing measures of specific food cravings are often not suitable for capturing the multiple facets of the craving experience. A short version of the Food Cravings Questionnaire-Trait (FCQ-T), the most widely used measure of general food cravings, was recently developed in German and shown to be a one-factorial, internally reliable measure. Other recent studies validated an Italian and Spanish version of the FCQ-T-reduced (FCQ-T-r) and successfully replicated its basic psychometrics. This study sought to examine the psychometric properties of the English version of the FCQ-T-r. Undergraduate students (n=610, 51.0% female, 53.9% white/Caucasian) completed a battery of questionnaires containing the FCQ-T-r and measures of specific food cravings, eating style, eating disorder symptoms, weight dissatisfaction, and impulsivity. Even though results of a confirmatory factor analysis suggested poor fit with a one-factorial model, the FCQ-T-r was found to be a one-factorial measure in both principal component and parallel analysis. The FCQ-T-r demonstrated excellent internal consistency reliability (Cronbach's α=.94), and scores were significantly and positively correlated with measures of specific food cravings, restrained eating, eating disorder symptoms, and impulsivity. More work is needed to confirm the factor structure of the English FCQ-T-r, but preliminary findings suggest that it constitutes a valid and reliable alternative to lengthier measures of general food cravings. Copyright © 2015 Elsevier Ltd. All rights reserved.

Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides A<->T+C<->G in the mitogenome of Kamimuria wangi.

PubMed

Seligmann, Hervé

2016-07-01

Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (X<->Y, i.e. A<->C) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the A<->T+C<->G exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

PubMed

Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

2014-08-01

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

The cancer-immunity cycle as rational design for synthetic cancer drugs: Novel DC vaccines and CAR T-cells.

PubMed

Ramachandran, Mohanraj; Dimberg, Anna; Essand, Magnus

2017-08-01

Cell therapy is an advanced form of cancer immunotherapy that has had remarkable clinical progress in the past decade in the search for cure of cancer. Most success has been achieved for chimeric antigen receptor (CAR) T-cells where CAR T-cells targeting CD19 show very high complete response rates for patients with refractory acute B-cell acute lymphoblastic leukemia (ALL) and are close to approval for this indication. CD19 CAR T-cells are also effective against B-cell chronic lymphoblastic leukemia (CLL) and B-cell lymphomas. Although encouraging, CAR T-cells have not yet proven clinically effective for solid tumors. This is mainly due to the lack of specific and homogenously expressed targets to direct the T-cells against and a hostile immunosuppressive tumor microenvironment in solid tumors. Cancer vaccines based on dendritic cells (DC) are also making progress although clinical efficacy is still lacking. The likelihood of success is however increasing now when individual tumors can be sequences and patient-specific neoepitopes identified. Neoepitopes and/or neoantigens can then be included in patient-based DC vaccines. This review discusses recent advancements of DC vaccines and CAR T-cells with emphasis on the cancer-immunity cycle, and current efforts to design novel cell therapies. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

The HIV-1 Tat protein modulates CD4 expression in human T cells through the induction of miR-222

PubMed Central

Orecchini, Elisa; Doria, Margherita; Michienzi, Alessandro; Giuliani, Erica; Vassena, Lia; Ciafrè, Silvia Anna; Farace, Maria Giulia; Galardi, Silvia

2014-01-01

Several cellular microRNAs show substantial changes in expression during HIV-1 infection and their active role in the viral life cycle is progressively emerging. In the present study, we found that HIV-1 infection of Jurkat T cells significantly induces the expression of miR-222. We show that this induction depends on HIV-1 Tat protein, which is able to increase the transcriptional activity of NFkB on miR-222 promoter. Moreover, we demonstrate that miR-222 directly targets CD4, a key receptor for HIV-1, thus reducing its expression. We propose that Tat, by inducing miR-222 expression, complements the CD4 downregulation activity exerted by other viral proteins (i.e., Nef, Vpu, and Env), and we suggest that this represents a novel mechanism through which HIV-1 efficiently represses CD4 expression in infected cells. PMID:24717285

Draft genome sequence of Dethiobacter alkaliphilus strain AHT1T, a gram-positive sulfidogenic polyextremophile

DOE PAGES

Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex; ...

2017-09-21

Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.

Draft genome sequence of Dethiobacter alkaliphilus strain AHT1T, a gram-positive sulfidogenic polyextremophile

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex

Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.

Draft Genome Sequence of Sphingobium lactosutens Strain DS20T, Isolated from a Hexachlorocyclohexane Dumpsite

PubMed Central

Kumar, Roshan; Dwivedi, Vatsala; Negi, Vivek; Khurana, J. P.

2013-01-01

Sphingobium lactosutens DS20T has been isolated from the hexachlorocyclohexane (HCH) dumpsite in Lucknow, India, but does not degrade any of the HCH isomers. Here, we present the ~5.36-Mb draft genome sequence of strain DS20T, which consists of 110 contigs and 5,288 coding sequences, with a G+C content of 63.1%. PMID:24051323

The AhR is involved in the regulation of LoVo cell proliferation through cell cycle-associated proteins.

PubMed

Yin, Jiuheng; Sheng, Baifa; Han, Bin; Pu, Aimin; Yang, Kunqiu; Li, Ping; Wang, Qimeng; Xiao, Weidong; Yang, Hua

2016-05-01

Some ingredients in foods can activate the aryl hydrocarbon receptor (AhR) and arrest cell proliferation. In this study, we hypothesized that 6-formylindolo [3, 2-b] carbazole (FICZ) arrests the cell cycle in LoVo cells (a colon cancer line) through the AhR. The AhR agonist FICZ and the AhR antagonist CH223191 were used to treat LoVo cells. Real-time PCR and Western blot analyses were performed to detect the expression of the AhR, CYP1A1, CDK4, cyclinD1, cyclin E, CDK2, P27, and pRb. The distribution and activation of the AhR were detected with immunofluorescence. A 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay and flow cytometric analysis were performed to measure cell viability, cell cycle stage, and apoptosis. Our results show that FICZ inhibited LoVo cell proliferation by inducing G1 cell cycle arrest but had no effect on epithelial apoptosis. Further analysis found that FICZ downregulated cyclinD1 and upregulated p27 expression to arrest Rb phosphorylation. The downregulation of cyclinD1 and upregulation of p27 were abolished by co-treatment with CH223191. We conclude that the AhR, when activated by FICZ (an endogenous AhR ligand), can arrest the cell cycle and block LoVo cell proliferation. © 2016 International Federation for Cell Biology.

62. R.L.T., photographer November 1, 1934 DEL NORTE COUNTY, SECTION ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

62. R.L.T., photographer November 1, 1934 DEL NORTE COUNTY, SECTION D, HIGHWAY 1. REDWOOD CLEARING ON EXISTING LINE, 1-DN-71-A #26, R.L.T. 11-1-34. Stamped office copy. - Redwood National & State Parks Roads, California coast from Crescent City to Trinidad, Crescent City, Del Norte County, CA

A Recessive Mutation Resulting in a Disabling Amino Acid Substitution (T194R) in the LHX3 Homeodomain Causes Combined Pituitary Hormone Deficiency

PubMed Central

Bechtold-Dalla Pozza, Susanne; Hiedl, Stefan; Roeb, Julia; Lohse, Peter; Malik, Raleigh E.; Park, Soyoung; Durán-Prado, Mario; Rhodes, Simon J.

2012-01-01

Background/Aims Recessive mutations in the LHX3 ho-meodomain transcription factor gene are associated with developmental disorders affecting the pituitary and nervous system. We describe pediatric patients with combined pituitary hormone deficiency (CPHD) who harbor a novel mutation in LHX3. Methods Two female siblings from related parents were examined. Both patients had neonatal complications. The index patient had CPHD featuring deficiencies of GH, LH, FSH, PRL, and TSH, with later onset of ACTH deficiency. She also had a hypoplastic anterior pituitary, respiratory distress, hearing impairment, and limited neck rotation. The LHX3 gene was sequenced and the biochemical properties of the predicted altered proteins were characterized. Results A novel homozygous mutation predicted to change amino acid 194 from threonine to arginine (T194R) was detected in both patients. This amino acid is conserved in the DNA-binding homeodomain. Computer modeling predicted that the T194R change would alter the homeodomain structure. The T194R protein did not bind tested LHX3 DNA recognition sites and did not activate the α-glycoprotein and PRL target genes. Conclusion The T194R mutation affects a critical residue in the LHX3 protein. This study extends our understanding of the phenotypic features, molecular mechanism, and developmental course associated with mutations in the LHX3 gene. PMID:22286346

Friedmann Cosmology with Matter Creation in Modified f( R, T) Gravity

NASA Astrophysics Data System (ADS)

Singh, Vijay; Singh, C. P.

2016-02-01

The theoretical and observational consequences of thermodynamics of open systems which allow matter creation, are investigated in modified f( R, T) ( R is the Ricci scalar and T is the trace of energy-momentum tensor) theory of gravity within the framework of a flat Friedmann-Robertson-Walker line element. The simplest model f( R, T)= R+2 f( T) with "gamma-law" equation of state p = ( γ-1) ρ is assumed to obtain the exact solution. A power-law expansion model is proposed by considering the natural phenomenological particle creation rate ψ = 3 β n H, where β is a pure number of the order of unity, n the particle number density and H is the Hubble parameter. A Big Rip singularity is observed for γ<0 describing phantom cosmology. The accelerated expansion of the Universe is driven by the particle creation. The density parameter shows the negative curvature of the Universe due to particle creation. The entropy increases with the evolution of the Universe. Some kinematics tests such as lookback time, luminosity distance, proper distance, angular diameter versus redshift are discussed in detail to observe the role of particle creation in early and late time evolution of the Universe.

Functional characterization of the heterodimeric sweet taste receptor T1R2 and T1R3 from a New World monkey species (squirrel monkey) and its response to sweet-tasting proteins

PubMed Central

Liu, Bo; Ha, Matthew; Meng, Xuan-Yu; Khaleduzzaman, Mohammed; Zhang, Zhe; Li, Xia; Cui, Meng

2012-01-01

The family C G protein-coupled receptor (GPCR) T1R2 and T1R3 heterodimer functions as a broadly acting sweet taste receptor. Perception of sweet taste is a species-dependent physiological process. It has been widely reported that New World monkeys and rodents can not perceive some of the artificial sweeteners and sweet-tasting proteins that can be perceived by humans, apes, and Old World monkeys. Until now, only the sweet receptors of humans, mice and rats have been functionally characterized. Here we report characterization of the sweet taste receptor (T1R2/T1R3) from a species of New World squirrel monkey. Our results show that the heterodimeric receptor of squirrel monkey does not respond to artificial sweeteners aspartame, neotame, cyclamate, saccharin and sweet-tasting protein monellin, but surprisingly, it does respond to thaumatin at high concentrations (>18 μM). This is the first report that New World monkey species can perceive some specific sweet-tasting proteins. Furthermore, the receptor responses to the sweeteners cannot be inhibited by the sweet inhibitor lactisole. We compared the response differences of the squirrel monkey and human receptors and found that the residues in T1R2 determine species-dependent sweet taste toward saccharin, while the residues in either T1R2 or T1R3 are responsible for the sweet taste difference between humans and squirrel monkeys toward monellin. Molecular models indicated that electrostatic properties of the receptors probably mediate the species-dependent response to sweet-tasting proteins. PMID:23000410

Gut T1R3 sweet taste receptors do not mediate sucrose-conditioned flavor preferences in mice.

PubMed

Sclafani, Anthony; Glass, Damien S; Margolskee, Robert F; Glendinning, John I

2010-12-01

Most mammals prefer the sweet taste of sugars, which is mediated by the heterodimeric T1R2+T1R3 taste receptor. Sugar appetite is also enhanced by the post-oral reinforcing actions of the nutrient in the gut. Here, we examined the contribution of gut T1R3 (either alone or as part of the T1R3+T1R3 receptor) to post-oral sugar reinforcement using a flavor-conditioning paradigm. We trained mice to associate consumption of a flavored solution (CS+) with intragastric (IG) infusions of a sweetener, and a different flavored solution (CS-) with IG infusions of water (23 h/day); then, we measured preference in a CS+ vs. CS- choice test. In experiment 1, we predicted that if activation of gut T1R3 mediates sugar reinforcement, then IG infusions of a nutritive (sucrose) or nonnutritive (sucralose) ligand for this receptor should condition a preference for the CS+ in B6 wild-type (WT) mice. While the mice that received IG sucrose infusions developed a strong preference for the CS+, those that received IG sucralose infusions developed a weak avoidance of the CS+. In experiment 2, we used T1R3 knockout (KO) mice to examine the necessity of gut T1R2+T1R3 receptors for conditioned flavor preferences. If intact gut T1R3 (or T1R2+T1R3) receptors are necessary for flavor-sugar conditioning, then T1R3 KO mice should not develop a sugar-conditioned flavor preference. We found that T1R3 KO mice, like WT mice, acquired a strong preference for the CS+ paired with IG sucrose infusions. The KO mice were also like WT mice in avoiding a CS+ flavor paired with IG sucralose infusions These findings provide clear evidence that gut T1R3 receptors are not necessary for sugar-conditioned flavor preferences or sucralose-induced flavor avoidance in mice.

Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

NASA Technical Reports Server (NTRS)

Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

1991-01-01

Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

Palatini formulation of f( R, T) gravity theory, and its cosmological implications

NASA Astrophysics Data System (ADS)

Wu, Jimin; Li, Guangjie; Harko, Tiberiu; Liang, Shi-Dong

2018-05-01

We consider the Palatini formulation of f( R, T) gravity theory, in which a non-minimal coupling between the Ricci scalar and the trace of the energy-momentum tensor is introduced, by considering the metric and the affine connection as independent field variables. The field equations and the equations of motion for massive test particles are derived, and we show that the independent connection can be expressed as the Levi-Civita connection of an auxiliary, energy-momentum trace dependent metric, related to the physical metric by a conformal transformation. Similar to the metric case, the field equations impose the non-conservation of the energy-momentum tensor. We obtain the explicit form of the equations of motion for massive test particles in the case of a perfect fluid, and the expression of the extra force, which is identical to the one obtained in the metric case. The thermodynamic interpretation of the theory is also briefly discussed. We investigate in detail the cosmological implications of the theory, and we obtain the generalized Friedmann equations of the f( R, T) gravity in the Palatini formulation. Cosmological models with Lagrangians of the type f=R-α ^2/R+g(T) and f=R+α ^2R^2+g(T) are investigated. These models lead to evolution equations whose solutions describe accelerating Universes at late times.

Complete genomic sequences for hepatitis C virus subtypes 4b, 4c, 4d, 4g, 4k, 4l, 4m, 4n, 4o, 4p, 4q, 4r and 4t.

PubMed

Li, Chunhua; Lu, Ling; Wu, Xianghong; Wang, Chuanxi; Bennett, Phil; Lu, Teng; Murphy, Donald

2009-08-01

In this study, we characterized the full-length genomic sequences of 13 distinct hepatitis C virus (HCV) genotype 4 isolates/subtypes: QC264/4b, QC381/4c, QC382/4d, QC193/4g, QC383/4k, QC274/4l, QC249/4m, QC97/4n, QC93/4o, QC139/4p, QC262/4q, QC384/4r and QC155/4t. These were amplified, using RT-PCR, from the sera of patients now residing in Canada, 11 of which were African immigrants. The resulting genomes varied between 9421 and 9475 nt in length and each contains a single ORF of 9018-9069 nt. The sequences showed nucleotide similarities of 77.3-84.3 % in comparison with subtypes 4a (GenBank accession no. Y11604) and 4f (EF589160) and 70.6-72.8 % in comparison with genotype 1 (M62321/1a, M58335/1b, D14853/1c, and 1?/AJ851228) reference sequences. These similarities were often higher than those currently defined by HCV classification criteria for subtype (75.0-80.0 %) and genotype (67.0-70.0 %) division, respectively. Further analyses of the complete and partial E1 and partial NS5B sequences confirmed these 13 'provisionally assigned subtypes'.

rRNA and Poly-β-Hydroxybutyrate Dynamics in Bioreactors Subjected to Feast and Famine Cycles

PubMed Central

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-01-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-β-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

rRNA and poly-beta-hydroxybutyrate dynamics in bioreactors subjected to feast and famine cycles.

PubMed

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-04-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-beta-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

T1 Shortening in the Globus Pallidus after Multiple Administrations of Gadobutrol: Assessment with a Multidynamic Multiecho Sequence.

PubMed

Kang, Koung Mi; Choi, Seung Hong; Hwang, Moonjung; Yun, Tae Jin; Kim, Ji-Hoon; Sohn, Chul-Ho

2018-04-01

Purpose To determine the association between the administration of the macrocyclic contrast medium gadobutrol and T1 relaxation time in the brains of patients with normal renal function by using multidynamic multiecho (MDME) magnetic resonance (MR) imaging sequences. Materials and Methods The institutional review board approved this retrospective study, and the need to obtain written informed consent was waived. This study included 46 patients (revealed by an electronic medical record search) who had received one or more gadobutrol injections and a maximum of one MR imaging contrast medium injection other than gadobutrol before MDME sequence acquisition. One radiologist performed quantitative analyses of regions of interest on quantitative T1 maps twice to cover the normal-appearing globus pallidus (GP), frontal white matter, frontal cortex, and thalamus. The number of administrations and the cumulative dose of gadobutrol, age, intervals between administrations, sex, and treatment were investigated. Univariable and multivariable linear regression analyses of the T1 values in four brain regions and the GP-to-thalamus signal intensity (SI) ratio were performed. P values of less than the Bonferroni-corrected value of .01 were considered to indicate significant differences. Results Intraobserver reproducibility was good to excellent (intraclass correlation coefficients, 0.62-0.81). Because of high multicollinearity between the number of gadobutrol administrations and accumulated dose (r = 0.96, P < .001), the number of gadobutrol administrations was considered in the regression analyses. T1 shortening in the GP was independently associated with the number of gadobutrol administrations (P = .002). T1 in the other brain regions and the GP-to-thalamus SI ratio were not significantly associated with the number of gadobutrol administrations (P > .01). Conclusion Multiple exposures to gadobutrol are associated with T1 shortening in the GP. © RSNA, 2017 Online supplemental

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

Synthesis of t-Butyl (2R)-Hydroxyisovalerate, A Precursor of Aureobasidin B

NASA Astrophysics Data System (ADS)

Maharani, R.; Puspitasari, D.; Taufiqqurahman; Huspa, D. H. P.; Hidayat, A. T.; Sumiarsa, D.; Hidayat, I. W.

2017-02-01

Aureobasidins are a family of cyclodepsipeptides have antifungal properties. They were isolated from the black yeast Aureobasidium pullulans R106 and over 30 derivatives have been successfully characterized. There are few publications reporting the total synthesis of aureobasidins. The limited reports of the synthesis of the aureobasidin derivatives are due to the difficult access to the preparations of precursors. The aim of this research is to synthesise a precursor of aureobasidin B, t-butyl (2R)-hydroxyisovalerate (t-Bu-Hiv), that is prepared for the total synthesis of aureobasidin B. The synthesis of AbB is planned to be undertaken by using a solid phase method, so the ester formation between t-Bu-Hiv and the Fmoc-β-hydroxymethylvaline will be carried out in solution phase to form depsidipeptide. The t-butyl group was used as protecting agent that is due to the straightforward elimination of the protecting group from the Fmoc-depsidipeptide. The t-Bu-Hiv acid was prepared from D-valine through diazotisation to form (2R)-acetyloxyisovaleric acid in 62.7% yield. Product of the first step was then protected by t-butyl group by using Boc-anhydride in t-butanol to give t-butil (2R)-acetyloxyisovalerate in 44% yield. In the last step, the acetyloxy group was eliminated by using potassium carbonate in methanol/water to give the desired product, t-Bu-Hiv in 33.5% yield. The t-Bu-Hiv is ready to be combined with Fmoc-β-hydroxymethylvaline to result in depsidipeptide that will be attached to the resin in the total synthesis of AbB. Each stage of this synthesis was controlled by thin layer chromatography and all products were purified by open column chromatography. All the synthesized products were characterized by various spectroscopic techniques, including infrared spectrophotometer, mass spectroscopy (ESI-MS), 1H-NMR and 13C-NMR.

Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

PubMed

Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

2016-07-01

Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

Impact du réchauffement climatique sur le cycle hydrologique

NASA Astrophysics Data System (ADS)

Planton, Serge; Déqué, Michel; Douville, Hervé; Spagnoli, Bruno

2005-02-01

At the planetary scale, the models consistently simulate an intensification of the hydrological cycle in a future climate, warmer than the present-day one. However, this intensification might be accompanied by its slowing down due to an increase of the residence time of water vapour in the atmosphere. The impact of climate change on extreme events is even more difficult to evaluate, as results are dependent on methods, emission scenarios and, above all, on models. However, the increase of extreme winter precipitation over northern Europe is a common feature of these evaluations. The hydrological cycle, through the geographical distribution of continental surface humidity, seems to play a key role on the possibility to detect the warming in France. To cite this article: S. Planton et al., C. R. Geoscience 337 (2005).

Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

PubMed

Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

2017-03-01

Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

An Estimate of the Size and Shape of Sunspot Cycle 24 Based on its Early Cycle Behavior using the Hathaway-Wilson-Reichmann Shape-Fitting Function

NASA Technical Reports Server (NTRS)

Wilson, Robert M.

2011-01-01

On the basis of 12-month moving averages (12-mma) of monthly mean sunspot number (R), sunspot cycle 24 had its minimum amplitude (Rm = 1.7) in December 2008. At 12 mo past minimum, R measured 8.3, and at 18 mo past minimum, it measured 16.4. Thus far, the maximum month-to-month rate of rise in 12-mma values of monthly mean sunspot number (AR(t) max) has been 1.7, having occurred at elapsed times past minimum amplitude (t) of 14 and 15 mo. Compared to other sunspot cycles of the modern era, cycle 24?s Rm and AR(t) max (as observed so far) are the smallest on record, suggesting that it likely will be a slow-rising, long-period sunspot cycle of below average maximum amplitude (RM). Supporting this view is the now observed relative strength of cycle 24?s geomagnetic minimum amplitude as measured using the 12-mma value of the aa-geomagnetic index (aam = 8.4), which also is the smallest on record, having occurred at t equals 8 and 9 mo. From the method of Ohl (the inferred preferential association between RM and aam), one predicts RM = 55 +/- 17 (the ?1 se prediction interval) for cycle 24. Furthermore, from the Waldmeier effect (the inferred preferential association between the ascent duration (ASC) and RM) one predicts an ASC longer than 48 mo for cycle 24; hence, maximum amplitude occurrence should be after December 2012. Application of the Hathaway-Wilson-Reichmann shape-fitting function, using an RM = 70 and ASC = 56 mo, is found to adequately fit the early sunspot number growth of cycle 24.

Isolation and sequence analysis of a novel rhesus macaque foamy virus isolate with a serotype-1-like env.

PubMed

Ensser, Armin; Großkopf, Anna K; Mätz-Rensing, Kerstin; Roos, Christian; Hahn, Alexander S

2018-06-02

SFVmmu-DPZ9524 represents the third completely sequenced rhesus macaque simian foamy virus (SFV) isolate, alongside SFVmmu_K3T with a similar SFV-1-type env, and R289HybAGM with a SFV-2-like env. Sequence analysis demonstrates that, in gag and pol, SFVmmu-DPZ9524 is more closely related to R289HybAGM than to SFVmmu_K3T, which, outside of env, is more similar to a Japanese macaque isolate than to the other two rhesus macaque isolates SFVmmu-DPZ9524 and R289HybAGM. Further, we identify bel as another recombinant locus in R289HybAGM, confirming that recombination contributes to sequence diversity in SFV.